Rice Fertilization-Independent Endosperm1 Regulates Seed Size under Heat Stress by Controlling Early Endosperm Development1[W

PubMed Central

Folsom, Jing J.; Begcy, Kevin; Hao, Xiaojuan; Wang, Dong; Walia, Harkamal

2014-01-01

Although heat stress reduces seed size in rice (Oryza sativa), little is known about the molecular mechanisms underlying the observed reduction in seed size and yield. To elucidate the mechanistic basis of heat sensitivity and reduced seed size, we imposed a moderate (34°C) and a high (42°C) heat stress treatment on developing rice seeds during the postfertilization stage. Both stress treatments reduced the final seed size. At a cellular level, the moderate heat stress resulted in precocious endosperm cellularization, whereas severe heat-stressed seeds failed to cellularize. Initiation of endosperm cellularization is a critical developmental transition required for normal seed development, and it is controlled by Polycomb Repressive Complex2 (PRC2) in Arabidopsis (Arabidopsis thaliana). We observed that a member of PRC2 called Fertilization-Independent Endosperm1 (OsFIE1) was sensitive to temperature changes, and its expression was negatively correlated with the duration of the syncytial stage during heat stress. Seeds from plants overexpressing OsFIE1 had reduced seed size and exhibited precocious cellularization. The DNA methylation status and a repressive histone modification of OsFIE1 were observed to be temperature sensitive. Our data suggested that the thermal sensitivity of seed enlargement could partly be caused by altered epigenetic regulation of endosperm development during the transition from the syncytial to the cellularized state. PMID:24590858

Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit

PubMed Central

2014-01-01

Background Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Results Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. Conclusions This first day - night study on heat stress adaption of the grapevine berry shows that the transcriptome of fleshy fruits is differentially affected by abiotic stress at night. The present results emphasize the necessity of including different developmental stages and especially several daytime points in transcriptomic studies. PMID:24774299

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster.

PubMed

Landis, Gary; Shen, Jie; Tower, John

2012-11-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging.

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster

PubMed Central

Landis, Gary; Shen, Jie; Tower, John

2012-01-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging. PMID:23211361

Thermal resistance, developmental rate and heat shock proteins in Artemia franciscana, from San Francisco Bay and southern Vietnam.

PubMed

Clegg; Jackson; Van Hoa N; Sorgeloos

2000-09-05

Cysts (encysted gastrula embryos) of Artemia franciscana collected from salterns in San Francisco Bay, California, USA (SF) were inoculated into much warmer growth ponds in the Mekong Delta region of Vietnam (V) in 1996. V adults arising directly from these cysts during 17 April to 15 May produced their own cysts, which were collected, processed and stored until shipped to the USA for study. Adults grown in the laboratory from SF cysts (those used for the inoculation) were less resistant to high temperature than adults cultured from V cysts. V cysts produced heat-resistant adults, even though cultured under the same laboratory conditions as SF animals, at much lower temperatures than they ever experienced in Vietnam. Differences in thermal performance between SF and V adults were retained in the second generation, cultured from cysts produced in the laboratory by first generation adults, suggesting a genetic basis for the better heat resistance of V adults. We propose that the operation of natural selection in the Vietnam growth ponds produced adults with improved thermal tolerance, and that the basis for this tolerance was incorporated into the developmental program of their cysts. Surprisingly, differences in heat resistance of laboratory reared animals were not reflected in constitutive levels of the hsp70 family which were similar in first generation SF and V adults. A conditioning heat shock (HS, 37 degrees C, 30 min) led to the same level of induced thermotolerance in SF and V first generation adults when evaluated 24 h post-HS. Levels of hsp70 were also up-regulated at that time, but to about the same extent in SF and V adults. Developmental rates of SF cysts used for the inoculation were faster than those of cysts produced in Vietnam when both were incubated at 21+/-1 degrees C, suggesting that V cysts have become adapted to develop at higher temperatures.

Abiotic and Biotic Stressors Causing Equivalent Mortality Induce Highly Variable Transcriptional Responses in the Soybean Aphid

PubMed Central

Enders, Laramy S.; Bickel, Ryan D.; Brisson, Jennifer A.; Heng-Moss, Tiffany M.; Siegfried, Blair D.; Zera, Anthony J.; Miller, Nicholas J.

2014-01-01

Environmental stress affects basic organismal functioning and can cause physiological, developmental, and reproductive impairment. However, in many nonmodel organisms, the core molecular stress response remains poorly characterized and the extent to which stress-induced transcriptional changes differ across qualitatively different stress types is largely unexplored. The current study examines the molecular stress response of the soybean aphid (Aphis glycines) using RNA sequencing and compares transcriptional responses to multiple stressors (heat, starvation, and plant defenses) at a standardized stress level (27% adult mortality). Stress-induced transcriptional changes showed remarkable variation, with starvation, heat, and plant defensive stress altering the expression of 3985, 510, and 12 genes, respectively. Molecular responses showed little overlap across all three stressors. However, a common transcriptional stress response was identified under heat and starvation, involved with up-regulation of glycogen biosynthesis and molecular chaperones and down-regulation of bacterial endosymbiont cellular and insect cuticular components. Stressor-specific responses indicated heat affected expression of heat shock proteins and cuticular components, whereas starvation altered a diverse set of genes involved in primary metabolism, oxidative reductive processes, nucleosome and histone assembly, and the regulation of DNA repair and replication. Exposure to host plant defenses elicited the weakest response, of which half of the genes were of unknown function. This study highlights the need for standardizing stress levels when comparing across stress types and provides a basis for understanding the role of general vs. stressor specific molecular responses in aphids. PMID:25538100

Prospects of engineering thermotolerance in crops through modulation of heat stress transcription factor and heat shock protein networks.

PubMed

Fragkostefanakis, Sotirios; Röth, Sascha; Schleiff, Enrico; Scharf, Klaus-Dieter

2015-09-01

Cell survival under high temperature conditions involves the activation of heat stress response (HSR), which in principle is highly conserved among different organisms, but shows remarkable complexity and unique features in plant systems. The transcriptional reprogramming at higher temperatures is controlled by the activity of the heat stress transcription factors (Hsfs). Hsfs allow the transcriptional activation of HSR genes, among which heat shock proteins (Hsps) are best characterized. Hsps belong to multigene families encoding for molecular chaperones involved in various processes including maintenance of protein homeostasis as a requisite for optimal development and survival under stress conditions. Hsfs form complex networks to activate downstream responses, but are concomitantly subjected to cell-type-dependent feedback regulation through factor-specific physical and functional interactions with chaperones belonging to Hsp90, Hsp70 and small Hsp families. There is increasing evidence that the originally assumed specialized function of Hsf/chaperone networks in the HSR turns out to be a complex central stress response system that is involved in the regulation of a broad variety of other stress responses and may also have substantial impact on various developmental processes. Understanding in detail the function of such regulatory networks is prerequisite for sustained improvement of thermotolerance in important agricultural crops. © 2014 John Wiley & Sons Ltd.

Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni.

PubMed

Neumann, S; Ziv, E; Lantner, F; Schechter, I

1993-03-01

Analyses of RNA from different developmental stages of Schistosoma mansoni showed stage-specific expression of heat-shock protein 70 (hsp70), which is regulated by a developmental program and by stress. The developmental program, common to hsp70 and other genes (e.g. paramyosin), refers to constitutive expression in miracidia sporocyst and adult worm but not in cercariae, and to the termination of hsp70 gene transcription during sporocyst/cercaria transformation. Stress induction, specific to hsp70, refers to transient accumulation of high levels of hsp70 mRNA during cercariae/schistosomula transformation and in adult worms after heat shock (42 degrees C). Cercariae/schistosomula transformation can be visualized as a physiological stress involving shifts in temperature (23-37 degrees C) and in salt concentration (from water to isotonic medium), as well as removal of tails from cercariae to yield isolated bodies that transform into schistosomula. It was found that temperature is an important factor, but not sufficient for strong induction of the hsp70 genes of schistosomula. Tail removal is an obligatory step for full induction of the hsp70 genes of schistosomula, in response to a temperature shift from 23-37 degrees C. The hsp70 genes in cercariae and isolated tails do not respond to stimuli (salt and temperature increases) that strongly activate the genes in isolated bodies (i.e., schistosomula). We speculate that the hsp70 genes in intact cercariae are not inducible because the tails can produce inhibitory signals that diffuse to the bodies and suppress their hsp70 genes. This hypothesis is useful to explain the termination of hsp70 gene transcription during sporocyst/cercaria transformation by the inhibitory effect of the growing tail.

Expression of the Hsp23 chaperone during Drosophila embryogenesis: association to distinct neural and glial lineages

PubMed Central

Michaud, Sébastien; Tanguay, Robert M

2003-01-01

Background In addition to their strong induction following stress, small heat shock proteins (Hsp) are also expressed during development in a wide variety of organisms. However, the precise identity of cell(s) expressing these proteins and the functional contribution of small heat shock proteins in such developmental context remain to be determined. The present study provides a detailed description of the Drosophila small heat shock protein Hsp23 expression pattern during embryogenesis and evaluates its functional contribution to central nervous system development. Results Throughout embryogenesis, Hsp23 is expressed in a stage-specific manner by a restricted number of neuronal and glial lineages of the central nervous system. Hsp23 is also detected in the amnioserosa and within a single lateral chordotonal organ. Its expression within the MP2 lineage does not require the presence of a functional midline nor the activity of the Notch signaling pathway. Transactivation assays demonstrate that transcription factors implicated in the differentiation of the midline also regulate hsp23 promoter activity. Phenotypic analysis of a transgenic line exhibiting loss of Hsp23 expression in the central nervous system suggests that Hsp23 is not required for development and function of this tissue. Likewise, its overexpression does not cause deleterious effects, as development remains unaffected. Conclusions Based on the presented data, we suggest that the tightly regulated developmental expression of Hsp23 is not actively involved in cell differentiation and central nervous system development per se but rather reflects a putative role in preventive "pre-stress" neuroprotection or in non-vital process(es) common to the identified cell lineages. PMID:14617383

45 CFR 1385.2 - Purpose of the regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

PubMed Central

Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

2011-01-01

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

PubMed

Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

2011-01-14

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

HSF-1 activates the ubiquitin proteasome system to promote non-apoptotic developmental cell death in C. elegans.

PubMed

Kinet, Maxime J; Malin, Jennifer A; Abraham, Mary C; Blum, Elyse S; Silverman, Melanie R; Lu, Yun; Shaham, Shai

2016-03-08

Apoptosis is a prominent metazoan cell death form. Yet, mutations in apoptosis regulators cause only minor defects in vertebrate development, suggesting that another developmental cell death mechanism exists. While some non-apoptotic programs have been molecularly characterized, none appear to control developmental cell culling. Linker-cell-type death (LCD) is a morphologically conserved non-apoptotic cell death process operating in Caenorhabditis elegans and vertebrate development, and is therefore a compelling candidate process complementing apoptosis. However, the details of LCD execution are not known. Here we delineate a molecular-genetic pathway governing LCD in C. elegans. Redundant activities of antagonistic Wnt signals, a temporal control pathway, and mitogen-activated protein kinase kinase signaling control heat shock factor 1 (HSF-1), a conserved stress-activated transcription factor. Rather than protecting cells, HSF-1 promotes their demise by activating components of the ubiquitin proteasome system, including the E2 ligase LET-70/UBE2D2 functioning with E3 components CUL-3, RBX-1, BTBD-2, and SIAH-1. Our studies uncover design similarities between LCD and developmental apoptosis, and provide testable predictions for analyzing LCD in vertebrates.

Up-regulation of heat shock proteins is essential for cold survival during insect diapause

PubMed Central

Rinehart, Joseph P.; Li, Aiqing; Yocum, George D.; Robich, Rebecca M.; Hayward, Scott A. L.; Denlinger, David L.

2007-01-01

Diapause, the dormancy common to overwintering insects, evokes a unique pattern of gene expression. In the flesh fly, most, but not all, of the fly's heat shock proteins (Hsps) are up-regulated. The diapause up-regulated Hsps include two members of the Hsp70 family, one member of the Hsp60 family (TCP-1), at least four members of the small Hsp family, and a small Hsp pseudogene. Expression of an Hsp70 cognate, Hsc70, is uninfluenced by diapause, and Hsp90 is actually down-regulated during diapause, thus diapause differs from common stress responses that elicit synchronous up-regulation of all Hsps. Up-regulation of the Hsps begins at the onset of diapause, persists throughout the overwintering period, and ceases within hours after the fly receives the signal to reinitiate development. The up-regulation of Hsps appears to be common to diapause in species representing diverse insect orders including Diptera, Lepidoptera, Coleoptera, and Hymenoptera as well as in diapauses that occur in different developmental stages (embryo, larva, pupa, adult). Suppressing expression of Hsp23 and Hsp70 in flies by using RNAi did not alter the decision to enter diapause or the duration of diapause, but it had a profound effect on the pupa's ability to survive low temperatures. We thus propose that up-regulation of Hsps during diapause is a major factor contributing to cold-hardiness of overwintering insects. PMID:17522254

Molecular processes of transgenerational acclimation to a warming ocean

NASA Astrophysics Data System (ADS)

Veilleux, Heather D.; Ryu, Taewoo; Donelson, Jennifer M.; van Herwerden, Lynne; Seridi, Loqmane; Ghosheh, Yanal; Berumen, Michael L.; Leggat, William; Ravasi, Timothy; Munday, Philip L.

2015-12-01

Some animals have the remarkable capacity to acclimate across generations to projected future climate change; however, the underlying molecular processes are unknown. We sequenced and assembled de novo transcriptomes of adult tropical reef fish exposed developmentally or transgenerationally to projected future ocean temperatures and correlated the resulting expression profiles with acclimated metabolic traits from the same fish. We identified 69 contigs representing 53 key genes involved in thermal acclimation of aerobic capacity. Metabolic genes were among the most upregulated transgenerationally, suggesting shifts in energy production for maintaining performance at elevated temperatures. Furthermore, immune- and stress-responsive genes were upregulated transgenerationally, indicating a new complement of genes allowing the second generation of fish to better cope with elevated temperatures. Other differentially expressed genes were involved with tissue development and transcriptional regulation. Overall, we found a similar suite of differentially expressed genes among developmental and transgenerational treatments. Heat-shock protein genes were surprisingly unresponsive, indicating that short-term heat-stress responses may not be a good indicator of long-term acclimation capacity. Our results are the first to reveal the molecular processes that may enable marine fishes to adjust to a future warmer environment over multiple generations.

Changes in the transcriptome of morula-stage bovine embryos caused by heat shock: relationship to developmental acquisition of thermotolerance

PubMed Central

2013-01-01

Background While initially sensitive to heat shock, the bovine embryo gains thermal resistance as it progresses through development so that physiological heat shock has little effect on development to the blastocyst stage by Day 5 after insemination. Here, experiments using 3’ tag digital gene expression (3’DGE) and real-time PCR were conducted to determine changes in the transcriptome of morula-stage bovine embryos in response to heat shock (40 degrees C for 8 h) that could be associated with thermotolerance. Results Using 3’DGE, expression of 173 genes were modified by heat shock, with 94 genes upregulated by heat shock and 79 genes downregulated by heat shock. A total of 38 differentially-regulated genes were associated with the ubiquitin protein, UBC. Heat shock increased expression of one heat shock protein gene, HSPB11, and one heat shock protein binding protein, HSPBP1, tended to increase expression of HSPA1A and HSPB1, but did not affect expression of 64 other genes encoding heat shock proteins, heat shock transcription factors or proteins interacting with heat shock proteins. Moreover, heat shock increased expression of five genes associated with oxidative stress (AKR7A2, CBR1, GGH, GSTA4, and MAP2K5), decreased expression of HIF3A, but did not affect expression of 42 other genes related to free radical metabolism. Heat shock also had little effect on genes involved in embryonic development. Effects of heat shock for 2, 4 and 8 h on selected heat shock protein and antioxidant genes were also evaluated by real-time PCR. Heat shock increased steady-state amounts of mRNA for HSPA1A (P<0.05) and tended to increase expression of HSP90AA1 (P<0.07) but had no effect on expression of SOD1 or CAT. Conclusions Changes in the transcriptome of the heat-shocked bovine morula indicate that the embryo is largely resistant to effects of heat shock. As a result, transcription of genes involved in thermal protection is muted and there is little disruption of gene networks involved in embryonic development. It is likely that the increased resistance of morula-stage embryos to heat shock as compared to embryos at earlier stages of development is due in part to developmental acquisition of mechanisms to prevent accumulation of denatured proteins and free radical damage. PMID:23320502

Tissue-Specific Transcriptomics Reveals an Important Role of the Unfolded Protein Response in Maintaining Fertility upon Heat Stress in Arabidopsis

PubMed Central

Zhang, Shuang-Shuang; Yang, Hongxing; Ding, Lan; Song, Ze-Ting; Ma, Hong; Chang, Fang

2017-01-01

High temperatures have a great impact on plant reproductive development and subsequent fruit and seed set, but the underlying molecular mechanisms are not well understood. We used transcriptome profiling to investigate the effect of heat stress on reproductive development of Arabidopsis thaliana plants and observed distinct response patterns in vegetative versus reproductive tissues. Exposure to heat stress affected reproductive developmental programs, including early phases of anther/ovule development and meiosis. Also, genes participating in the unfolded protein response (UPR) were enriched in the reproductive tissue-specific genes that were upregulated by heat. Moreover, we found that the UPR-deficient bzip28 bzip60 double mutant was sensitive to heat stresses and had reduced silique length and fertility. Comparison of heat-responsive wild type versus bzip28 bzip60 plants identified 521 genes that were regulated by bZIP28 and bZIP60 upon heat stress during reproductive stages, most of which were noncanonical UPR genes. Chromatin immunoprecipitation coupled with high-throughput sequencing analyses revealed 133 likely direct targets of bZIP28 in Arabidopsis seedlings subjected to heat stress, including 27 genes that were also upregulated by heat during reproductive development. Our results provide important insights into heat responsiveness in Arabidopsis reproductive tissues and demonstrate the protective roles of the UPR for maintaining fertility upon heat stress. PMID:28442596

Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.

PubMed

Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

2016-02-01

Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.

Effects of heat stress on bovine preimplantation embryos produced in vitro

PubMed Central

SAKATANI, Miki

2017-01-01

Summer heat stress decreases the pregnancy rate in cattle and has been thought to be associated with the early embryonic death caused by the elevation of maternal body temperature. In vitro cultures have been widely used for the evaluation of effects of heat stress on oocytes, fertilization, preimplantation, and embryonic development. Susceptibility to heat stress is present in developmental stages from oocytes to cleavage-stage (before embryonic gene activation, EGA) embryos, leading to a consequent decrease in developmental competence. On the other hand, advanced-stage embryos such as morula or blastocysts have acquired thermotolerance. The mechanism for the developmental stage-dependent change in thermotolerance is considered to be the accumulation of antioxidants in embryos in response to heat-inducible production of reactive oxygen species. The supplementation of antioxidants to the culture media has been known to neutralize the detrimental effects of heat stress. Besides, EGA could be involved in acquisition of thermotolerance in later stages of embryos. Morulae or blastocysts can repair heat-induced unfolded proteins or prevent DNA damage occurring in processes such as apoptosis. Therefore, embryo transfer (ET) that can bypass the heat-sensitive stage could be a good solution to improve the pregnancy rate under heat stress. However, frozen-thawed ET could not improve the pregnancy rate as expected. Frozen-thawed blastocysts were more sensitive to heat stress and showed less proliferation upon heat exposure, compared to fresh blastocysts. Therefore, further research is required to improve the reduction in pregnancy rates due to summer heat stress. PMID:28496018

Effects of heat stress on bovine preimplantation embryos produced in vitro.

PubMed

Sakatani, Miki

2017-08-19

Summer heat stress decreases the pregnancy rate in cattle and has been thought to be associated with the early embryonic death caused by the elevation of maternal body temperature. In vitro cultures have been widely used for the evaluation of effects of heat stress on oocytes, fertilization, preimplantation, and embryonic development. Susceptibility to heat stress is present in developmental stages from oocytes to cleavage-stage (before embryonic gene activation, EGA) embryos, leading to a consequent decrease in developmental competence. On the other hand, advanced-stage embryos such as morula or blastocysts have acquired thermotolerance. The mechanism for the developmental stage-dependent change in thermotolerance is considered to be the accumulation of antioxidants in embryos in response to heat-inducible production of reactive oxygen species. The supplementation of antioxidants to the culture media has been known to neutralize the detrimental effects of heat stress. Besides, EGA could be involved in acquisition of thermotolerance in later stages of embryos. Morulae or blastocysts can repair heat-induced unfolded proteins or prevent DNA damage occurring in processes such as apoptosis. Therefore, embryo transfer (ET) that can bypass the heat-sensitive stage could be a good solution to improve the pregnancy rate under heat stress. However, frozen-thawed ET could not improve the pregnancy rate as expected. Frozen-thawed blastocysts were more sensitive to heat stress and showed less proliferation upon heat exposure, compared to fresh blastocysts. Therefore, further research is required to improve the reduction in pregnancy rates due to summer heat stress.

Transgenic Tobacco Plants Overexpressing a Grass PpEXP1 Gene Exhibit Enhanced Tolerance to Heat Stress

PubMed Central

Xu, Qian; Xu, Xiao; Shi, Yang; Xu, Jichen; Huang, Bingru

2014-01-01

Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis) and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum) was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera) as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C) in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars. PMID:25003197

Unraveling Regulation of the Small Heat Shock Proteins by the Heat Shock Factor HvHsfB2c in Barley: Its Implications in Drought Stress Response and Seed Development

PubMed Central

Reddy, Palakolanu Sudhakar; Kavi Kishor, Polavarapu B.; Seiler, Christiane; Kuhlmann, Markus; Eschen-Lippold, Lennart; Lee, Justin; Reddy, Malireddy K.; Sreenivasulu, Nese

2014-01-01

The rapid increase in heat shock proteins upon exposure to damaging stresses and during plant development related to desiccation events reveal their dual importance in plant development and stress tolerance. Genome-wide sequence survey identified 20 non-redundant small heat shock proteins (sHsp) and 22 heat shock factor (Hsf) genes in barley. While all three major classes (A, B, C) of Hsfs are localized in nucleus, the 20 sHsp gene family members are localized in different cell organelles like cytoplasm, mitochondria, plastid and peroxisomes. Hsf and sHsp members are differentially regulated during drought and at different seed developmental stages suggesting the importance of chaperone role under drought as well as seed development. In silico cis-regulatory motif analysis of Hsf promoters showed an enrichment with abscisic acid responsive cis-elements (ABRE), implying regulatory role of ABA in mediating transcriptional response of HvsHsf genes. Gene regulatory network analysis identified HvHsfB2c as potential central regulator of the seed-specific expression of several HvsHsps including 17.5CI sHsp. These results indicate that HvHsfB2c is co-expressed in the central hub of small Hsps and therefore it may be regulating the expression of several HvsHsp subclasses HvHsp16.88-CI, HvHsp17.5-CI and HvHsp17.7-CI. The in vivo relevance of binding specificity of HvHsfB2C transcription factor to HSE-element present in the promoter of HvSHP17.5-CI under heat stress exposure is confirmed by gel shift and LUC-reporter assays. Further, we isolated 477 bp cDNA from barley encoding a 17.5 sHsp polypeptide, which was predominantly upregulated under drought stress treatments and also preferentially expressed in developing seeds. Recombinant HvsHsp17.5-CI protein was expressed in E. coli and purified to homogeneity, which displayed in vitro chaperone activity. The predicted structural model of HvsHsp-17.5-CI protein suggests that the α-crystallin domain is evolutionarily highly conserved. PMID:24594978

Unraveling regulation of the small heat shock proteins by the heat shock factor HvHsfB2c in barley: its implications in drought stress response and seed development.

PubMed

Reddy, Palakolanu Sudhakar; Kavi Kishor, Polavarapu B; Seiler, Christiane; Kuhlmann, Markus; Eschen-Lippold, Lennart; Lee, Justin; Reddy, Malireddy K; Sreenivasulu, Nese

2014-01-01

The rapid increase in heat shock proteins upon exposure to damaging stresses and during plant development related to desiccation events reveal their dual importance in plant development and stress tolerance. Genome-wide sequence survey identified 20 non-redundant small heat shock proteins (sHsp) and 22 heat shock factor (Hsf) genes in barley. While all three major classes (A, B, C) of Hsfs are localized in nucleus, the 20 sHsp gene family members are localized in different cell organelles like cytoplasm, mitochondria, plastid and peroxisomes. Hsf and sHsp members are differentially regulated during drought and at different seed developmental stages suggesting the importance of chaperone role under drought as well as seed development. In silico cis-regulatory motif analysis of Hsf promoters showed an enrichment with abscisic acid responsive cis-elements (ABRE), implying regulatory role of ABA in mediating transcriptional response of HvsHsf genes. Gene regulatory network analysis identified HvHsfB2c as potential central regulator of the seed-specific expression of several HvsHsps including 17.5CI sHsp. These results indicate that HvHsfB2c is co-expressed in the central hub of small Hsps and therefore it may be regulating the expression of several HvsHsp subclasses HvHsp16.88-CI, HvHsp17.5-CI and HvHsp17.7-CI. The in vivo relevance of binding specificity of HvHsfB2C transcription factor to HSE-element present in the promoter of HvSHP17.5-CI under heat stress exposure is confirmed by gel shift and LUC-reporter assays. Further, we isolated 477 bp cDNA from barley encoding a 17.5 sHsp polypeptide, which was predominantly upregulated under drought stress treatments and also preferentially expressed in developing seeds. Recombinant HvsHsp17.5-CI protein was expressed in E. coli and purified to homogeneity, which displayed in vitro chaperone activity. The predicted structural model of HvsHsp-17.5-CI protein suggests that the α-crystallin domain is evolutionarily highly conserved.

Profiling of differential gene expression in the hypothalamus of broiler-type Taiwan country chickens in response to acute heat stress.

PubMed

Tu, Wei-Lin; Cheng, Chuen-Yu; Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

2016-02-01

Acute heat stress severely impacts poultry production. The hypothalamus acts as a crucial center to regulate body temperature, detect temperature changes, and modulate the autonomic nervous system and endocrine loop for heat retention and dissipation. The purpose of this study was to investigate global gene expression in the hypothalamus of broiler-type B strain Taiwan country chickens after acute heat stress. Twelve 30-week-old hens were allocated to four groups. Three heat-stressed groups were subjected to acute heat stress at 38 °C for 2 hours without recovery (H2R0), with 2 hours of recovery (H2R2), and with 6 hours of recovery (H2R6). The control hens were maintained at 25 °C. At the end, hypothalamus samples were collected for gene expression analysis. The results showed that 24, 11, and 25 genes were upregulated and 41, 15, and 42 genes were downregulated in H2R0, H2R2, and H2R6 treatments, respectively. The expressions of gonadotropin-releasing hormone 1 (GNRH1), heat shock 27-kDa protein 1 (HSPB1), neuropeptide Y (NPY), and heat shock protein 25 (HSP25) were upregulated at all recovery times after heat exposure. Conversely, the expression of TPH2 was downregulated at all recovery times. A gene ontology analysis showed that most of the differentially expressed genes were involved in biological processes including cellular processes, metabolic processes, localization, multicellular organismal processes, developmental processes, and biological regulation. A functional annotation analysis showed that the differentially expressed genes were related to the gene networks of responses to stress and reproductive functions. These differentially expressed genes might be essential and unique key factors in the heat stress response of the hypothalamus in chickens. Copyright © 2016 Elsevier Inc. All rights reserved.

Expression of hsrω-RNAi transgene prior to heat shock specifically compromises accumulation of heat shock-induced Hsp70 in Drosophila melanogaster.

PubMed

Singh, Anand K; Lakhotia, Subhash C

2016-01-01

A delayed organismic lethality was reported in Drosophila following heat shock when developmentally active and stress-inducible noncoding hsrω-n transcripts were down-regulated during heat shock through hs-GAL4-driven expression of the hsrω-RNAi transgene, despite the characteristic elevation of all heat shock proteins (Hsp), including Hsp70. Here, we show that hsrω-RNAi transgene expression prior to heat shock singularly prevents accumulation of Hsp70 in all larval tissues without affecting transcriptional induction of hsp70 genes and stability of their transcripts. Absence of the stress-induced Hsp70 accumulation was not due to higher levels of Hsc70 in hsrω-RNAi transgene-expressing tissues. Inhibition of proteasomal activity during heat shock restored high levels of the induced Hsp70, suggesting very rapid degradation of the Hsp70 even during the stress when hsrω-RNAi transgene was expressed ahead of heat shock. Unexpectedly, while complete absence of hsrω transcripts in hsrω (66) homozygotes (hsrω-null) did not prevent high accumulation of heat shock-induced Hsp70, hsrω-RNAi transgene expression in hsrω-null background blocked Hsp70 accumulation. Nonspecific RNAi transgene expression did not affect Hsp70 induction. These observations reveal that, under certain conditions, the stress-induced Hsp70 can be selectively and rapidly targeted for proteasomal degradation even during heat shock. In the present case, the selective degradation of Hsp70 does not appear to be due to down-regulation of the hsrω-n transcripts per se; rather, this may be an indirect effect of the expression of hsrω-RNAi transgene whose RNA products may titrate away some RNA-binding proteins which may also be essential for stability of the induced Hsp70.

First evidence of DNA methylation in insect Tribolium castaneum: environmental regulation of DNA methylation within heterochromatin.

PubMed

Feliciello, Isidoro; Parazajder, Josip; Akrap, Ivana; Ugarković, Durđica

2013-05-01

DNA methylation has been studied in many eukaryotic organisms, in particular vertebrates, and was implicated in developmental and phenotypic variations. Little is known about the role of DNA methylation in invertebrates, although insects are considered as excellent models for studying the evolution of DNA methylation. In the red flour beetle, Tribolium castaneum (Tenebrionidae, Coleoptera), no evidence of DNA methylation has been found till now. In this paper, a cytosine methylation in Tribolium castaneum embryos was detected by methylation sensitive restriction endonucleases and immuno-dot blot assay. DNA methylation in embryos is followed by a global demethylation in larvae, pupae and adults. DNA demethylation seems to proceed actively through 5-hydroxymethylcytosine, most probably by the action of TET enzyme. Bisulfite sequencing of a highly abundant satellite DNA located in pericentromeric heterochromatin revealed similar profile of cytosine methylation in adults and embryos. Cytosine methylation was not only restricted to CpG sites but was found at CpA, CpT and CpC sites. In addition, complete cytosine demethylation of heterochromatic satellite DNA was induced by heat stress. The results reveal existence of DNA methylation cycling in T. castaneum ranging from strong overall cytosine methylation in embryos to a weak DNA methylation in other developmental stages. Nevertheless, DNA methylation is preserved within heterochromatin during development, indicating its role in heterochromatin formation and maintenance. It is, however, strongly affected by heat stress, suggesting a role for DNA methylation in heterochromatin structure modulation during heat stress response.

Developmental competence of bovine embryos from heat-stressed ova.

PubMed

Edwards, J L; Bogart, A N; Rispoli, L A; Saxton, A M; Schrick, F N

2009-02-01

Because multiple ovulation embryo transfer procedures are occasionally performed in cows experiencing heat stress, the goal of this study was to assess the developmental competence of otherwise morphologically normal embryos from heat-stressed ova. To this end, the ability of compact morulae from heat-stressed and non-heat-stressed bovine ova to undergo blastocyst development after culture at 38.5 or 41.0 degrees C was examined. It was hypothesized that heat-induced perturbations in the ooplasm carry over to increase the susceptibility of the preattachment embryo to heat stress. Initially, ova were matured at 38.5 or 41.0 degrees C. The consequences of heat stress did not include altered cleavage, but did reduce the proportion of 8- to 16-cell-stage embryos (55.3 vs. 50.6%; SEM +/- 1.9). Although proportionately fewer, compact morulae from heat-stressed ova were equivalent in quality to those from non-heat-stressed ova (2.1 and 2.1; SEM = 0.04). Culture of compact morulae from non-heat-stressed ova at 41.0 degrees C did not affect blastocyst development (71.9 and 71.5%; SEM = 3.0). Furthermore, the development of compact morulae from heat-stressed ova was similar to that of non-heat-stressed ova after culture at 38.5 degrees C (68.2 vs. 71.9 and 71.5%; SEM = 3.0). However, blastocyst development was reduced when compact morulae from heat-stressed ova were cultured at 41.0 degrees C (62.3 vs. 71.9, 71.5 and 68.2; SEM = 3.1). In summary, reduced compaction rates of heat-stressed ova explained in part why fewer develop to the blastocyst stage after fertilization. The thermolability of the few embryos that develop from otherwise developmentally challenged ova emphasizes the importance of minimizing exposure to stressor(s) during oocyte maturation.

AoRim15 is involved in conidial stress tolerance, conidiation and sclerotia formation in the filamentous fungus Aspergillus oryzae.

PubMed

Nakamura, Hidetoshi; Kikuma, Takashi; Jin, Feng Jie; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

2016-04-01

The serine-threonine kinase Rim15p is a master regulator of stress signaling and is required for stress tolerance and sexual sporulation in the yeast Saccharomyces cerevisiae. However, in filamentous fungi that reproduce asexually via conidiation, the physiological function of Rim15p homologs has not been extensively analyzed. Here, we functionally characterized the protein homolog of Rim15p in the filamentous fungus Aspergillus oryzae, by deleting and overexpressing the corresponding Aorim15 gene and examining the role of this protein in stress tolerance and development. Deletion of Aorim15 resulted in an increase in the sensitivity of conidia to oxidative and heat stresses, whereas conidia of the Aorim15 overexpressing strain were more resistant to these stresses. These results indicated that AoRim15 functions in stress tolerance, similar to S. cerevisiae Rim15p. Phenotypic analysis revealed that conidiation was markedly reduced by overexpression of Aorim15 in A. oryzae, and was completely abolished in the deletion strain. In addition, the formation of sclerotia, which is another type of developmental structure in filamentous fungi, was decreased by the deletion of Aorim15, whereas Aorim15 overexpression increased the number of sclerotia. These results indicated that AoRim15 is a positive regulator of sclerotia formation and that overexpression of AoRim15 shifts the developmental balance from conidiation towards sclerotia formation. Collectively, we demonstrated that AoRim15 is involved in the stress tolerance of conidia and differentially regulates between the two developmental fates of conidiation and sclerotia formation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

PubMed Central

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Tissue-Specific Transcriptomics Reveals an Important Role of the Unfolded Protein Response in Maintaining Fertility upon Heat Stress in Arabidopsis.

PubMed

Zhang, Shuang-Shuang; Yang, Hongxing; Ding, Lan; Song, Ze-Ting; Ma, Hong; Chang, Fang; Liu, Jian-Xiang

2017-05-01

High temperatures have a great impact on plant reproductive development and subsequent fruit and seed set, but the underlying molecular mechanisms are not well understood. We used transcriptome profiling to investigate the effect of heat stress on reproductive development of Arabidopsis thaliana plants and observed distinct response patterns in vegetative versus reproductive tissues. Exposure to heat stress affected reproductive developmental programs, including early phases of anther/ovule development and meiosis. Also, genes participating in the unfolded protein response (UPR) were enriched in the reproductive tissue-specific genes that were upregulated by heat. Moreover, we found that the UPR-deficient bzip28 bzip60 double mutant was sensitive to heat stresses and had reduced silique length and fertility. Comparison of heat-responsive wild type versus bzip28 bzip60 plants identified 521 genes that were regulated by bZIP28 and bZIP60 upon heat stress during reproductive stages, most of which were noncanonical UPR genes. Chromatin immunoprecipitation coupled with high-throughput sequencing analyses revealed 133 likely direct targets of bZIP28 in Arabidopsis seedlings subjected to heat stress, including 27 genes that were also upregulated by heat during reproductive development. Our results provide important insights into heat responsiveness in Arabidopsis reproductive tissues and demonstrate the protective roles of the UPR for maintaining fertility upon heat stress. © 2017 American Society of Plant Biologists. All rights reserved.

Loggerhead sea turtle embryos (Caretta caretta) regulate expression of stress response and developmental genes when exposed to a biologically realistic heat stress.

PubMed

Bentley, Blair P; Haas, Brian J; Tedeschi, Jamie N; Berry, Oliver

2017-06-01

Oviparous reptile embryos are expected to breach their critical thermal maxima if temperatures reach those predicted under current climate change models due to the lack of the maternal buffering processes and parental care. Heat-shock proteins (HSPs) are integral in the molecular response to thermal stress, and their expression is heritable, but the roles of other candidate families such as the heat-shock factors (HSFs) have not been determined in reptiles. Here, we subject embryonic sea turtles (Caretta caretta) to a biologically realistic thermal stress and employ de novo transcriptomic profiling of brain tissue to investigate the underlying molecular response. From a reference transcriptome of 302 293 transcripts, 179 were identified as differentially expressed between treatments. As anticipated, genes enriched in the heat-shock treatment were primarily associated with the Hsp families, or were genes whose products play similar protein editing and chaperone functions (e.g. bag3, MYOC and serpinh1). Unexpectedly, genes encoding the HSFs were not significantly upregulated under thermal stress, indicating their presence in unstressed cells in an inactive state. Genes that were downregulated under thermal stress were less well functionally defined but were associated with stress response, development and cellular organization, suggesting that developmental processes may be compromised at realistically high temperatures. These results confirm that genes from the Hsp families play vital roles in the thermal tolerance of developing reptile embryos and, in addition with a number of other genes, should be targets for evaluating the capacity of oviparous reptiles to respond adaptively to the effects of climate change. © 2017 John Wiley & Sons Ltd.

Metabolic and functional characterization of effects of developmental temperature in Drosophila melanogaster.

PubMed

Schou, Mads F; Kristensen, Torsten N; Pedersen, Anders; Karlsson, B Göran; Loeschcke, Volker; Malmendal, Anders

2017-02-01

The ability of ectotherms to respond to changes in their thermal environment through plastic mechanisms is central to their adaptive capability. However, we still lack knowledge on the physiological and functional responses by which ectotherms acclimate to temperatures during development, and in particular, how physiological stress at extreme temperatures may counteract beneficial acclimation responses at benign temperatures. We exposed Drosophila melanogaster to 10 developmental temperatures covering their entire permissible temperature range. We obtained metabolic profiles and reaction norms for several functional traits: egg-to-adult viability, developmental time, and heat and cold tolerance. Females were more heat tolerant than males, whereas no sexual dimorphism was found in cold tolerance. A group of metabolites, mainly free amino acids, had linear reaction norms. Several energy-carrying molecules, as well as some sugars, showed distinct inverted U-shaped norms of reaction across the thermal range, resulting in a positive correlation between metabolite intensities and egg-to-adult viability. At extreme temperatures, low levels of these metabolites were interpreted as a response characteristic of costs of homeostatic perturbations. Our results provide novel insights into a range of metabolites reported to be central for the acclimation response and suggest several new candidate metabolites. Low and high temperatures result in different adaptive physiological responses, but they also have commonalities likely to be a result of the failure to compensate for the physiological stress. We suggest that the regulation of metabolites that are tightly connected to the performance curve is important for the ability of ectotherms to cope with variation in temperature. Copyright © 2017 the American Physiological Society.

Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.).

PubMed

Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

2017-01-01

Lettuce ( Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce.

Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.)

PubMed Central

Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

2018-01-01

Lettuce (Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce. PMID:29403510

Genome-wide identification and analysis of biotic and abiotic stress regulation of small heat shock protein (HSP20) family genes in bread wheat.

PubMed

Muthusamy, Senthilkumar K; Dalal, Monika; Chinnusamy, Viswanathan; Bansal, Kailash C

2017-04-01

Small Heat Shock Proteins (sHSPs)/HSP20 are molecular chaperones that protect plants by preventing protein aggregation during abiotic stress conditions, especially heat stress. Due to global climate change, high temperature is emerging as a major threat to wheat productivity. Thus, the identification of HSP20 and analysis of HSP transcriptional regulation under different abiotic stresses in wheat would help in understanding the role of these proteins in abiotic stress tolerance. We used sequences of known rice and Arabidopsis HSP20 HMM profiles as queries against publicly available wheat genome and wheat full length cDNA databases (TriFLDB) to identify the respective orthologues from wheat. 163 TaHSP20 (including 109 sHSP and 54 ACD) genes were identified and classified according to the sub-cellular localization and phylogenetic relationship with sequenced grass genomes (Oryza sativa, Sorghum bicolor, Zea mays, Brachypodium distachyon and Setaria italica). Spatio-temporal, biotic and abiotic stress-specific expression patterns in normalized RNA seq and wheat array datasets revealed constitutive as well as inductive responses of HSP20 in different tissues and developmental stages of wheat. Promoter analysis of TaHSP20 genes showed the presence of tissue-specific, biotic, abiotic, light-responsive, circadian and cell cycle-responsive cis-regulatory elements. 14 TaHSP20 family genes were under the regulation of 8 TamiRNA genes. The expression levels of twelve HSP20 genes were studied under abiotic stress conditions in the drought- and heat-tolerant wheat genotype C306. Of the 13 TaHSP20 genes, TaHSP16.9H-CI showed high constitutive expression with upregulation only under salt stress. Both heat and salt stresses upregulated the expression of TaHSP17.4-CI, TaHSP17.7A-CI, TaHSP19.1-CIII, TaACD20.0B-CII and TaACD20.6C-CIV, while TaHSP23.7-MTI was specifically induced only under heat stress. Our results showed that the identified TaHSP20 genes play an important role under different abiotic stress conditions. Thus, the results illustrate the complexity of the TaHSP20 gene family and its stress regulation in wheat, and suggest that sHSPs as attractive breeding targets for improvement of the heat tolerance of wheat. Copyright © 2017 Elsevier GmbH. All rights reserved.

Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

PubMed

Kovacs, Maria; Lopez-Duran, Nestor L

2012-04-01

For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

An integrative review of ethnic and cultural variation in socialization and children's self-regulation.

PubMed

LeCuyer, Elizabeth A; Zhang, Yi

2015-04-01

To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.

Comparative transcriptome profiling of Pyropia yezoensis (Ueda) M.S. Hwang & H.G. Choi in response to temperature stresses.

PubMed

Sun, Peipei; Mao, Yunxiang; Li, Guiyang; Cao, Min; Kong, Fanna; Wang, Li; Bi, Guiqi

2015-06-17

Pyropia yezoensis is a model organism often used to investigate the mechanisms underlying stress tolerance in intertidal zones. The digital gene expression (DGE) approach was used to characterize a genome-wide comparative analysis of differentially expressed genes (DEGs) that influence the physiological, developmental or biochemical processes in samples subjected to 4 treatments: high-temperature stress (HT), chilling stress (CS), freezing stress (FS) and normal temperature (NT). Equal amounts of total RNAs collected from 8 samples (two biological replicates per treatment) were sequenced using the Illumina/Solexa platform. Compared with NT, a total of 2202, 1334 and 592 differentially expressed unigenes were detected in HT, CS and FS respectively. Clustering analysis suggested P. yezoensis acclimates to low and high-temperature stress condition using different mechanisms: In heat stress, the unigenes related to replication and repair of DNA and protein processing in endoplasmic reticulum were active; however at low temperature stresses, unigenes related to carbohydrate metabolism and energy metabolism were active. Analysis of gene differential expression showed that four categories of DEGs functioning as temperature sensors were found, including heat shock proteins, H2A, histone deacetylase complex and transcription factors. Heat stress caused chloroplast genes down-regulated and unigenes encoding metacaspases up-regulated, which is an important regulator of PCD. Cold stress caused an increase in the expression of FAD to improve the proportion of polyunsaturated fatty acids. An up-regulated unigene encoding farnesyl pyrophosphate synthase was found in cold stress, indicating that the plant hormone ABA also played an important role in responding to temperature stress in P. yezoensis. The variation of amount of unigenes and different gene expression pattern under different temperature stresses indicated the complicated and diverse regulation mechanism in response to temperature stress in P. yezoensis. Several common metabolism pathways were found both in P. yezoensis and in higher plants, such as FAD in low-temperature stress and HSP in heat stress. Meanwhile, many chloroplast genes and unigene related to the synthesis of abscisic acid were detected, revealing its unique temperature-regulation mechanism in this intertidal species. This sequencing dataset and analysis may serve as a valuable resource to study the mechanisms involved in abiotic stress tolerance in intertidal seaweeds.

EVALUATION OF POTENTIAL DEVELOPMENTAL NEUROTOXICITY OF ORGANOTINS.

EPA Science Inventory

Organotins, including monomethyltin (MMT), dimethyltin (DMT), and dibutyltin (DBT), are widely used as heat stabilizers in PVC and CPVC piping, which results in their presence in drinking water supplies. Concern for developmental neurotoxic effects were raised by published findi...

Mechanical analysis of a heat-shock induced developmental defect

NASA Astrophysics Data System (ADS)

Crews, Sarah M.; McCleery, W. Tyler; Hutson, M. Shane

2014-03-01

Embryonic development in Drosophila is a complex process involving coordinated movements of mechanically interacting tissues. Perturbing this system with a transient heat shock can result in a number of developmental defects. In particular, a heat shock applied during the earliest morphogenetic movements of gastrulation can lead to apparent recovery, but then subsequent morphogenetic failure 5-6 hours later during germ band retraction. The process of germ band retraction requires an intact amnioserosa - a single layered extra-embryonic epithelial tissue - and heat shock at gastrulation can induce the later opening of holes in the amnioserosa. These holes are highly correlated with failures of germ band retraction. These holes could be caused by a combination of mechanical weakness in the amnioserosa or local increases in mechanical stress. Here, we assess the role of mechanical stress using confocal imaging to compare cell and tissue morphology in the amnioserosa of normal and heat-shocked embryos and laser hole drilling to map the stress field around the times and locations at which heat-shock induced holes open.

Genetic structure and regulation of isoprene synthase in Poplar (Populus spp.).

PubMed

Vickers, Claudia E; Possell, Malcolm; Nicholas Hewitt, C; Mullineaux, Philip M

2010-07-01

Isoprene is a volatile 5-carbon hydrocarbon derived from the chloroplastic methylerythritol 2-C-methyl-D: -erythritol 4-phosphate isoprenoid pathway. In plants, isoprene emission is controlled by the enzyme isoprene synthase; however, there is still relatively little known about the genetics and regulation of this enzyme. Isoprene synthase gene structure was analysed in three poplar species. It was found that genes encoding stromal isoprene synthase exist as a small gene family, the members of which encode virtually identical proteins and are differentially regulated. Accumulation of isoprene synthase protein is developmentally regulated, but does not differ between sun and shade leaves and does not increase when heat stress is applied. Our data suggest that, in mature leaves, isoprene emission rates are primarily determined by substrate (dimethylallyl diphosphate, DMADP) availability. In immature leaves, where isoprene synthase levels are variable, emission levels are also influenced by the amount of isoprene synthase protein. No thylakoid isoforms could be identified in Populus alba or in Salix babylonica. Together, these data show that control of isoprene emission at the genetic level is far more complicated than previously assumed.

Developmental Regulation across the Life Span: Toward a New Synthesis

ERIC Educational Resources Information Center

Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

2013-01-01

How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

HUPO BPP pilot study: a proteomics analysis of the mouse brain of different developmental stages.

PubMed

Wang, Jing; Gu, Yong; Wang, Lihong; Hang, Xingyi; Gao, Yan; Wang, Hangyan; Zhang, Chenggang

2007-11-01

This study is a part of the HUPO Brain Proteome Project (BPP) pilot study, which aims at obtaining a reliable database of mouse brain proteome, at the comparison of techniques, laboratories, and approaches as well as at preparing subsequent proteome studies of neurologic diseases. The C57/Bl6 mouse brains of three developmental stages at embryonic day 16 (E16), postnatal day 7 (P7), and 8 wk (P56) (n = 5 in each group) were provided by the HUPO BPP executive committee. The whole brain proteins of each animal were individually prepared using 2-DE coupled with PDQuest software analysis. The protein spots representing developmentally related or stably expressed proteins were then prepared with in-gel digestion followed with MALDI-TOF/TOF MS/MS and analyzed using the MASCOT search engines to search the Swiss-Prot or NCBInr database. The 2-DE gel maps of the mouse brains of all of the developmental stages were obtained and submitted to the Data Collection Centre (DCC). The proteins alpha-enolase, stathmin, actin, C14orf166 homolog, 28,000 kDa heat- and acid-stable phosphoprotein, 3-mercaptopyruvate sulfurtransferase and 40 S ribosomal protein S3a were successfully identified. A further Western blotting analysis demonstrated that enolase is a protein up-regulated in the mouse brain from embryonic stage to adult stage. These data are helpful for understanding the proteome changes in the development of the mouse brain.

The Development of Self-Regulation across Early Childhood

PubMed Central

Montroy, Janelle J.; Bowles, Ryan P.; Skibbe, Lori E.; McClelland, Megan M.; Morrison, Frederick J.

2016-01-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of three and seven, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across three diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow three distinct developmental patterns of growth. These three trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds with implications for offering individualized support across children. PMID:27709999

MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

PubMed Central

Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

2010-01-01

Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

Brief report: Poor self-regulation as a predictor of individual differences in adaptive functioning in young children with autism spectrum disorder.

PubMed

Uljarević, Mirko; Hedley, Darren; Nevill, Rose; Evans, David W; Cai, Ru Ying; Butter, Eric; Mulick, James A

2018-04-06

The present study examined the link between poor self-regulation (measured by the child behavior checklist dysregulated profile [DP]) and core autism symptoms, as well as with developmental level, in a sample of 107 children with autism spectrum disorder (ASD) aged 19-46 months. We further examined the utility of DP in predicting individual differences in adaptive functioning, relative to the influence of ASD severity, chronological age (CA), and developmental level. Poor self-regulation was unrelated to CA, developmental level, and severity of ADOS-2 restricted and repetitive behaviors, but was associated with lower ADOS-2 social affect severity. Hierarchical regression identified poor self-regulation as a unique independent predictor of adaptive behavior, with more severe dysregulation predicting poorer adaptive functioning. Results highlight the importance of early identification of deficits in self-regulation, and more specifically, of the utility of DP, when designing individually tailored treatments for young children with ASD. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. This study explored the relationship between poor self-regulation and age, verbal and non-verbal developmental level, severity of autism symptoms and adaptive functioning in 107 children with autism under 4 years of age. Poor self-regulation was unrelated to age, developmental level, and severity of restricted and repetitive behaviors but was associated with lower social affect severity. Importantly, more severe self-regulation deficits predicted poorer adaptive functioning. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.

Expression of Heat Shock Protein Genes in Different Developmental Stages and After Temperature Stress in the Maize Weevil (Coleoptera: Curculionidae).

PubMed

Tungjitwitayakul, Jatuporn; Tatun, Nujira; Vajarasathira, Boongeua; Sakurai, Sho

2015-06-01

The maize weevil, Sitophilus zeamais Motschulsky, is a major pest of rice and other postharvest grain stocks in tropical countries. Heating and cooling treatments have been adopted to control this pest. Because heat shock protein (hsp) genes respond to temperature stress, we examined the association of hsp genes with development and thermal stress in S. zeamais. The temperature response of the insect to heat and cold treatments was assessed at four developmental stages: egg, larva, pupa, and adult. LT50 values at high temperatures were similar among the four developmental stages, while adults were the most tolerant to low temperatures, and eggs, larvae, and pupae exhibited similar LT50 values. Expression levels of three hsps--Szhsp70, Szhsc70, and Szhsp90--fluctuated substantially throughout the four stages at a rearing temperature of 28°C. Heat shock and cold shock increased the expression of all three hsps, and the highest upregulation was observed at 40°C, although the intensity of upregulation varied among the three genes: strongly in Szhsp70, moderately in Szhsp90, and slightly in Szhsc70. Basal expression of the three hsps at 28°C and gene responses to heat and cold shock also varied significantly at the tissue level. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma

PubMed Central

Gilmore, Sarah A.; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-01-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5’ leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature. PMID:26177267

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma.

PubMed

Gilmore, Sarah A; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-07-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5' leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature.

Cloning & sequence identification of Hsp27 gene and expression analysis of the protein on thermal stress in Lucilia cuprina.

PubMed

Singh, Manish K; Tiwari, Pramod K

2016-08-01

Hsp27, a highly conserved small molecular weight heat shock protein, is widely known to be developmentally regulated and heat inducible. Its role in thermotolerance is also implicated. This study is a sequel of our earlier studies to understand the molecular organization of heat shock genes/proteins and their role in development and thermal adaptation in a sheep pest, Lucilia cuprina (blowfly), which exhibits unusually high adaptability to a variety of environmental stresses, including heat and chemicals. In this report our aim was to understand the evolutionary relationship of Lucilia hsp27 gene/protein with those of other species and its role in thermal adaptation. We sequence characterized the Lchsp27 gene (coding region) and analyzed its expression in various larval and adult tissues under normal as well as heat shock conditions. The nucleotide sequence analysis of 678 bps long-coding region of Lchsp27 exhibited closest evolutionary proximity with Drosophila (90.09%), which belongs to the same order, Diptera. Heat shock caused significant enhancement in the expression of Lchsp27 gene in all the larval and adult tissues examined, however, in a tissue specific manner. Significantly, in Malpighian tubules, while the heat-induced level of hsp27 transcript (mRNA) appeared increased as compared to control, the protein level remained unaltered and nuclear localized. We infer that Lchsp27 may have significant role in the maintenance of cellular homeostasis, particularly, during summer months, when the fly remains exposed to high heat in its natural habitat. © 2015 Institute of Zoology, Chinese Academy of Sciences.

The Development of Emotional and Behavioral Self-Regulation and Their Effects on Academic Achievement in Childhood

ERIC Educational Resources Information Center

Edossa, Ashenafi Kassahun; Schroeders, Ulrich; Weinert, Sabine; Artelt, Cordula

2018-01-01

Self-regulation is an essential ability of children to cope with various developmental challenges. This study examines the developmental interplay between emotional and behavioral self-regulation during childhood and the relationship with academic achievement using data from the longitudinal Millennium Cohort Study (UK). Using cross-lagged panel…

Developmental Origins of Infant Emotion Regulation: Mediation by Temperamental Negativity and Moderation by Maternal Sensitivity

ERIC Educational Resources Information Center

Thomas, Jenna C.; Letourneau, Nicole; Campbell, Tavis S.; Tomfohr-Madsen, Lianne; Giesbrecht, Gerald F.

2017-01-01

Emotion regulation is essential to cognitive, social, and emotional development and difficulties with emotion regulation portend future socioemotional, academic, and behavioral difficulties. There is growing awareness that many developmental outcomes previously thought to begin their development in the postnatal period have their origins in the…

Conservation in the involvement of heterochronic genes and hormones during developmental transitions.

PubMed

Faunes, Fernando; Larraín, Juan

2016-08-01

Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

Self-Regulation and Math Attitudes: Effects on Academic Performance in Developmental Math Courses at a Community College

ERIC Educational Resources Information Center

Otts, Cynthia D.

2010-01-01

The purpose of the study was to investigate the relationship among math attitudes, self-regulated learning, and course outcomes in developmental math. Math attitudes involved perceived usefulness of math and math anxiety. Self-regulated learning represented the ability of students to control cognitive, metacognitive, and behavioral aspects of…

Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

ERIC Educational Resources Information Center

de Oliveira, Rita F.; Wann, John P.

2011-01-01

In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

Silver nanoparticles induced heat shock protein 70, oxidative stress and apoptosis in Drosophila melanogaster.

PubMed

Ahamed, Maqusood; Posgai, Ryan; Gorey, Timothy J; Nielsen, Mark; Hussain, Saber M; Rowe, John J

2010-02-01

Due to the intensive commercial application of silver nanoparticles (Ag NPs), risk assessment of this nanoparticle is of great importance. Our previous in vitro study demonstrated that Ag NPs caused DNA damage and apoptosis in mouse embryonic stem cells and fibroblasts. However, toxicity of Ag NPs in vivo is largely lacking. This study was undertaken to examine the toxic effects of well-characterized polysaccharide coated 10 nm Ag NPs on heat shock stress, oxidative stress, DNA damage and apoptosis in Drosophila melanogaster. Third instar larvae of D. melanogaster were fed a diet of standard cornmeal media mixed with Ag NPs at the concentrations of 50 and 100 microg/ml for 24 and 48 h. Ag NPs up-regulated the expression of heat shock protein 70 and induced oxidative stress in D. melanogaster. Malondialdehyde level, an end product of lipid peroxidation was significantly higher while antioxidant glutathione content was significantly lower in Ag NPs exposed organisms. Activities of antioxidant enzyme superoxide dismutase and catalase were also significantly higher in the organisms exposed to Ag NPs. Furthermore, Ag NPs up-regulated the cell cycle checkpoint p53 and cell signaling protein p38 that are involved in the DNA damage repair pathway. Moreover, activities of caspase-3 and caspase-9, markers of apoptosis were significantly higher in Ag NPs exposed organisms. The results indicate that Ag NPs in D. melanogaster induce heat shock stress, oxidative stress, DNA damage and apoptosis. This study suggests that the organism is stressed and thus warrants more careful assessment of Ag NPs using in vivo models to determine if chronic exposure presents developmental and reproductive toxicity. Copyright 2009 Elsevier Inc. All rights reserved.

Calcium promotes activity and confers heat stability on plant peroxidases

PubMed Central

Plieth, Christoph; Vollbehr, Sonja

2012-01-01

In this paper we demonstrate how peroxidase (PO) activities and their heat stability correlate with the availability of free Ca2+ ions. Calcium ions work as a molecular switch for PO activity and exert a protective function, rendering POs heat stable. The concentration ranges of these two activities differ markedly. POs are activated by µM Ca2+ concentration ranges, whereas heat stabilization is observed in the nM range. This suggests the existence of different Ca2+ binding sites. The heat stability of POs depends on the source plant species. Terrestrial plants have POs that exhibit higher temperature stability than those POs from limnic and marine plants. Different POs from a single species can differ in terms of heat stability. The abundance of different POs within a plant is dependent on age and developmental stage. The heat stability of a PO does not necessarily correlate with the maximum temperature the source species is usually exposed to in its natural habitat. This raises questions on the role of POs in the heat tolerance of plants. Consequently, detailed investigations are needed to identify and characterize individual POs, with regard to their genetic origin, subcellular expression, tissue abundance, developmental emergence and their functions in innate and acquired heat tolerance. PMID:22580695

Expert System For Heat Exchanger

NASA Technical Reports Server (NTRS)

Bagby, D. Gordon; Cormier, Reginald A.

1991-01-01

Diagnosis simplified for non-engineers. Developmental expert-system computer program assists operator in controlling, monitoring operation, diagnosing malfunctions, and ordering repairs of heat-exchanger system dissipating heat generated by 20-kW radio transmitter. System includes not only heat exchanger but also pumps, fans, sensors, valves, reservoir, and associated plumbing. Program conceived to assist operator while avoiding cost of keeping engineer in full-time attendance. Similar programs developed for heating, ventilating, and air-conditioning systems.

Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

PubMed

Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

2016-02-01

Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life interventions may be a practical approach to promote physical activity in man.

The development of self-regulation across early childhood.

PubMed

Montroy, Janelle J; Bowles, Ryan P; Skibbe, Lori E; McClelland, Megan M; Morrison, Frederick J

2016-11-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of 3 and 7 years, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across 3 diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow 3 distinct developmental patterns of growth. These 3 trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds, with implications for offering individualized support across children. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

Laser Measurement Of Convective-Heat-Transfer Coefficient

NASA Technical Reports Server (NTRS)

Porro, A. Robert; Hingst, Warren R.; Chriss, Randall M.; Seablom, Kirk D.; Keith, Theo G., Jr.

1994-01-01

Coefficient of convective transfer of heat at spot on surface of wind-tunnel model computed from measurements acquired by developmental laser-induced-heat-flux technique. Enables non-intrusive measurements of convective-heat-transfer coefficients at many points across surfaces of models in complicated, three-dimensional, high-speed flows. Measurement spot scanned across surface of model. Apparatus includes argon-ion laser, attenuator/beam splitter electronic shutter infrared camera, and subsystem.

Citrinin induces apoptosis via a mitochondria-dependent pathway and inhibition of survival signals in embryonic stem cells, and causes developmental injury in blastocysts

PubMed Central

Chan, Wen-Hsiung

2007-01-01

The mycotoxin CTN (citrinin), a natural contaminant in foodstuffs and animal feeds, has cytotoxic and genotoxic effects on various mammalian cells. CTN is known to cause cell injury, including apoptosis, but the precise regulatory mechanisms of CTN action, particularly in stem cells and embryos, are currently unclear. In the present paper, I report that CTN has cytotoxic effects on mouse embryonic stem cells and blastocysts, and is associated with defects in their subsequent development, both in vitro and in vivo. Experiments in embryonic stem cells (ESC-B5) showed that CTN induces apoptosis via ROS (reactive oxygen species) generation, increased Bax/Bcl-2 ratio, loss of MMP (mitochondrial membrane potential), induction of cytochrome c release, and activation of caspase 3. In this model, CTN triggers cell death via inactivation of the HSP90 [a 90 kDa isoform of the HSP (heat-shock protein) family proteins]/multichaperone complex and subsequent degradation of Ras and Raf-1, further inhibiting anti-apoptotic processes, such as the Ras→ERK (extracellular-signal-regulated kinase) signal transduction pathway. In addition, CTN causes early developmental injury in mouse ESCs and blastocysts in vitro. Lastly, using an in vivo mouse model, I show that consumption of drinking water containing 10 μM CTN results in blastocyst apoptosis and early embryonic developmental injury. Collectively, these findings show for the first time that CTN induces ROS and mitochondria-dependent apoptotic processes, inhibits Ras→ERK survival signalling via inactivation of the HSP90/multichaperone complex, and causes developmental injury in vivo. PMID:17331071

Iron Absorption in Drosophila melanogaster

PubMed Central

Mandilaras, Konstantinos; Pathmanathan, Tharse; Missirlis, Fanis

2013-01-01

The way in which Drosophila melanogaster acquires iron from the diet remains poorly understood despite iron absorption being of vital significance for larval growth. To describe the process of organismal iron absorption, consideration needs to be given to cellular iron import, storage, export and how intestinal epithelial cells sense and respond to iron availability. Here we review studies on the Divalent Metal Transporter-1 homolog Malvolio (iron import), the recent discovery that Multicopper Oxidase-1 has ferroxidase activity (iron export) and the role of ferritin in the process of iron acquisition (iron storage). We also describe what is known about iron regulation in insect cells. We then draw upon knowledge from mammalian iron homeostasis to identify candidate genes in flies. Questions arise from the lack of conservation in Drosophila for key mammalian players, such as ferroportin, hepcidin and all the components of the hemochromatosis-related pathway. Drosophila and other insects also lack erythropoiesis. Thus, systemic iron regulation is likely to be conveyed by different signaling pathways and tissue requirements. The significance of regulating intestinal iron uptake is inferred from reports linking Drosophila developmental, immune, heat-shock and behavioral responses to iron sequestration. PMID:23686013

45 CFR 1385.1 - General.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES... the Rights of Individuals with Developmental Disabilities; (c)Projects of National Significance;and (d...

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

45 CFR 1386.80 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... Developmental Disabilities Assistance and Bill of Rights Act. This term includes Federal funds provided under...

Molecular basis of natural variation and environmental control of trichome patterning

PubMed Central

Hauser, Marie-Theres

2014-01-01

Trichomes are differentiated epidermal cells on above ground organs of nearly all land plants. They play important protective roles as structural defenses upon biotic attacks such as herbivory, oviposition and fungal infections, and against abiotic stressors such as drought, heat, freezing, excess of light, and UV radiation. The pattern and density of trichomes is highly variable within natural population suggesting tradeoffs between traits positively affecting fitness such as resistance and the costs of trichome production. The spatial distribution of trichomes is regulated through a combination of endogenous developmental programs and external signals. This review summarizes the current understanding on the molecular basis of the natural variation and the role of phytohormones and environmental stimuli on trichome patterning. PMID:25071803

Self-Regulated Strategy Instruction in College Developmental Writing

ERIC Educational Resources Information Center

MacArthur, Charles A.; Philippakos, Zoi A.; Ianetta, Melissa

2015-01-01

The purpose of this study was to evaluate the effects of a curriculum for college developmental writing classes, developed in prior design research and based on self-regulated strategy instruction. Students learned strategies for planning, drafting, and revising compositions with an emphasis on using knowledge of genre organization to guide…

GLUCOCORTICOID RECEPTOR REGULATION IN THE RAT EMBRYO: A POTENTIAL SITE FOR DEVELOPMENTAL TOXICITY?

EPA Science Inventory

Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?

Ghosh B, Wood CR, Held GA, Abbott BD, Lau C.

National Research Council, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711, USA.

Assessment of Reproductive and Developmental Toxicity of Mixtures of Regulated Drinking Water Chlorination By-Products in a Multigenerational Rat Bioassay

EPA Science Inventory

Epidemiological and animal toxicity studies have raised concerns regarding possible adverse reproductive and developmental effects of disinfection by-products (DBPs) in drinking water. To address these concerns, we provided mixtures of the regulated trihalomethanes (THMs; chlorof...

Developmental mechanisms regulating secondary growth in woody plants

Treesearch

Andrew Groover; Marcel Robischon

2006-01-01

Secondary growth results in the radial expansion of woody stems, and requires the coordination of tissue patterning, cell differentiation, and the maintenance of meristematic stem cells within the vascular cambium. Advances are being made towards describing molecular mechanisms that regulate these developmental processes, thanks in part to the application of new...

Developmental College Student Self-Regulation: Results from Two Measures

ERIC Educational Resources Information Center

Young, Dawn; Ley, Kathryn

2005-01-01

This study compared 34 lower-achieving (developmental) first-time college students' self-reported self-regulation strategies from a Likert scale to those they reported in structured interviews. Likert scales have offered convenient administration and evaluation and have been used to identify what and how learners study. The reported study activity…

Impact of hot events at different developmental stages of a moth: the closer to adult stage, the less reproductive output

PubMed Central

Zhang, Wei; Chang, Xiang-Qian; Hoffmann, AryA.; Zhang, Shu; Ma, Chun-Sen

2015-01-01

Hot days in summer (involving a few hours at particularly high temperatures) are expected to become more common under climate change. How such events at different life stages affect survival and reproduction remains unclear in most organisms. Here, we investigated how an exposure to 40 °C at different life stages in the global insect pest, Plutella xylostella, affects immediate survival, subsequent survival and reproductive output. First-instar larvae showed the lowest survival under heat stress, whereas 3rd-instar larvae were relatively heat resistant. Heat exposure at the 1st-instar or egg stage did not influence subsequent maturation success, while exposure at the 3rd-instar larval stage did have an effect. We found that heat stress at developmental stages closer to adult stage caused greater detrimental effects on reproduction than heat stress experienced at earlier life stages. The effects of hot events on insect populations can therefore depend critically on the timing of the event relative to an organism’s life-cycle. PMID:26000790

The Developmental Regulator SEEDSTICK Controls Structural and Mechanical Properties of the Arabidopsis Seed Coat

PubMed Central

Beauzamy, Léna; Caporali, Elisabetta; Koroney, Abdoul-Salam

2016-01-01

Although many transcription factors involved in cell wall morphogenesis have been identified and studied, it is still unknown how genetic and molecular regulation of cell wall biosynthesis is integrated into developmental programs. We demonstrate by molecular genetic studies that SEEDSTICK (STK), a transcription factor controlling ovule and seed integument identity, directly regulates PMEI6 and other genes involved in the biogenesis of the cellulose-pectin matrix of the cell wall. Based on atomic force microscopy, immunocytochemistry, and chemical analyses, we propose that structural modifications of the cell wall matrix in the stk mutant contribute to defects in mucilage release and seed germination under water-stress conditions. Our studies reveal a molecular network controlled by STK that regulates cell wall properties of the seed coat, demonstrating that developmental regulators controlling organ identity also coordinate specific aspects of cell wall characteristics. PMID:27624758

The History of Legislation and Regulations Related to Children with Developmental Disabilities: Implications for School Nursing Practice Today

ERIC Educational Resources Information Center

Dang, Michelle T.

2010-01-01

A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahamed, Maqusood; Posgai, Ryan; Gorey, Timothy J.

Due to the intensive commercial application of silver nanoparticles (Ag NPs), risk assessment of this nanoparticle is of great importance. Our previous in vitro study demonstrated that Ag NPs caused DNA damage and apoptosis in mouse embryonic stem cells and fibroblasts. However, toxicity of Ag NPs in vivo is largely lacking. This study was undertaken to examine the toxic effects of well-characterized polysaccharide coated 10 nm Ag NPs on heat shock stress, oxidative stress, DNA damage and apoptosis in Drosophila melanogaster. Third instar larvae of D. melanogaster were fed a diet of standard cornmeal media mixed with Ag NPs atmore » the concentrations of 50 and 100 mug/ml for 24 and 48 h. Ag NPs up-regulated the expression of heat shock protein 70 and induced oxidative stress in D. melanogaster. Malondialdehyde level, an end product of lipid peroxidation was significantly higher while antioxidant glutathione content was significantly lower in Ag NPs exposed organisms. Activities of antioxidant enzyme superoxide dismutase and catalase were also significantly higher in the organisms exposed to Ag NPs. Furthermore, Ag NPs up-regulated the cell cycle checkpoint p53 and cell signaling protein p38 that are involved in the DNA damage repair pathway. Moreover, activities of caspase-3 and caspase-9, markers of apoptosis were significantly higher in Ag NPs exposed organisms. The results indicate that Ag NPs in D. melanogaster induce heat shock stress, oxidative stress, DNA damage and apoptosis. This study suggests that the organism is stressed and thus warrants more careful assessment of Ag NPs using in vivo models to determine if chronic exposure presents developmental and reproductive toxicity.« less

Oxidative Stress, Unfolded Protein Response, and Apoptosis in Developmental Toxicity

PubMed Central

Kupsco, Allison; Schlenk, Daniel

2016-01-01

Physiological development requires precise spatiotemporal regulation of cellular and molecular processes. Disruption of these key events can generate developmental toxicity in the form of teratogenesis or mortality. The mechanism behind many developmental toxicants remains unknown. While recent work has focused on the unfolded protein response (UPR), oxidative stress, and apoptosis in the pathogenesis of disease, few studies have addressed their relationship in developmental toxicity. Redox regulation, UPR, and apoptosis are essential for physiological development and can be disturbed by a variety of endogenous and exogenous toxicants to generate lethality and diverse malformations. This review examines the current knowledge of the role of oxidative stress, UPR, and apoptosis in physiological development as well as in developmental toxicity, focusing on studies and advances in vertebrates model systems. PMID:26008783

Heat Tolerance Induction of the Indian Meal Moth (Lepidoptera: Pyralidae) Is Accompanied by Upregulation of Heat Shock Proteins and Polyols.

PubMed

Kim, Minhyun; Lee, Seunghee; Chun, Yong Shik; Na, Jahyun; Kwon, Hyeok; Kim, Wook; Kim, Yonggyun

2017-08-01

The Indian meal moth, Plodia interpunctella, causes massive damage to stored grains and processed foods. Heat treatment has been widely used to control insect pests infesting stored grains. However, heat treatment may result in unsatisfactory control owing to heat tolerance of target insects. This study quantified the heat tolerance and analyzed its induction in P. interpunctella. Susceptibility of P. interpunctella to different high temperatures was assessed in all developmental stages. Heat treatment at 44 °C for 1 h caused significant mortalities to all developmental stages, with late-instar larvae exhibiting the highest tolerance. However, the survivorship to heat treatment was significantly increased by pre-exposure to 37 °C for 30 min. The induction of heat tolerance was accompanied by upregulation of two heat shock proteins of Hsc70 and Hsp90. Trehalose and glycerol concentrations in the hemolymph also increased after pre-exposure to 37 °C for 30 min. RNA interference (RNAi) by specific double-stranded RNAs effectively suppressed the inducible expressions of both Hsc70 and Hsp90 in response to 37 °C for 30 min. Either RNAi of Hsc70 or Hsp90 significantly impaired the heat tolerance induction of P. interpunctella. These results suggest that the induction of heat tolerance in P. interpunctella involves the upregulation of these heat shock proteins and hemolymph polyol levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

PubMed

Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

2008-11-01

Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

A brief indicator of household energy security: associations with food security, child health, and child development in US infants and toddlers.

PubMed

Cook, John T; Frank, Deborah A; Casey, Patrick H; Rose-Jacobs, Ruth; Black, Maureen M; Chilton, Mariana; Ettinger de Cuba, Stephanie; Appugliese, Danielle; Coleman, Sharon; Heeren, Timothy; Berkowitz, Carol; Cutts, Diana B

2008-10-01

Household energy security has not been measured empirically or related to child health and development but is an emerging concern for clinicians and researchers as energy costs increase. The objectives of this study were to develop a clinical indicator of household energy security and assess associations with food security, health, and developmental risk in children <36 months of age. A cross-sectional study that used household survey and surveillance data was conducted. Caregivers were interviewed in emergency departments and primary care clinics form January 2001 through December 2006 on demographics, public assistance, food security, experience with heating/cooling and utilities, Parents Evaluation of Developmental Status, and child health. The household energy security indicator includes energy-secure, no energy problems; moderate energy insecurity, utility shutoff threatened in past year; and severe energy insecurity, heated with cooking stove, utility shutoff, or >or=1 day without heat/cooling in past year. The main outcome measures were household and child food security, child reported health status, Parents Evaluation of Developmental Status concerns, and hospitalizations. Of 9721 children, 11% (n = 1043) and 23% (n = 2293) experienced moderate and severe energy insecurity, respectively. Versus children with energy security, children with moderate energy insecurity had greater odds of household food insecurity, child food insecurity, hospitalization since birth, and caregiver report of child fair/poor health, adjusted for research site and mother, child, and household characteristics. Children with severe energy insecurity had greater adjusted odds of household food insecurity, child food insecurity, caregivers reporting significant developmental concerns on the Parents Evaluation of Developmental Status scale, and report of child fair/poor health. No significant association was found between energy security and child weight for age or weight for length. As household energy insecurity increases, infants and toddlers experienced increased odds of household and child food insecurity and of reported poor health, hospitalizations, and developmental risks.

45 CFR 1386.33 - Protection of employee's interests.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Section 1386.33 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Federal Assistance to State Developmental Disabilities...

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

[Regulation of heat shock gene expression in response to stress].

PubMed

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS protein mRNAs ensure their preferential translation in stress.

Developmental stability, age at onset of foraging and longevity of Africanized honey bees (Apis mellifera L.) under heat stress (Hymenoptera: Apidae).

PubMed

Medina, Rubén G; Paxton, Robert J; De Luna, Efraín; Fleites-Ayil, Fernando A; Medina Medina, Luis A; Quezada-Euán, José Javier G

2018-05-01

Beekeeping with the western honey bee (Apis mellifera) is important in tropical regions but scant information is available on the possible consequences of global warming for tropical beekeeping. We evaluated the effect of heat stress on developmental stability, the age at onset of foraging (AOF) and longevity in Africanized honey bees (AHBs) in the Yucatan Peninsula of Mexico, one of the main honey producing areas in the Neotropics, where high temperatures occur in spring and summer. To do so, we reared worker AHB pupae under a fluctuating temperature regime, simulating current tropical heatwaves, with a high temperature peak of 40.0 °C for 1 h daily across six days, and compared them to control pupae reared at stable temperatures of 34.0-35.5 °C. Heat stress did not markedly affect overall body size, though the forewing of heat-stressed bees was slightly shorter than controls. However, bees reared under heat stress showed significantly greater fluctuating asymmetry (FA) in forewing shape. Heat stress also decreased AOF and reduced longevity. Our results show that changes occur in the phenotype and behavior of honey bees under heat stress, with potential consequences for colony fitness. Copyright © 2018 Elsevier Ltd. All rights reserved.

Annotation of Differential Gene Expression in Small Yellow Follicles of a Broiler-Type Strain of Taiwan Country Chickens in Response to Acute Heat Stress.

PubMed

Cheng, Chuen-Yu; Tu, Wei-Lin; Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

2015-01-01

This study investigated global gene expression in the small yellow follicles (6-8 mm diameter) of broiler-type B strain Taiwan country chickens (TCCs) in response to acute heat stress. Twelve 30-wk-old TCC hens were divided into four groups: control hens maintained at 25°C and hens subjected to 38°C acute heat stress for 2 h without recovery (H2R0), with 2-h recovery (H2R2), and with 6-h recovery (H2R6). Small yellow follicles were collected for RNA isolation and microarray analysis at the end of each time point. Results showed that 69, 51, and 76 genes were upregulated and 58, 15, 56 genes were downregulated after heat treatment of H2R0, H2R2, and H2R6, respectively, using a cutoff value of two-fold or higher. Gene ontology analysis revealed that these differentially expressed genes are associated with the biological processes of cell communication, developmental process, protein metabolic process, immune system process, and response to stimuli. Upregulation of heat shock protein 25, interleukin 6, metallopeptidase 1, and metalloproteinase 13, and downregulation of type II alpha 1 collagen, discoidin domain receptor tyrosine kinase 2, and Kruppel-like factor 2 suggested that acute heat stress induces proteolytic disintegration of the structural matrix and inflamed damage and adaptive responses of gene expression in the follicle cells. These suggestions were validated through gene expression, using quantitative real-time polymerase chain reaction. Functional annotation clarified that interleukin 6-related pathways play a critical role in regulating acute heat stress responses in the small yellow follicles of TCC hens.

Annotation of Differential Gene Expression in Small Yellow Follicles of a Broiler-Type Strain of Taiwan Country Chickens in Response to Acute Heat Stress

PubMed Central

Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

2015-01-01

This study investigated global gene expression in the small yellow follicles (6–8 mm diameter) of broiler-type B strain Taiwan country chickens (TCCs) in response to acute heat stress. Twelve 30-wk-old TCC hens were divided into four groups: control hens maintained at 25°C and hens subjected to 38°C acute heat stress for 2 h without recovery (H2R0), with 2-h recovery (H2R2), and with 6-h recovery (H2R6). Small yellow follicles were collected for RNA isolation and microarray analysis at the end of each time point. Results showed that 69, 51, and 76 genes were upregulated and 58, 15, 56 genes were downregulated after heat treatment of H2R0, H2R2, and H2R6, respectively, using a cutoff value of two-fold or higher. Gene ontology analysis revealed that these differentially expressed genes are associated with the biological processes of cell communication, developmental process, protein metabolic process, immune system process, and response to stimuli. Upregulation of heat shock protein 25, interleukin 6, metallopeptidase 1, and metalloproteinase 13, and downregulation of type II alpha 1 collagen, discoidin domain receptor tyrosine kinase 2, and Kruppel-like factor 2 suggested that acute heat stress induces proteolytic disintegration of the structural matrix and inflamed damage and adaptive responses of gene expression in the follicle cells. These suggestions were validated through gene expression, using quantitative real-time polymerase chain reaction. Functional annotation clarified that interleukin 6-related pathways play a critical role in regulating acute heat stress responses in the small yellow follicles of TCC hens. PMID:26587838

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

PubMed

Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

2015-12-22

Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

Emotion regulation: a theme in search of definition.

PubMed

Thompson, R A

1994-01-01

Contemporary interest in emotion regulation promises to advance important new views of emotional development as well as offering applications to developmental psychopathology, but these potential contributions are contingent on developmentalists' attention to some basic definitional issues. This essay offers a perspective on these issues by considering how emotion regulation should be defined, the various components of the management of emotion, how emotion regulation strategies fit into the dynamics of social interaction, and how individual differences in emotion regulation should be conceptualized and measured. In the end, it seems clear that emotion regulation is a conceptual rubric for a remarkable range of developmental processes, each of which may have its own catalysts and control processes. Likewise, individual differences in emotion regulation skills likely have multifaceted origins and are also related in complex ways to the person's emotional goals and the immediate demands of the situation. Assessment approaches that focus on the dynamics of emotion are well suited to elucidating these complex developmental and individual differences. In sum, a challenging research agenda awaits those who enter this promising field of study.

Isolation and Characterization of a myo-inositol-1-phosphate Synthase Gene from Yellow Passion Fruit (Passiflora edulis f. flavicarpa) Expressed During Seed Development and Environmental Stress

PubMed Central

Abreu, Emanuel F. M.; Aragão, Francisco J. L.

2007-01-01

Background and Aims Myo-inositol-1l-phosphate synthase (MIPS) catalyses the conversion of d-glucose 6-phosphate to 1-l-myo-inositol-1-phosphate, the first and rate-limiting step in the biosynthesis of all inositol-containing compounds. Inositol phospholipids play a vital role in membrane trafficking and signalling pathways, auxin storage and transport, phytic acid biosynthesis, cell wall biosynthesis and production of stress-related molecules. In the present study, an MIPS cDNA from developing Passiflora edulis f. flavicarpa seeds was characterized and an investigation made into its spatial and differential expression, as well as changes in its transcription during exposure of growing plants to cold and heat stresses. Methods The MIPS-encoding gene was isolated by polymerase chain reaction (PCR) methods, and transcript levels were examined using semi-quantitative reverse transcription–PCR (RT–PCR) during seed development and in response to heat and cold stress. In addition, the copy number of the cloned PeMIPS1 gene in the genome of Passiflora edulis, P. eichleriana, P. caerulea, P. nitida and P. coccinea was determined by Southern blot analyses. Key Results A full-length cDNA clone of the PeMIPS1 from P. edulis was isolated and characterized. Southern blot analyses indicated that the genomic DNA might have diverse sequences of MIPS-encoding genes and one copy of the cloned PeMIPS1 gene in the genomes of P. edulis, P. eichleriana, P. caerulea, P. nitida and P. coccinea. RT–PCR expression analyses revealed the presence of PeMIPS1 transcripts in ovules, pollen grains and leaves, and during the seed developmental stages, where it peaked at 9 d after pollination. The PeMIPS1 gene is differentially regulated under cold and heat stress, presenting a light-responsive transcription. Conclusions Experimental data suggest that PeMIPS1 transcription plays an important role in the establishment of developmental programmes and during the response of plants to environmental changes. The PeMIPS1 is differentially transcribed during cold and heat stress, presenting a light response pattern, suggesting that it is important for environmental stress response. PMID:17138579

Development of Civic Engagement: Theoretical and Methodological Issues

ERIC Educational Resources Information Center

Lerner, Richard M.; Wang, Jun; Champine, Robey B.; Warren, Daniel J. A.; Erickson, Karl

2014-01-01

Within contemporary developmental science, models derived from relational developmental systems (RDS) metatheory emphasize that the basic process of human development involves mutually-influential relations, termed developmental regulations, between the developing individual and his or her complex and changing physical, social, and cultural…

Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

EPA Science Inventory

Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

PubMed Central

Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

2011-01-01

Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low- and highly-methyl-esterified HG epitopes are developmentally regulated in diverse embryogenic stages during somatic embryogenesis. This study provides new information about pectin composition, HG methyl-esterification and developmental localization of pectin epitopes during somatic embryogenesis of banana. PMID:21826225

29 CFR 1952.384 - Completed developmental steps.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completed developmental steps. 1952.384 Section 1952.384 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION....384 Completed developmental steps. (a) In accordance with the requirements of § 1952.10, Puerto Rico's...

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

The ULTRAPETALA1 trxG factor contributes to patterning the Arabidopsis adaxial-abaxial leaf polarity axis

USDA-ARS?s Scientific Manuscript database

The SAND domain protein ULTRAPETALA1 (ULT1) functions as a trithorax group factor that regulates a variety of developmental processes in Arabidopsis. We have recently shown that ULT1 regulates developmental patterning in the gynoecia and leaves. ULT1 acts together with the KANADI1 (KAN1) transcripti...

Using Formative Assessment and Self-Regulated Learning to Help Developmental Mathematics Students Achieve: A Multi-Campus Program

ERIC Educational Resources Information Center

Hudesman, John; Crosby, Sara; Ziehmke, Niesha; Everson, Howard; Issac, Sharlene; Flugman, Bert; Zimmerman, Barry; Moylan, Adam

2014-01-01

The authors describe an Enhanced Formative Assessment and Self-Regulated Learning (EFA-SRL) program designed to improve the achievement of community college students enrolled in developmental mathematics courses. Their model includes the use of specially formatted quizzes designed to assess both the students' mathematics and metacognitive skill…

Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

ERIC Educational Resources Information Center

Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

2016-01-01

The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

The Effects of Self-Regulated Learning Training on Community College Students' Metacognition and Achievement in Developmental Math Courses

ERIC Educational Resources Information Center

Bol, Linda; Campbell, Karen D. Y.; Perez, Tony; Yen, Cherng-Jyh

2016-01-01

The effects of training in self-regulation on metacognition and math achievement were investigated. The participants were 116 community college students enrolled in developmental math courses. Students enrolled in 16 classrooms were randomly assigned to the treatment and control groups. Participants in the treatment group completed four…

SNAT2 and LAT1 transporter abundance is developmentally regulated in skeletal muscle of neonatal pigs

USDA-ARS?s Scientific Manuscript database

Previously, we demonstrated that the insulin and amino acid–induced activation of the mammalian target of rapamycin complex 1 (mTORC1), is developmentally regulated in neonatal pigs. Recent studies have indicated an important role of the System A transporters (SNAT2 and SLC1A5) and the L transporter...

Conscientiousness: Origins in Childhood?

PubMed Central

Eisenberg, Nancy; Duckworth, Angela L.; Spinrad, Tracy L.; Valiente, Carlos

2012-01-01

In this review, we evaluate developmental and personality research with the aim of determining if the personality trait of conscientiousness can be identified in children and adolescents. After concluding that conscientiousness does emerge in childhood, we discuss the developmental origins of conscientiousness with a specific focus on self-regulation, academic motivation, and internalized compliance/internalization of standards. Based on the accumulated body of evidence, we conclude that self-regulation fosters conscientiousness later in life, both directly and via academic motivation and internalized compliance with norms. We argue that elements of conscientiousness are evident by early childhood, self-regulation skills are likely a core developmental component of conscientiousness, and despite the contribution of heredity to the aforementioned aspects of functioning, environmental factors likely contribute to conscientiousness. PMID:23244405

Epigenetic events in plant male germ cell heat stress responses.

PubMed

Chen, Yuanyuan; Müller, Florian; Rieu, Ivo; Winter, Peter

2016-06-01

A review on pollen epigenetics. Plants grow in an ever-changing environment and are used to environmental fluctuations such as high and low temperatures during their life cycles. To cope with adverse conditions, plants have evolved intricate short-term and long-term mechanisms to respond and adapt to external stresses. The plant's ability to respond to stresses largely depends on its capacity to modulate the transcriptome rapidly and specifically. Epigenetic mechanisms, including DNA methylation, chromatin dynamics and small RNAs, play an essential role in the regulation of stress-responsive gene expression. Stress-related covalent modifications of DNA and histones can be passed on during mitosis and meiosis to the next generation and provide a memory that enables the plant and even its offspring to adopt better to a subsequent stress. Plant reproduction, in particular pollen development, is the most stress-sensitive process in the life cycle of the organism. In particular, developmental stages around the meiotic and mitotic divisions are the most vulnerable. In this review, we highlight the current understanding of epigenetic mechanisms involved in pollen development and speculate on their roles in pollen heat stress response.

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Cyber "Pokes": Motivational Antidote for Developmental College Readers

ERIC Educational Resources Information Center

Bowers-Campbell, Joy

2008-01-01

Difficulties characterizing developmental college students are reviewed within the context of motivational theories of learning. The author highlights problems of low self-efficacy and inadequate self-regulated learning for developmental college students. The author argues that the use of Facebook, a widely-used social networking technology, may…

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

Lysophosphatidic acid acts as a nutrient-derived developmental cue to regulate early hematopoiesis

PubMed Central

Li, Haisen; Yue, Rui; Wei, Bin; Gao, Ge; Du, Jiulin; Pei, Gang

2014-01-01

Primitive hematopoiesis occurs in the yolk sac blood islands during vertebrate embryogenesis, where abundant phosphatidylcholines (PC) are available as important nutrients for the developing embryo. However, whether these phospholipids also generate developmental cues to promote hematopoiesis is largely unknown. Here, we show that lysophosphatidic acid (LPA), a signaling molecule derived from PC, regulated hemangioblast formation and primitive hematopoiesis. Pharmacological and genetic blockage of LPA receptor 1 (LPAR1) or autotoxin (ATX), a secretory lysophospholipase that catalyzes LPA production, inhibited hematopoietic differentiation of mouse embryonic stem cells and impaired the formation of hemangioblasts. Mechanistic experiments revealed that the regulatory effect of ATX-LPA signaling was mediated by PI3K/Akt-Smad pathway. Furthermore, during in vivo embryogenesis in zebrafish, LPA functioned as a developmental cue for hemangioblast formation and primitive hematopoiesis. Taken together, we identified LPA as an important nutrient-derived developmental cue for primitive hematopoiesis as well as a novel mechanism of hemangioblast regulation. PMID:24829209

Lysophosphatidic acid acts as a nutrient-derived developmental cue to regulate early hematopoiesis.

PubMed

Li, Haisen; Yue, Rui; Wei, Bin; Gao, Ge; Du, Jiulin; Pei, Gang

2014-06-17

Primitive hematopoiesis occurs in the yolk sac blood islands during vertebrate embryogenesis, where abundant phosphatidylcholines (PC) are available as important nutrients for the developing embryo. However, whether these phospholipids also generate developmental cues to promote hematopoiesis is largely unknown. Here, we show that lysophosphatidic acid (LPA), a signaling molecule derived from PC, regulated hemangioblast formation and primitive hematopoiesis. Pharmacological and genetic blockage of LPA receptor 1 (LPAR1) or autotoxin (ATX), a secretory lysophospholipase that catalyzes LPA production, inhibited hematopoietic differentiation of mouse embryonic stem cells and impaired the formation of hemangioblasts. Mechanistic experiments revealed that the regulatory effect of ATX-LPA signaling was mediated by PI3K/Akt-Smad pathway. Furthermore, during in vivo embryogenesis in zebrafish, LPA functioned as a developmental cue for hemangioblast formation and primitive hematopoiesis. Taken together, we identified LPA as an important nutrient-derived developmental cue for primitive hematopoiesis as well as a novel mechanism of hemangioblast regulation. © 2014 The Authors.

Integrated mRNA and microRNA transcriptome analyses reveal regulation of thermal acclimation in Gymnocypris przewalskii: A case study in Tibetan Schizothoracine fish

PubMed Central

Tian, Fei; Zhao, Kai

2017-01-01

Environmental acclimation is important episode in wildlife occupation of the high-altitude Tibetan Plateau (TP). Transcriptome-wide studies on thermal acclimation mechanism in fish species are rarely revealed in Tibetan Plateau fish at high altitude. Thus, we used mRNA and miRNA transcriptome sequencing to investigate regulation of thermal acclimation in larval Tibetan naked carp, Gymnocypris przewalskii. We first remodeled the regulation network of mRNA and miRNA in thermal acclimation, and then identified differential expression of miRNAs and target mRNAs enriched in metabolic and digestive pathways. Interestingly, we identified two candidate genes contributed to normal skeletal development. The altered expression of these gene groups could potentially be associated with the developmental issues of deformity and induced larval death. Our results have three important implications: first, these findings provide strong evidences to support our hypothesis that G. przewalskii possess ability to build heat-tolerance against the controversial issue. Second, this study shows that transcriptional and post-transcriptional regulations are extensively involved in thermal acclimation. Third, the integrated mRNA and microRNA transcriptome analyses provide a large number of valuable genetic resources for future studies on environmental stress response in G. przewalskii and as a case study in Tibetan Schizothoracine fish. PMID:29045433

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

29 CFR 1956.62 - Completion of developmental steps and certification. [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completion of developmental steps and certification. [Reserved] 1956.62 Section 1956.62 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... EMPLOYEE PLANS New Jersey § 1956.62 Completion of developmental steps and certification. [Reserved] ...

Small Heat Shock Proteins Can Release Light Dependence of Tobacco Seed during Germination1[OPEN

PubMed Central

Koo, Hyun Jo; Park, Soo Min; Kim, Keun Pill; Suh, Mi Chung; Lee, Mi Ok; Lee, Seong-Kon; Xinli, Xia

2015-01-01

Small heat shock proteins (sHSPs) function as ATP-independent molecular chaperones, and although the production and function of sHSPs have often been described under heat stress, the expression and function of sHSPs in fundamental developmental processes, such as pollen and seed development, have also been confirmed. Seed germination involves the breaking of dormancy and the resumption of embryo growth that accompany global changes in transcription, translation, and metabolism. In many plants, germination is triggered simply by imbibition of water; however, different seeds require different conditions in addition to water. For small-seeded plants, like Arabidopsis (Arabidopsis thaliana), lettuce (Lactuca sativa), tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum), light is an important regulator of seed germination. The facts that sHSPs accumulate during seed development, sHSPs interact with various client proteins, and seed germination accompanies synthesis and/or activation of diverse proteins led us to investigate the role of sHSPs in seed germination, especially in the context of light dependence. In this study, we have built transgenic tobacco plants that ectopically express sHSP, and the effect was germination of the seeds in the dark. Administering heat shock to the seeds also resulted in the alleviation of light dependence during seed germination. Subcellular localization of ectopically expressed sHSP was mainly observed in the cytoplasm, whereas heat shock-induced sHSPs were transported to the nucleus. We hypothesize that ectopically expressed sHSPs in the cytoplasm led the status of cytoplasmic proteins involved in seed germination to function during germination without additional stimulus and that heat shock can be another signal that induces seed germination. PMID:25604531

Functional metabolomics as a tool to analyze Mediator function and structure in plants.

PubMed

Davoine, Celine; Abreu, Ilka N; Khajeh, Khalil; Blomberg, Jeanette; Kidd, Brendan N; Kazan, Kemal; Schenk, Peer M; Gerber, Lorenz; Nilsson, Ove; Moritz, Thomas; Björklund, Stefan

2017-01-01

Mediator is a multiprotein transcriptional co-regulator complex composed of four modules; Head, Middle, Tail, and Kinase. It conveys signals from promoter-bound transcriptional regulators to RNA polymerase II and thus plays an essential role in eukaryotic gene regulation. We describe subunit localization and activities of Mediator in Arabidopsis through metabolome and transcriptome analyses from a set of Mediator mutants. Functional metabolomic analysis based on the metabolite profiles of Mediator mutants using multivariate statistical analysis and heat-map visualization shows that different subunit mutants display distinct metabolite profiles, which cluster according to the reported localization of the corresponding subunits in yeast. Based on these results, we suggest localization of previously unassigned plant Mediator subunits to specific modules. We also describe novel roles for individual subunits in development, and demonstrate changes in gene expression patterns and specific metabolite levels in med18 and med25, which can explain their phenotypes. We find that med18 displays levels of phytoalexins normally found in wild type plants only after exposure to pathogens. Our results indicate that different Mediator subunits are involved in specific signaling pathways that control developmental processes and tolerance to pathogen infections.

New Directions in Developmental Emotion Regulation Research across the Life Span: Introduction to the Special Section

ERIC Educational Resources Information Center

Zimmermann, Peter; Thompson, Ross A.

2014-01-01

Research on the development of emotion regulation has become a prominent topic in developmental science covering a broad age range from infancy to old age because of its theoretical importance and practical implications. This introductory essay of this special section includes reflections on some of the conceptual themes of this research field and…

Abundance of amino acid transporters involved in mTORC1 activation in skeletal muscle of neonatal pigs is developmentally regulated

USDA-ARS?s Scientific Manuscript database

Previously we demonstrated that the insulinand amino acid-induced activation of the mammalian target of rapamycin complex 1 (mTORC1) is developmentally regulated in neonatal pigs. Recent studies have indicated that members of the System A transporter (SNAT2), the System N transporter (SNAT3), the Sy...

Medicaid program; mental retardation--definition of "persons with related conditions"--Health Care Financing Administration. Proposed rule.

PubMed

1983-02-23

We propose to amend the 1978 Medicaid regulations on intermediate care facility services for the mentally retarded and persons with related conditions to correct the definition of "persons with related conditions". This definition, because of an inadvertent error in 1978, is currently tied to the definition of developmental disability in the Developmental Disabilities Assistance and Bill of Rights Act (DDABRA) as amended in 1978. The DDABRA, as amended, covers the mentally ill. The 1978 regulations intended to make "no substantive change" to prior Medicaid regulations which did not cover the mentally ill. The cross-reference to the DDABRA produced the unintended result of incorporating into Medicaid regulations the revision to the definition of the developmentally disabled created by the 1978 amendments to the DDABRA and may tend to cause confusion about the kind of care that is covered by the Medicaid program. Therefore, a correction of this drafting error is necessary. To avoid results of this kind in the future this proposal would establish a Medicaid definition of conditions related to mental retardation that would meet specific needs of the Medicaid program and would be independent of the definition of developmental disability in the DDABRA.

Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)

USGS Publications Warehouse

Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.

2003-01-01

Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance. 

Developmental model of static allometry in holometabolous insects.

PubMed

Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W

2008-08-22

The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.

Differential response of cell-cycle and cell-expansion regulators to heat stress in apple (Malus domestica) fruitlets.

PubMed

Flaishman, Moshe A; Peles, Yuval; Dahan, Yardena; Milo-Cochavi, Shira; Frieman, Aviad; Naor, Amos

2015-04-01

Temperature is one of the most significant factors affecting physiological and biochemical aspects of fruit development. Current and progressing global warming is expected to change climate in the traditional deciduous fruit tree cultivation regions. In this study, 'Golden Delicious' trees, grown in a controlled environment or commercial orchard, were exposed to different periods of heat treatment. Early fruitlet development was documented by evaluating cell number, cell size and fruit diameter for 5-70 days after full bloom. Normal activities of molecular developmental and growth processes in apple fruitlets were disrupted under daytime air temperatures of 29°C and higher as a result of significant temporary declines in cell-production and cell-expansion rates, respectively. Expression screening of selected cell cycle and cell expansion genes revealed the influence of high temperature on genetic regulation of apple fruitlet development. Several core cell-cycle and cell-expansion genes were differentially expressed under high temperatures. While expression levels of B-type cyclin-dependent kinases and A- and B-type cyclins declined moderately in response to elevated temperatures, expression of several cell-cycle inhibitors, such as Mdwee1, Mdrbr and Mdkrps was sharply enhanced as the temperature rose, blocking the cell-cycle cascade at the G1/S and G2/M transition points. Moreover, expression of several expansin genes was associated with high temperatures, making them potentially useful as molecular platforms to enhance cell-expansion processes under high-temperature regimes. Understanding the molecular mechanisms of heat tolerance associated with genes controlling cell cycle and cell expansion may lead to the development of novel strategies for improving apple fruit productivity under global warming. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Characteristics of six small heat shock protein genes from Bactrocera dorsalis: Diverse expression under conditions of thermal stress and normal growth.

PubMed

Dou, Wei; Tian, Yi; Liu, Hong; Shi, Yan; Smagghe, Guy; Wang, Jin-Jun

2017-11-01

To explore the functions of small heat shock proteins (sHsps) in relation to thermal stress and development in Bactrocera dorsalis (Hendel), one of the most economically important pest species attacking a wide range of fruits and vegetables, six full-length cDNAs of sHsp genes (BdHsp17.7, 18.4, 20.4, 20.6, 21.6 and 23.8) were cloned, and the expression patterns in different developmental stages and tissues, as well as in response to both thermal and 20-hydroxyecdysone (20E) exposures, were examined using real time quantitative PCR. The open reading frames (ORFs) of six sHsps are 453, 489, 537, 543, 567 and 630bp in length, encoding proteins with molecular weights of 17.7, 18.4, 20.4, 20.6, 21.6 and 23.8kDa, respectively. BdHsp18.4 and BdHsp20.4 maintained lower expression levels in both eggs and larvae, whereas remarkably up-regulated after the larval-pupal transformation, suggesting that these two sHsps may be involved in metamorphosis. Significant tissue specificity exists among sHsps: the highest expression of BdHsp20.6 and BdHsp23.8 in the Malpighian tubules and ovary, respectively, versus a peak in the fat body for others. BdHsp20.4 and BdHsp20.6 were significantly up-regulated by thermal stress. In contrast, BdHsp18.4 and BdHsp23.8 reacted only to heat stress. BdHsp17.7 and BdHsp21.6 were insensitive to both heat and cold stresses. The degree of sHsps response depends on intensity of 20E treatment, i.e., dose and time. These results strongly suggest functional differentiation within the sHsp subfamily in B. dorsalis. The physiological function of sHsp members under thermal stress and normal growth remains the subjects of further investigation. Copyright © 2017 Elsevier Inc. All rights reserved.

Development and regulation of chloride homeostasis in the central nervous system.

PubMed

Watanabe, Miho; Fukuda, Atsuo

2015-01-01

γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter of the mature central nervous system (CNS). The developmental switch of GABAergic transmission from excitation to inhibition is induced by changes in Cl(-) gradients, which are generated by cation-Cl(-) co-transporters. An accumulation of Cl(-) by the Na(+)-K(+)-2Cl(-) co-transporter (NKCC1) increases the intracellular Cl(-) concentration ([Cl(-)]i) such that GABA depolarizes neuronal precursors and immature neurons. The subsequent ontogenetic switch, i.e., upregulation of the Cl(-)-extruder KCC2, which is a neuron-specific K(+)-Cl(-) co-transporter, with or without downregulation of NKCC1, results in low [Cl(-)]i levels and the hyperpolarizing action of GABA in mature neurons. Development of Cl(-) homeostasis depends on developmental changes in NKCC1 and KCC2 expression. Generally, developmental shifts (decreases) in [Cl(-)]i parallel the maturation of the nervous system, e.g., early in the spinal cord, hypothalamus and thalamus, followed by the limbic system, and last in the neocortex. There are several regulators of KCC2 and/or NKCC1 expression, including brain-derived neurotrophic factor (BDNF), insulin-like growth factor (IGF), and cystic fibrosis transmembrane conductance regulator (CFTR). Therefore, regionally different expression of these regulators may also contribute to the regional developmental shifts of Cl(-) homeostasis. KCC2 and NKCC1 functions are also regulated by phosphorylation by enzymes such as PKC, Src-family tyrosine kinases, and WNK1-4 and their downstream effectors STE20/SPS1-related proline/alanine-rich kinase (SPAK)-oxidative stress responsive kinase-1 (OSR1). In addition, activation of these kinases is modulated by humoral factors such as estrogen and taurine. Because these transporters use the electrochemical driving force of Na(+) and K(+) ions, topographical interaction with the Na(+)-K(+) ATPase and its modulators such as creatine kinase (CK) should modulate functions of Cl(-) transporters. Therefore, regional developmental regulation of these regulators and modulators of Cl(-) transporters may also play a pivotal role in the development of Cl(-) homeostasis.

Epigenetic mechanisms in heart development and disease.

PubMed

Martinez, Shannalee R; Gay, Maresha S; Zhang, Lubo

2015-07-01

Suboptimal intrauterine development has been linked to predisposition to cardiovascular disease in adulthood, a concept termed 'developmental origins of health and disease'. Although the exact mechanisms underlying this developmental programming are unknown, a growing body of evidence supports the involvement of epigenetic regulation. Epigenetic mechanisms such as DNA methylation, histone modifications and micro-RNA confer added levels of gene regulation without altering DNA sequences. These modifications are relatively stable signals, offering possible insight into the mechanisms underlying developmental origins of health and disease. This review will discuss the role of epigenetic mechanisms in heart development as well as aberrant epigenetic regulation contributing to cardiovascular disease. Additionally, we will address recent advances targeting epigenetic mechanisms as potential therapeutic approaches to cardiovascular disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

PubMed Central

Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

2012-01-01

Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 4 2012-10-01 2012-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES...

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

Physiology and Endocrinology Symposium: influence of cattle genotype (Bos indicus vs. Bos taurus) on oocyte and preimplantation embryo resistance to increased temperature.

PubMed

Paula-Lopes, F F; Lima, R S; Satrapa, R A; Barros, C M

2013-03-01

High environmental temperatures during the hot months of the year reduce reproductive performance in cattle. Summer heat stress depression in fertility is a multifactorial problem; however, there is evidence that the bovine germinal vesicle and maturing oocyte, as well as the early embryo, are major targets of the deleterious effects of heat stress. Such adverse effects are less pronounced in heat-tolerant breeds (Bos indicus) than heat-sensitive breeds (Bos taurus). This genetic variation results from the greater thermoregulatory ability and cellular thermoresistance of heat-tolerant breeds. Heat-induced oocyte cellular damage occurs in both cytoplasmic and nuclear compartments. Heat shock has been shown to reduce oocyte nuclear maturation, induce apoptosis, compromise oocyte cytoskeleton, and impair oocyte mitochondrial function and developmental competence. However, the oocyte cytoplasm is more susceptible to heat shock than the nucleus. This effect is greater for Bos taurus than Bos indicus oocytes. The detrimental effects of heat shock are also critical during the first cleavage divisions when most of the embryonic genome is inactive; however, the bovine embryo becomes more resistant to increased temperature as it proceeds through development. Several studies demonstrated that Bos indicus embryos are more thermotolerant than Bos taurus embryos. Adaptive changes involved in acquisition of thermotolerance are likely derived from changes in gene expression and (or) activity of biochemical molecules that control cellular functions against stress. Recently, molecules such as IGF-I and caspase inhibitor z-DEVD-fmk have been shown to exert a thermoprotective role, rescuing heat-induced oocyte and embryo cellular damage and developmental competence. Therefore, cattle genotype and thermoprotective molecules can be considered as an alternative to modulate the effects of increased temperature in reproductive function.

Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

PubMed Central

2009-01-01

Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic genes in grape berries. Integration of the transcript, radiotracer and metabolite data demonstrates that Asc and TA metabolism are developmentally regulated in grapevines; resulting in low accumulated levels of the biosynthetic intermediate Asc, and high accumulated levels of the metabolic end-product TA. PMID:19995454

Expression of AeaHsp26 and AeaHsp83 in Aedes aegypti Larvae and Pupae in Response to Heat Shock Stress.

USDA-ARS?s Scientific Manuscript database

Immature mosquito development and survival of adults is highly sensitive to environmental temperature and temperature can alter gene expression during the mosquito life-cycle. To further understand how heat shock proteins (HSPs) are developmentally expressed in mosquitoes, we subjected of 1st instar...

Molecular characterization and expression analysis of heat shock protein 70 and 90 from Hermetia illucens reared in a food waste bioconversion pilot plant.

PubMed

Giannetto, Alessia; Oliva, Sabrina; Mazza, Lorenzo; Mondello, Giovanni; Savastano, Domenico; Mauceri, Angela; Fasulo, Salvatore

2017-09-05

Two full-length cDNAs of heat shock protein (HSP) genes (Hihsp70 and Hihsp90) were cloned from the black soldier fly (BSF) Hermetia illucens larvae reared in a food waste bioconversion pilot plant. The Hihsp70 and Hihsp90 transcripts were 2243 and 2507bp long, contained 1923 and 2166bp open reading frames encoding proteins of 640 and 721 amino acids with a molecular mass of 69.8 and 83kDa, respectively. Comparative analysis of protein sequences revealed the presence of the conserved HSP motifs in both proteins, showing high homology to their counterparts in other insect species from six different orders. Hihsp70 and Hihsp90 transcriptional expression profiles during two key developmental stages in the bioconversion process were evaluated by quantitative real time PCR showing that both genes were modulated during larval development. HiHsp70 mRNA expression levels during the II instar larvae was higher in respect to the V instar larvae. A similar difference in mRNA expression levels, but in a less extent, was found for the Hihsp90. Moreover, a diverse transcript level between the two genes at the V larval stage was observed where Hihsp90 was up-regulated compared to Hihsp70. These results suggested the involvement of Hsp70 and Hsp90 in H. illucens development and provide further evidences on the ecological and evolutionary importance of HSPs in the insect developmental processes together with valuable information on molecular features of adaptability to peculiar rearing conditions during food waste bioconversion. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

PubMed

Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

2002-05-01

Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

The let-7 microRNA interfaces extensively with the translation machinery to regulate cell differentiation

PubMed Central

Ding, Xavier C.; Slack, Frank J.; Großhans, Helge

2010-01-01

MicroRNAs (miRNAs) are noncoding RNAs that regulate numerous target genes through a posttranscriptional mechanism and thus control major developmental pathways. The phylogenetically conserved let-7 miRNA regulates cell proliferation and differentiation, thus functioning as a key regulator of developmental timing in C. elegans and a tumor suppressor gene in humans. Using a reverse genetic screen, we have identified genetic interaction partners of C. elegans let-7, including known and novel potential target genes. Initial identification of several translation initiation factors as suppressors of a let-7 mutation led us to systematically examine genetic interaction between let-7 and the translational machinery, which we found to be widespread. In the presence of wild-type let-7, depletion of the translation initiation factor eIF3 resulted in precocious cell differentiation, suggesting that developmental timing is translationally regulated, possibly by let-7. As overexpression of eIF3 in humans promotes translation of mRNAs that are also targets of let-7-mediated repression, we suggest that eIF3 may directly or indirectly oppose let-7 activity. This might provide an explanation for the opposite functions of let-7 and eIF3 in regulating tumorigenesis. PMID:18818519

Neuroendocrine Regulation of Maternal Behavior

PubMed Central

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Neuroendocrine regulation of maternal behavior.

PubMed

Bridges, Robert S

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

GABA-CREB signalling regulates maturation and survival of newly generated neurons in the adult hippocampus

PubMed Central

Jagasia, Ravi; Steib, Kathrin; Englberger, Elisabeth; Herold, Sabine; Faus-Kessler, Theresa; Saxe, Michael; Gage, Fred H.; Song, Hongjun; Lie, D. Chichung

2009-01-01

Survival and integration of new neurons in the hippocampal circuit are rate-limiting steps in adult hippocampal neurogenesis. Neuronal network activity is a major regulator of these processes, yet little is known about the respective downstream signalling pathways. Here, we investigate the role of CREB signalling in adult hippocampal neurogenesis. CREB is activated in new granule neurons during a distinct developmental period. Loss of CREB function in a cell-autonomous fashion impairs dendritic development, decreases the expression of the neurogenic transcription factor NeuroD and of the neuronal microtubule associated protein, DCX, and compromises the survival of newborn neurons. In addition, GABA-mediated excitation regulates CREB activation at early developmental stages. Importantly, developmental defects following loss of GABA-mediated excitation can be compensated by enhanced CREB signalling. These results indicate that CREB signalling is a central pathway in adult hippocampal neurogenesis, regulating the development and survival of new hippocampal neurons downstream of GABA-mediated excitation. PMID:19553437

Developmental and environmental regulation of the Nicotiana plumbaginifolia cytosolic Cu/Zn-superoxide dismutase promoter in transgenic tobacco.

PubMed Central

Hérouart, D; Van Montagu, M; Inzé, D

1994-01-01

Superoxide dismutases (SODs) play a key role in the cellular defense against reactive oxygen species. To study the transcriptional regulation at the cellular level, the promoter of the Nicotiana plumbaginifolia cytosolic gene encoding Cu/ZnSOD (SODCc) was fused to the beta-glucuronidase (GUS) reporter gene (gusA) and analyzed in transgenic tobacco plants. The promoter was highly active in vascular bundles of leaves and stems, where it is confined to phloem cells. In flowers, GUS activity was detected in ovules and pollen grains, in pigmented tissues of petals, and in vascular tissue of ovaries and anthers. In response to treatment with the superoxide-generating herbicide paraquat, very strong GUS staining was observed in photosynthetically active cells of leaves and in some epidermal root cells of seedlings. The expression of the SODCc-gusA was also induced in seedlings after heat shock and chilling and after treatment with sulfhydryl antioxidants such as reduced glutathione and cysteine. It is postulated that SODCc expression is directly linked to a cell-specific production of excess superoxide radicals in the cytosol. PMID:8165260

Developmental and environmental regulation of the Nicotiana plumbaginifolia cytosolic Cu/Zn-superoxide dismutase promoter in transgenic tobacco.

PubMed

Hérouart, D; Van Montagu, M; Inzé, D

1994-03-01

Superoxide dismutases (SODs) play a key role in the cellular defense against reactive oxygen species. To study the transcriptional regulation at the cellular level, the promoter of the Nicotiana plumbaginifolia cytosolic gene encoding Cu/ZnSOD (SODCc) was fused to the beta-glucuronidase (GUS) reporter gene (gusA) and analyzed in transgenic tobacco plants. The promoter was highly active in vascular bundles of leaves and stems, where it is confined to phloem cells. In flowers, GUS activity was detected in ovules and pollen grains, in pigmented tissues of petals, and in vascular tissue of ovaries and anthers. In response to treatment with the superoxide-generating herbicide paraquat, very strong GUS staining was observed in photosynthetically active cells of leaves and in some epidermal root cells of seedlings. The expression of the SODCc-gusA was also induced in seedlings after heat shock and chilling and after treatment with sulfhydryl antioxidants such as reduced glutathione and cysteine. It is postulated that SODCc expression is directly linked to a cell-specific production of excess superoxide radicals in the cytosol.

Stress and developmental regulation of the yeast C-type cyclin Ume3p (Srb11p/Ssn8p).

PubMed Central

Cooper, K F; Mallory, M J; Smith, J B; Strich, R

1997-01-01

The ume3-1 allele was identified as a mutation that allowed the aberrant expression of several meiotic genes (e.g. SPO11, SPO13) during mitotic cell division in Saccharomyces cerevisiae. Here we report that UME3 is also required for the full repression of the HSP70 family member SSA1. UME3 encodes a non-essential C-type cyclin (Ume3p) whose levels do not vary through the mitotic cell cycle. However, Ume3p is destroyed during meiosis or when cultures are subjected to heat shock. Ume3p mutants resistant to degradation resulted in a 2-fold reduction in SPO13 mRNA levels during meiosis, indicating that the down-regulation of this cyclin is important for normal meiotic gene expression. Mutational analysis identified two regions (PEST-rich and RXXL) that mediate Ume3p degradation. A third destruction signal lies within the highly conserved cyclin box, a region that mediates cyclin-cyclin-dependent kinase (Cdk) interactions. However, the Cdk activated by Ume3p (Ume5p) is not required for the rapid destruction of this cyclin. Finally, Ume3p destruction was not affected in mutants defective for ubiquitin-dependent proteolysis. These results support a model in which Ume3p, when exposed to heat shock or sporulation conditions, is targeted for destruction to allow the expression of genes necessary for the cell to respond correctly to these environmental cues. PMID:9303311

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

2013-10-01

The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

PubMed Central

Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

2015-01-01

While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

Heat-Treatment-Responsive Proteins in Different Developmental Stages of Tomato Pollen Detected by Targeted Mass Accuracy Precursor Alignment (tMAPA).

PubMed

Chaturvedi, Palak; Doerfler, Hannes; Jegadeesan, Sridharan; Ghatak, Arindam; Pressman, Etan; Castillejo, Maria Angeles; Wienkoop, Stefanie; Egelhofer, Volker; Firon, Nurit; Weckwerth, Wolfram

2015-11-06

Recently, we have developed a quantitative shotgun proteomics strategy called mass accuracy precursor alignment (MAPA). The MAPA algorithm uses high mass accuracy to bin mass-to-charge (m/z) ratios of precursor ions from LC-MS analyses, determines their intensities, and extracts a quantitative sample versus m/z ratio data alignment matrix from a multitude of samples. Here, we introduce a novel feature of this algorithm that allows the extraction and alignment of proteotypic peptide precursor ions or any other target peptide from complex shotgun proteomics data for accurate quantification of unique proteins. This strategy circumvents the problem of confusing the quantification of proteins due to indistinguishable protein isoforms by a typical shotgun proteomics approach. We applied this strategy to a comparison of control and heat-treated tomato pollen grains at two developmental stages, post-meiotic and mature. Pollen is a temperature-sensitive tissue involved in the reproductive cycle of plants and plays a major role in fruit setting and yield. By LC-MS-based shotgun proteomics, we identified more than 2000 proteins in total for all different tissues. By applying the targeted MAPA data-processing strategy, 51 unique proteins were identified as heat-treatment-responsive protein candidates. The potential function of the identified candidates in a specific developmental stage is discussed.

45 CFR 1386.103 - Discovery.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Practice and Procedure for Hearings Pertaining to States...

The histone acetyltransferases CBP and Chameau integrate developmental and DNA replication programs in Drosophila ovarian follicle cells

PubMed Central

McConnell, Kristopher H.; Dixon, Michael; Calvi, Brian R.

2012-01-01

DNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic location of origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins in concert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarian follicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histone acetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm had relatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of its ortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also binds amplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect on nucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaborate in origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate the developmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of origin epigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integrates differentiation and DNA replication programs. PMID:22951641

Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina.

PubMed

Gunter, Helen M; Degnan, Bernard M

2007-08-01

Heat shock proteins (Hsps) have dual functions, participating in both the stress response and a broad range of developmental processes. At physiological temperatures, it has been demonstrated in deuterostomes (vertebrates) and ecdysozoans (insects) that Hsps are expressed in tissues that are undergoing differentiation and morphogenesis. Here we investigate the developmental expression of Hsp70, Hsp90 and their regulatory transcription factor heat shock transcription factor (HSF) in the marine gastropod Haliotis asinina, a representative of the 3rd major lineage of bilaterian animals, the Lophotrochozoa. HasHsp70, HasHsp90 and HasHSF are maternally expressed in H. asinina and are progressively restricted to the micromere lineage during cleavage. During larval morphogenesis, they are expressed in unique and overlapping patterns in the prototroch, foot, and mantle. Hsp expression peaked in these tissues during periods of cell differentiation and morphogenesis, returning to lower levels after morphogenesis was complete. These patterns of Hsp and HSF expression in H. asinina are akin to those observed in ecdysozoans and deuterostomes, with Hsps being activated in cells and tissues undergoing morphogenesis.

Specification of select hypothalamic circuits and innate behaviors by the embryonic patterning gene Dbx1

PubMed Central

Sokolowski, Katie; Esumi, Shigeyuki; Hirata, Tsutomu; Kamal, Yasman; Tran, Tuyen; Lam, Andrew; Oboti, Livio; Brighthaupt, Sherri-Chanelle; Zaghlula, Manar; Martinez, Jennifer; Ghimbovschi, Svetlana; Knoblach, Susan; Pierani, Alessandra; Tamamaki, Nobuaki; Shah, Nirao M; Jones, Kevin S; Corbin, Joshua G

2015-01-01

SUMMARY The hypothalamus integrates information required for the production of a variety of innate behaviors such as feeding, mating, aggression and predator avoidance. Despite an extensive knowledge of hypothalamic function, how embryonic genetic programs specify circuits that regulate these behaviors remains unknown. Here, we find that in the hypothalamus the developmentally regulated homeodomain-containing transcription factor Dbx1 is required for the generation of specific subclasses of neurons within the lateral hypothalamic area/zona incerta (LH) and the arcuate (Arc) nucleus. Consistent with this specific developmental role, Dbx1 hypothalamic-specific conditional-knockout mice display attenuated responses to predator odor and feeding stressors but do not display deficits in other innate behaviors such as mating or conspecific aggression. Thus, activity of a single developmentally regulated gene, Dbx1, is a shared requirement for the specification of hypothalamic nuclei governing a subset of innate behaviors. PMID:25864637

Production of systemically circulating Hedgehog by the intestine couples nutrition to growth and development.

PubMed

Rodenfels, Jonathan; Lavrynenko, Oksana; Ayciriex, Sophie; Sampaio, Julio L; Carvalho, Maria; Shevchenko, Andrej; Eaton, Suzanne

2014-12-01

In Drosophila larvae, growth and developmental timing are regulated by nutrition in a tightly coordinated fashion. The networks that couple these processes are far from understood. Here, we show that the intestine responds to nutrient availability by regulating production of a circulating lipoprotein-associated form of the signaling protein Hedgehog (Hh). Levels of circulating Hh tune the rates of growth and developmental timing in a coordinated fashion. Circulating Hh signals to the fat body to control larval growth. It regulates developmental timing by controlling ecdysteroid production in the prothoracic gland. Circulating Hh is especially important during starvation, when it is also required for mobilization of fat body triacylglycerol (TAG) stores. Thus, we demonstrate that Hh, previously known only for its local morphogenetic functions, also acts as a lipoprotein-associated endocrine hormone, coordinating the response of multiple tissues to nutrient availability. © 2014 Rodenfels et al.; Published by Cold Spring Harbor Laboratory Press.

Applications of HCMM satellite data to the study of urban heating patterns

NASA Technical Reports Server (NTRS)

Carlson, T. N. (Principal Investigator)

1980-01-01

A research summary is presented and is divided into two major areas, one developmental and the other basic science. In the first three sub-categories are discussed: image processing techniques, especially the method whereby surface temperature image are converted to images of surface energy budget, moisture availability and thermal inertia; model development; and model verification. Basic science includes the use of a method to further the understanding of the urban heat island and anthropogenic modification of the surface heating, evaporation over vegetated surfaces, and the effect of surface heat flux on plume spread.

Evolution of branched regulatory genetic pathways: directional selection on pleiotropic loci accelerates developmental system drift.

PubMed

Johnson, Norman A; Porter, Adam H

2007-01-01

Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.

Systems theory and cascades in developmental psychopathology.

PubMed

Cox, Martha J; Mills-Koonce, Roger; Propper, Cathi; Gariépy, Jean-Louis

2010-08-01

In the wake of prominent theoreticians in developmental science, whose contributions we review in this article, many developmental psychologists came to endorse a systems approach to understanding how the individual, as it develops, establishes functional relationships to social ecological contexts that from birth to school entry rapidly increase in complexity. The concept of developmental cascade has been introduced in this context to describe lawful processes by which antecedent conditions may be related with varying probabilities to specified outcomes. These are understood as processes by which function at one level or in one domain of behavior affect the organization of competency in later developing domains of general adaptation. Here we propose a developmental sequence by which the developing child acquires regulative capacities that are key to adjustment to a society that demands considerable control of emotional and cognitive functions early in life. We report empirical evidence showing that the acquisition of regulative capacities may be understood as a cascade of shifts in control parameters induced by the progressive integration of biological, transactional, and socioaffective systems over development. We conclude by suggesting how the developmental process may be accessed for effective intervention in populations deemed "at risk" for later problems of psychosocial adjustment.

Tuning Hsf1 levels drives distinct fungal morphogenetic programs with depletion impairing Hsp90 function and overexpression expanding the target space.

PubMed

Veri, Amanda O; Miao, Zhengqiang; Shapiro, Rebecca S; Tebbji, Faiza; O'Meara, Teresa R; Kim, Sang Hu; Colazo, Juan; Tan, Kaeling; Vyas, Valmik K; Whiteway, Malcolm; Robbins, Nicole; Wong, Koon Ho; Cowen, Leah E

2018-03-01

The capacity to respond to temperature fluctuations is critical for microorganisms to survive within mammalian hosts, and temperature modulates virulence traits of diverse pathogens. One key temperature-dependent virulence trait of the fungal pathogen Candida albicans is its ability to transition from yeast to filamentous growth, which is induced by environmental cues at host physiological temperature. A key regulator of temperature-dependent morphogenesis is the molecular chaperone Hsp90, which has complex functional relationships with the transcription factor Hsf1. Although Hsf1 controls global transcriptional remodeling in response to heat shock, its impact on morphogenesis remains unknown. Here, we establish an intriguing paradigm whereby overexpression or depletion of C. albicans HSF1 induces morphogenesis in the absence of external cues. HSF1 depletion compromises Hsp90 function, thereby driving filamentation. HSF1 overexpression does not impact Hsp90 function, but rather induces a dose-dependent expansion of Hsf1 direct targets that drives overexpression of positive regulators of filamentation, including Brg1 and Ume6, thereby bypassing the requirement for elevated temperature during morphogenesis. This work provides new insight into Hsf1-mediated environmentally contingent transcriptional control, implicates Hsf1 in regulation of a key virulence trait, and highlights fascinating biology whereby either overexpression or depletion of a single cellular regulator induces a profound developmental transition.

Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.

PubMed

Lee, Daehan; Lee, Harksun; Kim, Nari; Lim, Daisy S; Lee, Junho

2017-03-04

Free-living nematode Caenorhabditis elegans exhibits various behaviors to adapt to the fluctuating environment. When early larvae of C. elegans experience the harsh environmental condition, they develop to an alternative developmental stage called dauer, which shows nictation, a stage-specific waving behavior. Nictation enables dauers to attach to more mobile animals, which helps them disperse to other habitats beyond physical barriers. However, underlying molecular mechanisms that regulate nictation behavior are largely unknown. In this study, we show that insulin signaling and transforming growth beta (TGF-β) signaling, the two major parallel signaling pathways that mediate dauer development, are involved in the regulation of dauer-specific nictation behavior. Genetic analysis revealed that downregulation of insulin signaling enhanced nictation behavior. Heat-shock induced rescue experiments showed that the action period of the insulin signaling is before dauer formation. Surprisingly, lowering of TGF-β signaling inhibited the normal performance of nictation, suggesting that TGF-β signaling acts in an opposite way from that for dauer formation. Cell-specific rescue experiments revealed that two signaling pathways act in the nervous system and an epistasis experiment showed that TGF-β signaling is epistatic to insulin signaling. Taken together, we propose that the neuroendocrinal insulin signaling and TGF-β signaling regulate nictation behavior during development in response to environmental conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

Tuning Hsf1 levels drives distinct fungal morphogenetic programs with depletion impairing Hsp90 function and overexpression expanding the target space

PubMed Central

Miao, Zhengqiang; Tan, Kaeling; Vyas, Valmik K.; Whiteway, Malcolm; Robbins, Nicole; Wong, Koon Ho; Cowen, Leah E.

2018-01-01

The capacity to respond to temperature fluctuations is critical for microorganisms to survive within mammalian hosts, and temperature modulates virulence traits of diverse pathogens. One key temperature-dependent virulence trait of the fungal pathogen Candida albicans is its ability to transition from yeast to filamentous growth, which is induced by environmental cues at host physiological temperature. A key regulator of temperature-dependent morphogenesis is the molecular chaperone Hsp90, which has complex functional relationships with the transcription factor Hsf1. Although Hsf1 controls global transcriptional remodeling in response to heat shock, its impact on morphogenesis remains unknown. Here, we establish an intriguing paradigm whereby overexpression or depletion of C. albicans HSF1 induces morphogenesis in the absence of external cues. HSF1 depletion compromises Hsp90 function, thereby driving filamentation. HSF1 overexpression does not impact Hsp90 function, but rather induces a dose-dependent expansion of Hsf1 direct targets that drives overexpression of positive regulators of filamentation, including Brg1 and Ume6, thereby bypassing the requirement for elevated temperature during morphogenesis. This work provides new insight into Hsf1-mediated environmentally contingent transcriptional control, implicates Hsf1 in regulation of a key virulence trait, and highlights fascinating biology whereby either overexpression or depletion of a single cellular regulator induces a profound developmental transition. PMID:29590106

Worker honey bee pheromone regulation of foraging ontogeny

NASA Astrophysics Data System (ADS)

Pankiw, Tanya

The evolution of sociality has configured communication chemicals, called primer pheromones, which play key roles in regulating the organization of social life. Primer pheromones exert relatively slow effects that fundamentally alter developmental, physiological, and neural systems. Here, I demonstrate how substances extracted from the surface of foraging and young pre-foraging worker bees regulated age at onset of foraging, a developmental process. Hexane-extractable compounds washed from foraging workers increased foraging age compared with controls, whereas extracts of young pre-foraging workers decreased foraging age. This represents the first known direct demonstration of primer pheromone activity derived from adult worker bees.

AGCVIII Kinases: at the crossroads of cellular signaling

USDA-ARS?s Scientific Manuscript database

AGCVIII kinases regulate diverse developmental and cellular processes in plants. As putative mediators of secondary messengers, AGCVIII kinases potentially integrate developmental and environmental cues into specific cellular responses through substrate phosphorylation. Here we discuss the functiona...

45 CFR 1386.19 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights of...

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Regulation of Expressive Behavior as Reflecting Affect Socialization.

ERIC Educational Resources Information Center

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

[Physical mapping of the genes px and cld coding peroxidase and cold-regulated protein in maize (Zea mays L.)].

PubMed

Ning, S B; Wang, L; Song, Y C

2000-01-01

Peroxidase plays a key role in plant disease resistance, cold stress and some developmental processes, and cold-regulated protein functions necessarily in reaction of plants on cold or heat stress. Recent studies showed that these processes in plant cells were involved in programmed cell death (PCD). Using a biotin-labelled in situ hybridization (ISH) technique, we physically mapped the genes px and cld coding peroxidase and cold-regulated protein respectively onto maize chromosomes. Both DAB and fluorescence detection systems gave the identical results, the probe uaz235 corresponding to gene px was localized onto the long arm of chromosome 2 (2L) and 7L, and csu19 corresponding to gene cld was hybridized onto 4L and 5L. The percentage distances (from the hybridization sites to centromeres) of uaz235 in 2L and 7L were 45.4 +/- 1.3 and 67.4 +/- 3.7 respectively, and those of csu19 in 4L and 5L were 68.6 +/- 2.6 and 58.2 +/- 1.6 respectively. The physical positions of px in 2L and cld in 4L coincide with those in their genetic map pattern. The results also show that both of these genes have duplicated sites in maize genome.

Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

PubMed

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

45 CFR 1386.25 - Allowable litigation costs.

Code of Federal Regulations, 2010 CFR

2010-10-01

....25 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights...

Early in vitro fertilization improves development of bovine ova heat stressed during in vitro maturation.

PubMed

Schrock, G E; Saxton, A M; Schrick, F N; Edwards, J L

2007-09-01

The objectives were to examine the development of embryos derived from control (38.5 degrees C) or heat-stressed ova [41.0 degrees C during the first 12 h of in vitro maturation (hIVM)] when in vitro fertilization (IVF) was performed at 16, 18, 20, 24, or 30 hIVM. Effects of heat stress in compromising ovum development depended on when IVF was performed (in vitro maturation temperature x IVF time interaction). When IVF was performed at 24 or 30 hIVM, fewer heat-stressed ova developed to the blastocyst stage compared with the respective controls. In contrast, when IVF was performed at 16, 18, or 20 hIVM, more heat-stressed ova developed to the blastocyst stage compared with the respective controls. Performing IVF earlier than usual was beneficial, because the ability of heat-stressed ova to develop to the blastocyst stage was improved when IVF was performed at 18 or 20 vs. 24 hIVM. Blastocyst stage and quality were equivalent to non-heat-stressed controls regardless of IVF time. Control ova undergoing IVF at 20, 24, 30, or 32 hIVM and heat-stressed ova undergoing IVF at 16, 18, 20, or 24 hIVM were compared for blastocyst development by multisource regression. Although linear and quadratic slopes were similar, heat stress reduced the peak and shifted the developmental response of ova by 7.3 h. In other words, obtaining optimal blastocyst development from heat-stressed ova would depend on performing IVF at 19.5 hIVM compared with 26.7 hIVM for non-heat-stressed controls. Heat-induced reductions in peak blastocyst development significantly reduced the window of time available to perform IVF and obtain > or = 20% blastocyst development. In summary, results support an effect of heat stress to hasten developmentally important events during oocyte maturation. The inability of earlier IVF to fully restore the development of heat-stressed ova to that of non-heat-stressed controls highlights the importance of further study.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.

PubMed

Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa

2007-03-01

The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

Neuron class-specific requirements for Fragile X Mental Retardation Protein in critical period development of calcium signaling in learning and memory circuitry.

PubMed

Doll, Caleb A; Broadie, Kendal

2016-05-01

Neural circuit optimization occurs through sensory activity-dependent mechanisms that refine synaptic connectivity and information processing during early-use developmental critical periods. Fragile X Mental Retardation Protein (FMRP), the gene product lost in Fragile X syndrome (FXS), acts as an activity sensor during critical period development, both as an RNA-binding translation regulator and channel-binding excitability regulator. Here, we employ a Drosophila FXS disease model to assay calcium signaling dynamics with a targeted transgenic GCaMP reporter during critical period development of the mushroom body (MB) learning/memory circuit. We find FMRP regulates depolarization-induced calcium signaling in a neuron-specific manner within this circuit, suppressing activity-dependent calcium transients in excitatory cholinergic MB input projection neurons and enhancing calcium signals in inhibitory GABAergic MB output neurons. Both changes are restricted to the developmental critical period and rectified at maturity. Importantly, conditional genetic (dfmr1) rescue of null mutants during the critical period corrects calcium signaling defects in both neuron classes, indicating a temporally restricted FMRP requirement. Likewise, conditional dfmr1 knockdown (RNAi) during the critical period replicates constitutive null mutant defects in both neuron classes, confirming cell-autonomous requirements for FMRP in developmental regulation of calcium signaling dynamics. Optogenetic stimulation during the critical period enhances depolarization-induced calcium signaling in both neuron classes, but this developmental change is eliminated in dfmr1 null mutants, indicating the activity-dependent regulation requires FMRP. These results show FMRP shapes neuron class-specific calcium signaling in excitatory vs. inhibitory neurons in developing learning/memory circuitry, and that FMRP mediates activity-dependent regulation of calcium signaling specifically during the early-use critical period. Copyright © 2016 Elsevier Inc. All rights reserved.

45 CFR 1385.5 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.5 Section 1385.5 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

45 CFR 1385.7 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.7 Section 1385.7 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

45 CFR 1387.1 - General requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false General requirements. 1387.1 Section 1387.1 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

45 CFR 1388.8 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1388.8 Section 1388.8 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

2017-03-01

Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

PubMed

Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

2016-07-01

Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Drosophila melanogaster as a model system for assessing development under conditions of microgravity

NASA Technical Reports Server (NTRS)

Abbott, M. K.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

1992-01-01

More is known about the regulation of early developmental events in Drosophila than any other animal. In addition, its size and short life cycle make it a facile experimental system. Since developmental perturbations have been demonstrated when both oogenesis and embryogenesis occur in the space environment, there is a strong rationale for using this organism for the elucidation of specific gravity-sensitive developmental events.

48 CFR 1852.223-71 - Frequency authorization.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Frequency authorization... obtained by the Contractor or subcontractor in need thereof. (b) For any experimental, developmental, or... device to the Contracting Officer during the initial planning, experimental, or developmental phase of...

45 CFR 1386.102 - Rights of parties.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Rights of parties. 1386.102 Section 1386.102 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

Abscisic Acid Synthesis and Response

PubMed Central

Finkelstein, Ruth

2013-01-01

Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development

PubMed Central

Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne

2004-01-01

Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937

The Intersection of Emotional and Sociocognitive Competencies with Civic Engagement in Middle Childhood and Adolescence.

PubMed

Metzger, Aaron; Alvis, Lauren M; Oosterhoff, Benjamin; Babskie, Elizabeth; Syvertsen, Amy; Wray-Lake, Laura

2018-03-23

Civic developmental theory anticipates connections between normative developmental competencies and civic engagement, but little previous research has directly studied such links. The current study sought to contribute to civic development theory by examining associations between emotional and sociocognitive competencies (empathy, emotion regulation, prosocial moral reasoning, future-orientation) and civic engagement (volunteering, informal helping, political behaviors and beliefs, environmental behaviors, social responsibility values, civic skills). Data came from a geographically and racially diverse sample of 2467 youth (M age  = 13.4, Range: 8-20 years, 56% female). The results indicated that empathy and future-orientation significantly predicted nearly all forms of civic engagement, whereas emotion regulation and prosocial moral reasoning were uniquely associated with specific forms of civic engagement. Exploratory multi-group models indicated that empathy and emotion regulation were more strongly associated with civic engagement among younger youth and prosocial moral reasoning and future-orientation were more strongly related to civic engagement among older youth. The findings help to advance developmental theory of youth civic engagement.

Callose homeostasis at plasmodesmata: molecular regulators and developmental relevance

PubMed Central

De Storme, Nico; Geelen, Danny

2014-01-01

Plasmodesmata are membrane-lined channels that are located in the plant cell wall and that physically interconnect the cytoplasm and the endoplasmic reticulum (ER) of adjacent cells. Operating as controllable gates, plasmodesmata regulate the symplastic trafficking of micro- and macromolecules, such as endogenous proteins [transcription factors (TFs)] and RNA-based signals (mRNA, siRNA, etc.), hence mediating direct cell-to-cell communication and long distance signaling. Besides this physiological role, plasmodesmata also form gateways through which viral genomes can pass, largely facilitating the pernicious spread of viral infections. Plasmodesmatal trafficking is either passive (e.g., diffusion) or active and responses both to developmental and environmental stimuli. In general, plasmodesmatal conductivity is regulated by the controlled build-up of callose at the plasmodesmatal neck, largely mediated by the antagonistic action of callose synthases (CalSs) and β-1,3-glucanases. Here, in this theory and hypothesis paper, we outline the importance of callose metabolism in PD SEL control, and highlight the main molecular factors involved. In addition, we also review other proteins that regulate symplastic PD transport, both in a developmental and stress-responsive framework, and discuss on their putative role in the modulation of PD callose turn-over. Finally, we hypothesize on the role of structural sterols in the regulation of (PD) callose deposition and outline putative mechanisms by which this regulation may occur. PMID:24795733

Developmental control of hypoxia during bud burst in grapevine.

PubMed

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

Major epigenetic development distinguishing neuronal and non-neuronal cells occurs postnatally in the murine hypothalamus

USDA-ARS?s Scientific Manuscript database

Prenatal and early postnatal environment can persistently alter one's risk of obesity. Environmental effects on hypothalamic developmental epigenetics constitute a likely mechanism underlying such 'developmental programming' of energy balance regulation. To advance our understanding of these process...

Developmental Social Cognitive Neuroscience: Insights from Deafness

ERIC Educational Resources Information Center

Corina, David; Singleton, Jenny

2009-01-01

The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

29 CFR 1952.221 - Developmental schedule.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...

DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

PubMed Central

Hua, Brian L.; Orr-Weaver, Terry L.

2017-01-01

Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

A prototype heat pipe heat exchanger for the capillary pumped loop flight experiment

NASA Technical Reports Server (NTRS)

Ku, Jentung; Yun, Seokgeun; Kroliczek, Edward J.

1992-01-01

A Capillary Pumped Two-Phase Heat Transport Loop (CAPL) Flight Experiment, currently planned for 1993, will provide microgravity verification of the prototype capillary pumped loop (CPL) thermal control system for EOS. CAPL employs a heat pipe heat exchanger (HPHX) to couple the condenser section of the CPL to the radiator assembly. A prototype HPHX consisting of a heat exchanger (HX), a header heat pipe (HHP), a spreader heat pipe (SHP), and a flow regulator has been designed and tested. The HX transmits heat from the CPL condenser to the HHP, while the HHP and SHP transport heat to the radiator assembly. The flow regulator controls flow distribution among multiple parallel HPHX's. Test results indicated that the prototype HPHX could transport up to 800 watts with an overall heat transfer coefficient of more than 6000 watts/sq m-deg C. Flow regulation among parallel HPHX's was also demonstrated.

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

The Two Faces of Temptation: Differing Motives for Self-Control

ERIC Educational Resources Information Center

Jensen-Campbell, Lauri A.; Graziano, William G.

2005-01-01

Self-regulation is critical to social and personality development in all cultures. Self-regulation may have developmental origins in temperament, yet it also interacts with socialization processes. This research specifically probes children's self-regulation during resistance to temptation. Socialization of self-regulation may be influenced by the…

Developmentally defined forebrain circuits regulate appetitive and aversive olfactory learning.

PubMed

Muthusamy, Nagendran; Zhang, Xuying; Johnson, Caroline A; Yadav, Prem N; Ghashghaei, H Troy

2017-01-01

Postnatal and adult neurogenesis are region- and modality-specific, but the significance of developmentally distinct neuronal populations remains unclear. We demonstrate that chemogenetic inactivation of a subset of forebrain and olfactory neurons generated at birth disrupts responses to an aversive odor. In contrast, novel appetitive odor learning is sensitive to inactivation of adult-born neurons, revealing that developmentally defined sets of neurons may differentially participate in hedonic aspects of sensory learning.

Calcium-binding proteins and development

NASA Technical Reports Server (NTRS)

Beckingham, K.; Lu, A. Q.; Andruss, B. F.; McIntire, L. V. (Principal Investigator)

1998-01-01

The known roles for calcium-binding proteins in developmental signaling pathways are reviewed. Current information on the calcium-binding characteristics of three classes of cell-surface developmental signaling proteins (EGF-domain proteins, cadherins and integrins) is presented together with an overview of the intracellular pathways downstream of these surface receptors. The developmental roles delineated to date for the universal intracellular calcium sensor, calmodulin, and its targets, and for calcium-binding regulators of the cytoskeleton are also reviewed.

Up-Regulation of HSFA2c and HSPs by ABA Contributing to Improved Heat Tolerance in Tall Fescue and Arabidopsis

PubMed Central

Wang, Xiuyun; Zhuang, Lili; Huang, Bingru

2017-01-01

Abscisic acid (ABA) is known to play roles in regulating plant tolerance to various abiotic stresses, but whether ABA’s effects on heat tolerance are associated with its regulation of heat stress transcription factors (HSFs) and heat shock proteins (HSPs) is not well documented. The objective of this study was to determine whether improved heat tolerance of tall fescue (Festuca arundinacea Schreb.) by ABA was through the regulation of HSFs and HSPs. ABA-responsive transcriptional factors, ABA-responsive element binding protein 3 (FaAREB3) and dehydration-responsive element binding protein 2A (FaDREB2A) of tall fescue, were able to bind to the cis-elements in the promoter of tall fescue heat stress transcription factor A2c (FaHSFA2c). Exogenous ABA (5 μM) application enhanced heat tolerance of tall fescue, as manifested by increased leaf photochemical efficiency and membrane stability under heat stress (37/32 °C, day/night). The expression levels of FaHSFA2c, several tall fescue HSPs (FaHSPs), and ABA-responsive transcriptional factors were up-regulated in plants treated with ABA. Deficiency of Arabidopsis heat stress transcription factor A2 (AtHSFA2) suppressed ABA-induction of AtHSPs expression and ABA-improved heat tolerance in Arabidopsis. These results suggested that HSFA2 plays an important role in ABA-mediated plant heat tolerance, and FaAREB3 and FaDREB2A may function as upstream trans-acting factors and regulate transcriptional activity of FaHSFA2c and the downstream FaHSPs, leading to improved heat tolerance. PMID:28914758

Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing

PubMed Central

2011-01-01

Background Biotic and abiotic stresses, such as powdery mildew infection and high temperature, are important limiting factors for yield and grain quality in wheat production. Emerging evidences suggest that long non-protein coding RNAs (npcRNAs) are developmentally regulated and play roles in development and stress responses of plants. However, identification of long npcRNAs is limited to a few plant species, such as Arabidopsis, rice and maize, no systematic identification of long npcRNAs and their responses to abiotic and biotic stresses is reported in wheat. Results In this study, by using computational analysis and experimental approach we identified 125 putative wheat stress responsive long npcRNAs, which are not conserved among plant species. Among them, some were precursors of small RNAs such as microRNAs and siRNAs, two long npcRNAs were identified as signal recognition particle (SRP) 7S RNA variants, and three were characterized as U3 snoRNAs. We found that wheat long npcRNAs showed tissue dependent expression patterns and were responsive to powdery mildew infection and heat stress. Conclusion Our results indicated that diverse sets of wheat long npcRNAs were responsive to powdery mildew infection and heat stress, and could function in wheat responses to both biotic and abiotic stresses, which provided a starting point to understand their functions and regulatory mechanisms in the future. PMID:21473757

Valosin-containing protein VCP/p97 is essential for the intracellular development of Leishmania and its survival under heat stress.

PubMed

Guedes Aguiar, Bruno; Padmanabhan, Prasad K; Dumas, Carole; Papadopoulou, Barbara

2018-06-12

Valosin-containing protein (VCP)/p97/Cdc48 is one of the best-characterised type II cytosolic AAA+ ATPases most known for their role in ubiquitin-dependent protein quality control. Here, we provide functional insights into the role of the Leishmania VCP/p97 homologue (LiVCP) in the parasite intracellular development. We demonstrate that although LiVCP is an essential gene, Leishmania infantum promastigotes can grow with less VCP. In contrast, growth of axenic and intracellular amastigotes is dramatically affected upon decreased LiVCP levels in heterozygous and temperature sensitive (ts) LiVCP mutants or the expression of dominant negative mutants known to specifically target the second conserved VCP ATPase domain, a major contributor of the VCP overall ATPase activity. Interestingly, these VCP mutants are also unable to survive heat stress, and a ts VCP mutant is defective in amastigote growth. Consistent with LiVCP's essential function in amastigotes, LiVCP messenger ribonucleic acid undergoes 3'Untranslated Region (UTR)-mediated developmental regulation, resulting in higher VCP expression in amastigotes. Furthermore, we show that parasite mutant lines expressing lower VCP levels or dominant negative VCP forms exhibit high accumulation of polyubiquitinated proteins and increased sensitivity to proteotoxic stress, supporting the ubiquitin-selective chaperone function of LiVCP. Together, these results emphasise the crucial role LiVCP plays under heat stress and during the parasite intracellular development. © 2018 John Wiley & Sons Ltd.

Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

PubMed Central

Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

2016-01-01

For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

Do Hassles and Uplifts Change with Age? Longitudinal Findings from the VA Normative Aging Study

PubMed Central

Aldwin, Carolyn M.; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

2014-01-01

To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed three scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Growth based modelling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative non-linear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. PMID:24660796

Do hassles and uplifts change with age? Longitudinal findings from the VA normative aging study.

PubMed

Aldwin, Carolyn M; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

2014-03-01

To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed 3 scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Group-based modeling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative nonlinear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. (c) 2014 APA, all rights reserved.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Environmental Toxicants and Developmental Disabilities: A Challenge for Psychologists

ERIC Educational Resources Information Center

Koger, Susan M.; Schettler, Ted; Weiss, Bernard

2005-01-01

Developmental, learning, and behavioral disabilities are a significant public health problem. Environmental chemicals can interfere with brain development during critical periods, thereby impacting sensory, motor, and cognitive function. Because regulation in the United States is based on limited testing protocols and essentially requires proof of…

Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

USDA-ARS?s Scientific Manuscript database

A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

Developmental palaeobiology of trilobite eyes and its evolutionary significance

NASA Astrophysics Data System (ADS)

Thomas, A. T.

2005-06-01

Understanding of the calcified composite eyes of trilobites, the oldest preserved visual system, has advanced greatly in recent decades. Three types of trilobite eye occur, the more derived abathochroal and schizochroal types having evolved neotenically from holochroal eyes. Comparative morphology and phylogenetic considerations suggest that all three eye-types were underlain by common developmental systems. So far, understanding of these systems has been based entirely on morphological data from fossils, particularly the way the visual surface grew and the patterning of lens emplacement. Lenses characteristically form a hexagonal array comprising horizontal rows and, conspicuously in schizochroal eyes, dorso-ventral files. Because individual trilobites sometimes have eyes with different numbers of files, file number must reflect the operation of a developmental programme rather than being under immediate genetic control. An empirical developmental model has been devised to describe trilobite eye development, with separate rules dealing with the initiation of lens emplacement, growth and differentiation of the visual surface, and the termination of lens emplacement. Rarely, trilobites may have visual surfaces of normal size, but which lack lenses. This confirms that visual surface growth must have been regulated separately from lens emplacement, and is a feature that cannot be accounted for by the existing developmental model. Such a developmental separation is one of a number of similarities shared with Drosophila, the modern arthropod in which eye development is best understood. Many aspects of eye development are conserved in the Euarthropoda, and in bilaterian metazoans in general. A revised model for trilobite eye development is proposed using extant phylogenetic bracketing, interpreting morphological data from the fossils in the context of the hierarchy of developmental controls now becoming known from living animals. This new model suggests that overall eye shape and size did not require differential growth of the generative zone, as previously thought, and that no separate instruction was needed to specify the termination of lens emplacement. Instead, these features were regulated directly, by controlling the proliferation of cells making up the nascent visual surface. A process documented from Drosophila, which involves the selective inhibition of cells in front of a wave-like front of differentiation, and that is regulated by widely conserved genes, can be used to explain how the trilobite visual surface became differentiated. The model implies also that changes in hormonally regulated developmental pathways known from recent arthropods may have been responsible for the development of abathochroal and schizochroal eyes, and for heterochronic secondary eye reduction and blindness in trilobites.

Temporal requirements of insulin/IGF-1 signaling for proteotoxicity protection.

PubMed

Cohen, Ehud; Du, Deguo; Joyce, Derek; Kapernick, Erik A; Volovik, Yuli; Kelly, Jeffery W; Dillin, Andrew

2010-04-01

Toxic protein aggregation (proteotoxicity) is a unifying feature in the development of late-onset human neurodegenerative disorders. Reduction of insulin/IGF-1 signaling (IIS), a prominent lifespan, developmental and reproductive regulatory pathway, protects worms from proteotoxicity associated with the aggregation of the Alzheimer's disease-linked Abeta peptide. We utilized transgenic nematodes that express human Abeta and found that late life IIS reduction efficiently protects from Abeta toxicity without affecting development, reproduction or lifespan. To alleviate proteotoxic stress in the animal, the IIS requires heat shock factor (HSF)-1 to modulate a protein disaggregase, while DAF-16 regulates a presumptive active aggregase, raising the question of how these opposing activities could be co-regulated. One possibility is that HSF-1 and DAF-16 have distinct temporal requirements for protection from proteotoxicity. Using a conditional RNAi approach, we found an early requirement for HSF-1 that is distinct from the adult functions of DAF-16 for protection from proteotoxicity. Our data also indicate that late life IIS reduction can protect from proteotoxicity when it can no longer promote longevity, strengthening the prospect that IIS reduction might be a promising strategy for the treatment of neurodegenerative disorders caused by proteotoxicity.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

WRKY transcription factors

PubMed Central

Bakshi, Madhunita; Oelmüller, Ralf

2014-01-01

WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

Markers of Developmentally Regulated Programmed Cell Death and Their Analysis in Cereal Seeds.

PubMed

Domínguez, Fernando; Cejudo, Francisco Javier

2018-01-01

Programmed cell death (PCD) is a key process for the development and differentiation of multicellular organisms, which is characterized by well-defined morphological and biochemical features. These include chromatin condensation, DNA degradation and nuclear fragmentation, with nucleases and proteases playing a relevant function in these processes. In this chapter we describe methods routinely used for the analysis of hallmarks of developmentally regulated PCD in cereal seed tissues, which are based on agarose and polyacrylamide gel electrophoresis, in situ staining of DNA fragmentation, and cell-free assays of relevant enzymatic activities.

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

PubMed

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Hormonal Regulation of Fluid and Electrolytes: Effects of Heat Exposure and Exercise in the Heat,

DTIC Science & Technology

1988-02-01

F.N. Craig. Effect of potassium depletion on response to acute heat exposure in unacclimatized man. Am. J. % Physi. 211:117-124, 1966.% 22 . Cochrane...AD-RI92 655 HORMONAL REGULATION OF FLUID AND ELECTROLYTES: EFFECTS 1/ OF HEAT EXPOSURE A.. CU) ARMY RESEARCH INST OF ENVIRONMENTAL MEDICINE NATICK MA...61102A______________________ MI6102BSI CA DA114 11. TITLE (Include Security Classification) Hormnal Regulation of Fluid and Electrolytes: Effects of

Effects of whole body heating on dynamic baroreflex regulation of heart rate in humans

NASA Technical Reports Server (NTRS)

Crandall, C. G.; Zhang, R.; Levine, B. D.

2000-01-01

The purpose of this project was to identify whether dynamic baroreflex regulation of heart rate (HR) is altered during whole body heating. In 14 subjects, dynamic baroreflex regulation of HR was assessed using transfer function analysis. In normothermic and heat-stressed conditions, each subject breathed at a fixed rate (0. 25 Hz) while beat-by-beat HR and systolic blood pressure (SBP) were obtained. Whole body heating significantly increased sublingual temperature, HR, and forearm skin blood flow. Spectral analysis of HR and SBP revealed that the heat stress significantly reduced HR and SBP variability within the high-frequency range (0.2-0.3 Hz), reduced SBP variability within the low-frequency range (0.03-0.15 Hz), and increased the ratio of low- to high-frequency HR variability (all P < 0.01). Transfer function gain analysis showed that the heat stress reduced dynamic baroreflex regulation of HR within the high-frequency range (from 1.04 +/- 0.06 to 0.54 +/- 0.6 beats. min(-1). mmHg(-1); P < 0.001) without significantly affecting the gain in the low-frequency range (P = 0.63). These data suggest that whole body heating reduced high-frequency dynamic baroreflex regulation of HR associated with spontaneous changes in blood pressure. Reduced vagal baroreflex regulation of HR may contribute to reduced orthostatic tolerance known to occur in humans during heat stress.

Germination of penicillium paneum Conidia is regulated by 1-octen-3-ol, a volatile self-inhibitor.

PubMed

Chitarra, Gilma S; Abee, Tjakko; Rombouts, Frank M; Posthumus, Maarten A; Dijksterhuis, Jan

2004-05-01

Penicillium paneum is an important contaminant of cereal grains which is able to grow at low temperature, low pH, high levels of carbon dioxide, and under acid conditions. P. paneum produces mycotoxins, which may be harmful to animals and humans. We found that conidia in dense suspensions showed poor germination, suggesting the presence of a self-inhibitor. A volatile compound(s) produced by these high-density conditions also inhibited mycelial growth of different species of fungi belonging to a variety of genera, suggesting a broad action range. The heat-stable compound was isolated by successive centrifugation of the supernatant obtained from spore suspensions with a density of 10(9) conidia ml(-1). By using static headspace analyses, two major peaks were distinguished, with the highest production of these metabolites after 22 h of incubation at 25 degrees C and shaking at 140 rpm. Gas chromatography coupled with mass spectra analysis revealed the compounds to be 3-octanone and 1-octen-3-ol. Notably, only the latter compound appeared to block the germination process at different developmental stages of the conidia (swelling and germ tube formation). In this study, 1-octen-3-ol influenced different developmental processes during the P. paneum life cycle, including induction of microcycle conidiation and inhibition of spore germination. Therefore, the compound can be considered a fungal hormone during fungal development.

Germination of Penicillium paneum Conidia Is Regulated by 1-Octen-3-ol, a Volatile Self-Inhibitor

PubMed Central

Chitarra, Gilma S.; Abee, Tjakko; Rombouts, Frank M.; Posthumus, Maarten A.; Dijksterhuis, Jan

2004-01-01

Penicillium paneum is an important contaminant of cereal grains which is able to grow at low temperature, low pH, high levels of carbon dioxide, and under acid conditions. P. paneum produces mycotoxins, which may be harmful to animals and humans. We found that conidia in dense suspensions showed poor germination, suggesting the presence of a self-inhibitor. A volatile compound(s) produced by these high-density conditions also inhibited mycelial growth of different species of fungi belonging to a variety of genera, suggesting a broad action range. The heat-stable compound was isolated by successive centrifugation of the supernatant obtained from spore suspensions with a density of 109 conidia ml−1. By using static headspace analyses, two major peaks were distinguished, with the highest production of these metabolites after 22 h of incubation at 25°C and shaking at 140 rpm. Gas chromatography coupled with mass spectra analysis revealed the compounds to be 3-octanone and 1-octen-3-ol. Notably, only the latter compound appeared to block the germination process at different developmental stages of the conidia (swelling and germ tube formation). In this study, 1-octen-3-ol influenced different developmental processes during the P. paneum life cycle, including induction of microcycle conidiation and inhibition of spore germination. Therefore, the compound can be considered a fungal hormone during fungal development. PMID:15128538

Association of Transition Readiness to Intentional Self-Regulation and Hopeful Future Expectations in Youth With Illness.

PubMed

Hart, Laura C; Pollock, McLean; Hill, Sherika; Maslow, Gary

Little is known about how transition readiness relates to other developmental skills of adolescence in youth with chronic illness. Better understanding of how transition readiness relates to these other developmental skills could lead to a broader array of tools to improve transition readiness. Intentional self-regulation (ISR) and hopeful future expectations (HFE) are 2 developmental skills of adolescence that improve with participation in developmental programming and thus are modifiable. We explored associations between transition readiness, as measured by the Transition Readiness Assessment Questionnaire 29 (TRAQ-29) and ISR and HFE in youth with chronic illness recruited from a variety of subspecialty clinics from a major southeast medical center. A total of 71 adolescents with chronic illness were included in the analysis. The TRAQ-29 Self-Advocacy domain showed positive associations to both ISR (P = .03) and HFE (P = .009). In addition, the TRAQ-29 overall had positive associations to HFE (P = .04). The significant associations between TRAQ-29 Self-Advocacy domain scores and ISR and HFE suggest that transition readiness is developing within the context of other developmental areas in adolescence. More work is needed to see if the programming that improves these other developmental skills might also improve transition readiness. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

Working Memory and Mathematics: A Review of Developmental, Individual Difference, and Cognitive Approaches

ERIC Educational Resources Information Center

Raghubar, Kimberly P.; Barnes, Marcia A.; Hecht, Steven A.

2010-01-01

Working memory refers to a mental workspace, involved in controlling, regulating, and actively maintaining relevant information to accomplish complex cognitive tasks (e.g. mathematical processing). Despite the potential relevance of a relation between working memory and math for understanding developmental and individual differences in…

Motivational Selectivity Prospectively Predicts Couples' Realization of Their Goal to Have a Child

ERIC Educational Resources Information Center

Rauers, Antje; Böhnke, Anja; Riediger, Michaela

2013-01-01

Developmental theories have emphasized that motivational selectivity--focusing on a few goals instead of "wanting it all"--regulates development in individuals, dyads, or groups. We provide first evidence that this motivational strategy predicts an objective, goal-related developmental outcome years later. We followed up on initially…

STAGE- AND SPECIES- SPECIFIC DEVELOPMENTAL TOXICITY OF ALL-TRANS RETINOIC ACID IN FOUR NATIVE NORTH AMERICAN RANIDS AND XENOPUS LAEVIS

EPA Science Inventory

Within the last decade there have been increasing reports of malformed amphibians across North America. Recently, it has been suggested that hindlimb malformations are a consequence of xenobiotic disruption of developmental pathways regulated by retinoids. To assess the validity ...

Between and within Ethnic Differences in Strategic Learning: A Study of Developmental Mathematics Students

ERIC Educational Resources Information Center

Fong, Carlton J.; Zientek, Linda Reichwein; Yetkiner Ozel, Zeynep Ebrar; Phelps, Julie M.

2015-01-01

The present study investigated developmental mathematics students' efficacy beliefs for motivational, self-regulated learning, resource management, and cognitive strategies and which of these beliefs most differentiated European American, African American and Hispanic students in terms of their mathematics achievement. The diverse sample consisted…

45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE...

Parental influences on children's self-regulation of energy intake: Insights from developmental literature on emotion regulation

USDA-ARS?s Scientific Manuscript database

This article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to childre...

Socialization of Self-Regulation: Continuity and Discontinuity Over Age and Context.

ERIC Educational Resources Information Center

Brownell, Celia A.; Etheridge, Wendy; Hungerford, Anne; Kelley, Sue

Self-regulation is a major developmental accomplishment that begins in infancy and continues throughout childhood. This study focused on early socialization of self-regulation, and examined whether there was a common core of self-regulation in young children cutting across contexts and age, and whether the same maternal behaviors operate similarly…

Role of the pre- and post-natal environment in developmental programming of health and productivity.

PubMed

Reynolds, Lawrence P; Caton, Joel S

2012-05-06

The concept that developmental insults (for example, poor pre- or postnatal nutrition) can have long-term consequences on health and well-being of the offspring has been termed developmental programming. In livestock, developmental programming affects production traits, including growth, body composition, and reproduction. Although low birth weight was used as a proxy for compromised fetal development in the initial epidemiological studies, based on controlled studies using livestock and other animal models in the last two decades we now know that developmental programming can occur independently of any effects on birth weight. Studies in humans, rodents, and livestock also have confirmed the critical role of the placenta in developmental programming. In addition, the central role of epigenetic regulation in developmental programming has been confirmed. Lastly, relatively simple therapeutic/management strategies designed to 'rescue' placental development and function are being developed to minimize the effects of developmental programming on health and productivity of humans, livestock, and other mammals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Cumulative-Genetic Plasticity, Parenting and Adolescent Self-Regulation

ERIC Educational Resources Information Center

Belsky, Jay; Beaver, Kevin M.

2011-01-01

Background: The capacity to control or regulate one's emotions, cognitions and behavior is central to competent functioning, with limitations in these abilities associated with developmental problems. Parenting appears to influence such self-regulation. Here the differential-susceptibility hypothesis is tested that the more putative "plasticity…

The Paradox of Regulations: A Commentary.

ERIC Educational Resources Information Center

Taylor, Steven J.

1992-01-01

This response to previous symposium papers (EC 604 155-161) concerning regulations and quality assurance in Intermediate Care Facilities for the Mentally Retarded (ICF/MR) sees regulations as the bureaucratization of values, identifies paradoxes implicit in regulatory controls, and urges reform of the current developmental disability service…

Focal gene misexpression in zebrafish embryos induced by local heat shock using a modified soldering iron.

PubMed

Hardy, Melissa E; Ross, Louis V; Chien, Chi-Bin

2007-11-01

Misexpression of genes in a temporally and spatially controlled fashion is an important tool for assessing gene function during development. Because few tissue-specific promoters have been identified in zebrafish, inducible systems such as the Cre/LoxP and Tet repressor systems are of limited utility. Here we describe a new method of misexpression: local heat shock using a modified soldering iron. Zebrafish carrying transgenes under the control of a heat shock promoter (hsp70) are focally heated with the soldering iron to induce gene expression in a small area of the embryo. We have validated this method in three stable transgenic lines and at three developmental timepoints. Local heat shock is a fast, easy, and inexpensive method for gene misexpression. Copyright 2007 Wiley-Liss, Inc.

RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

PubMed Central

Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies. PMID:23145190

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

PubMed

Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies.

Understanding entrepreneurial intent in late adolescence: the role of intentional self-regulation and innovation.

PubMed

Geldhof, G John; Weiner, Michelle; Agans, Jennifer P; Mueller, Megan K; Lerner, Richard M

2014-01-01

Entrepreneurship represents a form of adaptive developmental regulation through which both entrepreneurs and their ecologies benefit. We describe entrepreneurship from the perspective of relational developmental systems theory, and examine the joint role of personal attributes, contextual attributes, and characteristics of person-context relationships in predicting entrepreneurial intent in a sample 3,461 college students enrolled in colleges and universities in the United States (60 % female; 61 % European American). Specifically, we tested whether personal characteristics (i.e., gender, intentional self-regulation skills, innovation orientation) and contextual factors (i.e., entrepreneurial parents) predicted college students' intentions to pursue an entrepreneurial career. Our findings suggest that self-regulation, innovation orientation, and having entrepreneurial role models (i.e., parents) predict entrepreneurial intent. Limitations and future directions for the study of youth entrepreneurship are discussed.

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

Developmental regulation of fear learning and anxiety behavior by endocannabinoids

PubMed Central

Lee, Tiffany T.-Y.; Hill, Matthew N.; Lee, Francis S.

2015-01-01

The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic endocannabinoid signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that endocannabinoid signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic endocannabinoid signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the endocannabinoid system and discuss clinical and rodent models demonstrating endocannabinoid regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the endocannabinoid system in the central nervous system, and models of pharmacological augmentation of endocannabinoid signaling during development in the context of fear learning and anxiety. PMID:26419643

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

Evaluation of Liquid Fuel Field Space Heaters: Standard Military, Developmental and Foreign

DTIC Science & Technology

1978-10-01

least 15 kg/kg, (2) to react as much fuel as possible by the flameless combustion reaction, and (3) to maintain gas temperatures not higher than 1000...as there is enough oxygen there to support combustion . As the fuel flow increases, the flames move up until at maximum flow only flameless ...HEATING FIELD HEATING COMBUSTION COMBUSTION (LIQUID FUELS) HEATERS TENT HEATERS LIQUID FUELS FUELS LIQUIDS OXYGEN tS»TRACT rCoaltnu* an rmrormm

Inducible Transposition of a Heat-Activated Retrotransposon in Tissue Culture.

PubMed

Masuta, Yukari; Nozawa, Kosuke; Takagi, Hiroki; Yaegashi, Hiroki; Tanaka, Keisuke; Ito, Tasuku; Saito, Hideyuki; Kobayashi, Hisato; Matsunaga, Wataru; Masuda, Seiji; Kato, Atsushi; Ito, Hidetaka

2017-02-01

A transposition of a heat-activated retrotransposon named ONSEN required compromise of a small RNA-mediated epigenetic regulation that includes RNA-directed DNA methylation (RdDM) machinery after heat treatment. In the current study, we analyzed the transcriptional and transpositional activation of ONSEN to better understand the underlying molecular mechanism involved in the maintenance and/or induction of transposon activation in plant tissue culture. We found the transposition of heat-primed ONSEN during tissue culture independently of RdDM mutation. The heat activation of ONSEN transcripts was not significantly up-regulated in tissue culture compared with that in heat-stressed seedlings, indicating that the transposition of ONSEN was regulated independently of the transcript level. RdDM-related genes were up-regulated by heat stress in both tissue culture and seedlings. The level of DNA methylation of ONSEN did not show any change in tissue culture, and the amount of ONSEN-derived small RNAs was not affected by heat stress. The results indicated that the transposition of ONSEN was regulated by an alternative mechanism in addition to the RdDM-mediated epigenetic regulation in tissue culture. We applied the tissue culture-induced transposition of ONSEN to Japanese radish, an important breeding species of the family Brassicaceae. Several new insertions were detected in a regenerated plant derived from heat-stressed tissues and its self-fertilized progeny, revealing the possibility of molecular breeding without genetic modification. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Brg1 modulates enhancer activation in mesoderm lineage commitment

DOE PAGES

Alexander, Jeffrey M.; Hota, Swetansu K.; He, Daniel; ...

2015-03-26

The interplay between different levels of gene regulation in modulating developmental transcriptional programs, such as histone modifications and chromatin remodeling, is not well understood. Here, we show that the chromatin remodeling factor Brg1 is required for enhancer activation in mesoderm induction. In an embryonic stem cell-based directed differentiation assay, the absence of Brg1 results in a failure of cardiomyocyte differentiation and broad deregulation of lineage-specific gene expression during mesoderm induction. We find that Brg1 co-localizes with H3K27ac at distal enhancers and is required for robust H3K27 acetylation at distal enhancers that are activated during mesoderm induction. Brg1 is also requiredmore » to maintain Polycomb-mediated repression of non-mesodermal developmental regulators, suggesting cooperativity between Brg1 and Polycomb complexes. Thus, Brg1 is essential for modulating active and repressive chromatin states during mesoderm lineage commitment, in particular the activation of developmentally important enhancers. In conclusion, these findings demonstrate interplay between chromatin remodeling complexes and histone modifications that, together, ensure robust and broad gene regulation during crucial lineage commitment decisions.« less

Epigenetics and the Developmental Origins of Health and ...

EPA Pesticide Factsheets

Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

Light-Mediated Hormonal Regulation of Plant Growth and Development.

PubMed

de Wit, Mieke; Galvão, Vinicius Costa; Fankhauser, Christian

2016-04-29

Light is crucial for plant life, and perception of the light environment dictates plant growth, morphology, and developmental changes. Such adjustments in growth and development in response to light conditions are often established through changes in hormone levels and signaling. This review discusses examples of light-regulated processes throughout a plant's life cycle for which it is known how light signals lead to hormonal regulation. Light acts as an important developmental switch in germination, photomorphogenesis, and transition to flowering, and light cues are essential to ensure light capture through architectural changes during phototropism and the shade avoidance response. In describing well-established links between light perception and hormonal changes, we aim to give insight into the mechanisms that enable plants to thrive in variable light environments.

[The principle of the energy minimum in ontogeny and the channeling of developmental processes].

PubMed

Ozerniuk, N D

1989-01-01

The principle of minimum of energy in ontogenesis has been formulated on the basis of data concerning age changes in energetic metabolism, as well as the influence of ecological factors on this process. According to this principle the smallest expenditures of energy are observed in the zone of the most favorable developmental conditions. The minimal level of energetic metabolism at every developmental stage that corresponds to the most stable state of organism is treated as homeostasis and the developmental stability is treated as homeorrhesis. Regulation mechanisms of energetic metabolism during ontogenesis and under the influence of environmental factors are analyzed.

Insulin/Insulin-like growth factor signaling controls non-Dauer developmental speed in the nematode Caenorhabditis elegans.

PubMed

Ruaud, Anne-Françoise; Katic, Iskra; Bessereau, Jean-Louis

2011-01-01

Identified as a major pathway controlling entry in the facultative dauer diapause stage, the DAF-2/Insulin receptor (InsR) signaling acts in multiple developmental and physiological regulation events in Caenorhabditis elegans. Here we identified a role of the insulin-like pathway in controlling developmental speed during the C. elegans second larval stage. This role relies on the canonical DAF-16/FOXO-dependent branch of the insulin-like signaling and is largely independent of dauer formation. Our studies provide further evidence for broad conservation of insulin/insulin-like growth factor (IGF) functions in developmental speed control.

45 CFR 1386.90 - Notice of hearing or opportunity for hearing.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Notice of hearing or opportunity for hearing. 1386.90 Section 1386.90 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM...

Lifespan Development of Neuromodulation of Adaptive Control and Motivation as an Ontogenetic Mechanism for Developmental Niche Construction

ERIC Educational Resources Information Center

Li, Shu-Chen

2013-01-01

Instead of viewing organisms and individuals as passive recipients of their biological, ecological, and cultural inheritances, the developmental niche construction theory and the biocultural co-construction framework both emphasize that the individual's agency plays a key role in regulating how environmental and sociocontextual influences may…

Developmental Conditions of Adaptive Self-Stabilization in Adolescence: An Exploratory Study

ERIC Educational Resources Information Center

Greve, Werner; Thomsen, Tamara

2013-01-01

In a cross-sectional study with 541 German students (mean age: 12.61 yrs) and (for a subsample of N = 350) one of their parents, developmental conditions for a particular resource of self-regulation ("Flexibility of Goal Adjustment"; Brandtstadter & Renner, 1990) are investigated. Theoretical ¨ arguments and empirical results from…

Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

PubMed Central

Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

2016-01-01

Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

Progranulin regulates neurogenesis in the developing vertebrate retina.

PubMed

Walsh, Caroline E; Hitchcock, Peter F

2017-09-01

We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

Self-Regulation Processes and Thriving in Childhood and Adolescence: A View of the Issues

ERIC Educational Resources Information Center

Lerner, Richard M.; Lerner, Jacqueline V.; Bowers, Edmond P.; Lewin-Bizan, Selva; Gestsdottir, Steinunn; Urban, Jennifer Brown

2011-01-01

Both organismic and intentional self-regulation processes must be integrated across childhood and adolescence for adaptive developmental regulations to exist and for the developing person to thrive, both during the first two decades of life and through the adult years. To date, such an integrated, life-span approach to self-regulation during…

Relating empathy and emotion regulation: do deficits in empathy trigger emotion dysregulation?

PubMed

Schipper, Marc; Petermann, Franz

2013-01-01

Emotion regulation is a crucial skill in adulthood; its acquisition represents one of the key developmental tasks in early childhood. Difficulties with adaptive emotion regulation increase the risk of psychopathology in childhood and adulthood. This is, for instance, shown by a relation between emotion regulation and aggressive behavior in childhood age, indicating emotion dysregulation as an important risk factor of aggressive behavior and potential precursor of psychopathology. Based on (1) interrelations between emotion processes and social information processing (maladaptive emotion regulation and social information processing are associated with higher levels of aggression) and (2) recent neuroscientific findings showing that empathy deficits might not only result in difficulties labeling others' emotions but one's own emotions too, we suggest that empathy deficits might serve as potential trigger of emotion dysregulation. Different studies investigating the relation between empathy and emotion regulation are presented and discussed. Discussions are based on the assumed potential of empathy deficits triggering emotion dysregulation. Furthermore, developmental neuroscientific findings on empathy and emotion regulation are highlighted which provide further insights on how these processes might relate. Finally, possible directions for future research are presented.

Nature and autonomy: an organizational view of social and neurobiological aspects of self-regulation in behavior and development.

PubMed

Ryan, R M; Kuhl, J; Deci, E L

1997-01-01

The concepts of self-regulation and autonomy are examined within an organizational framework. We begin by retracing the historical origins of the organizational viewpoint in early debates within the field of biology between vitalists and reductionists, from which the construct of self-regulation emerged. We then consider human autonomy as an evolved behavioral, developmental, and experiential phenomenon that operates at both neurobiological and psychological levels and requires very specific supports within higher order social organizations. We contrast autonomy or true self-regulation with controlling regulation (a nonautonomous form of intentional behavior) in phenomenological and functional terms, and we relate the forms of regulation to the developmental processes of intrinsic motivation and internalization. Subsequently, we describe how self-regulation versus control may be characterized by distinct neurobiological underpinnings, and we speculate about some of the adaptive advantages that may underlie the evolution of autonomy. Throughout, we argue that disturbances of autonomy, which have both biological and psychological etiologies, are central to many forms of psychopathology and social alienation.

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

Relationships between Parent and Child Emotion Regulation Strategy Use: A Brief Report

ERIC Educational Resources Information Center

Bariola, Emily; Hughes, Elizabeth K.; Gullone, Eleonora

2012-01-01

We examined the direct relationships between parent and child emotion regulation (ER) strategy use during the transitionary and understudied developmental periods of middle childhood through to adolescence. Three hundred and seventy-nine participants aged between 9 and 19 years, completed the Emotion Regulation Questionnaire for Children and…

Differences in Kindergartners' Participation and Regulation Strategies across Time and Instructional Contexts

ERIC Educational Resources Information Center

Neitzel, Carin; Connor, Lisa

2017-01-01

This study addressed questions about the function of children's various participation and regulation strategies in different instructional contexts and at different points in time in school. The developmental trajectories of kindergartners' academic participation and regulation strategy selection and use across the school year in teacher-directed…

Focus on Preschool Aquatics: Child Care Regulations.

ERIC Educational Resources Information Center

Sayre, Nancy E.

This paper proposes state regulations for the training of child care staff members in developmentally appropriate safe aquatic practices, outlines required features of any pools that children visit, and suggests safe practices for water-related activities at child care centers and swimming pools. The staff training regulation suggestions include…

Aspp2 negatively regulates body growth but not developmental timing by modulating IRS signaling in zebrafish embryos.

PubMed

Liu, Chengdong; Luan, Jing; Bai, Yan; Li, Yun; Lu, Ling; Liu, Yunzhang; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Duan, Cunming; Zhou, Jianfeng

2014-02-01

The growth and developmental rate of developing embryos and fetus are tightly controlled and coordinated to maintain proper body shape and size. The insulin receptor substrate (IRS) proteins, key intracellular transducers of insulin and insulin-like growth factor signaling, play essential roles in the regulation of growth and development. A short isoform of apoptosis-stimulating protein of p53 2 (ASPP2) was recently identified as a binding partner of IRS-1 and IRS-2 in mammalian cells in vitro. However, it is unclear whether ASPP2 plays any role in vertebrate embryonic growth and development. Here, we show that zebrafish Aspp2a and Aspp2b negatively regulate embryonic growth without affecting developmental rate. Human ASPP2 had similar effects on body growth in zebrafish embryos. Aspp2a and 2b inhibit Akt signaling. This inhibition was reversed by coinjection of myr-Akt1, a constitutively active form of Akt1. Zebrafish Aspp2a and Aspp2b physically bound with Irs-1, and the growth inhibitory effects of ASPP2/Aspp2 depend on the presence of their ankyrin repeats and SH3 domains. These findings uncover a novel role of Aspp2 in regulating vertebrate embryonic growth. Copyright © 2013 Elsevier Inc. All rights reserved.

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

A.S.N. Reddy

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The regulation of SR45 mobility by ATP and a transcriptional inhibitor is in contrast to the mobility of SR family splicing factors in animals and suggests fundamental differences in the movement of plant and animals splicing factors. In vivo interaction of U170K with SR45: To analyze the interaction of U170K with SR45, we expressed these proteins fused to RFP and GFP respectively, in protoplasts. Both the reporters co-localized to the same subnuclear domains. To determine direct interaction of these proteins, we fused full-length U170K to one part of split YFP and full-length or truncated version of SR45 to the second half of split YFP. Coexpession of these split YFP constructs resulted in reconstitution of YFP in speckles, suggesting direction interaction of these proteins in vivo (Ali et al., 2008). SR45 is a Novel Plant-Specific Splicing Factor and is Involved in Regulating Multiple Developmental Processes: Using an in vitro splicing complementation assay, we showed that SR45 is an essential splicing factor. The sr45-1 mutant exhibited a number of developmental abnormalities. Further analysis of flowering time has shown that the autonomous pathway of flowering is affected in the mutant. Expression analysis of several flowering genes has revealed that FLC, a key flowering repressor, is up-regulated in the SR45 mutant. Further, alternative splicing pattern of several other SR genes was altered in the sr45-1 mutant in a tissue-specific manner. Hence, the observed pleiotropic effects on various aspects of development are likely due to altered level of SR protein isoforms, which in turn regulate the splicing of other pre-mRNAs. Expression of wild-type SR45 in the mutant complemented the phenotypic defects and changes in alternative splicing of SR genes. SR45 thus is a novel plant-specific splicing factor and plays a crucial role in multiple developmental processes.« less

Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

PubMed

Stiles, Kari A; Van Volkenburgh, Elizabeth

2002-07-01

Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

Children in Foster Care and the Development of Favorable Outcomes

PubMed Central

Fisher, Philip A.

2011-01-01

Young foster children have invariably faced a variety of risks that are strongly linked to long-term deficits in functioning across multiple developmental domains. Despite these risks, however, some children demonstrate more favorable outcomes and exhibit adaptation and the development of assets. In the present study, the relationship of early childhood factors (e.g., maltreatment history, placement history, parenting practices, environmental stress, developmental status, and attachment behavior) to the development of favorable outcomes in middle childhood were examined in a sample of foster children who had been in foster care in preschool (N = 35). Favorable outcomes were defined as demonstrations of emotion regulation and school adjustment in during middle childhood. Developmental status (particularly attention and executive functioning) and a lack of environmental stress during early childhood foster care experiences had a significant positive relationship with the development of emotion regulation and school adjustment in middle childhood. PMID:21987598

A network of epigenetic regulators guides developmental haematopoiesis in vivo.

PubMed

Huang, Hsuan-Ting; Kathrein, Katie L; Barton, Abby; Gitlin, Zachary; Huang, Yue-Hua; Ward, Thomas P; Hofmann, Oliver; Dibiase, Anthony; Song, Anhua; Tyekucheva, Svitlana; Hide, Winston; Zhou, Yi; Zon, Leonard I

2013-12-01

The initiation of cellular programs is orchestrated by key transcription factors and chromatin regulators that activate or inhibit target gene expression. To generate a compendium of chromatin factors that establish the epigenetic code during developmental haematopoiesis, a large-scale reverse genetic screen was conducted targeting orthologues of 425 human chromatin factors in zebrafish. A set of chromatin regulators was identified that target different stages of primitive and definitive blood formation, including factors not previously implicated in haematopoiesis. We identified 15 factors that regulate development of primitive erythroid progenitors and 29 factors that regulate development of definitive haematopoietic stem and progenitor cells. These chromatin factors are associated with SWI/SNF and ISWI chromatin remodelling, SET1 methyltransferase, CBP-p300-HBO1-NuA4 acetyltransferase, HDAC-NuRD deacetylase, and Polycomb repressive complexes. Our work provides a comprehensive view of how specific chromatin factors and their associated complexes play a major role in the establishment of haematopoietic cells in vivo.

Transcriptional regulation of heat shock proteins and ascorbate peroxidase by CtHsfA2b from African bermudagrass conferring heat tolerance in Arabidopsis

PubMed Central

Wang, Xiuyun; Huang, Wanlu; Yang, Zhimin; Liu, Jun; Huang, Bingru

2016-01-01

Heat stress transcription factor A2s (HsfA2s) are key regulators in plant response to high temperature. Our objectives were to isolate an HsfA2 gene (CtHsfA2b) from a warm-season grass species, African bermudagrass (Cynodon transvaalensis Burtt-Davy), and to determine the physiological functions and transcriptional regulation of HsfA2 for improving heat tolerance. Gene expression analysis revealed that CtHsfA2b was heat-inducible and exhibited rapid response to increasing temperature. Ectopic expression of CtHsfA2b improved heat tolerance in Arabidopsis and restored heat-sensitive defects of Arabidopsis hsfa2 mutant, which was demonstrated by higher survival rate and photosynthetic parameters, and lower electrolyte leakage in transgenic plants compared to the WT or hsfa2 mutant. CtHsfA2b transgenic plants showed elevated transcriptional regulation of several downstream genes, including those encoding ascorbate peroxidase (AtApx2) and heat shock proteins [AtHsp18.1-CI, AtHsp22.0-ER, AtHsp25.3-P and AtHsp26.5-P(r), AtHsp70b and AtHsp101-3]. CtHsfA2b was found to bind to the heat shock element (HSE) on the promoter of AtApx2 and enhanced transcriptional activity of AtApx2. These results suggested that CtHsfA2b could play positive roles in heat protection by up-regulating antioxidant defense and chaperoning mechanisms. CtHsfA2b has the potential to be used as a candidate gene to genetically modify cool-season species for improving heat tolerance. PMID:27320381

Emotion Regulation from Early Adolescence to Emerging Adulthood and Middle Adulthood: Age Differences, Gender Differences, and Emotion-Epecific Developmental Variations

ERIC Educational Resources Information Center

Zimmermann, Peter; Iwanski, Alexandra

2014-01-01

Despite the growing research on emotion regulation, the empirical evidence for normative age-related emotion regulation patterns is rather divergent. From a life-span perspective, normative age changes in emotion regulation may be more salient applying the same methodological approach on a broad age range examining both growth and decline during…

Challenges to Developmental Regulation across the Life Course: What Are They and Which Individual Differences Matter?

ERIC Educational Resources Information Center

Heckhausen, Jutta; Wrosch, Carsten

2016-01-01

We discuss the major processes involved in individuals' motivation and self-regulation of goal striving throughout the life course. While much is regulated based on the biological and societal scaffolding of lifespan development, certain challenges for motivation and self-regulation are more substantial and need to be managed by the individual,…

Getting Back to the Woods: Familial Perspectives on Culture and Preschoolers' Acquisition of Self-Regulation and Emotion Regulation

ERIC Educational Resources Information Center

Boyer, Wanda

2013-01-01

Discourse on culture is vital to early childhood educators' understanding of the young child in various socio-cultural experiences in family and community settings. In this article, the author will present a contemporary definition of culture. This article will then discuss the developmental constructs of self-regulation and emotion regulation and…

Physiological Perturbation Reveals Modularity of Eyespot Development in the Painted Lady Butterfly, Vanessa cardui

PubMed Central

Rhen, Turk; Simmons, Rebecca B.

2016-01-01

Butterfly eyespots are complex morphological traits that can vary in size, shape and color composition even on the same wing surface. Homology among eyespots suggests they share a common developmental basis and function as an integrated unit in response to selection. Despite strong evidence of genetic integration, eyespots can also exhibit modularity or plasticity, indicating an underlying flexibility in pattern development. The extent to which particular eyespots or eyespot color elements exhibit modularity or integration is poorly understood, particularly following exposure to novel conditions. We used perturbation experiments to explore phenotypic correlations among different eyespots and their color elements on the ventral hindwing of V. cardui. Specifically, we identified which eyespots and eyespot features are most sensitive to perturbation by heat shock and injection of heparin—a cold shock mimic. For both treatments, the two central eyespots (3 + 4) were most affected by the experimental perturbations, whereas the outer eyespot border was more resistant to modification than the interior color elements. Overall, the individual color elements displayed a similar response to heat shock across all eyespots, but varied in their response to each other. Graphical modeling also revealed that although eyespots differ morphologically, regulation of eyespot size and colored elements appear to be largely integrated across the wing. Patterns of integration, however, were disrupted following heat shock, revealing that the strength of integration varies across the wing and is strongest between the two central eyespots. These findings support previous observations that document coupling between eyespots 3 + 4 in other nymphalid butterflies. PMID:27560365

Physiological Perturbation Reveals Modularity of Eyespot Development in the Painted Lady Butterfly, Vanessa cardui.

PubMed

Connahs, Heidi; Rhen, Turk; Simmons, Rebecca B

2016-01-01

Butterfly eyespots are complex morphological traits that can vary in size, shape and color composition even on the same wing surface. Homology among eyespots suggests they share a common developmental basis and function as an integrated unit in response to selection. Despite strong evidence of genetic integration, eyespots can also exhibit modularity or plasticity, indicating an underlying flexibility in pattern development. The extent to which particular eyespots or eyespot color elements exhibit modularity or integration is poorly understood, particularly following exposure to novel conditions. We used perturbation experiments to explore phenotypic correlations among different eyespots and their color elements on the ventral hindwing of V. cardui. Specifically, we identified which eyespots and eyespot features are most sensitive to perturbation by heat shock and injection of heparin-a cold shock mimic. For both treatments, the two central eyespots (3 + 4) were most affected by the experimental perturbations, whereas the outer eyespot border was more resistant to modification than the interior color elements. Overall, the individual color elements displayed a similar response to heat shock across all eyespots, but varied in their response to each other. Graphical modeling also revealed that although eyespots differ morphologically, regulation of eyespot size and colored elements appear to be largely integrated across the wing. Patterns of integration, however, were disrupted following heat shock, revealing that the strength of integration varies across the wing and is strongest between the two central eyespots. These findings support previous observations that document coupling between eyespots 3 + 4 in other nymphalid butterflies.

The regulation of TNFα production after heat and endotoxin stimulation is dependent on Annexin-A1 and HSP70.

PubMed

Nair, Sunitha; Arora, Suruchi; Lim, Jyue Yuan; Lee, Lay Hoon; Lim, Lina H K

2015-07-01

Febrile temperatures can induce stress responses which protect cells from damage and can reduce inflammation during infections and sepsis. However, the mechanisms behind the protective functions of heat in response to the bacterial endotoxin LPS are unclear. We have recently shown that Annexin-1 (ANXA1)-deficient macrophages exhibited higher TNFα levels after LPS stimulation. Moreover, we have previously reported that ANXA1 can function as a stress protein. Therefore in this study, we determined if ANXA1 is involved in the protective effects of heat on cytokine levels in macrophages after heat and LPS. Exposure of macrophages to 42 °C for 1 h prior to LPS results in an inhibition of TNFα production, which was not evident in ANXA1(-/-) macrophages. We show that this regulation involves primarily MYD88-independent pathways. ANXA1 regulates TNFα mRNA stability after heat and LPS, and this is dependent on endogenous ANXA1 expression and not exogenously secreted factors. Further mechanistic studies revealed the possible involvement of the heat shock protein HSP70 and JNK in the heat and inflammatory stress response regulated by ANXA1. This study shows that ANXA1, an immunomodulatory protein, is critical in the heat stress response induced after heat and endotoxin stimulation.

Promoting Positive Youth Development in the Face of Contextual Changes and Challenges: The Roles of Individual Strengths and Ecological Assets

ERIC Educational Resources Information Center

Lerner, Richard M.; Bowers, Edmond P.; Geldhof, G. John; Gestsdottir, Steinunn; DeSouza, Lisette

2012-01-01

Contemporary developmental theory is framed by relational developmental systems models that emphasize that change across life occurs through mutually regulative relations between individuals and their contexts (represented as individual [left arrow][right arrow] context relations). Within these models, all contextual levels are involved in these…

Developmental changes rather than repeated administration drive paracetamol glucuronidation in neonates and infants.

PubMed

Krekels, Elke H J; van Ham, Saskia; Allegaert, Karel; de Hoon, Jan; Tibboel, Dick; Danhof, Meindert; Knibbe, Catherijne A J

2015-09-01

Based on recovered metabolite ratios in urine, it has been concluded that paracetamol glucuronidation may be up-regulated upon multiple dosing. This study investigates paracetamol clearance in neonates and infants after single and multiple dosing using a population modelling approach. A population pharmacokinetic model was developed in NONMEM VI, based on paracetamol plasma concentrations from 54 preterm and term neonates and infants, and on paracetamol, paracetamol-glucuronide and paracetamol-sulphate amounts in urine from 22 of these patients. Patients received either a single intravenous propacetamol dose or up to 12 repeated doses. Paracetamol and metabolite disposition was best described with one-compartment models. The formation clearance of paracetamol-sulphate was 1.46 mL/min/kg(1.4), which was about 5.5 times higher than the formation clearance of the glucuronide of 0.266 mL/min/kg. The renal excretion rate constants of both metabolites was estimated to be 11.4 times higher than the excretion rate constant of unchanged paracetamol, yielding values of 0.580 mL/min/kg. Developmental changes were best described by bodyweight in linear relationships on the distribution volumes, the formation of paracetamol-glucuronide and the unchanged excretion of paracetamol, and in an exponential relationship on the formation of paracetamol-sulphate. There was no evidence for up-regulation or other time-varying changes in any of the model parameters. Simulations with this model illustrate how paracetamol-glucuronide recovery in urine increases over time due to the slower formation of this metabolite and in the absence of up-regulation. Developmental changes, described by bodyweight-based functions, rather than up-regulation, explain developmental changes in paracetamol disposition in neonates and infants.

Comparison of a teratogenic transcriptome-based predictive test based on human embryonic versus inducible pluripotent stem cells.

PubMed

Shinde, Vaibhav; Perumal Srinivasan, Sureshkumar; Henry, Margit; Rotshteyn, Tamara; Hescheler, Jürgen; Rahnenführer, Jörg; Grinberg, Marianna; Meisig, Johannes; Blüthgen, Nils; Waldmann, Tanja; Leist, Marcel; Hengstler, Jan Georg; Sachinidis, Agapios

2016-12-30

Human embryonic stem cells (hESCs) partially recapitulate early embryonic three germ layer development, allowing testing of potential teratogenic hazards. Because use of hESCs is ethically debated, we investigated the potential for human induced pluripotent stem cells (hiPSCs) to replace hESCs in such tests. Three cell lines, comprising hiPSCs (foreskin and IMR90) and hESCs (H9) were differentiated for 14 days. Their transcriptome profiles were obtained on day 0 and day 14 and analyzed by comprehensive bioinformatics tools. The transcriptomes on day 14 showed that more than 70% of the "developmental genes" (regulated genes with > 2-fold change on day 14 compared to day 0) exhibited variability among cell lines. The developmental genes belonging to all three cell lines captured biological processes and KEGG pathways related to all three germ layer embryonic development. In addition, transcriptome profiles were obtained after 14 days of exposure to teratogenic valproic acid (VPA) during differentiation. Although the differentially regulated genes between treated and untreated samples showed more than 90% variability among cell lines, VPA clearly antagonized the expression of developmental genes in all cell lines: suppressing upregulated developmental genes, while inducing downregulated ones. To quantify VPA-disturbed development based on developmental genes, we estimated the "developmental potency" (D p ) and "developmental index" (D i ). Despite differences in genes deregulated by VPA, uniform D i values were obtained for all three cell lines. Given that the D i values for VPA were similar for hESCs and hiPSCs, D i can be used for robust hazard identification, irrespective of whether hESCs or hiPSCs are used in the test systems.

A Computational Model Predicting Disruption of Blood Vessel Development

EPA Science Inventory

Vascular development is a complex process regulated by dynamic biological networks that vary in topology and state across different tissues and developmental stages. Signals regulating de novo blood vessel formation (vasculogenesis) and remodeling (angiogenesis) come from a varie...

Differential expression of calcium-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit

USDA-ARS?s Scientific Manuscript database

Calcium has been shown to increase stress tolerance, enhance fruit firmness and reduce decay. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also resp...

The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

PubMed

Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

2013-04-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

PubMed Central

Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

2013-01-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

Developmental regulation of fear learning and anxiety behavior by endocannabinoids.

PubMed

Lee, T T-Y; Hill, M N; Lee, F S

2016-01-01

The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid (eCB) system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic eCB signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that eCB signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic eCB signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the eCB system and discuss clinical and rodent models showing eCB regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the eCB system in the central nervous system, and models of pharmacological augmentation of eCB signaling during development in the context of fear learning and anxiety. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Genome-wide analysis, expression profile of heat shock factor gene family (CaHsfs) and characterisation of CaHsfA2 in pepper (Capsicum annuum L.).

PubMed

Guo, Meng; Lu, Jin-Ping; Zhai, Yu-Fei; Chai, Wei-Guo; Gong, Zhen-Hui; Lu, Ming-Hui

2015-06-19

Heat shock factors (Hsfs) play crucial roles in plant developmental and defence processes. The production and quality of pepper (Capsicum annuum L.), an economically important vegetable crop, are severely reduced by adverse environmental stress conditions, such as heat, salt and osmotic stress. Although the pepper genome has been fully sequenced, the characterization of the Hsf gene family under abiotic stress conditions remains incomplete. A total of 25 CaHsf members were identified in the pepper genome by bioinformatics analysis and PCR assays. They were grouped into three classes, CaHsfA, B and C, based on highly conserved Hsf domains, were distributed over 11 of 12 chromosomes, with none found on chromosome 11, and all of them, except CaHsfA5, formed a protein-protein interaction network. According to the RNA-seq data of pepper cultivar CM334, most CaHsf members were expressed in at least one tissue among root, stem, leaf, pericarp and placenta. Quantitative real-time PCR assays showed that all of the CaHsfs responded to heat stress (40 °C for 2 h), except CaHsfC1 in thermotolerant line R9 leaves, and that the expression patterns were different from those in thermosensitive line B6. Many CaHsfs were also regulated by salt and osmotic stresses, as well as exogenous Ca(2+), putrescine, abscisic acid and methyl jasmonate. Additionally, CaHsfA2 was located in the nucleus and had transcriptional activity, consistent with the typical features of Hsfs. Time-course expression profiling of CaHsfA2 in response to heat stress revealed differences in its expression level and pattern between the pepper thermosensitive line B6 and thermotolerant line R9. Twenty-five Hsf genes were identified in the pepper genome and most of them responded to heat, salt, osmotic stress, and exogenous substances, which provided potential clues for further analyses of CaHsfs functions in various kinds of abiotic stresses and of corresponding signal transduction pathways in pepper.

Role and regulation of autophagy in heat stress responses of tomato plants

PubMed Central

Zhou, Jie; Wang, Jian; Yu, Jing-Quan; Chen, Zhixiang

2014-01-01

As sessile organisms, plants are constantly exposed to a wide spectrum of stress conditions such as high temperature, which causes protein misfolding. Misfolded proteins are highly toxic and must be efficiently removed to reduce cellular proteotoxic stress if restoration of native conformations is unsuccessful. Although selective autophagy is known to function in protein quality control by targeting degradation of misfolded and potentially toxic proteins, its role and regulation in heat stress responses have not been analyzed in crop plants. In the present study, we found that heat stress induced expression of autophagy-related (ATG) genes and accumulation of autophagosomes in tomato plants. Virus-induced gene silencing (VIGS) of tomato ATG5 and ATG7 genes resulted in increased sensitivity of tomato plants to heat stress based on both increased development of heat stress symptoms and compromised photosynthetic parameters of heat-stressed leaf tissues. Silencing of tomato homologs for the selective autophagy receptor NBR1, which targets ubiquitinated protein aggregates, also compromised tomato heat tolerance. To better understand the regulation of heat-induced autophagy, we found that silencing of tomato ATG5, ATG7, or NBR1 compromised heat-induced expression of not only the targeted genes but also other autophagy-related genes. Furthermore, we identified two tomato genes encoding proteins highly homologous to Arabidopsis WRKY33 transcription factor, which has been previously shown to interact physically with an autophagy protein. Silencing of tomato WRKY33 genes compromised tomato heat tolerance and reduced heat-induced ATG gene expression and autophagosome accumulation. Based on these results, we propose that heat-induced autophagy in tomato is subject to cooperative regulation by both WRKY33 and ATG proteins and plays a critical role in tomato heat tolerance, mostly likely through selective removal of heat-induced protein aggregates. PMID:24817875

Forkhead Box M1 Is Regulated by Heat Shock Factor 1 and Promotes Glioma Cells Survival under Heat Shock Stress*

PubMed Central

Dai, Bingbing; Gong, Aihua; Jing, Zhitao; Aldape, Kenneth D.; Kang, Shin-Hyuk; Sawaya, Raymond; Huang, Suyun

2013-01-01

The forkhead box M1 (FoxM1) is a key transcription factor regulating multiple aspects of cell biology. Prior studies have shown that FoxM1 is overexpressed in a variety of human tumors, including brain tumor, and plays a critical role in cancer development and progression. In this study we found that FoxM1 was up-regulated by heat shock factor 1 (HSF1) under heat shock stress condition in multiple cell lines. Knockdown of HSF1 with HSF1 siRNA or inhibition of HSF1 with a HSF1 inhibitor abrogated heat shock-induced expression of FoxM1. Genetic deletion of HSF1 in mouse embryo fibroblast cells also abolished heat shock stress-induced FoxM1 expression. Moreover, we showed that HSF1 directly bound to FoxM1 promoter and increased FoxM1 promoter activity. Furthermore, we demonstrated that FoxM1 was required for the G2-M phase progression through regulating Cdc2, Cdc20, and Cdc25B under a mild heat shock stress but enhanced cell survival under lethal heat shock stress condition. Finally, in human glioblastoma specimens, FoxM1 overexpression correlated with elevated HSF1 expression. Our results indicate that FoxM1 is regulated by HSF1 and is critical for HSF1-mediated heat shock response. We demonstrated a novel mechanism of stress resistance controlled by HSF1 and a new HSF-FoxM1 connection that mediates cellular thermotolerance. PMID:23192351

Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

NASA Technical Reports Server (NTRS)

Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

2000-01-01

beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

MicroRNA-276 promotes egg-hatching synchrony by up-regulating brm in locusts

PubMed Central

He, Jing; Chen, Qianquan; Wei, Yuanyuan; Jiang, Feng; Yang, Meiling; Hao, Shuguang; Guo, Xiaojiao; Chen, Dahua; Kang, Le

2016-01-01

Developmental synchrony, the basis of uniform swarming, migration, and sexual maturation, is an important strategy for social animals to adapt to variable environments. However, the molecular mechanisms underlying developmental synchrony are largely unexplored. The migratory locust exhibits polyphenism between gregarious and solitarious individuals, with the former displaying more synchronous sexual maturation and migration than the latter. Here, we found that the egg-hatching time of gregarious locusts was more uniform compared with solitarious locusts and that microRNA-276 (miR-276) was expressed significantly higher in both ovaries and eggs of gregarious locusts than in solitarious locusts. Interestingly, inhibiting miR-276 in gregarious females and overexpressing it in solitarious females, respectively, caused more heterochronic and synchronous hatching of progeny eggs. Moreover, miR-276 directly targeted a transcription coactivator gene, brahma (brm), resulting in its up-regulation. Knockdown of brm not only resulted in asynchronous egg hatching in gregarious locusts but also impaired the miR-276–induced synchronous egg hatching in solitarious locusts. Mechanistically, miR-276 mediated brm activation in a manner that depended on the secondary structure of brm, namely, a stem-loop around the binding site of miR-276. Collectively, our results unravel a mechanism by which miR-276 enhances brm expression to promote developmental synchrony and provide insight into regulation of developmental homeostasis and population sustaining that are closely related to biological synchrony. PMID:26729868

29 CFR 1952.201 - Developmental schedule.

Code of Federal Regulations, 2011 CFR

2011-07-01

... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

29 CFR 1952.201 - Developmental schedule.

Code of Federal Regulations, 2013 CFR

2013-07-01

... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

29 CFR 1952.201 - Developmental schedule.

Code of Federal Regulations, 2010 CFR

2010-07-01

... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

29 CFR 1952.201 - Developmental schedule.

Code of Federal Regulations, 2014 CFR

2014-07-01

... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

29 CFR 1952.201 - Developmental schedule.

Code of Federal Regulations, 2012 CFR

2012-07-01

... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Toy Age-Labeling: An Overview for Pediatricians of How Toys Receive Their Age Safety and Developmental Designations.

PubMed

Kulak, Shuli; Stein, Ruth E K

2016-07-01

Injuries related to toys continue to cause significant childhood morbidity and mortality, despite considerable government regulation of the toy industry. Recent controversy related to toys that contain strong magnets demonstrate the dangers they pose to children. The pediatric community is often unaware of how toys receive their developmental and safety labeling and the degree to which age-labeling on toys can be discretionary. Toy labeling has 2 basic manifestations. The first, safety labeling for hazards like small parts, balloons, or small balls that may present a choking risk, is mandatory. The second, "developmental" age-labeling, describes the age of the children for which the toy is intended, and sometimes has discretionary components. This article provides a review of the regulations governing toy age-safety standards and how they are reflected on toy packaging to help pediatric practitioners apply safety advice across settings and patient characteristics. We review the existing age-labeling regulations and processes and discuss the major areas where children remain vulnerable despite labeling. Finally, we list some recommendations for counseling parents about toy safety. Copyright © 2016 by the American Academy of Pediatrics.

A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance.

PubMed

Maheshwari, Richa; Pushpa, Kumari; Subramaniam, Kuppuswamy

2016-09-01

Membrane-bound receptors, which are crucial for mediating several key developmental signals, are synthesized on endoplasmic reticulum (ER). The functional integrity of ER must therefore be important for the regulation of at least some developmental programs. However, the developmental control of ER function is not well understood. Here, we identify the C. elegans protein FARL-11, an ortholog of the mammalian STRIPAK complex component STRIP1/2 (FAM40A/B), as an ER protein. In the C. elegans embryo, we find that FARL-11 is essential for the cell cycle-dependent morphological changes of ER and for embryonic viability. In the germline, FARL-11 is required for normal ER morphology and for membrane localization of the GLP-1/Notch receptor involved in germline stem cell (GSC) maintenance. Furthermore, we provide evidence that PUF-8, a key translational regulator in the germline, promotes the translation of farl-11 mRNA. These findings reveal that ER form and function in the C. elegans germline are post-transcriptionally regulated and essential for the niche-GSC signaling mediated by GLP-1. © 2016. Published by The Company of Biologists Ltd.

Isolation and expression profiling of GhNAC transcription factor genes in cotton (Gossypium hirsutum L.) during leaf senescence and in response to stresses.

PubMed

Shah, Syed Tariq; Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Arain, Saima; Yu, Shuxun

2013-12-01

NAC (NAM, ATAF, and CUC) is a plant-specific transcription factor family with diverse roles in plant development and stress regulation. In this report, stress-responsive NAC genes (GhNAC8-GhNAC17) isolated from cotton (Gossypium hirsutum L.) were characterised in the context of leaf senescence and stress tolerance. The characterisation of NAC genes during leaf senescence has not yet been reported for cotton. Based on the sequence characterisation, these GhNACs could be classified into three groups belonging to three known NAC sub-families. Their predicted amino acid sequences exhibited similarities to NAC genes from other plant species. Senescent leaves were the sites of maximum expression for all GhNAC genes except GhNAC10 and GhNAC13, which showed maximum expression in fibres, collected from 25 days post anthesis (DPA) plants. The ten GhNAC genes displayed differential expression patterns and levels during natural and induced leaf senescence. Quantitative RT-PCR and promoter analyses suggest that these genes are induced by ABA, ethylene, drought, salinity, cold, heat, and other hormonal treatments. These results support a role for cotton GhNAC genes in transcriptional regulation of leaf senescence, stress tolerance and other developmental stages of cotton. © 2013.

The 70 kDa Heat Shock Protein Assists during the Repair of Chilling Injury in the Insect, Pyrrhocoris apterus

PubMed Central

Koštál, Vladimír; Tollarová-Borovanská, Michaela

2009-01-01

Background The Pyrrhocoris apterus (Insecta: Heteroptera) adults attain high levels of cold tolerance during their overwintering diapause. Non-diapause reproducing adults, however, lack the capacity to express a whole array of cold-tolerance adaptations and show relatively low survival when exposed to sub-zero temperatures. We assessed the competence of non-diapause males of P. apterus for responding to heat- and cold-stresses by up-regulation of 70 kDa heat shock proteins (Hsps) and the role of Hsps during repair of heat- and cold-induced injury. Principal Findings The fragments of P. apterus homologues of Hsp70 inducible (PaHsp70) and cognate forms (PaHsc70) were cloned and sequenced. The abundance of mRNA transcripts for the inducible form (qPCR) and corresponding protein (Western blotting) were significantly up-regulated in response to high and low temperature stimuli. In the cognate form, mRNA was slightly up-regulated in response to both stressors but very low or no up-regulation of protein was apparent after heat- or cold-stress, respectively. Injection of 695 bp-long Pahsp70 dsRNA (RNAi) caused drastic suppression of the heat- and cold-stress-induced Pahsp70 mRNA response and the up-regulation of corresponding protein was practically eliminated. Our RNAi predictably prevented recovery from heat shock and, in addition, negatively influenced repair of chilling injuries caused by cold stress. Cold tolerance increased when the insects were first exposed to a mild heat shock, in order to trigger the up-regulation of PaHsp70, and subsequently exposed to cold stress. Conclusion Our results suggest that accumulation of PaHsp70 belongs to a complex cold tolerance adaptation in the insect Pyrrhocoris apterus. PMID:19229329

Developmental Changes in Anger Expression and Attention Focus: Learning to Wait

ERIC Educational Resources Information Center

Cole, Pamela M.; Tan, Patricia Z.; Hall, Sarah E.; Zhang, Yiyun; Crnic, Keith A.; Blair, Clancy B.; Li, Runze

2011-01-01

Being able to wait is an essential part of self-regulation. In the present study, the authors examined the developmental course of changes in the latency to and duration of target-waiting behaviors by following 65 boys and 55 girls from rural and semirural economically strained homes from ages 18 months to 48 months. Age-related changes in latency…

Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

PubMed

Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

2017-01-01

Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Regulation of priority carcinogens and reproductive or developmental toxicants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hooper, K.; LaDou, J.; Rosenbaum, J.S.

In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies suchmore » as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.« less

Regulation of priority carcinogens and reproductive or developmental toxicants.

PubMed

Hooper, K; LaDou, J; Rosenbaum, J S; Book, S A

1992-01-01

In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies such as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.

The Wheat NAC Transcription Factor TaNAC2L Is Regulated at the Transcriptional and Post-Translational Levels and Promotes Heat Stress Tolerance in Transgenic Arabidopsis.

PubMed

Guo, Weiwei; Zhang, Jinxia; Zhang, Ning; Xin, Mingming; Peng, Huiru; Hu, Zhaorong; Ni, Zhongfu; Du, Jinkun

2015-01-01

Heat stress poses a serious threat to global crop production. In efforts that aim to mitigate the adverse effects of heat stress on crops, a variety of genetic tools are being used to develop plants with improved thermotolerance. The characterization of important regulators of heat stress tolerance provides essential information for this aim. In this study, we examine the wheat (Triticum aestivum) NAC transcription factor gene TaNAC2L. High temperature induced TaNAC2L expression in wheat and overexpression of TaNAC2L in Arabidopsis thaliana enhanced acquired heat tolerance without causing obvious alterations in phenotype compared with wild type under normal conditions. TaNAC2L overexpression also activated the expression of heat-related genes in the transgenic Arabidopsis plants, suggesting that TaNAC2L may improve heat tolerance by regulating the expression of stress-responsive genes. Notably, TaNAC2L is also regulated at the post-translational level and might be degraded via a proteasome-mediated pathway. Thus, this wheat transcription factor may have potential uses in enhancing thermotolerance in crops.

EVALUATION OF DEVELOPMENTAL NEUROTOXICITY OF ORGANOTINS VIA DRINKING WATER IN RATS: MONOMETHYL TIN

EPA Science Inventory

Organotins such as monomethyltin (MMT) are widely used as heat stabilizers in PVC and CPVC piping. Because human exposure to organotins is widespread via drinking water and the health consequences unknown, organotins were listed on the US EPA Candidate Contaminant List. Particu...

Effects of the plant growth-promoting bacterium Burkholderia phytofirmans PsJN throughout the life cycle of Arabidopsis thaliana.

PubMed

Poupin, María Josefina; Timmermann, Tania; Vega, Andrea; Zuñiga, Ana; González, Bernardo

2013-01-01

Plant growth-promoting rhizobacteria (PGPR) induce positive effects in plants, such as increased growth or reduced stress susceptibility. The mechanisms behind PGPR/plant interaction are poorly understood, as most studies have described short-term responses on plants and only a few studies have analyzed plant molecular responses under PGPR colonization. Here, we studied the effects of the PGPR bacterial model Burkholderiaphytofirmans PsJN on the whole life cycle of Arabidopsis thaliana plants. We reported that at different plant developmental points, strain PsJN can be found in the rhizosphere and also colonizing their internal tissues. In early ontogeny, strain PsJN increased several growth parameters and accelerated growth rate of the plants. Also, an Arabidopsis transcriptome analysis revealed that 408 genes showed differential expression in PsJN-inoculated plants; some of these genes are involved in stress response and hormone pathways. Specifically, genes implicated in auxin and gibberellin pathways were induced. Quantitative transcriptional analyses of selected genes in different developmental stages revealed that the beginning of these changes could be evidenced early in development, especially among the down-regulated genes. The inoculation with heat-killed bacteria provoked a more severe transcriptional response in plants, but was not able to induce plant growth-promotion. Later in ontogeny, the growth rates of inoculated plants decreased with respect to the non-inoculated group and, interestingly, the inoculation accelerated the flowering time and the appearance of senescence signs in plants; these modifications correlate with the early up-regulation of flowering control genes. Then, we show that a single inoculation with a PGPR could affect the whole life cycle of a plant, accelerating its growth rate and shortening its vegetative period, both effects relevant for most crops. Thus, these findings provide novel and interesting aspects of these relevant biological interactions.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Cognitive Modeling and Self-Regulation of Learning in Instructional Settings

ERIC Educational Resources Information Center

White, Marie C.

2017-01-01

Self-regulation of cognition and behavior is an important aspect of student learning and academic performance in the 21st-century classroom. The purpose of the chapter is to present how an integrated framework of cyclical phases and developmental levels of self-regulated learning play a significant role in modeling and self-regulatory learning as…

Contextual Emotion-Regulation Therapy for Childhood Depression: Description and Pilot Testing of a New Intervention

ERIC Educational Resources Information Center

Kovacs, Maria; Sherrill, Joel; George, Charles J.; Pollock, Myrna; Tumuluru, Rameshwari V.; Ho, Vincent

2006-01-01

Objective: To pilot test the acceptability and efficacy of contextual emotion-regulation therapy (CERT), a new, developmentally appropriate intervention for childhood depression, which focuses on the self-regulation of dysphoria. Method: Two samples of convenience (n = 29, n = 2) served to verify some CERT constructs; it was then operationalized…

Developmental Consequences of Early Parenting Experiences: Self-Recognition and Self-Regulation in Three Cultural Communities

ERIC Educational Resources Information Center

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Krtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of…

Molecular regulation and physiological functions of a novel FaHsfA2c cloned from tall fescue conferring plant tolerance to heat stress.

PubMed

Wang, Xiuyun; Huang, Wanlu; Liu, Jun; Yang, Zhimin; Huang, Bingru

2017-02-01

Heat stress transcription factors (HSFs) compose a large gene family, and different members play differential roles in regulating plant responses to abiotic stress. The objectives of this study were to identify and characterize an A2-type HSF, FaHsfA2c, in a cool-season perennial grass tall fescue (Festuca arundinacea Schreb.) for its association with heat tolerance and to determine the underlying physiological functions and regulatory mechanisms of FaHsfA2c imparting plant tolerance to heat stress. FaHsfA2c was localized in nucleus and exhibited a rapid transcriptional increase in leaves and roots during early phase of heat stress. Ectopic expression of FaHsfA2c improved basal and acquired thermotolerance in wild-type Arabidopsis and also restored heat-sensitive deficiency of hsfa2 mutant. Overexpression of FaHsfA2c in tall fescue enhanced plant tolerance to heat by triggering transcriptional regulation of heat-protective gene expression, improving photosynthetic capacity and maintaining plant growth under heat stress. Our results indicated that FaHsfA2c acted as a positive regulator conferring thermotolerance improvement in Arabidopsis and tall fescue, and it could be potentially used as a candidate gene for genetic modification and molecular breeding to develop heat-tolerant cool-season grass species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Constellation crew exploration vehicle, or CEV, is being prepare

NASA Image and Video Library

2007-11-27

In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars.

48 CFR 2527.7002 - NSF patent policy.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NSF patent policy. 2527.7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL... Department of Commerce in all its funding agreements for the performance of experimental, developmental, or...

Champagne Heat Pump

NASA Technical Reports Server (NTRS)

Jones, Jack A.

2004-01-01

The term champagne heat pump denotes a developmental heat pump that exploits a cycle of absorption and desorption of carbon dioxide in an alcohol or other organic liquid. Whereas most heat pumps in common use in the United States are energized by mechanical compression, the champagne heat pump is energized by heating. The concept of heat pumps based on other absorption cycles energized by heat has been understood for years, but some of these heat pumps are outlawed in many areas because of the potential hazards posed by leakage of working fluids. For example, in the case of the water/ammonia cycle, there are potential hazards of toxicity and flammability. The organic-liquid/carbon dioxide absorption/desorption cycle of the champagne heat pump is similar to the water/ammonia cycle, but carbon dioxide is nontoxic and environmentally benign, and one can choose an alcohol or other organic liquid that is also relatively nontoxic and environmentally benign. Two candidate nonalcohol organic liquids are isobutyl acetate and amyl acetate. Although alcohols and many other organic liquids are flammable, they present little or no flammability hazard in the champagne heat pump because only the nonflammable carbon dioxide component of the refrigerant mixture is circulated to the evaporator and condenser heat exchangers, which are the only components of the heat pump in direct contact with air in habitable spaces.

Thermal Regulation of Heat Transfer Processes

DTIC Science & Technology

2014-10-02

determine the contrasts of thermophysical properties of composites and thin films , and various approaches to regulate heat transport processes. In the...nanofluids, 2) thermal regulation of optical properties in thin film , and 3) thermal regulation of phase transition for efficient steam generation...stress generated during the crystals growth forces CNTs to contact with each other and form a conductive percolation network. Hence the composite

Sucrose affects the developmental transition of rhizomes in Oryza longistaminata.

PubMed

Bessho-Uehara, Kanako; Nugroho, Jovano Erris; Kondo, Hirono; Angeles-Shim, Rosalyn B; Ashikari, Motoyuki

2018-05-08

Oryza longistaminata, the African wild rice, can propagate vegetatively through rhizomes. Rhizomes elongate horizontally underground as sink organs, however, they undergo a developmental transition that shifts their growth to the surface of the ground to become aerial stems. This particular stage is essential for the establishment of new ramets. While several determinants such as abiotic stimuli and plant hormones have been reported as key factors effecting developmental transition in aerial stem, the cause of this phenomenon in rhizome remains elusive. This study shows that depletion of nutrients, particularly sucrose, is the key stimulus that induces the developmental transition in rhizomes, as indicated by the gradient of sugars from the base to the tip of the rhizome. Sugar treatments revealed that sucrose specifically represses the developmental transition from rhizome to aerial stem by inhibiting the expression of sugar metabolism and hormone synthesis genes at the bending point. Sucrose depletion affected several factors contributing to the developmental transition of rhizome including signal transduction, transcriptional regulation and plant hormone balance.

Monitoring, metacognition, and executive function: elucidating the role of self-reflection in the development of self-regulation.

PubMed

Lyons, Kristen E; Zelazo, Philip David

2011-01-01

While an abundance of research has investigated the development of the automatic and controlled processes through which individuals control their thoughts, emotions, and actions, less research has emphasized the role of the self in self-regulation. This chapter synthesizes four literatures that have examined the mechanisms through which the individual acts in a managerial role, evaluating the current status of the system and initiating regulatory actions as necessary. Taken together, these literatures (on executive function, error monitoring, metacognition, and uncertainty monitoring) suggest that self-reflection plays a critical role in self-regulation, and that developmental improvements in self-reflection (via increasing levels of conscious awareness and enhanced calibration of monitoring systems) may serve as driving forces underlying developmental improvement (and temperamental individual differences) in children's ability to control their thoughts and actions.

Membrane-tethered transcription factors provide a connection between stress response and developmental pathways

PubMed Central

Slabaugh, Erin

2011-01-01

Membrane-tethered transcription factors (MTTFs) are proteins that are targeted to membranes and are capable of regulating gene expression. In this way, they are physically restrained from entering the nucleus and are innately dormant. Upon specific signal recognition cues, MTTFs are activated through cleavage by a protease that releases the transcription factor domain into the cytosol thus allowing it to translocate to the nucleus where it can regulate gene expression. MTTFs are classically thought to provide an advantage to an organism by allowing for rapid signal transduction in response to cellular and environmental stresses. However, recent findings suggest that MTTFs may not only act as a means to respond quickly to stress but also are able to regulate developmental pathways, illustrating a point of interaction between stress and development. PMID:21758012

Distinct Skeletal Muscle Gene Regulation from Active Contraction, Passive Vibration, and Whole Body Heat Stress in Humans.

PubMed

Petrie, Michael A; Kimball, Amy L; McHenry, Colleen L; Suneja, Manish; Yen, Chu-Ling; Sharma, Arpit; Shields, Richard K

2016-01-01

Skeletal muscle exercise regulates several important metabolic genes in humans. We know little about the effects of environmental stress (heat) and mechanical stress (vibration) on skeletal muscle. Passive mechanical stress or systemic heat stress are often used in combination with many active exercise programs. We designed a method to deliver a vibration stress and systemic heat stress to compare the effects with active skeletal muscle contraction. The purpose of this study is to examine whether active mechanical stress (muscle contraction), passive mechanical stress (vibration), or systemic whole body heat stress regulates key gene signatures associated with muscle metabolism, hypertrophy/atrophy, and inflammation/repair. Eleven subjects, six able-bodied and five with chronic spinal cord injury (SCI) participated in the study. The six able-bodied subjects sat in a heat stress chamber for 30 minutes. Five subjects with SCI received a single dose of limb-segment vibration or a dose of repetitive electrically induced muscle contractions. Three hours after the completion of each stress, we performed a muscle biopsy (vastus lateralis or soleus) to analyze mRNA gene expression. We discovered repetitive active muscle contractions up regulated metabolic transcription factors NR4A3 (12.45 fold), PGC-1α (5.46 fold), and ABRA (5.98 fold); and repressed MSTN (0.56 fold). Heat stress repressed PGC-1α (0.74 fold change; p < 0.05); while vibration induced FOXK2 (2.36 fold change; p < 0.05). Vibration similarly caused a down regulation of MSTN (0.74 fold change; p < 0.05), but to a lesser extent than active muscle contraction. Vibration induced FOXK2 (p < 0.05) while heat stress repressed PGC-1α (0.74 fold) and ANKRD1 genes (0.51 fold; p < 0.05). These findings support a distinct gene regulation in response to heat stress, vibration, and muscle contractions. Understanding these responses may assist in developing regenerative rehabilitation interventions to improve muscle cell development, growth, and repair.

Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity.

PubMed

Terenzi, Fulvia; Ladd, Andrea N

2010-01-01

Muscleblind-like (MBNL) proteins have been shown to regulate pre-mRNA alternative splicing, and MBNL1 has been implicated in regulating fetal-to-adult transitions in alternative splicing in the heart. MBNL1 is highly conserved, exhibiting more than 95% identity at the amino acid level between birds and mammals. To investigate MBNL1 expression during embryonic heart development, we examined MBNL1 transcript and protein expression in the embryonic chicken heart from the formation of the primitive heart tube through cardiac morphogenesis (embryonic days 1.5 through 8). MBNL1 transcript levels remained steady throughout these stages, whereas MBNL1 protein levels increased and exhibited a shift in isoforms. MBNL1 has several alternatively spliced exons. Using RT-PCR, we determined that the inclusion of one of these, exon 5, decreases dramatically during cardiac morphogenesis. This developmental transition is conserved in mice. Functional analyses of MBNL1 isoforms containing or lacking exon 5-encoded sequences revealed that exon 5 is important for the regulation of the subcellular localization, RNA binding affinity, and alternative splicing activity of MBNL1 proteins. A second MBNL protein, MBNL2, is also expressed in the embryonic heart. We found that MBNL2 exon 5, which is paralogous to MBNL1 exon 5, is similarly regulated during embryonic heart development. Analysis of MBNL1 and MBNL2 transcripts in several embryonic tissues in chicken and mouse indicate that exon 5 alternative splicing is highly conserved and tissue-specific. Thus, we propose that conserved developmental stage- and tissue-specific alternative splicing of MBNL transcripts is an important mechanism by which MBNL activity is regulated during embryonic development.

Rankine cycle waste heat recovery system

DOEpatents

Ernst, Timothy C.; Nelson, Christopher R.

2016-05-10

This disclosure relates to a waste heat recovery (WHR) system and to a system and method for regulation of a fluid inventory in a condenser and a receiver of a Rankine cycle WHR system. Such regulation includes the ability to regulate the pressure in a WHR system to control cavitation and energy conversion.

Rankine cycle waste heat recovery system

DOEpatents

Ernst, Timothy C.; Nelson, Christopher R.

2014-08-12

This disclosure relates to a waste heat recovery (WHR) system and to a system and method for regulation of a fluid inventory in a condenser and a receiver of a Rankine cycle WHR system. Such regulation includes the ability to regulate the pressure in a WHR system to control cavitation and energy conversion.

The bromodomain protein BRD4 regulates splicing during heat shock

PubMed Central

Hussong, Michelle; Kaehler, Christian; Kerick, Martin; Grimm, Christina; Franz, Alexandra; Timmermann, Bernd; Welzel, Franziska; Isensee, Jörg; Hucho, Tim; Krobitsch, Sylvia; Schweiger, Michal R.

2017-01-01

The cellular response to heat stress is an ancient and evolutionarily highly conserved defence mechanism characterised by the transcriptional up-regulation of cyto-protective genes and a partial inhibition of splicing. These features closely resemble the proteotoxic stress response during tumor development. The bromodomain protein BRD4 has been identified as an integral member of the oxidative stress as well as of the inflammatory response, mainly due to its role in the transcriptional regulation process. In addition, there are also several lines of evidence implicating BRD4 in the splicing process. Using RNA-sequencing we found a significant increase in splicing inhibition, in particular intron retentions (IR), following heat treatment in BRD4-depleted cells. This leads to a decrease of mRNA abundancy of the affected transcripts, most likely due to premature termination codons. Subsequent experiments revealed that BRD4 interacts with the heat shock factor 1 (HSF1) such that under heat stress BRD4 is recruited to nuclear stress bodies and non-coding SatIII RNA transcripts are up-regulated. These findings implicate BRD4 as an important regulator of splicing during heat stress. Our data which links BRD4 to the stress induced splicing process may provide novel mechanisms of BRD4 inhibitors in regard to anti-cancer therapies. PMID:27536004

RNAi screen in Drosophila larvae identifies histone deacetylase 3 as a positive regulator of the hsp70 heat shock gene expression during heat shock.

PubMed

Achary, Bhavana G; Campbell, Katie M; Co, Ivy S; Gilmour, David S

2014-05-01

The transcription regulation of the Drosophila hsp70 gene is a complex process that involves the regulation of multiple steps, including the establishment of paused Pol II and release of Pol II into elongation upon heat shock activation. While the major players involved in the regulation of gene expression have been studied in detail, additional factors involved in this process continue to be discovered. To identify factors involved in hsp70 expression, we developed a screen that capitalizes on a visual assessment of heat shock activation using a hsp70-beta galactosidase reporter and publicly available RNAi fly lines to deplete candidate proteins. We validated the screen by showing that the depletion of HSF, CycT, Cdk9, Nurf 301, or ELL prevented the full induction of hsp70 by heat shock. Our screen also identified the histone deacetylase HDAC3 and its associated protein SMRTER as positive regulators of hsp70 activation. Additionally, we show that HDAC3 and SMRTER contribute to hsp70 gene expression at a step subsequent to HSF-mediated activation and release of the paused Pol II that resides at the promoter prior to heat shock induction. Copyright © 2014 Elsevier B.V. All rights reserved.

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

The rpoE operon regulates heat stress response in Burkholderia pseudomallei.

PubMed

Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee

2008-07-01

Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.

Phase 1 of the First Solar Small Power System Experiment (experimental System No. 1). Volume 2: Appendix A - D

NASA Technical Reports Server (NTRS)

Clark, T. B. (Editor)

1979-01-01

Recommended conceptual designs for the baseline solar concentrator and electrical subsystems are defined, and trade offs that were evaluated to arrive at the baseline systems are presented. In addition, the developmental history of the Stirling engine is reviewed, the U4 configuration is described, and a Stirling engine heat pipe system is evaluated for solar application where sodium vapor is used as the heat source. An organic Rankine cycle engine is also evaluated for solar small power system application.

Development and testing of the Junkeeper Control Corporation integrated programmable electronic controller and hydronics package

NASA Technical Reports Server (NTRS)

Hankins, J. D.

1979-01-01

Additional developmental work on the existing programmable electronic controller and hydronic package for use with solar heating and cooling systems is summarized. The controller/hydronics subsystems passed all acceptance tests and performance criteria. The subsystems were shown marketable for public use.

PERINATAL DIMETHYLTIN EXPOSURE ALTERS SPATIAL LEARNING ABILITY IN ADULT RATS.

EPA Science Inventory

Dimethyltin (DMT) is widely used as a heat and light stabilizer in PVC and CPVC piping, and has been detected in domestic water supplies. Due to the lack of developmental neurotoxicity data on DMT, we initiated studies to evaluate long-term neurobehavioral changes in offspring fo...

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

PubMed Central

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

PubMed Central

Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

2015-01-01

Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

Thermal diodes, regulators, and switches: Physical mechanisms and potential applications

NASA Astrophysics Data System (ADS)

Wehmeyer, Geoff; Yabuki, Tomohide; Monachon, Christian; Wu, Junqiao; Dames, Chris

2017-12-01

Interest in new thermal diodes, regulators, and switches has been rapidly growing because these components have the potential for rich transport phenomena that cannot be achieved using traditional thermal resistors and capacitors. Each of these thermal components has a signature functionality: Thermal diodes can rectify heat currents, thermal regulators can maintain a desired temperature, and thermal switches can actively control the heat transfer. Here, we review the fundamental physical mechanisms of switchable and nonlinear heat transfer which have been harnessed to make thermal diodes, switches, and regulators. The review focuses on experimental demonstrations, mainly near room temperature, and spans the fields of heat conduction, convection, and radiation. We emphasize the changes in thermal properties across phase transitions and thermal switching using electric and magnetic fields. After surveying fundamental mechanisms, we present various nonlinear and active thermal circuits that are based on analogies with well-known electrical circuits, and analyze potential applications in solid-state refrigeration and waste heat scavenging.

Intranuclear DNA density affects chromosome condensation in metazoans

PubMed Central

Hara, Yuki; Iwabuchi, Mari; Ohsumi, Keita; Kimura, Akatsuki

2013-01-01

Chromosome condensation is critical for accurate inheritance of genetic information. The degree of condensation, which is reflected in the size of the condensed chromosomes during mitosis, is not constant. It is differentially regulated in embryonic and somatic cells. In addition to the developmentally programmed regulation of chromosome condensation, there may be adaptive regulation based on spatial parameters such as genomic length or cell size. We propose that chromosome condensation is affected by a spatial parameter called the chromosome amount per nuclear space, or “intranuclear DNA density.” Using Caenorhabditis elegans embryos, we show that condensed chromosome sizes vary during early embryogenesis. Of importance, changing DNA content to haploid or polyploid changes the condensed chromosome size, even at the same developmental stage. Condensed chromosome size correlates with interphase nuclear size. Finally, a reduction in nuclear size in a cell-free system from Xenopus laevis eggs resulted in reduced condensed chromosome sizes. These data support the hypothesis that intranuclear DNA density regulates chromosome condensation. This suggests an adaptive mode of chromosome condensation regulation in metazoans. PMID:23783035

29 CFR 1956.61 - Developmental Schedule.

Code of Federal Regulations, 2010 CFR

2010-07-01

... steps as provided in the plan: (a) Adopt standards identical to or at least as effective as all existing OSHA standards within one year after plan approval. (b) Adopt amendments to regulations regarding... 1908 within three years after plan approval. (f) Adopt amendments to regulations regarding...

Developmental Control of Cell-Cycle Compensation Provides a Switch for Patterned Mitosis at the Onset of Chordate Neurulation.

PubMed

Ogura, Yosuke; Sasakura, Yasunori

2016-04-18

During neurulation of chordate ascidians, the 11th mitotic division within the epidermal layer shows a posterior-to-anterior wave that is precisely coordinated with the unidirectional progression of the morphogenetic movement. Here we show that the first sign of this patterned mitosis is an asynchronous anterior-to-posterior S-phase length and that mitotic synchrony is reestablished by a compensatory asynchronous G2-phase length. Live imaging combined with genetic experiments demonstrated that compensatory G2-phase regulation requires transcriptional activation of the G2/M regulator cdc25 by the patterning genes GATA and AP-2. The downregulation of GATA and AP-2 at the onset of neurulation leads to loss of compensatory G2-phase regulation and promotes the transition to patterned mitosis. We propose that such developmentally regulated cell-cycle compensation provides an abrupt switch to spatially patterned mitosis in order to achieve the coordination between mitotic timing and morphogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Behavioral Assessment of Emotion Discrimination, Emotion Regulation, and Cognitive Control in Childhood, Adolescence, and Adulthood

PubMed Central

Tottenham, Nim; Hare, Todd A.; Casey, B. J.

2011-01-01

Emotion discrimination, emotion regulation, and cognitive control are three related, yet separable processes that emerge over the course of development. The current study tested 100 children, adolescents, and adults on an Emotional Go/Nogo task, illustrating the ability of this paradigm to identify the unique developmental patterns for each of these three processes in the context of both positive (happy) and negative emotions (fear, sad, and anger), across three different age groups. Consistent with previous literature, our findings show that emotion discrimination and regulatory abilities (both cognitive control and emotion regulation) improve steadily for each age group, with each age group showing unique patterns of performance. The findings suggest that emotion regulation is constructed from basic cognition control and emotion discrimination skills. The patterns of behavior from the Emotional Go/Nogo task provide normative benchmark data across a wide range of emotions that can be used for future behavioral and neuroimaging studies that examine the developmental construction of emotion regulatory processes. PMID:21716604

Cell identity regulators link development and stress responses in the Arabidopsis root.

PubMed

Iyer-Pascuzzi, Anjali S; Jackson, Terry; Cui, Hongchang; Petricka, Jalean J; Busch, Wolfgang; Tsukagoshi, Hironaka; Benfey, Philip N

2011-10-18

Stress responses in plants are tightly coordinated with developmental processes, but interaction of these pathways is poorly understood. We used genome-wide assays at high spatiotemporal resolution to understand the processes that link development and stress in the Arabidopsis root. Our meta-analysis finds little evidence for a universal stress response. However, common stress responses appear to exist with many showing cell type specificity. Common stress responses may be mediated by cell identity regulators because mutations in these genes resulted in altered responses to stress. Evidence for a direct role for cell identity regulators came from genome-wide binding profiling of the key regulator SCARECROW, which showed binding to regulatory regions of stress-responsive genes. Coexpression in response to stress was used to identify genes involved in specific developmental processes. These results reveal surprising linkages between stress and development at cellular resolution, and show the power of multiple genome-wide data sets to elucidate biological processes. Copyright © 2011 Elsevier Inc. All rights reserved.

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

Developmental toxicity evaluation of unleaded gasoline vapor in the rat.

PubMed

Roberts, L; White, R; Bui, Q; Daughtrey, W; Koschier, F; Rodney, S; Schreiner, C; Steup, D; Breglia, R; Rhoden, R; Schroeder, R; Newton, P

2001-01-01

To evaluate the potential of unleaded gasoline vapor for developmental toxicity, a sample was prepared by slowly heating API 94-02 (1990 industry average gasoline) and condensing the vapor. The composition of this vapor condensate, which comprises 10.4% by volume of the starting gasoline, is representative of real-world exposure to gasoline vapor encountered at service stations and other occupational settings and consists primarily of volatile short chain (C4-C6) aliphatic hydrocarbons (i.e. paraffins) with small amounts of cycloparaffins and aromatic hydrocarbons. A preliminary study in rats and mice resulted in no developmental toxicity in either species. However, a slight reduction in maternal body weight gain in rats led to the selection of rats for this guideline study. Groups of pregnant rats (n = 24/group) were exposed to unleaded gasoline vapor at concentrations of 0, 1000, 3000, or 9000 (75% lower explosive limit) ppm equivalent to 0, 2653, 7960, or 23,900 mg/m3, for 6 h/day on gestation days 6-19. All rats were sacrificed on gestation day 20. No maternal toxicity was observed. Developmentally, there were no differences between treated and control groups in malformations, total variations, resorptions, fetal body weight, or viability. The maternal and developmental NOAEL is 9000 ppm. Under conditions of this study, unleaded gasoline vapors did not produce evidence of developmental toxicity.

Addition of insulin-like growth factor I to the maturation medium of bovine oocytes subjected to heat shock: effects on the production of reactive oxygen species, mitochondrial activity and oocyte competence.

PubMed

Ascari, I J; Alves, N G; Jasmin, J; Lima, R R; Quintão, C C R; Oberlender, G; Moraes, E A; Camargo, L S A

2017-07-01

This study was performed to investigate the effects of insulin-like growth factor-I (IGF-I) addition to in vitro maturation (IVM) medium on apoptosis, mitochondrial membrane potential, ROS production, and developmental competence of bovine oocytes subjected to heat shock. Two temperatures (conventional: 24 h at 38.5°C, or heat shock: 12 h at 41°C followed by 12 h at 38.5°C) and 3 IGF-I concentrations (0, 25, and 100 ng/mL) were tested during IVM. The oocytes were then fertilized in vitro, and the presumptive zygotes were cultured until reaching the blastocyst stage. There was no interaction between temperature and IGF-I concentration for any variable evaluated (P > 0.05). The addition of IGF-I did not alter the proportion of nuclear maturation, TUNEL-positive oocytes and caspase-3 activity, or blastocyst proportion on Days 7 and 8 post-fertilization. Furthermore, the total number of cells and the number of cells in the inner cell mass (ICM) in the blastocyst were not altered (P > 0.05). However, IGF-I increased (P < 0.05) the mitochondrial membrane potential and the production of ROS in oocytes and decreased (P < 0.05) the proportion of apoptotic cells in the ICM in blastocysts. Heat shock increased (P < 0.05) the proportion of TUNEL-positive oocytes and ROS production and reduced (P < 0.05) the mitochondrial membrane potential. Moreover, heat shock increased (P < 0.05) the apoptosis proportion in the ICM cells. In conclusion, supplementing IVM medium with IGF-I may increase the mitochondrial membrane potential and ROS production in oocytes and decrease apoptosis in the ICM in blastocysts. Heat shock for 12 h compromised oocyte developmental competence and increased apoptosis within the ICM cells of the blastocysts. Copyright © 2017 Elsevier Inc. All rights reserved.

Emotional Self-Regulation, Peer Rejection, and Antisocial Behavior: Developmental Associations from Early Childhood to Early Adolescence

ERIC Educational Resources Information Center

Trentacosta, Christopher J.; Shaw, Daniel S.

2009-01-01

This study examined relations among emotional self-regulation, peer rejection, and antisocial behavior in a sample of 122 boys from low-income families who participated in a summer camp and were followed longitudinally from early childhood to early adolescence. Emotional self-regulation strategies were coded in early childhood from a waiting task,…

Dynamics of DNA methylomes underlie oyster development

PubMed Central

Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

2017-01-01

DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes. PMID:28594821

Dynamics of DNA methylomes underlie oyster development.

PubMed

Riviere, Guillaume; He, Yan; Tecchio, Samuele; Crowell, Elizabeth; Gras, Michaël; Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

2017-06-01

DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes.

Distinct emotion regulation skills explain psychopathology and problems in social relationships following childhood emotional abuse and neglect.

PubMed

Berzenski, Sara R

2018-03-22

Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.

Effects of heat stress on mammalian reproduction

PubMed Central

Hansen, Peter J.

2009-01-01

Heat stress can have large effects on most aspects of reproductive function in mammals. These include disruptions in spermatogenesis and oocyte development, oocyte maturation, early embryonic development, foetal and placental growth and lactation. These deleterious effects of heat stress are the result of either the hyperthermia associated with heat stress or the physiological adjustments made by the heat-stressed animal to regulate body temperature. Many effects of elevated temperature on gametes and the early embryo involve increased production of reactive oxygen species. Genetic adaptation to heat stress is possible both with respect to regulation of body temperature and cellular resistance to elevated temperature. PMID:19833646

Investigation of the spatial structure and developmental dynamics of near-Earth plasma perturbations under the action of powerful HF radio waves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belov, A. S., E-mail: alexis-belov@yandex.ru

2015-10-15

Results of numerical simulations of the near-Earth plasma perturbations induced by powerful HF radio waves from the SURA heating facility are presented. The simulations were performed using a modified version of the SAMI2 ionospheric model for the input parameters corresponding to the series of in-situ SURA–DEMETER experiments. The spatial structure and developmental dynamics of large-scale plasma temperature and density perturbations have been investigated. The characteristic formation and relaxation times of the induced large-scale plasma perturbations at the altitudes of the Earth’s outer ionosphere have been determined.

BAG3 affects the nucleocytoplasmic shuttling of HSF1 upon heat stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Young-Hee; Ahn, Sang-Gun; Kim, Soo-A., E-mail: ksooa@dongguk.ac.kr

2015-08-21

Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a novel role for BAG3 in regulating the nuclear shuttling of HSF1 during heat stress. The expression level of BAG3 was induced by heat stress in HeLa cells. Interestingly, BAG3 rapidly translocalized to the nucleus upon heat stress. Immunoprecipitation assay showed that BAG3 interacts with HSF1 under normal and stressed conditions and co-translocalizes to the nucleus upon heat stress. We alsomore » demonstrated that BAG3 interacts with HSF1 via its BAG domain. Over-expression of BAG3 down-regulates the level of nuclear HSF1 by exporting it to the cytoplasm during the recovery period. Depletion of BAG3 using siRNA results in reduced nuclear HSF1 and decreased Hsp70 promoter activity. BAG3 in MEF(hsf1{sup −/−}) cells actively translocalizes to the nucleus upon heat stress suggesting that BAG3 plays a key role in the processing of the nucleocytoplasmic shuttling of HSF1 upon heat stress. - Highlights: • The expression level of BAG3 is induced by heat stress. • BAG3 translocates to the nucleus upon heat stress. • BAG3 interacts with HSF1 and co-localizes to the nucleus. • BAG3 is a key regulator for HSF1 nuclear shuttling.« less

Susceptibility of Plodia interpunctella (Lepidoptera: Pyralidae) developmental stages to high temperatures used during structural heat treatments.

PubMed

Mahroof, R; Subramanyam, B

2006-12-01

Heating the ambient air of a whole, or a portion of a food-processing facility to 50 to 60 degrees C and maintaining these elevated temperatures for 24 to 36 h, is an old technology, referred to as heat treatment. There is renewed interest in adopting heat treatments around the world as a viable insect control alternative to fumigation with methyl bromide. There is limited published information on responses of the Indian meal moth, Plodia interpunctella (Hübner), exposed to elevated temperatures typically used during heat treatments. Time-mortality relationships were determined for eggs, fifth-instars (wandering-phase larvae), pupae, and adults of P. interpunctella exposed to five constant temperatures between 44 and 52 degrees C. Mortality of each stage increased with increasing temperature and exposure time. In general, fifth-instars were the most heat-tolerant stage at all temperatures tested. Exposure for a minimum of 34 min at 50 degrees C was required to kill 99% of the fifth-instars. It is proposed that heat treatments aimed at controlling fifth-instars should be able to control all other stages of P. interpunctella.

Early developmental gene regulation in Strongylocentrotus purpuratus embryos in response to elevated CO₂ seawater conditions.

PubMed

Hammond, LaTisha M; Hofmann, Gretchen E

2012-07-15

Ocean acidification, or the increased uptake of CO(2) by the ocean due to elevated atmospheric CO(2) concentrations, may variably impact marine early life history stages, as they may be especially susceptible to changes in ocean chemistry. Investigating the regulatory mechanisms of early development in an environmental context, or ecological development, will contribute to increased understanding of potential organismal responses to such rapid, large-scale environmental changes. We examined transcript-level responses to elevated seawater CO(2) during gastrulation and the initiation of spiculogenesis, two crucial developmental processes in the purple sea urchin, Strongylocentrotus purpuratus. Embryos were reared at the current, accepted oceanic CO(2) concentration of 380 microatmospheres (μatm), and at the elevated levels of 1000 and 1350 μatm, simulating predictions for oceans and upwelling regions, respectively. The seven genes of interest comprised a subset of pathways in the primary mesenchyme cell gene regulatory network (PMC GRN) shown to be necessary for the regulation and execution of gastrulation and spiculogenesis. Of the seven genes, qPCR analysis indicated that elevated CO(2) concentrations only had a significant but subtle effect on two genes, one important for early embryo patterning, Wnt8, and the other an integral component in spiculogenesis and biomineralization, SM30b. Protein levels of another spicule matrix component, SM50, demonstrated significant variable responses to elevated CO(2). These data link the regulation of crucial early developmental processes with the environment that these embryos would be developing within, situating the study of organismal responses to ocean acidification in a developmental context.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Hormonal interactions and gene regulation can link monoecy and environmental plasticity to the evolution of dioecy in plants.

PubMed

Golenberg, Edward M; West, Nicholas W

2013-06-01

Most models for dioecy in flowering plants assume that dioecy arises directly from hermaphroditism through a series of independent feminizing and masculinizing mutations that become chromosomally linked. However, dioecy appears to evolve most frequently through monoecious grades. The major genetic models do not explain the evolution of unisexual flowers in monoecious and submonoecious populations, nor do they account for environmentally induced sexual plasticity. In this review, we explore the roles of environmental stress and hormones on sex determination, and propose a model that can explain the evolution of dioecy through monoecy, and the mechanisms of environmental sex determination. Environmental stresses elicit hormones that allow plants to mediate the negative effects of the stresses. Many of these same hormones are involved in the regulation of floral developmental genes. Recent studies have elucidated the mechanisms whereby these hormones interact and can act as switchpoints in regulatory pathways. Consequently, differential concentrations of plant hormones can regulate whole developmental pathways, providing a mechanism for differential development within isogenic individuals such as seen in monoecious plants. Sex-determining genes in such systems will evolve to generate clusters of coexpressed suites. Coexpression rather than coinheritance of gender-specific genes will define the sexual developmental fate. Therefore, selection for gender type will drive evolution of the regulatory sequences of such genes rather than their synteny. Subsequent mutations to hyper- or hyposensitive alleles within the hormone response pathway can result in segregating dioecious populations. Simultaneously, such developmental systems will remain sensitive to external stimuli that modify hormone responses.

A Developmental Neuroscience of Borderline Pathology: Emotion Dysregulation and Social Baseline Theory

ERIC Educational Resources Information Center

Hughes, Amy E.; Crowell, Sheila E.; Uyeji, Lauren; Coan, James A.

2012-01-01

Theoretical and empirical research has linked poor emotion regulation abilities with dysfunctional frontolimbic circuitry. Consistent with this, research on borderline personality disorder (BPD) finds that frontolimbic dysfunction is a predominant neural substrate underlying the disorder. Emotion regulation is profoundly compromised in BPD.…

75 FR 56115 - Center for Scientific Review; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-15

... Processes Integrated Review Group, Biobehavioral Regulation, Learning and Ethology Study Section. Date..., Biobehavioral Regulation, Learning and Ethology. Date: October 8, 2010. Time: 9 a.m. to 10 a.m. Agenda: To..., Cellular and Developmental Neuroscience Integrated Review Group, Biophysics of Neural Systems Study Section...

Developmental programming of energy balance regulation: Is physical activity more "programmable" than food intake

USDA-ARS?s Scientific Manuscript database

Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mecha...

A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

PubMed

Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

2015-12-01

A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

A DNA damage checkpoint pathway coordinates the division of dikaryotic cells in the ink cap mushroom Coprinopsis cinerea.

PubMed

de Sena-Tomás, Carmen; Navarro-González, Mónica; Kües, Ursula; Pérez-Martín, José

2013-09-01

The fungal fruiting body or mushroom is a multicellular structure essential for sexual reproduction. It is composed of dikaryotic cells that contain one haploid nucleus from each mating partner sharing the same cytoplasm without undergoing nuclear fusion. In the mushroom, the pileus bears the hymenium, a layer of cells that includes the specialized basidia in which nuclear fusion, meiosis, and sporulation occur. Coprinopsis cinerea is a well-known model fungus used to study developmental processes associated with the formation of the fruiting body. Here we describe that knocking down the expression of Atr1 and Chk1, two kinases shown to be involved in the response to DNA damage in a number of eukaryotic organisms, dramatically impairs the ability to develop fruiting bodies in C. cinerea, as well as other developmental decisions such as sclerotia formation. These developmental defects correlated with the impairment in silenced strains to sustain an appropriated dikaryotic cell cycle. Dikaryotic cells in which chk1 or atr1 genes were silenced displayed a higher level of asynchronous mitosis and as a consequence aberrant cells carrying an unbalanced dose of nuclei. Since fruiting body initiation is dependent on the balanced mating-type regulator doses present in the dikaryon, we believe that the observed developmental defects were a consequence of the impaired cell cycle in the dikaryon. Our results suggest a connection between the DNA damage response cascade, cell cycle regulation, and developmental processes in this fungus.

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

Heat shock instructs hESCs to exit from the self-renewal program through negative regulation of OCT4 by SAPK/JNK and HSF1 pathway.

PubMed

Byun, Kyunghee; Kim, Taek-Kyun; Oh, Jeehyun; Bayarsaikhan, Enkhjargal; Kim, Daesik; Lee, Min Young; Pack, Chan-Gi; Hwang, Daehee; Lee, Bonghee

2013-11-01

Environmental factors affect self-renewal of stem cells by modulating the components of self-renewal networks. Heat shock, an environmental factor, induces heat shock factors (HSFs), which up-regulate stress response-related genes. However, the link of heat shock to self-renewal of stem cells has not been elucidated yet. Here, we present the direct link of heat shock to a core stem cell regulator, OCT4, in the self-renewal network through SAPK/JNK and HSF1 pathway. We first showed that heat shock initiated differentiation of human embryonic stem cells (hESCs). Gene expression analysis revealed that heat shock increased the expression of many genes involved in cellular processes related to differentiation of stem cells. We then examined the effects of HSFs induced by heat shock on core self-renewal factors. Among HSFs, heat shock induced mainly HSF1 in hESCs. The HSF1 repressed the expression of OCT4, leading to the differentiation of hESCs and the above differentiation-related gene expression change. We further examined the effects of the upstream MAP (mitogen-activated protein) kinases of HSF1 on the repression of OCT4 expression by HSF1. Among the MAP kinases, SAPK/JNK controlled predominantly the repression of the OCT4 expression by HSF1. The direct link of heat shock to the core self-renewal regulator through SAPK/JNK and HSF1 provides a fundamental basis for understanding the effect of heat and other stresses involving activation of HSF1 on the self-renewal program and further controlling differentiation of hESCs in a broad spectrum of stem cell applications using these stresses. © 2013.

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b overexpression enhances water productivity, resistance to drought, and infection

PubMed Central

Richard, François; Bowden, Laura; Morison, James I.L.; Mullineaux, Philip M.

2013-01-01

Heat-stressed crops suffer dehydration, depressed growth, and a consequent decline in water productivity, which is the yield of harvestable product as a function of lifetime water consumption and is a trait associated with plant growth and development. Heat shock transcription factor (HSF) genes have been implicated not only in thermotolerance but also in plant growth and development, and therefore could influence water productivity. Here it is demonstrated that Arabidopsis thaliana plants with increased HSFA1b expression showed increased water productivity and harvest index under water-replete and water-limiting conditions. In non-stressed HSFA1b-overexpressing (HSFA1bOx) plants, 509 genes showed altered expression, and these genes were not over-represented for development-associated genes but were for response to biotic stress. This confirmed an additional role for HSFA1b in maintaining basal disease resistance, which was stress hormone independent but involved H2O2 signalling. Fifty-five of the 509 genes harbour a variant of the heat shock element (HSE) in their promoters, here named HSE1b. Chromatin immunoprecipitation-PCR confirmed binding of HSFA1b to HSE1b in vivo, including in seven transcription factor genes. One of these is MULTIPROTEIN BRIDGING FACTOR1c (MBF1c). Plants overexpressing MBF1c showed enhanced basal resistance but not water productivity, thus partially phenocopying HSFA1bOx plants. A comparison of genes responsive to HSFA1b and MBF1c overexpression revealed a common group, none of which harbours a HSE1b motif. From this example, it is suggested that HSFA1b directly regulates 55 HSE1b-containing genes, which control the remaining 454 genes, collectively accounting for the stress defence and developmental phenotypes of HSFA1bOx. PMID:23828547

Modeling activity and target-dependent developmental cell death of mouse retinal ganglion cells ex vivo.

PubMed

Voyatzis, Sylvie; Muzerelle, Aude; Gaspar, Patricia; Nicol, Xavier

2012-01-01

Programmed cell death is widespread during the development of the central nervous system and serves multiple purposes including the establishment of neural connections. In the mouse retina a substantial reduction of retinal ganglion cells (RGCs) occurs during the first postnatal week, coinciding with the formation of retinotopic maps in the superior colliculus (SC). We previously established a retino-collicular culture preparation which recapitulates the progressive topographic ordering of RGC projections during early post-natal life. Here, we questioned whether this model could also be suitable to examine the mechanisms underlying developmental cell death of RGCs. Brn3a was used as a marker of the RGCs. A developmental decline in the number of Brn3a-immunolabelled neurons was found in the retinal explant with a timing that paralleled that observed in vivo. In contrast, the density of photoreceptors or of starburst amacrine cells increased, mimicking the evolution of these cell populations in vivo. Blockade of neural activity with tetrodotoxin increased the number of surviving Brn3a-labelled neurons in the retinal explant, as did the increase in target availability when one retinal explant was confronted with 2 or 4 collicular slices. Thus, this ex vivo model reproduces the developmental reduction of RGCs and recapitulates its regulation by neural activity and target availability. It therefore offers a simple way to analyze developmental cell death in this classic system. Using this model, we show that ephrin-A signaling does not participate to the regulation of the Brn3a population size in the retina, indicating that eprhin-A-mediated elimination of exuberant projections does not involve developmental cell death.

Activation of catalase activity by a peroxisome-localized small heat shock protein Hsp17.6CII.

PubMed

Li, Guannan; Li, Jing; Hao, Rong; Guo, Yan

2017-08-20

Plant catalases are important antioxidant enzymes and are indispensable for plant to cope with adverse environmental stresses. However, little is known how catalase activity is regulated especially at an organelle level. In this study, we identified that small heat shock protein Hsp17.6CII (AT5G12020) interacts with and activates catalases in the peroxisome of Arabidopsis thaliana. Although Hsp17.6CII is classified into the cytosol-located small heat shock protein subfamily, we found that Hsp17.6CII is located in the peroxisome. Moreover, Hsp17.6CII contains a novel non-canonical peroxisome targeting signal 1 (PTS1), QKL, 16 amino acids upstream from the C-terminus. The QKL signal peptide can partially locate GFP to peroxisome, and mutations in the tripeptide lead to the abolishment of this activity. In vitro catalase activity assay and holdase activity assay showed that Hsp17.6CII increases CAT2 activity and prevents it from thermal aggregation. These results indicate that Hsp17.6CII is a peroxisome-localized catalase chaperone. Overexpression of Hsp17.6CII conferred enhanced catalase activity and tolerance to abiotic stresses in Arabidopsis. Interestingly, overexpression of Hsp17.6CII in catalase-deficient mutants, nca1-3 and cat2 cat3, failed to rescue their stress-sensitive phenotypes and catalase activity, suggesting that Hsp17.6CII-mediated stress response is dependent on NCA1 and catalase activity. Overall, we identified a novel peroxisome-located catalase chaperone that is involved in plant abiotic stress resistance by activating catalase activity. Copyright © 2017 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

PubMed

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

PubMed Central

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

Paradigm shift in consciousness research: the child's self-awareness and abnormalities in autism, ADHD and schizophrenia.

PubMed

Lou, Hans C

2012-02-01

Self-awareness is a pivotal component of any conscious experience and conscious self-regulation of behaviour. A paralimbic network is active, specific and causal in self-awareness. Its regions interact by gamma synchrony. Gamma synchrony develops throughout infancy, childhood and adolescence into adulthood and is regulated by dopamine and other neurotransmitters via GABA interneurons. Major derailments of this network and self-awareness occur in developmental disorders of conscious self-regulation like autism, attention deficit hyperactivity disorder (ADHD) and schizophrenia. Recent research on conscious experience is no longer limited to the study of neural 'correlations' but is increasingly lending itself to the study of causality. This paradigm shift opens new perspectives for understanding the neural mechanisms of the developing self and the causal effects of their disturbance in developmental disorders. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

Zinc and Zinc Transporters: Novel Regulators of Ventricular Myocardial Development.

PubMed

Lin, Wen; Li, Deqiang

2018-06-01

Ventricular myocardial development is a well-orchestrated process involving different cardiac structures, multiple signal pathways, and myriad proteins. Dysregulation of this important developmental event can result in cardiomyopathies, such as left ventricle non-compaction, which affect the pediatric population and the adults. Human and mouse studies have shed light upon the etiology of some cardiomyopathy cases and highlighted the contribution of both genetic and environmental factors. However, the regulation of ventricular myocardial development remains incompletely understood. Zinc is an essential trace metal with structural, enzymatic, and signaling function. Perturbation of zinc homeostasis has resulted in developmental and physiological defects including cardiomyopathy. In this review, we summarize several mechanisms by which zinc and zinc transporters can impact the regulation of ventricular myocardial development. Based on our review, we propose that zinc deficiency and mutations of zinc transporters may underlie some cardiomyopathy cases especially those involving ventricular myocardial development defects.

Plant hormone signaling lightens up: integrators of light and hormones.

PubMed

Lau, On Sun; Deng, Xing Wang

2010-10-01

Light is an important environmental signal that regulates diverse growth and developmental processes in plants. In these light-regulated processes, multiple hormonal pathways are often modulated by light to mediate the developmental changes. Conversely, hormone levels in plants also serve as endogenous cues in influencing light responsiveness. Although interactions between light and hormone signaling pathways have long been observed, recent studies have advanced our understanding by identifying signaling integrators that connect the pathways. These integrators, namely PHYTOCHROME-INTERACTING FACTOR 3 (PIF3), PIF4, PIF3-LIKE 5 (PIL5)/PIF1 and LONG HYPOCOTYL 5 (HY5), are key light signaling components and they link light signals to the signaling of phytohormones, such as gibberellin (GA), abscisic acid (ABA), auxin and cytokinin, in regulating seedling photomorphogenesis and seed germination. This review focuses on these integrators in illustrating how light and hormone interact. Copyright © 2010 Elsevier Ltd. All rights reserved.

The bromodomain protein BRD4 regulates splicing during heat shock.

PubMed

Hussong, Michelle; Kaehler, Christian; Kerick, Martin; Grimm, Christina; Franz, Alexandra; Timmermann, Bernd; Welzel, Franziska; Isensee, Jörg; Hucho, Tim; Krobitsch, Sylvia; Schweiger, Michal R

2017-01-09

The cellular response to heat stress is an ancient and evolutionarily highly conserved defence mechanism characterised by the transcriptional up-regulation of cyto-protective genes and a partial inhibition of splicing. These features closely resemble the proteotoxic stress response during tumor development. The bromodomain protein BRD4 has been identified as an integral member of the oxidative stress as well as of the inflammatory response, mainly due to its role in the transcriptional regulation process. In addition, there are also several lines of evidence implicating BRD4 in the splicing process. Using RNA-sequencing we found a significant increase in splicing inhibition, in particular intron retentions (IR), following heat treatment in BRD4-depleted cells. This leads to a decrease of mRNA abundancy of the affected transcripts, most likely due to premature termination codons. Subsequent experiments revealed that BRD4 interacts with the heat shock factor 1 (HSF1) such that under heat stress BRD4 is recruited to nuclear stress bodies and non-coding SatIII RNA transcripts are up-regulated. These findings implicate BRD4 as an important regulator of splicing during heat stress. Our data which links BRD4 to the stress induced splicing process may provide novel mechanisms of BRD4 inhibitors in regard to anti-cancer therapies. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Drosophila Protein Kinase CK2: Genetics, Regulatory Complexity and Emerging Roles during Development

PubMed Central

Bandyopadhyay, Mohna; Arbet, Scott; Bishop, Clifton P.; Bidwai, Ashok P.

2016-01-01

CK2 is a Ser/Thr protein kinase that is highly conserved amongst all eukaryotes. It is a well-known oncogenic kinase that regulates vital cell autonomous functions and animal development. Genetic studies in the fruit fly Drosophila are providing unique insights into the roles of CK2 in cell signaling, embryogenesis, organogenesis, neurogenesis, and the circadian clock, and are revealing hitherto unknown complexities in CK2 functions and regulation. Here, we review Drosophila CK2 with respect to its structure, subunit diversity, potential mechanisms of regulation, developmental abnormalities linked to mutations in the gene encoding CK2 subunits, and emerging roles in multiple aspects of eye development. We examine the Drosophila CK2 “interaction map” and the eye-specific “transcriptome” databases, which raise the prospect that this protein kinase has many additional targets in the developing eye. We discuss the possibility that CK2 functions during early retinal neurogenesis in Drosophila and mammals bear greater similarity than has been recognized, and that this conservation may extend to other developmental programs. Together, these studies underscore the immense power of the Drosophila model organism to provide new insights and avenues to further investigate developmentally relevant targets of this protein kinase. PMID:28036067

Social Crowding during Development Causes Changes in GnRH1 DNA Methylation.

PubMed

Alvarado, Sebastian G; Lenkov, Kapa; Williams, Blake; Fernald, Russell D

2015-01-01

Gestational and developmental cues have important consequences for long-term health, behavior and adaptation to the environment. In addition, social stressors cause plastic molecular changes in the brain that underlie unique behavioral phenotypes that also modulate fitness. In the adult African cichlid, Astatotilapia burtoni, growth and social status of males are both directly regulated by social interactions in a dynamic social environment, which causes a suite of plastic changes in circuits, cells and gene transcription in the brain. We hypothesized that a possible mechanism underlying some molecular changes might be DNA methylation, a reversible modification made to cytosine nucleotides that is known to regulate gene function. Here we asked whether changes in DNA methylation of the GnRH1 gene, the central regulator of the reproductive axis, were altered during development of A. burtoni. We measured changes in methylation state of the GnRH1 gene during normal development and following the gestational and developmental stress of social crowding. We found differential DNA methylation within developing juveniles between 14-, 28- and 42-day-old. Following gestational crowding of mouth brooding mothers, we saw differential methylation and transcription of GnRH1 in their offspring. Taken together, our data provides evidence for social control of GnRH1 developmental responses to gestational cues through DNA methylation.

Mindfulness training for adolescents: A neurodevelopmental perspective on investigating modifications in attention and emotion regulation using event-related brain potentials.

PubMed

Sanger, Kevanne Louise; Dorjee, Dusana

2015-09-01

Mindfulness training is increasingly being introduced in schools, yet studies examining its impact on the developing brain have been scarce. A neurodevelopmental perspective on mindfulness has been advocated as a powerful tool to enhance our understanding of underlying neurocognitive changes that have implications for developmental well-being research and the implementation of mindfulness in education. To stimulate more research in the developmental cognitive neuroscience of mindfulness, this article outlines possible indexes of mindfulness-based change in adolescence, with a focus on event-related brain potential (ERP) markers. We provide methodological recommendations for future studies and offer examples of research paradigms. We also discuss how mindfulness practice could impact on the development of prefrontal brain structures and enhance attention control and emotion regulation skills in adolescents, impacting in turn on their self-regulation and coping skills. We highlight advantages of the ERP methodology in neurodevelopmental research of mindfulness. It is proposed that research using established experimental tasks targeting ERP components such as the contingent negative variability, N200, error-related negativity and error positivity, P300, and late positive potential could elucidate developmentally salient shifts in the neural plasticity of the adolescent brain induced by mindfulness practice.

Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower.

PubMed

Silva, Catarina S; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

2015-01-01

Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These "developmental control genes" and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction - LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower.

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Somatoform Pain: A developmental theory and translational research review

PubMed Central

Landa, Alla; Peterson, Bradley S.; Fallon, Brian A.

2013-01-01

Somatoform pain is a highly prevalent, debilitating condition and a tremendous public health problem. Effective treatments for somatoform pain are urgently needed. The etiology of this condition is, however, still unknown. On the basis of a review of recent basic and clinical research, we propose one potential mechanisms of symptom formation in somatoform pain and a developmental theory of its pathogenesis. The emerging evidence from animal and human studies in developmental neurobiology, cognitive-affective neuroscience, psychoneuroimmunology, genetics, epigenetics, and clinical and treatment studies of somatoform pain all point to the existence of a shared physical and social pain neural system. Research findings also show that non-optimal early experiences interact with genetic predispositions to influence the development of this shared system and ability to regulate it in an effective way. Interpersonal affect regulation between infant and caregiver is crucial for the optimal development of these brain circuits. The aberrant development of this shared neural system during infancy, childhood and adolescence, therefore, may ultimately lead to an increased sensitivity to physical and social pain and to problems with their regulation in adulthood. The authors critically review translational research findings that support this theory and discuss its clinical and research implications. Specifically, the proposed theory and reviewed research suggest that psychotherapeutic and/or pharmacologic interventions that foster the development of affect regulation capacities in an interpersonal context will also serve to more effectively modulate aberrantly activated neural pain circuits and thus be of particular benefit in the treatment of somatoform pain. PMID:22929064

Flexible Goal Adjustment from Late Childhood to Late Adolescence: Developmental Differences and Relations to Cognitive Coping and Emotion Regulation

ERIC Educational Resources Information Center

Thomsen, Tamara

2016-01-01

One way to avert negative influences on well-being when confronted with blocked goals is the flexible adjustment of one's goals to the given situation. This study examines developmental differences in flexible goal adjustment (FGA) regarding age and gender in a sample of N = 815 participants (10 to 20 years; M = 13.63, SD = 2.60, 48.5% male).…

Effects of environmental disturbance on phenotypic variation: an integrated assessment of canalization, developmental stability, modularity, and allometry in lizard head shape.

PubMed

Lazić, Marko M; Carretero, Miguel A; Crnobrnja-Isailović, Jelka; Kaliontzopoulou, Antigoni

2015-01-01

When populations experience suboptimal conditions, the mechanisms involved in the regulation of phenotypic variation can be challenged, resulting in increased phenotypic variance. This kind of disturbance can be diagnosed by using morphometric tools to study morphological patterns at different hierarchical levels and evaluate canalization, developmental stability, integration, modularity, and allometry. We assess the effect of urbanization on phenotypic variation in the common wall lizard (Podarcis muralis) by using geometric morphometrics to assess disturbance to head shape development. The head shapes of urban lizards were more variable and less symmetric, suggesting that urban living is more likely to disturb development. Head shape variation was congruent within and across individuals, which indicated that canalization and developmental stability are two related phenomena in these organisms. Furthermore, urban lizards exhibited smaller mean head sizes, divergent size-shape allometries, and increased deviation from within-group allometric lines. This suggests that mechanisms regulating head shape allometry may also be disrupted. The integrated evaluation of several measures of developmental instability at different hierarchical levels, which provided in this case congruent results, can be a powerful methodological guide for future studies, as it enhances the detection of environmental disturbances on phenotypic variation and aids biological interpretation of the results.

Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

PubMed Central

Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

2012-01-01

The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

KSC-07pd3481

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

KSC-07pd3479

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

KSC-07pd3482

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

KSC-07pd3478

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

KSC-07pd3477

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

KSC-07pd3480

NASA Image and Video Library

2007-11-27

KENNEDY SPACE CENTER, FLA. -- In Hangar N at NASA's Kennedy Space Center, a heat shield for the Constellation crew exploration vehicle, or CEV, is being prepared for a demonstration. A developmental heat shield for the Orion spacecraft is being tested and evaluated at Kennedy. The shield was designed and assembled by the Boeing Company in Huntington Beach, Calif., for NASA's Constellation Program. The thermal protection system manufacturing demonstration unit is designed to protect astronauts from extreme heat during re-entry to Earth's atmosphere from low Earth orbit and lunar missions. The CEV will be used to dock and gain access to the International Space Station, travel to the moon in the 2018 timeframe and play a crucial role in exploring Mars. Photo credit: NASA/Kim Shiflett

Feedback regulated induction heater for a flowing fluid

DOEpatents

Migliori, Albert; Swift, Gregory W.

1985-01-01

A regulated induction heater for heating a stream of flowing fluid to a predetermined desired temperature. The heater includes a radiofrequency induction coil which surrounds a glass tube through which the fluid flows. A heating element consisting of a bundle of approximately 200 stainless steel capillary tubes located within the glass tube couples the output of the induction coil to the fluid. The temperature of the fluid downstream from the heating element is sensed with a platinum resistance thermometer, the output of which is applied to an adjustable proportional and integral feedback control circuit which regulates the power applied to the induction coil. The heater regulates the fluid temperature to within 0.005.degree. C. at a flow rate of 50 cm.sup.3 /second with a response time of less than 0.1 second, and can accommodate changes in heat load up to 1500 watts.

Feedback regulated induction heater for a flowing fluid

DOEpatents

Migliori, A.; Swift, G.W.

1984-06-13

A regulated induction heater for heating a stream of flowing fluid to a predetermined desired temperature. The heater includes a radiofrequency induction coil which surrounds a glass tube through which the fluid flows. A heating element consisting of a bundle of approximately 200 stainless steel capillary tubes located within the glass tube couples the output of the induction coil to the fluid. The temperature of the fluid downstream from the heating element is sensed with a platinum resistance thermometer, the output of which is applied to an adjustable porportional and integral feedback control circuit which regulates the power applied to the induction coil. The heater regulates the fluid temperature to within 0.005/sup 0/C at a flow rate of 50 cm/sup 3//sec with a response time of less than 0.1 second, and can accommodate changes in heat load up to 1500 watts.

48 CFR 1852.227-11 - Patent Rights-Retention by the Contractor (Short Form).

Code of Federal Regulations, 2010 CFR

2010-10-01

... of tier, for experimental, developmental, research, design, or engineering work to be performed by... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Patent Rights-Retention by the Contractor (Short Form). 1852.227-11 Section 1852.227-11 Federal Acquisition Regulations System...

IN VITRO TO IN VIVO SCREENING OF THYROID HORMONE RECEPTOR DISRUPTING CHEMICALS

EPA Science Inventory

Upon completion of these studies, we will have established the predictive value of the GH3.TRE-LUC cell line to detect chemicals that can impact TH regulated gene expression and TH regulated developmental events in vivo. These studies have excellent potential to discover new c...

48 CFR 3027.304-1 - General.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 7 2013-10-01 2012-10-01 true General. 3027.304-1 Section 3027.304-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY... subcontracts for experimental, developmental, or research work (FAR) 48 CFR 27.304-1(e)(2)(ii) may be submitted...

Drosulfakinin activates CCKLR-17D1 and promotes larval locomotion and escape response in Drosophila

USDA-ARS?s Scientific Manuscript database

Neuropeptides are ubiquitous in both mammals and invertebrates and play essential roles in regulation and modulation of many developmental and physiological processes through activation of G-protein-coupled-receptors (GPCRs). However, the mechanisms by which many of the neuropeptides regulate speci...

College Student Binge Eating: Insecure Attachment and Emotion Regulation

ERIC Educational Resources Information Center

Han, Suejung; Pistole, M. Carole

2014-01-01

Because college students who have accomplished developmental tasks less effectively may be at risk for detrimental behavior such as binge eating, we examined emotion regulation as a mediator of attachment insecurity and binge eating. Based on undergraduate and graduate student responses to a Web-based survey ("N" = 381), structural…

Brassinosteroid and Gibberellin control of seedling traits in maize (Zea mays L.)

USDA-ARS?s Scientific Manuscript database

Brassinosteroids (BRs) and gibberellins (GAs) are two major plant hormones regulating various plant developmental processes. In maize, BRs and GAs have been shown to regulate field traits such as plant height and sex determination. This study used 207 doubled haploid maize lines and measured respons...

Early Childhood Profiles of Sleep Problems and Self-Regulation Predict Later School Adjustment

ERIC Educational Resources Information Center

Williams, Kate E.; Nicholson, Jan M.; Walker, Sue; Berthelsen, Donna

2016-01-01

Background: Children's sleep problems and self-regulation problems have been independently associated with poorer adjustment to school, but there has been limited exploration of longitudinal early childhood profiles that include both indicators. Aims: This study explores the normative developmental pathway for sleep problems and self-regulation…

Insecure Attachment and Eating Pathology in Early Adolescence: Role of Emotion Regulation

ERIC Educational Resources Information Center

van Durme, Kim; Braet, Caroline; Goossens, Lien

2015-01-01

The present study investigated whether associations exist between attachment dimensions toward mother and different forms of eating pathology (EP) in a group of early adolescent boys and girls, and whether these associations were mediated by maladaptive emotion regulation (ER) strategies. Developmentally appropriate self-report questionnaires were…

Emotion Regulation in the Brain: Conceptual Issues and Directions for Developmental Research

ERIC Educational Resources Information Center

Lewis, Marc D.; Stieben, Jim

2004-01-01

Emotion regulation cannot be temporally distinguished from emotion in the brain, but activation patterns in prefrontal cortex appear to mediate cognitive control during emotion episodes. Frontal event-related potentials (ERPs) can tap cognitive control hypothetically mediated by the anterior cingulate cortex, and developmentalists have used these…

doublesex alters aggressiveness as a function of social context and sex in the polyphenic beetle Onthophagus taurus.

PubMed

Beckers, Oliver M; Kijimoto, Teiya; Moczek, Armin P

2017-10-01

Despite sharing nearly the same genome, individuals within the same species can vary drastically in both morphology and behaviour as a function of developmental stage, sex or developmental plasticity. Thus, regulatory processes must exist that enable the stage-, sex- or environment-specific expression of traits and their integration during ontogeny, yet exactly how trait complexes are co-regulated and integrated is poorly understood. In this study, we explore the developmental genetic basis of the regulation and integration of environment-dependent sexual dimorphism in behaviour and morphology in the horn-polyphenic dung beetle Onthophagus taurus through the experimental manipulation of the transcription factor doublesex (dsx). The gene dsx plays a profound role in the developmental regulation of morphological differences between sexes as well as alternative male morphs by inhibiting horn formation in females but enabling nutrition-responsive horn growth in males. Specifically, we investigated whether experimental downregulation of dsx expression affects male and female aggressive and courtship behaviours in two social contexts: interactions between individuals of the same sex and interactions between males and females. We find that dsx downregulation significantly alters aggressiveness in both males and females, yet does so differently for both sexes as a function of social context: dsx RNAi males exhibited elevated aggression towards males but showed reduced aggression towards females, whereas dsx RNAi females became more aggressive towards males, while their aggressiveness towards other females was unaffected. Moreover, we document unexpectedly high levels of female aggression independent of dsx treatment in both wild-type and control-injected individuals. Lastly, we found no effects of dsx RNAi on courtship and mating behaviours. We discuss the role of dsx in the regulation of sex-specific and plastic behaviours, the unexpectedly high levels of aggression of hornless dsx RNAi males in relation to the well-established description of the hornless sneaker phenotype and the potential ecological function of high female aggression.

Multi-scale computational modeling of developmental biology.

PubMed

Setty, Yaki

2012-08-01

Normal development of multicellular organisms is regulated by a highly complex process in which a set of precursor cells proliferate, differentiate and move, forming over time a functioning tissue. To handle their complexity, developmental systems can be studied over distinct scales. The dynamics of each scale is determined by the collective activity of entities at the scale below it. I describe a multi-scale computational approach for modeling developmental systems and detail the methodology through a synthetic example of a developmental system that retains key features of real developmental systems. I discuss the simulation of the system as it emerges from cross-scale and intra-scale interactions and describe how an in silico study can be carried out by modifying these interactions in a way that mimics in vivo experiments. I highlight biological features of the results through a comparison with findings in Caenorhabditis elegans germline development and finally discuss about the applications of the approach in real developmental systems and propose future extensions. The source code of the model of the synthetic developmental system can be found in www.wisdom.weizmann.ac.il/~yaki/MultiScaleModel. yaki.setty@gmail.com Supplementary data are available at Bioinformatics online.

Physiological evaluation of men wearing three different toxicological protective systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levine, L.; Cadarette, B.S.; Sawka, M.N.

1989-08-01

This study examined the physiological responses of seven volunteers exercising in the heat while wearing three different toxicological protective systems. The Toxicological Agent Protective (TAP) suit has been available for use for more than 30 years while the other two protective systems are developmental efforts. The Self-Contained Toxicological Environmental Protection Outfit (STEPO) includes either a backpack-rebreather (with CO{sub 2} scrubber) and ice-cooling vest (STEPO-R), or a tether system which supplies breathing/cooling air inside the suit (STEPO-T). After the volunteers were heat acclimated, the three toxicological protection systems were evaluated utilizing a counter-balanced experimental design initially in a hot and thenmore » in a cool environment while subjects walked at 1.12 m/s, 0% grade for an attempted two hours. There was no statistical advantage of any one system in terms of exercise time in the cool environment. While evaporated sweating rate was greater for the STEPO-T in the cool environment compared to both STEPO-R and TAP. Development efforts to improve the STEPO system designs continue, and physiological evaluation of new developmental models is underway.« less

Arctigenin from Fructus Arctii is a novel suppressor of heat shock response in mammalian cells

PubMed Central

Ishihara, Keiichi; Yamagishi, Nobuyuki; Saito, Youhei; Takasaki, Midori; Konoshima, Takao; Hatayama, Takumi

2006-01-01

Because heat shock proteins (Hsps) are involved in protecting cells and in the pathophysiology of diseases such as inflammation, cancer, and neurodegenerative disorders, the use of regulators of the expression of Hsps in mammalian cells seems to be useful as a potential therapeutic modality. To identify compounds that modulate the response to heat shock, we analyzed several natural products using a mammalian cell line containing an hsp promoter-regulated reporter gene. In this study, we found that an extract from Fructus Arctii markedly suppressed the expression of Hsp induced by heat shock. A component of the extract arctigenin, but not the component arctiin, suppressed the response at the level of the activation of heat shock transcription factor, the induction of mRNA, and the synthesis and accumulation of Hsp. Furthermore, arctigenin inhibited the acquisition of thermotolerance in mammalian cells, including cancer cells. Thus, arctigenin seemed to be a new suppressive regulator of heat shock response in mammalian cells, and may be useful for hyperthermia cancer therapy. PMID:16817321

The Developmental Trajectory of Perceived Self-Regulation, Personal Interest, and General Achievement throughout High School: A Longitudinal Study

ERIC Educational Resources Information Center

Helle, Laura; Laakkonen, Eero; Tuijula, Tiina; Vermunt, Jan D.

2013-01-01

Background: Our interest in perceived self-regulation of learning arose in the context of educational reform. After decades of stability, the Finnish high school system underwent reform in the 1990s, with a significant emphasis being placed on promoting student self-regulation of learning. Aims: The purposes of the study were (1) to evaluate…

Molecular Cloning and mRNA Expression of Heat Shock Protein Genes and Their Response to Cadmium Stress in the Grasshopper Oxya chinensis.

PubMed

Zhang, Yuping; Liu, Yaoming; Zhang, Jianzhen; Guo, Yaping; Ma, Enbo

2015-01-01

Heat shock proteins (Hsps) are highly conserved molecular chaperones that are synthesized in response to stress. In this study, we cloned the full-length sequences of the Grp78 (glucose-regulated protein 78), Hsp70, Hsp90, and Hsp40 genes from the Chinese rice grasshopper Oxya chinensis. The full-length cDNA sequences of OcGrp78, OcHsp70, OcHsp90, and OcHsp40 contain open reading frames of 1947, 1920, 2172, and 1042 bp that encode proteins of 649, 640, 724, and 347 amino acids, respectively. Fluorescent real-time quantitative PCR (RT-qPCR) was performed to quantify the relative transcript levels of these Hsp genes in different tissues and developmental stages. The mRNAs encoding these four Hsp genes were present at all developmental stages and in all tissues examined but were expressed at varying levels. Additionally, we investigated the mRNA expression profiles of these four Hsps in O. chinensis subjected to Cadmium (Cd) stress. OcGrp78, OcHsp70, OcHsp90, and OcHsp40 mRNA expression was induced under acute Cd stress; the levels reached a maximum within a short time (6 h), were reduced significantly at 12 h, and were lowered to or below control levels by 48 h. Regarding induction efficiency, OcHsp70 was the most sensitive gene to acute Cd stress. Chronic Cd exposure showed that dietary Cd treatment induced increased OcGrp78, OcHsp90, and OcHsp40 expression. However, dietary Cd induced a significant reduction of OcHsp70 expression. In the period tested, no significant difference in the mortality of the grasshoppers was observed. Our results suggest that these four Hsps genes, especially OcHsp70, are sensitive to acute Cd stress and could be used as molecular markers for toxicology studies. However, our results also indicate that OcHsp70 is not suitable for use as a molecular marker of chronic Cd contamination.

Cloning of heat shock protein genes (hsp70, hsc70 and hsp90) and their expression in response to larval diapause and thermal stress in the wheat blossom midge, Sitodiplosis mosellana.

PubMed

Cheng, Weining; Li, Dan; Wang, Yue; Liu, Yang; Zhu-Salzman, Keyan

2016-12-01

Sitodiplosis mosellana Géhin, one of the most important pests of wheat, undergoes obligatory diapause as a larva to survive unfavorable temperature extremes during hot summers and cold winters. To explore the potential roles of heat shock proteins (hsp) in this process, we cloned full-length cDNAs of hsp70, hsc70 and hsp90 from S. mosellana larvae, and examined their expression in response to diapause and short-term temperature stresses. Three hsps included all signature sequences of corresponding protein family and EEVD motifs. They showed high homology to their counterparts in other species, and the phylogenetic analysis of hsp90 was consistent with the known classification of insects. Expression of hsp70 and hsp90 were highly induced by diapause, particularly pronounced during summer and winter. Interestingly, hsp70 was more strongly expressed in summer than in winter whereas hsp90 displayed the opposite pattern. Abundance of hsc70 mRNA was comparable prior to and during diapauses and was highly up-regulated when insects began to enter the stage of post-diapause quiescence. Heat-stressed over-summering larvae (⩾30°C) or cold-stressed over-wintering larvae (⩽0°C) could further elevate expression of these three genes, but temperature extremes i.e. as high as 45°C or as low as -15°C failed to trigger such expression patterns. Notably, hsp70 was most sensitive to heat stress and hsp90 was most sensitive to cold stress. These results suggested that hsp70 and hsp90 play key roles in diapause maintenance and thermal stress; the former may be more prominent contributor to heat tolerance and the latter for cold tolerance. In contrast, hsc70 most likely is involved in developmental transition from diapause to post-diapause quiescence, and thus may serve as a molecular marker to predict diapause termination. Copyright © 2016 Elsevier Ltd. All rights reserved.

Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

PubMed

Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

2017-02-01

Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

Distinct Skeletal Muscle Gene Regulation from Active Contraction, Passive Vibration, and Whole Body Heat Stress in Humans

PubMed Central

Petrie, Michael A.; Kimball, Amy L.; McHenry, Colleen L.; Suneja, Manish; Yen, Chu-Ling; Sharma, Arpit; Shields, Richard K.

2016-01-01

Skeletal muscle exercise regulates several important metabolic genes in humans. We know little about the effects of environmental stress (heat) and mechanical stress (vibration) on skeletal muscle. Passive mechanical stress or systemic heat stress are often used in combination with many active exercise programs. We designed a method to deliver a vibration stress and systemic heat stress to compare the effects with active skeletal muscle contraction. Purpose: The purpose of this study is to examine whether active mechanical stress (muscle contraction), passive mechanical stress (vibration), or systemic whole body heat stress regulates key gene signatures associated with muscle metabolism, hypertrophy/atrophy, and inflammation/repair. Methods: Eleven subjects, six able-bodied and five with chronic spinal cord injury (SCI) participated in the study. The six able-bodied subjects sat in a heat stress chamber for 30 minutes. Five subjects with SCI received a single dose of limb-segment vibration or a dose of repetitive electrically induced muscle contractions. Three hours after the completion of each stress, we performed a muscle biopsy (vastus lateralis or soleus) to analyze mRNA gene expression. Results: We discovered repetitive active muscle contractions up regulated metabolic transcription factors NR4A3 (12.45 fold), PGC-1α (5.46 fold), and ABRA (5.98 fold); and repressed MSTN (0.56 fold). Heat stress repressed PGC-1α (0.74 fold change; p < 0.05); while vibration induced FOXK2 (2.36 fold change; p < 0.05). Vibration similarly caused a down regulation of MSTN (0.74 fold change; p < 0.05), but to a lesser extent than active muscle contraction. Vibration induced FOXK2 (p < 0.05) while heat stress repressed PGC-1α (0.74 fold) and ANKRD1 genes (0.51 fold; p < 0.05). Conclusion: These findings support a distinct gene regulation in response to heat stress, vibration, and muscle contractions. Understanding these responses may assist in developing regenerative rehabilitation interventions to improve muscle cell development, growth, and repair. PMID:27486743

Post-Transcriptional Regulation of the Trypanosome Heat Shock Response by a Zinc Finger Protein

PubMed Central

Droll, Dorothea; Minia, Igor; Fadda, Abeer; Singh, Aditi; Stewart, Mhairi; Queiroz, Rafael; Clayton, Christine

2013-01-01

In most organisms, the heat-shock response involves increased heat-shock gene transcription. In Kinetoplastid protists, however, virtually all control of gene expression is post-transcriptional. Correspondingly, Trypanosoma brucei heat-shock protein 70 (HSP70) synthesis after heat shock depends on regulation of HSP70 mRNA turnover. We here show that the T. brucei CCCH zinc finger protein ZC3H11 is a post-transcriptional regulator of trypanosome chaperone mRNAs. ZC3H11 is essential in bloodstream-form trypanosomes and for recovery of insect-form trypanosomes from heat shock. ZC3H11 binds to mRNAs encoding heat-shock protein homologues, with clear specificity for the subset of trypanosome chaperones that is required for protein refolding. In procyclic forms, ZC3H11 was required for stabilisation of target chaperone-encoding mRNAs after heat shock, and the HSP70 mRNA was also decreased upon ZC3H11 depletion in bloodstream forms. Many mRNAs bound to ZC3H11 have a consensus AUU repeat motif in the 3′-untranslated region. ZC3H11 bound preferentially to AUU repeats in vitro, and ZC3H11 regulation of HSP70 mRNA in bloodstream forms depended on its AUU repeat region. Tethering of ZC3H11 to a reporter mRNA increased reporter expression, showing that it is capable of actively stabilizing an mRNA. These results show that expression of trypanosome heat-shock genes is controlled by a specific RNA-protein interaction. They also show that heat-shock-induced chaperone expression in procyclic trypanosome enhances parasite survival at elevated temperatures. PMID:23592996

HSF1 and HSF3 cooperatively regulate the heat shock response in lizards.

PubMed

Takii, Ryosuke; Fujimoto, Mitsuaki; Matsuura, Yuki; Wu, Fangxu; Oshibe, Namiko; Takaki, Eiichi; Katiyar, Arpit; Akashi, Hiroshi; Makino, Takashi; Kawata, Masakado; Nakai, Akira

2017-01-01

Cells cope with temperature elevations, which cause protein misfolding, by expressing heat shock proteins (HSPs). This adaptive response is called the heat shock response (HSR), and it is regulated mainly by heat shock transcription factor (HSF). Among the four HSF family members in vertebrates, HSF1 is a master regulator of HSP expression during proteotoxic stress including heat shock in mammals, whereas HSF3 is required for the HSR in birds. To examine whether only one of the HSF family members possesses the potential to induce the HSR in vertebrate animals, we isolated cDNA clones encoding lizard and frog HSF genes. The reconstructed phylogenetic tree of vertebrate HSFs demonstrated that HSF3 in one species is unrelated with that in other species. We found that the DNA-binding activity of both HSF1 and HSF3 in lizard and frog cells was induced in response to heat shock. Unexpectedly, overexpression of lizard and frog HSF3 as well as HSF1 induced HSP70 expression in mouse cells during heat shock, indicating that the two factors have the potential to induce the HSR. Furthermore, knockdown of either HSF3 or HSF1 markedly reduced HSP70 induction in lizard cells and resistance to heat shock. These results demonstrated that HSF1 and HSF3 cooperatively regulate the HSR at least in lizards, and suggest complex mechanisms of the HSR in lizards as well as frogs.

HSF1 and HSF3 cooperatively regulate the heat shock response in lizards

PubMed Central

Takii, Ryosuke; Fujimoto, Mitsuaki; Matsuura, Yuki; Wu, Fangxu; Oshibe, Namiko; Takaki, Eiichi; Katiyar, Arpit; Akashi, Hiroshi; Makino, Takashi; Kawata, Masakado

2017-01-01

Cells cope with temperature elevations, which cause protein misfolding, by expressing heat shock proteins (HSPs). This adaptive response is called the heat shock response (HSR), and it is regulated mainly by heat shock transcription factor (HSF). Among the four HSF family members in vertebrates, HSF1 is a master regulator of HSP expression during proteotoxic stress including heat shock in mammals, whereas HSF3 is required for the HSR in birds. To examine whether only one of the HSF family members possesses the potential to induce the HSR in vertebrate animals, we isolated cDNA clones encoding lizard and frog HSF genes. The reconstructed phylogenetic tree of vertebrate HSFs demonstrated that HSF3 in one species is unrelated with that in other species. We found that the DNA-binding activity of both HSF1 and HSF3 in lizard and frog cells was induced in response to heat shock. Unexpectedly, overexpression of lizard and frog HSF3 as well as HSF1 induced HSP70 expression in mouse cells during heat shock, indicating that the two factors have the potential to induce the HSR. Furthermore, knockdown of either HSF3 or HSF1 markedly reduced HSP70 induction in lizard cells and resistance to heat shock. These results demonstrated that HSF1 and HSF3 cooperatively regulate the HSR at least in lizards, and suggest complex mechanisms of the HSR in lizards as well as frogs. PMID:28686674

Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera).

PubMed

Li, Zhou; Peng, Yan; Huang, Bingru

2018-05-31

Gamma-aminobutyric acid (GABA) may play a positive role in regulating plant tolerance to drought or heat stress. The objectives of this study were to investigate the physiological effects of GABA on tolerance of creeping bentgrass ( Agrostis stolonifera ) to heat and drought stress and to determine whether enhanced heat and drought tolerance due to GABA treatment was associated with the up-regulation of selected genes and transcriptional factors involved in stress protection. Creeping bentgrass (cultivar "Penncross") plants were treated with 0.5 mM GABA or water (untreated control) as a foliar spray and were subsequently exposed to heat stress (35/30 °C, day/night), drought stress by withholding irrigation, or non-stress conditions in controlled-environment growth chambers. Exogenous application of GABA significantly improved plant tolerance to heat and drought stress, as reflected by increased leaf water content, cell membrane stability, and chlorophyll content. The analysis of gene transcript level revealed that exogenous GABA up-regulated the expression of ABF3 , POD , APX , HSP90 , DHN3 , and MT1 during heat stress and the expression of CDPK26 , MAPK1 , ABF3 , WRKY75 , MYB13 , HSP70 , MT1 , 14-3-3 , and genes ( SOD , CAT , POD , APX , MDHAR , DHAR , and GR ) encoding antioxidant enzymes during drought stress. The up-regulation of the aforementioned stress-protective genes and transcriptional factors could contribute to improved heat and drought tolerance in creeping bentgrass.

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

Leaf Proteome Analysis Reveals Prospective Drought and Heat Stress Response Mechanisms in Soybean.

PubMed

Das, Aayudh; Eldakak, Moustafa; Paudel, Bimal; Kim, Dea-Wook; Hemmati, Homa; Basu, Chhandak; Rohila, Jai S

2016-01-01

Drought and heat are among the major abiotic stresses that affect soybean crops worldwide. During the current investigation, the effect of drought, heat, and drought plus heat stresses was compared in the leaves of two soybean varieties, Surge and Davison, combining 2D-DIGE proteomic data with physiology and biochemical analyses. We demonstrated how 25 differentially expressed photosynthesis-related proteins affect RuBisCO regulation, electron transport, Calvin cycle, and carbon fixation during drought and heat stress. We also observed higher abundance of heat stress-induced EF-Tu protein in Surge. It is possible that EF-Tu might have activated heat tolerance mechanisms in the soybean. Higher level expressions of heat shock-related protein seem to be regulating the heat tolerance mechanisms. This study identifies the differential expression of various abiotic stress-responsive proteins that regulate various molecular processes and signaling cascades. One inevitable outcome from the biochemical and proteomics assays of this study is that increase of ROS levels during drought stress does not show significant changes at the phenotypic level in Davison and this seems to be due to a higher amount of carbonic anhydrase accumulation in the cell which aids the cell to become more resistant to cytotoxic concentrations of H2O2.

Leaf Proteome Analysis Reveals Prospective Drought and Heat Stress Response Mechanisms in Soybean

PubMed Central

Das, Aayudh; Eldakak, Moustafa; Paudel, Bimal; Kim, Dea-Wook; Hemmati, Homa; Basu, Chhandak

2016-01-01

Drought and heat are among the major abiotic stresses that affect soybean crops worldwide. During the current investigation, the effect of drought, heat, and drought plus heat stresses was compared in the leaves of two soybean varieties, Surge and Davison, combining 2D-DIGE proteomic data with physiology and biochemical analyses. We demonstrated how 25 differentially expressed photosynthesis-related proteins affect RuBisCO regulation, electron transport, Calvin cycle, and carbon fixation during drought and heat stress. We also observed higher abundance of heat stress-induced EF-Tu protein in Surge. It is possible that EF-Tu might have activated heat tolerance mechanisms in the soybean. Higher level expressions of heat shock-related protein seem to be regulating the heat tolerance mechanisms. This study identifies the differential expression of various abiotic stress-responsive proteins that regulate various molecular processes and signaling cascades. One inevitable outcome from the biochemical and proteomics assays of this study is that increase of ROS levels during drought stress does not show significant changes at the phenotypic level in Davison and this seems to be due to a higher amount of carbonic anhydrase accumulation in the cell which aids the cell to become more resistant to cytotoxic concentrations of H2O2. PMID:27034942

Effect of Heat Stress on Reproduction in Dairy Cows: Insights into the Cellular and Molecular Responses of the Oocyte.

PubMed

Roth, Zvi

2017-02-08

Among the components of the female reproductive tract, the ovarian pool of follicles and their enclosed oocytes are highly sensitive to hyperthermia. Heat-induced alterations in small antral follicles can be expressed later as compromised maturation and developmental capacity of the ovulating oocyte. This review summarizes the most up-to-date information on the effects of heat stress on the oocyte with an emphasis on unclear points and open questions, some of which might involve new research directions, for instance, whether preantral follicles are heat resistant. The review focuses on the follicle-enclosed oocytes, provides new insights into the cellular and molecular responses of the oocyte to elevated temperature, points out the role of the follicle microenvironment, and discusses some mechanisms that might underlie oocyte impairment. Mechanisms include nuclear and cytoplasmic maturation, mitochondrial function, apoptotic pathways, and oxidative stress. Understanding the mechanism by which heat stress compromises fertility might enable development of new strategies to mitigate its effects.

Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

PubMed

Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

2017-10-01

Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats.

PubMed

Beaudin, Stephane A; Strupp, Barbara J; Strawderman, Myla; Smith, Donald R

2017-02-01

Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1-21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230-237; http://dx.doi.org/10.1289/EHP258.

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats

PubMed Central

Beaudin, Stephane A.; Strupp, Barbara J.; Strawderman, Myla; Smith, Donald R.

2016-01-01

Background: Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. Objectives: To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Methods: Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1–21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Results: Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. Conclusions: This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230–237; http://dx.doi.org/10.1289/EHP258 PMID:27384154

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Deubiquitylases USP5 and USP13 are recruited to and regulate heat-induced stress granules through their deubiquitylating activities.

PubMed

Xie, Xuan; Matsumoto, Shunsuke; Endo, Akinori; Fukushima, Toshiaki; Kawahara, Hiroyuki; Saeki, Yasushi; Komada, Masayuki

2018-04-12

Stress granules are transient cytoplasmic foci induced by various stresses that contain translation-stalled mRNAs and RNA-binding proteins. They are proposed to modulate mRNA translation and stress responses. Here, we show that the deubiquitylases USP5 and USP13 are recruited to heat-induced stress granules. Heat-induced stress granules also contained K48- and K63-linked ubiquitin chains. Depletion of USP5 or USP13 resulted in elevated ubiquitin chain levels and accelerated assembly of heat-induced stress granules, suggesting that these enzymes regulate the stability of the stress granules through their ubiquitin isopeptidase activity. Moreover, disassembly of heat-induced stress granules after returning the cells to normal temperatures was markedly repressed by individual depletion of USP5 or USP13. Finally, overexpression of a ubiquitin mutant lacking the C-terminal diglycine motif caused the accumulation of unanchored ubiquitin chains and the repression of the disassembly of heat-induced stress granules. As unanchored ubiquitin chains are preferred substrates for USP5, we suggest that USP5 regulates the assembly and disassembly of heat-induced stress granules by mediating the hydrolysis of unanchored ubiquitin chains while USP13 regulates stress granules through deubiquitylating protein-conjugated ubiquitin chains.This article has an associated First Person interview with the first author of the paper. © 2018. Published by The Company of Biologists Ltd.

Leaf proteome alterations in the context of physiological and morphological responses to drought and heat stress in barley (Hordeum vulgare L.)

PubMed Central

von Korff, M.

2013-01-01

The objective of this study was to identify barley leaf proteins differentially regulated in response to drought and heat and the combined stresses in context of the morphological and physiological changes that also occur. The Syrian landrace Arta and the Australian cultivar Keel were subjected to drought, high temperature, or a combination of both treatments starting at heading. Changes in the leaf proteome were identified using differential gel electrophoresis and mass spectrometry. The drought treatment caused strong reductions of biomass and yield, while photosynthetic performance and the proteome were not significantly changed. In contrast, the heat treatment and the combination of heat and drought reduced photosynthetic performance and caused changes of the leaf proteome. The proteomic analysis identified 99 protein spots differentially regulated in response to heat treatment, 14 of which were regulated in a genotype-specific manner. Differentially regulated proteins predominantly had functions in photosynthesis, but also in detoxification, energy metabolism, and protein biosynthesis. The analysis indicated that de novo protein biosynthesis, protein quality control mediated by chaperones and proteases, and the use of alternative energy resources, i.e. glycolysis, play important roles in adaptation to heat stress. In addition, genetic variation identified in the proteome, in plant growth and photosynthetic performance in response to drought and heat represent stress adaption mechanisms to be exploited in future crop breeding efforts. PMID:23918963

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

PubMed

Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

2012-09-28

Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs, antioxidant enzymes (i.e., ascorbate peroxidase), and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

OsMADS26 Negatively Regulates Resistance to Pathogens and Drought Tolerance in Rice1[OPEN

PubMed Central

Khong, Giang Ngan; Richaud, Frédérique; Parizot, Boris; Mai, Chung Duc; Bès, Martine; Bourrié, Isabelle; Meynard, Donaldo; Beeckman, Tom; Selvaraj, Michael Gomez; Manabu, Ishitani; Brugidou, Christophe; Nang Do, Vinh; Guiderdoni, Emmanuel; Morel, Jean-Benoit; Gantet, Pascal

2015-01-01

Functional analyses of MADS-box transcription factors in plants have unraveled their role in major developmental programs (e.g. flowering and floral organ identity) as well as stress-related developmental processes, such as abscission, fruit ripening, and senescence. Overexpression of the rice (Oryza sativa) MADS26 gene in rice has revealed a possible function related to stress response. Here, we show that OsMADS26-down-regulated plants exhibit enhanced resistance against two major rice pathogens: Magnaporthe oryzae and Xanthomonas oryzae. Despite this enhanced resistance to biotic stresses, OsMADS26-down-regulated plants also displayed enhanced tolerance to water deficit. These phenotypes were observed in both controlled and field conditions. Interestingly, alteration of OsMADS26 expression does not have a strong impact on plant development. Gene expression profiling revealed that a majority of genes misregulated in overexpresser and down-regulated OsMADS26 lines compared with control plants are associated to biotic or abiotic stress response. Altogether, our data indicate that OsMADS26 acts as an upstream regulator of stress-associated genes and thereby, a hub to modulate the response to various stresses in the rice plant. PMID:26424158

How does mindfulness modulate self-regulation in pre-adolescent children? An integrative neurocognitive review.

PubMed

Kaunhoven, Rebekah Jane; Dorjee, Dusana

2017-03-01

Pre-adolescence is a key developmental period in which complex intrinsic volitional methods of self-regulation are acquired as a result of rapid maturation within the brain networks underlying the self-regulatory processes of attention control and emotion regulation. Fostering adaptive self-regulation skills during this stage of development has strong implications for physical health, emotional and socio-economic outcomes during adulthood. There is a growing interest in mindfulness-based programmes for pre-adolescents with initial findings suggesting self-regulation improvements, however, neurodevelopmental studies on mindfulness with pre-adolescents are scarce. This analytical review outlines an integrative neuro-developmental approach, which combines self-report and behavioural assessments with event related brain potentials (ERPs) to provide a systemic multilevel understanding of the neurocognitive mechanisms of mindfulness in pre-adolescence. We specifically focus on the N2, error related negativity (ERN), error positivity (Pe), P3a, P3b and late positive potential (LPP) ERP components as indexes of mindfulness related modulations in non-volitional bottom-up self-regulatory processes (salience detection, stimulus driven orienting and mind wandering) and volitional top-down self-regulatory processes (endogenous orienting and executive attention). Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

PubMed Central

Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

2006-01-01

Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

Hydroxylated PBDEs induce developmental arrest in zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu

The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was notmore » observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.« less

Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer.

PubMed

Gelmedin, Verena; Brodigan, Thomas; Gao, Xin; Krause, Michael; Wang, Zhu; Hawdon, John M

2011-01-01

Parasitic hookworms and the free-living model nematode Caenorhabtidis elegans share a developmental arrested stage, called the dauer stage in C. elegans and the infective third-stage larva (L3) in hookworms. One of the key transcription factors that regulate entrance to and exit from developmental arrest is the forkhead transcription factor DAF-16/FoxO. During the dauer stage, DAF-16 is activated and localized in the nucleus. DAF-16 is negatively regulated by phosphorylation by the upstream kinase AKT, which causes DAF-16 to localize out of the nucleus and the worm to exit from dauer. DAF-16 is conserved in hookworms, and hypothesized to control recovery from L3 arrest during infection. Lacking reverse genetic techniques for use in hookworms, we used C. elegans complementation assays to investigate the function of Ancylostoma caninum DAF-16 during entrance and exit from L3 developmental arrest. We performed dauer switching assays and observed the restoration of the dauer phenotype when Ac-DAF-16 was expressed in temperature-sensitive dauer defective C. elegans daf-2(e1370);daf-16(mu86) mutants. AKT phosphorylation site mutants of Ac-DAF-16 were also able to restore the dauer phenotype, but surprisingly allowed dauer exit when temperatures were lowered. We used fluorescence microscopy to localize DAF-16 during dauer and exit from dauer in C. elegans DAF-16 mutant worms expressing Ac-DAF-16, and found that Ac-DAF-16 exited the nucleus during dauer exit. Surprisingly, Ac-DAF-16 with mutated AKT phosphorylation sites also exited the nucleus during dauer exit. Our results suggest that another mechanism may be involved in the regulation DAF-16 nuclear localization during recovery from developmental arrest.

Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells.

PubMed

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A; Engel, Felix B; Yamashita, Jun K

2013-12-01

The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provides therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells. The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse pluripotent stem cell-derived cardiomyocytes and identified 4 chemical compound groups: inhibitors of glycogen synthase kinase-3, p38 mitogen-activated protein kinase, and Ca(2+)/calmodulin-dependent protein kinase II, and activators of extracellular signal-regulated kinase. Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human pluripotent stem cells, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas extracellular signal-regulated kinase activators and Ca(2+)/calmodulin-dependent protein kinase II inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, glycogen synthase kinase-3 and p38 mitogen-activated protein kinase inhibitors substantially and synergistically induced re-entry and progression of cell cycle in neonatal but also as well as adult cardiomyocytes. Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered pluripotent stem cell-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies.

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

The expression of miR-125b regulates angiogenesis during the recovery of heat-denatured HUVECs.

PubMed

Zhou, Situo; Zhang, Pihong; Liang, Pengfei; Huang, Xiaoyuan

2015-06-01

In previous studies we found that miR-125b was down-regulated in denatured dermis of deep partial thickness burn patients. Moreover, miR-125b inhibited tumor-angiogenesis associated with the decrease of ERBB2 and VEGF expression in ovarian cancer cells and breast cancer cells, etc. In this study, we investigated the expression patterns and roles of miR-125b during the recovery of denatured dermis and heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burns in Sprague-Dawley rats and the heat-denatured cells (52°C, 35 s) were used for analysis. Western blot analysis and real-time PCR were applied to evaluate the expression of miR-125b and ERBB2 and VEGF. The ability of angiogenesis in heat-denatured HUVECs was analyzed by scratch wound healing and tube formation assay after pri-miR-125b or anti-miR-125b transfection. miR-125b expression was time-dependent during the recovery of heat-denatured dermis and HUVECs. Moreover, miR-125b regulated ERBB2 mRNA and Protein Expression and regulated angiogenesis association with regulating the expression of VEGF in heat-denatured HUVECs. Taken together our results show that the expression of miR-125b is time-dependent and miR-125b plays a regulatory role of angiogenesis during wound healing after burns. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

Abscisic Acid Signaling and Abiotic Stress Tolerance in Plants: A Review on Current Knowledge and Future Prospects

PubMed Central

Vishwakarma, Kanchan; Upadhyay, Neha; Kumar, Nitin; Yadav, Gaurav; Singh, Jaspreet; Mishra, Rohit K.; Kumar, Vivek; Verma, Rishi; Upadhyay, R. G.; Pandey, Mayank; Sharma, Shivesh

2017-01-01

Abiotic stress is one of the severe stresses of environment that lowers the growth and yield of any crop even on irrigated land throughout the world. A major phytohormone abscisic acid (ABA) plays an essential part in acting toward varied range of stresses like heavy metal stress, drought, thermal or heat stress, high level of salinity, low temperature, and radiation stress. Its role is also elaborated in various developmental processes including seed germination, seed dormancy, and closure of stomata. ABA acts by modifying the expression level of gene and subsequent analysis of cis- and trans-acting regulatory elements of responsive promoters. It also interacts with the signaling molecules of processes involved in stress response and development of seeds. On the whole, the stress to a plant can be susceptible or tolerant by taking into account the coordinated activities of various stress-responsive genes. Numbers of transcription factor are involved in regulating the expression of ABA responsive genes by acting together with their respective cis-acting elements. Hence, for improvement in stress-tolerance capacity of plants, it is necessary to understand the mechanism behind it. On this ground, this article enlightens the importance and role of ABA signaling with regard to various stresses as well as regulation of ABA biosynthetic pathway along with the transcription factors for stress tolerance. PMID:28265276

Loss of neurogenesis in Hydra leads to compensatory regulation of neurogenic and neurotransmission genes in epithelial cells

PubMed Central

2016-01-01

Hydra continuously differentiates a sophisticated nervous system made of mechanosensory cells (nematocytes) and sensory–motor and ganglionic neurons from interstitial stem cells. However, this dynamic adult neurogenesis is dispensable for morphogenesis. Indeed animals depleted of their interstitial stem cells and interstitial progenitors lose their active behaviours but maintain their developmental fitness, and regenerate and bud when force-fed. To characterize the impact of the loss of neurogenesis in Hydra, we first performed transcriptomic profiling at five positions along the body axis. We found neurogenic genes predominantly expressed along the central body column, which contains stem cells and progenitors, and neurotransmission genes predominantly expressed at the extremities, where the nervous system is dense. Next, we performed transcriptomics on animals depleted of their interstitial cells by hydroxyurea, colchicine or heat-shock treatment. By crossing these results with cell-type-specific transcriptomics, we identified epithelial genes up-regulated upon loss of neurogenesis: transcription factors (Dlx, Dlx1, DMBX1/Manacle, Ets1, Gli3, KLF11, LMX1A, ZNF436, Shox1), epitheliopeptides (Arminins, PW peptide), neurosignalling components (CAMK1D, DDCl2, Inx1), ligand-ion channel receptors (CHRNA1, NaC7), G-Protein Coupled Receptors and FMRFRL. Hence epitheliomuscular cells seemingly enhance their sensing ability when neurogenesis is compromised. This unsuspected plasticity might reflect the extended multifunctionality of epithelial-like cells in early eumetazoan evolution. PMID:26598723

Loss of neurogenesis in Hydra leads to compensatory regulation of neurogenic and neurotransmission genes in epithelial cells.

PubMed

Wenger, Y; Buzgariu, W; Galliot, B

2016-01-05

Hydra continuously differentiates a sophisticated nervous system made of mechanosensory cells (nematocytes) and sensory-motor and ganglionic neurons from interstitial stem cells. However, this dynamic adult neurogenesis is dispensable for morphogenesis. Indeed animals depleted of their interstitial stem cells and interstitial progenitors lose their active behaviours but maintain their developmental fitness, and regenerate and bud when force-fed. To characterize the impact of the loss of neurogenesis in Hydra, we first performed transcriptomic profiling at five positions along the body axis. We found neurogenic genes predominantly expressed along the central body column, which contains stem cells and progenitors, and neurotransmission genes predominantly expressed at the extremities, where the nervous system is dense. Next, we performed transcriptomics on animals depleted of their interstitial cells by hydroxyurea, colchicine or heat-shock treatment. By crossing these results with cell-type-specific transcriptomics, we identified epithelial genes up-regulated upon loss of neurogenesis: transcription factors (Dlx, Dlx1, DMBX1/Manacle, Ets1, Gli3, KLF11, LMX1A, ZNF436, Shox1), epitheliopeptides (Arminins, PW peptide), neurosignalling components (CAMK1D, DDCl2, Inx1), ligand-ion channel receptors (CHRNA1, NaC7), G-Protein Coupled Receptors and FMRFRL. Hence epitheliomuscular cells seemingly enhance their sensing ability when neurogenesis is compromised. This unsuspected plasticity might reflect the extended multifunctionality of epithelial-like cells in early eumetazoan evolution. © 2015 The Authors.

Remodeling of the postsynaptic plasma membrane during neural development.

PubMed

Tulodziecka, Karolina; Diaz-Rohrer, Barbara B; Farley, Madeline M; Chan, Robin B; Di Paolo, Gilbert; Levental, Kandice R; Waxham, M Neal; Levental, Ilya

2016-11-07

Neuronal synapses are the fundamental units of neural signal transduction and must maintain exquisite signal fidelity while also accommodating the plasticity that underlies learning and development. To achieve these goals, the molecular composition and spatial organization of synaptic terminals must be tightly regulated; however, little is known about the regulation of lipid composition and organization in synaptic membranes. Here we quantify the comprehensive lipidome of rat synaptic membranes during postnatal development and observe dramatic developmental lipidomic remodeling during the first 60 postnatal days, including progressive accumulation of cholesterol, plasmalogens, and sphingolipids. Further analysis of membranes associated with isolated postsynaptic densities (PSDs) suggests the PSD-associated postsynaptic plasma membrane (PSD-PM) as one specific location of synaptic remodeling. We analyze the biophysical consequences of developmental remodeling in reconstituted synaptic membranes and observe remarkably stable microdomains, with the stability of domains increasing with developmental age. We rationalize the developmental accumulation of microdomain-forming lipids in synapses by proposing a mechanism by which palmitoylation of the immobilized scaffold protein PSD-95 nucleates domains at the postsynaptic plasma membrane. These results reveal developmental changes in lipid composition and palmitoylation that facilitate the formation of postsynaptic membrane microdomains, which may serve key roles in the function of the neuronal synapse. © 2016 Tulodziecka et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Identification of High-Temperature-Responsive Genes in Cereals1[C][W

PubMed Central

Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

2012-01-01

High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

78 FR 78962 - Criteria for a Recommended Standard; Occupational Exposure to Heat and Hot Environments; Draft...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-27

.... Heat stress can result in heat-related illnesses such as heat stroke, heat exhaustion, heat cramps, or... related materials, visit http://www.regulations.gov and enter CDC-2013-0025 in the search field and click... hydration that should be considered? (4) Are there any additional risk factors for heat-related illnesses...

Heat stress in pregnant sows: Thermal responses and subsequent performance of sows and their offspring.

PubMed

Lucy, Matthew C; Safranski, Timothy J

2017-09-01

Seasonal infertility is a significant problem in the swine industry, and may be influenced by photoperiod and heat stress. Heat stress during gestation in particular affects pregnancy, resulting in long-term developmental damage to the offspring. This review summarizes what is known about how heat stress on the pregnant sow affects lactation and her offspring. Sows responded to heat stress during gestation with increased rectal temperature, respiration rate, and skin temperature, and tended to reduce their activity-which may have changed their body composition, increasing the adipose-to-muscle ratio. Heat stress during gestation caused temporary insulin resistance during lactation, but this metabolic state did not seem to affect health, lactation, or rebreeding performance of the sow. Heat-stressed sows also presented with a shorter gestation period and reduced litter birth weight, although weaning weights are not affected when these sows are moved to thermoneutral conditions for lactation. The offspring of gestational heat-stressed sows, however, possessed unique phenotypes, including elevated body temperature, greater fat deposition, and impaired gonad development. Thus, gestational heat stress may significantly impact a herd through its effects on sows and their offspring. Further work is necessary to determine the magnitude of the effects across fa cilities and breeds. © 2017 Wiley Periodicals, Inc.

Adolescent Family Adversity and Mental Health Problems: The Role of Adaptive Self-Regulation Capacities. The TRAILS Study

ERIC Educational Resources Information Center

Bakker, Martin Paul; Ormel, Johan; Verhulst, Frank C.; Oldehinkel, Albertine J.

2011-01-01

Adolescent family adversity is a considerable adaptive challenge in an increasingly turbulent developmental period. Using data from a prospective population cohort of 2230 Dutch adolescents, we tested risk-buffering interactions between adolescent family adversity and self-regulation capacities on mental health. We used two adaptive…

The Emotion Regulation Questionnaire for Children and Adolescents (ERQ-CA): A Psychometric Evaluation

ERIC Educational Resources Information Center

Gullone, Eleonora; Taffe, John

2012-01-01

Despite the recognized importance of emotion regulation (ER) for healthy psychological development, ER research has focused predominantly on the developmental periods of infancy, early childhood, and adulthood, while the middle childhood to adolescence years have been relatively neglected. An obstacle to ER research during these periods is the…

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal mouse tissues.

EPA Science Inventory

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...

A Combinatorial Interplay Among the 1-Aminocyclopropane-1-carboxylate Isoforms Regulates Ethylene Biosynthesis in Arabidopsis thaliana

USDA-ARS?s Scientific Manuscript database

Ethylene (C2H4) is a unique plant-signaling molecule that regulates numerous developmental processes. The key enzyme in the two-step biosynthetic pathway of ethylene is 1-aminocyclopropane-1-carboxylate synthase (ACS), which catalyzes the conversion of Sadenosyl-methionine (AdoMet) to ACC, the precu...

The Promotion of Self-Regulation through Parenting Interventions

ERIC Educational Resources Information Center

Sanders, Matthew R.; Mazzucchelli, Trevor G.

2013-01-01

The capacity for a parent to self-regulate their own performance is argued to be a fundamental process underpinning the maintenance of positive, nurturing, non-abusive parenting practices that promote good developmental and health outcomes in children. Deficits in self-regulatory capacity, which have their origins in early childhood, are common in…

Emotional Reactivity, Regulation and Childhood Stuttering: A Behavioral and Electrophysiological Study

ERIC Educational Resources Information Center

Arnold, Hayley S.; Conture, Edward G.; Key, Alexandra P. F.; Walden, Tedra

2011-01-01

The purpose of this preliminary study was to assess whether behavioral and psychophysiological correlates of emotional reactivity and regulation are associated with developmental stuttering, as well as determine the feasibility of these methods in preschool-age children. Nine preschool-age children who stutter (CWS) and nine preschool-age children…

The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth

Treesearch

Juan Du; Shawn D. Mansfield; Andrew T. Groover

2009-01-01

The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX...

Disorders of Regulation of Cognitive Activity in Autistic Children.

ERIC Educational Resources Information Center

Adrien, Jean Louis; And Others

1995-01-01

This study compared the regulation of cognitive activity in 30 children (ages 15 to 95 months) with autism or mental retardation matched for global, verbal, and nonverbal developmental ages. Testing on tasks of object permanence indicated that the autistic children had a pervasive difficulty in maintenance set, made more perseverative errors, and…

Wt1 Flip-Flops Chromatin in a CTCF Domain

PubMed Central

Gurudatta, B. V.; Corces, Victor G.

2011-01-01

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. PMID:21920307

Preadolescents' Gendered Spiritual Identities and Self-Regulation

ERIC Educational Resources Information Center

Bosacki, Sandra Leanne; Moore, Kelsey; Talwar, Victoria; Park-Saltzman, Jeeseon

2011-01-01

Research suggests that self-control or self-regulation may play a role in the connections among spirituality, health, well-being, and social behavior. Within the framework of social-cognitive developmental theory, we explore the question of how do children and adolescents learn to think of themselves as gendered and spiritual beings within the…

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation

USDA-ARS?s Scientific Manuscript database

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing ac...

The Synergistic Effects of Self-Regulation Tools and the Flipped Classroom

ERIC Educational Resources Information Center

Butzler, Kelly B.

2016-01-01

Students at open-enrollment institutions enter college with a wide range of academic preparedness and are often required to take developmental classes to increase their academic skills to be successful in higher education. Further, few students possess self-regulated learning skills to aid in their learning. Researchers posited that academically…

Regulation of planar growth by the Arabidopsis AGC protein kinase UNICORN.

PubMed

Enugutti, Balaji; Kirchhelle, Charlotte; Oelschner, Maxi; Torres Ruiz, Ramón Angel; Schliebner, Ivo; Leister, Dario; Schneitz, Kay

2012-09-11

The spatial coordination of growth is of central importance for the regulation of plant tissue architecture. Individual layers, such as the epidermis, are clonally propagated and structurally maintained by symmetric cell divisions that are oriented along the plane of the layer. The developmental control of this process is poorly understood. The simple cellular basis and sheet-like structure of Arabidopsis integuments make them an attractive model system to address planar growth. Here we report on the characterization of the Arabidopsis UNICORN (UCN) gene. Analysis of ucn integuments reveals localized distortion of planar growth, eventually resulting in an ectopic multicellular protrusion. In addition, ucn mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. We further show that UCN encodes an active AGC VIII kinase. Genetic, biochemical, and cell biological data suggest that UCN suppresses ectopic growth in integuments by directly repressing the KANADI transcription factor ABERRANT TESTA SHAPE. Our findings indicate that UCN represents a unique plant growth regulator that maintains planar growth of integuments by repressing a developmental regulator involved in the control of early integument growth and polarity.

Drosophila Fragile X Mental Retardation Protein Developmentally Regulates Activity-Dependent Axon Pruning

PubMed Central

Tessier, Charles R.; Broadie, Kendal

2014-01-01

Summary Fragile X Syndrome (FraX) is a broad-spectrum neurological disorder with symptoms ranging from hyperexcitability to mental retardation and autism. Loss of the fragile X mental retardation 1 (fmr1) gene product, the mRNA-binding translational regulator FMRP, causes structural over-elaboration of dendritic and axonal processes as well as functional alterations in synaptic plasticity at maturity. It is unclear, however, whether FraX is primarily a disease of development, a disease of plasticity or both; a distinction vital for engineering intervention strategies. To address this critical issue, we have used the Drosophila FraX model to investigate the developmental roles of Drosophila FMRP (dFMRP). dFMRP expression and regulation of chickadee/profilin coincides with a transient window of late brain development. During this time, dFMRP is positively regulated by sensory input activity, and required to limit axon growth and for efficient activity-dependent pruning of axon branches in the Mushroom Body learning/memory center. These results demonstrate that dFMRP has a primary role in activity-dependent neural circuit refinement in late brain development. PMID:18321984

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE PAGES

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.; ...

2017-04-26

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

miR-14 regulates autophagy during developmental cell death by targeting ip3-kinase 2.

PubMed

Nelson, Charles; Ambros, Victor; Baehrecke, Eric H

2014-11-06

Macroautophagy (autophagy) is a lysosome-dependent degradation process that has been implicated in age-associated diseases. Autophagy is involved in both cell survival and cell death, but little is known about the mechanisms that distinguish its use during these distinct cell fates. Here, we identify the microRNA miR-14 as being both necessary and sufficient for autophagy during developmentally regulated cell death in Drosophila. Loss of miR-14 prevented induction of autophagy during salivary gland cell death, but had no effect on starvation-induced autophagy in the fat body. Moreover, misexpression of miR-14 was sufficient to prematurely induce autophagy in salivary glands, but not in the fat body. Importantly, miR-14 regulates this context-specific autophagy through its target, inositol 1,4,5-trisphosphate kinase 2 (ip3k2), thereby affecting inositol 1,4,5-trisphosphate (IP3) signaling and calcium levels during salivary gland cell death. This study provides in vivo evidence of microRNA regulation of autophagy through modulation of IP3 signaling. Copyright © 2014 Elsevier Inc. All rights reserved.

Alcohol exposure during development: Impact on the epigenome.

PubMed

Perkins, Amy; Lehmann, Claudia; Lawrence, R Charles; Kelly, Sandra J

2013-10-01

Fetal alcohol spectrum disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposureresulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol's impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. Copyright © 2013 ISDN. Published by Elsevier Ltd. All rights reserved.

Alcohol exposure during development: Impact on the epigenome

PubMed Central

Perkins, Amy; Lehmann, Claudia; Lawrence, R. Charles; Kelly, Sandra J.

2013-01-01

Fetal Alcohol Spectrum Disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposure resulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol’s impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. PMID:23542005

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TAF-4.

PubMed

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling

2008-10-03

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TFIID component TAF-4

PubMed Central

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M.; Lin, Rueyling

2008-01-01

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1–P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres, but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II following fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wildtype OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators. PMID:18854162

Nitric Oxide Regulates Protein Methylation during Stress Responses in Plants.

PubMed

Hu, Jiliang; Yang, Huanjie; Mu, Jinye; Lu, Tiancong; Peng, Juli; Deng, Xian; Kong, Zhaosheng; Bao, Shilai; Cao, Xiaofeng; Zuo, Jianru

2017-08-17

Methylation and nitric oxide (NO)-based S-nitrosylation are highly conserved protein posttranslational modifications that regulate diverse biological processes. In higher eukaryotes, PRMT5 catalyzes Arg symmetric dimethylation, including key components of the spliceosome. The Arabidopsis prmt5 mutant shows severe developmental defects and impaired stress responses. However, little is known about the mechanisms regulating the PRMT5 activity. Here, we report that NO positively regulates the PRMT5 activity through S-nitrosylation at Cys-125 during stress responses. In prmt5-1 plants, a PRMT5 C125S transgene, carrying a non-nitrosylatable mutation at Cys-125, fully rescues the developmental defects, but not the stress hypersensitive phenotype and the responsiveness to NO during stress responses. Moreover, the salt-induced Arg symmetric dimethylation is abolished in PRMT5 C125S /prmt5-1 plants, correlated to aberrant splicing of pre-mRNA derived from a stress-related gene. These findings define a mechanism by which plants transduce stress-triggered NO signal to protein methylation machinery through S-nitrosylation of PRMT5 in response to environmental alterations. Copyright © 2017 Elsevier Inc. All rights reserved.

10 CFR 431.2 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... defined in § 431.12; commercial heating, ventilating, and air conditioning, and water heating product... distributor of the covered equipment being evaluated. ISO means International Organization for Standardization... territory or possession of the United States. State regulation means a law or regulation of a State or...

Breeding for plant heat tolerance at vegetative and reproductive stages.

PubMed

Driedonks, Nicky; Rieu, Ivo; Vriezen, Wim H

2016-06-01

Thermotolerant crop research. Global warming has become a serious worldwide threat. High temperature is a major environmental factor limiting crop productivity. Current adaptations to high temperature via alterations to technical and management systems are insufficient to sustain yield. For this reason, breeding for heat-tolerant crops is in high demand. This review provides an overview of the effects of high temperature on plant physiology, fertility and crop yield and discusses the strategies for breeding heat-tolerant cultivars. Generating thermotolerant crops seems to be a challenging task as heat sensitivity is highly variable across developmental stages and processes. In response to heat, plants trigger a cascade of events, switching on numerous genes. Although breeding has made substantial advances in developing heat-tolerant lines, the genetic basis and diversity of heat tolerance in plants remain largely unknown. The development of new varieties is expensive and time-consuming, and knowledge of heat tolerance mechanisms would aid the design of strategies to screen germplasm for heat tolerance traits. However, gains in heat tolerance are limited by the often narrow genetic diversity. Exploration and use of wild relatives and landraces in breeding can increase useful genetic diversity in current crops. Due to the complex nature of plant heat tolerance and its immediate global concern, it is essential to face this breeding challenge in a multidisciplinary holistic approach involving governmental agencies, private companies and academic institutions.

Early Developmental Disturbances of Cortical Inhibitory Neurons: Contribution to Cognitive Deficits in Schizophrenia

PubMed Central

Volk, David W.; Lewis, David A.

2014-01-01

Cognitive dysfunction is a disabling and core feature of schizophrenia. Cognitive impairments have been linked to disturbances in inhibitory (gamma-aminobutyric acid [GABA]) neurons in the prefrontal cortex. Cognitive deficits are present well before the onset of psychotic symptoms and have been detected in early childhood with developmental delays reported during the first year of life. These data suggest that the pathogenetic process that produces dysfunction of prefrontal GABA neurons in schizophrenia may be related to altered prenatal development. Interestingly, adult postmortem schizophrenia brain tissue studies have provided evidence consistent with a disease process that affects different stages of prenatal development of specific subpopulations of prefrontal GABA neurons. Prenatal ontogeny (ie, birth, proliferation, migration, and phenotypic specification) of distinct subpopulations of cortical GABA neurons is differentially regulated by a host of transcription factors, chemokine receptors, and other molecular markers. In this review article, we propose a strategy to investigate how alterations in the expression of these developmental regulators of subpopulations of cortical GABA neurons may contribute to the pathogenesis of cortical GABA neuron dysfunction and consequently cognitive impairments in schizophrenia. PMID:25053651

Requirements for efficient cell-type proportioning: regulatory timescales, stochasticity and lateral inhibition

NASA Astrophysics Data System (ADS)

Pfeuty, B.; Kaneko, K.

2016-04-01

The proper functioning of multicellular organisms requires the robust establishment of precise proportions between distinct cell types. This developmental differentiation process typically involves intracellular regulatory and stochastic mechanisms to generate cell-fate diversity as well as intercellular signaling mechanisms to coordinate cell-fate decisions at tissue level. We thus surmise that key insights about the developmental regulation of cell-type proportion can be captured by the modeling study of clustering dynamics in population of inhibitory-coupled noisy bistable systems. This general class of dynamical system is shown to exhibit a very stable two-cluster state, but also metastability, collective oscillations or noise-induced state hopping, which can prevent from timely and reliably reaching a robust and well-proportioned clustered state. To circumvent these obstacles or to avoid fine-tuning, we highlight a general strategy based on dual-time positive feedback loops, such as mediated through transcriptional versus epigenetic mechanisms, which improves proportion regulation by coordinating early and flexible lineage priming with late and firm commitment. This result sheds new light on the respective and cooperative roles of multiple regulatory feedback, stochasticity and lateral inhibition in developmental dynamics.

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Developmental effects on ureide levels are mediated by tissue-specific regulation of allantoinase in Phaseolus vulgaris L.

PubMed

Díaz-Leal, Juan Luis; Gálvez-Valdivieso, Gregorio; Fernández, Javier; Pineda, Manuel; Alamillo, Josefa M

2012-06-01

The ureides allantoin and allantoate are key molecules in the transport and storage of nitrogen in ureide legumes. In shoots and leaves from Phaseolus vulgaris plants using symbiotically fixed nitrogen as the sole nitrogen source, ureide levels were roughly equivalent to those of nitrate-supported plants during the whole vegetative stage, but they exhibited a sudden increase at the onset of flowering. This rise in the level of ureides, mainly in the form of allantoate, was accompanied by increases in allantoinase gene expression and enzyme activity, consistent with developmental regulation of ureide levels mainly through the tissue-specific induction of allantoate synthesis catalysed by allantoinase. Moreover, surprisingly high levels of ureides were also found in non-nodulated plants fertilized with nitrate, at both early and late developmental stages. The results suggest that remobilized N from lower leaves is probably involved in the sharp rise in ureides in shoots and leaves during early pod filling in N(2)-fixing plants and in the significant amounts of ureides observed in non-nodulated plants.

Maturation of the growth axis in marsupials occurs gradually during post-natal life and over an equivalent developmental stage relative to eutherian species.

PubMed

Menzies, Brandon R; Shaw, Geoffrey; Fletcher, Terry P; Pask, Andrew J; Renfree, Marilyn B

2012-02-26

The separation of a nutrition-responsive insulin-like growth factor (IGF) system and a growth hormone (GH) responsive IGF system to control pre- and post-natal growth of developing mammals may originate from the constraints imposed by intra-uterine development. In eutherian species that deliver relatively precocial young, maturation of the GH regulatory system is coincident with the time of birth. We measured the hepatic expression of the four key growth axis genes GH-receptor, IGF-1 and -2, and IGFBBP-3, and plasma protein concentrations of IGF-1 from late fetal life through to adult stages of a marsupial, the tammar wallaby. The data clearly show that maturation of GH-regulated growth in marsupials occurs gradually over the course of post-natal life at an equivalent developmental stage to that of precocial eutherian mammals. This suggests that the timing of GH-regulated growth in marsupials is not related to parturition but instead to the relative developmental stage. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

STRUCTURE-ACTIVITY RELATIONSHIP AMONG ORGANOTINS IN AN IN VITRO MODEL OF NEURONAL DIFFERENTIATION AND PROGRAMMED CELL DEATH.

EPA Science Inventory

The organotins are used as heat stabilizers in PVC pipes and as marine biocides. Human exposure to monomethyltin (MMT) and dimethyltin (DMT) can occur in the water supply as a result of leaching from PVC pipes. Developmental exposure of rats to MMT and the known neurotoxicant t...

Exploring the Williams Syndrome Face-Processing Debate: The Importance of Building Developmental Trajectories

ERIC Educational Resources Information Center

Karmiloff-Smith, Annette; Thomas, Michael; Annaz, Dagmara; Humphreys, Kate; Ewing, Sandra; Brace, Nicola; Van Duuren, Mike; Pike, Graham; Grice, Sarah; Campbell, Ruth

2004-01-01

Background: Face processing in Williams syndrome (WS) has been a topic of heated debate over the past decade. Initial claims about a normally developing ("intact") face-processing module were challenged by data suggesting that individuals with WS used a different balance of cognitive processes from controls, even when their behavioural scores fell…

Thermal Vacuum Testing of a Proto-flight Miniature Loop Heat Pipe with Two Evaporators and Two Condensers

NASA Technical Reports Server (NTRS)

Ku, Jentung; Ottenstein, Laura

2011-01-01

This paper describes thermal vacuum testing of a proto-flight miniature loop heat pipe (MLHP) with two evaporators and two condensers designed for future small systems applications requiring low mass, low power and compactness. Each evaporator contains a wick with an outer diameter of 6.35 mm, and each has its own integral compensation chamber (CC). Miniaturization of the loop components reduces the volume and mass of the thermal system. Multiple evaporators provide flexibility for placement of instruments that need to be maintained at the same temperature, and facilitate heat load sharing among instruments, reducing the auxiliary heater power requirement. A flow regulator is used to regulate heat dissipations between the two condensers, allowing flexible placement of radiators on the spacecraft. A thermoelectric converter (TEC) is attached to each CC for control of the operating temperature and enhancement of start-up success. Tests performed include start-up, power cycle, sink temperature cycle, high power and low power operation, heat load sharing, and operating temperature control. The proto-flight MLHP demonstrated excellent performance in the thermal vacuum test. The loop started successfully and operated stably under various evaporator heat loads and condenser sink temperatures. The TECs were able to maintain the loop operating temperature within b1K of the desired set point temperature at all power levels and all sink temperatures. The un-powered evaporator would automatically share heat from the other powered evaporator. The flow regulator was able to regulate the heat dissipation among the radiators and prevent vapor from flowing into the liquid line.

Heat shock factor 2 is required for maintaining proteostasis against febrile-range thermal stress and polyglutamine aggregation

PubMed Central

Shinkawa, Toyohide; Tan, Ke; Fujimoto, Mitsuaki; Hayashida, Naoki; Yamamoto, Kaoru; Takaki, Eiichi; Takii, Ryosuke; Prakasam, Ramachandran; Inouye, Sachiye; Mezger, Valerie; Nakai, Akira

2011-01-01

Heat shock response is characterized by the induction of heat shock proteins (HSPs), which facilitate protein folding, and non-HSP proteins with diverse functions, including protein degradation, and is regulated by heat shock factors (HSFs). HSF1 is a master regulator of HSP expression during heat shock in mammals, as is HSF3 in avians. HSF2 plays roles in development of the brain and reproductive organs. However, the fundamental roles of HSF2 in vertebrate cells have not been identified. Here we find that vertebrate HSF2 is activated during heat shock in the physiological range. HSF2 deficiency reduces threshold for chicken HSF3 or mouse HSF1 activation, resulting in increased HSP expression during mild heat shock. HSF2-null cells are more sensitive to sustained mild heat shock than wild-type cells, associated with the accumulation of ubiquitylated misfolded proteins. Furthermore, loss of HSF2 function increases the accumulation of aggregated polyglutamine protein and shortens the lifespan of R6/2 Huntington's disease mice, partly through αB-crystallin expression. These results identify HSF2 as a major regulator of proteostasis capacity against febrile-range thermal stress and suggest that HSF2 could be a promising therapeutic target for protein-misfolding diseases. PMID:21813737

ATF1 Modulates the Heat Shock Response by Regulating the Stress-Inducible Heat Shock Factor 1 Transcription Complex

PubMed Central

Takii, Ryosuke; Fujimoto, Mitsuaki; Tan, Ke; Takaki, Eiichi; Hayashida, Naoki; Nakato, Ryuichiro; Shirahige, Katsuhiko

2014-01-01

The heat shock response is an evolutionally conserved adaptive response to high temperatures that controls proteostasis capacity and is regulated mainly by an ancient heat shock factor (HSF). However, the regulation of target genes by the stress-inducible HSF1 transcription complex has not yet been examined in detail in mammalian cells. In the present study, we demonstrated that HSF1 interacted with members of the ATF1/CREB family involved in metabolic homeostasis and recruited them on the HSP70 promoter in response to heat shock. The HSF1 transcription complex, including the chromatin-remodeling factor BRG1 and lysine acetyltransferases p300 and CREB-binding protein (CBP), was formed in a manner that was dependent on the phosphorylation of ATF1. ATF1-BRG1 promoted the establishment of an active chromatin state and HSP70 expression during heat shock, whereas ATF1-p300/CBP accelerated the shutdown of HSF1 DNA-binding activity during recovery from acute stress, possibly through the acetylation of HSF1. Furthermore, ATF1 markedly affected the resistance to heat shock. These results revealed the unanticipated complexity of the primitive heat shock response mechanism, which is connected to metabolic adaptation. PMID:25312646

BAG3 affects the nucleocytoplasmic shuttling of HSF1 upon heat stress.

PubMed

Jin, Young-Hee; Ahn, Sang-Gun; Kim, Soo-A

2015-08-21

Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a novel role for BAG3 in regulating the nuclear shuttling of HSF1 during heat stress. The expression level of BAG3 was induced by heat stress in HeLa cells. Interestingly, BAG3 rapidly translocalized to the nucleus upon heat stress. Immunoprecipitation assay showed that BAG3 interacts with HSF1 under normal and stressed conditions and co-translocalizes to the nucleus upon heat stress. We also demonstrated that BAG3 interacts with HSF1 via its BAG domain. Over-expression of BAG3 down-regulates the level of nuclear HSF1 by exporting it to the cytoplasm during the recovery period. Depletion of BAG3 using siRNA results in reduced nuclear HSF1 and decreased Hsp70 promoter activity. BAG3 in MEF(hsf1(-/-)) cells actively translocalizes to the nucleus upon heat stress suggesting that BAG3 plays a key role in the processing of the nucleocytoplasmic shuttling of HSF1 upon heat stress. Copyright © 2015 Elsevier Inc. All rights reserved.

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

Genome-Wide Analysis of the AP2/ERF Family in Eucalyptus grandis: An Intriguing Over-Representation of Stress-Responsive DREB1/CBF Genes

PubMed Central

SanClemente, H.; Mounet, F.; Dunand, C.; Marque, G.; Marque, C.; Teulières, C.

2015-01-01

Background The AP2/ERF family includes a large number of developmentally and physiologically important transcription factors sharing an AP2 DNA-binding domain. Among them DREB1/CBF and DREB2 factors are known as master regulators respectively of cold and heat/osmotic stress responses. Experimental Approaches The manual annotation of AP2/ERF family from Eucalyptus grandis, Malus, Populus and Vitis genomes allowed a complete phylogenetic study for comparing the structure of this family in woody species and the model Arabidopsis thaliana. Expression profiles of the whole groups of EgrDREB1 and EgrDREB2 were investigated through RNAseq database survey and RT-qPCR analyses. Results The structure and the size of the AP2/ERF family show a global conservation for the plant species under comparison. In addition to an expansion of the ERF subfamily, the tree genomes mainly differ with respect to the group representation within the subfamilies. With regard to the E. grandis DREB subfamily, an obvious feature is the presence of 17 DREB1/CBF genes, the maximum reported to date for dicotyledons. In contrast, only six DREB2 have been identified, which is similar to the other plants species under study, except for Malus. All the DREB1/CBF and DREB2 genes from E. grandis are expressed in at least one condition and all are heat-responsive. Regulation by cold and drought depends on the genes but is not specific of one group; DREB1/CBF group is more cold-inducible than DREB2 which is mainly drought responsive. Conclusion These features suggest that the dramatic expansion of the DREB1/CBF group might be related to the adaptation of this evergreen tree to climate changes when it expanded in Australia. PMID:25849589

A Dynamic Neural Network Approach to CBM

DTIC Science & Technology

2011-03-15

high efficiency water cooled heat exchanger positioned on the side of the engine. The air temperature was controlled at the desired set-point by...regulating the inlet water flow in the heat exchanger. The temperature of the cooling water was not regulated. The typical set-point for the air charge...temperature was 127 degF, as used in other durability tests carried out in these facilities. Because the heat exchanger controller was optimized for

Internal thermotopography and shifts in general thermal balance in man under special heat transfer conditions

NASA Technical Reports Server (NTRS)

Gorodinskiy, S. M.; Gramenitskiy, P. M.; Kuznets, Y. I.; Ozerov, O. Y.; Yakovleva, E. V.; Groza, P.; Kozlovskiy, S.; Naremski, Y.

1974-01-01

Thermal regulation for astronauts working in pressure suits in open space provides for protection by a system of artificial heat removal and compensation to counteract possible changes in the heat regulating function of the human body that occur under the complex effects of space flight conditions. Most important of these factors are prolonged weightlessness, prolonged limitation of motor activity, and possible deviations of microclimatic environmental parameters.

Mechanisms of embryonic stomach development.

PubMed

McCracken, Kyle W; Wells, James M

2017-06-01

The stomach is a digestive organ that has important roles in human physiology and pathophysiology. The developmental origin of the stomach is the embryonic foregut, which also gives rise a number of other structures. There are several signaling pathways and transcription factors that are known to regulate stomach development at different stages, including foregut patterning, stomach specification, and gastric regionalization. These developmental events have important implications in later homeostasis and disease in the adult stomach. Here we will review the literature that has shaped our current understanding of the molecular mechanisms that coordinate gastric organogenesis. Further we will discuss how developmental paradigms have guided recent efforts to differentiate stomach tissue from pluripotent stem cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

The developmental roots of social responsibility in childhood and adolescence.

PubMed

Wray-Lake, Laura; Syvertsen, Amy K

2011-01-01

Social responsibility is a value orientation, rooted in democratic relationships with others and moral principles of care and justice, that motivates certain civic actions. Given its relevance for building stronger relationships and communities, the development of social responsibility within individuals should be a more concerted focus for developmental scholars and youth practitioners. During childhood and adolescence, the developmental roots of individuals' social responsibility lie in the growth of executive function, empathy and emotion regulation, and identity. Efforts to cultivate children and adolescents' social responsibility in the proximal settings of their everyday lives should emphasize modeling prosocial behaviors, communicating concerns for others, and creating opportunities to practice civic skills. Copyright © 2011 Wiley Periodicals, Inc., A Wiley Company.

Quantitative assessment of pheromone-induced Dauer formation in Caenorhabditis elegans.

PubMed

Neal, Scott J; Kim, Kyuhyung; Sengupta, Piali

2013-01-01

Environmental conditions experienced during early larval stages dictate the developmental trajectory of the nematode C. elegans. Favorable conditions such as low population density, abundant food, and lower temperatures allow reproductive growth, while stressful conditions promote entry of second-stage (L2) larvae into the alternate dauer developmental stage. Population density is signaled by the concentration and composition of a complex mixture of small molecules that is produced by all stages of animals, and is collectively referred to as dauer pheromone; pheromone concentration is a major trigger for dauer formation. Here, we describe a quantitative dauer formation assay that provides a measure of the potency of single or mixtures of pheromone components in regulating this critical developmental decision.

De novo pathogenic variants in CHAMP1 are associated with global developmental delay, intellectual disability, and dysmorphic facial features.

PubMed

Tanaka, Akemi J; Cho, Megan T; Retterer, Kyle; Jones, Julie R; Nowak, Catherine; Douglas, Jessica; Jiang, Yong-Hui; McConkie-Rosell, Allyn; Schaefer, G Bradley; Kaylor, Julie; Rahman, Omar A; Telegrafi, Aida; Friedman, Bethany; Douglas, Ganka; Monaghan, Kristin G; Chung, Wendy K

2016-01-01

We identified five unrelated individuals with significant global developmental delay and intellectual disability (ID), dysmorphic facial features and frequent microcephaly, and de novo predicted loss-of-function variants in chromosome alignment maintaining phosphoprotein 1 (CHAMP1). Our findings are consistent with recently reported de novo mutations in CHAMP1 in five other individuals with similar features. CHAMP1 is a zinc finger protein involved in kinetochore-microtubule attachment and is required for regulating the proper alignment of chromosomes during metaphase in mitosis. Mutations in CHAMP1 may affect cell division and hence brain development and function, resulting in developmental delay and ID.

Patterns of odour emission, thermogenesis and pollinator activity in cones of an African cycad: what mechanisms apply?

PubMed

Suinyuy, Terence N; Donaldson, John S; Johnson, Steven D

2013-09-01

Ontogenetic patterns of odour emissions and heating associated with plant reproductive structures may have profound effects on insect behaviour, and consequently on pollination. In some cycads, notably Macrozamia, temporal changes in emission of specific odour compounds and temperature have been interpreted as a 'push-pull' interaction in which pollinators are either attracted or repelled according to the concentration of the emitted volatiles. To establish which mechanisms occur in the large Encephalartos cycad clade, the temporal patterns of volatile emissions, heating and pollinator activity of cones of Encephalartos villosus in the Eastern Cape (EC) and KwaZulu Natal (KZN) of South Africa were investigated. Gas chromatography-mass spectrometry (GC-MS) analyses of Encephalartos villosus cone volatiles showed that emissions, dominated by eucalyptol and 2-isopropyl-3-methoxypyrazine in EC populations and (3E)-1,3-octadiene and (3E,5Z)-1,3,5-octatriene in the KZN populations, varied across developmental stages but did not vary significantly on a daily cycle. Heating in male cones was higher at dehiscence than during pre- and post-dehiscence, and reached a maximum at about 1830 h when temperatures were between 7·0 and 12·0 °C above ambient. Daily heating of female cones was less pronounced and reached a maximum at about 1345 h when it was on average between 0·9 and 3·0 °C above ambient. Insect abundance on male cones was higher at dehiscence than at the other stages and significantly higher in the afternoon than in the morning and evening. There are pronounced developmental changes in volatile emissions and heating in E. villosus cones, as well as strong daily changes in thermogenesis. Daily patterns of volatile emissions and pollinator abundance in E. villosus are different from those observed in some Macrozamia cycads and not consistent with the push-pull pattern as periods of peak odour emission do not coincide with mass exodus of insects from male cones.

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Analysis of model replication origins in Drosophila reveals new aspects of the chromatin landscape and its relationship to origin activity and the prereplicative complex

PubMed Central

Liu, Jun; McConnell, Kristopher; Dixon, Michael; Calvi, Brian R.

2012-01-01

Epigenetic regulation exerts a major influence on origins of DNA replication during development. The mechanisms for this regulation, however, are poorly defined. We showed previously that acetylation of nucleosomes regulates the origins that mediate developmental gene amplification during Drosophila oogenesis. Here we show that developmental activation of these origins is associated with acetylation of multiple histone lysines. Although these modifications are not unique to origin loci, we find that the level of acetylation is higher at the active origins and quantitatively correlated with the number of times these origins initiate replication. All of these acetylation marks were developmentally dynamic, rapidly increasing with origin activation and rapidly declining when the origins shut off and neighboring promoters turn on. Fine-scale analysis of the origins revealed that both hyperacetylation of nucleosomes and binding of the origin recognition complex (ORC) occur in a broad domain and that acetylation is highest on nucleosomes adjacent to one side of the major site of replication initiation. It was surprising to find that acetylation of some lysines depends on binding of ORC to the origin, suggesting that multiple histone acetyltransferases may be recruited during origin licensing. Our results reveal new insights into the origin epigenetic landscape and lead us to propose a chromatin switch model to explain the coordination of origin and promoter activity during development. PMID:22049023

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower

PubMed Central

Silva, Catarina S.; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

2016-01-01

Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These “developmental control genes” and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction – LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower. PMID:26779227