Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

PubMed Central

Hua, Brian L.; Orr-Weaver, Terry L.

2017-01-01

Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

Comparison of a teratogenic transcriptome-based predictive test based on human embryonic versus inducible pluripotent stem cells.

PubMed

Shinde, Vaibhav; Perumal Srinivasan, Sureshkumar; Henry, Margit; Rotshteyn, Tamara; Hescheler, Jürgen; Rahnenführer, Jörg; Grinberg, Marianna; Meisig, Johannes; Blüthgen, Nils; Waldmann, Tanja; Leist, Marcel; Hengstler, Jan Georg; Sachinidis, Agapios

2016-12-30

Human embryonic stem cells (hESCs) partially recapitulate early embryonic three germ layer development, allowing testing of potential teratogenic hazards. Because use of hESCs is ethically debated, we investigated the potential for human induced pluripotent stem cells (hiPSCs) to replace hESCs in such tests. Three cell lines, comprising hiPSCs (foreskin and IMR90) and hESCs (H9) were differentiated for 14 days. Their transcriptome profiles were obtained on day 0 and day 14 and analyzed by comprehensive bioinformatics tools. The transcriptomes on day 14 showed that more than 70% of the "developmental genes" (regulated genes with > 2-fold change on day 14 compared to day 0) exhibited variability among cell lines. The developmental genes belonging to all three cell lines captured biological processes and KEGG pathways related to all three germ layer embryonic development. In addition, transcriptome profiles were obtained after 14 days of exposure to teratogenic valproic acid (VPA) during differentiation. Although the differentially regulated genes between treated and untreated samples showed more than 90% variability among cell lines, VPA clearly antagonized the expression of developmental genes in all cell lines: suppressing upregulated developmental genes, while inducing downregulated ones. To quantify VPA-disturbed development based on developmental genes, we estimated the "developmental potency" (D p ) and "developmental index" (D i ). Despite differences in genes deregulated by VPA, uniform D i values were obtained for all three cell lines. Given that the D i values for VPA were similar for hESCs and hiPSCs, D i can be used for robust hazard identification, irrespective of whether hESCs or hiPSCs are used in the test systems.

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation

USDA-ARS?s Scientific Manuscript database

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing ac...

The let-7 microRNA interfaces extensively with the translation machinery to regulate cell differentiation

PubMed Central

Ding, Xavier C.; Slack, Frank J.; Großhans, Helge

2010-01-01

MicroRNAs (miRNAs) are noncoding RNAs that regulate numerous target genes through a posttranscriptional mechanism and thus control major developmental pathways. The phylogenetically conserved let-7 miRNA regulates cell proliferation and differentiation, thus functioning as a key regulator of developmental timing in C. elegans and a tumor suppressor gene in humans. Using a reverse genetic screen, we have identified genetic interaction partners of C. elegans let-7, including known and novel potential target genes. Initial identification of several translation initiation factors as suppressors of a let-7 mutation led us to systematically examine genetic interaction between let-7 and the translational machinery, which we found to be widespread. In the presence of wild-type let-7, depletion of the translation initiation factor eIF3 resulted in precocious cell differentiation, suggesting that developmental timing is translationally regulated, possibly by let-7. As overexpression of eIF3 in humans promotes translation of mRNAs that are also targets of let-7-mediated repression, we suggest that eIF3 may directly or indirectly oppose let-7 activity. This might provide an explanation for the opposite functions of let-7 and eIF3 in regulating tumorigenesis. PMID:18818519

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Developmental control of hypoxia during bud burst in grapevine.

PubMed

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

PubMed

Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

2013-04-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

PubMed Central

Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

2013-01-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Epigenetics and the Developmental Origins of Health and ...

EPA Pesticide Factsheets

Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

PubMed Central

2012-01-01

Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental stages as well as in barley cultivars with different seed size was evidenced for both genes. The two barley Type I MADS-box genes were found to be induced by ABA and JA. DNA methylation differences in different seed developmental stages and after exogenous application of ABA is suggestive of epigenetic regulation of gene expression. The study of barley Type I-like MADS-box genes extends our investigations of gene regulation during endosperm and seed development in a monocot crop like barley. PMID:22985436

RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

PubMed Central

Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies. PMID:23145190

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

PubMed

Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies.

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.

PubMed

Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa

2007-03-01

The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

NASA Astrophysics Data System (ADS)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Identification of High-Temperature-Responsive Genes in Cereals1[C][W

PubMed Central

Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

2012-01-01

High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

PubMed Central

Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

2012-01-01

The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

PubMed

Baskar, Venkidasamy; Park, Se Won

2015-07-01

Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

Specification of select hypothalamic circuits and innate behaviors by the embryonic patterning gene Dbx1

PubMed Central

Sokolowski, Katie; Esumi, Shigeyuki; Hirata, Tsutomu; Kamal, Yasman; Tran, Tuyen; Lam, Andrew; Oboti, Livio; Brighthaupt, Sherri-Chanelle; Zaghlula, Manar; Martinez, Jennifer; Ghimbovschi, Svetlana; Knoblach, Susan; Pierani, Alessandra; Tamamaki, Nobuaki; Shah, Nirao M; Jones, Kevin S; Corbin, Joshua G

2015-01-01

SUMMARY The hypothalamus integrates information required for the production of a variety of innate behaviors such as feeding, mating, aggression and predator avoidance. Despite an extensive knowledge of hypothalamic function, how embryonic genetic programs specify circuits that regulate these behaviors remains unknown. Here, we find that in the hypothalamus the developmentally regulated homeodomain-containing transcription factor Dbx1 is required for the generation of specific subclasses of neurons within the lateral hypothalamic area/zona incerta (LH) and the arcuate (Arc) nucleus. Consistent with this specific developmental role, Dbx1 hypothalamic-specific conditional-knockout mice display attenuated responses to predator odor and feeding stressors but do not display deficits in other innate behaviors such as mating or conspecific aggression. Thus, activity of a single developmentally regulated gene, Dbx1, is a shared requirement for the specification of hypothalamic nuclei governing a subset of innate behaviors. PMID:25864637

Neuroendocrine Regulation of Maternal Behavior

PubMed Central

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Neuroendocrine regulation of maternal behavior.

PubMed

Bridges, Robert S

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

PubMed

Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

2006-09-01

Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

Brg1 modulates enhancer activation in mesoderm lineage commitment

DOE PAGES

Alexander, Jeffrey M.; Hota, Swetansu K.; He, Daniel; ...

2015-03-26

The interplay between different levels of gene regulation in modulating developmental transcriptional programs, such as histone modifications and chromatin remodeling, is not well understood. Here, we show that the chromatin remodeling factor Brg1 is required for enhancer activation in mesoderm induction. In an embryonic stem cell-based directed differentiation assay, the absence of Brg1 results in a failure of cardiomyocyte differentiation and broad deregulation of lineage-specific gene expression during mesoderm induction. We find that Brg1 co-localizes with H3K27ac at distal enhancers and is required for robust H3K27 acetylation at distal enhancers that are activated during mesoderm induction. Brg1 is also requiredmore » to maintain Polycomb-mediated repression of non-mesodermal developmental regulators, suggesting cooperativity between Brg1 and Polycomb complexes. Thus, Brg1 is essential for modulating active and repressive chromatin states during mesoderm lineage commitment, in particular the activation of developmentally important enhancers. In conclusion, these findings demonstrate interplay between chromatin remodeling complexes and histone modifications that, together, ensure robust and broad gene regulation during crucial lineage commitment decisions.« less

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera.

PubMed

Barchuk, Angel R; Cristino, Alexandre S; Kucharski, Robert; Costa, Luciano F; Simões, Zilá L P; Maleszka, Ryszard

2007-06-18

In honeybees, differential feeding of female larvae promotes the occurrence of two different phenotypes, a queen and a worker, from identical genotypes, through incremental alterations, which affect general growth, and character state alterations that result in the presence or absence of specific structures. Although previous studies revealed a link between incremental alterations and differential expression of physiometabolic genes, the molecular changes accompanying character state alterations remain unknown. By using cDNA microarray analyses of >6,000 Apis mellifera ESTs, we found 240 differentially expressed genes (DEGs) between developing queens and workers. Many genes recorded as up-regulated in prospective workers appear to be unique to A. mellifera, suggesting that the workers' developmental pathway involves the participation of novel genes. Workers up-regulate more developmental genes than queens, whereas queens up-regulate a greater proportion of physiometabolic genes, including genes coding for metabolic enzymes and genes whose products are known to regulate the rate of mass-transforming processes and the general growth of the organism (e.g., tor). Many DEGs are likely to be involved in processes favoring the development of caste-biased structures, like brain, legs and ovaries, as well as genes that code for cytoskeleton constituents. Treatment of developing worker larvae with juvenile hormone (JH) revealed 52 JH responsive genes, specifically during the critical period of caste development. Using Gibbs sampling and Expectation Maximization algorithms, we discovered eight overrepresented cis-elements from four gene groups. Graph theory and complex networks concepts were adopted to attain powerful graphical representations of the interrelation between cis-elements and genes and objectively quantify the degree of relationship between these entities. We suggest that clusters of functionally related DEGs are co-regulated during caste development in honeybees. This network of interactions is activated by nutrition-driven stimuli in early larval stages. Our data are consistent with the hypothesis that JH is a key component of the developmental determination of queen-like characters. Finally, we propose a conceptual model of caste differentiation in A. mellifera based on gene-regulatory networks.

Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera

PubMed Central

Barchuk, Angel R; Cristino, Alexandre S; Kucharski, Robert; Costa, Luciano F; Simões, Zilá LP; Maleszka, Ryszard

2007-01-01

Background In honeybees, differential feeding of female larvae promotes the occurrence of two different phenotypes, a queen and a worker, from identical genotypes, through incremental alterations, which affect general growth, and character state alterations that result in the presence or absence of specific structures. Although previous studies revealed a link between incremental alterations and differential expression of physiometabolic genes, the molecular changes accompanying character state alterations remain unknown. Results By using cDNA microarray analyses of >6,000 Apis mellifera ESTs, we found 240 differentially expressed genes (DEGs) between developing queens and workers. Many genes recorded as up-regulated in prospective workers appear to be unique to A. mellifera, suggesting that the workers' developmental pathway involves the participation of novel genes. Workers up-regulate more developmental genes than queens, whereas queens up-regulate a greater proportion of physiometabolic genes, including genes coding for metabolic enzymes and genes whose products are known to regulate the rate of mass-transforming processes and the general growth of the organism (e.g., tor). Many DEGs are likely to be involved in processes favoring the development of caste-biased structures, like brain, legs and ovaries, as well as genes that code for cytoskeleton constituents. Treatment of developing worker larvae with juvenile hormone (JH) revealed 52 JH responsive genes, specifically during the critical period of caste development. Using Gibbs sampling and Expectation Maximization algorithms, we discovered eight overrepresented cis-elements from four gene groups. Graph theory and complex networks concepts were adopted to attain powerful graphical representations of the interrelation between cis-elements and genes and objectively quantify the degree of relationship between these entities. Conclusion We suggest that clusters of functionally related DEGs are co-regulated during caste development in honeybees. This network of interactions is activated by nutrition-driven stimuli in early larval stages. Our data are consistent with the hypothesis that JH is a key component of the developmental determination of queen-like characters. Finally, we propose a conceptual model of caste differentiation in A. mellifera based on gene-regulatory networks. PMID:17577409

Early developmental gene regulation in Strongylocentrotus purpuratus embryos in response to elevated CO₂ seawater conditions.

PubMed

Hammond, LaTisha M; Hofmann, Gretchen E

2012-07-15

Ocean acidification, or the increased uptake of CO(2) by the ocean due to elevated atmospheric CO(2) concentrations, may variably impact marine early life history stages, as they may be especially susceptible to changes in ocean chemistry. Investigating the regulatory mechanisms of early development in an environmental context, or ecological development, will contribute to increased understanding of potential organismal responses to such rapid, large-scale environmental changes. We examined transcript-level responses to elevated seawater CO(2) during gastrulation and the initiation of spiculogenesis, two crucial developmental processes in the purple sea urchin, Strongylocentrotus purpuratus. Embryos were reared at the current, accepted oceanic CO(2) concentration of 380 microatmospheres (μatm), and at the elevated levels of 1000 and 1350 μatm, simulating predictions for oceans and upwelling regions, respectively. The seven genes of interest comprised a subset of pathways in the primary mesenchyme cell gene regulatory network (PMC GRN) shown to be necessary for the regulation and execution of gastrulation and spiculogenesis. Of the seven genes, qPCR analysis indicated that elevated CO(2) concentrations only had a significant but subtle effect on two genes, one important for early embryo patterning, Wnt8, and the other an integral component in spiculogenesis and biomineralization, SM30b. Protein levels of another spicule matrix component, SM50, demonstrated significant variable responses to elevated CO(2). These data link the regulation of crucial early developmental processes with the environment that these embryos would be developing within, situating the study of organismal responses to ocean acidification in a developmental context.

Hormonal interactions and gene regulation can link monoecy and environmental plasticity to the evolution of dioecy in plants.

PubMed

Golenberg, Edward M; West, Nicholas W

2013-06-01

Most models for dioecy in flowering plants assume that dioecy arises directly from hermaphroditism through a series of independent feminizing and masculinizing mutations that become chromosomally linked. However, dioecy appears to evolve most frequently through monoecious grades. The major genetic models do not explain the evolution of unisexual flowers in monoecious and submonoecious populations, nor do they account for environmentally induced sexual plasticity. In this review, we explore the roles of environmental stress and hormones on sex determination, and propose a model that can explain the evolution of dioecy through monoecy, and the mechanisms of environmental sex determination. Environmental stresses elicit hormones that allow plants to mediate the negative effects of the stresses. Many of these same hormones are involved in the regulation of floral developmental genes. Recent studies have elucidated the mechanisms whereby these hormones interact and can act as switchpoints in regulatory pathways. Consequently, differential concentrations of plant hormones can regulate whole developmental pathways, providing a mechanism for differential development within isogenic individuals such as seen in monoecious plants. Sex-determining genes in such systems will evolve to generate clusters of coexpressed suites. Coexpression rather than coinheritance of gender-specific genes will define the sexual developmental fate. Therefore, selection for gender type will drive evolution of the regulatory sequences of such genes rather than their synteny. Subsequent mutations to hyper- or hyposensitive alleles within the hormone response pathway can result in segregating dioecious populations. Simultaneously, such developmental systems will remain sensitive to external stimuli that modify hormone responses.

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

Is Transcriptomic Regulation of Berry Development More Important at Night than During the Day?

PubMed Central

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T.; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far. PMID:24551177

Is transcriptomic regulation of berry development more important at night than during the day?

PubMed

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

PubMed

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

PubMed Central

Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

2006-01-01

The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

The genes encoding fructose bisphosphate aldolase in Trypanosoma brucei are interspersed with unrelated genes.

PubMed Central

Vijayasarathy, S; Ernest, I; Itzhaki, J E; Sherman, D; Mowatt, M R; Michels, P A; Clayton, C E

1990-01-01

The fructose bisphosphate aldolase genes of Trypanosoma brucei are interspersed with unrelated genes whose transcript levels show no developmental modulation. Transcription appears approximately constant across the entire locus, suggesting that aldolase mRNA abundance is regulated post-transcriptionally. Images PMID:2349093

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

PubMed Central

Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

2017-01-01

Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

Social Crowding during Development Causes Changes in GnRH1 DNA Methylation.

PubMed

Alvarado, Sebastian G; Lenkov, Kapa; Williams, Blake; Fernald, Russell D

2015-01-01

Gestational and developmental cues have important consequences for long-term health, behavior and adaptation to the environment. In addition, social stressors cause plastic molecular changes in the brain that underlie unique behavioral phenotypes that also modulate fitness. In the adult African cichlid, Astatotilapia burtoni, growth and social status of males are both directly regulated by social interactions in a dynamic social environment, which causes a suite of plastic changes in circuits, cells and gene transcription in the brain. We hypothesized that a possible mechanism underlying some molecular changes might be DNA methylation, a reversible modification made to cytosine nucleotides that is known to regulate gene function. Here we asked whether changes in DNA methylation of the GnRH1 gene, the central regulator of the reproductive axis, were altered during development of A. burtoni. We measured changes in methylation state of the GnRH1 gene during normal development and following the gestational and developmental stress of social crowding. We found differential DNA methylation within developing juveniles between 14-, 28- and 42-day-old. Following gestational crowding of mouth brooding mothers, we saw differential methylation and transcription of GnRH1 in their offspring. Taken together, our data provides evidence for social control of GnRH1 developmental responses to gestational cues through DNA methylation.

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

OsMADS26 Negatively Regulates Resistance to Pathogens and Drought Tolerance in Rice1[OPEN

PubMed Central

Khong, Giang Ngan; Richaud, Frédérique; Parizot, Boris; Mai, Chung Duc; Bès, Martine; Bourrié, Isabelle; Meynard, Donaldo; Beeckman, Tom; Selvaraj, Michael Gomez; Manabu, Ishitani; Brugidou, Christophe; Nang Do, Vinh; Guiderdoni, Emmanuel; Morel, Jean-Benoit; Gantet, Pascal

2015-01-01

Functional analyses of MADS-box transcription factors in plants have unraveled their role in major developmental programs (e.g. flowering and floral organ identity) as well as stress-related developmental processes, such as abscission, fruit ripening, and senescence. Overexpression of the rice (Oryza sativa) MADS26 gene in rice has revealed a possible function related to stress response. Here, we show that OsMADS26-down-regulated plants exhibit enhanced resistance against two major rice pathogens: Magnaporthe oryzae and Xanthomonas oryzae. Despite this enhanced resistance to biotic stresses, OsMADS26-down-regulated plants also displayed enhanced tolerance to water deficit. These phenotypes were observed in both controlled and field conditions. Interestingly, alteration of OsMADS26 expression does not have a strong impact on plant development. Gene expression profiling revealed that a majority of genes misregulated in overexpresser and down-regulated OsMADS26 lines compared with control plants are associated to biotic or abiotic stress response. Altogether, our data indicate that OsMADS26 acts as an upstream regulator of stress-associated genes and thereby, a hub to modulate the response to various stresses in the rice plant. PMID:26424158

Cell identity regulators link development and stress responses in the Arabidopsis root.

PubMed

Iyer-Pascuzzi, Anjali S; Jackson, Terry; Cui, Hongchang; Petricka, Jalean J; Busch, Wolfgang; Tsukagoshi, Hironaka; Benfey, Philip N

2011-10-18

Stress responses in plants are tightly coordinated with developmental processes, but interaction of these pathways is poorly understood. We used genome-wide assays at high spatiotemporal resolution to understand the processes that link development and stress in the Arabidopsis root. Our meta-analysis finds little evidence for a universal stress response. However, common stress responses appear to exist with many showing cell type specificity. Common stress responses may be mediated by cell identity regulators because mutations in these genes resulted in altered responses to stress. Evidence for a direct role for cell identity regulators came from genome-wide binding profiling of the key regulator SCARECROW, which showed binding to regulatory regions of stress-responsive genes. Coexpression in response to stress was used to identify genes involved in specific developmental processes. These results reveal surprising linkages between stress and development at cellular resolution, and show the power of multiple genome-wide data sets to elucidate biological processes. Copyright © 2011 Elsevier Inc. All rights reserved.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

Mutations in MYB3R1 and MYB3R4 Cause Pleiotropic Developmental Defects and Preferential Down-Regulation of Multiple G2/M-Specific Genes in Arabidopsis1[C][W

PubMed Central

Haga, Nozomi; Kobayashi, Kosuke; Suzuki, Takamasa; Maeo, Kenichiro; Kubo, Minoru; Ohtani, Misato; Mitsuda, Nobutaka; Demura, Taku; Nakamura, Kenzo; Jürgens, Gerd; Ito, Masaki

2011-01-01

R1R2R3-Myb proteins represent an evolutionarily conserved class of Myb family proteins important for cell cycle regulation and differentiation in eukaryotic cells. In plants, this class of Myb proteins are believed to regulate the transcription of G2/M phase-specific genes by binding to common cis-elements, called mitosis-specific activator (MSA) elements. In Arabidopsis (Arabidopsis thaliana), MYB3R1 and MYB3R4 act as transcriptional activators and positively regulate cytokinesis by activating the transcription of KNOLLE, which encodes a cytokinesis-specific syntaxin. Here, we show that the double mutation myb3r1 myb3r4 causes pleiotropic developmental defects, some of which are due to deficiency of KNOLLE whereas other are not, suggesting that multiple target genes are involved. Consistently, microarray analysis of the double mutant revealed altered expression of many genes, among which G2/M-specific genes showed significant overrepresentation of the MSA motif and a strong tendency to be down-regulated by the double mutation. Our results demonstrate, on a genome-wide level, the importance of the MYB3R-MSA pathway for regulating G2/M-specific transcription. In addition, MYB3R1 and MYB3R4 may have diverse roles during plant development by regulating G2/M-specific genes with various functions as well as genes possibly unrelated to the cell cycle. PMID:21862669

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

Arsenic as an endocrine disruptor: arsenic disrupts retinoic acid receptor-and thyroid hormone receptor-mediated gene regulation and thyroid hormone-mediated amphibian tail metamorphosis.

PubMed

Davey, Jennifer C; Nomikos, Athena P; Wungjiranirun, Manida; Sherman, Jenna R; Ingram, Liam; Batki, Cavus; Lariviere, Jean P; Hamilton, Joshua W

2008-02-01

Chronic exposure to excess arsenic in drinking water has been strongly associated with increased risks of multiple cancers, diabetes, heart disease, and reproductive and developmental problems in humans. We previously demonstrated that As, a potent endocrine disruptor at low, environmentally relevant levels, alters steroid signaling at the level of receptor-mediated gene regulation for all five steroid receptors. The goal of this study was to determine whether As can also disrupt gene regulation via the retinoic acid (RA) receptor (RAR) and/or the thyroid hormone (TH) receptor (TR) and whether these effects are similar to previously observed effects on steroid regulation. Human embryonic NT2 or rat pituitary GH3 cells were treated with 0.01-5 microM sodium arsenite for 24 hr, with or without RA or TH, respectively, to examine effects of As on receptor-mediated gene transcription. At low, noncytotoxic doses, As significantly altered RAR-dependent gene transcription of a transfected RAR response element-luciferase construct and the native RA-inducible cytochrome P450 CYP26A gene in NT2 cells. Likewise, low-dose As significantly altered expression of a transfected TR response element-luciferase construct and the endogenous TR-regulated type I deiodinase (DIO1) gene in a similar manner in GH3 cells. An amphibian ex vivo tail metamorphosis assay was used to examine whether endocrine disruption by low-dose As could have specific pathophysiologic consequences, because tail metamorphosis is tightly controlled by TH through TR. TH-dependent tail shrinkage was inhibited in a dose-dependent manner by 0.1- 4.0 microM As. As had similar effects on RAR- and TR-mediated gene regulation as those previously observed for the steroid receptors, suggesting a common mechanism or action. Arsenic also profoundly affected a TR-dependent developmental process in a model animal system at very low concentrations. Because RAR and TH are critical for both normal human development and adult function and their dysregulation is associated with many disease processes, disruption of these hormone receptor-dependent processes by As is also potentially relevant to human developmental problems and disease risk.

A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

PubMed

Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

2015-12-01

A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Systematic identification of genes involved in divergent skeletal muscle growth rates of broiler and layer chickens.

PubMed

Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai

2009-02-22

The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.

Applications of Gene Targeting Technology to Mental Retardation and Developmental Disability Research

ERIC Educational Resources Information Center

Pimenta, Aurea F.; Levitt, Pat

2005-01-01

The human and mouse genome projects elucidated the sequence and position map of innumerous genes expressed in the central nervous system (CNS), advancing our ability to manipulate these sequences and create models to investigate regulation of gene expression and function. In this article, we reviewed gene targeting methodologies with emphasis on…

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Dynamics of DNA methylomes underlie oyster development

PubMed Central

Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

2017-01-01

DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes. PMID:28594821

Dynamics of DNA methylomes underlie oyster development.

PubMed

Riviere, Guillaume; He, Yan; Tecchio, Samuele; Crowell, Elizabeth; Gras, Michaël; Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

2017-06-01

DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes.

Evolution of developmental regulation in the vertebrate FgfD subfamily.

PubMed

Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

2010-01-15

Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

PubMed Central

Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

2014-01-01

Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

USDA-ARS?s Scientific Manuscript database

Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

PubMed

Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus.

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

2017-03-01

To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P<0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48h LD10 and LD50 were 1.35 and 1.84kJ/m 2 , and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5kJ/m 2 ) induced developmental delays, and higher doses (6-18kJ/m 2 ) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12kJ/m 2 ) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.

Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

PubMed Central

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

PubMed

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

De novo mutations in the genome organizer CTCF cause intellectual disability.

PubMed

Gregor, Anne; Oti, Martin; Kouwenhoven, Evelyn N; Hoyer, Juliane; Sticht, Heinrich; Ekici, Arif B; Kjaergaard, Susanne; Rauch, Anita; Stunnenberg, Hendrik G; Uebe, Steffen; Vasileiou, Georgia; Reis, André; Zhou, Huiqing; Zweier, Christiane

2013-07-11

An increasing number of genes involved in chromatin structure and epigenetic regulation has been implicated in a variety of developmental disorders, often including intellectual disability. By trio exome sequencing and subsequent mutational screening we now identified two de novo frameshift mutations and one de novo missense mutation in CTCF in individuals with intellectual disability, microcephaly, and growth retardation. Furthermore, an individual with a larger deletion including CTCF was identified. CTCF (CCCTC-binding factor) is one of the most important chromatin organizers in vertebrates and is involved in various chromatin regulation processes such as higher order of chromatin organization, enhancer function, and maintenance of three-dimensional chromatin structure. Transcriptome analyses in all three individuals with point mutations revealed deregulation of genes involved in signal transduction and emphasized the role of CTCF in enhancer-driven expression of genes. Our findings indicate that haploinsufficiency of CTCF affects genomic interaction of enhancers and their regulated gene promoters that drive developmental processes and cognition. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

PubMed

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.)

PubMed Central

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries (Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm—plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus. These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop. PMID:28659963

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

The histone acetyltransferases CBP and Chameau integrate developmental and DNA replication programs in Drosophila ovarian follicle cells

PubMed Central

McConnell, Kristopher H.; Dixon, Michael; Calvi, Brian R.

2012-01-01

DNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic location of origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins in concert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarian follicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histone acetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm had relatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of its ortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also binds amplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect on nucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaborate in origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate the developmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of origin epigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integrates differentiation and DNA replication programs. PMID:22951641

Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

PubMed

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-12-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Challenges for modeling global gene regulatory networks during development: insights from Drosophila.

PubMed

Wilczynski, Bartek; Furlong, Eileen E M

2010-04-15

Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention

PubMed Central

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V.

2012-01-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3′-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context. PMID:22661231

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention.

PubMed

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V

2012-06-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3'-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context.

The Developmental Regulator SEEDSTICK Controls Structural and Mechanical Properties of the Arabidopsis Seed Coat

PubMed Central

Beauzamy, Léna; Caporali, Elisabetta; Koroney, Abdoul-Salam

2016-01-01

Although many transcription factors involved in cell wall morphogenesis have been identified and studied, it is still unknown how genetic and molecular regulation of cell wall biosynthesis is integrated into developmental programs. We demonstrate by molecular genetic studies that SEEDSTICK (STK), a transcription factor controlling ovule and seed integument identity, directly regulates PMEI6 and other genes involved in the biogenesis of the cellulose-pectin matrix of the cell wall. Based on atomic force microscopy, immunocytochemistry, and chemical analyses, we propose that structural modifications of the cell wall matrix in the stk mutant contribute to defects in mucilage release and seed germination under water-stress conditions. Our studies reveal a molecular network controlled by STK that regulates cell wall properties of the seed coat, demonstrating that developmental regulators controlling organ identity also coordinate specific aspects of cell wall characteristics. PMID:27624758

Hydroxylated PBDEs induce developmental arrest in zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu

The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was notmore » observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.« less

A cross-species bi-clustering approach to identifying conserved co-regulated genes.

PubMed

Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

2016-06-15

A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

Membrane-tethered transcription factors provide a connection between stress response and developmental pathways

PubMed Central

Slabaugh, Erin

2011-01-01

Membrane-tethered transcription factors (MTTFs) are proteins that are targeted to membranes and are capable of regulating gene expression. In this way, they are physically restrained from entering the nucleus and are innately dormant. Upon specific signal recognition cues, MTTFs are activated through cleavage by a protease that releases the transcription factor domain into the cytosol thus allowing it to translocate to the nucleus where it can regulate gene expression. MTTFs are classically thought to provide an advantage to an organism by allowing for rapid signal transduction in response to cellular and environmental stresses. However, recent findings suggest that MTTFs may not only act as a means to respond quickly to stress but also are able to regulate developmental pathways, illustrating a point of interaction between stress and development. PMID:21758012

1,25-dihydroxyvitamin D3 is an autonomous regulator of the transcriptional changes leading to a tolerogenic dendritic cell phenotype.

PubMed

Széles, Lajos; Keresztes, Gábor; Töröcsik, Dániel; Balajthy, Zoltán; Krenács, László; Póliska, Szilárd; Steinmeyer, Andreas; Zuegel, Ulrich; Pruenster, Monika; Rot, Antal; Nagy, László

2009-02-15

Activation of vitamin D receptor (VDR) by 1,25-dihydroxyvitamin D(3) (1,25-vitD) reprograms dendritic cells (DC) to become tolerogenic. Previous studies suggested that 1,25-vitD could inhibit the changes brought about by differentiation and maturation of DCs. Underpinning the described phenotypic and functional alterations, there must be 1,25-vitD-coordinated transcriptional events. However, this transcriptional program has not been systematically investigated, particularly not in a developmental context. Hence, it has not been explored how 1,25-vitD-regulated genes, particularly the ones bringing about the tolerogenic phenotype, are connected to differentiation. We conducted global gene expression analysis followed by comprehensive quantitative PCR validation to clarify the interrelationship between 1,25-vitD and differentiation-driven gene expression patterns in developing human monocyte-derived and blood myeloid DCs. In this study we show that 1,25-vitD regulates a large set of genes that are not affected by differentiation. Interestingly, several genes, impacted both by the ligand and by differentiation, appear to be regulated by 1,25-vitD independently of the developmental context. We have also characterized the kinetics of generation of 1,25-vitD by using three early and robustly regulated genes, the chemokine CCL22, the inhibitory receptors CD300LF and CYP24A1. We found that monocyte-derived DCs are able to turn on 1,25-vitD sensitive genes in early phases of differentiation if the precursor is present. Our data collectively suggest that exogenous or endogenously generated 1,25-vitD regulates a large set of its targets autonomously and not via inhibition of differentiation and maturation, leading to the previously characterized tolerogenic state.

Arsenic as an Endocrine Disruptor: Arsenic Disrupts Retinoic Acid Receptor–and Thyroid Hormone Receptor–Mediated Gene Regulation and Thyroid Hormone–Mediated Amphibian Tail Metamorphosis

PubMed Central

Davey, Jennifer C.; Nomikos, Athena P.; Wungjiranirun, Manida; Sherman, Jenna R.; Ingram, Liam; Batki, Cavus; Lariviere, Jean P.; Hamilton, Joshua W.

2008-01-01

Background Chronic exposure to excess arsenic in drinking water has been strongly associated with increased risks of multiple cancers, diabetes, heart disease, and reproductive and developmental problems in humans. We previously demonstrated that As, a potent endocrine disruptor at low, environmentally relevant levels, alters steroid signaling at the level of receptor-mediated gene regulation for all five steroid receptors. Objectives The goal of this study was to determine whether As can also disrupt gene regulation via the retinoic acid (RA) receptor (RAR) and/or the thyroid hormone (TH) receptor (TR) and whether these effects are similar to previously observed effects on steroid regulation. Methods and results Human embryonic NT2 or rat pituitary GH3 cells were treated with 0.01–5 μM sodium arsenite for 24 hr, with or without RA or TH, respectively, to examine effects of As on receptor-mediated gene transcription. At low, noncytotoxic doses, As significantly altered RAR-dependent gene transcription of a transfected RAR response element–luciferase construct and the native RA-inducible cytochrome P450 CYP26A gene in NT2 cells. Likewise, low-dose As significantly altered expression of a transfected TR response element–luciferase construct and the endogenous TR-regulated type I deiodinase (DIO1) gene in a similar manner in GH3 cells. An amphibian ex vivo tail metamorphosis assay was used to examine whether endocrine disruption by low-dose As could have specific pathophysiologic consequences, because tail metamorphosis is tightly controlled by TH through TR. TH-dependent tail shrinkage was inhibited in a dose-dependent manner by 0.1– 4.0 μM As. Conclusions As had similar effects on RAR- and TR-mediated gene regulation as those previously observed for the steroid receptors, suggesting a common mechanism or action. Arsenic also profoundly affected a TR-dependent developmental process in a model animal system at very low concentrations. Because RAR and TH are critical for both normal human development and adult function and their dysregulation is associated with many disease processes, disruption of these hormone receptor–dependent processes by As is also potentially relevant to human developmental problems and disease risk. PMID:18288313

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

PubMed Central

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

PubMed Central

2010-01-01

Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

PubMed

Rosario, Christopher J; Tan, Ming

2016-01-15

Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

PubMed

Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

2015-04-13

Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

Pleiotropy in the wild: the dormancy gene DOG1 exerts cascading control on life cycles.

PubMed

Chiang, George C K; Barua, Deepak; Dittmar, Emily; Kramer, Elena M; de Casas, Rafael Rubio; Donohue, Kathleen

2013-03-01

In the wild, organismal life cycles occur within seasonal cycles, so shifts in the timing of developmental transitions can alter the seasonal environment experienced subsequently. Effects of genes that control the timing of prior developmental events can therefore be magnified in the wild because they determine seasonal conditions experienced by subsequent life stages, which can influence subsequent phenotypic expression. We examined such environmentally induced pleiotropy of developmental-timing genes in a field experiment with Arabidopsis thaliana. When studied in the field under natural seasonal variation, an A. thaliana seed-dormancy gene, Delay Of Germination 1 (DOG1), was found to influence not only germination, but also flowering time, overall life history, and fitness. Flowering time of the previous generation, in turn, imposed maternal effects that altered germination, the effects of DOG1 alleles, and the direction of natural selection on these alleles. Thus under natural conditions, germination genes act as flowering genes and potentially vice versa. These results illustrate how seasonal environmental variation can alter pleiotropic effects of developmental-timing genes, such that effects of genes that regulate prior life stages ramify to influence subsequent life stages. In this case, one gene acting at the seed stage impacted the entire life cycle. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

PubMed Central

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Retinal Determination genes function along with cell-cell signals to regulate Drosophila eye development: examples of multi-layered regulation by Master Regulators

PubMed Central

Baker, Nicholas E.; Firth, Lucy C.

2015-01-01

It is thought that Retinal Determination gene products define the response made to cell-cell signals within the eye developmental field by binding to enhancers of genes that are also regulated by cell-cell signaling pathways. In Drosophila, Retinal Determination genes including Eyeless, teashirt, eyes absent, dachsous and sine oculis, are required for normal eye development and can induce ectopic eyes when mis-expressed. Characterization of the enhancers responsible for eye expression of the hedgehog, shaven, and atonal genes, as well as the dynamics of Retinal Determination gene expression themselves, now suggest a multilayered network whereby transcriptional regulation by either Retinal Determination genes or cell-cell signaling pathways can sometimes be indirect and mediated by other transcription factor intermediates. In this updated view of the interaction between extracellular information and cell intrinsic programs during development, regulation of individual genes might sometimes be several steps removed from either the Retinal Determination genes or cell-cell signaling pathways that nevertheless govern their expression. PMID:21607995

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

PubMed Central

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

20-Hydroxyecdysone (20E) Primary Response Gene E75 Isoforms Mediate Steroidogenesis Autoregulation and Regulate Developmental Timing in Bombyx*

PubMed Central

Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng

2016-01-01

The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399

Epigenetic mechanisms in heart development and disease.

PubMed

Martinez, Shannalee R; Gay, Maresha S; Zhang, Lubo

2015-07-01

Suboptimal intrauterine development has been linked to predisposition to cardiovascular disease in adulthood, a concept termed 'developmental origins of health and disease'. Although the exact mechanisms underlying this developmental programming are unknown, a growing body of evidence supports the involvement of epigenetic regulation. Epigenetic mechanisms such as DNA methylation, histone modifications and micro-RNA confer added levels of gene regulation without altering DNA sequences. These modifications are relatively stable signals, offering possible insight into the mechanisms underlying developmental origins of health and disease. This review will discuss the role of epigenetic mechanisms in heart development as well as aberrant epigenetic regulation contributing to cardiovascular disease. Additionally, we will address recent advances targeting epigenetic mechanisms as potential therapeutic approaches to cardiovascular disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit.

PubMed

Castellarin, Simone D; Pfeiffer, Antonella; Sivilotti, Paolo; Degan, Mirko; Peterlunger, Enrico; DI Gaspero, Gabriele

2007-11-01

Anthocyanin biosynthesis is strongly up-regulated in ripening fruit of grapevines (Vitis vinifera L.) grown under drought conditions. We investigated the effects of long-term water deficit on the expression of genes coding for flavonoid and anthocyanin biosynthetic enzymes and related transcription factors, genes sensitive to endogenous [sugars, abscisic acid (ABA)] and environmental (light) stimuli connected to drought stress, and genes developmentally regulated in ripening berries. Total anthocyanin content has increased at harvest in water-stressed (WS) fruits by 37-57% in two consecutive years. At least 84% of the total variation in anthocyanin content was explained by the linear relationship between the integral of mRNA accumulation of the specific anthocyanin biosynthetic gene UDP-glucose : flavonoid 3-O-glucosyltransferase (UFGT) and metabolite content during time series from véraison through ripening. Chalcone synthase (CHS2, CHS3) and flavanone 3-hydroxylase (F3H) genes of the flavonoid pathway showed high correlation as well. Genes coding for flavonoid 3',5'-hydroxylase (F3'5'H) and O-methyltransferase (OMT) were also up-regulated in berries from dehydrated plants in which anthocyanin composition enriched in more hydroxylated and more methoxylated derivatives such as malvidin and peonidin, the grape anthocyanins to which human gastric bilitranslocase displays the highest affinity. The induction in WS plants of structural and regulatory genes of the flavonoid pathway and of genes that trigger brassinosteroid hormonal onset of maturation suggested that the interrelationships between developmental and environmental signalling pathways were magnified by water deficit which actively promoted fruit maturation and, in this context, anthocyanin biosynthesis.

Identification of ARF and AUX/IAA gene families in Rafflesia cantleyi

NASA Astrophysics Data System (ADS)

Elias, Nur Atiqah Mohd; Goh, Hoe-Han; Isa, Nurulhikma Md; Wan, Kiew-Lian

2016-11-01

Rafflesia is a unique plant that produces the largest flowers in the world. It has a short blooming period of 6 to 7 days. Due to its rarity and limited accessibility, little is known about the growth and developmental process in the Rafflesia plant. In all plant species, auxin is the key hormone that is involved in growth and development. The auxin signal transduction involves members of the ARF transcription factor and AUX/IAA regulator families, which activate or inhibit the regulation of auxin response genes, thereby control the developmental process in plants. To gain a better understanding of molecular regulations in the Rafflesia plant development during flowering, members of the ARF and AUX/IAA gene families were identified from the transcriptome data of flower blooming stages in Rafflesia cantleyi. Based on Rafflesia unique transcripts (UTs) against the Arabidopsis TAIR database using BLASTX search, a total of nine UTs were identified as ARF transcription factors, while another seven UTs were identified as AUX/IAA regulators. These genes were found to be expressed in all three R. cantleyi flower stages i.e. days 1 (F1), 3 (F2), and 5 (F3). Gene expression analysis identified three genes that are differentially expressed in stage F1 vs. F2 i.e. IAA4 is upregulated while IAA8 and ARF3 are downregulated. These genes may be involved in the activation and/or inhibition of the auxin signal transduction pathway. Further analysis of these genes may unravel their function in the phenotypic development of the Rafflesia plant.

Pervasive, Coordinated Protein-Level Changes Driven by Transcript Isoform Switching during Meiosis.

PubMed

Cheng, Ze; Otto, George Maxwell; Powers, Emily Nicole; Keskin, Abdurrahman; Mertins, Philipp; Carr, Steven Alfred; Jovanovic, Marko; Brar, Gloria Ann

2018-02-22

To better understand the gene regulatory mechanisms that program developmental processes, we carried out simultaneous genome-wide measurements of mRNA, translation, and protein through meiotic differentiation in budding yeast. Surprisingly, we observed that the levels of several hundred mRNAs are anti-correlated with their corresponding protein products. We show that rather than arising from canonical forms of gene regulatory control, the regulation of at least 380 such cases, or over 8% of all measured genes, involves temporally regulated switching between production of a canonical, translatable transcript and a 5' extended isoform that is not efficiently translated into protein. By this pervasive mechanism for the modulation of protein levels through a natural developmental program, a single transcription factor can coordinately activate and repress protein synthesis for distinct sets of genes. The distinction is not based on whether or not an mRNA is induced but rather on the type of transcript produced. Copyright © 2018 Elsevier Inc. All rights reserved.

Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

PubMed

Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

2017-10-01

The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

Mammalian Homologs of Yeast Checkpoint Genes

DTIC Science & Technology

2002-07-01

pathway is sensitive to various forms of DNA damage Developmental Biology throughout the cell cycle . The DNA replication check- Yale University point...components would be ordered into pathways for mammalian checkpoint function, with emphasis on p53 regulation, cell cycle regulation, and complementation...structurally related to the human tumor suppressor ATM. MEC1 and RAD53, two essential genes, play a central role in DNA damage checkpoints at all cell cycle

Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

PubMed

Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

2016-07-01

Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis

PubMed Central

Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM

2014-01-01

Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953

Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

PubMed

Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

2016-01-01

Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators were known to be involved in muscle and adipose tissues development, but others not previously associated with pig muscle growth were also identified, as PVALB, KLF1 or IRF2. The present study discloses potential molecular mechanisms underlying phenotypic differences observed between IB and IBxDU pigs and highlights candidate genes implicated in these molecular mechanisms.

X chromosome regulation: diverse patterns in development, tissues and disease

PubMed Central

Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.

2014-01-01

Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023

5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

PubMed Central

2013-01-01

Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes important to early stages of mushroom fruiting development, though their precise molecular functions and biological roles are not yet fully known. This study serves to advance our understanding of the molecular mechanisms of fruiting body development in the model mushroom C. cinerea. PMID:23514374

Regulation of melanin biosynthesis via the dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete Sordaria macrospora.

PubMed

Engh, Ines; Nowrousian, Minou; Kück, Ulrich

2007-10-01

The filamentous ascomycete Sordaria macrospora accumulates melanin during sexual development. The four melanin biosynthesis genes pks, teh, sdh and tih were isolated and their homology to genes involved in 1,8 dihydroxynaphthalene (DHN) melanin biosynthesis was shown. The presence of DHN melanin in S. macrospora was further confirmed by disrupting the pks gene encoding a putative polyketide synthase and by RNA interference-mediated silencing of the sdh gene encoding a putative scytalone dehydratase. Because melanin occurs in fruiting bodies that develop through several intermediate stages within 7 days of growth, a Northern analysis of a developmental time-course was conducted. These data revealed a time-dependent regulation of teh and sdh transcript levels. Comparing the transcriptional expression by real-time PCR of melanin biosynthesis genes in the wild type under conditions allowing or repressing sexual development, a significant downregulation during vegetative growth was detected. Quantitative real-time PCR and Northern blot analysis of melanin biosynthesis gene expression in different developmental mutants confirmed that melanin biosynthesis is linked to fruiting body development and is under the control of specific regulatory genes that participate in sexual differentiation.

Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni.

PubMed

Neumann, S; Ziv, E; Lantner, F; Schechter, I

1993-03-01

Analyses of RNA from different developmental stages of Schistosoma mansoni showed stage-specific expression of heat-shock protein 70 (hsp70), which is regulated by a developmental program and by stress. The developmental program, common to hsp70 and other genes (e.g. paramyosin), refers to constitutive expression in miracidia sporocyst and adult worm but not in cercariae, and to the termination of hsp70 gene transcription during sporocyst/cercaria transformation. Stress induction, specific to hsp70, refers to transient accumulation of high levels of hsp70 mRNA during cercariae/schistosomula transformation and in adult worms after heat shock (42 degrees C). Cercariae/schistosomula transformation can be visualized as a physiological stress involving shifts in temperature (23-37 degrees C) and in salt concentration (from water to isotonic medium), as well as removal of tails from cercariae to yield isolated bodies that transform into schistosomula. It was found that temperature is an important factor, but not sufficient for strong induction of the hsp70 genes of schistosomula. Tail removal is an obligatory step for full induction of the hsp70 genes of schistosomula, in response to a temperature shift from 23-37 degrees C. The hsp70 genes in cercariae and isolated tails do not respond to stimuli (salt and temperature increases) that strongly activate the genes in isolated bodies (i.e., schistosomula). We speculate that the hsp70 genes in intact cercariae are not inducible because the tails can produce inhibitory signals that diffuse to the bodies and suppress their hsp70 genes. This hypothesis is useful to explain the termination of hsp70 gene transcription during sporocyst/cercaria transformation by the inhibitory effect of the growing tail.

Forkhead Transcription Factor Fd3F Cooperates with Rfx to Regulate a Gene Expression Program for Mechanosensory Cilia Specialization

PubMed Central

Newton, Fay G.; zur Lage, Petra I.; Karak, Somdatta; Moore, Daniel J.; Göpfert, Martin C.; Jarman, Andrew P.

2012-01-01

Summary Cilia have evolved hugely diverse structures and functions to participate in a wide variety of developmental and physiological processes. Ciliary specialization requires differences in gene expression, but few transcription factors are known to regulate this, and their molecular function is unclear. Here, we show that the Drosophila Forkhead box (Fox) gene, fd3F, is required for specialization of the mechanosensory cilium of chordotonal (Ch) neurons. fd3F regulates genes for Ch-specific axonemal dyneins and TRPV ion channels, which are required for sensory transduction, and retrograde transport genes, which are required to differentiate their distinct motile and sensory ciliary zones. fd3F is reminiscent of vertebrate Foxj1, a motile cilia regulator, but fd3F regulates motility genes as part of a broader sensory regulation program. Fd3F cooperates with the pan-ciliary transcription factor, Rfx, to regulate its targets directly. This illuminates pathways involved in ciliary specialization and the molecular mechanism of transcription factors that regulate them. PMID:22698283

[Epigenome: what we learned from Rett syndrome, a neurological disease caused by mutation of a methyl-CpG binding protein].

PubMed

Kubota, Takeo

2013-01-01

Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

Hey bHLH transcription factors.

PubMed

Weber, David; Wiese, Cornelia; Gessler, Manfred

2014-01-01

Hey bHLH transcription factors are direct targets of canonical Notch signaling. The three mammalian Hey proteins are closely related to Hes proteins and they primarily repress target genes by either directly binding to core promoters or by inhibiting other transcriptional activators. Individual candidate gene approaches and systematic screens identified a number of Hey target genes, which often encode other transcription factors involved in various developmental processes. Here, we review data on interaction partners and target genes and conclude with a model for Hey target gene regulation. Furthermore, we discuss how expression of Hey proteins affects processes like cell fate decisions and differentiation, e.g., in cardiovascular, skeletal, and neural development or oncogenesis and how this relates to the observed developmental defects and phenotypes observed in various knockout mice. © 2014 Elsevier Inc. All rights reserved.

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

PubMed Central

Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

2013-01-01

MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Granger, C. L.; Cyr, R. J.

2001-01-01

Inducible promoters or gene-switches are used to both spatially and temporally regulate gene expression. Such regulation can provide information concerning the function of a gene in a developmental context as well as avoid potential harmful effects due to overexpression. A gfp construct under the control of a copper-inducible promoter was introduced into Arabidopsis thaliana (L.) Heynh. and the regulatory parameters of this inducible promoter were determined. Here, we describe the time-course of up- and down-regulation of GFP expression in response to copper level, the optimal regulatory levels of copper, and the tissue specificity of expression in three transgenic lines. We conclude that the copper-inducible promoter system may be useful in regulating the time and location of gene expression in A. thaliana.

Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

NASA Astrophysics Data System (ADS)

Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

1987-05-01

Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

PubMed Central

Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

2010-01-01

Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

Transcriptome profile analysis of floral sex determination in cucumber.

PubMed

Wu, Tao; Qin, Zhiwei; Zhou, Xiuyan; Feng, Zhuo; Du, Yalin

2010-07-15

Cucumber has been widely studied as a model for floral sex determination. In this investigation, we performed genome-wide transcriptional profiling of apical tissue of a gynoecious mutant (Csg-G) and the monoecious wild-type (Csg-M) of cucumber in an attempt to isolate genes involved in sex determination, using the Solexa technology. The profiling analysis revealed numerous changes in gene expression attributable to the mutation, which resulted in the down-regulation of 600 genes and the up-regulation of 143 genes. The Solexa data were confirmed by reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative RT-PCR (qRT-PCR). Gene ontology (GO) analysis revealed that the differentially expressed genes were mainly involved in biogenesis, transport and organization of cellular component, macromolecular and cellular biosynthesis, localization, establishment of localization, translation and other processes. Furthermore, the expression of some of these genes depended upon the tissue and the developmental stage of the flowers of gynoecious mutant. The results of this study suggest two important concepts, which govern sex determination in cucumber. First, the differential expression of genes involved in plant hormone signaling pathways, such as ACS, Asr1, CsIAA2, CS-AUX1 and TLP, indicate that phytohormones and their crosstalk might play a critical role in the sex determination. Second, the regulation of some transcription factors, including EREBP-9, may also be involved in this developmental process. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

Compound-specific effects of diverse neurodevelopmental toxicants on global gene expression in the neural embryonic stem cell test (ESTn)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theunissen, P.T., E-mail: Peter.Theunissen@rivm.nl; Department of Toxicogenomics, Maastricht University, Maastricht; Robinson, J.F.

Alternative assays for developmental toxicity testing are needed to reduce animal use in regulatory toxicology. The in vitro murine neural embryonic stem cell test (ESTn) was designed as an alternative for neurodevelopmental toxicity testing. The integration of toxicogenomic-based approaches may further increase predictivity as well as provide insight into underlying mechanisms of developmental toxicity. In the present study, we investigated concentration-dependent effects of six mechanistically diverse compounds, acetaldehyde (ACE), carbamazepine (CBZ), flusilazole (FLU), monoethylhexyl phthalate (MEHP), penicillin G (PENG) and phenytoin (PHE), on the transcriptome and neural differentiation in the ESTn. All compounds with the exception of PENG altered ESTnmore » morphology (cytotoxicity and neural differentiation) in a concentration-dependent manner. Compound induced gene expression changes and corresponding enriched gene ontology biological processes (GO–BP) were identified after 24 h exposure at equipotent differentiation-inhibiting concentrations of the compounds. Both compound-specific and common gene expression changes were observed between subsets of tested compounds, in terms of significance, magnitude of regulation and functionality. For example, ACE, CBZ and FLU induced robust changes in number of significantly altered genes (≥ 687 genes) as well as a variety of GO–BP, as compared to MEHP, PHE and PENG (≤ 55 genes with no significant changes in GO–BP observed). Genes associated with developmentally related processes (embryonic morphogenesis, neuron differentiation, and Wnt signaling) showed diverse regulation after exposure to ACE, CBZ and FLU. In addition, gene expression and GO–BP enrichment showed concentration dependence, allowing discrimination of non-toxic versus toxic concentrations on the basis of transcriptomics. This information may be used to define adaptive versus toxic responses at the transcriptome level.« less

EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

PubMed Central

Brenner, Eric D; Katari, Manpreet S; Stevenson, Dennis W; Rudd, Stephen A; Douglas, Andrew W; Moss, Walter N; Twigg, Richard W; Runko, Suzan J; Stellari, Giulia M; McCombie, WR; Coruzzi, Gloria M

2005-01-01

Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate), female (megasporangiate), and vegetative organs (leaves) of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and pollen evolution, and to resolve the ambiguous phylogenetic relationship of G. biloba among the gymnosperms. PMID:16225698

Hyper-activation of the TCP4 transcription factor in Arabidopsis thaliana accelerates multiple aspects of plant maturation.

PubMed

Sarvepalli, Kavitha; Nath, Utpal

2011-08-01

Plant organs are initiated as primordial outgrowths, and require controlled cell division and differentiation to achieve their final size and shape. Superimposed on this is another developmental program that orchestrates the switch from vegetative to reproductive to senescence stages in the life cycle. These require sequential function of heterochronic regulators. Little is known regarding the coordination between organ and organismal growth in plants. The TCP gene family encodes transcription factors that control diverse developmental traits, and a subgroup of class II TCP genes regulate leaf morphogenesis. Absence of these genes results in large, crinkly leaves due to excess division, mainly at margins. It has been suggested that these class II TCPs modulate the spatio-temporal control of differentiation in a growing leaf, rather than regulating cell proliferation per se. However, the link between class II TCP action and cell growth has not been established. As loss-of-function mutants of individual TCP genes in Arabidopsis are not very informative due to gene redundancy, we generated a transgenic line that expressed a hyper-activated form of TCP4 in its endogenous expression domain. This resulted in premature onset of maturation and decreased cell proliferation, leading to much smaller leaves, with cup-shaped lamina in extreme cases. Further, the transgenic line initiated leaves faster than wild-type and underwent precocious reproductive maturation due to a shortened adult vegetative phase. Early senescence and severe fertility defects were also observed. Thus, hyper-activation of TCP4 revealed its role in determining the timing of crucial developmental events, both at the organ and organism level. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Ovule identity mediated by pre-mRNA processing in Arabidopsis

PubMed Central

Rodríguez-Cazorla, Encarnación; Candela, Héctor; Bailey-Steinitz, Lindsay J.; Yanofsky, Martin F.; Martínez-Laborda, Antonio

2018-01-01

Ovules are fundamental for plant reproduction and crop yield as they are the precursors of seeds. Therefore, ovule specification is a critical developmental program. In Arabidopsis thaliana, ovule identity is redundantly conferred by the homeotic D-class genes SHATTERPROOF1 (SHP1), SHP2 and SEEDSTICK (STK), phylogenetically related to the MADS-domain regulatory gene AGAMOUS (AG), essential in floral organ specification. Previous studies have shown that the HUA-PEP activity, comprised of a suite of RNA-binding protein (RBP) encoding genes, regulates AG pre-mRNA processing and thus flower patterning and organ identity. Here, we report that the HUA-PEP activity additionally governs ovule morphogenesis. Accordingly, in severe hua-pep backgrounds ovules transform into flower organ-like structures. These homeotic transformations are most likely due to the dramatic reduction in SHP1, SHP2 and STK activity. Our molecular and genome-wide profiling strategies revealed the accumulation of prematurely terminated transcripts of D-class genes in hua-pep mutants and reduced amounts of their respective functional messengers, which points to pre-mRNA processing misregulation as the origin of the ovule developmental defects in such backgrounds. RNA processing and transcription are coordinated by the RNA polymerase II (RNAPII) carboxyl-terminal domain (CTD). Our results show that HUA-PEP activity members can interact with the CTD regulator C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 (CPL1), supporting a co-transcriptional mode of action for the HUA-PEP activity. Our findings expand the portfolio of reproductive developmental programs in which HUA-PEP activity participates, and further substantiates the importance of RNA regulatory mechanisms (pre-mRNA co-transcriptional regulation) for correct gene expression during plant morphogenesis. PMID:29329291

microRNAs of parasites: current status and future perspectives

USDA-ARS?s Scientific Manuscript database

MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs regulating gene expression in eukaryotes at the post-transcriptional level. The complex life cycles of parasites may require the ability to respond to environmental and developmental signals through miRNA-mediated gene expression. Ov...

Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...

Dynamic changes of genome-wide DNA methylation during soybean seed development

USDA-ARS?s Scientific Manuscript database

Seed development is programmed by expression of many genes in plants. Seed maturation is an important developmental process to soybean seed quality and yield. DNA methylation is a major epigenetic modification regulating gene expression. However, little is known about the dynamic nature of DNA me...

Life cycle expression analysis of three cell wall degradation-related genes in ethylene-treated grass

USDA-ARS?s Scientific Manuscript database

Ethylene regulates multiple developmental processes during a plant life cycle, but the effect of ethylene on the upregulation of senescence-, stress-, and post-harvest-related genes in forage grasses is poorly understood. In this work, we used quantitative PCR to determine whether ethylene applicat...

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

Enhancer modularity and the evolution of new traits.

PubMed

Koshikawa, Shigeyuki

2015-01-01

Animals have modular cis-regulatory regions in their genomes, and expression of a single gene is often regulated by multiple enhancers residing in such a region. In the laboratory, and also in natural populations, loss of an enhancer can result in a loss of gene expression. Although only a few examples have been well characterized to date, some studies have suggested that an evolutionary gain of a new enhancer function can establish a new gene expression domain. Our recent study showed that Drosophila guttifera has more enhancers and additional expression domains of the wingless gene during the pupal stage, compared to D. melanogaster, and that these new features appear to have evolved in the ancestral lineage leading to D. guttifera. (1) Gain of a new expression domain of a developmental regulatory gene (toolkit gene), such as wingless, can cause co-option of the expression of its downstream genes to the new domain, resulting in duplication of a preexisting structure at this new body position. Recently, with the advancement of evo-devo studies, we have learned that the developmental regulatory systems are strikingly similar across various animal taxa, in spite of the great diversity of the animals' morphology. Even behind "new" traits, co-options of essential developmental genes from known systems are very common. We previously provided concrete evidence of gains of enhancer activities of a developmental regulatory gene underlying gains of new traits. (1) Broad occurrence of this scenario is testable and should be validated in the future.

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Regulating nutrient allocation in plants

DOEpatents

Udvardi, Michael; Yang, Jiading; Worley, Eric

2014-12-09

The invention provides coding and promoter sequences for a VS-1 and AP-2 gene, which affects the developmental process of senescence in plants. Vectors, transgenic plants, seeds, and host cells comprising heterologous VS-1 and AP-2 genes are also provided. Additionally provided are methods of altering nutrient allocation and composition in a plant using the VS-1 and AP-2 genes.

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

USDA-ARS?s Scientific Manuscript database

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

Nrf2 and Nrf2-Related Proteins in Development and Developmental Toxicity: Insights from studies in Zebrafish (Danio rerio)

PubMed Central

Hahn, Mark E.; Timme-Laragy, Alicia R.; Karchner, Sibel I.; Stegeman, John J.

2015-01-01

Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap’n’collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. PMID:26130508

The Role of Epigenetics in the Latent Effects of Early Life Exposure to Obesogenic Endocrine Disrupting Chemicals

PubMed Central

Stel, Jente

2015-01-01

Recent research supports a role for exposure to endocrine-disrupting chemicals (EDCs) in the global obesity epidemic. Obesogenic EDCs have the potential to inappropriately stimulate adipogenesis and fat storage, influence metabolism and energy balance and increase susceptibility to obesity. Developmental exposure to obesogenic EDCs is proposed to interfere with epigenetic programming of gene regulation, partly by activation of nuclear receptors, thereby influencing the risk of obesity later in life. The goal of this minireview is to briefly describe the epigenetic mechanisms underlying developmental plasticity and to evaluate the evidence of a mechanistic link between altered epigenetic gene regulation by early life EDC exposure and latent onset of obesity. We summarize the results of recent in vitro, in vivo, and transgenerational studies, which clearly show that the obesogenic effects of EDCs such as tributyltin, brominated diphenyl ether 47, and polycyclic aromatic hydrocarbons are mediated by the activation and associated altered methylation of peroxisome proliferator-activated receptor-γ, the master regulator of adipogenesis, or its target genes. Importantly, studies are emerging that assess the effects of EDCs on the interplay between DNA methylation and histone modifications in altered chromatin structure. These types of studies coupled with genome-wide rather than gene-specific analyses are needed to improve mechanistic understanding of epigenetic changes by EDC exposure. Current advances in the field of epigenomics have led to the first potential epigenetic markers for obesity that can be detected at birth, providing an important basis to determine the effects of developmental exposure to obesogenic EDCs in humans. PMID:26241072

The Role of Epigenetics in the Latent Effects of Early Life Exposure to Obesogenic Endocrine Disrupting Chemicals.

PubMed

Stel, Jente; Legler, Juliette

2015-10-01

Recent research supports a role for exposure to endocrine-disrupting chemicals (EDCs) in the global obesity epidemic. Obesogenic EDCs have the potential to inappropriately stimulate adipogenesis and fat storage, influence metabolism and energy balance and increase susceptibility to obesity. Developmental exposure to obesogenic EDCs is proposed to interfere with epigenetic programming of gene regulation, partly by activation of nuclear receptors, thereby influencing the risk of obesity later in life. The goal of this minireview is to briefly describe the epigenetic mechanisms underlying developmental plasticity and to evaluate the evidence of a mechanistic link between altered epigenetic gene regulation by early life EDC exposure and latent onset of obesity. We summarize the results of recent in vitro, in vivo, and transgenerational studies, which clearly show that the obesogenic effects of EDCs such as tributyltin, brominated diphenyl ether 47, and polycyclic aromatic hydrocarbons are mediated by the activation and associated altered methylation of peroxisome proliferator-activated receptor-γ, the master regulator of adipogenesis, or its target genes. Importantly, studies are emerging that assess the effects of EDCs on the interplay between DNA methylation and histone modifications in altered chromatin structure. These types of studies coupled with genome-wide rather than gene-specific analyses are needed to improve mechanistic understanding of epigenetic changes by EDC exposure. Current advances in the field of epigenomics have led to the first potential epigenetic markers for obesity that can be detected at birth, providing an important basis to determine the effects of developmental exposure to obesogenic EDCs in humans.

Tyrosine pathway regulation is host-mediated in the pea aphid symbiosis during late embryonic and early larval development.

PubMed

Rabatel, Andréane; Febvay, Gérard; Gaget, Karen; Duport, Gabrielle; Baa-Puyoulet, Patrice; Sapountzis, Panagiotis; Bendridi, Nadia; Rey, Marjolaine; Rahbé, Yvan; Charles, Hubert; Calevro, Federica; Colella, Stefano

2013-04-10

Nutritional symbioses play a central role in insects' adaptation to specialized diets and in their evolutionary success. The obligatory symbiosis between the pea aphid, Acyrthosiphon pisum, and the bacterium, Buchnera aphidicola, is no exception as it enables this important agricultural pest insect to develop on a diet exclusively based on plant phloem sap. The symbiotic bacteria provide the host with essential amino acids lacking in its diet but necessary for the rapid embryonic growth seen in the parthenogenetic viviparous reproduction of aphids. The aphid furnishes, in exchange, non-essential amino acids and other important metabolites. Understanding the regulations acting on this integrated metabolic system during the development of this insect is essential in elucidating aphid biology. We used a microarray-based approach to analyse gene expression in the late embryonic and the early larval stages of the pea aphid, characterizing, for the first time, the transcriptional profiles in these developmental phases. Our analyses allowed us to identify key genes in the phenylalanine, tyrosine and dopamine pathways and we identified ACYPI004243, one of the four genes encoding for the aspartate transaminase (E.C. 2.6.1.1), as specifically regulated during development. Indeed, the tyrosine biosynthetic pathway is crucial for the symbiotic metabolism as it is shared between the two partners, all the precursors being produced by B. aphidicola. Our microarray data are supported by HPLC amino acid analyses demonstrating an accumulation of tyrosine at the same developmental stages, with an up-regulation of the tyrosine biosynthetic genes. Tyrosine is also essential for the synthesis of cuticular proteins and it is an important precursor for cuticle maturation: together with the up-regulation of tyrosine biosynthesis, we observed an up-regulation of cuticular genes expression. We were also able to identify some amino acid transporter genes which are essential for the switch over to the late embryonic stages in pea aphid development. Our data show that, in the development of A. pisum, a specific host gene set regulates the biosynthetic pathways of amino acids, demonstrating how the regulation of gene expression enables an insect to control the production of metabolites crucial for its own development and symbiotic metabolism.

The B-cell identity factor Pax5 regulates distinct transcriptional programmes in early and late B lymphopoiesis

PubMed Central

Revilla-i-Domingo, Roger; Bilic, Ivan; Vilagos, Bojan; Tagoh, Hiromi; Ebert, Anja; Tamir, Ido M; Smeenk, Leonie; Trupke, Johanna; Sommer, Andreas; Jaritz, Markus; Busslinger, Meinrad

2012-01-01

Pax5 controls the identity and development of B cells by repressing lineage-inappropriate genes and activating B-cell-specific genes. Here, we used genome-wide approaches to identify Pax5 target genes in pro-B and mature B cells. In these cell types, Pax5 bound to 40% of the cis-regulatory elements defined by mapping DNase I hypersensitive (DHS) sites, transcription start sites and histone modifications. Although Pax5 bound to 8000 target genes, it regulated only 4% of them in pro-B and mature B cells by inducing enhancers at activated genes and eliminating DHS sites at repressed genes. Pax5-regulated genes in pro-B cells account for 23% of all expression changes occurring between common lymphoid progenitors and committed pro-B cells, which identifies Pax5 as an important regulator of this developmental transition. Regulated Pax5 target genes minimally overlap in pro-B and mature B cells, which reflects massive expression changes between these cell types. Hence, Pax5 controls B-cell identity and function by regulating distinct target genes in early and late B lymphopoiesis. PMID:22669466

IN VITRO TO IN VIVO SCREENING OF THYROID HORMONE RECEPTOR DISRUPTING CHEMICALS

EPA Science Inventory

Upon completion of these studies, we will have established the predictive value of the GH3.TRE-LUC cell line to detect chemicals that can impact TH regulated gene expression and TH regulated developmental events in vivo. These studies have excellent potential to discover new c...

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

PubMed

Kishi, Shuji

2011-09-01

Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.

Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

PubMed Central

Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

2015-01-01

Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

PubMed

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

PubMed Central

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

PubMed

Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

2016-02-01

Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

Trainable Gene Regulation Networks with Applications to Drosophila Pattern Formation

NASA Technical Reports Server (NTRS)

Mjolsness, Eric

2000-01-01

This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila melanogaster. For details the reader is referred to the papers introduced below. It will then introduce a new gene regulation network model which can describe promoter-level substructure in gene regulation. As described in chapter 2, gene regulation may be thought of as a combination of cis-acting regulation by the extended promoter of a gene (including all regulatory sequences) by way of the transcription complex, and of trans-acting regulation by the transcription factor products of other genes. If we simplify the cis-action by using a phenomenological model which can be tuned to data, such as a unit or other small portion of an artificial neural network, then the full transacting interaction between multiple genes during development can be modelled as a larger network which can again be tuned or trained to data. The larger network will in general need to have recurrent (feedback) connections since at least some real gene regulation networks do. This is the basic modeling approach taken, which describes how a set of recurrent neural networks can be used as a modeling language for multiple developmental processes including gene regulation within a single cell, cell-cell communication, and cell division. Such network models have been called "gene circuits", "gene regulation networks", or "genetic regulatory networks", sometimes without distinguishing the models from the actual modeled systems.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

PubMed

Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

2013-11-06

Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex

PubMed Central

Clare, Alison J.; Wicky, Hollie E.; Empson, Ruth M.; Hughes, Stephanie M.

2017-01-01

Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their expression could contribute to the progression of disease phenotypes. PMID:28936162

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance.

PubMed

Rath, Martin F; Rohde, Kristian; Klein, David C; Møller, Morten

2013-06-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell.

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance

PubMed Central

Rath, Martin F.; Rohde, Kristian; Klein, David C.; Møller, Morten

2012-01-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell. PMID:23076630

Inference of developmental gene regulatory networks beyond classical model systems: new approaches in the post-genomic era.

PubMed

Fernandez-Valverde, Selene L; Aguilera, Felipe; Ramos-Díaz, René Alexander

2018-06-18

The advent of high-throughput sequencing technologies has revolutionized the way we understand the transformation of genetic information into morphological traits. Elucidating the network of interactions between genes that govern cell differentiation through development is one of the core challenges in genome research. These networks are known as developmental gene regulatory networks (dGRNs) and consist largely of the functional linkage between developmental control genes, cis-regulatory modules and differentiation genes, which generate spatially and temporally refined patterns of gene expression. Over the last 20 years, great advances have been made in determining these gene interactions mainly in classical model systems, including human, mouse, sea urchin, fruit fly, and worm. This has brought about a radical transformation in the fields of developmental biology and evolutionary biology, allowing the generation of high-resolution gene regulatory maps to analyse cell differentiation during animal development. Such maps have enabled the identification of gene regulatory circuits and have led to the development of network inference methods that can recapitulate the differentiation of specific cell-types or developmental stages. In contrast, dGRN research in non-classical model systems has been limited to the identification of developmental control genes via the candidate gene approach and the characterization of their spatiotemporal expression patterns, as well as to the discovery of cis-regulatory modules via patterns of sequence conservation and/or predicted transcription-factor binding sites. However, thanks to the continuous advances in high-throughput sequencing technologies, this scenario is rapidly changing. Here, we give a historical overview on the architecture and elucidation of the dGRNs. Subsequently, we summarize the approaches available to unravel these regulatory networks, highlighting the vast range of possibilities of integrating multiple technical advances and theoretical approaches to expand our understanding on the global of gene regulation during animal development in non-classical model systems. Such new knowledge will not only lead to greater insights into the evolution of molecular mechanisms underlying cell identity and animal body plans, but also into the evolution of morphological key innovations in animals.

Protective effects of puerarin against tetrabromobisphenol a-induced apoptosis and cardiac developmental toxicity in zebrafish embryo-larvae.

PubMed

Yang, Suwen; Wang, Shengrui; Sun, Fengchao; Zhang, Mengmeng; Wu, Fengchang; Xu, Fanfan; Ding, Zhishan

2015-09-01

Tetrabromobisphenol A (TBBPA), a brominated flame retardant, is detected commonly in aquatic environments, where it is thought to be highly toxic to the development of aquatic life. In this study, zebrafish embryos and larvae were used to investigate the protective effects of puerarin after exposure to TBBPA. Malformation, blood flow disorders, pericardial edema, and spawn coagulation rates increased, whereas survival decreased significantly after exposure to 0.5 and 1.0 mg L(-1) TBBPA. The measured indices of morphological toxicity improved after treatment with puerarin. TBBPA also induced reactive oxygen species (ROS) production in a dose-dependent manner. Acridine orange staining results revealed that TBBPA exposure caused cardiomyocyte apoptosis and induced the expression of three proapoptotic genes: P53, Bax, and Caspase9. In contrast, the expression of the antiapoptotic gene Bcl2 was down-regulated. When genes related to cardiac development were assessed, the expression of Tbx1, Raldh2, and Bmp2b changed after exposure to the combination of TBBPA and puerarin. These results suggest that TBBPA induces cardiomyocyte apoptosis and ROS production, resulting in cardiac developmental toxicity in zebrafish embryos or larvae. Therefore, puerarin regulates the expression of cardiac developmental genes, such as Tbx1, Bmp2b, and Raldh2 by inhibiting ROS production, and subsequently modulates cardiac development after the exposure of zebrafish larvae to TBBPA. © 2014 Wiley Periodicals, Inc.

Regulation of the epithelial adhesion molecule CEACAM1 is important for palate formation.

PubMed

Mima, Junko; Koshino, Aya; Oka, Kyoko; Uchida, Hitoshi; Hieda, Yohki; Nohara, Kanji; Kogo, Mikihiko; Chai, Yang; Sakai, Takayoshi

2013-01-01

Cleft palate results from a mixture of genetic and environmental factors and occurs when the bilateral palatal shelves fail to fuse. The objective of this study was to search for new genes involved in mouse palate formation. Gene expression of murine embryonic palatal tissue was analyzed at various developmental stages before, during, and after palate fusion using GeneChip® microarrays. Ceacam1 was one of the highly up-regulated genes during palate formation, and this was confirmed by quantitative real-time PCR. Immunohistochemical staining showed that CEACAM1 was present in prefusion palatal epithelium and was degraded during fusion. To investigate the developmental role of CEACAM1, function-blocking antibody was added to embryonic mouse palate in organ culture. Palatal fusion was inhibited by this function-blocking antibody. To investigate the subsequent developmental role of CEACAM1, we characterized Ceacam1-deficient (Ceacam1(-/-)) mice. Epithelial cells persisted abnormally at the midline of the embryonic palate even on day E16.0, and palatal fusion was delayed in Ceacam1(-/-) mice. TGFβ3 expression, apoptosis, and cell proliferation in palatal epithelium were not affected in the palate of Ceacam1(-/-)mice. However, CEACAM1 expression was retained in the remaining MEE of TGFβ-deficient mice. These results suggest that CEACAM1 has roles in the initiation of palatal fusion via epithelial cell adhesion.

Novel promoters and coding first exons in DLG2 linked to developmental disorders and intellectual disability.

PubMed

Reggiani, Claudio; Coppens, Sandra; Sekhara, Tayeb; Dimov, Ivan; Pichon, Bruno; Lufin, Nicolas; Addor, Marie-Claude; Belligni, Elga Fabia; Digilio, Maria Cristina; Faletra, Flavio; Ferrero, Giovanni Battista; Gerard, Marion; Isidor, Bertrand; Joss, Shelagh; Niel-Bütschi, Florence; Perrone, Maria Dolores; Petit, Florence; Renieri, Alessandra; Romana, Serge; Topa, Alexandra; Vermeesch, Joris Robert; Lenaerts, Tom; Casimir, Georges; Abramowicz, Marc; Bontempi, Gianluca; Vilain, Catheline; Deconinck, Nicolas; Smits, Guillaume

2017-07-19

Tissue-specific integrative omics has the potential to reveal new genic elements important for developmental disorders. Two pediatric patients with global developmental delay and intellectual disability phenotype underwent array-CGH genetic testing, both showing a partial deletion of the DLG2 gene. From independent human and murine omics datasets, we combined copy number variations, histone modifications, developmental tissue-specific regulation, and protein data to explore the molecular mechanism at play. Integrating genomics, transcriptomics, and epigenomics data, we describe two novel DLG2 promoters and coding first exons expressed in human fetal brain. Their murine conservation and protein-level evidence allowed us to produce new DLG2 gene models for human and mouse. These new genic elements are deleted in 90% of 29 patients (public and in-house) showing partial deletion of the DLG2 gene. The patients' clinical characteristics expand the neurodevelopmental phenotypic spectrum linked to DLG2 gene disruption to cognitive and behavioral categories. While protein-coding genes are regarded as well known, our work shows that integration of multiple omics datasets can unveil novel coding elements. From a clinical perspective, our work demonstrates that two new DLG2 promoters and exons are crucial for the neurodevelopmental phenotypes associated with this gene. In addition, our work brings evidence for the lack of cross-annotation in human versus mouse reference genomes and nucleotide versus protein databases.

Information Propagation in Developmental Enhancers

NASA Astrophysics Data System (ADS)

Jena, Siddhartha; Levine, Michael

Rather than encoding information about protein sequence, certain lengths of noncoding DNA, called enhancers, interact with protein machinery such as transcription factors to precisely regulate gene expression. Enhancers have been studied extensively in the fruit fly Drosophila melanogaster, where they regulate the expression of developmental genes that establish the blueprint of the adult fly. It has been suggested that enhancer sequences possess a specific but unknown syntax with regards to the placement and strength of transcription factor binding sites. Moreover, studies in divergent fly species have shown that compensatory evolution allows for maintenance of enhancer functionality despite considerable variation in primary DNA sequence. Here, the possible role of enhancers as signal processing modules is studied as a way of explaining these two findings. We first demonstrate how this framework can be used to explain the fine-tuned spatiotemporal dynamics of gene expression. We then explore the evolutionary pressure on enhancer sequences and the resulting emergence of enhancers that are linked by compensatory mutations. This study provides a possible mechanism for the function of multiple enhancers linked to a single gene.

Transcriptomic Analysis of Flower Blooming in Jasminum sambac through De Novo RNA Sequencing.

PubMed

Li, Yong-Hua; Zhang, Wei; Li, Yong

2015-06-10

Flower blooming is a critical and complicated plant developmental process in flowering plants. However, insufficient information is available about the complex network that regulates flower blooming in Jasminum sambac. In this study, we used the RNA-Seq platform to analyze the molecular regulation of flower blooming in J. sambac by comparing the transcript profiles at two flower developmental stages: budding and blooming. A total of 4577 differentially-expressed genes (DEGs) were identified between the two floral stages. The Gene Ontology and the Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses revealed that the DEGs in the "oxidation-reduction process", "extracellular region", "steroid biosynthesis", "glycosphingolipid biosynthesis", "plant hormone signal transduction" and "pentose and glucuronate interconversions" might be associated with flower development. A total of 103 and 92 unigenes exhibited sequence similarities to the known flower development and floral scent genes from other plants. Among these unigenes, five flower development and 19 floral scent unigenes exhibited at least four-fold differences in expression between the two stages. Our results provide abundant genetic resources for studying the flower blooming mechanisms and molecular breeding of J. sambac.

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

An Arabidopsis gene regulatory network for secondary cell wall synthesis

DOE PAGES

Taylor-Teeples, M.; Lin, L.; de Lucas, M.; ...

2014-12-24

The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. In this paper, we present a protein–DNA network between Arabidopsis thaliana transcription factors and secondary cell wall metabolic genes with gene expression regulated bymore » a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. Finally, these interactions will serve as a foundation for understanding the regulation of a complex, integral plant component.« less

Tbx16 regulates hox gene activation in mesodermal progenitor cells

PubMed Central

Payumo, Alexander Y.; McQuade, Lindsey E.; Walker, Whitney J.; Yamazoe, Sayumi; Chen, James K.

2016-01-01

The transcription factor T-box 16 (Tbx16/Spadetail) is an essential regulator of paraxial mesoderm development in zebrafish (Danio rerio). Mesodermal progenitor cells (MPCs) fail to differentiate into trunk somites in tbx16 mutants and instead accumulate within the tailbud in an immature state. The mechanisms by which Tbx16 controls mesoderm patterning have remained enigmatic, and we describe here the application of photoactivatable morpholino oligonucleotides to determine the Tbx16 transcriptome in MPCs. We identify 124 Tbx16-regulated genes that are expressed in zebrafish gastrulae, including several developmental signaling proteins and regulators of gastrulation, myogenesis, and somitogenesis. Unexpectedly, we observe that loss of Tbx16 function precociously activates posterior hox genes in MPCs, and overexpression of a single posterior hox gene is sufficient to disrupt MPC migration. Our studies support a model in which Tbx16 regulates the timing of collinear hox gene activation to coordinate the anterior-posterior fates and positions of paraxial MPCs. PMID:27376691

Landscape of histone modifications in a sponge reveals the origin of animal cis-regulatory complexity

PubMed Central

Gaiti, Federico; Jindrich, Katia; Fernandez-Valverde, Selene L; Roper, Kathrein E; Degnan, Bernard M; Tanurdžić, Miloš

2017-01-01

Combinatorial patterns of histone modifications regulate developmental and cell type-specific gene expression and underpin animal complexity, but it is unclear when this regulatory system evolved. By analysing histone modifications in a morphologically-simple, early branching animal, the sponge Amphimedonqueenslandica, we show that the regulatory landscape used by complex bilaterians was already in place at the dawn of animal multicellularity. This includes distal enhancers, repressive chromatin and transcriptional units marked by H3K4me3 that vary with levels of developmental regulation. Strikingly, Amphimedon enhancers are enriched in metazoan-specific microsyntenic units, suggesting that their genomic location is extremely ancient and likely to place constraints on the evolution of surrounding genes. These results suggest that the regulatory foundation for spatiotemporal gene expression evolved prior to the divergence of sponges and eumetazoans, and was necessary for the evolution of animal multicellularity. DOI: http://dx.doi.org/10.7554/eLife.22194.001 PMID:28395144

Developmental Toxicity of Zinc Oxide Nanoparticles to Zebrafish (Danio rerio): A Transcriptomic Analysis

PubMed Central

Choi, Jin Soo; Kim, Ryeo-Ok; Yoon, Seokjoo

2016-01-01

Zinc oxide nanoparticles (ZnO NPs) are being utilized in an increasing number of fields and commercial applications. While their general toxicity and associated oxidative stress have been extensively studied, the toxicological pathways that they induce in developmental stages are still largely unknown. In this study, the developmental toxicity of ZnO NPs to embryonic/larval zebrafish was investigated. The transcriptional expression profiles induced by ZnO NPs were also investigated to ascertain novel genomic responses related to their specific toxicity pathway. Zebrafish embryos were exposed to 0.01, 0.1, 1, and 10 mg/L ZnO NPs for 96 h post-fertilization. The toxicity of ZnO NPs, based on their Zn concentration, was quite similar to that in embryonic/larval zebrafish exposed to corresponding ZnSO4 concentrations. Pericardial edema and yolk-sac edema were the principal malformations induced by ZnO NPs. Gene-expression profiling using microarrays demonstrated 689 genes that were differentially regulated (fold change >1.5) following exposure to ZnO NPs (498 upregulated, 191 downregulated). Several genes that were differentially regulated following ZnO NP exposure shared similar biological pathways with those observed with ZnSO4 exposure, but six genes (aicda, cyb5d1, edar, intl2, ogfrl2 and tnfsf13b) associated with inflammation and the immune system responded specifically to ZnO NPs (either in the opposite direction or were unchanged in ZnSO4 exposure). Real-time reverse-transcription quantitative polymerase chain reaction confirmed that the responses of these genes to ZnO NPs were significantly different from their response to ZnSO4 exposure. ZnO NPs may affect genes related to inflammation and the immune system, resulting in yolk-sac edema and pericardia edema in embryonic/larval developmental stages. These results will assist in elucidating the mechanisms of toxicity of ZnO NPs during development of zebrafish. PMID:27504894

Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2

NASA Technical Reports Server (NTRS)

Johnson, K. A.; Sistrunk, M. L.; Polisensky, D. H.; Braam, J.; McIntire, L. V. (Principal Investigator)

1998-01-01

Plants exposed to repetitive touch or wind are generally shorter and stockier than sheltered plants. These mechanostimulus-induced developmental changes are termed thigmomorphogenesis and may confer resistance to subsequent stresses. An early response of Arabidopsis thaliana to touch or wind is the up-regulation of TCH (touch) gene expression. The signal transduction pathway that leads to mechanostimulus responses is not well defined. A role for ethylene has been proposed based on the observation that mechanostimulation of plants leads to ethylene evolution and exogenous ethylene leads to thigmomorphogenetic-like changes. To determine whether ethylene has a role in plant responses to mechanostimulation, we assessed the ability of two ethylene-insensitive mutants, etr1-3 and ein2-1, to undergo thigmomorphogenesis and TCH gene up-regulation of expression. The ethylene-insensitive mutants responded to wind similarly to the wild type, with a delay in flowering, decrease in inflorescence elongation rate, shorter mature primary inflorescences, more rosette paraclades, and appropriate TCH gene expression changes. Also, wild-type and mutant Arabidopsis responded to vibrational stimulation, with an increase in hypocotyl elongation and up-regulation of TCH gene expression. We conclude that the ETR1 and EIN2 protein functions are not required for the developmental and molecular responses to mechanical stimulation.

Gangliosides in the Nervous System: Biosynthesis and Degradation

NASA Astrophysics Data System (ADS)

Yu, Robert K.; Ariga, Toshio; Yanagisawa, Makoto; Zeng, Guichao

Gangliosides, abundant in the nervous system, are known to play crucial modulatory roles in cellular recognition, interaction, adhesion, and signal transduction, particularly during early developmental stages. The expression of gangliosides in the nervous system is developmentally regulated and is closely related to the differentiation state of the cell. Ganglioside biosynthesis occurs in intracellular organelles, from which gangliosides are transported to the plasma membrane. During brain development, the ganglioside composition of the nervous system undergoes remarkable changes and is strictly regulated by the activities of glycosyltransferases, which can occur at different levels of control, including glycosyltransferase gene transcription and posttranslational modification. Genes for glycosyltransferase involved in ganglioside biosynthesis have been cloned and classified into families of glycosyltransferases based on their amino acid sequence similarities. The donor and acceptor substrate specificities are determined by enzymatic analysis of the glycosyltransferase gene products. Cell-type specific regulation of these genes has also been studied. Gangliosides are degraded by lysosomal exoglycosidases. The action of these enzymes occurs frequently in cooperation with activator proteins. Several human diseases are caused by defects of degradative enzymes, resulting in massive accumulation of certain glycolipids, including gangliosides in the lysosomal compartment and other organelles in the brain and visceral organs. Some of the representative lysosomal storage diseases (LSDs) caused by the accumulation of lipids in late endosomes and lysosomes will be discussed.

Variants of the Xenopus laevis ribosomal transcription factor xUBF are developmentally regulated by differential splicing.

PubMed

Guimond, A; Moss, T

1992-07-11

XUBF is a Xenopus ribosomal transcription factor of the HMG-box family which contains five tandemly disposed homologies to the HMG1 & 2 DNA binding domains. XUBF has been isolated as a protein doublet and two cDNAs encoding the two molecular weight variants have been characterised. The major two forms of xUBF identified differ by the presence or absence of a 22 amino acid segment lying between HMG-boxes 3 and 4. Here we show that the mRNAs for these two forms of xUBF are regulated during development and differentiation over a range of nearly 20 fold. By isolating two of the xUBF genes, it was possible to show that both encoded the variable 22 amino acid segment in exon 12. Oocyte splicing assays and the sequencing of PCR-generated cDNA fragments, demonstrated that the transcripts from one of these genes were differentially spliced in a developmentally regulated manner. Transcripts from the second gene were found to be predominantly or exclusively spliced to produce the lower molecular weight form of xUBF. Expression of a high molecular weight form from yet a third gene was also detected. Although the intron-exon structures of the Xenopus and mouse UBF genes were found to be essentially identical, the differential splicing of exon 8 found in mammals, was not detected in Xenopus.

DNA methylation in schizophrenia in different patient-derived cell types.

PubMed

Vitale, Alejandra M; Matigian, Nicholas A; Cristino, Alexandre S; Nones, Katia; Ravishankar, Sugandha; Bellette, Bernadette; Fan, Yongjun; Wood, Stephen A; Wolvetang, Ernst; Mackay-Sim, Alan

2017-01-01

DNA methylation of gene promoter regions represses transcription and is a mechanism via which environmental risk factors could affect cells during development in individuals at risk for schizophrenia. We investigated DNA methylation in patient-derived cells that might shed light on early development in schizophrenia. Induced pluripotent stem cells may reflect a "ground state" upon which developmental and environmental influences would be minimal. Olfactory neurosphere-derived cells are an adult-derived neuro-ectodermal stem cell modified by developmental and environmental influences. Fibroblasts provide a non-neural control for life-long developmental and environmental influences. Genome-wide profiling of DNA methylation and gene expression was done in these three cell types from the same individuals. All cell types had distinct, statistically significant schizophrenia-associated differences in DNA methylation and linked gene expression, with Gene Ontology analysis showing that the differentially affected genes clustered in networks associated with cell growth, proliferation, and movement, functions known to be affected in schizophrenia patient-derived cells. Only five gene loci were differentially methylated in all three cell types. Understanding the role of epigenetics in cell function in the brain in schizophrenia is likely to be complicated by similar cell type differences in intrinsic and environmentally induced epigenetic regulation.

Serial analysis of gene expression in the silkworm, Bombyx mori.

PubMed

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

PubMed

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

The expression of the Alzheimer’s Amyloid Precursor Protein-like gene is regulated by developmental timing microRNAs and their targets in Caenorhabditis elegans

PubMed Central

Niwa, Ryusuke; Zhou, Feng; Li, Chris; Slack, Frank J.

2008-01-01

Alzheimer’s Disease (AD) is a neurodegenerative disorder characterized by the accumulation of dense plaques in the brain, resulting in progressive dementia. A major plaque component is the β-amyloid peptide, which is a cleavage product of the amyloid precursor protein (APP). Studies of dominant inheritable familial AD support the hypothesis that APP is critical for AD development. On the other hand, the pathogenesis of amyloid plaque deposition in AD is thought to be the result of age-related changes with unknown mechanisms. Here we show that the Caenorhabditis elegans homolog of APP, APP-like-1 (apl-1), functions with and is under the control of molecules regulating developmental progression. In C. elegans, the timing of cell fate determination is controlled by the heterochronic genes, including let-7 microRNAs. C. elegans apl-1 shows significant genetic interactions with let-7 family microRNAs and let-7-targeted heterochronic genes, hbl-1, lin-41 and lin-42. apl-1 expression is upregulated during the last larval stage in hypodermal seam cells which is transcriptionally regulated by hbl-1, lin-41 and lin-42. Moreover, the levels of the apl-1 transcription are modulated by the activity of let-7 family microRNAs. Our works places apl-1 in a developmental timing pathway and may provide new insights into the time-dependent progression of AD. PMID:18262516

Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

PubMed Central

Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

2009-01-01

Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

PubMed

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

PubMed Central

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.

2008-01-01

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

Non-coding RNAs—Novel targets in neurotoxicity

PubMed Central

Tal, Tamara L.; Tanguay, Robert L.

2012-01-01

Over the past ten years non-coding RNAs (ncRNAs) have emerged as pivotal players in fundamental physiological and cellular processes and have been increasingly implicated in cancer, immune disorders, and cardiovascular, neurodegenerative, and metabolic diseases. MicroRNAs (miRNAs) represent a class of ncRNA molecules that function as negative regulators of post-transcriptional gene expression. miRNAs are predicted to regulate 60% of all human protein-coding genes and as such, play key roles in cellular and developmental processes, human health, and disease. Relative to counterparts that lack bindings sites for miRNAs, genes encoding proteins that are post-transcriptionally regulated by miRNAs are twice as likely to be sensitive to environmental chemical exposure. Not surprisingly, miRNAs have been recognized as targets or effectors of nervous system, developmental, hepatic, and carcinogenic toxicants, and have been identified as putative regulators of phase I xenobiotic-metabolizing enzymes. In this review, we give an overview of the types of ncRNAs and highlight their roles in neurodevelopment, neurological disease, activity-dependent signaling, and drug metabolism. We then delve into specific examples that illustrate their importance as mediators, effectors, or adaptive agents of neurotoxicants or neuroactive pharmaceutical compounds. Finally, we identify a number of outstanding questions regarding ncRNAs and neurotoxicity. PMID:22394481

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal mouse tissues.

EPA Science Inventory

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...

The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth

Treesearch

Juan Du; Shawn D. Mansfield; Andrew T. Groover

2009-01-01

The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX...

Wt1 Flip-Flops Chromatin in a CTCF Domain

PubMed Central

Gurudatta, B. V.; Corces, Victor G.

2011-01-01

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. PMID:21920307

Stuxnet Facilitates the Degradation of Polycomb Protein during Development.

PubMed

Du, Juan; Zhang, Junzheng; He, Tao; Li, Yajuan; Su, Ying; Tie, Feng; Liu, Min; Harte, Peter J; Zhu, Alan Jian

2016-06-20

Polycomb-group (PcG) proteins function to ensure correct deployment of developmental programs by epigenetically repressing target gene expression. Despite the importance, few studies have been focused on the regulation of PcG activity itself. Here, we report a Drosophila gene, stuxnet (stx), that controls Pc protein stability. We find that heightened stx activity leads to homeotic transformation, reduced Pc activity, and de-repression of PcG targets. Conversely, stx mutants, which can be rescued by decreased Pc expression, display developmental defects resembling hyperactivation of Pc. Our biochemical analyses provide a mechanistic basis for the interaction between stx and Pc; Stx facilitates Pc degradation in the proteasome, independent of ubiquitin modification. Furthermore, this mode of regulation is conserved in vertebrates. Mouse stx promotes degradation of Cbx4, an orthologous Pc protein, in vertebrate cells and induces homeotic transformation in Drosophila. Our results highlight an evolutionarily conserved mechanism of regulated protein degradation on PcG homeostasis and epigenetic activity. Copyright © 2016 Elsevier Inc. All rights reserved.

An Unbiased Assessment of the Role of Imprinted Genes in an Intergenerational Model of Developmental Programming

PubMed Central

Radford, Elizabeth J.; Isganaitis, Elvira; Jimenez-Chillaron, Josep; Schroeder, Joshua; Molla, Michael; Andrews, Simon; Didier, Nathalie; Charalambous, Marika; McEwen, Kirsten; Marazzi, Giovanna; Sassoon, David; Patti, Mary-Elizabeth; Ferguson-Smith, Anne C.

2012-01-01

Environmental factors during early life are critical for the later metabolic health of the individual and of future progeny. In our obesogenic environment, it is of great socioeconomic importance to investigate the mechanisms that contribute to the risk of metabolic ill health. Imprinted genes, a class of functionally mono-allelic genes critical for early growth and metabolic axis development, have been proposed to be uniquely susceptible to environmental change. Furthermore, it has also been suggested that perturbation of the epigenetic reprogramming of imprinting control regions (ICRs) may play a role in phenotypic heritability following early life insults. Alternatively, the presence of multiple layers of epigenetic regulation may in fact protect imprinted genes from such perturbation. Unbiased investigation of these alternative hypotheses requires assessment of imprinted gene expression in the context of the response of the whole transcriptome to environmental assault. We therefore analyse the role of imprinted genes in multiple tissues in two affected generations of an established murine model of the developmental origins of health and disease using microarrays and quantitative RT–PCR. We demonstrate that, despite the functional mono-allelicism of imprinted genes and their unique mechanisms of epigenetic dosage control, imprinted genes as a class are neither more susceptible nor protected from expression perturbation induced by maternal undernutrition in either the F1 or the F2 generation compared to other genes. Nor do we find any evidence that the epigenetic reprogramming of ICRs in the germline is susceptible to nutritional restriction. However, we propose that those imprinted genes that are affected may play important roles in the foetal response to undernutrition and potentially its long-term sequelae. We suggest that recently described instances of dosage regulation by relaxation of imprinting are rare and likely to be highly regulated. PMID:22511876

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways.

PubMed

Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula

2014-01-20

Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response.

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways

PubMed Central

2014-01-01

Background Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. Results We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. Conclusions This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response. PMID:24443808

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Identification of functional elements and regulatory circuits by Drosophila modENCODE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- andmore » tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions of {approx}40% of the protein and nonprotein-coding genes [FlyBase 5.12 (4)] have been determined from cDNA collections (5, 6), manual curation of gene models (7), gene mutations and comprehensive genome-wide RNA interference screens (8-10), and comparative genomic analyses (11, 12). The Drosophila modENCODE project has generated more than 700 data sets that profile transcripts, histone modifications and physical nucleosome properties, general and specific transcription factors (TFs), and replication programs in cell lines, isolated tissues, and whole organisms across several developmental stages (Fig. 1). Here, we computationally integrate these data sets and report (i) improved and additional genome annotations, including full-length proteincoding genes and peptides as short as 21 amino acids; (ii) noncoding transcripts, including 132 candidate structural RNAs and 1608 nonstructural transcripts; (iii) additional Argonaute (Ago)-associated small RNA genes and pathways, including new microRNAs (miRNAs) encoded within protein-coding exons and endogenous small interfering RNAs (siRNAs) from 3-inch untranslated regions; (iv) chromatin 'states' defined by combinatorial patterns of 18 chromatin marks that are associated with distinct functions and properties; (v) regions of high TF occupancy and replication activity with likely epigenetic regulation; (vi)mixed TF and miRNA regulatory networks with hierarchical structure and enriched feed-forward loops; (vii) coexpression- and co-regulation-based functional annotations for nearly 3000 genes; (viii) stage- and tissue-specific regulators; and (ix) predictive models of gene expression levels and regulator function.« less

Genetical Toxicogenomics in Drosophila Identifies Master Modulatory Loci that are Regulated by Developmental Exposure to Lead

PubMed Central

Ruden, Douglas M.; Chen, Lang; Possidente, Debra; Possidente, Bernard; Rasouli, Parsa; Wang, Luan; Lu, Xiangyi; Garfinkel, Mark D.; Hirsch, Helmut V. B.; Page, Grier P.

2009-01-01

The genetics of gene expression in recombinant inbred lines (RILs) can be mapped as expression quantitative trait loci (eQTLs). So-called “genetical genomics” studies have identified locally-acting eQTLs (cis-eQTLs) for genes that show differences in steady state RNA levels. These studies have also identified distantly-acting master-modulatory trans-eQTLs that regulate tens or hundreds of transcripts (hotspots or transbands). We expand on these studies by performing genetical genomics experiments in two environments in order to identify trans-eQTL that might be regulated by developmental exposure to the neurotoxin lead. Flies from each of 75 RIL were raised from eggs to adults on either control food (made with 250 µM sodium acetate), or lead-treated food (made with 250 µM lead acetate, PbAc). RNA expression analyses of whole adult male flies (5–10 days old) were performed with Affymetrix DrosII whole genome arrays (18,952 probesets). Among the 1,389 genes with cis-eQTL, there were 405 genes unique to control flies and 544 genes unique to lead-treated ones (440 genes had the same cis-eQTLs in both samples). There are 2,396 genes with trans-eQTL which mapped to 12 major transbands with greater than 95 genes. Permutation analyses of the strain labels but not the expression data suggests that the total number of eQTL and the number of transbands are more important criteria for validation than the size of the transband. Two transbands, one located on the 2nd chromosome and one on the 3rd chromosome, co-regulate 33 lead-induced genes, many of which are involved in neurodevelopmental processes. For these 33 genes, rather than allelic variation at one locus exerting differential effects in two environments, we found that variation at two different loci are required for optimal effects on lead-induced expression. PMID:19737576

Nrf2 and Nrf2-related proteins in development and developmental toxicity: Insights from studies in zebrafish (Danio rerio).

PubMed

Hahn, Mark E; Timme-Laragy, Alicia R; Karchner, Sibel I; Stegeman, John J

2015-11-01

Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap'n'collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. Copyright © 2015. Published by Elsevier Inc.

Seq-ing answers: uncovering the unexpected in global gene regulation.

PubMed

Otto, George Maxwell; Brar, Gloria Ann

2018-04-19

The development of techniques for measuring gene expression globally has greatly expanded our understanding of gene regulatory mechanisms in depth and scale. We can now quantify every intermediate and transition in the canonical pathway of gene expression-from DNA to mRNA to protein-genome-wide. Employing such measurements in parallel can produce rich datasets, but extracting the most information requires careful experimental design and analysis. Here, we argue for the value of genome-wide studies that measure multiple outputs of gene expression over many timepoints during the course of a natural developmental process. We discuss our findings from a highly parallel gene expression dataset of meiotic differentiation, and those of others, to illustrate how leveraging these features can provide new and surprising insight into fundamental mechanisms of gene regulation.

Conceptualizing Child Health Disparities: A Role for Developmental Neurogenomics

PubMed Central

Francis, Darlene D.

2010-01-01

Biological, psychological, and social processes interact over a lifetime to influence health and vulnerability to disease. Those interested in studying and understanding how and why racial/ethnic and social disparities emerge need to focus on the intersection of these processes. Recent work exploring molecular epigenetic mechanisms of gene expression (in humans as well and other mammalian systems) has provided evidence demonstrating that the genome is subject to regulation by surrounding contexts (eg, cytoplasmic, cellular, organismic, social). The developing stress axis is exquisitely sensitive to regulation by social forces represented at the level of the epigenome. Old assumptions about an inert genome are simply incorrect. Epigenetic processes may provide the missing link that will allow us to understand how social and political conditions, along with individual subjective experiences, can directly alter gene expression and thereby contribute to observed social inequalities in health. Developmental neurogenomics may provide the direct link between the biological and social/psychological worlds. These biological mechanisms of plasticity (at the level of gene expression and regulation) may play a profound role in how we conceptualize health inequalities by informing our concepts regarding the somatization or embodiment of social inequalities. PMID:19861470

Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development.

PubMed

Phippard, D J; Weber-Hall, S J; Sharpe, P T; Naylor, M S; Jayatalake, H; Maas, R; Woo, I; Roberts-Clark, D; Francis-West, P H; Liu, Y H; Maxson, R; Hill, R E; Dale, T C

1996-09-01

Expression of the Msx-1 and Msx-2 homeobox genes have been shown to be coordinately regulated with the Bmp-2 and Bmp-4 ligands in a variety of developing tissues. Here we report that transcripts from all four genes are developmentally regulated during both foetal and postnatal mammary gland development. The location and time-course of the Bmp and Msx expression point to a role for Msx and Bmp gene products in the control of epithelial-mesenchymal interactions. Expression of Msx-2, but not Msx-1, Bmp-2 or Bmp-4 was decreased following ovariectomy, while expression of the human Msx-2 homologue was regulated by 17beta-oestradiol in the MCF-7 breast cancer cell line. The regulation of Msx-2 expression by oestrogen raises the possibility that hormonal regulation of mammary development is mediated through the control of epithelial-mesenchymal interactions.

Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

PubMed

Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

2005-07-01

Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower.

PubMed

Silva, Catarina S; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

2015-01-01

Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These "developmental control genes" and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction - LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower.

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.

PubMed

Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D

2014-07-21

Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric development may involve re-programming of the transcriptome through small modifications of the developmental genetic network, which may also indicate that response to social interaction involves many genes with individually small transcriptional effect.

Abscisic Acid Synthesis and Response

PubMed Central

Finkelstein, Ruth

2013-01-01

Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

Identification of miRNAs during mouse postnatal ovarian development and superovulation.

PubMed

Khan, Hamid Ali; Zhao, Yi; Wang, Li; Li, Qian; Du, Yu-Ai; Dan, Yi; Huo, Li-Jun

2015-07-08

MicroRNAs are small noncoding RNAs that play critical roles in regulation of gene expression in wide array of tissues including the ovary through sequence complementarity at post-transcriptional level. Tight regulation of multitude of genes involved in ovarian development and folliculogenesis could be regulated at transcription level by these miRNAs. Therefore, tissue specific miRNAs identification is considered a key step towards understanding the role of miRNAs in biological processes. To investigate the role of microRNAs during ovarian development and folliculogenesis we sequenced eight different libraries using Illumina deep sequencing technology. Different developmental stages were selected to explore miRNAs expression pattern at different stages of gonadal maturation with/without treatment of PMSG/hCG for superovulation. From massive sequencing reads, clean reads of 16-26 bp were selected for further analysis of differential expression analysis and novel microRNA annotation. Expression analysis of all miRNAs at different developmental stages showed that some miRNAs were present ubiquitously while others were differentially expressed at different stages. Among differentially expressed miRNAs we reported 61 miRNAs with a fold change of more than 2 at different developmental stages among all libraries. Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 while mmu-mir-150 was down-regulated more than 3 fold. Furthermore, we found 2659 target genes for 20 differentially expressed microRNAs using seven different target predictions programs (DIANA-mT, miRanda, miRDB, miRWalk, RNAhybrid, PICTAR5, TargetScan). Analysis of the predicted targets showed certain ovary specific genes targeted by single or multiple microRNAs. Furthermore, pathway annotation and Gene ontology showed involvement of these microRNAs in basic cellular process. These results suggest the presence of different miRNAs at different stages of ovarian development and superovulation. Potential role of these microRNAs was elucidated using bioinformatics tools in regulation of different pathways, biological functions and cellular components underlying ovarian development and superovulation. These results provide a framework for extended analysis of miRNAs and their roles during ovarian development and superovulation. Furthermore, this study provides a base for characterization of individual miRNAs to discover their role in ovarian development and female fertility.

Genome-wide dynamics of alternative polyadenylation in rice

PubMed Central

Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

2016-01-01

Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

PubMed

Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

2015-06-01

Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Genomic Pangea: coordinate gene regulation and cell-specific chromosomal topologies.

PubMed

Laster, Kyle; Kosak, Steven T

2010-06-01

The eukaryotic nucleus is functionally organized. Gene loci, for example, often reveal altered localization patterns according to their developmental regulation. Whole chromosomes also demonstrate non-random nuclear positions, correlated with inherent characteristics such as gene density or size. Given that hundreds to thousands of genes are coordinately regulated in any given cell type, interest has grown in whether chromosomes may be specifically localized according to gene regulation. A synthesis of the evidence for preferential chromosomal organization suggests that, beyond basic characteristics, chromosomes can assume positions functionally related to gene expression. Moreover, analysis of total chromosome organization during cellular differentiation indicates that unique chromosome topologies, albeit probabilistic, in effect define a cell lineage. Future work with new techniques, including the advanced forms of the chromosome conformation capture (3C), and the development of next-generation whole-genome imaging approaches, will help to refine our view of chromosomal organization. We suggest that genomic organization during cellular differentiation should be viewed as a dynamic process, with gene expression patterns leading to chromosome associations that feed back on themselves, leading to the self-organization of the genome according to coordinate gene regulation. Copyright 2010 Elsevier Ltd. All rights reserved.

Dynamic genome wide expression profiling of Drosophila head development reveals a novel role of Hunchback in retinal glia cell development and blood-brain barrier integrity

PubMed Central

Torres-Oliva, Montserrat; Schneider, Julia; Wiegleb, Gordon

2018-01-01

Drosophila melanogaster head development represents a valuable process to study the developmental control of various organs, such as the antennae, the dorsal ocelli and the compound eyes from a common precursor, the eye-antennal imaginal disc. While the gene regulatory network underlying compound eye development has been extensively studied, the key transcription factors regulating the formation of other head structures from the same imaginal disc are largely unknown. We obtained the developmental transcriptome of the eye-antennal discs covering late patterning processes at the late 2nd larval instar stage to the onset and progression of differentiation at the end of larval development. We revealed the expression profiles of all genes expressed during eye-antennal disc development and we determined temporally co-expressed genes by hierarchical clustering. Since co-expressed genes may be regulated by common transcriptional regulators, we combined our transcriptome dataset with publicly available ChIP-seq data to identify central transcription factors that co-regulate genes during head development. Besides the identification of already known and well-described transcription factors, we show that the transcription factor Hunchback (Hb) regulates a significant number of genes that are expressed during late differentiation stages. We confirm that hb is expressed in two polyploid subperineurial glia cells (carpet cells) and a thorough functional analysis shows that loss of Hb function results in a loss of carpet cells in the eye-antennal disc. Additionally, we provide for the first time functional data indicating that carpet cells are an integral part of the blood-brain barrier. Eventually, we combined our expression data with a de novo Hb motif search to reveal stage specific putative target genes of which we find a significant number indeed expressed in carpet cells. PMID:29360820

Mechanisms of specificity in neuronal activity-regulated gene transcription

PubMed Central

Lyons, Michelle R.; West, Anne E.

2011-01-01

The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.

PubMed

Müller-Molina, Arnoldo J; Schöler, Hans R; Araúzo-Bravo, Marcos J

2012-01-01

To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.

Comprehensive Human Transcription Factor Binding Site Map for Combinatory Binding Motifs Discovery

PubMed Central

Müller-Molina, Arnoldo J.; Schöler, Hans R.; Araúzo-Bravo, Marcos J.

2012-01-01

To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%–20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory “DNA words.” From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%—far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of “DNA words,” newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters. PMID:23209563

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

NASA Astrophysics Data System (ADS)

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-01

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

PubMed

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-17

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Turmeric (Curcuma longa): miRNAs and their regulating targets are involved in development and secondary metabolite pathways.

PubMed

Singh, Noopur; Sharma, Ashok

Turmeric has been used as a therapeutic herb over centuries in traditional medicinal systems due to the presence of several secondary metabolite compounds. microRNAs are known to regulate gene expression at the post-transcriptional level by transcriptional cleavage or translation repression. miRNAs have been demonstrated to play an active role in secondary metabolism regulation. The present work was focused on the identification of the miRNAs involved in the regulation of secondary metabolite and development process of turmeric. Eighteen miRNA families were identified for turmeric. Sixteen miRNA families were observed to regulate 238 target transcripts. LncRNAs targets of the putative miRNA candidates were also predicted. Our results indicated their role in binding, reproduction, stress, and other developmental processes. Gene annotation and pathway analysis illustrated the biological function of the targets regulated by the putative miRNAs. The miRNA-mediated gene regulatory network also revealed co-regulated targets that were regulated by two or more miRNA families. miR156 and miR5015 were observed to be involved in rhizome development. miR5021 showed regulation for terpenoid backbone biosynthesis and isoquinoline alkaloid biosynthesis pathways. The flavonoid biosynthesis pathway was observed to be regulated by miR2919. The analysis revealed the probable involvement of three miRNAs (miR1168.2, miR156b and miR1858) in curcumin biosynthesis. Other miRNAs were found to be involved in the growth and developmental process of turmeric. Phylogenetic analysis of selective miRNAs was also performed. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

PubMed

Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

2018-04-11

The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

Differential expression of genes in fetal brain as a consequence of maternal protein deficiency and nematode infection.

PubMed

Haque, Manjurul; Starr, Lisa M; Koski, Kristine G; Scott, Marilyn E

2018-01-01

Maternal dietary protein deficiency and gastrointestinal nematode infection during early pregnancy have negative impacts on both maternal placental gene expression and fetal growth in the mouse. Here we used next-generation RNA sequencing to test our hypothesis that maternal protein deficiency and/or nematode infection also alter the expression of genes in the developing fetal brain. Outbred pregnant CD1 mice were used in a 2×2 design with two levels of dietary protein (24% versus 6%) and two levels of infection (repeated sham versus Heligmosomoides bakeri beginning at gestation day 5). Pregnant dams were euthanized on gestation day 18 to harvest the whole fetal brain. Four fetal brains from each treatment group were analyzed using RNA Hi-Seq sequencing and the differential expression of genes was determined by the edgeR package using NetworkAnalyst. In response to maternal H. bakeri infection, 96 genes (88 up-regulated and eight down-regulated) were differentially expressed in the fetal brain. Differentially expressed genes were involved in metabolic processes, developmental processes and the immune system according to the PANTHER classification system. Among the important biological functions identified, several up-regulated genes have known neurological functions including neuro-development (Gdf15, Ing4), neural differentiation (miRNA let-7), synaptic plasticity (via suppression of NF-κβ), neuro-inflammation (S100A8, S100A9) and glucose metabolism (Tnnt1, Atf3). However, in response to maternal protein deficiency, brain-specific serine protease (Prss22) was the only up-regulated gene and only one gene (Dynlt1a) responded to the interaction of maternal nematode infection and protein deficiency. In conclusion, maternal exposure to GI nematode infection from day 5 to 18 of pregnancy may influence developmental programming of the fetal brain. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

PubMed Central

Chandra, Govind; Chater, Keith F

2014-01-01

To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

PubMed

Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

2016-02-01

Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Transcriptome analysis on the exoskeleton formation in early developmetal stages and reconstruction scenario in growth-moulting in Litopenaeus vannamei.

PubMed

Gao, Yi; Wei, Jiankai; Yuan, Jianbo; Zhang, Xiaojun; Li, Fuhua; Xiang, Jianhai

2017-04-24

Exoskeleton construction is an important issue in shrimp. To better understand the molecular mechanism of exoskeleton formation, development and reconstruction, the transcriptome of the entire developmental process in Litopenaeus vannamei, including nine early developmental stages and eight adult-moulting stages, was sequenced and analysed using Illumina RNA-seq technology. A total of 117,539 unigenes were obtained, with 41.2% unigenes predicting the full-length coding sequence. Gene Ontology, Clusters of Orthologous Group (COG), the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and functional annotation of all unigenes gave a better understanding of the exoskeleton developmental process in L. vannamei. As a result, more than six hundred unigenes related to exoskeleton development were identified both in the early developmental stages and adult-moulting. A cascade of sequential expression events of exoskeleton-related genes were summarized, including exoskeleton formation, regulation, synthesis, degradation, mineral absorption/reabsorption, calcification and hardening. This new insight on major transcriptional events provide a deep understanding for exoskeleton formation and reconstruction in L. vannamei. In conclusion, this is the first study that characterized the integrated transcriptomic profiles cover the entire exoskeleton development from zygote to adult-moulting in a crustacean, and these findings will serve as significant references for exoskeleton developmental biology and aquaculture research.

Environmental perception and epigenetic memory: mechanistic insight through FLC

PubMed Central

Berry, Scott; Dean, Caroline

2015-01-01

Chromatin plays a central role in orchestrating gene regulation at the transcriptional level. However, our understanding of how chromatin states are altered in response to environmental and developmental cues, and then maintained epigenetically over many cell divisions, remains poor. The floral repressor gene FLOWERING LOCUS C (FLC) in Arabidopsis thaliana is a useful system to address these questions. FLC is transcriptionally repressed during exposure to cold temperatures, allowing studies of how environmental conditions alter expression states at the chromatin level. FLC repression is also epigenetically maintained during subsequent development in warm conditions, so that exposure to cold may be remembered. This memory depends on molecular complexes that are highly conserved among eukaryotes, making FLC not only interesting as a paradigm for understanding biological decision-making in plants, but also an important system for elucidating chromatin-based gene regulation more generally. In this review, we summarize our understanding of how cold temperature induces a switch in the FLC chromatin state, and how this state is epigenetically remembered. We also discuss how the epigenetic state of FLC is reprogrammed in the seed to ensure a requirement for cold exposure in the next generation. Significance Statement FLOWERING LOCUS C (FLC) regulation provides a paradigm for understanding how chromatin can be modulated to determine gene expression in a developmental context. This review describes our current mechanistic understanding of how FLC expression is genetically specified and epigenetically regulated throughout the plant life cycle, and how this determines plant life-history strategy. PMID:25929799

Cerebellum: links between development, developmental disorders and motor learning

PubMed Central

Manto, Mario U.; Jissendi, Patrice

2012-01-01

The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodeling are being unraveled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signaling between granule cells and Purkinje neurons. The expression profile of sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired developments and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders. PMID:22291620

Differential regulation of ParaHox genes by retinoic acid in the invertebrate chordate amphioxus (Branchiostoma floridae).

PubMed

Osborne, Peter W; Benoit, Gérard; Laudet, Vincent; Schubert, Michael; Ferrier, David E K

2009-03-01

The ParaHox cluster is the evolutionary sister to the Hox cluster. Like the Hox cluster, the ParaHox cluster displays spatial and temporal regulation of the component genes along the anterior/posterior axis in a manner that correlates with the gene positions within the cluster (a feature called collinearity). The ParaHox cluster is however a simpler system to study because it is composed of only three genes. We provide a detailed analysis of the amphioxus ParaHox cluster and, for the first time in a single species, examine the regulation of the cluster in response to a single developmental signalling molecule, retinoic acid (RA). Embryos treated with either RA or RA antagonist display altered ParaHox gene expression: AmphiGsx expression shifts in the neural tube, and the endodermal boundary between AmphiXlox and AmphiCdx shifts its anterior/posterior position. We identified several putative retinoic acid response elements and in vitro assays suggest some may participate in RA regulation of the ParaHox genes. By comparison to vertebrate ParaHox gene regulation we explore the evolutionary implications. This work highlights how insights into the regulation and evolution of more complex vertebrate arrangements can be obtained through studies of a simpler, unduplicated amphioxus gene cluster.

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE PAGES

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

2017-06-21

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

The developmental genetics of human hemoglobin.

PubMed

Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

1985-01-01

Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

PubMed

Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

2018-01-01

The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

mir-125a-5p-mediated Regulation of Lfng is Essential for the Avian Segmentation Clock

PubMed Central

Riley, Maurisa F.; Bochter, Matthew S.; Wahi, Kanu; Nuovo, Gerard J.; Cole, Susan E.

2013-01-01

Summary Somites are embryonic precursors of the axial skeleton and skeletal muscles, and establish the segmental vertebrate body plan. Somitogenesis is controlled in part by a segmentation clock that requires oscillatory expression of genes including Lunatic fringe (Lfng). Oscillatory genes must be tightly regulated both at the transcriptional and post-transcriptional levels for proper clock function. Here we demonstrate that microRNA-mediated regulation of Lfng is essential for proper segmentation during chick somitogenesis. We find that mir-125a-5p targets evolutionarily conserved sequences in the Lfng 3′UTR, and that preventing interactions between mir-125a-5p and Lfng transcripts in vivo causes abnormal segmentation and perturbs clock activity. This provides strong evidence that miRNAs function in the post-transcriptional regulation of oscillatory genes in the segmentation clock. Further, this demonstrates that the relatively subtle effects of miRNAs on target genes can have broad effects in developmental situations that have critical requirements for tight post-transcriptional regulation. PMID:23484856

Function and Evolution of DNA Methylation in Nasonia vitripennis

PubMed Central

Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

2013-01-01

The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana

PubMed Central

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H.; Trivedi, Prabodh K.

2016-01-01

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana. PMID:27539368

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

PubMed

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

2016-08-19

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

Developmental Role and Auxin Responsiveness of Class III Homeodomain Leucine Zipper Gene Family Members in Rice1[C][W][OA

PubMed Central

Itoh, Jun-Ichi; Hibara, Ken-Ichiro; Sato, Yutaka; Nagato, Yasuo

2008-01-01

Members of the Class III homeodomain leucine zipper (Class III HD-Zip) gene family are central regulators of crucial aspects of plant development. To better understand the roles of five Class III HD-Zip genes in rice (Oryza sativa) development, we investigated their expression patterns, ectopic expression phenotypes, and auxin responsiveness. Four genes, OSHB1 to OSHB4, were expressed in a localized domain of the shoot apical meristem (SAM), the adaxial cells of leaf primordia, the leaf margins, and the xylem tissue of vascular bundles. In contrast, expression of OSHB5 was observed only in phloem tissue. Plants ectopically expressing microRNA166-resistant versions of the OSHB3 gene exhibited severe defects, including the ectopic production of leaf margins, shoots, and radialized leaves. The treatment of seedlings with auxin quickly induced ectopic OSHB3 expression in the entire region of the SAM, but not in other tissues. Furthermore, this ectopic expression of OSHB3 was correlated with leaf initiation defects. Our findings suggest that rice Class III HD-Zip genes have conserved functions with their homologs in Arabidopsis (Arabidopsis thaliana), but have also acquired specific developmental roles in grasses or monocots. In addition, some Class III HD-Zip genes may regulate the leaf initiation process in the SAM in an auxin-dependent manner. PMID:18567825

Evolution and development of the vertebrate ear

NASA Technical Reports Server (NTRS)

Fritzsch, B.; Beisel, K. W.

2001-01-01

This review outlines major aspects of development and evolution of the ear, specifically addressing issues of cell fate commitment and the emerging molecular governance of these decisions. Available data support the notion of homology of subsets of mechanosensors across phyla (proprioreceptive mechanosensory neurons in insects, hair cells in vertebrates). It is argued that this conservation is primarily related to the specific transducing environment needed to achieve mechanosensation. Achieving this requires highly conserved transcription factors that regulate the expression of the relevant structural genes for mechanosensory transduction. While conserved at the level of some cell fate assignment genes (atonal and its mammalian homologue), the ear has also radically reorganized its development by implementing genes used for cell fate assignment in other parts of the developing nervous systems (e.g., neurogenin 1) and by evolving novel sets of genes specifically associated with the novel formation of sensory neurons that contact hair cells (neurotrophins and their receptors). Numerous genes have been identified that regulate morphogenesis, but there is only one common feature that emerges at the moment: the ear appears to have co-opted genes from a large variety of other parts of the developing body (forebrain, limbs, kidneys) and establishes, in combination with existing transcription factors, an environment in which those genes govern novel, ear-related morphogenetic aspects. The ear thus represents a unique mix of highly conserved developmental elements combined with co-opted and newly evolved developmental elements.

Characterization of the altered gene expression profile in early porcine embryos generated from parthenogenesis and somatic cell chromatin transfer.

PubMed

Zhou, Chi; Dobrinsky, John; Tsoi, Stephen; Foxcroft, George R; Dixon, Walter T; Stothard, Paul; Verstegen, John; Dyck, Michael K

2014-01-01

The in vitro production of early porcine embryos is of particular scientific and economic interest. In general, embryos produced from in vitro Assisted Reproductive Technologies (ART) manipulations, such as somatic cell chromatin transfer (CT) and parthenogenetic activation (PA), are less developmentally competent than in vivo-derived embryos. The mechanisms underlying the deficiencies of embryos generated from PA and CT have not been completely understood. To characterize the altered genes and gene networks in embryos generated from CT and PA, comparative transcriptomic analyses of in vivo (IVV) expanded blastocysts (XB), IVV hatched blastocyst (HB), PA XB, PA HB, and CT HB were performed using a custom microarray platform enriched for genes expressed during early embryonic development. Differential expressions of 1492 and 103 genes were identified in PA and CT HB, respectively, in comparison with IVV HB. The "eIF2 signalling", "mitochondrial dysfunction", "regulation of eIF4 and p70S6K signalling", "protein ubiquitination", and "mTOR signalling" pathways were down-regulated in PA HB. Dysregulation of notch signalling-associated genes were observed in both PA and CT HB. TP53 was predicted to be activated in both PA and CT HB, as 136 and 23 regulation targets of TP53 showed significant differential expression in PA and CT HB, respectively, in comparison with IVV HB. In addition, dysregulations of several critical pluripotency, trophoblast development, and implantation-associated genes (NANOG, GATA2, KRT8, LGMN, and DPP4) were observed in PA HB during the blastocyst hatching process. The critical genes that were observed to be dysregulated in CT and PA embryos could be indicative of underlying developmental deficiencies of embryos produced from these technologies.

A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

PubMed

Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

1991-10-01

Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

PubMed

Eickelberg, Garrett J; Fisher, Alison J

2013-01-01

We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

Methyl jasmonate as a vital substance in plants.

PubMed

Cheong, Jong-Joo; Choi, Yang Do

2003-07-01

The plant floral scent methyl jasmonate (MeJA) has been identified as a vital cellular regulator that mediates diverse developmental processes and defense responses against biotic and abiotic stresses. The pleiotropic effects of MeJA have raised numerous questions about its regulation for biogenesis and mode of action. Characterization of the gene encoding jasmonic acid carboxyl methyltransferase has provided basic information on the role(s) of this phytohormone in gene-activation control and systemic long-distance signaling. Recent approaches using functional genomics and bioinformatics have identified a whole set of MeJA-responsive genes, and provide insights into how plants use volatile signals to withstand diverse and variable environments.

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

Development of functional ectopic compound eyes in scarabaeid beetles by knockdown of orthodenticle.

PubMed

Zattara, Eduardo E; Macagno, Anna L M; Busey, Hannah A; Moczek, Armin P

2017-11-07

Complex traits like limbs, brains, or eyes form through coordinated integration of diverse cell fates across developmental space and time, yet understanding how complexity and integration emerge from uniform, undifferentiated precursor tissues remains limited. Here, we use ectopic eye formation as a paradigm to investigate the emergence and integration of novel complex structures following massive ontogenetic perturbation. We show that down-regulation via RNAi of a single head patterning gene- orthodenticle -induces ectopic structures externally resembling compound eyes at the middorsal adult head of both basal and derived scarabaeid beetle species (Onthophagini and Oniticellini). Scanning electron microscopy documents ommatidial organization of these induced structures, while immunohistochemistry reveals the presence of rudimentary ommatidial lenses, crystalline cones, and associated neural-like tissue within them. Further, RNA-sequencing experiments show that after orthodenticle down-regulation, the transcriptional signature of the middorsal head-the location of ectopic eye induction-converges onto that of regular compound eyes, including up-regulation of several retina-specific genes. Finally, a light-aversion behavioral assay to assess functionality reveals that ectopic compound eyes can rescue the ability to respond to visual stimuli when wild-type eyes are surgically removed. Combined, our results show that knockdown of a single gene is sufficient for the middorsal head to acquire the competence to ectopically generate a functional compound eye-like structure. These findings highlight the buffering capacity of developmental systems, allowing massive genetic perturbations to be channeled toward orderly and functional developmental outcomes, and render ectopic eye formation a widely accessible paradigm to study the evolution of complex systems. Published under the PNAS license.

Association of abnormal morphology and altered gene expression in human preimplantation embryos.

PubMed

Wells, Dagan; Bermúdez, Mercedes G; Steuerwald, Nury; Malter, Henry E; Thornhill, Alan R; Cohen, Jacques

2005-08-01

We set out to characterize the expression of nine genes in human preimplantation embryos and determine whether abnormal morphology is associated with altered gene activity. Reverse transcription and real-time polymerase chain reaction were used to quantify the expression of multiple genes in each embryo. The genes studied have various important cellular roles (e.g., cell cycle regulation, DNA repair, and apoptosis). Research laboratory working closely with a clinical IVF practice. Over 50 embryos were donated by infertile patients (various etiologies). Among these, all major stages of preimplantation development and a variety of common morphologic abnormalities were represented. None. Quantification of mRNA transcripts. We detected an association between certain forms of abnormal morphology and disturbances of gene activity. Cellular fragmentation was associated with altered expression of several genes, including TP53, suggesting that fragmenting blastomeres are suffering stress of a type monitored by p53, possibly as a consequence of suboptimal culture conditions. Appropriate gene expression is vital for the regulation of metabolic pathways and key developmental events. Our data indicates a possible causal relationship between changes in gene expression and the formation of clinically relevant abnormal embryo morphologies. We hypothesize that embryos with expression profiles characteristic of good morphology and appropriate for their developmental stage have the greatest potential for implantation. If confirmed, this could lead to a new generation of preimplantation genetic diagnosis (PGD) tests for assessing embryo viability and predicting implantation potential.

Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca

PubMed Central

Wei, Wei; Hu, Yang; Cui, Meng-Yuan; Han, Yong-Tao; Gao, Kuan; Feng, Jia-Yue

2016-01-01

Plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS (TCP) transcription factors play versatile functions in multiple processes of plant growth and development. However, no systematic study has been performed in strawberry. In this study, 19 FvTCP genes were identified in the diploid woodland strawberry (Fragaria vesca) accession Heilongjiang-3. Phylogenetic analysis suggested that the FvTCP genes were classified into two main classes, with the second class further divided into two subclasses, which was supported by the exon-intron organizations and the conserved motif structures. Promoter analysis revealed various cis-acting elements related to growth and development, hormone and/or stress responses. We analyzed FvTCP gene transcript accumulation patterns in different tissues and fruit developmental stages. Among them, 12 FvTCP genes exhibited distinct tissue-specific transcript accumulation patterns. Eleven FvTCP genes were down-regulated in different fruit developmental stages, while five FvTCP genes were up-regulated. Transcripts of FvTCP genes also varied with different subcultural propagation periods and were induced by hormone treatments and biotic and abiotic stresses. Subcellular localization analysis showed that six FvTCP-GFP fusion proteins showed distinct localizations in Arabidopsis mesophyll protoplasts. Notably, transient over-expression of FvTCP9 in strawberry fruits dramatically affected the expression of a series of genes implicated in fruit development and ripening. Taken together, the present study may provide the basis for functional studies to reveal the role of this gene family in strawberry growth and development. PMID:28066489

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

PubMed Central

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

Polycomb group protein bodybuilding: working out the routines.

PubMed

Sievers, Cem; Paro, Renato

2013-09-30

Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

Developmental expression and estrogen responses of endocrine genes in juvenile yellow perch (Perca flavescens)

USDA-ARS?s Scientific Manuscript database

The present study examines the expression of growth-regulating genes (gh, prl, smtl and igf1b), the estrogen receptors (esr1 and esr2a) and aromatase (cyp19a1a) in developing yellow perch. To gain an initial understanding into the endocrine control of growth preceding and involved with sexual size d...

Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni

PubMed Central

Isokpehi, Raphael D.; Mahmud, Ousman; Mbah, Andreas N.; Simmons, Shaneka S.; Avelar, Lívia; Rajnarayanan, Rajendram V.; Udensi, Udensi K.; Ayensu, Wellington K.; Cohly, Hari H.; Brown, Shyretha D.; Dates, Centdrika R.; Hentz, Sonya D.; Hughes, Shawntae J.; Smith-McInnis, Dominique R.; Patterson, Carvey O.; Sims, Jennifer N.; Turner, Kelisha T.; Williams, Baraka S.; Johnson, Matilda O.; Adubi, Taiwo; Mbuh, Judith V.; Anumudu, Chiaka I.; Adeoye, Grace O.; Thomas, Bolaji N.; Nashiru, Oyekanmi; Oliveira, Guilherme

2011-01-01

The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the formation of a network of researchers to understand the function and regulation of the universal stress proteins encoded in genomes of schistosomes and their snail intermediate hosts. PMID:22084571

Fibroblast growth factor receptors: multifactorial-contributors to tumor initiation and progression.

PubMed

Feng, Shachuan; Zhou, Li; Nice, Edouard Collins; Huang, Canhua

2015-01-01

Fibroblast growth factor receptors (FGFRs), encoded by four genes (FGFR1, FGFR2, FGFR3, and FGFR4) are tightly associated with many biological processes such as organ development, cell proliferation and migration. Studies over the past decades have validated the pivotal roles FGFRs play in tumorigenesis due to the regulation of diverse tumorigenesis-related processes, including cell survival, proliferation, inflammation, metastasis and angiogenesis. Interestingly, FGFR mutations in somatic cells leading to tumorigenesis and those in germ cells leading to developmental disorders are identical, suggesting that FGFR mutations result in different diseases due to their spatio-temporal expression. Thus, discoveries in developmental biology may also be applicable to cancer. FGFRs regulate the expression and/or the activity of a myriad of molecules (e.g. matrix metalloproteinases (MMPs) and Snail) that are tightly linked to tumorigenesis by four main signaling pathways (RAS-MAPK, PI3K-AKT, PLCγ-PIP2, and STAT), as well as other minor branches. Epigenetic and genetic alteration of FGFR genes, including DNA methylation, histone remodeling, microRNA regulation, single nucleotide polymorphisms (SNPs), gene missense mutations, amplification, and fusion of FGFRs with other genes, which result in gain or loss of FGFR function, have been identified in many types of cancer. In this review, we focus in particular on recent advances in the relationship between FGFR disorders and tumorigenesis.

Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

PubMed Central

Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

2014-01-01

The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

Genome-Wide Analysis Reveals Novel Regulators of Growth in Drosophila melanogaster

PubMed Central

Vonesch, Sibylle Chantal; Lamparter, David; Mackay, Trudy F. C.; Bergmann, Sven; Hafen, Ernst

2016-01-01

Organismal size depends on the interplay between genetic and environmental factors. Genome-wide association (GWA) analyses in humans have implied many genes in the control of height but suffer from the inability to control the environment. Genetic analyses in Drosophila have identified conserved signaling pathways controlling size; however, how these pathways control phenotypic diversity is unclear. We performed GWA of size traits using the Drosophila Genetic Reference Panel of inbred, sequenced lines. We find that the top associated variants differ between traits and sexes; do not map to canonical growth pathway genes, but can be linked to these by epistasis analysis; and are enriched for genes and putative enhancers. Performing GWA on well-studied developmental traits under controlled conditions expands our understanding of developmental processes underlying phenotypic diversity. PMID:26751788

Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

PubMed Central

van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

1999-01-01

The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride

PubMed Central

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E.; Staege, Martin S.; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS. PMID:29515560

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

PubMed

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

The AtRbx1 protein is part of plant SCF complexes, and its down-regulation causes severe growth and developmental defects.

PubMed

Lechner, Esther; Xie, Daoxin; Grava, Sandrine; Pigaglio, Emmanuelle; Planchais, Severine; Murray, James A H; Parmentier, Yves; Mutterer, Jerome; Dubreucq, Bertrand; Shen, Wen-Hui; Genschik, Pascal

2002-12-20

Recently in yeast and animal cells, one particular class of ubiquitin ligase (E3), called the SCF, was demonstrated to regulate diverse processes including cell cycle and development. In plants SCF-dependent proteolysis is also involved in different developmental and hormonal regulations. To further investigate the function of SCF, we characterized at the molecular level the Arabidopsis RING-H2 finger protein AtRbx1. We demonstrated that the plant gene is able to functionally complement a yeast knockout mutant strain and showed that AtRbx1 protein interacts physically with at least two members of the Arabidopsis cullin family (AtCul1 and AtCul4). AtRbx1 also associates with AtCul1 and the Arabidopsis SKP1-related proteins in planta, indicating that it is part of plant SCF complexes. AtRbx1 mRNAs accumulate in various tissues of the plant, but at higher levels in tissues containing actively dividing cells. Finally to study the function of the gene in planta, we either overexpressed AtRbx1 or reduced its expression by a dsRNA strategy. Down-regulation of AtRbx1 impaired seedling growth and development, indicating that the gene is essential in plants. Furthermore, the AtRbx1-silenced plants showed a reduced level of AtCul1 protein, but accumulated higher level of cyclin D3.

Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

PubMed

Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

2012-07-10

A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b, involved in the regulation of GHR. SOCS3 plays a critical role in regulating skeletal muscle growth and fat deposition via let-7b-mediated GHR expression.

Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens

PubMed Central

2012-01-01

Background A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. Results At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3′ untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. Conclusions There is a critical miRNA, let-7b, involved in the regulation of GHR. SOCS3 plays a critical role in regulating skeletal muscle growth and fat deposition via let-7b-mediated GHR expression. PMID:22781587

A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

PubMed Central

Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

PubMed

Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation

PubMed Central

Ravens, Sarina; Fournier, Marjorie; Ye, Tao; Stierle, Matthieu; Dembele, Doulaye; Chavant, Virginie; Tora, Làszlò

2014-01-01

The histone acetyltransferase (HAT) Mof is essential for mouse embryonic stem cell (mESC) pluripotency and early development. Mof is the enzymatic subunit of two different HAT complexes, MSL and NSL. The individual contribution of MSL and NSL to transcription regulation in mESCs is not well understood. Our genome-wide analysis show that i) MSL and NSL bind to specific and common sets of expressed genes, ii) NSL binds exclusively at promoters, iii) while MSL binds in gene bodies. Nsl1 regulates proliferation and cellular homeostasis of mESCs. MSL is the main HAT acetylating H4K16 in mESCs, is enriched at many mESC-specific and bivalent genes. MSL is important to keep a subset of bivalent genes silent in mESCs, while developmental genes require MSL for expression during differentiation. Thus, NSL and MSL HAT complexes differentially regulate specific sets of expressed genes in mESCs and during differentiation. DOI: http://dx.doi.org/10.7554/eLife.02104.001 PMID:24898753

Mobile microRNAs hit the target.

PubMed

Gursanscky, Nial R; Searle, Iain R; Carroll, Bernard J

2011-11-01

MicroRNAs (miRNAs) are negative regulators of gene expression in eukaryotic organisms, whereas small interfering RNAs (siRNAs) guide host-cell defence against viruses, transposons and transgenes. A key issue in plant biology is whether miRNAs act only in cells in which they are formed, or if, like siRNAs, they also function after passive diffusion or active transportation into other cells. Recent reports show that miRNAs are indeed able to move between plant cells to direct developmental programming of gene expression. In both leaf and root development, miRNAs establish intercellular gradients of gene expression that are essential for cell and tissue differentiation. Gradients in gene expression also play crucial roles in animal development, and there is strong evidence for intercellular movement of miRNAs in animals. Thus, intercellular movement of miRNAs may be crucial to animal developmental biology as well as plants. © 2011 John Wiley & Sons A/S.

Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

PubMed Central

2011-01-01

Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes involved in extracellular matrix regulation, cell death/apoptosis, and calcium signaling/muscle function, as well as genes with miscellaneous function was confirmed by qPCR. Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of their protein products. PMID:21385442

Wt1 flip-flops chromatin in a CTCF domain.

PubMed

Gurudatta, B V; Corces, Victor G

2011-09-13

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of a NAC transcription factor, EPHEMERAL1, that controls petal senescence in Japanese morning glory.

PubMed

Shibuya, Kenichi; Shimizu, Keiichi; Niki, Tomoko; Ichimura, Kazuo

2014-09-01

In flowering plants, floral longevity is species-specific and is closely linked to reproductive strategy; petal senescence, a type of programmed cell death (PCD), is a highly regulated developmental process. However, little is known about regulatory pathways for cell death in petal senescence, which is developmentally controlled in an age-dependent manner. Here, we show that a NAC transcription factor, designated EPHEMERAL1 (EPH1), positively regulates PCD during petal senescence in the ephemeral flowers of Japanese morning glory (Ipomoea nil). EPH1 expression is induced independently of ethylene signaling, and suppression of EPH1 resulted in Japanese morning glory flowers that are in bloom until the second day. The suppressed expression of EPH1 delays progression of PCD, possibly through suppression of the expression of PCD-related genes, including genes for plant caspase and autophagy in the petals. Our data further suggest that EPH1 is involved in the regulation of ethylene-accelerated petal senescence. In this study, we identified a key regulator of PCD in petal senescence, which will facilitate further elucidation of the regulatory network of petal senescence. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

A hitchhiker's guide to the MADS world of plants.

PubMed

Gramzow, Lydia; Theissen, Guenter

2010-01-01

Plant life critically depends on the function of MADS-box genes encoding MADS-domain transcription factors, which are present to a limited extent in nearly all major eukaryotic groups, but constitute a large gene family in land plants. There are two types of MADS-box genes, termed type I and type II, and in plants these groups are distinguished by exon-intron and domain structure, rates of evolution, developmental function and degree of functional redundancy. The type I genes are further subdivided into three groups - M alpha, M beta and M gamma - while the type II genes are subdivided into the MIKCC and MIKC* groups. The functional diversification of MIKCC genes is closely linked to the origin of developmental and morphological novelties in the sporophytic (usually diploid) generation of seed plants, most spectacularly the floral organs and fruits of angiosperms. Functional studies suggest different specializations for the different classes of genes; whereas type I genes may preferentially contribute to female gametophyte, embryo and seed development and MIKC*-group genes to male gametophyte development, the MIKCC-group genes became essential for diverse aspects of sporophyte development. Beyond the usual transcriptional regulation, including feedback and feed-forward loops, various specialized mechanisms have evolved to control the expression of MADS-box genes, such as epigenetic control and regulation by small RNAs. In future, more data from genome projects and reverse genetic studies will allow us to understand the birth, functional diversification and death of members of this dynamic and important family of transcription factors in much more detail.

Transcriptional regulation of mammalian selenoprotein expression

PubMed Central

Stoytcheva, Zoia R.; Berry, Marla J.

2009-01-01

Background Selenoproteins contain the twenty-first amino acid, selenocysteine, and are involved in cellular defenses against oxidative damage, important metabolic and developmental pathways, and responses to environmental challenges. Elucidating the mechanisms regulating selenoprotein expression at the transcriptional level is key to understanding how these mechanisms are called into play to respond to the changing environment. Methods This review summarizes published studies on transcriptional regulation of selenoprotein genes, focused primarily on genes whose encoded protein functions are at least partially understood. This is followed by in silico analysis of predicted regulatory elements in selenoprotein genes, including those in the aforementioned category as well as the genes whose functions are not known. Results Our findings reveal regulatory pathways common to many selenoprotein genes, including several involved in stress-responses. In addition, tissue-specific regulatory factors are implicated in regulating many selenoprotein genes. Conclusions These studies provide new insights into how selenoprotein genes respond to environmental and other challenges, and the roles these proteins play in allowing cells to adapt to these changes. General Significance Elucidating the regulatory mechanisms affecting selenoprotein expression is essential for understanding their roles in human diseases, and for developing diagnostic and potential therapeutic approaches to address dysregulation of members of this gene family. PMID:19465084

The phenotype of the CRINKLY4 deletion mutant of Physcomitrella patens suggests a broad role in developmental regulation in early land plants.

PubMed

Demko, Viktor; Ako, Eugene; Perroud, Pierre-François; Quatrano, Ralph; Olsen, Odd-Arne

2016-07-01

Deletion of the ancestral gene of the land plant multigene family of receptor like kinase CR4 in Physcomitrella patens demonstrates involvement in developmental control of gametophytic and sporophytic organs. The CRINKLY4 (CR4) family of receptor kinases in angiosperms consists of three clades, one including CR4, the CR4-related CCR1 and CCR2, a second including CCR3 and CCR4 family members, and a third and more distant clade. In addition to crinkly leaves in maize, which gave rise to the mutant gene name, CR4 is implicated in ovule, embryo, flower and root development in Arabidopsis thaliana. In root tips of the same species the module including a CLAVATA3/ESR-related protein, an Arabidopsis CR4, a CLAVATA1 and a WUSCHEL-related homeobox 5 (CLE40-ACR4-CLV1-WOX5) is implicated in meristem cell regulation. In embryos and shoots, CR4 acts together with A. thaliana MERISTEM LAYER 1 and PROTODERMAL FACTOR 2 to promote A. thaliana epidermis differentiation. Phylogenetic analysis has demonstrated that early land plants, e.g. mosses carry a single ancestral CR4 gene, together with genes encoding the other members of the CLE40-ACR4-CLV1-WOX5 signaling module. Here we show that CR4 serves as a broad regulator of morphogenesis both in gametophyte phyllids, archegonia and in sporophyte epidermis of the moss Physcomitrella patens. The phenotype of the CR4 deletion mutant in moss provides insight into the role of the ancestral CR4 gene as a regulator of development in early land plants.

Exposure to butachlor causes thyroid endocrine disruption and promotion of metamorphosis in Xenopus laevis.

PubMed

Li, Shuying; Li, Meng; Wang, Qiangwei; Gui, Wenjun; Zhu, Guonian

2016-06-01

Butachlor is extensively applied in rice paddy ecosystem in china, and has been widespread contaminant in the aquatic environment. Here, Xenopus laevis was used for the evaluation of teratogenesis developmental toxicity, and disruption of thyroid system when exposure to different concentrations of butachlor by window phase exposure. Acute toxicity investigation shown that 96 h-LC50 value of butachlor was 1.424 mg L(-1) and 0.962 mg L(-1) for tadpoles (starting from stages 46/47) and embryos (starting from stages 8/9), respectively. Exposure to butachlor caused malformation, including abnormal eye, pericardial edema, enlarged proctodaeum and bent tail. Window phase exposure test indicated that butachlor significantly promote the contents of whole-body thyroid hormones (THs, T3 and T4) at higher levels, indicating thyroid endocrine disruption. At 7 days, exposure to butachlor up-regulated the mRNA expression of genes involved in THs synthesis and metabolism (tshα, tg, tpo and dio1) and THs receptors (trα and trβ). At 14 days, up-regulation of the mRNA expression of genes related to THs synthesis and metabolism (tshα, tshβ, tg, tpo, dio1, dio2 and ttr) and THs receptors (trβ) were also observed after the exposure to butachlor. At 21 days, butachlor up-regulated the mRNA expression of tshα, tg, tpo genes and down-regulated the mRNA expression of tshβ, tg, dio1, ttr and trα genes. These results showed that butachlor could change the mRNA expression of genes involved in the HPT axis and increase whole-body thyroid hormones levels of X. laevis tadpoles in a dose- and time-dependent manner, causing thyroid endocrine disruption and developmental toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

The genetics of fat distribution.

PubMed

Schleinitz, Dorit; Böttcher, Yvonne; Blüher, Matthias; Kovacs, Peter

2014-07-01

Fat stored in visceral depots makes obese individuals more prone to complications than subcutaneous fat. There is good evidence that body fat distribution (FD) is controlled by genetic factors. WHR, a surrogate measure of FD, shows significant heritability of up to ∼60%, even after adjusting for BMI. Genetic variants have been linked to various forms of altered FD such as lipodystrophies; however, the polygenic background of visceral obesity has only been sparsely investigated in the past. Recent genome-wide association studies (GWAS) for measures of FD revealed numerous loci harbouring genes potentially regulating FD. In addition, genes with fat depot-specific expression patterns (in particular subcutaneous vs visceral adipose tissue) provide plausible candidate genes involved in the regulation of FD. Many of these genes are differentially expressed in various fat compartments and correlate with obesity-related traits, thus further supporting their role as potential mediators of metabolic alterations associated with a distinct FD. Finally, developmental genes may at a very early stage determine specific FD in later life. Indeed, genes such as TBX15 not only manifest differential expression in various fat depots, but also correlate with obesity and related traits. Moreover, recent GWAS identified several polymorphisms in developmental genes (including TBX15, HOXC13, RSPO3 and CPEB4) strongly associated with FD. More accurate methods, including cardiometabolic imaging, for assessment of FD are needed to promote our understanding in this field, where the main focus is now to unravel the yet unknown biological function of these novel 'fat distribution genes'.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

The chromatin remodeling factor CHD7 controls cerebellar development by regulating reelin expression

PubMed Central

Whittaker, Danielle E.; Riegman, Kimberley L.H.; Kasah, Sahrunizam; Mohan, Conor; Yu, Tian; Sala, Blanca Pijuan; Hebaishi, Husam; Caruso, Angela; Marques, Ana Claudia; Michetti, Caterina; Smachetti, María Eugenia Sanz; Shah, Apar; Sabbioni, Mara; Kulhanci, Omer; Tee, Wee-Wei; Reinberg, Danny; Scattoni, Maria Luisa; McGonnell, Imelda; Wardle, Fiona C.; Fernandes, Cathy

2017-01-01

The mechanisms underlying the neurodevelopmental deficits associated with CHARGE syndrome, which include cerebellar hypoplasia, developmental delay, coordination problems, and autistic features, have not been identified. CHARGE syndrome has been associated with mutations in the gene encoding the ATP-dependent chromatin remodeler CHD7. CHD7 is expressed in neural stem and progenitor cells, but its role in neurogenesis during brain development remains unknown. Here we have shown that deletion of Chd7 from cerebellar granule cell progenitors (GCps) results in reduced GCp proliferation, cerebellar hypoplasia, developmental delay, and motor deficits in mice. Genome-wide expression profiling revealed downregulated expression of the gene encoding the glycoprotein reelin (Reln) in Chd7-deficient GCps. Recessive RELN mutations have been associated with severe cerebellar hypoplasia in humans. We found molecular and genetic evidence that reductions in Reln expression contribute to GCp proliferative defects and cerebellar hypoplasia in GCp-specific Chd7 mouse mutants. Finally, we showed that CHD7 is necessary for maintaining an open, accessible chromatin state at the Reln locus. Taken together, this study shows that Reln gene expression is regulated by chromatin remodeling, identifies CHD7 as a previously unrecognized upstream regulator of Reln, and provides direct in vivo evidence that a mammalian CHD protein can control brain development by modulating chromatin accessibility in neuronal progenitors. PMID:28165338

Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

PubMed Central

2010-01-01

Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate. Conclusions These results suggest that microarray analysis of chemical-induced spore formation is an excellent system to specifically identify genes necessary for the core sporulation process of a Gram negative model organism for differentiation. PMID:20420673

The genetics of colony form and function in Caribbean Acropora corals.

PubMed

Hemond, Elizabeth M; Kaluziak, Stefan T; Vollmer, Steven V

2014-12-17

Colonial reef-building corals have evolved a broad spectrum of colony morphologies based on coordinated asexual reproduction of polyps on a secreted calcium carbonate skeleton. Though cnidarians have been shown to possess and use similar developmental genes to bilaterians during larval development and polyp formation, little is known about genetic regulation of colony morphology in hard corals. We used RNA-seq to evaluate transcriptomic differences between functionally distinct regions of the coral (apical branch tips and branch bases) in two species of Caribbean Acropora, the staghorn coral, A. cervicornis, and the elkhorn coral, A. palmata. Transcriptome-wide gene profiles differed significantly between different parts of the coral colony as well as between species. Genes showing differential expression between branch tips and bases were involved in developmental signaling pathways, such as Wnt, Notch, and BMP, as well as pH regulation, ion transport, extracellular matrix production and other processes. Differences both within colonies and between species identify a relatively small number of genes that may contribute to the distinct "staghorn" versus "elkhorn" morphologies of these two sister species. The large number of differentially expressed genes supports a strong division of labor between coral branch tips and branch bases. Genes involved in growth of mature Acropora colonies include the classical signaling pathways associated with development of cnidarian larvae and polyps as well as morphological determination in higher metazoans.

Genome-wide identification of long non-coding RNA genes and their association with insecticide resistance and metamorphosis in diamondback moth, Plutella xylostella.

PubMed

Liu, Feiling; Guo, Dianhao; Yuan, Zhuting; Chen, Chen; Xiao, Huamei

2017-11-20

Long non-coding RNA (lncRNA) is a class of noncoding RNA >200 bp in length that has essential roles in regulating a variety of biological processes. Here, we constructed a computational pipeline to identify lncRNA genes in the diamondback moth (Plutella xylostella), a major insect pest of cruciferous vegetables. In total, 3,324 lncRNAs corresponding to 2,475 loci were identified from 13 RNA-Seq datasets, including samples from parasitized, insecticide-resistant strains and different developmental stages. The identified P. xylostella lncRNAs had shorter transcripts and fewer exons than protein-coding genes. Seven out of nine randomly selected lncRNAs were validated by strand-specific RT-PCR. In total, 54-172 lncRNAs were specifically expressed in the insecticide resistant strains, among which one lncRNA was located adjacent to the sodium channel gene. In addition, 63-135 lncRNAs were specifically expressed in different developmental stages, among which three lncRNAs overlapped or were located adjacent to the metamorphosis-associated genes. These lncRNAs were either strongly or weakly co-expressed with their overlapping or neighboring mRNA genes. In summary, we identified thousands of lncRNAs and presented evidence that lncRNAs might have key roles in conferring insecticide resistance and regulating the metamorphosis development in P. xylostella.

Stuxnet Recruits the Proteasome to Take Down Polycomb.

PubMed

Karch, François

2016-06-20

In this issue of Developmental Cell, Du et al. (2016) describe a gene named stuxnet that regulates Polycomb protein stability, thereby influencing the activity of the Polycomb-group repressive chromatin complexes. Copyright © 2016 Elsevier Inc. All rights reserved.

MEDIATOR18 and MEDIATOR20 confer susceptibility to Fusarium oxysporum in Arabidopsis thaliana

PubMed Central

Stiller, Jiri; Davoine, Celine; Björklund, Stefan; Manners, John M.; Kazan, Kemal; Schenk, Peer M.

2017-01-01

The conserved protein complex known as Mediator conveys transcriptional signals by acting as an intermediary between transcription factors and RNA polymerase II. As a result, Mediator subunits play multiple roles in regulating developmental as well as abiotic and biotic stress pathways. In this report we identify the head domain subunits MEDIATOR18 and MEDIATOR20 as important susceptibility factors for Fusarium oxysporum infection in Arabidopsis thaliana. Mutants of MED18 and MED20 display down-regulation of genes associated with jasmonate signaling and biosynthesis while up-regulation of salicylic acid associated pathogenesis related genes and reactive oxygen producing and scavenging genes. We propose that MED18 and MED20 form a sub-domain within Mediator that controls the balance of salicylic acid and jasmonate associated defense pathways. PMID:28441405

Transcriptome Analysis and Discovery of Genes Relevant to Development in Bradysia odoriphaga at Three Developmental Stages.

PubMed

Gao, Huanhuan; Zhai, Yifan; Wang, Wenbo; Chen, Hao; Zhou, Xianhong; Zhuang, Qianying; Yu, Yi; Li, Rumei

2016-01-01

Bradysia odoriphaga (Diptera: Sciaridae) is the most important pest of Chinese chive (Allium tuberosum) in Asia; however, the molecular genetics are poorly understood. To explore the molecular biological mechanism of development, Illumina sequencing and de novo assembly were performed in the third-instar, fourth-instar, and pupal B. odoriphaga. The study resulted in 16.2 Gb of clean data and 47,578 unigenes (≥125 bp) contained in 7,632,430 contigs, 46.21% of which were annotated from non-redundant protein (NR), Gene Ontology (GO), Clusters of Orthologous Groups (COG), Eukaryotic Orthologous Groups (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. It was found that 19.67% of unigenes matched the homologous species mainly, including Aedes aegypti, Culex quinquefasciatus, Ceratitis capitata, and Anopheles gambiae. According to differentially expressed gene (DEG) analysis, 143, 490, and 309 DEGs were annotated as involved in the developmental process in the GO database respectively, in the comparisons of third-instar and fourth-instar larvae, third-instar larvae and pupae, and fourth-instar larvae and pupae. Twenty-five genes were closely related to these processes, including developmental process, reproduction process, and reproductive organs development and programmed cell death (PCD). The information of unigenes assembled in B. odoriphaga through transcriptome and DEG analyses could provide a detailed genetic basis and regulated information for elaborating the developmental mechanism from the larval, pre-pupal to pupal stages of B. odoriphaga.

Regulation of Conidiation by Light in Aspergillus nidulans

PubMed Central

Ruger-Herreros, Carmen; Rodríguez-Romero, Julio; Fernández-Barranco, Raul; Olmedo, María; Fischer, Reinhard; Corrochano, Luis M.; Canovas, David

2011-01-01

Light regulates several aspects of the biology of many organisms, including the balance between asexual and sexual development in some fungi. To understand how light regulates fungal development at the molecular level we have used Aspergillus nidulans as a model. We have performed a genome-wide expression analysis that has allowed us to identify >400 genes upregulated and >100 genes downregulated by light in developmentally competent mycelium. Among the upregulated genes were genes required for the regulation of asexual development, one of the major biological responses to light in A. nidulans, which is a pathway controlled by the master regulatory gene brlA. The expression of brlA, like conidiation, is induced by light. A detailed analysis of brlA light regulation revealed increased expression after short exposures with a maximum after 60 min of light followed by photoadaptation with longer light exposures. In addition to brlA, genes flbA–C and fluG are also light regulated, and flbA–C are required for the correct light-dependent regulation of the upstream regulator fluG. We have found that light induction of brlA required the photoreceptor complex composed of a phytochrome FphA, and the white-collar homologs LreA and LreB, and the fluffy genes flbA–C. We propose that the activation of regulatory genes by light is the key event in the activation of asexual development by light in A. nidulans. PMID:21624998

The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

PubMed

Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

2018-04-15

The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

FRUITFULL controls SAUR10 expression and regulates Arabidopsis growth and architecture.

PubMed

Bemer, Marian; van Mourik, Hilda; Muiño, Jose M; Ferrándiz, Cristina; Kaufmann, Kerstin; Angenent, Gerco C

2017-06-15

MADS-domain transcription factors are well known for their roles in plant development and regulate sets of downstream genes that have been uncovered by high-throughput analyses. A considerable number of these targets are predicted to function in hormone responses or responses to environmental stimuli, suggesting that there is a close link between developmental and environmental regulators of plant growth and development. Here, we show that the Arabidopsis MADS-domain factor FRUITFULL (FUL) executes several functions in addition to its noted role in fruit development. Among the direct targets of FUL, we identified SMALL AUXIN UPREGULATED RNA 10 (SAUR10), a growth regulator that is highly induced by a combination of auxin and brassinosteroids and in response to reduced R:FR light. Interestingly, we discovered that SAUR10 is repressed by FUL in stems and inflorescence branches. SAUR10 is specifically expressed at the abaxial side of these branches and this localized activity is influenced by hormones, light conditions and by FUL, which has an effect on branch angle. Furthermore, we identified a number of other genes involved in hormone pathways and light signalling as direct targets of FUL in the stem, demonstrating a connection between developmentally and environmentally regulated growth programs. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

PubMed Central

Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

2016-01-01

Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

USGS Publications Warehouse

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence

PubMed Central

Chang, Xiaoxiao; Donnelly, Linda; Sun, Daoyang; Rao, Jingping; Reid, Michael S.; Jiang, Cai-Zhong

2014-01-01

Flower senescence is initiated by developmental and environmental signals, and regulated by gene transcription. A homeodomain-leucine zipper transcription factor, PhHD-Zip, is up-regulated during petunia flower senescence. Virus-induced gene silencing of PhHD-Zip extended flower life by 20% both in unpollinated and pollinated flowers. Silencing PhHD-Zip also dramatically reduced ethylene production and the abundance of transcripts of genes involved in ethylene (ACS, ACO), and ABA (NCED) biosynthesis. Abundance of transcripts of senescence-related genes (SAG12, SAG29) was also dramatically reduced in the silenced flowers. Over-expression of PhHD-Zip accelerated petunia flower senescence. Furthermore, PhHD-Zip transcript abundance in petunia flowers was increased by application of hormones (ethylene, ABA) and abiotic stresses (dehydration, NaCl and cold). Our results suggest that PhHD-Zip plays an important role in regulating petunia flower senescence. PMID:24551088

A Petunia homeodomain-leucine zipper protein, PhHD-Zip, plays an important role in flower senescence.

PubMed

Chang, Xiaoxiao; Donnelly, Linda; Sun, Daoyang; Rao, Jingping; Reid, Michael S; Jiang, Cai-Zhong

2014-01-01

Flower senescence is initiated by developmental and environmental signals, and regulated by gene transcription. A homeodomain-leucine zipper transcription factor, PhHD-Zip, is up-regulated during petunia flower senescence. Virus-induced gene silencing of PhHD-Zip extended flower life by 20% both in unpollinated and pollinated flowers. Silencing PhHD-Zip also dramatically reduced ethylene production and the abundance of transcripts of genes involved in ethylene (ACS, ACO), and ABA (NCED) biosynthesis. Abundance of transcripts of senescence-related genes (SAG12, SAG29) was also dramatically reduced in the silenced flowers. Over-expression of PhHD-Zip accelerated petunia flower senescence. Furthermore, PhHD-Zip transcript abundance in petunia flowers was increased by application of hormones (ethylene, ABA) and abiotic stresses (dehydration, NaCl and cold). Our results suggest that PhHD-Zip plays an important role in regulating petunia flower senescence.

Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

PubMed

Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

2012-06-01

In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility.

PubMed

Du, Hongling; Taylor, Hugh S

2015-11-09

HOX genes convey positional identity that leads to the proper partitioning and adult identity of the female reproductive track. Abnormalities in reproductive tract development can be caused by HOX gene mutations or altered HOX gene expression. Diethylstilbestrol (DES) and other endocrine disruptors cause Müllerian defects by changing HOX gene expression. HOX genes are also essential regulators of adult endometrial development. Regulated HOXA10 and HOXA11 expression is necessary for endometrial receptivity; decreased HOXA10 or HOXA11 expression leads to decreased implantation rates. Alternation of HOXA10 and HOXA11 expression has been identified as a mechanism of the decreased implantation associated with endometriosis, polycystic ovarian syndrome, leiomyoma, polyps, adenomyosis, and hydrosalpinx. Alteration of HOX gene expression causes both uterine developmental abnormalities and impaired adult endometrial development that prevent implantation and lead to female infertility. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

Notch signaling genes

PubMed Central

Terragni, Jolyon; Zhang, Guoqiang; Sun, Zhiyi; Pradhan, Sriharsa; Song, Lingyun; Crawford, Gregory E; Lacey, Michelle; Ehrlich, Melanie

2014-01-01

Notch intercellular signaling is critical for diverse developmental pathways and for homeostasis in various types of stem cells and progenitor cells. Because Notch gene products need to be precisely regulated spatially and temporally, epigenetics is likely to help control expression of Notch signaling genes. Reduced representation bisulfite sequencing (RRBS) indicated significant hypomethylation in myoblasts, myotubes, and skeletal muscle vs. many nonmuscle samples at intragenic or intergenic regions of the following Notch receptor or ligand genes: NOTCH1, NOTCH2, JAG2, and DLL1. An enzymatic assay of sites in or near these genes revealed unusually high enrichment of 5-hydroxymethylcytosine (up to 81%) in skeletal muscle, heart, and cerebellum. Epigenetics studies and gene expression profiles suggest that hypomethylation and/or hydroxymethylation help control expression of these genes in heart, brain, myoblasts, myotubes, and within skeletal muscle myofibers. Such regulation could promote cell renewal, cell maintenance, homeostasis, and a poised state for repair of tissue damage. PMID:24670287

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration

PubMed Central

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2, which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words “neuron” or “axonogenesis” were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer’s, Parkinson’s, and Huntington’s diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell–cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin–radixin–moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2’s importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases. PMID:28798667

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration.

PubMed

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2 , which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words "neuron" or "axonogenesis" were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer's, Parkinson's, and Huntington's diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell-cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin-radixin-moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2's importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases.

CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

PubMed

Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

2012-07-01

Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

Reciprocal Expression of lin-41 and the microRNAs let-7 and mir-125 During Mouse Embryogenesis

PubMed Central

Schulman, Betsy R. Maller; Esquela-Kerscher, Aurora; Slack, Frank J.

2008-01-01

In C. elegans, heterochronic genes control the timing of cell fate determination during development. Two heterochronic genes, let-7 and lin-4, encode microRNAs (miRNAs) that down-regulate a third heterochronic gene lin-41 by binding to complementary sites in its 3’UTR. let-7 and lin-4 are conserved in mammals. Here we report the cloning and sequencing of mammalian lin-41 orthologs. We find that mouse and human lin-41 genes contain predicted conserved complementary sites for let-7 and the lin-4 ortholog, mir-125, in their 3’UTRs. Mouse lin-41 (Mlin-41) is temporally expressed in developing mouse embryos, most dramatically in the limb buds. Mlin-41 is down-regulated during mid-embryogenesis at the time when mouse let-7c and mir-125 RNA levels are up-regulated. Our results suggest that mammalian lin-41 is temporally regulated by miRNAs in order to direct key developmental events such as limb formation. PMID:16247770

Complexity of the Alternative Splicing Landscape in Plants[C][W][OPEN

PubMed Central

Reddy, Anireddy S.N.; Marquez, Yamile; Kalyna, Maria; Barta, Andrea

2013-01-01

Alternative splicing (AS) of precursor mRNAs (pre-mRNAs) from multiexon genes allows organisms to increase their coding potential and regulate gene expression through multiple mechanisms. Recent transcriptome-wide analysis of AS using RNA sequencing has revealed that AS is highly pervasive in plants. Pre-mRNAs from over 60% of intron-containing genes undergo AS to produce a vast repertoire of mRNA isoforms. The functions of most splice variants are unknown. However, emerging evidence indicates that splice variants increase the functional diversity of proteins. Furthermore, AS is coupled to transcript stability and translation through nonsense-mediated decay and microRNA-mediated gene regulation. Widespread changes in AS in response to developmental cues and stresses suggest a role for regulated splicing in plant development and stress responses. Here, we review recent progress in uncovering the extent and complexity of the AS landscape in plants, its regulation, and the roles of AS in gene regulation. The prevalence of AS in plants has raised many new questions that require additional studies. New tools based on recent technological advances are allowing genome-wide analysis of RNA elements in transcripts and of chromatin modifications that regulate AS. Application of these tools in plants will provide significant new insights into AS regulation and crosstalk between AS and other layers of gene regulation. PMID:24179125

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae)

PubMed Central

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S.; Reichelt, Michael; Schranz, Michael E.

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C. Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema. Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction. PMID:28603537

Genome-wide expression profiling of in vivo-derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

PubMed Central

Kabani, Sarah; Fenn, Katelyn; Ross, Alan; Ivens, Al; Smith, Terry K; Ghazal, Peter; Matthews, Keith

2009-01-01

Background Trypanosomes undergo extensive developmental changes during their complex life cycle. Crucial among these is the transition between slender and stumpy bloodstream forms and, thereafter, the differentiation from stumpy to tsetse-midgut procyclic forms. These developmental events are highly regulated, temporally reproducible and accompanied by expression changes mediated almost exclusively at the post-transcriptional level. Results In this study we have examined, by whole-genome microarray analysis, the mRNA abundance of genes in slender and stumpy forms of T.brucei AnTat1.1 cells, and also during their synchronous differentiation to procyclic forms. In total, five biological replicates representing the differentiation of matched parasite populations derived from five individual mouse infections were assayed, with RNAs being derived at key biological time points during the time course of their synchronous differentiation to procyclic forms. Importantly, the biological context of these mRNA profiles was established by assaying the coincident cellular events in each population (surface antigen exchange, morphological restructuring, cell cycle re-entry), thereby linking the observed gene expression changes to the well-established framework of trypanosome differentiation. Conclusion Using stringent statistical analysis and validation of the derived profiles against experimentally-predicted gene expression and phenotypic changes, we have established the profile of regulated gene expression during these important life-cycle transitions. The highly synchronous nature of differentiation between stumpy and procyclic forms also means that these studies of mRNA profiles are directly relevant to the changes in mRNA abundance within individual cells during this well-characterised developmental transition. PMID:19747379

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae).

PubMed

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S; Reichelt, Michael; Schranz, Michael E

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C . Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema . Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction.

SAUR Proteins as Effectors of Hormonal and Environmental Signals in Plant Growth

PubMed Central

Ren, Hong; Gray, William M.

2016-01-01

The plant hormone auxin regulates numerous aspects of plant growth and development. Early auxin response genes mediate its genomic effects on plant growth and development. Discovered in 1987, SMALL AUXIN UP RNAs (SAURs) are the largest family of early auxin response genes. SAUR functions have remained elusive, however, presumably due to extensive genetic redundancy. However, recent molecular, genetic, biochemical, and genomic studies have implicated SAURs in the regulation of a wide range of cellular, physiological, and developmental processes. Recently, crucial mechanistic insight into SAUR function was provided by the demonstration that SAURs inhibit PP2C.D phosphatases to activate plasma membrane (PM) H+-ATPases and promote cell expansion. In addition to auxin, several other hormones and environmental factors also regulate SAUR gene expression. We propose that SAURs are key effector outputs of hormonal and environmental signals that regulate plant growth and development. PMID:25983207

Arabidopsis thaliana G2-LIKE FLAVONOID REGULATOR and BRASSINOSTEROID ENHANCED EXPRESSION1 are low-temperature regulators of flavonoid accumulation.

PubMed

Petridis, Antonios; Döll, Stefanie; Nichelmann, Lars; Bilger, Wolfgang; Mock, Hans-Peter

2016-08-01

Flavonoid synthesis is predominantly regulated at the transcriptional level through the MYB-basic helix-loop-helix (bHLH)-WD40 (MBW) (MYB: transcription factor of the myeloblastosis protein family, WD40: tanscription factor with a short structural motif of 40 amino acids which terminates in an aspartic acid-tryptophan dipeptide) complex, and responds to both environmental and developmental stimuli. Although the developmental regulation of flavonoid accumulation in Arabidopsis thaliana has been examined in great detail, the response of the flavonoid synthesis pathway to abiotic stress (particularly low temperature) remains unclear. A screen of a Dissociation element (Ds) transposon-induced mutation collection identified two lines which exhibited an altered profile of phenylpropanoid accumulation following exposure to low-temperature stress. One of the mutated genes (BRASSINOSTEROID ENHANCED EXPRESSION1 (BEE1)) encoded a brassinosteroid enhanced expression transcription factor, while the other (G2-LIKE FLAVONOID REGULATOR (GFR)) encoded a G2-like flavonoid regulator. Phenylpropanoid-targeted analysis was performed using high-performance LC-MS, and gene expression analysis using quantitative reverse transcription-PCR. In both mutants, the accumulation of quercetins and scopolin was reduced under low-temperature growing conditions, whereas that of anthocyanin was increased. BEE1 and GFR were both shown to negatively regulate anthocyanin accumulation by inhibiting anthocyanin synthesis genes via the suppression of the bHLH (TRANSPARENT TESTA8 (TT8) and GLABROUS3 (GL3)) and/or the MYB (PRODUCTION OF ANTHOCYANIN PIGMENTS2 (PAP2)) components of the MBW complex. Our results provide new insight into the regulatory control of phenylpropanoid metabolism at low temperatures, and reveal that BEE1 and GFR act as important components of the signal transduction chain. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves

PubMed Central

Safavi-Rizi, Vajiheh; Franzaring, Jürgen; Fangmeier, Andreas; Kunze, Reinhard

2018-01-01

In the spring oilseed rape (OSR) cultivar ‘Mozart’ grown under optimal N supply (NO) or mild N deficiency (NL) the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4) and younger higher canopy leaves (leaf #8) were investigated. Twelve weeks old NO and NL plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In NO leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in NL leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes) than in N-depleted plants (∼750 genes). This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs). Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in NL plants, but none in NO plants. In contrast, from weeks 13 to 16 in leaves #8 of NL plants only 11 PSGs were downregulated in comparison to 66 PSGs in NO plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in NL leaves #4 or NO leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves. PMID:29449851

The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.

PubMed

Bozdech, Zbynek; Llinás, Manuel; Pulliam, Brian Lee; Wong, Edith D; Zhu, Jingchun; DeRisi, Joseph L

2003-10-01

Plasmodium falciparum is the causative agent of the most burdensome form of human malaria, affecting 200-300 million individuals per year worldwide. The recently sequenced genome of P. falciparum revealed over 5,400 genes, of which 60% encode proteins of unknown function. Insights into the biochemical function and regulation of these genes will provide the foundation for future drug and vaccine development efforts toward eradication of this disease. By analyzing the complete asexual intraerythrocytic developmental cycle (IDC) transcriptome of the HB3 strain of P. falciparum, we demonstrate that at least 60% of the genome is transcriptionally active during this stage. Our data demonstrate that this parasite has evolved an extremely specialized mode of transcriptional regulation that produces a continuous cascade of gene expression, beginning with genes corresponding to general cellular processes, such as protein synthesis, and ending with Plasmodium-specific functionalities, such as genes involved in erythrocyte invasion. The data reveal that genes contiguous along the chromosomes are rarely coregulated, while transcription from the plastid genome is highly coregulated and likely polycistronic. Comparative genomic hybridization between HB3 and the reference genome strain (3D7) was used to distinguish between genes not expressed during the IDC and genes not detected because of possible sequence variations. Genomic differences between these strains were found almost exclusively in the highly antigenic subtelomeric regions of chromosomes. The simple cascade of gene regulation that directs the asexual development of P. falciparum is unprecedented in eukaryotic biology. The transcriptome of the IDC resembles a "just-in-time" manufacturing process whereby induction of any given gene occurs once per cycle and only at a time when it is required. These data provide to our knowledge the first comprehensive view of the timing of transcription throughout the intraerythrocytic development of P. falciparum and provide a resource for the identification of new chemotherapeutic and vaccine candidates.

Primary and Secondary Abscission in Pisum sativum and Euphorbia pulcherrima—How Do They Compare and How Do They Differ?

PubMed Central

Hvoslef-Eide, Anne K.; Munster, Cristel M.; Mathiesen, Cecilie A.; Ayeh, Kwadwo O.; Melby, Tone I.; Rasolomanana, Paoly; Lee, YeonKyeong

2016-01-01

Abscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in 1 week. AFLP differential display (DD) was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental funiculus) gene, which was compared with wild type peas (tall and dwarf in both cases) was performed. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first 2 days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions), enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis. This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94–98 million years in evolution, hence any genes or processes in common are bound to be widespread in the plant kingdom. PMID:26858724

Interspecies modulation of bacterial development through iron competition and siderophore piracy

PubMed Central

Traxler, Matthew F.; Seyedsayamdost, Mohammad R.; Clardy, Jon; Kolter, Roberto

2012-01-01

Summary While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key down-stream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were down-regulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. PMID:22931126

Transcriptomic Analysis of Grapevine (cv. Summer Black) Leaf, Using the Illumina Platform

PubMed Central

Pervaiz, Tariq; Haifeng, Jia; Salman Haider, Muhammad; Cheng, Zhang; Cui, Mengjie; Wang, Mengqi; Cui, Liwen; Wang, Xicheng; Fang, Jinggui

2016-01-01

Proceeding to illumina sequencing, determining RNA integrity numbers for poly RNA were separated from each of the four developmental stages of cv. Summer Black leaves by using Illumina HiSeq™ 2000. The sums of 272,941,656 reads were generated from vitis vinifera leaf at four different developmental stages, with more than 27 billion nucleotides of the sequence data. At each growth stage, RNA samples were indexed through unique nucleic acid identifiers and sequenced. KEGG annotation results depicted that the highest number of transcripts in 2,963 (2Avs4A) followed by 1Avs4A (2,920), and 3Avs4A (2,294) out of 15,614 (71%) transcripts were recorded. In comparison, a total of 1,532 transcripts were annotated in GOs, including Cellular component, with the highest number in “Cell part” 251 out of 353 transcripts (71.1%), followed by intracellular organelle 163 out of 353 transcripts (46.2%), while in molecular function and metabolic process 375 out of 525 (71.4%) transcripts, multicellular organism process 40 out of 525 (7.6%) transcripts in biological process were most common in 1Avs2A. While in case of 1Avs3A, cell part 476 out of 662 transcripts (71.9%), and membrane-bounded organelle 263 out of 662 transcripts (39.7%) were recorded in Cellular component. In the grapevine transcriptome, during the initial stages of leaf development 1Avs2A showed single transcript was down-regulated and none of them were up-regulated. While in comparison of 1A to 3A showed one up-regulated (photosystem II reaction center protein C) and one down regulated (conserved gene of unknown function) transcripts, during the hormone regulating pathway namely SAUR-like auxin-responsive protein family having 2 up-regulated and 7 down-regulated transcripts, phytochrome-associated protein showed 1 up-regulated and 9 down-regulated transcripts, whereas genes associated with the Leucine-rich repeat protein kinase family protein showed 7 up-regulated and 1 down-regulated transcript, meanwhile Auxin Resistant 2 has single up-regulated transcript in second developmental stage, although 3 were down-regulated at lateral growth stages (3A and 4A). In the present study, 489 secondary metabolic pathways related genes were identified during leaf growth, which mainly includes alkaloid (40), anthocyanins (21), Diterpenoid (144), Monoterpenoid (90) and Flavonoids (93). Quantitative real-time PCR was applied to validate 10 differentially expressed transcripts patterns from flower, leaf and fruit metabolic pathways at different growth stages. PMID:26824474

miRTex: A Text Mining System for miRNA-Gene Relation Extraction

PubMed Central

Li, Gang; Ross, Karen E.; Arighi, Cecilia N.; Peng, Yifan; Wu, Cathy H.; Vijay-Shanker, K.

2015-01-01

MicroRNAs (miRNAs) regulate a wide range of cellular and developmental processes through gene expression suppression or mRNA degradation. Experimentally validated miRNA gene targets are often reported in the literature. In this paper, we describe miRTex, a text mining system that extracts miRNA-target relations, as well as miRNA-gene and gene-miRNA regulation relations. The system achieves good precision and recall when evaluated on a literature corpus of 150 abstracts with F-scores close to 0.90 on the three different types of relations. We conducted full-scale text mining using miRTex to process all the Medline abstracts and all the full-length articles in the PubMed Central Open Access Subset. The results for all the Medline abstracts are stored in a database for interactive query and file download via the website at http://proteininformationresource.org/mirtex. Using miRTex, we identified genes potentially regulated by miRNAs in Triple Negative Breast Cancer, as well as miRNA-gene relations that, in conjunction with kinase-substrate relations, regulate the response to abiotic stress in Arabidopsis thaliana. These two use cases demonstrate the usefulness of miRTex text mining in the analysis of miRNA-regulated biological processes. PMID:26407127

A Network of Chromatin Factors Is Regulating the Transition to Postembryonic Development in Caenorhabditis elegans

PubMed Central

Erdelyi, Peter; Wang, Xing; Suleski, Marina; Wicky, Chantal

2016-01-01

Mi2 proteins are evolutionarily conserved, ATP-dependent chromatin remodelers of the CHD family that play key roles in stem cell differentiation and reprogramming. In Caenorhabditis elegans, the let-418 gene encodes one of the two Mi2 homologs, which is part of at least two chromatin complexes, namely the Nucleosome Remodeling and histone Deacetylase (NuRD) complex and the MEC complex, and functions in larval development, vulval morphogenesis, lifespan regulation, and cell fate determination. To explore the mechanisms involved in the action of LET-418/Mi2, we performed a genome-wide RNA interference (RNAi) screen for suppressors of early larval arrest associated with let-418 mutations. We identified 29 suppressor genes, of which 24 encode chromatin regulators, mostly orthologs of proteins present in transcriptional activator complexes. The remaining five genes vary broadly in their predicted functions. All suppressor genes could suppress multiple aspects of the let-418 phenotype, including developmental arrest and ectopic expression of germline genes in the soma. Analysis of available transcriptomic data and quantitative PCR revealed that LET-418 and the suppressors of early larval arrest are regulating common target genes. These suppressors might represent direct competitors of LET-418 complexes for chromatin regulation of crucial genes involved in the transition to postembryonic development. PMID:28007841

A Network of Chromatin Factors Is Regulating the Transition to Postembryonic Development in Caenorhabditis elegans.

PubMed

Erdelyi, Peter; Wang, Xing; Suleski, Marina; Wicky, Chantal

2017-02-09

Mi2 proteins are evolutionarily conserved, ATP-dependent chromatin remodelers of the CHD family that play key roles in stem cell differentiation and reprogramming. In Caenorhabditis elegans , the let-418 gene encodes one of the two Mi2 homologs, which is part of at least two chromatin complexes, namely the Nucleosome Remodeling and histone Deacetylase (NuRD) complex and the MEC complex, and functions in larval development, vulval morphogenesis, lifespan regulation, and cell fate determination. To explore the mechanisms involved in the action of LET-418/Mi2, we performed a genome-wide RNA interference (RNAi) screen for suppressors of early larval arrest associated with let-418 mutations. We identified 29 suppressor genes, of which 24 encode chromatin regulators, mostly orthologs of proteins present in transcriptional activator complexes. The remaining five genes vary broadly in their predicted functions. All suppressor genes could suppress multiple aspects of the let-418 phenotype, including developmental arrest and ectopic expression of germline genes in the soma. Analysis of available transcriptomic data and quantitative PCR revealed that LET-418 and the suppressors of early larval arrest are regulating common target genes. These suppressors might represent direct competitors of LET-418 complexes for chromatin regulation of crucial genes involved in the transition to postembryonic development. Copyright © 2017 Erdelyi et al.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the parasites. Conclusive functional proof of different rRNAs in regulating parasite development, however, is still absent or controversial. Here we functionally demonstrate for the first time that a stage-specifically expressed D-type small-subunit rRNA gene (D-ssu) is essential for oocyst development of the malaria parasite Plasmodium yoelii in the mosquito. This study also shows that variations in D-ssu sequence and/or the timing of transcription may have profound effects on parasite oocyst development. The results show that in addition to protein translation, rRNAs of malaria parasites also regulate parasite development and differentiation in a strain-specific manner, which can be explored for controlling parasite transmission. Copyright © 2015 Qi et al.

Mechanisms and pathways of growth failure in primordial dwarfism.

PubMed

Klingseisen, Anna; Jackson, Andrew P

2011-10-01

The greatest difference between species is size; however, the developmental mechanisms determining organism growth remain poorly understood. Primordial dwarfism is a group of human single-gene disorders with extreme global growth failure (which includes Seckel syndrome, microcephalic osteodysplastic primordial dwarfism I [MOPD] types I and II, and Meier-Gorlin syndrome). Ten genes have now been identified for microcephalic primordial dwarfism, encoding proteins involved in fundamental cellular processes including genome replication (ORC1 [origin recognition complex 1], ORC4, ORC6, CDT1, and CDC6), DNA damage response (ATR [ataxia-telangiectasia and Rad3-related]), mRNA splicing (U4atac), and centrosome function (CEP152, PCNT, and CPAP). Here, we review the cellular and developmental mechanisms underlying the pathogenesis of these conditions and address whether further study of these genes could provide novel insight into the physiological regulation of organism growth.

Developmental studies of the lamprey and hierarchical evolutionary steps towards the acquisition of the jaw

PubMed Central

Kuratani, Shigeru

2005-01-01

The evolution of animal morphology can be understood as a series of changes in developmental programs. Among vertebrates, some developmental stages are conserved across species, representing particular developmental constraints. One of the most conserved stages is the vertebrate pharyngula, in which similar embryonic morphology is observed and the Hox code is clearly expressed. The oral developmental program also appears to be constrained to some extent, as both its morphology and the the Hox-code-default state of the oropharyngeal region are well conserved between the lamprey and gnathostome embryos. These features do not by themselves explain the evolution of jaws, but should be regarded as a prerequisite for evolutionary diversification of the mandibular arch. By comparing the pharyngula morphology of the lamprey and gnathostomes, it has become clear that the oral pattern is not entirely identical; in particular, the positional differentiation of the rostral ectomesenchyme is shifted between these animals. Therefore, the jaw seems to have arisen as an evolutionary novelty by overriding ancestral constraints, a process in which morphological homologies are partially lost. This change involves the heterotopic shift of tissue interaction, which appears to have been preceded by the transition from monorhiny to diplorhiny, as well as separation of the hypophysis. When gene expression patterns are compared between the lamprey and gnathostomes, cell-autonomously functioning genes tend to be associated with identical cell types or equivalent anatomical domains, whereas growth-factor-encoding genes have changed their expression domains during evolution. Thus, the heterotopic evolution may be based on changes in the regulation of signalling-molecule-encoding genes. PMID:16313390

Berry skin development in Norton grape: distinct patterns of transcriptional regulation and flavonoid biosynthesis.

PubMed

Ali, Mohammad B; Howard, Susanne; Chen, Shangwu; Wang, Yechun; Yu, Oliver; Kovacs, Laszlo G; Qiu, Wenping

2011-01-10

The complex and dynamic changes during grape berry development have been studied in Vitis vinifera, but little is known about these processes in other Vitis species. The grape variety 'Norton', with a major portion of its genome derived from Vitis aestivalis, maintains high levels of malic acid and phenolic acids in the ripening berries in comparison with V. vinifera varieties such as Cabernet Sauvignon. Furthermore, Norton berries develop a remarkably high level of resistance to most fungal pathogens while Cabernet Sauvignon berries remain susceptible to those pathogens. The distinct characteristics of Norton and Cabernet Sauvignon merit a comprehensive analysis of transcriptional regulation and metabolite pathways. A microarray study was conducted on transcriptome changes of Norton berry skin during the period of 37 to 127 days after bloom, which represents berry developmental phases from herbaceous growth to full ripeness. Samples of six berry developmental stages were collected. Analysis of the microarray data revealed that a total of 3,352 probe sets exhibited significant differences at transcript levels, with two-fold changes between at least two developmental stages. Expression profiles of defense-related genes showed a dynamic modulation of nucleotide-binding site-leucine-rich repeat (NBS-LRR) resistance genes and pathogenesis-related (PR) genes during berry development. Transcript levels of PR-1 in Norton berry skin clearly increased during the ripening phase. As in other grapevines, genes of the phenylpropanoid pathway were up-regulated in Norton as the berry developed. The most noticeable was the steady increase of transcript levels of stilbene synthase genes. Transcriptional patterns of six MYB transcription factors and eleven structural genes of the flavonoid pathway and profiles of anthocyanins and proanthocyanidins (PAs) during berry skin development were analyzed comparatively in Norton and Cabernet Sauvignon. Transcriptional patterns of MYB5A and MYB5B were similar during berry development between the two varieties, but those of MYBPA1 and MYBPA2 were strikingly different, demonstrating that the general flavonoid pathways are regulated under different MYB factors. The data showed that there were higher transcript levels of the genes encoding flavonoid-3'-O-hydroxylase (F3'H), flavonoid-3',5'-hydroxylase (F3'5'H), leucoanthocyanidin dioxygenase (LDOX), UDP-glucose:flavonoid 3'-O-glucosyltransferase (UFGT), anthocyanidin reductase (ANR), leucoanthocyanidin reductase (LAR) 1 and LAR2 in berry skin of Norton than in those of Cabernet Sauvignon. It was also found that the total amount of anthocyanins was markedly higher in Norton than in Cabernet Sauvignon berry skin at harvest, and five anthocyanin derivatives and three PA compounds exhibited distinctive accumulation patterns in Norton berry skin. This study provides an overview of the transcriptome changes and the flavonoid profiles in the berry skin of Norton, an important North American wine grape, during berry development. The steady increase of transcripts of PR-1 and stilbene synthase genes likely contributes to the developmentally regulated resistance during ripening of Norton berries. More studies are required to address the precise role of each stilbene synthase gene in berry development and disease resistance. Transcriptional regulation of MYBA1, MYBA2, MYB5A and MYBPA1 as well as expression levels of their putative targets F3'H, F3'5'H, LDOX, UFGT, ANR, LAR1, and LAR2 are highly correlated with the characteristic anthocyanin and PA profiles in Norton berry skin. These results reveal a unique pattern of the regulation of transcription and biosynthesis pathways underlying the viticultural and enological characteristics of Norton grape, and yield new insights into the understanding of the flavonoid pathway in non-vinifera grape varieties.

Berry skin development in Norton grape: Distinct patterns of transcriptional regulation and flavonoid biosynthesis

PubMed Central

2011-01-01

Background The complex and dynamic changes during grape berry development have been studied in Vitis vinifera, but little is known about these processes in other Vitis species. The grape variety 'Norton', with a major portion of its genome derived from Vitis aestivalis, maintains high levels of malic acid and phenolic acids in the ripening berries in comparison with V. vinifera varieties such as Cabernet Sauvignon. Furthermore, Norton berries develop a remarkably high level of resistance to most fungal pathogens while Cabernet Sauvignon berries remain susceptible to those pathogens. The distinct characteristics of Norton and Cabernet Sauvignon merit a comprehensive analysis of transcriptional regulation and metabolite pathways. Results A microarray study was conducted on transcriptome changes of Norton berry skin during the period of 37 to 127 days after bloom, which represents berry developmental phases from herbaceous growth to full ripeness. Samples of six berry developmental stages were collected. Analysis of the microarray data revealed that a total of 3,352 probe sets exhibited significant differences at transcript levels, with two-fold changes between at least two developmental stages. Expression profiles of defense-related genes showed a dynamic modulation of nucleotide-binding site-leucine-rich repeat (NBS-LRR) resistance genes and pathogenesis-related (PR) genes during berry development. Transcript levels of PR-1 in Norton berry skin clearly increased during the ripening phase. As in other grapevines, genes of the phenylpropanoid pathway were up-regulated in Norton as the berry developed. The most noticeable was the steady increase of transcript levels of stilbene synthase genes. Transcriptional patterns of six MYB transcription factors and eleven structural genes of the flavonoid pathway and profiles of anthocyanins and proanthocyanidins (PAs) during berry skin development were analyzed comparatively in Norton and Cabernet Sauvignon. Transcriptional patterns of MYB5A and MYB5B were similar during berry development between the two varieties, but those of MYBPA1 and MYBPA2 were strikingly different, demonstrating that the general flavonoid pathways are regulated under different MYB factors. The data showed that there were higher transcript levels of the genes encoding flavonoid-3'-O-hydroxylase (F3'H), flavonoid-3',5'-hydroxylase (F3'5'H), leucoanthocyanidin dioxygenase (LDOX), UDP-glucose:flavonoid 3'-O-glucosyltransferase (UFGT), anthocyanidin reductase (ANR), leucoanthocyanidin reductase (LAR) 1 and LAR2 in berry skin of Norton than in those of Cabernet Sauvignon. It was also found that the total amount of anthocyanins was markedly higher in Norton than in Cabernet Sauvignon berry skin at harvest, and five anthocyanin derivatives and three PA compounds exhibited distinctive accumulation patterns in Norton berry skin. Conclusions This study provides an overview of the transcriptome changes and the flavonoid profiles in the berry skin of Norton, an important North American wine grape, during berry development. The steady increase of transcripts of PR-1 and stilbene synthase genes likely contributes to the developmentally regulated resistance during ripening of Norton berries. More studies are required to address the precise role of each stilbene synthase gene in berry development and disease resistance. Transcriptional regulation of MYBA1, MYBA2, MYB5A and MYBPA1 as well as expression levels of their putative targets F3'H, F3'5'H, LDOX, UFGT, ANR, LAR1, and LAR2 are highly correlated with the characteristic anthocyanin and PA profiles in Norton berry skin. These results reveal a unique pattern of the regulation of transcription and biosynthesis pathways underlying the viticultural and enological characteristics of Norton grape, and yield new insights into the understanding of the flavonoid pathway in non-vinifera grape varieties. PMID:21219654

Metabolic Regulation of Caspase 2 in Breast Cancer

DTIC Science & Technology

2011-04-01

S. The apoptosome: physiological, developmental, and pathological modes of regulation. Dev Cell 10, 549-61 ( 2006 ). 3. Baliga, B.C., Read, S.H...Mol Biol Cell 17, 2150-7 ( 2006 ). 9. Bergeron, L. et al. Defects in regulation of apoptosis in caspase-2-deficient mice. Genes Dev 12, 1304-14 (1998...Warburg, O. On the origin of cancer cells. Science 123, 309-14 (1956). 17. Lassus, P., Opitz- Araya , X. & Lazebnik, Y. Requirement for caspase-2 in

Strigolactone biology: genes, functional genomics, epigenetics and applications.

PubMed

Makhzoum, Abdullah; Yousefzadi, Morteza; Malik, Sonia; Gantet, Pascal; Tremouillaux-Guiller, Jocelyne

2017-03-01

Strigolactones (SLs) represent an important new plant hormone class marked by their multifunctional role in plant and rhizosphere interactions. These compounds stimulate hyphal branching in arbuscular mycorrhizal fungi (AMF) and seed germination of root parasitic plants. In addition, they are involved in the control of plant architecture by inhibiting bud outgrowth as well as many other morphological and developmental processes together with other plant hormones such as auxins and cytokinins. The biosynthetic pathway of SLs that are derived from carotenoids was partially decrypted based on the identification of mutants from a variety of plant species. Only a few SL biosynthetic and regulated genes and related regulatory transcription factors have been identified. However, functional genomics and epigenetic studies started to give first elements on the modality of the regulation of SLs related genes. Since they control plant architecture and plant-rhizosphere interaction, SLs start to be used for agronomical and biotechnological applications. Furthermore, the genes involved in the SL biosynthetic pathway and genes regulated by SL constitute interesting targets for plant breeding. Therefore, it is necessary to decipher and better understand the genetic determinants of their regulation at different levels.

Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

PubMed

Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

2017-10-01

Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

The POU Factor Ventral Veins Lacking/Drifter Directs the Timing of Metamorphosis through Ecdysteroid and Juvenile Hormone Signaling

PubMed Central

Chaieb, Leila; Koyama, Takashi; Sarwar, Prioty; Mirth, Christen K.; Smith, Wendy A.; Suzuki, Yuichiro

2014-01-01

Although endocrine changes are known to modulate the timing of major developmental transitions, the genetic mechanisms underlying these changes remain poorly understood. In insects, two developmental hormones, juvenile hormone (JH) and ecdysteroids, are coordinated with each other to induce developmental changes associated with metamorphosis. However, the regulation underlying the coordination of JH and ecdysteroid synthesis remains elusive. Here, we examined the function of a homolog of the vertebrate POU domain protein, Ventral veins lacking (Vvl)/Drifter, in regulating both of these hormonal pathways in the red flour beetle, Tribolium castaneum (Tenebrionidae). RNA interference-mediated silencing of vvl expression led to both precocious metamorphosis and inhibition of molting in the larva. Ectopic application of a JH analog on vvl knockdown larvae delayed the onset of metamorphosis and led to a prolonged larval stage, indicating that Vvl acts upstream of JH signaling. Accordingly, vvl knockdown also reduced the expression of a JH biosynthesis gene, JH acid methyltransferase 3 (jhamt3). In addition, ecdysone titer and the expression of the ecdysone response gene, hormone receptor 3 (HR3), were reduced in vvl knockdown larvae. The expression of the ecdysone biosynthesis gene phantom (phm) and spook (spo) were reduced in vvl knockdown larvae in the anterior and posterior halves, respectively, indicating that Vvl might influence ecdysone biosynthesis in both the prothoracic gland and additional endocrine sources. Injection of 20-hydroxyecdysone (20E) into vvl knockdown larvae could restore the expression of HR3 although molting was never restored. These findings suggest that Vvl coordinates both JH and ecdysteroid biosynthesis as well as molting behavior to influence molting and the timing of metamorphosis. Thus, in both vertebrates and insects, POU factors modulate the production of major neuroendocrine regulators during sexual maturation. PMID:24945490

Fatty acids from membrane lipids become incorporated into lipid bodies during Myxococcus xanthus differentiation.

PubMed

Bhat, Swapna; Boynton, Tye O; Pham, Dan; Shimkets, Lawrence J

2014-01-01

Myxococcus xanthus responds to amino acid limitation by producing fruiting bodies containing dormant spores. During development, cells produce triacylglycerides in lipid bodies that become consumed during spore maturation. As the cells are starved to induce development, the production of triglycerides represents a counterintuitive metabolic switch. In this paper, lipid bodies were quantified in wild-type strain DK1622 and 33 developmental mutants at the cellular level by measuring the cross sectional area of the cell stained with the lipophilic dye Nile red. We provide five lines of evidence that triacylglycerides are derived from membrane phospholipids as cells shorten in length and then differentiate into myxospores. First, in wild type cells, lipid bodies appear early in development and their size increases concurrent with an 87% decline in membrane surface area. Second, developmental mutants blocked at different stages of shortening and differentiation accumulated lipid bodies proportionate with their cell length with a Pearson's correlation coefficient of 0.76. Third, peripheral rods, developing cells that do not produce lipid bodies, fail to shorten. Fourth, genes for fatty acid synthesis are down-regulated while genes for fatty acid degradation are up regulated. Finally, direct movement of fatty acids from membrane lipids in growing cells to lipid bodies in developing cells was observed by pulse labeling cells with palmitate. Recycling of lipids released by Programmed Cell Death appears not to be necessary for lipid body production as a fadL mutant was defective in fatty acid uptake but proficient in lipid body production. The lipid body regulon involves many developmental genes that are not specifically involved in fatty acid synthesis or degradation. MazF RNA interferase and its target, enhancer-binding protein Nla6, appear to negatively regulate cell shortening and TAG accumulation whereas most cell-cell signals activate these processes.

Impact of developmental lead exposure on splenic factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kasten-Jolly, Jane, E-mail: kjolly@wadsworth.or; Heo, Yong, E-mail: yheo@cu.ac.k; Lawrence, David A., E-mail: david.lawrence@wadsworth.or

2010-09-01

Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, inmore » order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.« less

Differential gene expression related to Nora virus infection of Drosophila melanogaster

PubMed Central

Cordes, Ethan J.; Licking-Murray, Kellie D; Carlson, Kimberly A.

2013-01-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. PMID:23603562

Cell fate regulation in the shoot meristem.

PubMed

Laux, T; Mayer, K F

1998-04-01

The shoot meristem is a proliferative centre containing pluripotent stem cells that are the ultimate source of all cells and organs continuously added to the growing shoot. The progeny of the stem cells have two developmental options, either to renew the stem cell population or to leave the meristem and to differentiate, possibly according to signals from more mature tissue. The destiny of each cell depends on its position within the dynamic shoot meristem. Genetic data suggest a simple model in which graded positional information is provided by antagonistic gene functions and is interpreted by genes which regulate cell fate.

Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

PubMed

Metzger, David C H; Schulte, Patricia M

2018-04-14

Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

The genome and transcriptome of the enteric parasite Entamoeba invadens, a model for encystation

PubMed Central

2013-01-01

Background Several eukaryotic parasites form cysts that transmit infection. The process is found in diverse organisms such as Toxoplasma, Giardia, and nematodes. In Entamoeba histolytica this process cannot be induced in vitro, making it difficult to study. In Entamoeba invadens, stage conversion can be induced, but its utility as a model system to study developmental biology has been limited by a lack of genomic resources. We carried out genome and transcriptome sequencing of E. invadens to identify molecular processes involved in stage conversion. Results We report the sequencing and assembly of the E. invadens genome and use whole transcriptome sequencing to characterize changes in gene expression during encystation and excystation. The E. invadens genome is larger than that of E. histolytica, apparently largely due to expansion of intergenic regions; overall gene number and the machinery for gene regulation are conserved between the species. Over half the genes are regulated during the switch between morphological forms and a key signaling molecule, phospholipase D, appears to regulate encystation. We provide evidence for the occurrence of meiosis during encystation, suggesting that stage conversion may play a key role in recombination between strains. Conclusions Our analysis demonstrates that a number of core processes are common to encystation between distantly related parasites, including meiosis, lipid signaling and RNA modification. These data provide a foundation for understanding the developmental cascade in the important human pathogen E. histolytica and highlight conserved processes more widely relevant in enteric pathogens. PMID:23889909

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

A genomic approach to identify hybrid incompatibility genes.

PubMed

Cooper, Jacob C; Phadnis, Nitin

2016-07-02

Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids.

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development1[OPEN

PubMed Central

2017-01-01

Rice (Oryza sativa) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1, a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. PMID:28500269

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development.

PubMed

Zhou, Li-Juan; Xiao, Lang-Tao; Xue, Hong-Wei

2017-07-01

Rice ( Oryza sativa ) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1 , a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. © 2017 American Society of Plant Biologists. All Rights Reserved.

Pancreatic cancer patient survival correlates with DNA methylation of pancreas development genes.

PubMed

Thompson, Michael J; Rubbi, Liudmilla; Dawson, David W; Donahue, Timothy R; Pellegrini, Matteo

2015-01-01

DNA methylation is an epigenetic mark associated with regulation of transcription and genome structure. These markers have been investigated in a variety of cancer settings for their utility in differentiating normal tissue from tumor tissue. Here, we examine the direct correlation between DNA methylation and patient survival. We find that changes in the DNA methylation of key pancreatic developmental genes are strongly associated with patient survival.

Transcriptome profiling reveals regulatory mechanisms underlying Corolla Senescence in Petunia

USDA-ARS?s Scientific Manuscript database

Genetic regulatory mechanisms that govern petal natural senescence in petunia is complicated and unclear. To identify key genes and pathways that regulate the process, we initiated a transcriptome analysis in petunia petals at four developmental time points, including petal opening without anthesis ...

Arabidopsis cpSRP54 regulates carotenoid accumulation in Arabidopsis and Brassica napus

PubMed Central

Gruber, Margaret Y.; Hannoufa, Abdelali

2012-01-01

An Arabidopsis thaliana mutant, cbd (carotenoid biosynthesis deficient), was recovered from a mutant population based on its yellow cotyledons, yellow-first true leaves, and stunted growth. Seven-day-old seedlings and mature seeds of this mutant had lower chlorophyll and total carotenoids than the wild type (WT). Genetic and molecular characterization revealed that cbd was a recessive mutant caused by a T-DNA insertion in the gene cpSRP54 encoding the 54kDa subunit of the chloroplast signal recognition particle. Transcript levels of most of the main carotenoid biosynthetic genes in cbd were unchanged relative to WT, but expression increased in carotenoid and abscisic acid catabolic genes. The chloroplasts of cbd also had developmental defects that contributed to decreased carotenoid and chlorophyll contents. Transcription of AtGLK1 (Golden 2-like 1), AtGLK2, and GUN4 appeared to be disrupted in the cbd mutant suggesting that the plastid-to-nucleus retrograde signal may be affected, regulating the changes in chloroplast functional and developmental states and carotenoid content flux. Transformation of A. thaliana and Brassica napus with a gDNA encoding the Arabidopsis cpSRP54 showed the utility of this gene in enhancing levels of seed carotenoids without affecting growth or seed yield. PMID:22791829

The expression of the cerato-platanin gene is related to hyphal growth and chlamydospores formation in Ceratocystis platani.

PubMed

Baccelli, Ivan; Comparini, Cecilia; Bettini, Priscilla P; Martellini, Federica; Ruocco, Michelina; Pazzagli, Luigia; Bernardi, Rodolfo; Scala, Aniello

2012-02-01

Cerato-platanin (CP) is a protein produced by Ceratocystis platani, the causal agent of canker stain disease of plane trees. CP is the first member of the 'cerato-platanin family', and its role as a pathogen-associated molecular pattern (PAMP), inducing defence responses both in host and nonhost plants, is established. However, the primary role of CP and its homologues in the fungal life remains unknown. In the present work, we investigated the regulation of the cp gene during the in vitro growth of C. platani in different conditions and under the effect of potential stress factors. Fungal growth and conidiogenesis were also analysed. Results showed that cp is a single-copy gene whose expression level is strictly associated with hyphal growth and with chlamydospores formation. The analysis of a 1368 bp 5'-flanking region revealed putative motifs that could be involved in the regulation of gene expression in response to stress and developmental cues. Taking into account the localization of CP in the fungal cell wall and the recently published 3D structure of the protein, our results support a role for CP in growth and developmental processes of C. platani. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Epigenomic Analysis of Multi-lineage Differentiation of Human Embryonic Stem Cells

PubMed Central

Xie, Wei; Schultz, Matthew D.; Lister, Ryan; Hou, Zhonggang; Rajagopal, Nisha; Ray, Pradipta; Whitaker, John W.; Tian, Shulan; Hawkins, R. David; Leung, Danny; Yang, Hongbo; Wang, Tao; Lee, Ah Young; Swanson, Scott A.; Zhang, Jiuchun; Zhu, Yun; Kim, Audrey; Nery, Joseph R.; Urich, Mark A.; Kuan, Samantha; Yen, Chia-an; Klugman, Sarit; Yu, Pengzhi; Suknuntha, Kran; Propson, Nicholas E.; Chen, Huaming; Edsall, Lee E.; Wagner, Ulrich; Li, Yan; Ye, Zhen; Kulkarni, Ashwinikumar; Xuan, Zhenyu; Chung, Wen-Yu; Chi, Neil C.; Antosiewicz-Bourget, Jessica E.; Slukvin, Igor; Stewart, Ron; Zhang, Michael Q.; Wang, Wei; Thomson, James A.; Ecker, Joseph R.; Ren, Bing

2013-01-01

SUMMARY Epigenetic mechanisms have been proposed to play crucial roles in mammalian development, but their precise functions are only partially understood. To investigate epigenetic regulation of embryonic development, we differentiated human embryonic stem cells into mesendoderm, neural progenitor cells, trophoblast-like cells, and mesenchymal stem cells, and systematically characterized DNA methylation, chromatin modifications, and the transcriptome in each lineage. We found that promoters that are active in early developmental stages tend to be CG rich and mainly engage H3K27me3 upon silencing in non-expressing lineages. By contrast, promoters for genes expressed preferentially at later stages are often CG poor and primarily employ DNA methylation upon repression. Interestingly, the early developmental regulatory genes are often located in large genomic domains that are generally devoid of DNA methylation in most lineages, which we termed DNA methylation valleys (DMVs). Our results suggest that distinct epigenetic mechanisms regulate early and late stages of ES cell differentiation. PMID:23664764

Complex expression patterns of lymphocyte-specific genes during the development of cartilaginous fish implicate unique lymphoid tissues in generating an immune repertoire

NASA Technical Reports Server (NTRS)

Miracle, A. L.; Anderson, M. K.; Litman, R. T.; Walsh, C. J.; Luer, C. A.; Rothenberg, E. V.; Litman, G. W.

2001-01-01

Cartilaginous fish express canonical B and T cell recognition genes, but their lymphoid organs and lymphocyte development have been poorly defined. Here, the expression of Ig, TCR, recombination-activating gene (Rag)-1 and terminal deoxynucleosidase (TdT) genes has been used to identify roles of various lymphoid tissues throughout development in the cartilaginous fish, Raja eglanteria (clearnose skate). In embryogenesis, Ig and TCR genes are sharply up-regulated at 8 weeks of development. At this stage TCR and TdT expression is limited to the thymus; later, TCR gene expression appears in peripheral sites in hatchlings and adults, suggesting that the thymus is a source of T cells as in mammals. B cell gene expression indicates more complex roles for the spleen and two special organs of cartilaginous fish-the Leydig and epigonal (gonad-associated) organs. In the adult, the Leydig organ is the site of the highest IgM and IgX expression. However, the spleen is the first site of IgM expression, while IgX is expressed first in gonad, liver, Leydig and even thymus. Distinctive spatiotemporal patterns of Ig light chain gene expression also are seen. A subset of Ig genes is pre-rearranged in the germline of the cartilaginous fish, making expression possible without rearrangement. To assess whether this allows differential developmental regulation, IgM and IgX heavy chain cDNA sequences from specific tissues and developmental stages have been compared with known germline-joined genomic sequences. Both non-productively rearranged genes and germline-joined genes are transcribed in the embryo and hatchling, but not in the adult.

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

A.S.N. Reddy

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The regulation of SR45 mobility by ATP and a transcriptional inhibitor is in contrast to the mobility of SR family splicing factors in animals and suggests fundamental differences in the movement of plant and animals splicing factors. In vivo interaction of U170K with SR45: To analyze the interaction of U170K with SR45, we expressed these proteins fused to RFP and GFP respectively, in protoplasts. Both the reporters co-localized to the same subnuclear domains. To determine direct interaction of these proteins, we fused full-length U170K to one part of split YFP and full-length or truncated version of SR45 to the second half of split YFP. Coexpession of these split YFP constructs resulted in reconstitution of YFP in speckles, suggesting direction interaction of these proteins in vivo (Ali et al., 2008). SR45 is a Novel Plant-Specific Splicing Factor and is Involved in Regulating Multiple Developmental Processes: Using an in vitro splicing complementation assay, we showed that SR45 is an essential splicing factor. The sr45-1 mutant exhibited a number of developmental abnormalities. Further analysis of flowering time has shown that the autonomous pathway of flowering is affected in the mutant. Expression analysis of several flowering genes has revealed that FLC, a key flowering repressor, is up-regulated in the SR45 mutant. Further, alternative splicing pattern of several other SR genes was altered in the sr45-1 mutant in a tissue-specific manner. Hence, the observed pleiotropic effects on various aspects of development are likely due to altered level of SR protein isoforms, which in turn regulate the splicing of other pre-mRNAs. Expression of wild-type SR45 in the mutant complemented the phenotypic defects and changes in alternative splicing of SR genes. SR45 thus is a novel plant-specific splicing factor and plays a crucial role in multiple developmental processes.« less

Time-dependent inhibitory effects of Tris(1, 3-dichloro-2-propyl) phosphate on growth and transcription of genes involved in the GH/IGF axis, but not the HPT axis, in female zebrafish.

PubMed

Zhu, Ya; Su, Guanyong; Yang, Dandong; Zhang, Yongkang; Yu, Liqin; Li, Yufei; Giesy, John P; Letcher, Robert J; Liu, Chunsheng

2017-10-01

Growth curves were used to determine sensitive exposure windows for evaluation of developmental toxicity of chemicals to zebrafish. Dose- and time-dependent effects on body mass, body length and expression of genes involved in the growth hormone/insulin-like growth factor (GH/IGF) axis and the hypothalamic-pituitary-thyroid (HPT) axis were examined after exposure to environmentally relevant concentrations of tris(1,3-dichloro-2-propyl) phosphate (TDCIPP). Based on growth curves, zebrafish grew most rapidly between 60 and 90 days post fertilization (dpf). Exposure to environmentally relevant concentrations of TDCIPP significantly decreased body mass and body length and down-regulated expression of several genes involved in the GH/IGF axis of female zebrafish, but no such effects were observed in male zebrafish. Exposure to TDCIPP did not change concentrations of thyroid hormones or expression of genes along the HPT axis in female and male zebrafish. These results suggest that growth stages of zebrafish between 60 and 90 dpf might be most appropriate for evaluation of developmental toxicity of chemicals, and down-regulation of genes involved in the GH/IGF axis, but not the HPT axis, might be responsible for the observed growth inhibition in females exposed to TDCIPP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differential Expression of Anthocyanin Biosynthetic Genes and Transcription Factor PcMYB10 in Pears (Pyrus communis L.)

PubMed Central

Li, Xi-Hong; Wu, Mao-Yu; Wang, Ai-Li; Jiang, Yu-Qian; Jiang, Yun-Hong

2012-01-01

Anthocyanin biosynthesis in various plants is affected by environmental conditions and controlled by the transcription level of the corresponding genes. In pears (Pyrus communis cv. ‘Wujiuxiang’), anthocyanin biosynthesis is significantly induced during low temperature storage compared with that at room temperature. We further examined the transcriptional levels of anthocyanin biosynthetic genes in ‘Wujiuxiang’ pears during developmental ripening and temperature-induced storage. The expression of genes that encode flavanone 3-hydroxylase, dihydroflavonol 4-reductase, anthocyanidin synthase, UDP-glucose: flavonoid 3-O-glucosyltransferase, and R2R3 MYB transcription factor (PcMYB10) was strongly positively correlated with anthocyanin accumulation in ‘Wujiuxiang’ pears in response to both developmental and cold-temperature induction. Hierarchical clustering analysis revealed the expression patterns of the set of target genes, of which PcMYB10 and most anthocyanin biosynthetic genes were related to the same cluster. The present work may help explore the molecular mechanism that regulates anthocyanin biosynthesis and its response to abiotic stress at the transcriptional level in plants. PMID:23029391

Genome-wide identification and expression profiling reveal tissue-specific expression and differentially-regulated genes involved in gibberellin metabolism between Williams banana and its dwarf mutant.

PubMed

Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming

2016-05-27

Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a better understanding of GA-regulated development in banana. The present results revealed that MaGA20ox4, MaGA20ox5, MaGA20ox7, MaGA2ox7, MaGA2ox12, and MaGA2ox14 were the main genes regulating GA content difference between 8818 and 8818-1. All of these genes may perform important functions in the developmental processes of banana, but each gene may perform different functions in different tissues or during different developmental stages.

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes

PubMed Central

2010-01-01

Background Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Results Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. Conclusions This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research. PMID:20416061

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes.

PubMed

Tarver, Matthew R; Zhou, Xuguo; Scharf, Michael E

2010-04-23

Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research.

Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

PubMed

Abete-Luzi, Patricia; Eisenmann, David M

2018-05-01

The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Genetic Diversity Influences the Response of the Brain to Developmental Lead Exposure

PubMed Central

Schneider, Jay S.; Talsania, Keyur; Mettil, William; Anderson, David W.

2014-01-01

Although extrinsic factors, such as nutritional status, and some intrinsic genetic factors may modify susceptibility to developmental lead (Pb) poisoning, no studies have specifically examined the influence of genetic background on outcomes from Pb exposure. In this study, we used gene microarray profiling to identify Pb-responsive genes in rats of different genetic backgrounds, including inbred (Fischer 344 (F344)) and outbred (Long Evans (LE), Sprague Dawley (SD)) strains, to investigate the role that genetic variation may play in influencing outcomes from developmental Pb exposure. Male and female animals received either perinatal (gestation through lactation) or postnatal (birth through weaning) exposure to Pb in food (0, 250, or 750 ppm). RNA was extracted from the hippocampus at day 55 and hybridized to Affymetrix Rat Gene 1.0 ST Arrays. There were significant strain-specific effects of Pb on the hippocampal transcriptome with 978 transcripts differentially expressed in LE rats across all experimental groups, 269 transcripts differentially expressed in F344 rats, and only 179 transcripts differentially expressed in SD rats. These results were not due to strain-related differences in brain accumulation of Pb. Further, no genes were consistently differentially regulated in all experimental conditions. There was no set of “Pb toxicity” genes that are a molecular signature for Pb neurotoxicity that transcended sex, exposure condition, and strain. These results demonstrate the influence that strain and genetic background play in modifying the brain's response to developmental Pb exposure and may have relevance for better understanding the molecular underpinnings of the lack of a neurobehavioral signature in childhood Pb poisoning. PMID:24913800

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

PubMed

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

A network of epigenetic regulators guides developmental haematopoiesis in vivo.

PubMed

Huang, Hsuan-Ting; Kathrein, Katie L; Barton, Abby; Gitlin, Zachary; Huang, Yue-Hua; Ward, Thomas P; Hofmann, Oliver; Dibiase, Anthony; Song, Anhua; Tyekucheva, Svitlana; Hide, Winston; Zhou, Yi; Zon, Leonard I

2013-12-01

The initiation of cellular programs is orchestrated by key transcription factors and chromatin regulators that activate or inhibit target gene expression. To generate a compendium of chromatin factors that establish the epigenetic code during developmental haematopoiesis, a large-scale reverse genetic screen was conducted targeting orthologues of 425 human chromatin factors in zebrafish. A set of chromatin regulators was identified that target different stages of primitive and definitive blood formation, including factors not previously implicated in haematopoiesis. We identified 15 factors that regulate development of primitive erythroid progenitors and 29 factors that regulate development of definitive haematopoietic stem and progenitor cells. These chromatin factors are associated with SWI/SNF and ISWI chromatin remodelling, SET1 methyltransferase, CBP-p300-HBO1-NuA4 acetyltransferase, HDAC-NuRD deacetylase, and Polycomb repressive complexes. Our work provides a comprehensive view of how specific chromatin factors and their associated complexes play a major role in the establishment of haematopoietic cells in vivo.

Methylation and microRNA-mediated epigenetic regulation of SOCS3

PubMed Central

Boosani, Chandra S.; Agrawal, Devendra K.

2017-01-01

Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

Multi‐layered inhibition of Streptomyces development: BldO is a dedicated repressor of whiB

PubMed Central

Chandra, Govind; Findlay, Kim C.; Buttner, Mark J.

2017-01-01

Summary BldD‐(c‐di‐GMP) sits on top of the regulatory network that controls differentiation in Streptomyces, repressing a large regulon of developmental genes when the bacteria are growing vegetatively. In this way, BldD functions as an inhibitor that blocks the initiation of sporulation. Here, we report the identification and characterisation of BldO, an additional developmental repressor that acts to sustain vegetative growth and prevent entry into sporulation. However, unlike the pleiotropic regulator BldD, we show that BldO functions as the dedicated repressor of a single key target gene, whiB, and that deletion of bldO or constitutive expression of whiB is sufficient to induce precocious hypersporulation. PMID:28271577

Histone deacetylases regulate multicellular development in the social amoeba Dictyostelium discoideum.

PubMed

Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand

2009-09-04

Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.

Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

PubMed

Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

2015-05-29

MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

Transcription regulation by the Mediator complex.

PubMed

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

Transgenesis of the Wolffian duct visualizes dynamic behavior of cells undergoing tubulogenesis in vivo.

PubMed

Atsuta, Yuji; Tadokoro, Ryosuke; Saito, Daisuke; Takahashi, Yoshiko

2013-05-01

Deciphering how the tubulogenesis is regulated is an essential but unsolved issue in developmental biology. Here, using Wolffian duct (WD) formation in chicken embryos, we have developed a novel method that enables gene manipulation during tubulogenesis in vivo. Exploiting that WD arises from a defined site located anteriorly in the embryo (pronephric region), we targeted this region with the enhanced green fluorescent protein (EGFP) gene by the in ovo electroporation technique. EGFP-positive signals were detected in a wide area of elongating WD, where transgenic cells formed an epithelial component in a mosaic manner. Time-lapse live imaging analyses further revealed dynamic behavior of cells during WD elongation: some cells possessed numerous filopodia, and others exhibited cellular tails that repeated elongation and retraction. The retraction of the tail was precisely regulated by Rho activity via actin dynamics. When electroporated with the C3 gene, encoding Rho inhibitor, WD cells failed to contract their tails, resulting in an aberrantly elongated process. We further combined with the Tol2 transposon-mediated gene transfer technique, and could trace EGFP-positive cells at later stages in the ureteric bud sprouting from WD. This is the first demonstration that exogenous gene(s) can directly be introduced into elongating tubular structures in living amniote embryos. This method has opened a way to investigate how a complex tubulogenesis proceeds in higher vertebrates. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

Functional Genomic Analysis of the let-7 Regulatory Network in Caenorhabditis elegans

PubMed Central

Zisoulis, Dimitrios G.; Lovci, Michael T.; Melnik-Martinez, Katya V.; Yeo, Gene W.; Pasquinelli, Amy E.

2013-01-01

The let-7 microRNA (miRNA) regulates cellular differentiation across many animal species. Loss of let-7 activity causes abnormal development in Caenorhabditis elegans and unchecked cellular proliferation in human cells, which contributes to tumorigenesis. These defects are due to improper expression of protein-coding genes normally under let-7 regulation. While some direct targets of let-7 have been identified, the genome-wide effect of let-7 insufficiency in a developing animal has not been fully investigated. Here we report the results of molecular and genetic assays aimed at determining the global network of genes regulated by let-7 in C. elegans. By screening for mis-regulated genes that also contribute to let-7 mutant phenotypes, we derived a list of physiologically relevant potential targets of let-7 regulation. Twenty new suppressors of the rupturing vulva or extra seam cell division phenotypes characteristic of let-7 mutants emerged. Three of these genes, opt-2, prmt-1, and T27D12.1, were found to associate with Argonaute in a let-7–dependent manner and are likely novel direct targets of this miRNA. Overall, a complex network of genes with various activities is subject to let-7 regulation to coordinate developmental timing across tissues during worm development. PMID:23516374

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

Distinct Contributions of Conserved Modules to Runt Transcription Factor Activity

PubMed Central

Walrad, Pegine B.; Hang, Saiyu; Joseph, Genevieve S.; Salas, Julia

2010-01-01

Runx proteins play vital roles in regulating transcription in numerous developmental pathways throughout the animal kingdom. Two Runx protein hallmarks are the DNA-binding Runt domain and a C-terminal VWRPY motif that mediates interaction with TLE/Gro corepressor proteins. A phylogenetic analysis of Runt, the founding Runx family member, identifies four distinct regions C-terminal to the Runt domain that are conserved in Drosophila and other insects. We used a series of previously described ectopic expression assays to investigate the functions of these different conserved regions in regulating gene expression during embryogenesis and in controlling axonal projections in the developing eye. The results indicate each conserved region is required for a different subset of activities and identify distinct regions that participate in the transcriptional activation and repression of the segmentation gene sloppy-paired-1 (slp1). Interestingly, the C-terminal VWRPY-containing region is not required for repression but instead plays a role in slp1 activation. Genetic experiments indicating that Groucho (Gro) does not participate in slp1 regulation further suggest that Runt's conserved C-terminus interacts with other factors to promote transcriptional activation. These results provide a foundation for further studies on the molecular interactions that contribute to the context-dependent properties of Runx proteins as developmental regulators. PMID:20462957

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

PubMed

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

C. elegans sym-1 is a downstream target of the hunchback-like-1 developmental timing transcription factor

PubMed Central

Niwa, Ryusuke; Hada, Kazumasa; Moliyama, Kouichi; Ohniwa, Ryosuke L.; Tan, Yi-Meng; Olsson-Carter, Katherine; Chi, Woo; Reinke, Valerie; Slack, Frank J.

2010-01-01

In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) and its family members control the timing of key developmental events in part by directly regulating expression of hunchback-like-1 (hbl-1). C. elegans hbl-1 mutants display multiple developmental timing deficiencies, including cell cycle defects during larval development. While hbl-1 is predicted to encode a transcriptional regulator, downstream targets of HBL-1 have not been fully elucidated. Here we report using microarray analysis to uncover genes downstream of HBL-1. We established a transgenic strain that overexpresses hbl-1 under the control of a heat shock promoter. Heat shock-induced hbl-1 overexpression led to retarded hypodermal structures at the adult stage, opposite to the effect seen in loss of function (lf) hbl-1 mutants. The microarray screen identified numerous potential genes that are upregulated or downregulated by HBL-1, including sym-1, which encodes a leucine-rich repeat protein with a signal sequence. We found an increase in sym-1 transcription in the heat shock-induced hbl-1 overexpression strain, while loss of hbl-1 function caused a decrease in sym-1 expression levels. Furthermore, we found that sym-1(lf) modified the hypodermal abnormalities in hbl-1 mutants. Given that SYM-1 is a protein secreted from hypodermal cells to the surrounding cuticle, we propose that the adult-specific cuticular structures may be under the temporal control of HBL-1 through regulation of sym-1 transcription. PMID:19923914

A spontaneous eggplant (Solanum melongena L.) color mutant conditions anthocyanin-free fruit pigmentation

USDA-ARS?s Scientific Manuscript database

Induced or spontaneously occuring color mutants in plants provide valuable tools for elucidating the genetic and developmental regulation of genes that influence pigmentation. We identified a single plant of the eggplant (Solanum melongena) cultivar Black Beauty bearing green fruit. Black Beauty no...

DELAY OF GERMINATION1 (DOG1) regulates both seed dormancy and flowering time through microRNA pathways

PubMed Central

Huo, Heqiang; Wei, Shouhui; Bradford, Kent J.

2016-01-01

Seed germination and flowering, two critical developmental transitions in plant life cycles, are coordinately regulated by genetic and environmental factors to match plant establishment and reproduction to seasonal cues. The DELAY OF GERMINATION1 (DOG1) gene is involved in regulating seed dormancy in response to temperature and has also been associated genetically with pleiotropic flowering phenotypes across diverse Arabidopsis thaliana accessions and locations. Here we show that DOG1 can regulate seed dormancy and flowering times in lettuce (Lactuca sativa, Ls) and Arabidopsis through an influence on levels of microRNAs (miRNAs) miR156 and miR172. In lettuce, suppression of LsDOG1 expression enabled seed germination at high temperature and promoted early flowering in association with reduced miR156 and increased miR172 levels. In Arabidopsis, higher miR156 levels resulting from overexpression of the MIR156 gene enhanced seed dormancy and delayed flowering. These phenotypic effects, as well as conversion of MIR156 transcripts to miR156, were compromised in DOG1 loss-of-function mutant plants, especially in seeds. Overexpression of MIR172 reduced seed dormancy and promoted early flowering in Arabidopsis, and the effect on flowering required functional DOG1. Transcript levels of several genes associated with miRNA processing were consistently lower in dry seeds of Arabidopsis and lettuce when DOG1 was mutated or its expression was reduced; in contrast, transcript levels of these genes were elevated in a DOG1 gain-of-function mutant. Our results reveal a previously unknown linkage between two critical developmental phase transitions in the plant life cycle through a DOG1–miR156–miR172 interaction. PMID:27035986

Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

PubMed Central

Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

2016-01-01

Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator

PubMed Central

Grants, Jennifer M.; Goh, Grace Y. S.; Taubert, Stefan

2015-01-01

The Mediator multiprotein complex (‘Mediator’) is an important transcriptional coregulator that is evolutionarily conserved throughout eukaryotes. Although some Mediator subunits are essential for the transcription of all protein-coding genes, others influence the expression of only subsets of genes and participate selectively in cellular signaling pathways. Here, we review the current knowledge of Mediator subunit function in the nematode Caenorhabditis elegans, a metazoan in which established and emerging genetic technologies facilitate the study of developmental and physiological regulation in vivo. In this nematode, unbiased genetic screens have revealed critical roles for Mediator components in core developmental pathways such as epidermal growth factor (EGF) and Wnt/β-catenin signaling. More recently, important roles for C. elegans Mediator subunits have emerged in the regulation of lipid metabolism and of systemic stress responses, engaging conserved transcription factors such as nuclear hormone receptors (NHRs). We emphasize instances where similar functions for individual Mediator subunits exist in mammals, highlighting parallels between Mediator subunit action in nematode development and in human cancer biology. We also discuss a parallel between the association of the Mediator subunit MED12 with several human disorders and the role of its C. elegans ortholog mdt-12 as a regulatory hub that interacts with numerous signaling pathways. PMID:25634893

PreImplantation factor (PIF*) promotes embryotrophic and neuroprotective decidual genes: effect negated by epidermal growth factor.

PubMed

Duzyj, Christina M; Paidas, Michael J; Jebailey, Lellean; Huang, Jing Shun; Barnea, Eytan R

2014-01-01

Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF's embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. PIF's effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer's and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases-autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development and hormone signaling, while downregulating genes protecting against xenobiotic response leading to connective tissue disorders. In both HESC and FTDC, PIF affects neural development and transmission pathways. In HESC interactome, PIF promotes FUS gene, which controls genome integrity, while in FTDC, PIF upregulates STAT3 critical transcription signal. EGF abolished PIF's effect on HESC, decreasing metalloproteinase and prolactin receptor genes, thereby interfering with decidualization, while in FTDC, EGF co-cultured with PIF reduced ZHX2, gene that regulates neural AFP secretion. PIF promotes decidual trophic genes and proteins to regulate neural development. By regulating the uterine milieu, PIF may decrease embryo vulnerability to post-natal neurodevelopmental disorders. Examination of PIF-based intervention strategies used during embryogenesis to improve pregnancy prognosis and reduce post-natal vulnerability is clearly in order.

PreImplantation factor (PIF*) promotes embryotrophic and neuroprotective decidual genes: effect negated by epidermal growth factor

PubMed Central

2014-01-01

Background Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF’s embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. Methods PIF’s effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. Results In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer’s and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases—autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development and hormone signaling, while downregulating genes protecting against xenobiotic response leading to connective tissue disorders. In both HESC and FTDC, PIF affects neural development and transmission pathways. In HESC interactome, PIF promotes FUS gene, which controls genome integrity, while in FTDC, PIF upregulates STAT3 critical transcription signal. EGF abolished PIF’s effect on HESC, decreasing metalloproteinase and prolactin receptor genes, thereby interfering with decidualization, while in FTDC, EGF co-cultured with PIF reduced ZHX2, gene that regulates neural AFP secretion. Conclusions PIF promotes decidual trophic genes and proteins to regulate neural development. By regulating the uterine milieu, PIF may decrease embryo vulnerability to post-natal neurodevelopmental disorders. Examination of PIF-based intervention strategies used during embryogenesis to improve pregnancy prognosis and reduce post-natal vulnerability is clearly in order. PMID:26085845

Understanding developmental and adaptive cues in pine through metabolite profiling and co-expression network analysis

PubMed Central

Cañas, Rafael A.; Canales, Javier; Muñoz-Hernández, Carmen; Granados, Jose M.; Ávila, Concepción; García-Martín, María L.; Cánovas, Francisco M.

2015-01-01

Conifers include long-lived evergreen trees of great economic and ecological importance, including pines and spruces. During their long lives conifers must respond to seasonal environmental changes, adapt to unpredictable environmental stresses, and co-ordinate their adaptive adjustments with internal developmental programmes. To gain insights into these responses, we examined metabolite and transcriptomic profiles of needles from naturally growing 25-year-old maritime pine (Pinus pinaster L. Aiton) trees over a year. The effect of environmental parameters such as temperature and rain on needle development were studied. Our results show that seasonal changes in the metabolite profiles were mainly affected by the needles’ age and acclimation for winter, but changes in transcript profiles were mainly dependent on climatic factors. The relative abundance of most transcripts correlated well with temperature, particularly for genes involved in photosynthesis or winter acclimation. Gene network analysis revealed relationships between 14 co-expressed gene modules and development and adaptation to environmental stimuli. Novel Myb transcription factors were identified as candidate regulators during needle development. Our systems-based analysis provides integrated data of the seasonal regulation of maritime pine growth, opening new perspectives for understanding the complex regulatory mechanisms underlying conifers’ adaptive responses. Taken together, our results suggest that the environment regulates the transcriptome for fine tuning of the metabolome during development. PMID:25873654

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

SETDB1 modulates PRC2 activity at developmental genes independently of H3K9 trimethylation in mouse ES cells

PubMed Central

Fei, Qi; Yang, Xiaoqin; Jiang, Hua; Wang, Qian; Yu, Yanyan; Yu, Yiling; Yi, Wei; Zhou, Shaolian; Chen, Taiping; Lu, Chris; Atadja, Peter; Liu, Xiaole Shirley; Li, En; Zhang, Yong; Shou, Jianyong

2015-01-01

SETDB1, a histone methyltransferase responsible for methylation of histone H3 lysine 9 (H3K9), is involved in maintenance of embryonic stem (ES) cells and early embryonic development of the mouse. However, how SETDB1 regulates gene expression during development is largely unknown. Here, we characterized genome-wide SETDB1 binding and H3K9 trimethylation (H3K9me3) profiles in mouse ES cells and uncovered two distinct classes of SETDB1 binding sites, termed solo and ensemble peaks. The solo peaks were devoid of H3K9me3 and enriched near developmental regulators while the ensemble peaks were associated with H3K9me3. A subset of the SETDB1 solo peaks, particularly those near neural development–related genes, was found to be associated with Polycomb Repressive Complex 2 (PRC2) as well as PRC2-interacting proteins JARID2 and MTF2. Genetic deletion of Setdb1 reduced EZH2 binding as well as histone 3 lysine 27 (H3K27) trimethylation level at SETDB1 solo peaks and facilitated neural differentiation. Furthermore, we found that H3K27me3 inhibits SETDB1 methyltransferase activity. The currently identified reciprocal action between SETDB1 and PRC2 reveals a novel mechanism underlying ES cell pluripotency and differentiation regulation. PMID:26160163

Comprehensive transcriptional map of primate brain development

PubMed Central

Bakken, Trygve E.; Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A.; Ng, Lydia; Szafer, Aaron; Dalley, Rachel A.; Royall, Joshua J.; Lemon, Tracy; Shapouri, Sheila; Aiona, Kaylynn; Arnold, James; Bennett, Jeffrey L.; Bertagnolli, Darren; Bickley, Kristopher; Boe, Andrew; Brouner, Krissy; Butler, Stephanie; Byrnes, Emi; Caldejon, Shiella; Carey, Anita; Cate, Shelby; Chapin, Mike; Chen, Jefferey; Dee, Nick; Desta, Tsega; Dolbeare, Tim A.; Dotson, Nadia; Ebbert, Amanda; Fulfs, Erich; Gee, Garrett; Gilbert, Terri L.; Goldy, Jeff; Gourley, Lindsey; Gregor, Ben; Gu, Guangyu; Hall, Jon; Haradon, Zeb; Haynor, David R.; Hejazinia, Nika; Hoerder-Suabedissen, Anna; Howard, Robert; Jochim, Jay; Kinnunen, Marty; Kriedberg, Ali; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Luong, Lon; Mastan, Naveed; May, Ryan; Melchor, Jose; Mosqueda, Nerick; Mott, Erika; Ngo, Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana; Pendergraft, Julie; Potekhina, Lydia; Reding, Melissa; Riley, Zackery L.; Roberts, Tyson; Rogers, Brandon; Roll, Kate; Rosen, David; Sandman, David; Sarreal, Melaine; Shapovalova, Nadiya; Shi, Shu; Sjoquist, Nathan; Sodt, Andy J.; Townsend, Robbie; Velasquez, Lissette; Wagley, Udi; Wakeman, Wayne B.; White, Cassandra; Bennett, Crissa; Wu, Jennifer; Young, Rob; Youngstrom, Brian L.; Wohnoutka, Paul; Gibbs, Richard A.; Rogers, Jeffrey; Hohmann, John G.; Hawrylycz, Michael J.; Hevner, Robert F.; Molnár, Zoltán; Phillips, John W.; Dang, Chinh; Jones, Allan R.; Amaral, David G.; Bernard, Amy; Lein, Ed S.

2017-01-01

The transcriptional underpinnings of brain development remain poorly understood, particularly in humans and closely related non-human primates. We describe a high resolution transcriptional atlas of rhesus monkey brain development that combines dense temporal sampling of prenatal and postnatal periods with fine anatomical parcellation of cortical and subcortical regions associated with human neuropsychiatric disease. Gene expression changes more rapidly before birth, both in progenitor cells and maturing neurons, and cortical layers and areas acquire adult-like molecular profiles surprisingly late postnatally. Disparate cell populations exhibit distinct developmental timing but also unexpected synchrony of processes underlying neural circuit construction including cell projection and adhesion. Candidate risk genes for neurodevelopmental disorders including primary microcephaly, autism spectrum disorder, intellectual disability, and schizophrenia show disease-specific spatiotemporal enrichment within developing neocortex. Human developmental expression trajectories are more similar to monkey than rodent, and approximately 9% of genes show human-specific regulation with evidence for prolonged maturation or neoteny. PMID:27409810

mus304 encodes a novel DNA damage checkpoint protein required during Drosophila development

PubMed Central

Brodsky, Michael H.; Sekelsky, Jeff J.; Tsang, Garson; Hawley, R. Scott; Rubin, Gerald M.

2000-01-01

Checkpoints block cell cycle progression in eukaryotic cells exposed to DNA damaging agents. We show that several Drosophila homologs of checkpoint genes, mei-41, grapes, and 14-3-3ε, regulate a DNA damage checkpoint in the developing eye. We have used this assay to show that the mutagen-sensitive gene mus304 is also required for this checkpoint. mus304 encodes a novel coiled-coil domain protein, which is targeted to the cytoplasm. Similar to mei-41, mus304 is required for chromosome break repair and for genomic stability. mus304 animals also exhibit three developmental defects, abnormal bristle morphology, decreased meiotic recombination, and arrested embryonic development. We suggest that these phenotypes reflect distinct developmental consequences of a single underlying checkpoint defect. Similar mechanisms may account for the puzzling array of symptoms observed in humans with mutations in the ATM tumor suppressor gene. PMID:10733527

Mechanisms and pathways of growth failure in primordial dwarfism

PubMed Central

Klingseisen, Anna; Jackson, Andrew P.

2011-01-01

The greatest difference between species is size; however, the developmental mechanisms determining organism growth remain poorly understood. Primordial dwarfism is a group of human single-gene disorders with extreme global growth failure (which includes Seckel syndrome, microcephalic osteodysplastic primordial dwarfism I [MOPD] types I and II, and Meier-Gorlin syndrome). Ten genes have now been identified for microcephalic primordial dwarfism, encoding proteins involved in fundamental cellular processes including genome replication (ORC1 [origin recognition complex 1], ORC4, ORC6, CDT1, and CDC6), DNA damage response (ATR [ataxia-telangiectasia and Rad3-related]), mRNA splicing (U4atac), and centrosome function (CEP152, PCNT, and CPAP). Here, we review the cellular and developmental mechanisms underlying the pathogenesis of these conditions and address whether further study of these genes could provide novel insight into the physiological regulation of organism growth. PMID:21979914

Circular RNAs: analysis, expression and potential functions

PubMed Central

Salzman, Julia

2016-01-01

Just a few years ago, it had been assumed that the dominant RNA isoforms produced from eukaryotic genes were variants of messenger RNA, functioning as intermediates in gene expression. In early 2012, however, a surprising discovery was made: circular RNA (circRNA) was shown to be a transcriptional product in thousands of human and mouse genes and in hundreds of cases constituted the dominant RNA isoform. Subsequent studies revealed that the expression of circRNAs is developmentally regulated, tissue and cell-type specific, and shared across the eukaryotic tree of life. These features suggest important functions for these molecules. Here, we describe major advances in the field of circRNA biology, focusing on the regulation of and functional roles played by these molecules. PMID:27246710

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster.

PubMed

Landis, Gary; Shen, Jie; Tower, John

2012-11-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging.

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster

PubMed Central

Landis, Gary; Shen, Jie; Tower, John

2012-01-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging. PMID:23211361

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs).

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Han, Jeonghoon; Kim, Hui-Su; Hwang, Dae-Sik; Lee, Jae-Seong

2017-02-01

Ecdysteroid hormones are pivotal in the development, growth, and molting of arthropods, and the hormone pathway is triggered by binding ecdysteroid to a heterodimer of the two nuclear receptors; ecdysone receptors (EcR) and ultraspiracle (USP). We have characterized EcR and USP genes, and their 5'-untranslated region (5'-UTR) from the copepod Paracyclopina nana, and studied mRNA transcription levels in post-embryonic stages and in response to water accommodated fractions (WAFs) of crude oil. The open reading frames (ORF) of EcR and USP were 1470 and 1287bp that encoded 490 and 429 amino acids with molecular weight of 121.18 and 105.03kDa, respectively. Also, a well conserved DNA-binding domain (DBD) and ligand-binding domain (LBD) were identified which confirmed by phylogenetic analysis. Messenger RNA transcriptional levels of EcR and USP were developmental stage-specific in early post-embryonic stages (N3-4). However, an evoked expression of USP was observed throughout copepodid stage and in adult females. WAFs (40 and 80%) were acted as an ecdysone agonist in P. nana, and elicited the mRNA transcription levels in adults. Developmental stage-specific transcriptional activation of EcR and USP in response to WAFs was observed. USP gene was down-regulated in the nauplius in response to WAF, whereas up-regulation of USP was observed in the adults. This study represents the first data of molecular elucidation of EcR and USP genes and their regulatory elements from P. nana and the developmental stage specific expression in response to WAFs, which can be used as potential biomarkers for environmental stressors with ecotoxicological evaluations in copepods. Copyright © 2016 Elsevier Inc. All rights reserved.

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses1[OPEN

PubMed Central

Andrade, Paola; Caudepón, Daniel; Arró, Montserrat

2016-01-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. PMID:27382138

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses.

PubMed

Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert

2016-09-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016 American Society of Plant Biologists. All rights reserved.

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

DkPK Genes Promote Natural Deastringency in C-PCNA Persimmon by Up-regulating DkPDC and DkADH Expression

PubMed Central

Guan, Changfei; Du, Xiaoyun; Zhang, Qinglin; Ma, Fengwang; Luo, Zhengrong; Yang, Yong

2017-01-01

The astringency of Chinese pollination-constant non-astringent (C-PCNA) persimmon (Diospyros kaki Thunb.) can be naturally removed on the tree. This process is controlled by a single locus and is dominant against other types of persimmons; therefore, this variant is an important candidate for commercial cultivation and the breeding of PCNA cultivars. In our previous study, six full-length coding sequences (CDS) for pyruvate kinase genes (DkPK1-6) were isolated, and DkPK1 is thought to be involved in the natural deastringency of C-PCNA persimmon fruit. Here, we characterize the eight other DkPK genes (DkPK7-14) from C-PCNA persimmon fruit based on transcriptome data. The transcript changes in DkPK7-14 genes and correlations with the proanthocyanidin (PA) content were investigated during different fruit development stages in C-PCNA, J-PCNA, and non-PCNA persimmon; DkPK7 and DkPK8 exhibited up-regulation patterns during the last developmental stage in C-PCNA persimmon that was negatively correlated with the decrease in soluble PAs. Phylogenetic analysis and subcellular localization analysis revealed that DkPK7 and DkPK8 are cytosolic proteins. Notably, DkPK7 and DkPK8 were ubiquitously expressed in various persimmon organs and abundantly up-regulated in seeds. Furthermore, transient over-expression of DkPK7 and DkPK8 in persimmon leaves led to a significant decrease in the content of soluble PAs but a significant increase in the expression levels of the pyruvate decarboxylase (DkPDC) and alcohol dehydrogenase genes (DkADH), which are closely related to acetaldehyde metabolism. The accumulated acetaldehyde that results from the up-regulation of the DkPDC and DkADH genes can combine with soluble PAs to form insoluble PAs, resulting in the removal of astringency from persimmon fruit. Thus, we suggest that both DkPK7 and DkPK8 are likely to be involved in natural deastringency via the up-regulation of DkPDC and DkADH expression during the last developmental stage in C-PCNA persimmon. PMID:28243247

Gene Expression Data from the Moon Jelly, Aurelia, Provide Insights into the Evolution of the Combinatorial Code Controlling Animal Sense Organ Development.

PubMed

Nakanishi, Nagayasu; Camara, Anthony C; Yuan, David C; Gold, David A; Jacobs, David K

2015-01-01

In Bilateria, Pax6, Six, Eya and Dach families of transcription factors underlie the development and evolution of morphologically and phyletically distinct eyes, including the compound eyes in Drosophila and the camera-type eyes in vertebrates, indicating that bilaterian eyes evolved under the strong influence of ancestral developmental gene regulation. However the conservation in eye developmental genetics deeper in the Eumetazoa, and the origin of the conserved gene regulatory apparatus controlling eye development remain unclear due to limited comparative developmental data from Cnidaria. Here we show in the eye-bearing scyphozoan cnidarian Aurelia that the ectodermal photosensory domain of the developing medusa sensory structure known as the rhopalium expresses sine oculis (so)/six1/2 and eyes absent/eya, but not optix/six3/6 or pax (A&B). In addition, the so and eya co-expression domain encompasses the region of active cell proliferation, neurogenesis, and mechanoreceptor development in rhopalia. Consistent with the role of so and eya in rhopalial development, developmental transcriptome data across Aurelia life cycle stages show upregulation of so and eya, but not optix or pax (A&B), during medusa formation. Moreover, pax6 and dach are absent in the Aurelia genome, and thus are not required for eye development in Aurelia. Our data are consistent with so and eya, but not optix, pax or dach, having conserved functions in sensory structure specification across Eumetazoa. The lability of developmental components including Pax genes relative to so-eya is consistent with a model of sense organ development and evolution that involved the lineage specific modification of a combinatorial code that specifies animal sense organs.

microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach.

PubMed

Macchiaroli, Natalia; Cucher, Marcela; Zarowiecki, Magdalena; Maldonado, Lucas; Kamenetzky, Laura; Rosenzvit, Mara Cecilia

2015-02-06

microRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in fundamental biological processes such as development and metabolism. The particular developmental and metabolic characteristics of cestode parasites highlight the importance of studying miRNA gene regulation in these organisms. Here, we perform a comprehensive analysis of miRNAs in the parasitic cestode Echinococcus canadensis G7, one of the causative agents of the neglected zoonotic disease cystic echinococcosis. Small RNA libraries from protoscoleces and cyst walls of E. canadensis G7 and protoscoleces of E. granulosus sensu stricto G1 were sequenced using Illumina technology. For miRNA prediction, miRDeep2 core algorithm was used. The output list of candidate precursors was manually curated to generate a high confidence set of miRNAs. Differential expression analysis of miRNAs between stages or species was estimated with DESeq. Expression levels of selected miRNAs were validated using poly-A RT-qPCR. In this study we used a high-throughput approach and found transcriptional evidence of 37 miRNAs thus expanding the miRNA repertoire of E. canadensis G7. Differential expression analysis showed highly regulated miRNAs between life cycle stages, suggesting a role in maintaining the features of each developmental stage or in the regulation of developmental timing. In this work we characterize conserved and novel Echinococcus miRNAs which represent 30 unique miRNA families. Here we confirmed the remarkable loss of conserved miRNA families in E. canadensis, reflecting their low morphological complexity and high adaptation to parasitism. We performed the first in-depth study profiling of small RNAs in the zoonotic parasite E. canadensis G7. We found that miRNAs are the preponderant small RNA silencing molecules, suggesting that these small RNAs could be an essential mechanism of gene regulation in this species. We also identified both parasite specific and divergent miRNAs which are potential biomarkers of infection. This study will provide valuable information for better understanding of the complex biology of this parasite and could help to find new potential targets for therapy and/or diagnosis.

DEVELOPMENTAL NEUROTOXICITY OF ORGANOPHOSPHATES TARGETS CELL CYCLE AND APOPTOSIS, REVEALED BY TRANSCRIPTIONAL PROFILES IN VIVO AND IN VITRO

PubMed Central

Slotkin, Theodore A.; Seidler, Frederic J.

2012-01-01

Developmental organophosphate exposure reduces the numbers of neural cells, contributing to neurobehavioral deficits. We administered chlorpyrifos or diazinon to newborn rats on postnatal days 1–4, in doses straddling the threshold for barely-detectable cholinesterase, and evaluated gene expression in the cell cycle and apoptosis pathways on postnatal day 5. Both organophosphates evoked transcriptional changes in 20–25% of the genes in each category; chlorpyrifos and diazinon targeted the same genes, with similar magnitudes of change, as evidenced by high concordance. Furthermore, the same effects were obtained with doses above or below the threshold for cholinesterase inhibition, indicating a mechanism unrelated to anticholinesterase actions. We then evaluated the effects of chlorpyrifos in undifferentiated and differentiating PC12 cells and found even greater targeting of cell cycle and apoptosis genes, affecting up to 40% of all genes in the pathways. Notably, the genes affected in undifferentiated cells were not concordant with those in differentiating cells, pointing to dissimilar outcomes dependent on developmental stage. The in vitro model successfully identified 60–70% of the genes affected by chlorpyrifos in vivo, indicating that the effects are exerted directly on developing neural cells. Our results show that organophosphates target the genes regulating the cell cycle and apoptosis in the developing brain and in neuronotypic cells in culture, with the pattern of vulnerability dependent on the specific stage of development. Equally important, these effects do not reflect actions on cholinesterase and operate at exposures below the threshold for any detectable inhibition of this enzyme. PMID:22222554

Developmental neurotoxicity of organophosphates targets cell cycle and apoptosis, revealed by transcriptional profiles in vivo and in vitro.

PubMed

Slotkin, Theodore A; Seidler, Frederic J

2012-03-01

Developmental organophosphate exposure reduces the numbers of neural cells, contributing to neurobehavioral deficits. We administered chlorpyrifos or diazinon to newborn rats on postnatal days 1-4, in doses straddling the threshold for barely-detectable cholinesterase inhibition, and evaluated gene expression in the cell cycle and apoptosis pathways on postnatal day 5. Both organophosphates evoked transcriptional changes in 20-25% of the genes in each category; chlorpyrifos and diazinon targeted the same genes, with similar magnitudes of change, as evidenced by high concordance. Furthermore, the same effects were obtained with doses above or below the threshold for cholinesterase inhibition, indicating a mechanism unrelated to anticholinesterase actions. We then evaluated the effects of chlorpyrifos in undifferentiated and differentiating PC12 cells and found even greater targeting of cell cycle and apoptosis genes, affecting up to 40% of all genes in the pathways. Notably, the genes affected in undifferentiated cells were not concordant with those in differentiating cells, pointing to dissimilar outcomes dependent on developmental stage. The in vitro model successfully identified 60-70% of the genes affected by chlorpyrifos in vivo, indicating that the effects are exerted directly on developing neural cells. Our results show that organophosphates target the genes regulating the cell cycle and apoptosis in the developing brain and in neuronotypic cells in culture, with the pattern of vulnerability dependent on the specific stage of development. Equally important, these effects do not reflect actions on cholinesterase and operate at exposures below the threshold for any detectable inhibition of this enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

Molecular dissection of transcriptional reprogramming of steviol glycosides synthesis in leaf tissue during developmental phase transitions in Stevia rebaudiana Bert.

PubMed

Singh, Gopal; Singh, Gagandeep; Singh, Pradeep; Parmar, Rajni; Paul, Navgeet; Vashist, Radhika; Swarnkar, Mohit Kumar; Kumar, Ashok; Singh, Sanatsujat; Singh, Anil Kumar; Kumar, Sanjay; Sharma, Ram Kumar

2017-09-19

Stevia is a natural source of commercially important steviol glycosides (SGs), which share biosynthesis route with gibberellic acids (GAs) through plastidal MEP and cytosolic MVA pathways. Ontogeny-dependent deviation in SGs biosynthesis is one of the key factor for global cultivation of Stevia, has not been studied at transcriptional level. To dissect underlying molecular mechanism, we followed a global transcriptome sequencing approach and generated more than 100 million reads. Annotation of 41,262 de novo assembled transcripts identified all the genes required for SGs and GAs biosynthesis. Differential gene expression and quantitative analysis of important pathway genes (DXS, HMGR, KA13H) and gene regulators (WRKY, MYB, NAC TFs) indicated developmental phase dependent utilization of metabolic flux between SGs and GAs synthesis. Further, identification of 124 CYPs and 45 UGTs enrich the genomic resources, and their PPI network analysis with SGs/GAs biosynthesis proteins identifies putative candidates involved in metabolic changes, as supported by their developmental phase-dependent expression. These putative targets can expedite molecular breeding and genetic engineering efforts to enhance SGs content, biomass and yield. Futuristically, the generated dataset will be a useful resource for development of functional molecular markers for diversity characterization, genome mapping and evolutionary studies in Stevia.

Patterns of expression of position-dependent integrated transgenes in mouse embryo.

PubMed Central

Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

1990-01-01

The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

Decoding transcriptional enhancers: Evolving from annotation to functional interpretation

PubMed Central

Engel, Krysta L.; Mackiewicz, Mark; Hardigan, Andrew A.; Myers, Richard M.; Savic, Daniel

2016-01-01

Deciphering the intricate molecular processes that orchestrate the spatial and temporal regulation of genes has become an increasingly major focus of biological research. The differential expression of genes by diverse cell types with a common genome is a hallmark of complex cellular functions, as well as the basis for multicellular life. Importantly, a more coherent understanding of gene regulation is critical for defining developmental processes, evolutionary principles and disease etiologies. Here we present our current understanding of gene regulation by focusing on the role of enhancer elements in these complex processes. Although functional genomic methods have provided considerable advances to our understanding of gene regulation, these assays, which are usually performed on a genome-wide scale, typically provide correlative observations that lack functional interpretation. Recent innovations in genome editing technologies have placed gene regulatory studies at an exciting crossroads, as systematic, functional evaluation of enhancers and other transcriptional regulatory elements can now be performed in a coordinated, high-throughput manner across the entire genome. This review provides insights on transcriptional enhancer function, their role in development and disease, and catalogues experimental tools commonly used to study these elements. Additionally, we discuss the crucial role of novel techniques in deciphering the complex gene regulatory landscape and how these studies will shape future research. PMID:27224938

Decoding transcriptional enhancers: Evolving from annotation to functional interpretation.

PubMed

Engel, Krysta L; Mackiewicz, Mark; Hardigan, Andrew A; Myers, Richard M; Savic, Daniel

2016-09-01

Deciphering the intricate molecular processes that orchestrate the spatial and temporal regulation of genes has become an increasingly major focus of biological research. The differential expression of genes by diverse cell types with a common genome is a hallmark of complex cellular functions, as well as the basis for multicellular life. Importantly, a more coherent understanding of gene regulation is critical for defining developmental processes, evolutionary principles and disease etiologies. Here we present our current understanding of gene regulation by focusing on the role of enhancer elements in these complex processes. Although functional genomic methods have provided considerable advances to our understanding of gene regulation, these assays, which are usually performed on a genome-wide scale, typically provide correlative observations that lack functional interpretation. Recent innovations in genome editing technologies have placed gene regulatory studies at an exciting crossroads, as systematic, functional evaluation of enhancers and other transcriptional regulatory elements can now be performed in a coordinated, high-throughput manner across the entire genome. This review provides insights on transcriptional enhancer function, their role in development and disease, and catalogues experimental tools commonly used to study these elements. Additionally, we discuss the crucial role of novel techniques in deciphering the complex gene regulatory landscape and how these studies will shape future research. Copyright © 2016 Elsevier Ltd. All rights reserved.

Combinatorial Regulation of Stilbene Synthase Genes by WRKY and MYB Transcription Factors in Grapevine (Vitis vinifera L.).

PubMed

Vannozzi, Alessandro; Wong, Darren Chern Jan; Höll, Janine; Hmmam, Ibrahim; Matus, José Tomás; Bogs, Jochen; Ziegler, Tobias; Dry, Ian; Barcaccia, Gianni; Lucchin, Margherita

2018-05-01

Stilbene synthase (STS) is the key enzyme leading to the biosynthesis of resveratrol. Recently we reported two R2R3-MYB transcription factor (TF) genes that regulate the stilbene biosynthetic pathway in grapevine: VviMYB14 and VviMYB15. These genes are strongly co-expressed with STS genes under a range of stress and developmental conditions, in agreement with the specific activation of STS promoters by these TFs. Genome-wide gene co-expression analysis using two separate transcriptome compendia based on microarray and RNA sequencing data revealed that WRKY TFs were the top TF family correlated with STS genes. On the basis of correlation frequency, four WRKY genes, namely VviWRKY03, VviWRKY24, VviWRKY43 and VviWRKY53, were further shortlisted and functionally validated. Expression analyses under both unstressed and stressed conditions, together with promoter-luciferase reporter assays, suggested different hierarchies for these TFs in the regulation of the stilbene biosynthetic pathway. In particular, VviWRKY24 seems to act as a singular effector in the activation of the VviSTS29 promoter, while VviWRKY03 acts through a combinatorial effect with VviMYB14, suggesting that these two regulators may interact at the protein level as previously reported in other species.

Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

PubMed

Sundararajan, Vignesh; Civetta, Alberto

2011-01-01

Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

Life-cycle and growth-phase-dependent regulation of the ubiquitin genes of Trypanosoma cruzi.

PubMed

Manning-Cela, Rebeca; Jaishankar, Sobha; Swindle, John

2006-07-01

Trypanosoma cruzi, the causative agent of Chagas disease, exhibits a complex life cycle that is accompanied by the stage-specific gene expression. At the molecular level, very little is known about gene regulation in trypanosomes. Complex gene organizations coupled with polycistronic transcription units make the analysis of regulated gene expression difficult in trypanosomes. The ubiquitin genes of T. cruzi are a good example of this complexity. They are organized as a single cluster containing five ubiquitin fusion (FUS) and five polyubiquitin (PUB) genes that are polycistronically transcribed but expressed differently in response to developmental and environmental changes. Gene replacements were used to study FUS and PUB gene expression at different stages of growth and at different points in the life cycle of T. cruzi. Based on the levels of reporter gene expression, it was determined that FUS1 expression was downregulated as the parasites approached stationary phase, whereas PUB12.5 polyubiquitin gene expression increased. Conversely, FUS1 expression increases when epimastigotes and amastigotes differentiate into trypomastigotes, whereas the expression of PUB12.5 decreases when epimastigotes differentiate into amastigotes and trypomastigotes. Although the level of CAT activity in logarithmic growing epimastigotes is six- to seven-fold higher when the gene was expressed from the FUS1 locus than when expressed from the PUB12.5 locus, the rate of transcription from the two loci was the same implying that post-transcriptional mechanisms play a dominant role in the regulation of gene expression.

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis)

USDA-ARS?s Scientific Manuscript database

Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and ...

MicroRNA Transcriptome Profiles During Swine Skeletal Muscle Development

USDA-ARS?s Scientific Manuscript database

MicroRNA (miR) are a class of small RNAs that regulate gene expression by inhibiting translation of protein encoding transcripts. To evaluate the role of miR in skeletal muscle of swine, global microRNA abundance was measured at specific developmental stages including proliferating satellite cells,...

Assessment of bone mineral status in children with Marfan syndrome

USDA-ARS?s Scientific Manuscript database

Marfan syndrome (MFS) is an autosomal dominant connective tissue disorder with skeletal involvement. It is caused by mutations in fibrillin1 (FBN1) gene resulting in activation of TGF-ßeta, which developmentally regulates bone mass and matrix properties. There is no consensus regarding bone minerali...

Developmental and Environmental Regulation of AaeIAP1 Transcript in Aedes aegypti

DTIC Science & Technology

2008-01-01

libitum. Emerged adults were transferred to a new screened cage, and adult samples were col- lected at different times after emergence. Bovine blood...and J. Zhang. 2007. The Aedes albopictus inhibitor of apoptosis 1 gene protects verte- brate cells from bluetongue virus-induced apoptosis. In- sect

Profiling the transcriptome of Gracilaria changii (Rhodophyta) in response to light deprivation.

PubMed

Ho, Chai-Ling; Teoh, Seddon; Teo, Swee-Sen; Rahim, Raha Abdul; Phang, Siew-Moi

2009-01-01

Light regulates photosynthesis, growth and reproduction, yield and properties of phycocolloids, and starch contents in seaweeds. Despite its importance as an environmental cue that regulates many developmental, physiological, and biochemical processes, the network of genes involved during light deprivation are obscure. In this study, we profiled the transcriptome of Gracilaria changii at two different irradiance levels using a cDNA microarray containing more than 3,000 cDNA probes. Microarray analysis revealed that 93 and 105 genes were up- and down-regulated more than 3-fold under light deprivation, respectively. However, only 50% of the transcripts have significant matches to the nonredundant peptide sequences in the database. The transcripts that accumulated under light deprivation include vanadium chloroperoxidase, thioredoxin, ferredoxin component, and reduced nicotinamide adenine dinucleotide dehydrogenase. Among the genes that were down-regulated under light deprivation were genes encoding light harvesting protein, light harvesting complex I, phycobilisome 7.8 kDa linker polypeptide, low molecular weight early light-inducible protein, and vanadium bromoperoxidase. Our findings also provided important clues to the functions of many unknown sequences that could not be annotated using sequence comparison.

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

Molecular processes of transgenerational acclimation to a warming ocean

NASA Astrophysics Data System (ADS)

Veilleux, Heather D.; Ryu, Taewoo; Donelson, Jennifer M.; van Herwerden, Lynne; Seridi, Loqmane; Ghosheh, Yanal; Berumen, Michael L.; Leggat, William; Ravasi, Timothy; Munday, Philip L.

2015-12-01

Some animals have the remarkable capacity to acclimate across generations to projected future climate change; however, the underlying molecular processes are unknown. We sequenced and assembled de novo transcriptomes of adult tropical reef fish exposed developmentally or transgenerationally to projected future ocean temperatures and correlated the resulting expression profiles with acclimated metabolic traits from the same fish. We identified 69 contigs representing 53 key genes involved in thermal acclimation of aerobic capacity. Metabolic genes were among the most upregulated transgenerationally, suggesting shifts in energy production for maintaining performance at elevated temperatures. Furthermore, immune- and stress-responsive genes were upregulated transgenerationally, indicating a new complement of genes allowing the second generation of fish to better cope with elevated temperatures. Other differentially expressed genes were involved with tissue development and transcriptional regulation. Overall, we found a similar suite of differentially expressed genes among developmental and transgenerational treatments. Heat-shock protein genes were surprisingly unresponsive, indicating that short-term heat-stress responses may not be a good indicator of long-term acclimation capacity. Our results are the first to reveal the molecular processes that may enable marine fishes to adjust to a future warmer environment over multiple generations.

Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera).

PubMed

Zeng, Yanling; Tan, Xiaofeng; Zhang, Lin; Jiang, Nan; Cao, Heping

2014-01-01

Tea oil tree (Camellia oleifera, Co) provides a fine edible oil source in China. Tea oil from the seeds is very beneficial to human health. Fructose-1,6-bisphosphate aldolase (FBA) hydrolyzes fructose-1,6-bisphosphate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, two critical metabolites for oil biosynthesis. The objectives of this study were to identify FBA genes and investigate the relationship between FBA gene expression and oil content in developing seeds of tea oil tree. In this paper, four developmentally up-regulated CoFBA genes were identified in Camellia oleifera seeds based on the transcriptome from two seed developmental stages corresponding to the initiation and peak stages of lipid biosynthesis. The expression of CoFBA genes, along with three key oil biosynthesis genes CoACP, CoFAD2 and CoSAD were analyzed in seeds from eight developmental stages by real-time quantitative PCR. The oil content and fatty acid composition were also analyzed. The results showed that CoFBA and CoSAD mRNA levels were well-correlated with oil content whereas CoFAD2 gene expression levels were correlated with fatty acid composition in Camellia seeds. We propose that CoFBA and CoSAD are two important factors for determining tea oil yield because CoFBA gene controls the flux of key intermediates for oil biosynthesis and CoSAD gene controls the synthesis of oleic acid, which accounts for 80% of fatty acids in tea oil. These findings suggest that tea oil yield could be improved by enhanced expression of CoFBA and CoSAD genes in transgenic plants.

SWI/SNF regulates half of its targets without the need of ATP-driven nucleosome remodeling by Brahma.

PubMed

Jordán-Pla, Antonio; Yu, Simei; Waldholm, Johan; Källman, Thomas; Östlund Farrants, Ann-Kristin; Visa, Neus

2018-05-18

Brahma (BRM) is the only catalytic subunit of the SWI/SNF chromatin-remodeling complex of Drosophila melanogaster. The function of SWI/SNF in transcription has long been attributed to its ability to remodel nucleosomes, which requires the ATPase activity of BRM. However, recent studies have provided evidence for a non-catalytic function of BRM in the transcriptional regulation of a few specific genes. Here we have used RNA-seq and ChIP-seq to identify the BRM target genes in S2 cells, and we have used a catalytically inactive BRM mutant (K804R) that is unable to hydrolyze ATP to investigate the magnitude of the non-catalytic function of BRM in transcription regulation. We show that 49% of the BRM target genes in S2 cells are regulated through mechanisms that do not require BRM to have an ATPase activity. We also show that the catalytic and non-catalytic mechanisms of SWI/SNF regulation operate on two subsets of genes that differ in promoter architecture and are linked to different biological processes. This study shows that the non-catalytic role of SWI/SNF in transcription regulation is far more prevalent than previously anticipated and that the genes that are regulated by SWI/SNF through ATPase-dependent and ATPase-independent mechanisms have specialized roles in different cellular and developmental processes.

Chromatin programming by developmentally regulated transcription factors: lessons from the study of haematopoietic stem cell specification and differentiation.

PubMed

Obier, Nadine; Bonifer, Constanze

2016-11-01

Although the body plan of individuals is encoded in their genomes, each cell type expresses a different gene expression programme and therefore has access to only a subset of this information. Alterations to gene expression programmes are the underlying basis for the differentiation of multiple cell types and are driven by tissue-specific transcription factors (TFs) that interact with the epigenetic regulatory machinery to programme the chromatin landscape into transcriptionally active and inactive states. The haematopoietic system has long served as a paradigm for studying the molecular principles that regulate gene expression in development. In this review article, we summarize the current knowledge on the mechanism of action of TFs regulating haematopoietic stem cell specification and differentiation, and place this information into the context of general principles governing development. © 2016 Federation of European Biochemical Societies.

Deciphering the Role of POLYCOMB REPRESSIVE COMPLEX1 Variants in Regulating the Acquisition of Flowering Competence in Arabidopsis1

PubMed Central

Picó, Sara; Merini, Wiam

2015-01-01

Polycomb group (PcG) proteins play important roles in regulating developmental phase transitions in plants; however, little is known about the role of the PcG machinery in regulating the transition from juvenile to adult phase. Here, we show that Arabidopsis (Arabidopsis thaliana) B lymphoma Moloney murine leukemia virus insertion region1 homolog (BMI1) POLYCOMB REPRESSIVE COMPLEX1 (PRC1) components participate in the repression of microRNA156 (miR156). Loss of AtBMI1 function leads to the up-regulation of the primary transcript of MIR156A and MIR156C at the time the levels of miR156 should decline, resulting in an extended juvenile phase and delayed flowering. Conversely, the PRC1 component EMBRYONIC FLOWER (EMF1) participates in the regulation of SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE and MIR172 genes. Accordingly, plants impaired in EMF1 function displayed misexpression of these genes early in development, which contributes to a CONSTANS-independent up-regulation of FLOWERING LOCUS T (FT) leading to the earliest flowering phenotype described in Arabidopsis. Our findings show how the different regulatory roles of two functional PRC1 variants coordinate the acquisition of flowering competence and help to reach the threshold of FT necessary to flower. Furthermore, we show how two central regulatory mechanisms, such as PcG and microRNA, assemble to achieve a developmental outcome. PMID:25897002

Deciphering the Role of POLYCOMB REPRESSIVE COMPLEX1 Variants in Regulating the Acquisition of Flowering Competence in Arabidopsis.

PubMed

Picó, Sara; Ortiz-Marchena, M Isabel; Merini, Wiam; Calonje, Myriam

2015-08-01

Polycomb group (PcG) proteins play important roles in regulating developmental phase transitions in plants; however, little is known about the role of the PcG machinery in regulating the transition from juvenile to adult phase. Here, we show that Arabidopsis (Arabidopsis thaliana) B lymphoma Moloney murine leukemia virus insertion region1 homolog (BMI1) POLYCOMB REPRESSIVE COMPLEX1 (PRC1) components participate in the repression of microRNA156 (miR156). Loss of AtBMI1 function leads to the up-regulation of the primary transcript of MIR156A and MIR156C at the time the levels of miR156 should decline, resulting in an extended juvenile phase and delayed flowering. Conversely, the PRC1 component EMBRYONIC FLOWER (EMF1) participates in the regulation of SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE and MIR172 genes. Accordingly, plants impaired in EMF1 function displayed misexpression of these genes early in development, which contributes to a CONSTANS-independent up-regulation of FLOWERING LOCUS T (FT) leading to the earliest flowering phenotype described in Arabidopsis. Our findings show how the different regulatory roles of two functional PRC1 variants coordinate the acquisition of flowering competence and help to reach the threshold of FT necessary to flower. Furthermore, we show how two central regulatory mechanisms, such as PcG and microRNA, assemble to achieve a developmental outcome. © 2015 American Society of Plant Biologists. All Rights Reserved.

HDAC2 deregulation in tumorigenesis is causally connected to repression of immune modulation and defense escape

PubMed Central

Conte, Mariarosaria; Dell'Aversana, Carmela; Benedetti, Rosaria; Petraglia, Francesca; Carissimo, Annamaria; Petrizzi, Valeria Belsito; D'Arco, Alfonso Maria; Abbondanza, Ciro; Nebbioso, Angela; Altucci, Lucia

2015-01-01

Histone deacetylase 2 (HDAC2) is overexpressed or mutated in several disorders such as hematological cancers, and plays a critical role in transcriptional regulation, cell cycle progression and developmental processes. Here, we performed comparative transcriptome analyses in acute myeloid leukemia to investigate the biological implications of HDAC2 silencing versus its enzymatic inhibition using epigenetic-based drug(s). By gene expression analysis of HDAC2-silenced vs wild-type cells, we found that HDAC2 has a specific role in leukemogenesis. Gene expression profiling of U937 cell line with or without treatment of the well-known HDAC inhibitor vorinostat (SAHA) identifies and characterizes several gene clusters where inhibition of HDAC2 ‘mimics’ its silencing, as well as those where HDAC2 is selectively and exclusively regulated by HDAC2 protein expression levels. These findings may represent an important tool for better understanding the mechanisms underpinning immune regulation, particularly in the study of major histocompatibility complex class II genes. PMID:25473896

Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch.

PubMed

Millimaki, Bonny B; Sweet, Elly M; Dhason, Mary S; Riley, Bruce B

2007-01-01

Hair cells of the inner ear develop from an equivalence group marked by expression of the proneural gene Atoh1. In mouse, Atoh1 is necessary for hair cell differentiation, but its role in specifying the equivalence group (proneural function) has been questioned and little is known about its upstream activators. We have addressed these issues in zebrafish. Two zebrafish homologs, atoh1a and atoh1b, are together necessary for hair cell development. These genes crossregulate each other but are differentially required during distinct developmental periods, first in the preotic placode and later in the otic vesicle. Interactions with the Notch pathway confirm that atoh1 genes have early proneural function. Fgf3 and Fgf8 are upstream activators of atoh1 genes during both phases, and foxi1, pax8 and dlx genes regulate atoh1b in the preplacode. A model is presented in which zebrafish atoh1 genes operate in a complex network leading to hair cell development.

Transcriptome analysis of PCOS arrested 2-cell embryos.

PubMed

Lu, Cuiling; Chi, Hongbin; Wang, Yapeng; Feng, Xue; Wang, Lina; Huang, Shuo; Yan, Liying; Lin, Shengli; Liu, Ping; Qiao, Jie

2018-06-18

In an attempt to explore the early developmental arrest in embryos from polycystic ovarian syndrome (PCOS) patients, we sequenced the transcriptome profiles of PCOS arrested 2-cell embryos, non-PCOS arrested 2-cell embryos and non-arrested 2-cell embryos using single-cell RNA-Seq technique. Differential expression analysis was performed using the DEGSeq R package. Gene Ontology (GO) enrichment was analyzed using the GOseq R package. Data revealed 62 differentially expressed genes between non-PCOS arrested and PCOS arrested embryos and 2217 differentially expressed genes between PCOS arrested and non-arrested 2-cell embryos. A total of 49 differently expressed genes (DEGs) were annotated with GO terms in the up-regulated genes between PCOS arrested and non-PCOS arrested embryos after GO enrichment. A total of 29 DEGs were annotated with GO terms in the down-regulated genes between PCOS arrested and non-arrested 2-cell embryos after GO enrichment. These data can provide a reference for screening specific genes involved in the arrest of PCOS embryos.

Physcomitrella MADS-box genes regulate water supply and sperm movement for fertilization.

PubMed

Koshimizu, Shizuka; Kofuji, Rumiko; Sasaki-Sekimoto, Yuko; Kikkawa, Masahide; Shimojima, Mie; Ohta, Hiroyuki; Shigenobu, Shuji; Kabeya, Yukiko; Hiwatashi, Yuji; Tamada, Yosuke; Murata, Takashi; Hasebe, Mitsuyasu

2018-01-01

MIKC classic (MIKC C )-type MADS-box genes encode transcription factors that function in various developmental processes, including angiosperm floral organ identity. Phylogenetic analyses of the MIKC C -type MADS-box family, including genes from non-flowering plants, suggest that the increased numbers of these genes in flowering plants is related to their functional divergence; however, their precise functions in non-flowering plants and their evolution throughout land plant diversification are unknown. Here, we show that MIKC C -type MADS-box genes in the moss Physcomitrella patens function in two ways to enable fertilization. Analyses of protein localization, deletion mutants and overexpression lines of all six genes indicate that three MIKC C -type MADS-box genes redundantly regulate cell division and growth in the stems for appropriate external water conduction, as well as the formation of sperm with motile flagella. The former function appears to be maintained in the flowering plant lineage, while the latter was lost in accordance with the loss of sperm.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Spatial mapping and quantification of developmental branching morphogenesis.

PubMed

Short, Kieran; Hodson, Mark; Smyth, Ian

2013-01-15

Branching morphogenesis is a fundamental developmental mechanism that shapes the formation of many organs. The complex three-dimensional shapes derived by this process reflect equally complex genetic interactions between branching epithelia and their surrounding mesenchyme. Despite the importance of this process to normal adult organ function, analysis of branching has been stymied by the absence of a bespoke method to quantify accurately the complex spatial datasets that describe it. As a consequence, although many developmentally important genes are proposed to influence branching morphogenesis, we have no way of objectively assessing their individual contributions to this process. We report the development of a method for accurately quantifying many aspects of branching morphogenesis and we demonstrate its application to the study of organ development. As proof of principle we have employed this approach to analyse the developing mouse lung and kidney, describing the spatial characteristics of the branching ureteric bud and pulmonary epithelia. To demonstrate further its capacity to profile unrecognised genetic contributions to organ development, we examine Tgfb2 mutant kidneys, identifying elements of both developmental delay and specific spatial dysmorphology caused by haplo-insufficiency for this gene. This technical advance provides a crucial resource that will enable rigorous characterisation of the genetic and environmental factors that regulate this essential and evolutionarily conserved developmental mechanism.

Identification and characterization of cis-acting elements involved in the regulation of ABA- and/or GA-mediated LuPLR1 gene expression and lignan biosynthesis in flax (Linum usitatissimum L.) cell cultures.

PubMed

Corbin, Cyrielle; Renouard, Sullivan; Lopez, Tatiana; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe

2013-03-15

Pinoresinol lariciresinol reductase 1, encoded by the LuPLR1 gene in flax (Linum usitatissimum L.), is responsible for the biosynthesis of (+)-secoisolariciresinol, a cancer chemopreventive phytoestrogenic lignan accumulated in high amount in the hull of flaxseed. Our recent studies have demonstrated a key role of abscisic acid (ABA) in the regulation of LuPLR1 gene expression and thus of the (+)-secoisolariciresinol synthesis during the flax seedcoat development. It is well accepted that gibberellins (GA) and ABA play antagonistic roles in the regulation of numerous developmental processes; therefore it is of interest to clarify their respective effects on lignan biosynthesis. Herein, using flax cell suspension cultures, we demonstrate that LuPLR1 gene expression and (+)-secoisolariciresinol synthesis are up-regulated by ABA and down-regulated by GA. The LuPLR1 gene promoter analysis and mutation experiments allow us to identify and characterize two important cis-acting sequences (ABRE and MYB2) required for these regulations. These results imply that a cross-talk between ABA and GA signaling orchestrated by transcription factors is involved in the regulation of lignan biosynthesis. This is particularly evidenced in the case of the ABRE cis-regulatory sequence of LuPLR1 gene promoter that appears to be a common target sequence of GA and ABA signals. Copyright © 2012 Elsevier GmbH. All rights reserved.

Chromatin dynamics in plants.

PubMed

Fransz, Paul F; de Jong, J Hans

2002-12-01

Recent studies in yeast, animals and plants have provided major breakthroughs in unraveling the molecular mechanism of higher-order gene regulation. In conjunction with the DNA code, proteins that are involved in chromatin remodeling, histone modification and epigenetic imprinting form a large network of interactions that control the nuclear programming of cell identity. New insight into how chromatin conformations are regulated in plants sheds light on the relationships between chromosome function, cell differentiation and developmental patterns.

Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

PubMed

Cho, Jungnam; Paszkowski, Jerzy

2017-08-26

It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

Sucrose affects the developmental transition of rhizomes in Oryza longistaminata.

PubMed

Bessho-Uehara, Kanako; Nugroho, Jovano Erris; Kondo, Hirono; Angeles-Shim, Rosalyn B; Ashikari, Motoyuki

2018-05-08

Oryza longistaminata, the African wild rice, can propagate vegetatively through rhizomes. Rhizomes elongate horizontally underground as sink organs, however, they undergo a developmental transition that shifts their growth to the surface of the ground to become aerial stems. This particular stage is essential for the establishment of new ramets. While several determinants such as abiotic stimuli and plant hormones have been reported as key factors effecting developmental transition in aerial stem, the cause of this phenomenon in rhizome remains elusive. This study shows that depletion of nutrients, particularly sucrose, is the key stimulus that induces the developmental transition in rhizomes, as indicated by the gradient of sugars from the base to the tip of the rhizome. Sugar treatments revealed that sucrose specifically represses the developmental transition from rhizome to aerial stem by inhibiting the expression of sugar metabolism and hormone synthesis genes at the bending point. Sucrose depletion affected several factors contributing to the developmental transition of rhizome including signal transduction, transcriptional regulation and plant hormone balance.

Microarray Analyses of Gene Expression during Adventitious Root Development in Pinus contorta1[w

PubMed Central

Brinker, Monika; van Zyl, Leonel; Liu, Wenbin; Craig, Deborah; Sederoff, Ronald R.; Clapham, David H.; von Arnold, Sara

2004-01-01

In order to investigate the gene expression pattern during adventitious root development, RNA of Pinus contorta hypocotyls, pulse-treated with the auxin indole-3-butyric acid and harvested at distinct developmental time points of root development, was hybridized to microarrays containing 2,178 cDNAs from Pinus taeda. Over the period of observation of root development, the transcript levels of 220 genes changed significantly. During the root initiation phase, genes involved in cell replication and cell wall weakening and a transcript encoding a PINHEAD/ZWILLE-like protein were up-regulated, while genes related to auxin transport, photosynthesis, and cell wall synthesis were down-regulated. In addition, there were changes in transcript abundance of genes related to water stress. During the root meristem formation phase the transcript abundances of genes involved in auxin transport, auxin responsive transcription, and cell wall synthesis, and of a gene encoding a B-box zinc finger-like protein, increased, while those encoding proteins involved in cell wall weakening decreased. Changes of transcript abundance of genes related to water stress during the root meristem formation and root formation phase indicate that the plant roots had become functional in water transport. Simultaneously, genes involved in auxin transport were up-regulated, while genes related to cell wall modification were down-regulated. Finally, during the root elongation phase down-regulation of transcripts encoding proteins involved in cell replication and stress occurred. Based on the observed changes in transcript abundances, we suggest hypotheses about the relative importance of various physiological processes during the auxin-induced development of roots in P. contorta. PMID:15247392

Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

PubMed Central

Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

2014-01-01

Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus

PubMed Central

Eijlander, Robyn T.; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P.

2016-01-01

Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus, whereas this is not observed in Bacillus subtilis. Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus ΔspoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes. PMID:27790204

SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus.

PubMed

Eijlander, Robyn T; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P

2016-01-01

Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus , whereas this is not observed in Bacillus subtilis . Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus Δ spoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes.

Differential gene expression related to Nora virus infection of Drosophila melanogaster.

PubMed

Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

2013-08-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish

PubMed Central

Sasaki, Tomoyuki; Kishi, Shuji

2013-01-01

The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. PMID:23660559

Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

PubMed Central

Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

2011-01-01

PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

Evaluation of reference genes for insect olfaction studies.

PubMed

Omondi, Bonaventure Aman; Latorre-Estivalis, Jose Manuel; Rocha Oliveira, Ivana Helena; Ignell, Rickard; Lorenzo, Marcelo Gustavo

2015-04-22

Quantitative reverse transcription PCR (qRT-PCR) is a robust and accessible method to assay gene expression and to infer gene regulation. Being a chain of procedures, this technique is subject to systematic error due to biological and technical limitations mainly set by the starting material and downstream procedures. Thus, rigorous data normalization is critical to grant reliability and repeatability of gene expression quantification by qRT-PCR. A number of 'housekeeping genes', involved in basic cellular functions, have been commonly used as internal controls for this normalization process. However, these genes could themselves be regulated and must therefore be tested a priori. We evaluated eight potential reference genes for their stability as internal controls for RT-qPCR studies of olfactory gene expression in the antennae of Rhodnius prolixus, a Chagas disease vector. The set of genes included were: α-tubulin; β-actin; Glyceraldehyde-3-phosphate dehydrogenase; Eukaryotic initiation factor 1A; Glutathione-S-transferase; Serine protease; Succinate dehydrogenase; and Glucose-6-phosphate dehydrogenase. Five experimental conditions, including changes in age,developmental stage and feeding status were tested in both sexes. We show that the evaluation of candidate reference genes is necessary for each combination of sex, tissue and physiological condition analyzed in order to avoid inconsistent results and conclusions. Although, Normfinder and geNorm software yielded different results between males and females, five genes (SDH, Tub, GAPDH, Act and G6PDH) appeared in the first positions in all rankings obtained. By using gene expression data of a single olfactory coreceptor gene as an example, we demonstrated the extent of changes expected using different internal standards. This work underlines the need for a rigorous selection of internal standards to grant the reliability of normalization processes in qRT-PCR studies. Furthermore, we show that particular physiological or developmental conditions require independent evaluation of a diverse set of potential reference genes.

Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

PubMed

Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

2015-11-01

The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

PubMed

Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

2016-09-08

The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

Thyroid hormone regulates the expression of the sonic hedgehog signaling pathway in the embryonic and adult Mammalian brain.

PubMed

Desouza, Lynette A; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E; Kottmann, Andreas H; Tole, Shubha; Vaidya, Vidita A

2011-05-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and hyperthyroidism bidirectionally influenced Shh mRNA in embryonic forebrain signaling centers at stages before fetal thyroid hormone synthesis. Further, Smo and Ptc expression were significantly decreased in the forebrain of embryos derived from hypothyroid dams. Adult-onset thyroid hormone perturbations also regulated expression of the Shh pathway bidirectionally, with a significant induction of Shh, Ptc, and Smo after hyperthyroidism and a decline in Smo expression in the hypothyroid brain. Short-term T₃ administration resulted in a significant induction of cortical Shh mRNA expression and also enhanced reporter gene expression in Shh(+/LacZ) mice. Further, acute T₃ treatment of cortical neuronal cultures resulted in a rapid and significant increase in Shh mRNA, suggesting direct effects. Chromatin immunoprecipitation assays performed on adult neocortex indicated enhanced histone acetylation at the Shh promoter after acute T₃ administration, providing further support that Shh is a thyroid hormone-responsive gene. Our results indicate that maternal and adult-onset perturbations of euthyroid status cause robust and region-specific changes in the Shh pathway in the embryonic and adult forebrain, implicating Shh as a possible mechanistic link for specific neurodevelopmental effects of thyroid hormone.

Developmental Regulation of an Adhesin Gene during Cellular Morphogenesis in the Fungal Pathogen Candida albicans▿ †

PubMed Central

Argimón, Silvia; Wishart, Jill A.; Leng, Roger; Macaskill, Susan; Mavor, Abigail; Alexandris, Thomas; Nicholls, Susan; Knight, Andrew W.; Enjalbert, Brice; Walmsley, Richard; Odds, Frank C.; Gow, Neil A. R.; Brown, Alistair J. P.

2007-01-01

Candida albicans expresses specific virulence traits that promote disease establishment and progression. These traits include morphological transitions between yeast and hyphal growth forms that are thought to contribute to dissemination and invasion and cell surface adhesins that promote attachment to the host. Here, we describe the regulation of the adhesin gene ALS3, which is expressed specifically during hyphal development in C. albicans. Using a combination of reporter constructs and regulatory mutants, we show that this regulation is mediated by multiple factors at the transcriptional level. The analysis of ALS3 promoter deletions revealed that this promoter contains two activation regions: one is essential for activation during hyphal development, while the second increases the amplitude of this activation. Further deletion analyses using the Renilla reniformis luciferase reporter delineate the essential activation region between positions −471 and −321 of the promoter. Further 5′ or 3′ deletions block activation. ALS3 transcription is repressed mainly by Nrg1 and Tup1, but Rfg1 contributes to this repression. Efg1, Tec1, and Bcr1 are essential for the transcriptional activation of ALS3, with Tec1 mediating its effects indirectly through Bcr1 rather than through the putative Tec1 sites in the ALS3 promoter. ALS3 transcription is not affected by Cph2, but Cph1 contributes to full ALS3 activation. The data suggest that multiple morphogenetic signaling pathways operate through the promoter of this adhesin gene to mediate its developmental regulation in this major fungal pathogen. PMID:17277173

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis).

PubMed

Zhou, Xiangjun; Fei, Zhangjun; Thannhauser, Theodore W; Li, Li

2011-11-23

Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5) was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant.

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis)

PubMed Central

2011-01-01

Background Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Results Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5) was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. Conclusions The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant. PMID:22112144

Epigenetic mechanisms in developmental programming of adult disease

PubMed Central

Chen, Man; Zhang, Lubo

2011-01-01

Adverse insults during intrauterine life can result in permanent changes in the physiology and metabolism of the offspring, which in turn leads to an increased risk of disease in adulthood. This is an adaptational response by the fetus to changes in the environmental signals that it receives during early life to ensure its survival and prepare itself for postnatal life. Increasing evidence suggests that the epigenetic regulation of gene expression patterns has a crucial role in the developmental programming of adult disease. This review summarizes recent studies of epigenetic mechanisms and focuses particularly on studies that explore identifiable epigenetic biomarkers in the promoters of specific disease-associated genes. Such biomarkers would enable early recognition of children who might be at risk of developing adult disease with fetal origins. PMID:21945859

Phenotypic Checkpoints Regulate Neuronal Development

PubMed Central

Ben-Ari, Yehezkel; Spitzer, Nicholas C.

2010-01-01

Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191

Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

PubMed Central

Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

2013-01-01

Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

LHP1 Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome

PubMed Central

Ariel, Federico; Latrasse, David; Mariappan, Kiruthiga Gayathri; Kim, Soon-Kap; Crespi, Martin; Hirt, Heribert; Bergounioux, Catherine; Raynaud, Cécile; Benhamed, Moussa

2016-01-01

Precise expression patterns of genes in time and space are essential for proper development of multicellular organisms. Dynamic chromatin conformation and spatial organization of the genome constitute a major step in this regulation to modulate developmental outputs. Polycomb repressive complexes (PRCs) mediate stable or flexible gene repression in response to internal and environmental cues. In Arabidopsis thaliana, LHP1 co-localizes with H3K27me3 epigenetic marks throughout the genome and interacts with PRC1 and PRC2 members as well as with a long noncoding RNA. Here, we show that LHP1 is responsible for the spreading of H3K27me3 towards the 3’ end of the gene body. We also identified a subset of LHP1-activated genes and demonstrated that LHP1 shapes local chromatin topology in order to control transcriptional co-regulation. Our work reveals a general role of LHP1 from local to higher conformation levels of chromatin configuration to determine its accessibility to define gene expression patterns. PMID:27410265

Prediction of C. elegans Longevity Genes by Human and Worm Longevity Networks

PubMed Central

de Magalhães, João Pedro; Ruvkun, Gary; Fraifeld, Vadim E.; Curran, Sean P.

2012-01-01

Intricate and interconnected pathways modulate longevity, but screens to identify the components of these pathways have not been saturating. Because biological processes are often executed by protein complexes and fine-tuned by regulatory factors, the first-order protein-protein interactors of known longevity genes are likely to participate in the regulation of longevity. Data-rich maps of protein interactions have been established for many cardinal organisms such as yeast, worms, and humans. We propose that these interaction maps could be mined for the identification of new putative regulators of longevity. For this purpose, we have constructed longevity networks in both humans and worms. We reasoned that the essential first-order interactors of known longevity-associated genes in these networks are more likely to have longevity phenotypes than randomly chosen genes. We have used C. elegans to determine whether post-developmental inactivation of these essential genes modulates lifespan. Our results suggest that the worm and human longevity networks are functionally relevant and possess a high predictive power for identifying new longevity regulators. PMID:23144747

Common developmental genome deprogramming in schizophrenia - Role of Integrative Nuclear FGFR1 Signaling (INFS).

PubMed

Narla, S T; Lee, Y-W; Benson, C A; Sarder, P; Brennand, K J; Stachowiak, E K; Stachowiak, M K

2017-07-01

The watershed-hypothesis of schizophrenia asserts that over 200 different mutations dysregulate distinct pathways that converge on an unspecified common mechanism(s) that controls disease ontogeny. Consistent with this hypothesis, our RNA-sequencing of neuron committed cells (NCCs) differentiated from established iPSCs of 4 schizophrenia patients and 4 control subjects uncovered a dysregulated transcriptome of 1349 mRNAs common to all patients. Data reveals a global dysregulation of developmental genome, deconstruction of coordinated mRNA networks, and the formation of aberrant, new coordinated mRNA networks indicating a concerted action of the responsible factor(s). Sequencing of miRNA transcriptomes demonstrated an overexpression of 16 miRNAs and deconstruction of interactive miRNA-mRNA networks in schizophrenia NCCs. ChiPseq revealed that the nuclear (n) form of FGFR1, a pan-ontogenic regulator, is overexpressed in schizophrenia NCCs and overtargets dysregulated mRNA and miRNA genes. The nFGFR1 targeted 54% of all human gene promoters and 84.4% of schizophrenia dysregulated genes. The upregulated genes reside within major developmental pathways that control neurogenesis and neuron formation, whereas downregulated genes are involved in oligodendrogenesis. Our results indicate (i) an early (preneuronal) genomic etiology of schizophrenia, (ii) dysregulated genes and new coordinated gene networks are common to unrelated cases of schizophrenia, (iii) gene dysregulations are accompanied by increased nFGFR1-genome interactions, and (iv) modeling of increased nFGFR1 by an overexpression of a nFGFR1 lead to up or downregulation of selected genes as observed in schizophrenia NCCs. Together our results designate nFGFR1 signaling as a potential common dysregulated mechanism in investigated patients and potential therapeutic target in schizophrenia. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Dynamic expression of ancient and novel molluscan shell genes during ecological transitions

PubMed Central

Jackson, Daniel J; Wörheide, Gert; Degnan, Bernard M

2007-01-01

Background The Mollusca constitute one of the most morphologically and ecologically diverse metazoan phyla, occupying a wide range of marine, terrestrial and freshwater habitats. The evolutionary success of the molluscs can in part be attributed to the evolvability of the external shell. Typically, the shell first forms during embryonic and larval development, changing dramatically in shape, colour and mineralogical composition as development and maturation proceeds. Major developmental transitions in shell morphology often correlate with ecological transitions (e.g. from a planktonic to benthic existence at metamorphosis). While the genes involved in molluscan biomineralisation are beginning to be identified, there is little understanding of how these are developmentally regulated, or if the same genes are operational at different stages of the mollusc's life. Results Here we relate the developmental expression of nine genes in the tissue responsible for shell production – the mantle – to ecological transitions that occur during the lifetime of the tropical abalone Haliotis asinina (Vetigastropoda). Four of these genes encode evolutionarily ancient proteins, while four others encode secreted proteins with little or no identity to known proteins. Another gene has been previously described from the mantle of another haliotid vetigastropod. All nine genes display dynamic spatial and temporal expression profiles within the larval shell field and juvenile mantle. Conclusion These expression data reflect the regulatory complexity that underlies molluscan shell construction from larval stages to adulthood, and serves to highlight the different ecological demands placed on each stage. The use of both ancient and novel genes in all stages of shell construction also suggest that a core set of shell-making genes was provided by a shared metazoan ancestor, which has been elaborated upon to produce the range of molluscan shell types we see today. PMID:17845714

Neuron class-specific requirements for Fragile X Mental Retardation Protein in critical period development of calcium signaling in learning and memory circuitry.

PubMed

Doll, Caleb A; Broadie, Kendal

2016-05-01

Neural circuit optimization occurs through sensory activity-dependent mechanisms that refine synaptic connectivity and information processing during early-use developmental critical periods. Fragile X Mental Retardation Protein (FMRP), the gene product lost in Fragile X syndrome (FXS), acts as an activity sensor during critical period development, both as an RNA-binding translation regulator and channel-binding excitability regulator. Here, we employ a Drosophila FXS disease model to assay calcium signaling dynamics with a targeted transgenic GCaMP reporter during critical period development of the mushroom body (MB) learning/memory circuit. We find FMRP regulates depolarization-induced calcium signaling in a neuron-specific manner within this circuit, suppressing activity-dependent calcium transients in excitatory cholinergic MB input projection neurons and enhancing calcium signals in inhibitory GABAergic MB output neurons. Both changes are restricted to the developmental critical period and rectified at maturity. Importantly, conditional genetic (dfmr1) rescue of null mutants during the critical period corrects calcium signaling defects in both neuron classes, indicating a temporally restricted FMRP requirement. Likewise, conditional dfmr1 knockdown (RNAi) during the critical period replicates constitutive null mutant defects in both neuron classes, confirming cell-autonomous requirements for FMRP in developmental regulation of calcium signaling dynamics. Optogenetic stimulation during the critical period enhances depolarization-induced calcium signaling in both neuron classes, but this developmental change is eliminated in dfmr1 null mutants, indicating the activity-dependent regulation requires FMRP. These results show FMRP shapes neuron class-specific calcium signaling in excitatory vs. inhibitory neurons in developing learning/memory circuitry, and that FMRP mediates activity-dependent regulation of calcium signaling specifically during the early-use critical period. Copyright © 2016 Elsevier Inc. All rights reserved.

Developmental Control of Cell-Cycle Compensation Provides a Switch for Patterned Mitosis at the Onset of Chordate Neurulation.

PubMed

Ogura, Yosuke; Sasakura, Yasunori

2016-04-18

During neurulation of chordate ascidians, the 11th mitotic division within the epidermal layer shows a posterior-to-anterior wave that is precisely coordinated with the unidirectional progression of the morphogenetic movement. Here we show that the first sign of this patterned mitosis is an asynchronous anterior-to-posterior S-phase length and that mitotic synchrony is reestablished by a compensatory asynchronous G2-phase length. Live imaging combined with genetic experiments demonstrated that compensatory G2-phase regulation requires transcriptional activation of the G2/M regulator cdc25 by the patterning genes GATA and AP-2. The downregulation of GATA and AP-2 at the onset of neurulation leads to loss of compensatory G2-phase regulation and promotes the transition to patterned mitosis. We propose that such developmentally regulated cell-cycle compensation provides an abrupt switch to spatially patterned mitosis in order to achieve the coordination between mitotic timing and morphogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Systems biology of embryonic development: Prospects for a complete understanding of the Caenorhabditis elegans embryo.

PubMed

Murray, John Isaac

2018-05-01

The convergence of developmental biology and modern genomics tools brings the potential for a comprehensive understanding of developmental systems. This is especially true for the Caenorhabditis elegans embryo because its small size, invariant developmental lineage, and powerful genetic and genomic tools provide the prospect of a cellular resolution understanding of messenger RNA (mRNA) expression and regulation across the organism. We describe here how a systems biology framework might allow large-scale determination of the embryonic regulatory relationships encoded in the C. elegans genome. This framework consists of two broad steps: (a) defining the "parts list"-all genes expressed in all cells at each time during development and (b) iterative steps of computational modeling and refinement of these models by experimental perturbation. Substantial progress has been made towards defining the parts list through imaging methods such as large-scale green fluorescent protein (GFP) reporter analysis. Imaging results are now being augmented by high-resolution transcriptome methods such as single-cell RNA sequencing, and it is likely the complete expression patterns of all genes across the embryo will be known within the next few years. In contrast, the modeling and perturbation experiments performed so far have focused largely on individual cell types or genes, and improved methods will be needed to expand them to the full genome and organism. This emerging comprehensive map of embryonic expression and regulatory function will provide a powerful resource for developmental biologists, and would also allow scientists to ask questions not accessible without a comprehensive picture. This article is categorized under: Invertebrate Organogenesis > Worms Technologies > Analysis of the Transcriptome Gene Expression and Transcriptional Hierarchies > Gene Networks and Genomics. © 2018 Wiley Periodicals, Inc.

Unscrambling butterfly oogenesis

PubMed Central

2013-01-01

Background Butterflies are popular model organisms to study physiological mechanisms underlying variability in oogenesis and egg provisioning in response to environmental conditions. Nothing is known, however, about; the developmental mechanisms governing butterfly oogenesis, how polarity in the oocyte is established, or which particular maternal effect genes regulate early embryogenesis. To gain insights into these developmental mechanisms and to identify the conserved and divergent aspects of butterfly oogenesis, we analysed a de novo ovarian transcriptome of the Speckled Wood butterfly Pararge aegeria (L.), and compared the results with known model organisms such as Drosophila melanogaster and Bombyx mori. Results A total of 17306 contigs were annotated, with 30% possibly novel or highly divergent sequences observed. Pararge aegeria females expressed 74.5% of the genes that are known to be essential for D. melanogaster oogenesis. We discuss the genes involved in all aspects of oogenesis, including vitellogenesis and choriogenesis, plus those implicated in hormonal control of oogenesis and transgenerational hormonal effects in great detail. Compared to other insects, a number of significant differences were observed in; the genes involved in stem cell maintenance and differentiation in the germarium, establishment of oocyte polarity, and in several aspects of maternal regulation of zygotic development. Conclusions This study provides valuable resources to investigate a number of divergent aspects of butterfly oogenesis requiring further research. In order to fully unscramble butterfly oogenesis, we also now also have the resources to investigate expression patterns of oogenesis genes under a range of environmental conditions, and to establish their function. PMID:23622113

Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

PubMed Central

Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

2014-01-01

Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

PubMed Central

2007-01-01

Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

Does mechanism matter? Unrelated neurotoxicants converge on cell cycle and apoptosis during neurodifferentiation.

PubMed

Slotkin, Theodore A; Seidler, Frederic J

2012-07-01

Mechanistically unrelated developmental neurotoxicants often produce neural cell loss culminating in similar functional and behavioral outcomes. We compared an organophosphate pesticide (diazinon), an organochlorine pesticide (dieldrin) and a metal (Ni(2+)) for effects on the genes regulating cell cycle and apoptosis in differentiating PC12 cells, an in vitro model of neuronal development. Each agent was introduced at 30μM for 24 or 72h, treatments devoid of cytotoxicity. Using microarrays, we examined the mRNAs encoding nearly 400 genes involved in each of the biological processes. All three agents targeted both the cell cycle and apoptosis pathways, evidenced by significant transcriptional changes in 40-45% of the cell cycle-related genes and 30-40% of the apoptosis-related genes. There was also a high degree of overlap as to which specific genes were affected by the diverse agents, with 80 cell cycle genes and 56 apoptosis genes common to all three. Concordance analysis, which assesses stringent matching of the direction, magnitude and timing of the transcriptional changes, showed highly significant correlations for pairwise comparisons of all the agents, for both cell cycle and apoptosis. Our results show that otherwise disparate developmental neurotoxicants converge on common cellular pathways governing the acquisition and programmed death of neural cells, providing a specific link to cell deficits. Our studies suggest that identifying the initial mechanism of action of a developmental neurotoxicant may be strategically less important than focusing on the pathways that converge on common final outcomes such as cell loss. Copyright © 2012 Elsevier Inc. All rights reserved.

DOES MECHANISM MATTER? UNRELATED NEUROTOXICANTS CONVERGE ON CELL CYCLE AND APOPTOSIS DURING NEURODIFFERENTIATION

PubMed Central

Slotkin, Theodore A.; Seidler, Frederic J.

2012-01-01

Mechanistically unrelated developmental neurotoxicants often produce neural cell loss culminating in similar functional and behavioral outcomes. We compared an organophosphate pesticide (diazinon), an organochlorine pesticide (dieldrin) and a metal (Ni2+) for effects on the genes regulating cell cycle and apoptosis in differentiating PC12 cells, an in vitro model of neuronal development. Each agent was introduced at 30 μM for 24 or 72 hr, treatments devoid of cytotoxicity. Using microarrays, we examined the mRNAs encoding nearly 400 genes involved in each of the biological processes. All three agents targeted both the cell cycle and apoptosis pathways, evidenced by significant transcriptional changes in 40–45% of the cell cycle-related genes and 30–40% of the apoptosis-related genes. There was also a high degree of overlap as to which specific genes were affected by the diverse agents, with 80 cell cycle genes and 56 apoptosis genes common to all three. Concordance analysis, which assesses stringent matching of the direction, magnitude and timing of the transcriptional changes, showed highly significant correlations for pairwise comparisons of all the agents, for both cell cycle and apoptosis. Our results show that otherwise disparate developmental neurotoxicants converge on common cellular pathways governing the acquisition and programmed death of neural cells, providing a specific link to cell deficits. Our studies suggest that identifying the initial mechanism of action of a developmental neurotoxicant may be strategically less important than focusing on the pathways that converge on common final outcomes such as cell loss. PMID:22546817

Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci.

PubMed

Amaral, Paulo P; Leonardi, Tommaso; Han, Namshik; Viré, Emmanuelle; Gascoigne, Dennis K; Arias-Carrasco, Raúl; Büscher, Magdalena; Pandolfini, Luca; Zhang, Anda; Pluchino, Stefano; Maracaja-Coutinho, Vinicius; Nakaya, Helder I; Hemberg, Martin; Shiekhattar, Ramin; Enright, Anton J; Kouzarides, Tony

2018-03-15

The mammalian genome is transcribed into large numbers of long noncoding RNAs (lncRNAs), but the definition of functional lncRNA groups has proven difficult, partly due to their low sequence conservation and lack of identified shared properties. Here we consider promoter conservation and positional conservation as indicators of functional commonality. We identify 665 conserved lncRNA promoters in mouse and human that are preserved in genomic position relative to orthologous coding genes. These positionally conserved lncRNA genes are primarily associated with developmental transcription factor loci with which they are coexpressed in a tissue-specific manner. Over half of positionally conserved RNAs in this set are linked to chromatin organization structures, overlapping binding sites for the CTCF chromatin organiser and located at chromatin loop anchor points and borders of topologically associating domains (TADs). We define these RNAs as topological anchor point RNAs (tapRNAs). Characterization of these noncoding RNAs and their associated coding genes shows that they are functionally connected: they regulate each other's expression and influence the metastatic phenotype of cancer cells in vitro in a similar fashion. Furthermore, we find that tapRNAs contain conserved sequence domains that are enriched in motifs for zinc finger domain-containing RNA-binding proteins and transcription factors, whose binding sites are found mutated in cancers. This work leverages positional conservation to identify lncRNAs with potential importance in genome organization, development and disease. The evidence that many developmental transcription factors are physically and functionally connected to lncRNAs represents an exciting stepping-stone to further our understanding of genome regulation.

[Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

PubMed

Yang, Li-Wei; Shi, Ji-Sen

2012-04-01

To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

Regulation of DNA replication during development

PubMed Central

Nordman, Jared; Orr-Weaver, Terry L.

2012-01-01

As development unfolds, DNA replication is not only coordinated with cell proliferation, but is regulated uniquely in specific cell types and organs. This differential regulation of DNA synthesis requires crosstalk between DNA replication and differentiation. This dynamic aspect of DNA replication is highlighted by the finding that the distribution of replication origins varies between differentiated cell types and changes with differentiation. Moreover, differential DNA replication in some cell types can lead to increases or decreases in gene copy number along chromosomes. This review highlights the recent advances and technologies that have provided us with new insights into the developmental regulation of DNA replication. PMID:22223677

A C. elegans mutant that lives twice as long as wild type.

PubMed

Kenyon, C; Chang, J; Gensch, E; Rudner, A; Tabtiang, R

1993-12-02

We have found that mutations in the gene daf-2 can cause fertile, active, adult Caenorhabditis elegans hermaphrodites to live more than twice as long as wild type. This lifespan extension, the largest yet reported in any organism, requires the activity of a second gene, daf-16. Both genes also regulate formation of the dauer larva, a developmentally arrested larval form that is induced by crowding and starvation and is very long-lived. Our findings raise the possibility that the longevity of the dauer is not simply a consequence of its arrested growth, but instead results from a regulated lifespan extension mechanism that can be uncoupled from other aspects of dauer formation. daf-2 and daf-16 provide entry points into understanding how lifespan can be extended.

In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

PubMed Central

Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

2014-01-01

Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

Characterization and expression analysis of gene encoding heme peroxidase HPX15 in major Indian malaria vector Anopheles stephensi (Diptera: Culicidae).

PubMed

Kajla, Mithilesh; Kakani, Parik; Choudhury, Tania Pal; Gupta, Kuldeep; Gupta, Lalita; Kumar, Sanjeev

2016-06-01

The interaction of mosquito immune system with Plasmodium is critical in determining the vector competence. Thus, blocking the crucial mosquito molecules that regulate parasite development might be effective in controlling the disease transmission. In this study, we characterized a full-length AsHPX15 gene from the major Indian malaria vector Anopheles stephensi. This gene is true ortholog of Anopheles gambiae heme peroxidase AgHPX15 (AGAP013327), which modulates midgut immunity and regulates Plasmodium falciparum development. We found that AsHPX15 is highly induced in mosquito developmental stages and blood fed midguts. In addition, this is a lineage-specific gene that has identical features and 65-99% amino acids identity with other HPX15 genes present in eighteen worldwide-distributed anophelines. We discuss that the conserved HPX15 gene might serve as a common target to manipulate mosquito immunity and arresting Plasmodium development inside the vector host. Copyright © 2016 Elsevier B.V. All rights reserved.

A genomic approach to identify hybrid incompatibility genes

PubMed Central

Cooper, Jacob C.; Phadnis, Nitin

2016-01-01

ABSTRACT Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids. PMID:27230814

BAC-recombineering for studying plant gene regulation: developmental control and cellular localization of SnRK1 kinase subunits.

PubMed

Bitrián, Marta; Roodbarkelari, Farshad; Horváth, Mihály; Koncz, Csaba

2011-03-01

Recombineering, permitting precise modification of genes within bacterial artificial chromosomes (BACs) through homologous recombination mediated by lambda phage-encoded Red proteins, is a widely used powerful tool in mouse, Caenorhabditis and Drosophila genetics. As Agrobacterium-mediated transfer of large DNA inserts from binary BACs and TACs into plants occurs at low frequency, recombineering is so far seldom exploited in the analysis of plant gene functions. We have constructed binary plant transformation vectors, which are suitable for gap-repair cloning of genes from BACs using recombineering methods previously developed for other organisms. Here we show that recombineering facilitates PCR-based generation of precise translational fusions between coding sequences of fluorescent reporter and plant proteins using galK-based exchange recombination. The modified target genes alone or as part of a larger gene cluster can be transferred by high-frequency gap-repair into plant transformation vectors, stably maintained in Agrobacterium and transformed without alteration into plants. Versatile application of plant BAC-recombineering is illustrated by the analysis of developmental regulation and cellular localization of interacting AKIN10 catalytic and SNF4 activating subunits of Arabidopsis Snf1-related (SnRK1) protein kinase using in vivo imaging. To validate full functionality and in vivo interaction of tagged SnRK1 subunits, it is demonstrated that immunoprecipitated SNF4-YFP is bound to a kinase that phosphorylates SnRK1 candidate substrates, and that the GFP- and YFP-tagged kinase subunits co-immunoprecipitate with endogenous wild type AKIN10 and SNF4. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs

PubMed Central

Goodale, B. C.; La Du, J.; Tilton, S. C.; Sullivan, C. M.; Bisson, W. H.; Waters, K. M.; Tanguay, R. L.

2015-01-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. PMID:26141390

Epigenetic stress responses induce muscle stem-cell ageing by Hoxa9 developmental signals.

PubMed

Schwörer, Simon; Becker, Friedrich; Feller, Christian; Baig, Ali H; Köber, Ute; Henze, Henriette; Kraus, Johann M; Xin, Beibei; Lechel, André; Lipka, Daniel B; Varghese, Christy S; Schmidt, Manuel; Rohs, Remo; Aebersold, Ruedi; Medina, Kay L; Kestler, Hans A; Neri, Francesco; von Maltzahn, Julia; Tümpel, Stefan; Rudolph, K Lenhard

2016-12-15

The functionality of stem cells declines during ageing, and this decline contributes to ageing-associated impairments in tissue regeneration and function. Alterations in developmental pathways have been associated with declines in stem-cell function during ageing, but the nature of this process remains poorly understood. Hox genes are key regulators of stem cells and tissue patterning during embryogenesis with an unknown role in ageing. Here we show that the epigenetic stress response in muscle stem cells (also known as satellite cells) differs between aged and young mice. The alteration includes aberrant global and site-specific induction of active chromatin marks in activated satellite cells from aged mice, resulting in the specific induction of Hoxa9 but not other Hox genes. Hoxa9 in turn activates several developmental pathways and represents a decisive factor that separates satellite cell gene expression in aged mice from that in young mice. The activated pathways include most of the currently known inhibitors of satellite cell function in ageing muscle, including Wnt, TGFβ, JAK/STAT and senescence signalling. Inhibition of aberrant chromatin activation or deletion of Hoxa9 improves satellite cell function and muscle regeneration in aged mice, whereas overexpression of Hoxa9 mimics ageing-associated defects in satellite cells from young mice, which can be rescued by the inhibition of Hoxa9-targeted developmental pathways. Together, these data delineate an altered epigenetic stress response in activated satellite cells from aged mice, which limits satellite cell function and muscle regeneration by Hoxa9-dependent activation of developmental pathways.

Effects on specific promoter DNA methylation in zebrafish embryos and larvae following benzo[a]pyrene exposure

USDA-ARS?s Scientific Manuscript database

Benzo[a]pyrene (BaP) is an established reproductive and developmental toxicant. BaP exposure in humans and animals has been linked to infertility and multigenerational health consequences. DNA methylation is the most studied epigenetic mechanism that regulates gene expression, and mapping of methyla...

Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

PubMed Central

Kaneko, Kunihiko

2011-01-01

The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353