Mining secreted proteins that function in pepper fruit development and ripening using a yeast secretion trap (YST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Je Min, E-mail: jemin@knu.ac.kr; Department of Horticultural Science, Kyungpook National University, Daegu; Lee, Sang-Jik

Highlights: • Yeast secretion trap (YST) is a valuable tool for mining secretome. • A total of 80 secreted proteins are newly identified via YST in pepper fruits. • The secreted proteins are differentially regulated during pepper development and ripening. • Transient GFP-fusion assay and in planta secretion trap can effectively validate the secretion of proteins. - Abstract: Plant cells secrete diverse sets of constitutively- and conditionally-expressed proteins under various environmental and developmental states. Secreted protein populations, or secretomes have multiple functions, including defense responses, signaling, metabolic processes, and developmental regulation. To identify genes encoding secreted proteins that function inmore » fruit development and ripening, a yeast secretion trap (YST) screen was employed using pepper (Capsicum annuum) fruit cDNAs. The YST screen revealed 80 pepper fruit-related genes (CaPFRs) encoding secreted proteins including cell wall proteins, several of which have not been previously described. Transient GFP-fusion assay and an in planta secretion trap were used to validate the secretion of proteins encoded by selected YST clones. In addition, RNA gel blot analyses provided further insights into their expression and regulation during fruit development and ripening. Integrating our data, we conclude that the YST provides a valuable functional genomics tool for the identification of substantial numbers of novel secreted plant proteins that are associated with biological processes, including fruit development and ripening.« less

The Fibroblast Growth Factor signaling pathway.

PubMed

Ornitz, David M; Itoh, Nobuyuki

2015-01-01

The signaling component of the mammalian Fibroblast Growth Factor (FGF) family is comprised of eighteen secreted proteins that interact with four signaling tyrosine kinase FGF receptors (FGFRs). Interaction of FGF ligands with their signaling receptors is regulated by protein or proteoglycan cofactors and by extracellular binding proteins. Activated FGFRs phosphorylate specific tyrosine residues that mediate interaction with cytosolic adaptor proteins and the RAS-MAPK, PI3K-AKT, PLCγ, and STAT intracellular signaling pathways. Four structurally related intracellular non-signaling FGFs interact with and regulate the family of voltage gated sodium channels. Members of the FGF family function in the earliest stages of embryonic development and during organogenesis to maintain progenitor cells and mediate their growth, differentiation, survival, and patterning. FGFs also have roles in adult tissues where they mediate metabolic functions, tissue repair, and regeneration, often by reactivating developmental signaling pathways. Consistent with the presence of FGFs in almost all tissues and organs, aberrant activity of the pathway is associated with developmental defects that disrupt organogenesis, impair the response to injury, and result in metabolic disorders, and cancer. For further resources related to this article, please visit the WIREs website. © 2015 The Authors. WIREs Developmental Biology published by Wiley Periodicals, Inc.

Phosphoproteomic analysis of the Chlamydia caviae elementary body and reticulate body forms

PubMed Central

Adams, Nancy E.; Maurelli, Anthony T.

2015-01-01

Chlamydia are Gram-negative, obligate intracellular bacteria responsible for significant diseases in humans and economically important domestic animals. These pathogens undergo a unique biphasic developmental cycle transitioning between the environmentally stable elementary body (EB) and the replicative intracellular reticulate body (RB), a conversion that appears to require extensive regulation of protein synthesis and function. However, Chlamydia possess a limited number of canonical mechanisms of transcriptional regulation. Ser/Thr/Tyr phosphorylation of proteins in bacteria has been increasingly recognized as an important mechanism of post-translational control of protein function. We utilized 2D gel electrophoresis coupled with phosphoprotein staining and MALDI-TOF/TOF analysis to map the phosphoproteome of the EB and RB forms of Chlamydia caviae. Forty-two non-redundant phosphorylated proteins were identified (some proteins were present in multiple locations within the gels). Thirty-four phosphorylated proteins were identified in EBs, including proteins found in central metabolism and protein synthesis, Chlamydia-specific hypothetical proteins and virulence-related proteins. Eleven phosphorylated proteins were identified in RBs, mostly involved in protein synthesis and folding and a single virulence-related protein. Only three phosphoproteins were found in both EB and RB phosphoproteomes. Collectively, 41 of 42 C. caviae phosphoproteins were present across Chlamydia species, consistent with the existence of a conserved chlamydial phosphoproteome. The abundance of stage-specific phosphoproteins suggests that protein phosphorylation may play a role in regulating the function of developmental-stage-specific proteins and/or may function in concert with other factors in directing EB–RB transitions. PMID:25998263

Phosphoproteomic analysis of the Chlamydia caviae elementary body and reticulate body forms.

PubMed

Fisher, Derek J; Adams, Nancy E; Maurelli, Anthony T

2015-08-01

Chlamydia are Gram-negative, obligate intracellular bacteria responsible for significant diseases in humans and economically important domestic animals. These pathogens undergo a unique biphasic developmental cycle transitioning between the environmentally stable elementary body (EB) and the replicative intracellular reticulate body (RB), a conversion that appears to require extensive regulation of protein synthesis and function. However, Chlamydia possess a limited number of canonical mechanisms of transcriptional regulation. Ser/Thr/Tyr phosphorylation of proteins in bacteria has been increasingly recognized as an important mechanism of post-translational control of protein function. We utilized 2D gel electrophoresis coupled with phosphoprotein staining and MALDI-TOF/TOF analysis to map the phosphoproteome of the EB and RB forms of Chlamydia caviae. Forty-two non-redundant phosphorylated proteins were identified (some proteins were present in multiple locations within the gels). Thirty-four phosphorylated proteins were identified in EBs, including proteins found in central metabolism and protein synthesis, Chlamydia-specific hypothetical proteins and virulence-related proteins. Eleven phosphorylated proteins were identified in RBs, mostly involved in protein synthesis and folding and a single virulence-related protein. Only three phosphoproteins were found in both EB and RB phosphoproteomes. Collectively, 41 of 42 C. caviae phosphoproteins were present across Chlamydia species, consistent with the existence of a conserved chlamydial phosphoproteome. The abundance of stage-specific phosphoproteins suggests that protein phosphorylation may play a role in regulating the function of developmental-stage-specific proteins and/or may function in concert with other factors in directing EB-RB transitions.

Polycomb Group (PcG) Proteins and Human Cancers: Multifaceted Functions and Therapeutic Implications.

PubMed

Wang, Wei; Qin, Jiang-Jiang; Voruganti, Sukesh; Nag, Subhasree; Zhou, Jianwei; Zhang, Ruiwen

2015-11-01

Polycomb group (PcG) proteins are transcriptional repressors that regulate several crucial developmental and physiological processes in the cell. More recently, they have been found to play important roles in human carcinogenesis and cancer development and progression. The deregulation and dysfunction of PcG proteins often lead to blocking or inappropriate activation of developmental pathways, enhancing cellular proliferation, inhibiting apoptosis, and increasing the cancer stem cell population. Genetic and molecular investigations of PcG proteins have long been focused on their PcG functions. However, PcG proteins have recently been shown to exert non-classical-Pc-functions, contributing to the regulation of diverse cellular functions. We and others have demonstrated that PcG proteins regulate the expression and function of several oncogenes and tumor suppressor genes in a PcG-independent manner, and PcG proteins are associated with the survival of patients with cancer. In this review, we summarize the recent advances in the research on PcG proteins, including both the Pc-repressive and non-classical-Pc-functions. We specifically focus on the mechanisms by which PcG proteins play roles in cancer initiation, development, and progression. Finally, we discuss the potential value of PcG proteins as molecular biomarkers for the diagnosis and prognosis of cancer, and as molecular targets for cancer therapy. © 2015 Wiley Periodicals, Inc.

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, J.; Pei-Chen Lin, C.; Pathak, M. C.

2016-07-06

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumedmore » during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.« less

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.

2014-07-11

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumedmore » during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.« less

Nitric Oxide Regulates Protein Methylation during Stress Responses in Plants.

PubMed

Hu, Jiliang; Yang, Huanjie; Mu, Jinye; Lu, Tiancong; Peng, Juli; Deng, Xian; Kong, Zhaosheng; Bao, Shilai; Cao, Xiaofeng; Zuo, Jianru

2017-08-17

Methylation and nitric oxide (NO)-based S-nitrosylation are highly conserved protein posttranslational modifications that regulate diverse biological processes. In higher eukaryotes, PRMT5 catalyzes Arg symmetric dimethylation, including key components of the spliceosome. The Arabidopsis prmt5 mutant shows severe developmental defects and impaired stress responses. However, little is known about the mechanisms regulating the PRMT5 activity. Here, we report that NO positively regulates the PRMT5 activity through S-nitrosylation at Cys-125 during stress responses. In prmt5-1 plants, a PRMT5 C125S transgene, carrying a non-nitrosylatable mutation at Cys-125, fully rescues the developmental defects, but not the stress hypersensitive phenotype and the responsiveness to NO during stress responses. Moreover, the salt-induced Arg symmetric dimethylation is abolished in PRMT5 C125S /prmt5-1 plants, correlated to aberrant splicing of pre-mRNA derived from a stress-related gene. These findings define a mechanism by which plants transduce stress-triggered NO signal to protein methylation machinery through S-nitrosylation of PRMT5 in response to environmental alterations. Copyright © 2017 Elsevier Inc. All rights reserved.

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

PubMed Central

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

The PsB glycoprotein complex is secreted as a preassembled precursor of the spore coat in Dictyostelium discoideum.

PubMed

Watson, N; McGuire, V; Alexander, S

1994-09-01

The PsB glycoprotein in Dictyostelium discoideum is one of a diverse group of developmentally regulated, prespore-cell-specific proteins, that contain a common O-linked oligosaccharide. This post-translational modification is dependent on the wild-type modB allele. The PsB protein exists as part of a multiprotein complex of six different proteins, which have different post-translational modifications and are held together by both covalent and non-covalent interactions (Watson et al. (1993). J. Biol. Chem. 268, 22634-22641). In this study we have used microscopic and biochemical analyses to examine the cellular localization and function of the PsB complex during development. We found that the PsB complex first accumulates in prespore vesicles in slug cells and is secreted later during culmination and becomes localized to both the extracellular matrix of the apical spore mass of mature fruiting bodies and to the inner layer of the spore coat. The PsB associated with the spore coat is covalently bound by disulfide bridges. The PsB protein always exists in a multiprotein complex, but the composition of the PsB complex changes during secretion and spore maturation. Some of the PsB complex proteins have been identified as spore coat proteins. These data demonstrate that some of the proteins that form the spore coat exist as a preassembled precursor complex. The PsB complex is secreted in a developmentally regulated manner during the process of spore differentiation, at which time proteins of the complex, as well as additional spore coat proteins, become covalently associated in at least two forms of extracellular matrix: the interspore matrix and the spore coat. These and other studies show that proteins with modB dependent O-linked oligosaccharides are involved in a wide variety of processes underlying morphogenesis in this organism. These developmental processes are the direct result of cellular mechanisms regulating protein targeting, assembly and secretion, and the assembly of specific extracellular matrices.

Epigenetics and the Developmental Origins of Health and ...

EPA Pesticide Factsheets

Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells.

PubMed

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A; Engel, Felix B; Yamashita, Jun K

2013-12-01

The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provides therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells. The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse pluripotent stem cell-derived cardiomyocytes and identified 4 chemical compound groups: inhibitors of glycogen synthase kinase-3, p38 mitogen-activated protein kinase, and Ca(2+)/calmodulin-dependent protein kinase II, and activators of extracellular signal-regulated kinase. Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human pluripotent stem cells, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas extracellular signal-regulated kinase activators and Ca(2+)/calmodulin-dependent protein kinase II inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, glycogen synthase kinase-3 and p38 mitogen-activated protein kinase inhibitors substantially and synergistically induced re-entry and progression of cell cycle in neonatal but also as well as adult cardiomyocytes. Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered pluripotent stem cell-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies.

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

Callose homeostasis at plasmodesmata: molecular regulators and developmental relevance

PubMed Central

De Storme, Nico; Geelen, Danny

2014-01-01

Plasmodesmata are membrane-lined channels that are located in the plant cell wall and that physically interconnect the cytoplasm and the endoplasmic reticulum (ER) of adjacent cells. Operating as controllable gates, plasmodesmata regulate the symplastic trafficking of micro- and macromolecules, such as endogenous proteins [transcription factors (TFs)] and RNA-based signals (mRNA, siRNA, etc.), hence mediating direct cell-to-cell communication and long distance signaling. Besides this physiological role, plasmodesmata also form gateways through which viral genomes can pass, largely facilitating the pernicious spread of viral infections. Plasmodesmatal trafficking is either passive (e.g., diffusion) or active and responses both to developmental and environmental stimuli. In general, plasmodesmatal conductivity is regulated by the controlled build-up of callose at the plasmodesmatal neck, largely mediated by the antagonistic action of callose synthases (CalSs) and β-1,3-glucanases. Here, in this theory and hypothesis paper, we outline the importance of callose metabolism in PD SEL control, and highlight the main molecular factors involved. In addition, we also review other proteins that regulate symplastic PD transport, both in a developmental and stress-responsive framework, and discuss on their putative role in the modulation of PD callose turn-over. Finally, we hypothesize on the role of structural sterols in the regulation of (PD) callose deposition and outline putative mechanisms by which this regulation may occur. PMID:24795733

Developmental and light regulation of tumor suppressor protein PP2A in the retina

PubMed Central

Rajala, Ammaji; Wang, Yuhong; Abcouwer, Steven F.; Gardner, Thomas W.; Rajala, Raju V.S.

2018-01-01

Protein phosphatases are a group of universal enzymes that are responsible for the dephosphorylation of various proteins and enzymes in cells. Cellular signal transduction events are largely governed by the phosphorylation of key proteins. The length of cellular response depends on the activation of protein phosphatase that dephosphorylates the phosphate groups to halt a biological response, and fine-tune the defined cellular outcome. Dysregulation of these phosphatase(s) results in various disease phenotypes. The retina is a post-mitotic tissue, and oncogenic tyrosine and serine/ threonine kinase activities are important for retinal neuron survival. Aberrant activation of protein phosphatase(s) may have a negative effect on retinal neurons. In the current study, we characterized tumor suppressor protein phosphatase 2 (PP2A), a major serine/ threonine kinase with a broad substrate specificity. Our data suggest that PP2A is developmentally regulated in the retina, localized predominantly in the inner retina, and expressed in photoreceptor inner segments. Our findings indicate that PKCα and mTOR may serve as PP2A substrates. We found that light regulates PP2A activity. Our studies also suggest that rhodopsin regulates PP2A and its substrate(s) dephosphorylation. PP2A substrate phosphorylation is increased in mice lacking the A-subunit of PP2A. However, there is no accompanying effect on retina structure and function. Together, our findings suggest that controlling the activity of PP2A in the retina may be neuroprotective. PMID:29416710

Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

PubMed

Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

2016-07-01

Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

Differential expression of calcium-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit

USDA-ARS?s Scientific Manuscript database

Calcium has been shown to increase stress tolerance, enhance fruit firmness and reduce decay. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also resp...

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

Poly(A) tail length regulates PABPC1 expression to tune translation in the heart.

PubMed

Chorghade, Sandip; Seimetz, Joseph; Emmons, Russell; Yang, Jing; Bresson, Stefan M; Lisio, Michael De; Parise, Gianni; Conrad, Nicholas K; Kalsotra, Auinash

2017-06-27

The rate of protein synthesis in the adult heart is one of the lowest in mammalian tissues, but it increases substantially in response to stress and hypertrophic stimuli through largely obscure mechanisms. Here, we demonstrate that regulated expression of cytosolic poly(A)-binding protein 1 (PABPC1) modulates protein synthetic capacity of the mammalian heart. We uncover a poly(A) tail-based regulatory mechanism that dynamically controls PABPC1 protein synthesis in cardiomyocytes and thereby titrates cellular translation in response to developmental and hypertrophic cues. Our findings identify PABPC1 as a direct regulator of cardiac hypertrophy and define a new paradigm of gene regulation in the heart, where controlled changes in poly(A) tail length influence mRNA translation.

Neuron class-specific requirements for Fragile X Mental Retardation Protein in critical period development of calcium signaling in learning and memory circuitry.

PubMed

Doll, Caleb A; Broadie, Kendal

2016-05-01

Neural circuit optimization occurs through sensory activity-dependent mechanisms that refine synaptic connectivity and information processing during early-use developmental critical periods. Fragile X Mental Retardation Protein (FMRP), the gene product lost in Fragile X syndrome (FXS), acts as an activity sensor during critical period development, both as an RNA-binding translation regulator and channel-binding excitability regulator. Here, we employ a Drosophila FXS disease model to assay calcium signaling dynamics with a targeted transgenic GCaMP reporter during critical period development of the mushroom body (MB) learning/memory circuit. We find FMRP regulates depolarization-induced calcium signaling in a neuron-specific manner within this circuit, suppressing activity-dependent calcium transients in excitatory cholinergic MB input projection neurons and enhancing calcium signals in inhibitory GABAergic MB output neurons. Both changes are restricted to the developmental critical period and rectified at maturity. Importantly, conditional genetic (dfmr1) rescue of null mutants during the critical period corrects calcium signaling defects in both neuron classes, indicating a temporally restricted FMRP requirement. Likewise, conditional dfmr1 knockdown (RNAi) during the critical period replicates constitutive null mutant defects in both neuron classes, confirming cell-autonomous requirements for FMRP in developmental regulation of calcium signaling dynamics. Optogenetic stimulation during the critical period enhances depolarization-induced calcium signaling in both neuron classes, but this developmental change is eliminated in dfmr1 null mutants, indicating the activity-dependent regulation requires FMRP. These results show FMRP shapes neuron class-specific calcium signaling in excitatory vs. inhibitory neurons in developing learning/memory circuitry, and that FMRP mediates activity-dependent regulation of calcium signaling specifically during the early-use critical period. Copyright © 2016 Elsevier Inc. All rights reserved.

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

Distinct Contributions of Conserved Modules to Runt Transcription Factor Activity

PubMed Central

Walrad, Pegine B.; Hang, Saiyu; Joseph, Genevieve S.; Salas, Julia

2010-01-01

Runx proteins play vital roles in regulating transcription in numerous developmental pathways throughout the animal kingdom. Two Runx protein hallmarks are the DNA-binding Runt domain and a C-terminal VWRPY motif that mediates interaction with TLE/Gro corepressor proteins. A phylogenetic analysis of Runt, the founding Runx family member, identifies four distinct regions C-terminal to the Runt domain that are conserved in Drosophila and other insects. We used a series of previously described ectopic expression assays to investigate the functions of these different conserved regions in regulating gene expression during embryogenesis and in controlling axonal projections in the developing eye. The results indicate each conserved region is required for a different subset of activities and identify distinct regions that participate in the transcriptional activation and repression of the segmentation gene sloppy-paired-1 (slp1). Interestingly, the C-terminal VWRPY-containing region is not required for repression but instead plays a role in slp1 activation. Genetic experiments indicating that Groucho (Gro) does not participate in slp1 regulation further suggest that Runt's conserved C-terminus interacts with other factors to promote transcriptional activation. These results provide a foundation for further studies on the molecular interactions that contribute to the context-dependent properties of Runx proteins as developmental regulators. PMID:20462957

The AtRbx1 protein is part of plant SCF complexes, and its down-regulation causes severe growth and developmental defects.

PubMed

Lechner, Esther; Xie, Daoxin; Grava, Sandrine; Pigaglio, Emmanuelle; Planchais, Severine; Murray, James A H; Parmentier, Yves; Mutterer, Jerome; Dubreucq, Bertrand; Shen, Wen-Hui; Genschik, Pascal

2002-12-20

Recently in yeast and animal cells, one particular class of ubiquitin ligase (E3), called the SCF, was demonstrated to regulate diverse processes including cell cycle and development. In plants SCF-dependent proteolysis is also involved in different developmental and hormonal regulations. To further investigate the function of SCF, we characterized at the molecular level the Arabidopsis RING-H2 finger protein AtRbx1. We demonstrated that the plant gene is able to functionally complement a yeast knockout mutant strain and showed that AtRbx1 protein interacts physically with at least two members of the Arabidopsis cullin family (AtCul1 and AtCul4). AtRbx1 also associates with AtCul1 and the Arabidopsis SKP1-related proteins in planta, indicating that it is part of plant SCF complexes. AtRbx1 mRNAs accumulate in various tissues of the plant, but at higher levels in tissues containing actively dividing cells. Finally to study the function of the gene in planta, we either overexpressed AtRbx1 or reduced its expression by a dsRNA strategy. Down-regulation of AtRbx1 impaired seedling growth and development, indicating that the gene is essential in plants. Furthermore, the AtRbx1-silenced plants showed a reduced level of AtCul1 protein, but accumulated higher level of cyclin D3.

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf.

PubMed

Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

2017-12-15

Black rice ( Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3-10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf.

Transcriptomic Analysis of Grapevine (cv. Summer Black) Leaf, Using the Illumina Platform

PubMed Central

Pervaiz, Tariq; Haifeng, Jia; Salman Haider, Muhammad; Cheng, Zhang; Cui, Mengjie; Wang, Mengqi; Cui, Liwen; Wang, Xicheng; Fang, Jinggui

2016-01-01

Proceeding to illumina sequencing, determining RNA integrity numbers for poly RNA were separated from each of the four developmental stages of cv. Summer Black leaves by using Illumina HiSeq™ 2000. The sums of 272,941,656 reads were generated from vitis vinifera leaf at four different developmental stages, with more than 27 billion nucleotides of the sequence data. At each growth stage, RNA samples were indexed through unique nucleic acid identifiers and sequenced. KEGG annotation results depicted that the highest number of transcripts in 2,963 (2Avs4A) followed by 1Avs4A (2,920), and 3Avs4A (2,294) out of 15,614 (71%) transcripts were recorded. In comparison, a total of 1,532 transcripts were annotated in GOs, including Cellular component, with the highest number in “Cell part” 251 out of 353 transcripts (71.1%), followed by intracellular organelle 163 out of 353 transcripts (46.2%), while in molecular function and metabolic process 375 out of 525 (71.4%) transcripts, multicellular organism process 40 out of 525 (7.6%) transcripts in biological process were most common in 1Avs2A. While in case of 1Avs3A, cell part 476 out of 662 transcripts (71.9%), and membrane-bounded organelle 263 out of 662 transcripts (39.7%) were recorded in Cellular component. In the grapevine transcriptome, during the initial stages of leaf development 1Avs2A showed single transcript was down-regulated and none of them were up-regulated. While in comparison of 1A to 3A showed one up-regulated (photosystem II reaction center protein C) and one down regulated (conserved gene of unknown function) transcripts, during the hormone regulating pathway namely SAUR-like auxin-responsive protein family having 2 up-regulated and 7 down-regulated transcripts, phytochrome-associated protein showed 1 up-regulated and 9 down-regulated transcripts, whereas genes associated with the Leucine-rich repeat protein kinase family protein showed 7 up-regulated and 1 down-regulated transcript, meanwhile Auxin Resistant 2 has single up-regulated transcript in second developmental stage, although 3 were down-regulated at lateral growth stages (3A and 4A). In the present study, 489 secondary metabolic pathways related genes were identified during leaf growth, which mainly includes alkaloid (40), anthocyanins (21), Diterpenoid (144), Monoterpenoid (90) and Flavonoids (93). Quantitative real-time PCR was applied to validate 10 differentially expressed transcripts patterns from flower, leaf and fruit metabolic pathways at different growth stages. PMID:26824474

Aspp2 negatively regulates body growth but not developmental timing by modulating IRS signaling in zebrafish embryos.

PubMed

Liu, Chengdong; Luan, Jing; Bai, Yan; Li, Yun; Lu, Ling; Liu, Yunzhang; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Duan, Cunming; Zhou, Jianfeng

2014-02-01

The growth and developmental rate of developing embryos and fetus are tightly controlled and coordinated to maintain proper body shape and size. The insulin receptor substrate (IRS) proteins, key intracellular transducers of insulin and insulin-like growth factor signaling, play essential roles in the regulation of growth and development. A short isoform of apoptosis-stimulating protein of p53 2 (ASPP2) was recently identified as a binding partner of IRS-1 and IRS-2 in mammalian cells in vitro. However, it is unclear whether ASPP2 plays any role in vertebrate embryonic growth and development. Here, we show that zebrafish Aspp2a and Aspp2b negatively regulate embryonic growth without affecting developmental rate. Human ASPP2 had similar effects on body growth in zebrafish embryos. Aspp2a and 2b inhibit Akt signaling. This inhibition was reversed by coinjection of myr-Akt1, a constitutively active form of Akt1. Zebrafish Aspp2a and Aspp2b physically bound with Irs-1, and the growth inhibitory effects of ASPP2/Aspp2 depend on the presence of their ankyrin repeats and SH3 domains. These findings uncover a novel role of Aspp2 in regulating vertebrate embryonic growth. Copyright © 2013 Elsevier Inc. All rights reserved.

Coordination of flower development by homeotic master regulators.

PubMed

Ito, Toshiro

2011-02-01

Floral homeotic genes encode transcription factors and act as master regulators of flower development. The homeotic protein complex is expressed in a specific whorl of the floral primordium and determines floral organ identity by the combinatorial action. Homeotic proteins continue to be expressed until late in flower development to coordinate growth and organogenesis. Recent genomic studies have shown that homeotic proteins bind thousands of target sites in the genome and regulate the expression of transcription factors, chromatin components and various proteins involved in hormone biosynthesis and signaling and other physiological activities. Further, homeotic proteins program chromatin to direct the developmental coordination of stem cell maintenance and differentiation in shaping floral organs. Copyright © 2010 Elsevier Ltd. All rights reserved.

Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

USDA-ARS?s Scientific Manuscript database

Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention

PubMed Central

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V.

2012-01-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3′-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context. PMID:22661231

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention.

PubMed

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V

2012-06-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3'-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context.

SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus

PubMed Central

Eijlander, Robyn T.; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P.

2016-01-01

Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus, whereas this is not observed in Bacillus subtilis. Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus ΔspoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes. PMID:27790204

SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus.

PubMed

Eijlander, Robyn T; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P

2016-01-01

Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus , whereas this is not observed in Bacillus subtilis . Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus Δ spoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes.

A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance.

PubMed

Maheshwari, Richa; Pushpa, Kumari; Subramaniam, Kuppuswamy

2016-09-01

Membrane-bound receptors, which are crucial for mediating several key developmental signals, are synthesized on endoplasmic reticulum (ER). The functional integrity of ER must therefore be important for the regulation of at least some developmental programs. However, the developmental control of ER function is not well understood. Here, we identify the C. elegans protein FARL-11, an ortholog of the mammalian STRIPAK complex component STRIP1/2 (FAM40A/B), as an ER protein. In the C. elegans embryo, we find that FARL-11 is essential for the cell cycle-dependent morphological changes of ER and for embryonic viability. In the germline, FARL-11 is required for normal ER morphology and for membrane localization of the GLP-1/Notch receptor involved in germline stem cell (GSC) maintenance. Furthermore, we provide evidence that PUF-8, a key translational regulator in the germline, promotes the translation of farl-11 mRNA. These findings reveal that ER form and function in the C. elegans germline are post-transcriptionally regulated and essential for the niche-GSC signaling mediated by GLP-1. © 2016. Published by The Company of Biologists Ltd.

Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

PubMed Central

Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

2010-01-01

Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

Polar auxin transport: controlling where and how much

NASA Technical Reports Server (NTRS)

Muday, G. K.; DeLong, A.; Brown, C. S. (Principal Investigator)

2001-01-01

Auxin is transported through plant tissues, moving from cell to cell in a unique polar manner. Polar auxin transport controls important growth and developmental processes in higher plants. Recent studies have identified several proteins that mediate polar auxin transport and have shown that some of these proteins are asymmetrically localized, paving the way for studies of the mechanisms that regulate auxin transport. New data indicate that reversible protein phosphorylation can control the amount of auxin transport, whereas protein secretion through Golgi-derived vesicles and interactions with the actin cytoskeleton might regulate the localization of auxin efflux complexes.

Long-chain n-3 fatty acids enhance neonatal insulin-regulated protein metabolism in piglets by differentially altering muscle lipid composition

PubMed Central

Bergeron, Karen; Julien, Pierre; Davis, Teresa A.; Myre, Alexandre; Thivierge, M. Carole

2009-01-01

This study investigated the role of long-chain n-3 polyunsaturated fatty acids (LCn-3PUFAs) of muscle phospholipids in the regulation of neonatal metabolism. Twenty-eight piglets were weaned at 2 days of age and raised on one of two milk formulas that consisted of either a control formula supplying 0% or a formula containing 3.5% LCn-3PUFAs until 10 or 28 days of age. There was a developmental decline in the insulin sensitivity of amino acid disposal in control pigs during the first month of life, with a slope of −2.24 μmol·kg−1·h−1 (P = 0.01) per unit of insulin increment, as assessed using hyperinsulinemic-euglycemic-euaminoacidemic clamps. LCn-3PUFA feeding blunted this developmental decline, resulting in differing insulin sensitivities (P < 0.001). When protein metabolism was assessed under parenteral feeding-induced hyperinsulinemia, LCn-3PUFAs reduced by 16% whole body oxidative losses of amino acids (from 238 to 231 μmol·kg−1·h−1; P = 0.06), allowing 41% more amino acids to accrete into body proteins (from 90 to 127 μmol·kg−1·h−1; P = 0.06). The fractional synthetic rate of muscle mixed proteins remained unaltered by the LCn-3PUFA feeding. However, LCn-3PUFAs retarded a developmental increase in the essential-to-nonessential amino acid ratio of the muscle intracellular free pool (P = 0.05). Overall, alterations in metabolism were concomitant with a preferential incorporation of LCn-3PUFAs into muscle total membrane phospholipids (P < 0.001), in contrast to intramuscular triglycerides. These results underscore the potential role of LCn-3PUFAs as regulators of different aspects of protein metabolism in the neonate. PMID:17673528

The tomato UV-damaged DNA binding protein 1 (DDB1) plays a role in organ size control via an epigenetic manner

USDA-ARS?s Scientific Manuscript database

Epigenetic regulation, including various covalent modifications of histone proteins and methylation of cytosine bases in DNA, participates broadly in many fundamentally physiological and developmental processes. The repressed or active states of transcription resulted from epigenetic modifications a...

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

Drosulfakinin activates CCKLR-17D1 and promotes larval locomotion and escape response in Drosophila

USDA-ARS?s Scientific Manuscript database

Neuropeptides are ubiquitous in both mammals and invertebrates and play essential roles in regulation and modulation of many developmental and physiological processes through activation of G-protein-coupled-receptors (GPCRs). However, the mechanisms by which many of the neuropeptides regulate speci...

Polycomb group protein bodybuilding: working out the routines.

PubMed

Sievers, Cem; Paro, Renato

2013-09-30

Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

PubMed Central

Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

2012-01-01

Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf

PubMed Central

Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

2017-01-01

Black rice (Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3–10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf. PMID:29244752

Production of systemically circulating Hedgehog by the intestine couples nutrition to growth and development.

PubMed

Rodenfels, Jonathan; Lavrynenko, Oksana; Ayciriex, Sophie; Sampaio, Julio L; Carvalho, Maria; Shevchenko, Andrej; Eaton, Suzanne

2014-12-01

In Drosophila larvae, growth and developmental timing are regulated by nutrition in a tightly coordinated fashion. The networks that couple these processes are far from understood. Here, we show that the intestine responds to nutrient availability by regulating production of a circulating lipoprotein-associated form of the signaling protein Hedgehog (Hh). Levels of circulating Hh tune the rates of growth and developmental timing in a coordinated fashion. Circulating Hh signals to the fat body to control larval growth. It regulates developmental timing by controlling ecdysteroid production in the prothoracic gland. Circulating Hh is especially important during starvation, when it is also required for mobilization of fat body triacylglycerol (TAG) stores. Thus, we demonstrate that Hh, previously known only for its local morphogenetic functions, also acts as a lipoprotein-associated endocrine hormone, coordinating the response of multiple tissues to nutrient availability. © 2014 Rodenfels et al.; Published by Cold Spring Harbor Laboratory Press.

GABA-CREB signalling regulates maturation and survival of newly generated neurons in the adult hippocampus

PubMed Central

Jagasia, Ravi; Steib, Kathrin; Englberger, Elisabeth; Herold, Sabine; Faus-Kessler, Theresa; Saxe, Michael; Gage, Fred H.; Song, Hongjun; Lie, D. Chichung

2009-01-01

Survival and integration of new neurons in the hippocampal circuit are rate-limiting steps in adult hippocampal neurogenesis. Neuronal network activity is a major regulator of these processes, yet little is known about the respective downstream signalling pathways. Here, we investigate the role of CREB signalling in adult hippocampal neurogenesis. CREB is activated in new granule neurons during a distinct developmental period. Loss of CREB function in a cell-autonomous fashion impairs dendritic development, decreases the expression of the neurogenic transcription factor NeuroD and of the neuronal microtubule associated protein, DCX, and compromises the survival of newborn neurons. In addition, GABA-mediated excitation regulates CREB activation at early developmental stages. Importantly, developmental defects following loss of GABA-mediated excitation can be compensated by enhanced CREB signalling. These results indicate that CREB signalling is a central pathway in adult hippocampal neurogenesis, regulating the development and survival of new hippocampal neurons downstream of GABA-mediated excitation. PMID:19553437

Post-synaptic BDNF-TrkB Signaling in Synapse Maturation, Plasticity and Disease

PubMed Central

Yoshii, Akira; Constantine-Paton, Martha

2010-01-01

Brain-derived neurotrophic factor (BDNF) is a prototypic neurotrophin that regulates diverse developmental events from the selection of neural progenitors to the terminal dendritic differentiation and connectivity of neurons. We focus here on activity-dependent synaptic regulation by BDNF and its receptor, full length TrkB. BDNF-TrkB signaling is involved in transcription, translation, and trafficking of proteins during various phases of synaptic development and has been implicated in several forms of synaptic plasticity. These functions are carried out by a combination of the three signaling cascades triggered when BDNF binds TrkB: the mitogen-activated protein kinase (MAPK), the phospholipase Cγ (PLC PLCγ), and the phosphatidylinositol 3-kinase (PI3K) pathways. MAPK and PI3K play crucial roles in both translation and/or trafficking of proteins induced by synaptic activity while PLCγ regulates intracellular Ca2+ that can drive transcription via cyclic AMP and a Protein Kinase C. Conversely, the abnormal regulation of BDNF is implicated in various developmental and neurodegenerative diseases that perturb neural development and function. We will discuss the current state of understanding BDNF signaling in the context of synaptic development and plasticity with a focus on the post-synaptic cell and close with the evidence that basic mechanisms of BDNF function still need to be understood in order to effectively treat genetic disruptions of these pathways that cause devastating neurodevelopmental diseases. PMID:20186705

Comparative proteomic analysis provides insight into the biological role of protein phosphatase inhibitor-2 from Arabidopsis.

PubMed

Ahsan, Nagib; Chen, Mingjie; Salvato, Fernanda; Wilson, Rashaun S; Shyama Prasad Rao, R; Thelen, Jay J

2017-08-08

Protein phosphatase inhibitor-2 (PPI-2) is a conserved eukaryotic effector protein that inhibits type one protein phosphatases (TOPP). A transfer-DNA knockdown of AtPPI-2 resulted in stunted growth in both vegetative and reproductive phases of Arabidopsis development. At the cellular level, AtPPI-2 knockdown had 35 to 40% smaller cells in developing roots and leaves. This developmental phenotype was rescued by transgenic expression of the AtPPI-2 cDNA behind a constitutive promoter. Comparative proteomics of developing leaves of wild type (WT) and AtPPI-2 mutant revealed reduced levels of proteins associated with chloroplast development, ribosome biogenesis, transport, and cell cycle regulation processes. Decreased abundance of several ribosomal proteins, a DEAD box RNA helicase family protein (AtRH3), Clp protease (ClpP3) and proteins associated with cell division suggests a bottleneck in chloroplast ribosomal biogenesis and cell cycle regulation in AtPPI-2 mutant plants. In contrast, eight out of nine Arabidopsis TOPP isoforms were increased at the transcript level in AtPPI-2 leaves compared to WT. A protein-protein interaction network revealed that >75% of the differentially accumulated proteins have at least secondary and/or tertiary connections with AtPPI-2. Collectively, these data reveal a potential basis for the growth defects of AtPPI-2 and support the presumed role of AtPPI-2 as a master regulator for TOPPs, which regulate diverse growth and developmental processes. Comparative label-free proteomics was used to characterize an AtPPI-2T-DNA knockdown mutant. The complex, reduced growth phenotype supports the notion that AtPPI-2 is a global regulator of TOPPs, and possibly other proteins. Comparative proteomics revealed a range of differences in protein abundance from various cellular processes such as chloroplast development, ribosome biogenesis, and transporter activity in the AtPPI-2 mutant relative to WT Arabidopsis. Collectively the results of proteomic analysis and the protein-protein network suggest that AtPPI-2 is involved in a wide range of biological processes either directly or indirectly including plastid biogenesis, translational mechanisms, and cell cycle regulation. The proposed protein interaction network comprises a testable model underlying changes in protein abundance in the AtPPI-2 mutant, and provides a better framework for future studies. Copyright © 2017 Elsevier B.V. All rights reserved.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

PubMed

Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

PubMed Central

Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

PubMed

Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

2013-04-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

PubMed Central

Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

2013-01-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

The Fibroblast Growth Factor signaling pathway

PubMed Central

Ornitz, David M; Itoh, Nobuyuki

2015-01-01

The signaling component of the mammalian Fibroblast Growth Factor (FGF) family is comprised of eighteen secreted proteins that interact with four signaling tyrosine kinase FGF receptors (FGFRs). Interaction of FGF ligands with their signaling receptors is regulated by protein or proteoglycan cofactors and by extracellular binding proteins. Activated FGFRs phosphorylate specific tyrosine residues that mediate interaction with cytosolic adaptor proteins and the RAS-MAPK, PI3K-AKT, PLCγ, and STAT intracellular signaling pathways. Four structurally related intracellular non-signaling FGFs interact with and regulate the family of voltage gated sodium channels. Members of the FGF family function in the earliest stages of embryonic development and during organogenesis to maintain progenitor cells and mediate their growth, differentiation, survival, and patterning. FGFs also have roles in adult tissues where they mediate metabolic functions, tissue repair, and regeneration, often by reactivating developmental signaling pathways. Consistent with the presence of FGFs in almost all tissues and organs, aberrant activity of the pathway is associated with developmental defects that disrupt organogenesis, impair the response to injury, and result in metabolic disorders, and cancer. © 2015 Wiley Periodicals, Inc. PMID:25772309

Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

PubMed

Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

2016-06-30

Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage product accumulation (10-16 DAF). The results highlight versatile cellular metabolic activity in the transition phase and strong convergence towards storage product accumulation in the storage phase. Notably, both phases are characterized by particular protective mechanism, such as scavenging of oxidative stress and defence against pathogens, during the transition and the storage phase, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

PubMed

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

NASA Technical Reports Server (NTRS)

Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

2000-01-01

beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

Spatiotemporally regulated proteolysis to dissect the role of vegetative proteins during Bacillus subtilis sporulation: cell-specific requirement of σH and σA.

PubMed

Riley, Eammon P; Trinquier, Aude; Reilly, Madeline L; Durchon, Marine; Perera, Varahenage R; Pogliano, Kit; Lopez-Garrido, Javier

2018-04-01

Sporulation in Bacillus subtilis is a paradigm of bacterial development, which involves the interaction between a larger mother cell and a smaller forespore. The mother cell and the forespore activate different genetic programs, leading to the production of sporulation-specific proteins. A critical gap in our understanding of sporulation is how vegetative proteins, made before sporulation initiation, contribute to spore formation. Here we present a system, spatiotemporally regulated proteolysis (STRP), which enables the rapid, developmentally regulated degradation of target proteins, thereby providing a suitable method to dissect the cell- and developmental stage-specific role of vegetative proteins. STRP has been used to dissect the role of two major vegetative sigma factors, σ H and σ A , during sporulation. The results suggest that σ H is only required in predivisional cells, where it is essential for sporulation initiation, but that it is dispensable during subsequent steps of spore formation. However, evidence has been provided that σ A plays different roles in the mother cell, where it replenishes housekeeping functions, and in the forespore, where it plays an unexpected role in promoting spore germination and outgrowth. Altogether, the results demonstrate that STRP has the potential to provide a comprehensive molecular dissection of every stage of sporulation, germination and outgrowth. © 2018 John Wiley & Sons Ltd.

ETOILE Regulates Developmental Patterning in the Filamentous Brown Alga Ectocarpus siliculosus[W

PubMed Central

Le Bail, Aude; Billoud, Bernard; Le Panse, Sophie; Chenivesse, Sabine; Charrier, Bénédicte

2011-01-01

Brown algae are multicellular marine organisms evolutionarily distant from both metazoans and land plants. The molecular or cellular mechanisms that govern the developmental patterning in brown algae are poorly characterized. Here, we report the first morphogenetic mutant, étoile (etl), produced in the brown algal model Ectocarpus siliculosus. Genetic, cellular, and morphometric analyses showed that a single recessive locus, ETL, regulates cell differentiation: etl cells display thickening of the extracellular matrix (ECM), and the elongated, apical, and actively dividing E cells are underrepresented. As a result of this defect, the overrepresentation of round, branch-initiating R cells in the etl mutant leads to the rapid induction of the branching process at the expense of the uniaxial growth in the primary filament. Computational modeling allowed the simulation of the etl mutant phenotype by including a modified response to the neighborhood information in the division rules used to specify wild-type development. Microarray experiments supported the hypothesis of a defect in cell–cell communication, as primarily Lin-Notch-domain transmembrane proteins, which share similarities with metazoan Notch proteins involved in binary cell differentiation were repressed in etl. Thus, our study highlights the role of the ECM and of novel transmembrane proteins in cell–cell communication during the establishment of the developmental pattern in this brown alga. PMID:21478443

YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.

PubMed

Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio

2018-04-01

Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.

TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis.

PubMed

Hatakeyama, Shigetsugu

2017-04-01

Tripartite motif (TRIM) family proteins, most of which have E3 ubiquitin ligase activities, have various functions in cellular processes including intracellular signaling, development, apoptosis, protein quality control, innate immunity, autophagy, and carcinogenesis. The ubiquitin system is one of the systems for post-translational modifications, which play crucial roles not only as markers for degradation of target proteins by the proteasome but also as regulators of protein-protein interactions and of the activation of enzymes. Accumulating evidence has shown that TRIM family proteins have unique, important roles and that their dysregulation causes several diseases classified as cancer, immunological disease, or developmental disorders. In this review we focus on recent emerging topics on TRIM proteins in the regulation of autophagy, innate immunity, and carcinogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

The multifunctional Staufen proteins: conserved roles from neurogenesis to synaptic plasticity

PubMed Central

Heraud-Farlow, Jacki E.; Kiebler, Michael A.

2014-01-01

Staufen (Stau) proteins belong to a family of RNA-binding proteins (RBPs) that are important for RNA localisation in many organisms. In this review we discuss recent findings on the conserved role played by Stau during both the early differentiation of neurons and in the synaptic plasticity of mature neurons. Recent molecular data suggest mechanisms for how Stau2 regulates mRNA localisation, mRNA stability, translation, and ribonucleoprotein (RNP) assembly. We offer a perspective on how this multifunctional RBP has been adopted to regulate mRNA localisation under several different cellular and developmental conditions. PMID:25012293

Phospholipase C and D regulation of Src, calcium release and membrane fusion during Xenopus laevis development

PubMed Central

Stith, Bradley J.

2015-01-01

This review emphasizes how lipids regulate membrane fusion and the proteins involved in three developmental stages: oocyte maturation to the fertilizable egg, fertilization and during first cleavage. Decades of work show that phosphatidic acid (PA) releases intracellular calcium, and recent work shows that the lipid can activate Src tyrosine kinase or phospholipase C during Xenopus fertilization. Numerous reports are summarized to show three levels of increase in lipid second messengers inositol 1,4,5-trisphosphate and sn 1,2-diacylglycerol (DAG) during the three different developmental stages. In addition, possible roles for PA, ceramide, lysophosphatidylcholine, plasmalogens, phosphatidylinositol 4-phosphate, phosphatidylinositol 5-phosphate, phosphatidylinositol 4,5-bisphosphate, membrane microdomains (rafts) and phosphatidylinositol 3,4,5-trisphosphate in regulation of membrane fusion (acrosome reaction, sperm-egg fusion, cortical granule exocytosis), inositol 1,4,5-trisphosphate receptors, and calcium release are discussed. The role of six lipases involved in generating putative lipid second messengers during fertilization is also discussed: phospholipase D, autotaxin, lipin1, sphingomyelinase, phospholipase C, and phospholipase A2. More specifically, proteins involved in developmental events and their regulation through lipid binding to SH3, SH4, PH, PX, or C2 protein domains is emphasized. New models are presented for PA activation of Src (through SH3, SH4 and a unique domain), that this may be why the SH2 domain of PLCγ is not required for Xenopus fertilization, PA activation of phospholipase C, a role for PA during the calcium wave after fertilization, and that calcium/calmodulin may be responsible for the loss of Src from rafts after fertilization. Also discussed is that the large DAG increase during fertilization derives from phospholipase D production of PA and lipin dephosphorylation to DAG. PMID:25748412

Developmental and environmental regulation of antifreeze proteins in the mealworm beetle Tenebrio molitor.

PubMed

Graham, L A; Walker, V K; Davies, P L

2000-11-01

The yellow mealworm beetle, Tenebrio molitor, contains a family of small Cys-rich and Thr-rich thermal hysteresis proteins that depress the hemolymph freezing point below the melting point by as much as 5. 5 degrees C (DeltaT = thermal hysteresis). Thermal hysteresis protein expression was evaluated throughout development and after exposure to altered environmental conditions. Under favorable growth conditions, small larvae (11-13 mg) had only low levels of thermal hysteresis proteins or thermal hysteresis protein message, but these levels increased 10-fold and 18-fold, respectively, by the final larval instar (> 190 mg), resulting in thermal hysteresis > 3 degrees C. Exposure of small larvae (11-13 mg) to 4 weeks of cold (4 degrees C) caused an approximately 20-fold increase in thermal hysteresis protein concentration, well in excess of the less than threefold developmental increase seen after 4 weeks at 22 degrees C. Exposure of large larvae (100-120 mg) to cold caused 12-fold and sixfold increases in thermal hysteresis protein message and protein levels, respectively, approximately double the maximum levels they would have attained in the final larval instar at 22 degrees C. Thus, thermal hysteresis increased to similar levels (> 4 degrees C) in the cold, irrespective of the size of the larvae (the overwintering stage). At pupation, thermal hysteresis protein message levels decreased > 20-fold and remained low thereafter, but thermal hysteresis activity decreased much more slowly. Exposure to cold did not reverse this decline. Desiccation or starvation of larvae had comparable effects to cold exposure, but surprisingly, short daylength photoperiod or total darkness had no effect on either thermal hysteresis or message levels. As all environmental conditions that caused increased thermal hysteresis also inhibited growth, we postulate that developmental arrest is a primary factor in the regulation of T. molitor thermal hysteresis proteins.

Developmental regulation of mitochondrial biogenesis and function in the mouse mammary gland during a prolonged lactation cycle

USDA-ARS?s Scientific Manuscript database

The regulation of mitochondrial biogenesis and function in the lactating mammary cell is poorly understood. The goal of this study was to use proteomics to relate temporal changes in mammary cell mitochondrial function during lactation to changes in the proteins that make up this organelle. The hypo...

Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

PubMed Central

Chandra, Govind; Chater, Keith F

2014-01-01

To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

PubMed Central

Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

2015-01-01

Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

Mutations in MYB3R1 and MYB3R4 Cause Pleiotropic Developmental Defects and Preferential Down-Regulation of Multiple G2/M-Specific Genes in Arabidopsis1[C][W

PubMed Central

Haga, Nozomi; Kobayashi, Kosuke; Suzuki, Takamasa; Maeo, Kenichiro; Kubo, Minoru; Ohtani, Misato; Mitsuda, Nobutaka; Demura, Taku; Nakamura, Kenzo; Jürgens, Gerd; Ito, Masaki

2011-01-01

R1R2R3-Myb proteins represent an evolutionarily conserved class of Myb family proteins important for cell cycle regulation and differentiation in eukaryotic cells. In plants, this class of Myb proteins are believed to regulate the transcription of G2/M phase-specific genes by binding to common cis-elements, called mitosis-specific activator (MSA) elements. In Arabidopsis (Arabidopsis thaliana), MYB3R1 and MYB3R4 act as transcriptional activators and positively regulate cytokinesis by activating the transcription of KNOLLE, which encodes a cytokinesis-specific syntaxin. Here, we show that the double mutation myb3r1 myb3r4 causes pleiotropic developmental defects, some of which are due to deficiency of KNOLLE whereas other are not, suggesting that multiple target genes are involved. Consistently, microarray analysis of the double mutant revealed altered expression of many genes, among which G2/M-specific genes showed significant overrepresentation of the MSA motif and a strong tendency to be down-regulated by the double mutation. Our results demonstrate, on a genome-wide level, the importance of the MYB3R-MSA pathway for regulating G2/M-specific transcription. In addition, MYB3R1 and MYB3R4 may have diverse roles during plant development by regulating G2/M-specific genes with various functions as well as genes possibly unrelated to the cell cycle. PMID:21862669

Top hits in contemporary JAZ: New information on jasmonate signaling

PubMed Central

Chung, Hoo Sun; Niu, Yajie; Browse, John; Howe, Gregg A.

2012-01-01

The phytohormone jasmonate (JA) regulates a wide range of growth, developmental, and defense-related processes during the plant life cycle. Identification of the JAZ family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression. Recent analysis of JAZ proteins has provided new insight into the nature of the JA receptor, the chemical specificity of signal perception, and cross-talk between JA and other hormone response pathways. Functional diversification of JAZ proteins by alternative splicing, together with the ability of JAZ proteins to homo- and heterodimerize, provide mechanisms to enhance combinatorial diversity and versatility in gene regulation by JA. PMID:19800644

Cohesin and Human Disease

PubMed Central

Liu, Jinglan; Krantz, Ian D.

2016-01-01

Cornelia de Lange syndrome (CdLS) is a dominant multisystem disorder caused by a disruption of cohesin function. The cohesin ring complex is composed of four protein subunits and more than 25 additional proteins involved in its regulation. The discovery that this complex also has a fundamental role in long-range regulation of transcription in Drosophila has shed light on the mechanism likely responsible for its role in development. In addition to the three cohesin proteins involved in CdLS, a second multisystem, recessively inherited, developmental disorder, Roberts-SC phocomelia, is caused by mutations in another regulator of the cohesin complex, ESCO2. Here we review the phenotypes of these disorders, collectively termed cohesinopathies, as well as the mechanism by which cohesin disruption likely causes these diseases. PMID:18767966

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

PubMed Central

Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

2017-01-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

HUPO BPP pilot study: a proteomics analysis of the mouse brain of different developmental stages.

PubMed

Wang, Jing; Gu, Yong; Wang, Lihong; Hang, Xingyi; Gao, Yan; Wang, Hangyan; Zhang, Chenggang

2007-11-01

This study is a part of the HUPO Brain Proteome Project (BPP) pilot study, which aims at obtaining a reliable database of mouse brain proteome, at the comparison of techniques, laboratories, and approaches as well as at preparing subsequent proteome studies of neurologic diseases. The C57/Bl6 mouse brains of three developmental stages at embryonic day 16 (E16), postnatal day 7 (P7), and 8 wk (P56) (n = 5 in each group) were provided by the HUPO BPP executive committee. The whole brain proteins of each animal were individually prepared using 2-DE coupled with PDQuest software analysis. The protein spots representing developmentally related or stably expressed proteins were then prepared with in-gel digestion followed with MALDI-TOF/TOF MS/MS and analyzed using the MASCOT search engines to search the Swiss-Prot or NCBInr database. The 2-DE gel maps of the mouse brains of all of the developmental stages were obtained and submitted to the Data Collection Centre (DCC). The proteins alpha-enolase, stathmin, actin, C14orf166 homolog, 28,000 kDa heat- and acid-stable phosphoprotein, 3-mercaptopyruvate sulfurtransferase and 40 S ribosomal protein S3a were successfully identified. A further Western blotting analysis demonstrated that enolase is a protein up-regulated in the mouse brain from embryonic stage to adult stage. These data are helpful for understanding the proteome changes in the development of the mouse brain.

Emerging roles of protein kinase CK2 in abscisic acid signaling.

PubMed

Vilela, Belmiro; Pagès, Montserrat; Riera, Marta

2015-01-01

The phytohormone abscisic acid (ABA) regulates many aspects of plant growth and development as well as responses to multiple stresses. Post-translational modifications such as phosphorylation or ubiquitination have pivotal roles in the regulation of ABA signaling. In addition to the positive regulator sucrose non-fermenting-1 related protein kinase 2 (SnRK2), the relevance of the role of other protein kinases, such as CK2, has been recently highlighted. We have recently established that CK2 phosphorylates the maize ortholog of open stomata 1 OST1, ZmOST1, suggesting a role of CK2 phosphorylation in the control of ZmOST1 protein degradation (Vilela et al., 2015). CK2 is a pleiotropic enzyme involved in multiple developmental and stress-responsive pathways. This review summarizes recent advances that taken together suggest a prominent role of protein kinase CK2 in ABA signaling and related processes.

Repulsive Guidance Molecules (RGMs) and Neogenin in Bone Morphogenetic Protein (BMP) signaling

PubMed Central

Tian, Chenxi; Liu, Jun

2015-01-01

Summary Bone morphogenetic proteins (BMPs) belong to the transforming growth factor-beta (TGFβ) superfamily. BMPs mediate a highly conserved signal transduction cascade through the type I and type II serine/threonine kinase receptors and intracellular Smad proteins. The BMP pathway regulates multiple developmental and homeostatic processes. Mutations in this pathway can cause various diseases in humans, such as skeletal disorders, cardiovascular diseases and various cancers. Multiple levels of regulation, including extracellular regulation, help to ensure proper spatiotemporal control of BMP signaling in the right cellular context. The family of repulsive guidance molecules (RGMs) and the type I trans-membrane protein neogenin, a paralog of DCC (Deleted in Colorectal Cancer), have been implicated in modulating the BMP pathway. In this review, we discuss the properties and functions of RGM proteins and neogenin, focusing on their roles in the modulation of BMP signal transduction. PMID:23740870

Golgi-to-plastid trafficking of proteins through secretory pathway: Insights into vesicle-mediated import toward the plastids.

PubMed

Baslam, Marouane; Oikawa, Kazusato; Kitajima-Koga, Aya; Kaneko, Kentaro; Mitsui, Toshiaki

2016-09-01

The diversity of protein targeting pathways to plastids and their regulation in response to developmental and metabolic status is a key issue in the regulation of cellular function in plants. The general import pathways that target proteins into and across the plastid envelope with changes in gene expression are critical for plant development by regulating the response to physiological and metabolic changes within the cell. Glycoprotein targeting to complex plastids involves routing through the secretory pathway, among others. However, the mechanisms of trafficking via this system remain poorly understood. The present article discusses our results in site-specific N-glycosylation of nucleotide pyrophosphatase/phosphodiesterases (NPPs) glycoproteins and highlights protein delivery in Golgi/plastid pathway via the secretory pathway. Furthermore, we outline the hypotheses that explain the mechanism for importing vesicles trafficking with nucleus-encoded proteins into plastids.

Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin

PubMed Central

2015-01-01

Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. To study the developmental processes that require intact ubiquitin, we executed the most extensive characterization of the lens proteome to date. We quantified lens protein expression changes in multiple replicate pools of P1 wild-type and K6W-Ub-expressing mouse lenses. Lens proteins were digested with trypsin, peptides were separated using strong cation exchange and reversed-phase liquid chromatography, and tandem mass (MS/MS) spectra were collected with a linear ion trap. Transgenic mice that expressed low levels of K6W-Ub (low expressers) had normal, clear lenses at birth, whereas the lenses that expressed high levels of K6W-Ub (higher expressers) had abnormal lenses and cataracts at birth. A total of 2052 proteins were identified, of which 996 were reliably quantified and compared between wild-type and K6W-Ub transgenic mice. Consistent with a delayed developmental program, fiber-cell-specific proteins, such as γ-crystallins (γA, γB, γC, and γE), were down-regulated in K6W-Ub higher expressers. Up-regulated proteins were involved in energy metabolism, signal transduction, and proteolysis. The K6W-Ub low expressers exhibited delayed onset and milder cataract consistent with smaller changes in protein expression. Because lens protein expression changes occurred prior to lens morphological abnormalities and cataract formation in K6W-Ub low expressers, it appears that expression of K6W-Ub sets in motion a process of altered protein expression that results in developmental defects and cataract. PMID:24450463

Differential regulation of oligodendrocyte markers by glucocorticoids: Post-transcriptional regulation of both proteolipid protein and myelin basic protein and transcriptional regulation of glycerol phosphate dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, S.; Cole, R.; Chiappelli, F.

During neonatal development glucocorticoids potentiate oligodendrocyte differentiation and myelinogenesis by regulating the expression of myelin basic protein, proteolipid protein, and glycerol phosphate dehydrogenase. The actual locus at which hydrocortisone exerts its developmental influence on glial physiology is, however, not well understood. Gycerol phosphate dehydrogenase is glucocorticoid-inducible in oligodendrocytes at all stages of development both in vivo and in vitro. In newborn rat cerebral cultures, between 9 and 15 days in vitro, a 2- to 3-fold increase in myelin basic protein and proteolipid protein mRNA levels occurs in oligodendrocytes within 12 hr of hydrocortisone treatment. Immunostaining demonstrates that this increase inmore » mRNAs is followed by a 2- to 3-fold increase in the protein levels within 24 hr. In vitro transcription assays performed with oligodendrocyte nuclei show an 11-fold increase in the transcriptional activity of glycerol phosphate dehydrogenase in response to hydrocortisone but no increase in transcription of myelin basic protein or proteolipid protein. These results indicate that during early myelinogeneis, glucocorticoids influence the expression of key oligodendroglial markers by different processes: The expression of glycerol phosphate dehydrogenase is regulated at the transcriptional level, whereas the expression of myelin basic protein and proteolipid protein is modulated via a different, yet uncharacterized, mechanism involving post-transcriptional regulation.« less

Function and regulation of primary cilia and intraflagellar transport proteins in the skeleton.

PubMed

Yuan, Xue; Serra, Rosa A; Yang, Shuying

2015-01-01

Primary cilia are microtubule-based organelles that project from the cell surface to enable transduction of various developmental signaling pathways. The process of intraflagellar transport (IFT) is crucial for the building and maintenance of primary cilia. Ciliary dysfunction has been found in a range of disorders called ciliopathies, some of which display severe skeletal dysplasias. In recent years, interest has grown in uncovering the function of primary cilia/IFT proteins in bone development, mechanotransduction, and cellular regulation. We summarize recent advances in understanding the function of cilia and IFT proteins in the regulation of cell differentiation in osteoblasts, osteocytes, chondrocytes, and mesenchymal stem cells (MSCs). We also discuss the mechanosensory function of cilia and IFT proteins in bone cells, cilia orientation, and other functions of cilia in chondrocytes. © 2014 New York Academy of Sciences.

The multifunctional Staufen proteins: conserved roles from neurogenesis to synaptic plasticity.

PubMed

Heraud-Farlow, Jacki E; Kiebler, Michael A

2014-09-01

Staufen (Stau) proteins belong to a family of RNA-binding proteins (RBPs) that are important for RNA localisation in many organisms. In this review we discuss recent findings on the conserved role played by Stau during both the early differentiation of neurons and in the synaptic plasticity of mature neurons. Recent molecular data suggest mechanisms for how Stau2 regulates mRNA localisation, mRNA stability, translation, and ribonucleoprotein (RNP) assembly. We offer a perspective on how this multifunctional RBP has been adopted to regulate mRNA localisation under several different cellular and developmental conditions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Biotype Characterization, Developmental Profiling, Insecticide Response and Binding Property of Bemisia tabaci Chemosensory Proteins: Role of CSP in Insect Defense

PubMed Central

Liu, Guoxia; Ma, Hongmei; Xie, Hongyan; Xuan, Ning; Guo, Xia; Fan, Zhongxue; Rajashekar, Balaji; Arnaud, Philippe; Offmann, Bernard; Picimbon, Jean-François

2016-01-01

Chemosensory proteins (CSPs) are believed to play a key role in the chemosensory process in insects. Sequencing genomic DNA and RNA encoding CSP1, CSP2 and CSP3 in the sweet potato whitefly Bemisia tabaci showed strong variation between B and Q biotypes. Analyzing CSP-RNA levels showed not only biotype, but also age and developmental stage-specific expression. Interestingly, applying neonicotinoid thiamethoxam insecticide using twenty-five different dose/time treatments in B and Q young adults showed that Bemisia CSP1, CSP2 and CSP3 were also differentially regulated over insecticide exposure. In our study one of the adult-specific gene (CSP1) was shown to be significantly up-regulated by the insecticide in Q, the most highly resistant form of B. tabaci. Correlatively, competitive binding assays using tryptophan fluorescence spectroscopy and molecular docking demonstrated that CSP1 protein preferentially bound to linoleic acid, while CSP2 and CSP3 proteins rather associated to another completely different type of chemical, i.e. α-pentyl-cinnamaldehyde (jasminaldehyde). This might indicate that some CSPs in whiteflies are crucial to facilitate the transport of fatty acids thus regulating some metabolic pathways of the insect immune response, while some others are tuned to much more volatile chemicals known not only for their pleasant odor scent, but also for their potent toxic insecticide activity. PMID:27167733

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function

PubMed Central

Bagley, Joshua A.; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill

2014-01-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the “histone code,” in regulating dendrite morphology. PMID:25184680

Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni

PubMed Central

Isokpehi, Raphael D.; Mahmud, Ousman; Mbah, Andreas N.; Simmons, Shaneka S.; Avelar, Lívia; Rajnarayanan, Rajendram V.; Udensi, Udensi K.; Ayensu, Wellington K.; Cohly, Hari H.; Brown, Shyretha D.; Dates, Centdrika R.; Hentz, Sonya D.; Hughes, Shawntae J.; Smith-McInnis, Dominique R.; Patterson, Carvey O.; Sims, Jennifer N.; Turner, Kelisha T.; Williams, Baraka S.; Johnson, Matilda O.; Adubi, Taiwo; Mbuh, Judith V.; Anumudu, Chiaka I.; Adeoye, Grace O.; Thomas, Bolaji N.; Nashiru, Oyekanmi; Oliveira, Guilherme

2011-01-01

The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the formation of a network of researchers to understand the function and regulation of the universal stress proteins encoded in genomes of schistosomes and their snail intermediate hosts. PMID:22084571

Hey bHLH transcription factors.

PubMed

Weber, David; Wiese, Cornelia; Gessler, Manfred

2014-01-01

Hey bHLH transcription factors are direct targets of canonical Notch signaling. The three mammalian Hey proteins are closely related to Hes proteins and they primarily repress target genes by either directly binding to core promoters or by inhibiting other transcriptional activators. Individual candidate gene approaches and systematic screens identified a number of Hey target genes, which often encode other transcription factors involved in various developmental processes. Here, we review data on interaction partners and target genes and conclude with a model for Hey target gene regulation. Furthermore, we discuss how expression of Hey proteins affects processes like cell fate decisions and differentiation, e.g., in cardiovascular, skeletal, and neural development or oncogenesis and how this relates to the observed developmental defects and phenotypes observed in various knockout mice. © 2014 Elsevier Inc. All rights reserved.

Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

PubMed

Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

2017-01-01

Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

PubMed Central

Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

2016-01-01

Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

System-Level and Granger Network Analysis of Integrated Proteomic and Metabolomic Dynamics Identifies Key Points of Grape Berry Development at the Interface of Primary and Secondary Metabolism.

PubMed

Wang, Lei; Sun, Xiaoliang; Weiszmann, Jakob; Weckwerth, Wolfram

2017-01-01

Grapevine is a fruit crop with worldwide economic importance. The grape berry undergoes complex biochemical changes from fruit set until ripening. This ripening process and production processes define the wine quality. Thus, a thorough understanding of berry ripening is crucial for the prediction of wine quality. For a systemic analysis of grape berry development we applied mass spectrometry based platforms to analyse the metabolome and proteome of Early Campbell at 12 stages covering major developmental phases. Primary metabolites involved in central carbon metabolism, such as sugars, organic acids and amino acids together with various bioactive secondary metabolites like flavonols, flavan-3-ols and anthocyanins were annotated and quantified. At the same time, the proteomic analysis revealed the protein dynamics of the developing grape berries. Multivariate statistical analysis of the integrated metabolomic and proteomic dataset revealed the growth trajectory and corresponding metabolites and proteins contributing most to the specific developmental process. K-means clustering analysis revealed 12 highly specific clusters of co-regulated metabolites and proteins. Granger causality network analysis allowed for the identification of time-shift correlations between metabolite-metabolite, protein- protein and protein-metabolite pairs which is especially interesting for the understanding of developmental processes. The integration of metabolite and protein dynamics with their corresponding biochemical pathways revealed an energy-linked metabolism before veraison with high abundances of amino acids and accumulation of organic acids, followed by protein and secondary metabolite synthesis. Anthocyanins were strongly accumulated after veraison whereas other flavonoids were in higher abundance at early developmental stages and decreased during the grape berry developmental processes. A comparison of the anthocyanin profile of Early Campbell to other cultivars revealed similarities to Concord grape and indicates the strong effect of genetic background on metabolic partitioning in primary and secondary metabolism.

System-Level and Granger Network Analysis of Integrated Proteomic and Metabolomic Dynamics Identifies Key Points of Grape Berry Development at the Interface of Primary and Secondary Metabolism

PubMed Central

Wang, Lei; Sun, Xiaoliang; Weiszmann, Jakob; Weckwerth, Wolfram

2017-01-01

Grapevine is a fruit crop with worldwide economic importance. The grape berry undergoes complex biochemical changes from fruit set until ripening. This ripening process and production processes define the wine quality. Thus, a thorough understanding of berry ripening is crucial for the prediction of wine quality. For a systemic analysis of grape berry development we applied mass spectrometry based platforms to analyse the metabolome and proteome of Early Campbell at 12 stages covering major developmental phases. Primary metabolites involved in central carbon metabolism, such as sugars, organic acids and amino acids together with various bioactive secondary metabolites like flavonols, flavan-3-ols and anthocyanins were annotated and quantified. At the same time, the proteomic analysis revealed the protein dynamics of the developing grape berries. Multivariate statistical analysis of the integrated metabolomic and proteomic dataset revealed the growth trajectory and corresponding metabolites and proteins contributing most to the specific developmental process. K-means clustering analysis revealed 12 highly specific clusters of co-regulated metabolites and proteins. Granger causality network analysis allowed for the identification of time-shift correlations between metabolite-metabolite, protein- protein and protein-metabolite pairs which is especially interesting for the understanding of developmental processes. The integration of metabolite and protein dynamics with their corresponding biochemical pathways revealed an energy-linked metabolism before veraison with high abundances of amino acids and accumulation of organic acids, followed by protein and secondary metabolite synthesis. Anthocyanins were strongly accumulated after veraison whereas other flavonoids were in higher abundance at early developmental stages and decreased during the grape berry developmental processes. A comparison of the anthocyanin profile of Early Campbell to other cultivars revealed similarities to Concord grape and indicates the strong effect of genetic background on metabolic partitioning in primary and secondary metabolism. PMID:28713396

Plasmodesmata: channels for intercellular signaling during plant growth and development.

PubMed

Sevilem, Iris; Yadav, Shri Ram; Helariutta, Ykä

2015-01-01

Plants have evolved strategies for short- and long-distance communication to coordinate plant development and to adapt to changing environmental conditions. Plasmodesmata (PD) are intercellular nanochannels that provide an effective pathway for both selective and nonselective movement of various molecules that function in diverse biological processes. Numerous non-cell-autonomous proteins (NCAP) and small RNAs have been identified that have crucial roles in cell fate determination and organ patterning during development. Both the density and aperture size of PD are developmentally regulated, allowing formation of spatial symplastic domains for establishment of tissue-specific developmental programs. The PD size exclusion limit (SEL) is controlled by reversible deposition of callose, as well as by some PD-associated proteins. Although a large number of PD-associated proteins have been identified, many of their functions remain unknown. Despite the fact that PD are primarily membranous structures, surprisingly very little is known about their lipid composition. Thus, future studies in PD biology will provide deeper insights into the high-resolution structure and tightly regulated functions of PD and the evolution of PD-mediated cell-to-cell communication in plants.

Stuxnet Recruits the Proteasome to Take Down Polycomb.

PubMed

Karch, François

2016-06-20

In this issue of Developmental Cell, Du et al. (2016) describe a gene named stuxnet that regulates Polycomb protein stability, thereby influencing the activity of the Polycomb-group repressive chromatin complexes. Copyright © 2016 Elsevier Inc. All rights reserved.

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

PubMed

Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

2017-11-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

A peptide export-import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay.

PubMed

Perego, M

1997-08-05

The phosphorelay signal transduction system activates developmental transcription in sporulation of Bacillus subtilis by phosphorylation of aspartyl residues of the Spo0F and Spo0A response regulators. The phosphorylation level of these response regulators is determined by the opposing activities of protein kinases and protein aspartate phosphatases that interpret positive and negative signals for development in a signal integration circuit. The RapA protein aspartate phosphatase of the phosphorelay is regulated by a peptide that directly inhibits its activity. This peptide is proteolytically processed from an inactive pre-inhibitor protein encoded in the phrA gene. The pre-inhibitor is cleaved by the protein export apparatus to a putative pro-inhibitor that is further processed to the active inhibitor peptide and internalized by the oligopeptide permease. This export-import circuit is postulated to be a mechanism for timing phosphatase activity where the processing enzymes regulate the rate of formation of the active inhibitor. The processing events may, in turn, be controlled by a regulatory hierarchy. Chromosome sequencing has revealed several other phosphatase-prepeptide gene pairs in B. subtilis, suggesting that the use of this mechanism may be widespread in signal transduction.

A peptide export–import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay

PubMed Central

Perego, Marta

1997-01-01

The phosphorelay signal transduction system activates developmental transcription in sporulation of Bacillus subtilis by phosphorylation of aspartyl residues of the Spo0F and Spo0A response regulators. The phosphorylation level of these response regulators is determined by the opposing activities of protein kinases and protein aspartate phosphatases that interpret positive and negative signals for development in a signal integration circuit. The RapA protein aspartate phosphatase of the phosphorelay is regulated by a peptide that directly inhibits its activity. This peptide is proteolytically processed from an inactive pre-inhibitor protein encoded in the phrA gene. The pre-inhibitor is cleaved by the protein export apparatus to a putative pro-inhibitor that is further processed to the active inhibitor peptide and internalized by the oligopeptide permease. This export–import circuit is postulated to be a mechanism for timing phosphatase activity where the processing enzymes regulate the rate of formation of the active inhibitor. The processing events may, in turn, be controlled by a regulatory hierarchy. Chromosome sequencing has revealed several other phosphatase–prepeptide gene pairs in B. subtilis, suggesting that the use of this mechanism may be widespread in signal transduction. PMID:9238025

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Novel promoters and coding first exons in DLG2 linked to developmental disorders and intellectual disability.

PubMed

Reggiani, Claudio; Coppens, Sandra; Sekhara, Tayeb; Dimov, Ivan; Pichon, Bruno; Lufin, Nicolas; Addor, Marie-Claude; Belligni, Elga Fabia; Digilio, Maria Cristina; Faletra, Flavio; Ferrero, Giovanni Battista; Gerard, Marion; Isidor, Bertrand; Joss, Shelagh; Niel-Bütschi, Florence; Perrone, Maria Dolores; Petit, Florence; Renieri, Alessandra; Romana, Serge; Topa, Alexandra; Vermeesch, Joris Robert; Lenaerts, Tom; Casimir, Georges; Abramowicz, Marc; Bontempi, Gianluca; Vilain, Catheline; Deconinck, Nicolas; Smits, Guillaume

2017-07-19

Tissue-specific integrative omics has the potential to reveal new genic elements important for developmental disorders. Two pediatric patients with global developmental delay and intellectual disability phenotype underwent array-CGH genetic testing, both showing a partial deletion of the DLG2 gene. From independent human and murine omics datasets, we combined copy number variations, histone modifications, developmental tissue-specific regulation, and protein data to explore the molecular mechanism at play. Integrating genomics, transcriptomics, and epigenomics data, we describe two novel DLG2 promoters and coding first exons expressed in human fetal brain. Their murine conservation and protein-level evidence allowed us to produce new DLG2 gene models for human and mouse. These new genic elements are deleted in 90% of 29 patients (public and in-house) showing partial deletion of the DLG2 gene. The patients' clinical characteristics expand the neurodevelopmental phenotypic spectrum linked to DLG2 gene disruption to cognitive and behavioral categories. While protein-coding genes are regarded as well known, our work shows that integration of multiple omics datasets can unveil novel coding elements. From a clinical perspective, our work demonstrates that two new DLG2 promoters and exons are crucial for the neurodevelopmental phenotypes associated with this gene. In addition, our work brings evidence for the lack of cross-annotation in human versus mouse reference genomes and nucleotide versus protein databases.

The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.

PubMed

Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2014-01-01

Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.

S6K1ing to ResTOR Adipogenesis with Polycomb.

PubMed

Juan, Aster H; Sartorelli, Vittorio

2016-05-05

Signal-directed chromatin recruitment of mammalian Polycomb complexes is a fundamental component of epigenetic regulation. In this issue, Yi et al. (2016) reveal how mTORC1 activation deploys the ribosomal serine/threonine kinase S6K1 and Polycomb proteins at genomic regulatory regions to repress expression of anti-adipogenic developmental regulators. Copyright © 2016 Elsevier Inc. All rights reserved.

A Pivotal Role of DELLAs in Regulating Multiple Hormone Signals.

PubMed

Davière, Jean-Michel; Achard, Patrick

2016-01-04

Plant phenotypic plasticity is controlled by diverse hormone pathways, which integrate and convey information from multiple developmental and environmental signals. Moreover, in plants many processes such as growth, development, and defense are regulated in similar ways by multiple hormones. Among them, gibberellins (GAs) are phytohormones with pleiotropic actions, regulating various growth processes throughout the plant life cycle. Previous work has revealed extensive interplay between GAs and other hormones, but the molecular mechanism became apparent only recently. Molecular and physiological studies have demonstrated that DELLA proteins, considered as master negative regulators of GA signaling, integrate multiple hormone signaling pathways through physical interactions with transcription factors or regulatory proteins from different families. In this review, we summarize the latest progress in GA signaling and its direct crosstalk with the main phytohormone signaling, emphasizing the multifaceted role of DELLA proteins with key components of major hormone signaling pathways. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Activation by insulin and amino acids of signaling components leading to translation initiation in skeletal muscle of neonatal pigs is developmentally regulated.

PubMed

Suryawan, Agus; Orellana, Renan A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Fleming, Jillian R; Davis, Teresa A

2007-12-01

Insulin and amino acids act independently to stimulate protein synthesis in skeletal muscle of neonatal pigs, and the responses decrease with development. The purpose of this study was to compare the separate effects of fed levels of INS and AA on the activation of signaling components leading to translation initiation and how these responses change with development. Overnight-fasted 6- (n = 4/group) and 26-day-old (n = 6/ group) pigs were studied during 1) euinsulinemic-euglycemiceuaminoacidemic conditions (controls), 2) euinsulinemic-euglycemichyperaminoacidemic clamps (AA), and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps (INS). INS, but not AA, increased the phosphorylation of protein kinase B (PKB) and tuberous sclerosis 2 (TSC2). Both INS and AA increased protein synthesis and the phosphorylation of mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase-1, and eukaryotic initiation factor (eIF)4E-binding protein 1 (4E-BP1), and these responses were higher in 6-day-old compared with 26-day-old pigs. Both INS and AA decreased the binding of 4E-BP1 to eIF4E and increased eIF4E binding to eIF4G; these effects were greater in 6-day-old than in 26-day-old pigs. Neither INS nor AA altered the composition of mTORC1 (raptor, mTOR, and GbetaL) or mTORC2 (rictor, mTOR, and GbetaL) complexes. Furthermore, neither INS, AA, nor age had any effect on the abundance of Rheb and the phosphorylation of AMP-activated protein kinase and eukaryotic elongation factor 2. Our results suggest that the activation by insulin and amino acids of signaling components leading to translation initiation is developmentally regulated and parallels the developmental decline in protein synthesis in skeletal muscle of neonatal pigs.

Genome-wide profiling of PRC1 and PRC2 Polycomb chromatin binding in Drosophila melanogaster.

PubMed

Tolhuis, Bas; de Wit, Elzo; Muijrers, Inhua; Teunissen, Hans; Talhout, Wendy; van Steensel, Bas; van Lohuizen, Maarten

2006-06-01

Polycomb group (PcG) proteins maintain transcriptional repression of developmentally important genes and have been implicated in cell proliferation and stem cell self-renewal. We used a genome-wide approach to map binding patterns of PcG proteins (Pc, esc and Sce) in Drosophila melanogaster Kc cells. We found that Pc associates with large genomic regions of up to approximately 150 kb in size, hereafter referred to as 'Pc domains'. Sce and esc accompany Pc in most of these domains. PcG-bound chromatin is trimethylated at histone H3 Lys27 and is generally transcriptionally silent. Furthermore, PcG proteins preferentially bind to developmental genes. Many of these encode transcriptional regulators and key components of signal transduction pathways, including Wingless, Hedgehog, Notch and Delta. We also identify several new putative functions of PcG proteins, such as in steroid hormone biosynthesis. These results highlight the extensive involvement of PcG proteins in the coordination of development through the formation of large repressive chromatin domains.

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Glimpse into Hox and tale regulation of cell differentiation and reprogramming.

PubMed

Cerdá-Esteban, Nuria; Spagnoli, Francesca M

2014-01-01

During embryonic development, cells become gradually restricted in their developmental potential and start elaborating lineage-specific transcriptional networks to ultimately acquire a unique differentiated state. Hox genes play a central role in specifying regional identities, thereby providing the cell with critical information on positional value along its differentiation path. The exquisite DNA-binding specificity of the Hox proteins is frequently dependent upon their interaction with members of the TALE family of homeodomain proteins. In addition to their function as Hox-cofactors, TALE homeoproteins control multiple crucial developmental processes through Hox-independent mechanisms. Here, we will review recent findings on the function of both Hox and TALE proteins in cell differentiation, referring mostly to vertebrate species. In addition, we will discuss the direct implications of this knowledge on cell plasticity and cell reprogramming. Copyright © 2013 Wiley Periodicals, Inc.

Computational synchronization of microarray data with application to Plasmodium falciparum.

PubMed

Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

2012-06-21

Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

Membrane-tethered transcription factors provide a connection between stress response and developmental pathways

PubMed Central

Slabaugh, Erin

2011-01-01

Membrane-tethered transcription factors (MTTFs) are proteins that are targeted to membranes and are capable of regulating gene expression. In this way, they are physically restrained from entering the nucleus and are innately dormant. Upon specific signal recognition cues, MTTFs are activated through cleavage by a protease that releases the transcription factor domain into the cytosol thus allowing it to translocate to the nucleus where it can regulate gene expression. MTTFs are classically thought to provide an advantage to an organism by allowing for rapid signal transduction in response to cellular and environmental stresses. However, recent findings suggest that MTTFs may not only act as a means to respond quickly to stress but also are able to regulate developmental pathways, illustrating a point of interaction between stress and development. PMID:21758012

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function.

PubMed

Bagley, Joshua A; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill; Jan, Lily Yeh; Jan, Yuh Nung

2014-09-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the "histone code," in regulating dendrite morphology. © 2014 Bagley et al.; Published by Cold Spring Harbor Laboratory Press.

An Atypical Phr Peptide Regulates the Developmental Switch Protein RapH ▿ †

PubMed Central

Mirouze, Nicolas; Parashar, Vijay; Baker, Melinda D.; Dubnau, David A.; Neiditch, Matthew B.

2011-01-01

Under conditions of nutrient limitation and high population density, the bacterium Bacillus subtilis can initiate a variety of developmental pathways. The signaling systems regulating B. subtilis differentiation are tightly controlled by switch proteins called Raps, named after the founding members of the family, which were shown to be response regulator aspartate phosphatases. A phr gene encoding a secreted pentapeptide that regulates the activity of its associated Rap protein was previously identified downstream of 8 of the chromosomally encoded rap genes. We identify and validate here the sequence of an atypical Phr peptide, PhrH, by in vivo and in vitro analyses. Using a luciferase reporter bioassay combined with in vitro experiments, we found that PhrH is a hexapeptide (TDRNTT), in contrast to the other characterized Phr pentapeptides. We also determined that phrH expression is driven by a promoter lying within rapH. Unlike the previously identified dedicated σH-driven phr promoters, it appears that phrH expression most likely requires σA. Furthermore, we show that PhrH can antagonize both of the known activities of RapH: the dephosphorylation of Spo0F and the sequestration of ComA, thus promoting the development of spores and the competent state. Finally, we propose that PhrH is the prototype of a newly identified class of Phr signaling molecules consisting of six amino acids. This class likely includes PhrI, which regulates RapI and the expression, excision, and transfer of the mobile genetic element ICEBs1. PMID:21908671

JMJ27, an Arabidopsis H3K9 histone demethylase, modulates defense against Pseudomonas syringae and flowering time.

PubMed

Dutta, Aditya; Choudhary, Pratibha; Caruana, Julie; Raina, Ramesh

2017-09-01

Histone methylation is known to dynamically regulate diverse developmental and physiological processes. Histone methyl marks are written by methyltransferases and erased by demethylases, and result in modification of chromatin structure to repress or activate transcription. However, little is known about how histone methylation may regulate defense mechanisms and flowering time in plants. Here we report characterization of JmjC DOMAIN-CONTAINING PROTEIN 27 (JMJ27), an Arabidopsis JHDM2 (JmjC domain-containing histone demethylase 2) family protein, which modulates defense against pathogens and flowering time. JMJ27 is a nuclear protein containing a zinc-finger motif and a catalytic JmjC domain with conserved Fe(II) and α-ketoglutarate binding sites, and displays H3K9me1/2 demethylase activity both in vitro and in vivo. JMJ27 is induced in response to virulent Pseudomonas syringae pathogens and is required for resistance against these pathogens. JMJ27 is a negative modulator of WRKY25 (a repressor of defense) and a positive modulator of several pathogenesis-related (PR) proteins. Additionally, loss of JMJ27 function leads to early flowering. JMJ27 negatively modulates the major flowering regulator CONSTANS (CO) and positively modulates FLOWERING LOCUS C (FLC). Taken together, our results indicate that JMJ27 functions as a histone demethylase to modulate both physiological (defense) and developmental (flowering time) processes in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Quantitative analysis of oyster larval proteome provides new insights into the effects of multiple climate change stressors.

PubMed

Dineshram, Ramadoss; Chandramouli, Kondethimmanahalli; Ko, Ginger Wai Kuen; Zhang, Huoming; Qian, Pei-Yuan; Ravasi, Timothy; Thiyagarajan, Vengatesen

2016-06-01

The metamorphosis of planktonic larvae of the Pacific oyster (Crassostrea gigas) underpins their complex life-history strategy by switching on the molecular machinery required for sessile life and building calcite shells. Metamorphosis becomes a survival bottleneck, which will be pressured by different anthropogenically induced climate change-related variables. Therefore, it is important to understand how metamorphosing larvae interact with emerging climate change stressors. To predict how larvae might be affected in a future ocean, we examined changes in the proteome of metamorphosing larvae under multiple stressors: decreased pH (pH 7.4), increased temperature (30 °C), and reduced salinity (15 psu). Quantitative protein expression profiling using iTRAQ-LC-MS/MS identified more than 1300 proteins. Decreased pH had a negative effect on metamorphosis by down-regulating several proteins involved in energy production, metabolism, and protein synthesis. However, warming switched on these down-regulated pathways at pH 7.4. Under multiple stressors, cell signaling, energy production, growth, and developmental pathways were up-regulated, although metamorphosis was still reduced. Despite the lack of lethal effects, significant physiological responses to both individual and interacting climate change related stressors were observed at proteome level. The metamorphosing larvae of the C. gigas population in the Yellow Sea appear to have adequate phenotypic plasticity at the proteome level to survive in future coastal oceans, but with developmental and physiological costs. © 2016 John Wiley & Sons Ltd.

Inhibition of Glutathione Biosynthesis Alters Compartmental Redox Status and the Thiol Proteome in Organogenesis-Stage Rat Conceptuses

PubMed Central

Harris, Craig; Shuster, Daniel Z.; Gomez, Rosaicela Roman; Sant, Karilyn E.; Reed, Matthew S.; Pohl, Jan; Hansen, Jason M.

2013-01-01

Developmental signals that control growth and differentiation are regulated by environmental factors that generate reactive oxygen species (ROS) and alter steady state redox environments in tissues and fluids. Protein thiols are selectively oxidized and reduced in distinct spatial and temporal patterns in conjunction with changes in glutathione/glutathione disulfide (GSH/GSSG) and cysteine/cystine (Cys/CySS) redox potentials (E0) to regulate developmental signaling. The purpose of this study was to measure compartment specific thiol redox status in cultured organogenesis-stage rat conceptuses and to evaluate the impact of thiol oxidation on the redox proteome. The visceral yolk sac (VYS) has the highest initial (0 hr) total intracellular GSH (GSH + 2GSSG) concentrations (5.5 mM) and the lowest Eh (−223 mV) as determined by HPLC analysis. Total embryo (EMB) GSH concentrations ranged lower (3.2 mM) and were only slightly more oxidized than the VYS. Total GSH concentrations in yolk sac fluid (YSF) and amniotic fluid (AF) are >500-fold lower than in tissues and are highly oxidized (YSF Eh = −121 mV and AF Eh = −49 mV). Steady state total Cys concentrations (Cys + 2CySS) were significantly lower than GSH in tissues but were otherwise equal in VYS and EMB near 0.5 mM. On gestational day 11, total GSH and Cys concentrations in EMB and VYS increase significantly over the 6 hr time course while Eh remains relatively constant. The Eh (GSH/GSSG) in YSF and AF become more reduced over time while Eh (Cys/CySS) become more oxidized. Addition of L-buthionine-S,R-sulfoximine (BS0) to selectively inhibit GSH synthesis and mimic the effects of some GSH-depleting environmental chemicals, significantly decreased VYS and EMB GSH and cys concentrations and increased Eh over the 6 hr exposure period, showing a greater overall oxidation. In the YSF, BSO caused a significant increase in total Cys concentrations to 1.7 mM but did not significantly change the Eh for Cys/CySS. A significant net oxidation was seen in the BSO-treated AF compartment after 6 hr. Biotinylated iodoacetamide (BIAM) labeling of proteins revealed the significant thiol-oxidation of many EMB proteins following BSO treatment. Quantitative changes in the thiol proteome, associated with developmentally-relevant pathways, were detected using isotope coded affinity tag (ICAT) labeling and mass spectroscopy. Adaptive pathways were selectively enriched with increased concentrations of proteins involved in mRNA processing (splicesome) and mRNA stabilization (glycolysis, GAPDH), as well as, protein synthesis (aminoacyl-tRNA) and protein folding (antigen processing, Hsp70, protein disulfide isomerase). These results show the ability of chemical and environmental modulators to selectively alter compartmental intracellular and extracellular GSH and Cys concentrations and change their corresponding Eh within the intact viable conceptus. The altered Eh were also of sufficient magnitude to alter the redox proteome and change relative protein concentrations suggesting that the mechanistic links through which environmental factors inform and regulate developmental signaling pathways may be discovered using systems developmental biology techniques. PMID:23736079

Inhibition of glutathione biosynthesis alters compartmental redox status and the thiol proteome in organogenesis-stage rat conceptuses.

PubMed

Harris, Craig; Shuster, Daniel Z; Roman Gomez, Rosaicela; Sant, Karilyn E; Reed, Matthew S; Pohl, Jan; Hansen, Jason M

2013-10-01

Developmental signals that control growth and differentiation are regulated by environmental factors that generate reactive oxygen species (ROS) and alter steady-state redox environments in tissues and fluids. Protein thiols are selectively oxidized and reduced in distinct spatial and temporal patterns in conjunction with changes in glutathione/glutathione disulfide (GSH/GSSG) and cysteine/cystine (Cys/CySS) redox potentials (E(h)) to regulate developmental signaling. The purpose of this study was to measure compartment-specific thiol redox status in cultured organogenesis-stage rat conceptuses and to evaluate the impact of thiol oxidation on the redox proteome. The visceral yolk sac (VYS) has the highest initial (0 h) total intracellular GSH (GSH+2GSSG) concentration (5.5 mM) and the lowest Eh (-223 mV) as determined by HPLC analysis. Total embryo (EMB) GSH concentrations ranged lower (3.2 mM) and were only slightly more oxidized than the VYS. Total GSH concentrations in yolk sac fluid (YSF) and amniotic fluid (AF) are >500-fold lower than in tissues and are highly oxidized (YSF E(h)=-121 mV and AF E(h)=-49 mV). Steady-state total Cys concentrations (Cys+2CySS) were significantly lower than GSH in tissues but were otherwise equal in VYS and EMB near 0.5 mM. On gestational day 11, total GSH and Cys concentrations in EMB and VYS increase significantly over the 6h time course while E(h) remains relatively constant. The Eh (GSH/GSSG) in YSF and AF become more reduced over time while E(h) (Cys/CySS) become more oxidized. Addition of L-buthionine-S,R-sulfoximine (BS0) to selectively inhibit GSH synthesis and mimic the effects of some GSH-depleting environmental chemicals significantly decreased VYS and EMB GSH and Cys concentrations and increased Eh over the 6h exposure period, showing a greater overall oxidation. In the YSF, BSO caused a significant increase in total Cys concentrations to 1.7 mM but did not significantly change the E(h) for Cys/CySS. A significant net oxidation was seen in the BSO-treated AF compartment after 6 h. Biotinylated iodoacetamide (BIAM) labeling of proteins revealed the significant thiol oxidation of many EMB proteins following BSO treatment. Quantitative changes in the thiol proteome, associated with developmentally relevant pathways, were detected using isotope coded affinity tag (ICAT) labeling and mass spectroscopy. Adaptive pathways were selectively enriched with increased concentrations of proteins involved in mRNA processing (splicesome) and mRNA stabilization (glycolysis, GAPDH), as well as protein synthesis (aminoacyl-tRNA) and protein folding (antigen processing, Hsp70, protein disulfide isomerase). These results show the ability of chemical and environmental modulators to selectively alter compartmental intracellular and extracellular GSH and Cys concentrations and change their corresponding E(h) within the intact viable conceptus. The altered E(h) were also of sufficient magnitude to alter the redox proteome and change relative protein concentrations, suggesting that the mechanistic links through which environmental factors inform and regulate developmental signaling pathways may be discovered using systems developmental biology techniques. Copyright © 2013 Elsevier Inc. All rights reserved.

STERILE APETALA modulates the stability of a repressor protein complex to control organ size in Arabidopsis thaliana

PubMed Central

Wang, Zhibiao; Ru, Licong; Baekelandt, Alexandra; Goossens, Alain; Xu, Ran; Zhu, Zhengge; Inzé, Dirk; Li, Yunhai

2018-01-01

Organ size control is of particular importance for developmental biology and agriculture, but the mechanisms underlying organ size regulation remain elusive in plants. Meristemoids, which possess stem cell-like properties, have been recognized to play important roles in leaf growth. We have recently reported that the Arabidopsis F-box protein STERILE APETALA (SAP)/SUPPRESSOR OF DA1 (SOD3) promotes meristemoid proliferation and regulates organ size by influencing the stability of the transcriptional regulators PEAPODs (PPDs). Here we demonstrate that KIX8 and KIX9, which function as adaptors for the corepressor TOPLESS and PPD, are novel substrates of SAP. SAP interacts with KIX8/9 and modulates their protein stability. Further results show that SAP acts in a common pathway with KIX8/9 and PPD to control organ growth by regulating meristemoid cell proliferation. Thus, these findings reveal a molecular mechanism by which SAP targets the KIX-PPD repressor complex for degradation to regulate meristemoid cell proliferation and organ size. PMID:29401459

Characterization of a novel glycine-rich protein from the cell wall of maize silk tissues.

PubMed

Tao, T Y; Ouellet, T; Dadej, K; Miller, S S; Johnson, D A; Singh, J

2006-08-01

The isolation, characterization and regulation of expression of a maize silk-specific gene is described. zmgrp5 (Zea mays glycine-rich protein 5) encodes a 187 amino acid glycine-rich protein that displays developmentally regulated silk-specific expression. Northern, Western, in situ mRNA hybridization and transient gene expression analyses indicate that zmgrp5 is expressed in silk hair and in cells of the vascular bundle and pollen tube transmitting tissue elements. The protein is secreted into the extracellular matrix and is localized in the cell wall fraction mainly through interactions mediated by covalent disulphide bridges. Taken together, these results suggest that the protein may play a role in maintaining silk structure during development. This is the first documented isolation of a stigma-specific gene from maize, an important agronomic member of the Poaceae family.

Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

PubMed Central

Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

2016-01-01

For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

A.S.N. Reddy

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The regulation of SR45 mobility by ATP and a transcriptional inhibitor is in contrast to the mobility of SR family splicing factors in animals and suggests fundamental differences in the movement of plant and animals splicing factors. In vivo interaction of U170K with SR45: To analyze the interaction of U170K with SR45, we expressed these proteins fused to RFP and GFP respectively, in protoplasts. Both the reporters co-localized to the same subnuclear domains. To determine direct interaction of these proteins, we fused full-length U170K to one part of split YFP and full-length or truncated version of SR45 to the second half of split YFP. Coexpession of these split YFP constructs resulted in reconstitution of YFP in speckles, suggesting direction interaction of these proteins in vivo (Ali et al., 2008). SR45 is a Novel Plant-Specific Splicing Factor and is Involved in Regulating Multiple Developmental Processes: Using an in vitro splicing complementation assay, we showed that SR45 is an essential splicing factor. The sr45-1 mutant exhibited a number of developmental abnormalities. Further analysis of flowering time has shown that the autonomous pathway of flowering is affected in the mutant. Expression analysis of several flowering genes has revealed that FLC, a key flowering repressor, is up-regulated in the SR45 mutant. Further, alternative splicing pattern of several other SR genes was altered in the sr45-1 mutant in a tissue-specific manner. Hence, the observed pleiotropic effects on various aspects of development are likely due to altered level of SR protein isoforms, which in turn regulate the splicing of other pre-mRNAs. Expression of wild-type SR45 in the mutant complemented the phenotypic defects and changes in alternative splicing of SR genes. SR45 thus is a novel plant-specific splicing factor and plays a crucial role in multiple developmental processes.« less

C. elegans sym-1 is a downstream target of the hunchback-like-1 developmental timing transcription factor

PubMed Central

Niwa, Ryusuke; Hada, Kazumasa; Moliyama, Kouichi; Ohniwa, Ryosuke L.; Tan, Yi-Meng; Olsson-Carter, Katherine; Chi, Woo; Reinke, Valerie; Slack, Frank J.

2010-01-01

In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) and its family members control the timing of key developmental events in part by directly regulating expression of hunchback-like-1 (hbl-1). C. elegans hbl-1 mutants display multiple developmental timing deficiencies, including cell cycle defects during larval development. While hbl-1 is predicted to encode a transcriptional regulator, downstream targets of HBL-1 have not been fully elucidated. Here we report using microarray analysis to uncover genes downstream of HBL-1. We established a transgenic strain that overexpresses hbl-1 under the control of a heat shock promoter. Heat shock-induced hbl-1 overexpression led to retarded hypodermal structures at the adult stage, opposite to the effect seen in loss of function (lf) hbl-1 mutants. The microarray screen identified numerous potential genes that are upregulated or downregulated by HBL-1, including sym-1, which encodes a leucine-rich repeat protein with a signal sequence. We found an increase in sym-1 transcription in the heat shock-induced hbl-1 overexpression strain, while loss of hbl-1 function caused a decrease in sym-1 expression levels. Furthermore, we found that sym-1(lf) modified the hypodermal abnormalities in hbl-1 mutants. Given that SYM-1 is a protein secreted from hypodermal cells to the surrounding cuticle, we propose that the adult-specific cuticular structures may be under the temporal control of HBL-1 through regulation of sym-1 transcription. PMID:19923914

The expression of the Alzheimer’s Amyloid Precursor Protein-like gene is regulated by developmental timing microRNAs and their targets in Caenorhabditis elegans

PubMed Central

Niwa, Ryusuke; Zhou, Feng; Li, Chris; Slack, Frank J.

2008-01-01

Alzheimer’s Disease (AD) is a neurodegenerative disorder characterized by the accumulation of dense plaques in the brain, resulting in progressive dementia. A major plaque component is the β-amyloid peptide, which is a cleavage product of the amyloid precursor protein (APP). Studies of dominant inheritable familial AD support the hypothesis that APP is critical for AD development. On the other hand, the pathogenesis of amyloid plaque deposition in AD is thought to be the result of age-related changes with unknown mechanisms. Here we show that the Caenorhabditis elegans homolog of APP, APP-like-1 (apl-1), functions with and is under the control of molecules regulating developmental progression. In C. elegans, the timing of cell fate determination is controlled by the heterochronic genes, including let-7 microRNAs. C. elegans apl-1 shows significant genetic interactions with let-7 family microRNAs and let-7-targeted heterochronic genes, hbl-1, lin-41 and lin-42. apl-1 expression is upregulated during the last larval stage in hypodermal seam cells which is transcriptionally regulated by hbl-1, lin-41 and lin-42. Moreover, the levels of the apl-1 transcription are modulated by the activity of let-7 family microRNAs. Our works places apl-1 in a developmental timing pathway and may provide new insights into the time-dependent progression of AD. PMID:18262516

A novel interplay between the ubiquitin–proteasome system and serine proteases during Drosophila development.

PubMed

Lipinszki, Zoltán; Klement, Eva; Hunyadi-Gulyas, Eva; Medzihradszky, Katalin F; Márkus, Róbert; Pál, Margit; Deák, Péter; Udvardy, Andor

2013-09-15

The concentrations of the Drosophila proteasomal and extraproteasomal polyubiquitin receptors fluctuate in a developmentally regulated fashion. This fluctuation is generated by a previously unidentified proteolytic activity. In the present paper, we describe the purification, identification and characterization of this protease (endoproteinase I). Its expression increases sharply at the L1-L2 larval stages, remains high until the second half of the L3 stage, then declines dramatically. This sharp decrease coincides precisely with the increase of polyubiquitin receptor concentrations in late L3 larvae, which suggests a tight developmental co-regulation. RNAi-induced down-regulation of endoproteinase I results in pupal lethality. Interestingly, we found a cross-talk between the 26S proteasome and this larval protease: transgenic overexpression of the in vivo target of endoproteinase I, the C-terminal half of the proteasomal polyubiquitin receptor subunit p54/Rpn10 results in transcriptional down-regulation of endoproteinase I and consequently a lower level of proteolytic elimination of the polyubiquitin receptors. Another larval protease, Jonah65A-IV, which degrades only unfolded proteins and exhibits similar cross-talk with the proteasome has also been purified and characterized. It may prevent the accumulation of polyubiquitylated proteins in larvae contrary to the low polyubiquitin receptor concentration.

Non-coding RNAs—Novel targets in neurotoxicity

PubMed Central

Tal, Tamara L.; Tanguay, Robert L.

2012-01-01

Over the past ten years non-coding RNAs (ncRNAs) have emerged as pivotal players in fundamental physiological and cellular processes and have been increasingly implicated in cancer, immune disorders, and cardiovascular, neurodegenerative, and metabolic diseases. MicroRNAs (miRNAs) represent a class of ncRNA molecules that function as negative regulators of post-transcriptional gene expression. miRNAs are predicted to regulate 60% of all human protein-coding genes and as such, play key roles in cellular and developmental processes, human health, and disease. Relative to counterparts that lack bindings sites for miRNAs, genes encoding proteins that are post-transcriptionally regulated by miRNAs are twice as likely to be sensitive to environmental chemical exposure. Not surprisingly, miRNAs have been recognized as targets or effectors of nervous system, developmental, hepatic, and carcinogenic toxicants, and have been identified as putative regulators of phase I xenobiotic-metabolizing enzymes. In this review, we give an overview of the types of ncRNAs and highlight their roles in neurodevelopment, neurological disease, activity-dependent signaling, and drug metabolism. We then delve into specific examples that illustrate their importance as mediators, effectors, or adaptive agents of neurotoxicants or neuroactive pharmaceutical compounds. Finally, we identify a number of outstanding questions regarding ncRNAs and neurotoxicity. PMID:22394481

Differential expression of genes in fetal brain as a consequence of maternal protein deficiency and nematode infection.

PubMed

Haque, Manjurul; Starr, Lisa M; Koski, Kristine G; Scott, Marilyn E

2018-01-01

Maternal dietary protein deficiency and gastrointestinal nematode infection during early pregnancy have negative impacts on both maternal placental gene expression and fetal growth in the mouse. Here we used next-generation RNA sequencing to test our hypothesis that maternal protein deficiency and/or nematode infection also alter the expression of genes in the developing fetal brain. Outbred pregnant CD1 mice were used in a 2×2 design with two levels of dietary protein (24% versus 6%) and two levels of infection (repeated sham versus Heligmosomoides bakeri beginning at gestation day 5). Pregnant dams were euthanized on gestation day 18 to harvest the whole fetal brain. Four fetal brains from each treatment group were analyzed using RNA Hi-Seq sequencing and the differential expression of genes was determined by the edgeR package using NetworkAnalyst. In response to maternal H. bakeri infection, 96 genes (88 up-regulated and eight down-regulated) were differentially expressed in the fetal brain. Differentially expressed genes were involved in metabolic processes, developmental processes and the immune system according to the PANTHER classification system. Among the important biological functions identified, several up-regulated genes have known neurological functions including neuro-development (Gdf15, Ing4), neural differentiation (miRNA let-7), synaptic plasticity (via suppression of NF-κβ), neuro-inflammation (S100A8, S100A9) and glucose metabolism (Tnnt1, Atf3). However, in response to maternal protein deficiency, brain-specific serine protease (Prss22) was the only up-regulated gene and only one gene (Dynlt1a) responded to the interaction of maternal nematode infection and protein deficiency. In conclusion, maternal exposure to GI nematode infection from day 5 to 18 of pregnancy may influence developmental programming of the fetal brain. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

PubMed

Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

2006-01-01

In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

PubMed Central

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

PubMed Central

Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

2015-01-01

Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

Prefrontal Cortex Dysfunction in Fragile X Mice Depends on the Continued Absence of Fragile X Mental Retardation Protein in the Adult Brain.

PubMed

Siegel, Jennifer J; Chitwood, Raymond A; Ding, James M; Payne, Clayton; Taylor, William; Gray, Richard; Zemelman, Boris V; Johnston, Daniel

2017-08-02

Fragile X Syndrome (FX) is generally considered a developmental disorder, arising from a mutation that disrupts the transcription of Fragile X Mental Retardation Protein (FMRP). However, FMRP regulates the transcription of other proteins and participates in an unknown number of protein-protein interactions throughout life. In addition to known developmental issues, it is thus likely that some dysfunction is also due to the ongoing absence of FMRP. Dissociating dysfunction due to developmental dysregulation from dysfunction due to the continued absence of FMRP is necessary to understand the different roles of FMRP and to treat patients effectively throughout life. We show here that FX model mice display substantial deficits in a PFC-dependent task. We then use conditional knock-out mice to eliminate FMRP only in the PFC alone of adult mice. We observe an increase in the proportion of nonlearners and a delay in the onset of learning in both FX and conditional knock-out mice. The results suggest that these deficits (1) are due to the absence of FMRP in the PFC alone and (2) are not the result of developmental dysregulation. Furthermore, PFC-associated deficits are rescued by initiating production of FMRP in adult conditional restoration mice, suggesting that PFC dysfunction may persist as long as FMRP is absent and therefore can be rescued after development. The data suggest that it is possible to dissociate the roles of FMRP in neural function from developmental dysregulation, and that PFC function can be restored in the adult FX brain. SIGNIFICANCE STATEMENT The absence of Fragile X Mental Retardation Protein (FMRP) from birth results in developmental disabilities and lifelong impairments. We show here that in mouse models PFC dysfunction in Fragile X Syndrome (FX) can be attributed to the continued absence of FMRP from the PFC, independent of FMRP status during development. Furthermore, initiation of FMRP production in the PFC of adult FX animals rescues PFC function. The results suggest that at least some FX-specific neurological defects can be rescued in the adult FX brain after development. Copyright © 2017 the authors 0270-6474/17/377305-13$15.00/0.

Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

PubMed Central

Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

2012-01-01

The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

Drosophila Fip200 is an essential regulator of autophagy that attenuates both growth and aging.

PubMed

Kim, Myungjin; Park, Hae Li; Park, Hwan-Woo; Ro, Seung-Hyun; Nam, Samuel G; Reed, John M; Guan, Jun-Lin; Lee, Jun Hee

2013-08-01

Autophagy-related 1 (Atg1)/Unc-51-like protein kinases (ULKs) are evolutionarily conserved proteins that play critical physiological roles in controlling autophagy, cell growth and neurodevelopment. RB1-inducible coiled-coil 1 (RB1CC1), also known as PTK2/FAK family-interacting protein of 200 kDa (FIP200) is a recently discovered binding partner of ULK1. Here we isolated the Drosophila RB1CC1/FIP200 homolog (Fip200/CG1347) and showed that it mediates Atg1-induced autophagy as a genetically downstream component in diverse physiological contexts. Fip200 loss-of-function mutants experienced severe mobility loss associated with neuronal autophagy defects and neurodegeneration. The Fip200 mutants were also devoid of both developmental and starvation-induced autophagy in salivary gland and fat body, while having no defects in axonal transport and projection in developing neurons. Interestingly, moderate downregulation of Fip200 accelerated both developmental growth and aging, accompanied by target of rapamycin (Tor) signaling upregulation. These results suggest that Fip200 is a critical downstream component of Atg1 and specifically mediates Atg1's autophagy-, aging- and growth-regulating functions.

Drosophila Fip200 is an essential regulator of autophagy that attenuates both growth and aging

PubMed Central

Kim, Myungjin; Park, Hae Li; Park, Hwan-Woo; Ro, Seung-Hyun; Nam, Samuel G.; Reed, John M.; Guan, Jun-Lin; Lee, Jun Hee

2013-01-01

Autophagy-related 1 (Atg1)/Unc-51-like protein kinases (ULKs) are evolutionarily conserved proteins that play critical physiological roles in controlling autophagy, cell growth and neurodevelopment. RB1-inducible coiled-coil 1 (RB1CC1), also known as PTK2/FAK family-interacting protein of 200 kDa (FIP200) is a recently discovered binding partner of ULK1. Here we isolated the Drosophila RB1CC1/FIP200 homolog (Fip200/CG1347) and showed that it mediates Atg1-induced autophagy as a genetically downstream component in diverse physiological contexts. Fip200 loss-of-function mutants experienced severe mobility loss associated with neuronal autophagy defects and neurodegeneration. The Fip200 mutants were also devoid of both developmental and starvation-induced autophagy in salivary gland and fat body, while having no defects in axonal transport and projection in developing neurons. Interestingly, moderate downregulation of Fip200 accelerated both developmental growth and aging, accompanied by target of rapamycin (Tor) signaling upregulation. These results suggest that Fip200 is a critical downstream component of Atg1 and specifically mediates Atg1’s autophagy-, aging- and growth-regulating functions. PMID:23819996

A Gestational High Protein Diet Affects the Abundance of Muscle Transcripts Related to Cell Cycle Regulation throughout Development in Porcine Progeny

PubMed Central

Oster, Michael; Murani, Eduard; Metges, Cornelia C.; Ponsuksili, Siriluck; Wimmers, Klaus

2012-01-01

Background In various animal models pregnancy diets have been shown to affect offspring phenotype. Indeed, the underlying programming of development is associated with modulations in birth weight, body composition, and continual diet-dependent modifications of offspring metabolism until adulthood, producing the hypothesis that the offspring's transcriptome is permanently altered depending on maternal diet. Methodology/Principal Findings To assess alterations of the offspring's transcriptome due to gestational protein supply, German Landrace sows were fed isoenergetic diets containing protein levels of either 30% (high protein - HP) or 12% (adequate protein - AP) throughout their pregnancy. Offspring muscle tissue (M. longissimus dorsi) was collected at 94 days post conception (dpc), and 1, 28, and 188 days post natum (dpn) for use with Affymetrix GeneChip Porcine Genome Arrays and subsequent statistical and Ingenuity pathway analyses. Numerous transcripts were found to have altered abundance at 94 dpc and 1 dpn; at 28 dpn no transcripts were altered, and at 188 dpn only a few transcripts showed a different abundance between diet groups. However, when assessing transcriptional changes across developmental time points, marked differences were obvious among the dietary groups. Depending on the gestational dietary exposure, short- and long-term effects were observed for mRNA expression of genes related to cell cycle regulation, energy metabolism, growth factor signaling pathways, and nucleic acid metabolism. In particular, the abundance of transcripts related to cell cycle remained divergent among the groups during development. Conclusion Expression analysis indicates that maternal protein supply induced programming of the offspring's genome; early postnatal compensation of the slight growth retardation obvious at birth in HP piglets resulted, as did a permanently different developmental alteration and responsiveness to the common environment of the transcriptome. The transcriptome modulations are interpreted as the molecular equivalent of developmental plasticity of the offspring that necessitates adaptation and maintenance of the organismal phenotype. PMID:22496824

Activation by Insulin and Amino Acids of Signaling Components Leading to Translation Initiation in Skeletal Muscle of Neonatal Pigs Is Developmentally Regulated

PubMed Central

Suryawan, Agus; Orellana, Renan A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Fleming, Jillian R.; Davis, Teresa A.

2009-01-01

Insulin (INS) and amino acids (AA) act independently to stimulate protein synthesis in skeletal muscle of neonatal pigs and the responses decrease with development. The purpose of this study was to compare the separate effects of fed levels of INS and AA on the activation of signaling components leading to translation initiation and how these responses change with development. Overnight fasted 6-day-old (n=4/group) and 26-day-old (n=6/group) pigs were studied during: 1) euinsulinemic-euglycemic-euaminoacidemic conditions (controls), 2) euinsulinemic-euglycemic-hyperaminoacidemic clamps (AA), and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps (INS). INS, but not AA, increased the phosphorylation of protein kinase B (PKB) and tuberous sclerosis 2 (TSC2). Both INS and AA increased protein synthesis and the phosphorylation of mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase-1, and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4E-BP1) and these responses were higher in 6-day-old compared to 26-day-old pigs. Both INS and AA decreased the binding of 4E-BP1 to eIF4E and increased eIF4E binding to eIF4G; these effects were greater in 6-day-old than in 26-day-old pigs. Neither INS nor AA altered the composition of mTORC1 (raptor, mTOR, and GβL) or mTORC2 (rictor, mTOR, and GβL) complexes. Furthermore, neither INS, AA, nor age had any effect on the abundance of Rheb and the phosphorylation of AMP-activated kinase (AMPK) and eukaryotic elongation factor 2 (eEF2). Our results suggest that the activation by insulin and amino acids of signaling components leading to translation initiation is developmentally regulated and parallels the developmental decline in protein synthesis in skeletal muscle of neonatal pigs. PMID:17878222

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism.

PubMed

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R; Raikhel, Natasha V

2015-01-06

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.

Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

PubMed Central

Almoguera, C.; Coca, M. A.; Jordano, J.

1995-01-01

We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

De novo pathogenic variants in CHAMP1 are associated with global developmental delay, intellectual disability, and dysmorphic facial features.

PubMed

Tanaka, Akemi J; Cho, Megan T; Retterer, Kyle; Jones, Julie R; Nowak, Catherine; Douglas, Jessica; Jiang, Yong-Hui; McConkie-Rosell, Allyn; Schaefer, G Bradley; Kaylor, Julie; Rahman, Omar A; Telegrafi, Aida; Friedman, Bethany; Douglas, Ganka; Monaghan, Kristin G; Chung, Wendy K

2016-01-01

We identified five unrelated individuals with significant global developmental delay and intellectual disability (ID), dysmorphic facial features and frequent microcephaly, and de novo predicted loss-of-function variants in chromosome alignment maintaining phosphoprotein 1 (CHAMP1). Our findings are consistent with recently reported de novo mutations in CHAMP1 in five other individuals with similar features. CHAMP1 is a zinc finger protein involved in kinetochore-microtubule attachment and is required for regulating the proper alignment of chromosomes during metaphase in mitosis. Mutations in CHAMP1 may affect cell division and hence brain development and function, resulting in developmental delay and ID.

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

Deciphering the Role of POLYCOMB REPRESSIVE COMPLEX1 Variants in Regulating the Acquisition of Flowering Competence in Arabidopsis1

PubMed Central

Picó, Sara; Merini, Wiam

2015-01-01

Polycomb group (PcG) proteins play important roles in regulating developmental phase transitions in plants; however, little is known about the role of the PcG machinery in regulating the transition from juvenile to adult phase. Here, we show that Arabidopsis (Arabidopsis thaliana) B lymphoma Moloney murine leukemia virus insertion region1 homolog (BMI1) POLYCOMB REPRESSIVE COMPLEX1 (PRC1) components participate in the repression of microRNA156 (miR156). Loss of AtBMI1 function leads to the up-regulation of the primary transcript of MIR156A and MIR156C at the time the levels of miR156 should decline, resulting in an extended juvenile phase and delayed flowering. Conversely, the PRC1 component EMBRYONIC FLOWER (EMF1) participates in the regulation of SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE and MIR172 genes. Accordingly, plants impaired in EMF1 function displayed misexpression of these genes early in development, which contributes to a CONSTANS-independent up-regulation of FLOWERING LOCUS T (FT) leading to the earliest flowering phenotype described in Arabidopsis. Our findings show how the different regulatory roles of two functional PRC1 variants coordinate the acquisition of flowering competence and help to reach the threshold of FT necessary to flower. Furthermore, we show how two central regulatory mechanisms, such as PcG and microRNA, assemble to achieve a developmental outcome. PMID:25897002

Deciphering the Role of POLYCOMB REPRESSIVE COMPLEX1 Variants in Regulating the Acquisition of Flowering Competence in Arabidopsis.

PubMed

Picó, Sara; Ortiz-Marchena, M Isabel; Merini, Wiam; Calonje, Myriam

2015-08-01

Polycomb group (PcG) proteins play important roles in regulating developmental phase transitions in plants; however, little is known about the role of the PcG machinery in regulating the transition from juvenile to adult phase. Here, we show that Arabidopsis (Arabidopsis thaliana) B lymphoma Moloney murine leukemia virus insertion region1 homolog (BMI1) POLYCOMB REPRESSIVE COMPLEX1 (PRC1) components participate in the repression of microRNA156 (miR156). Loss of AtBMI1 function leads to the up-regulation of the primary transcript of MIR156A and MIR156C at the time the levels of miR156 should decline, resulting in an extended juvenile phase and delayed flowering. Conversely, the PRC1 component EMBRYONIC FLOWER (EMF1) participates in the regulation of SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE and MIR172 genes. Accordingly, plants impaired in EMF1 function displayed misexpression of these genes early in development, which contributes to a CONSTANS-independent up-regulation of FLOWERING LOCUS T (FT) leading to the earliest flowering phenotype described in Arabidopsis. Our findings show how the different regulatory roles of two functional PRC1 variants coordinate the acquisition of flowering competence and help to reach the threshold of FT necessary to flower. Furthermore, we show how two central regulatory mechanisms, such as PcG and microRNA, assemble to achieve a developmental outcome. © 2015 American Society of Plant Biologists. All Rights Reserved.

MicroRNA Transcriptome Profiles During Swine Skeletal Muscle Development

USDA-ARS?s Scientific Manuscript database

MicroRNA (miR) are a class of small RNAs that regulate gene expression by inhibiting translation of protein encoding transcripts. To evaluate the role of miR in skeletal muscle of swine, global microRNA abundance was measured at specific developmental stages including proliferating satellite cells,...

Krebs Cycle Moonlights in Caspase Regulation.

PubMed

Minis, Adi; Steller, Hermann

2016-04-04

In this issue of Developmental Cell, Aram et al. (2016) identify a mechanism that uses a Krebs cycle protein to control local activation of a ubiquitin ligase complex at the mitochondrial outer membrane for temporally and spatially restricted caspase activation during Drosophila sperm differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

PubMed

Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

2018-04-11

The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

Zinc and Zinc Transporters: Novel Regulators of Ventricular Myocardial Development.

PubMed

Lin, Wen; Li, Deqiang

2018-06-01

Ventricular myocardial development is a well-orchestrated process involving different cardiac structures, multiple signal pathways, and myriad proteins. Dysregulation of this important developmental event can result in cardiomyopathies, such as left ventricle non-compaction, which affect the pediatric population and the adults. Human and mouse studies have shed light upon the etiology of some cardiomyopathy cases and highlighted the contribution of both genetic and environmental factors. However, the regulation of ventricular myocardial development remains incompletely understood. Zinc is an essential trace metal with structural, enzymatic, and signaling function. Perturbation of zinc homeostasis has resulted in developmental and physiological defects including cardiomyopathy. In this review, we summarize several mechanisms by which zinc and zinc transporters can impact the regulation of ventricular myocardial development. Based on our review, we propose that zinc deficiency and mutations of zinc transporters may underlie some cardiomyopathy cases especially those involving ventricular myocardial development defects.

Chromatin dynamics in plants.

PubMed

Fransz, Paul F; de Jong, J Hans

2002-12-01

Recent studies in yeast, animals and plants have provided major breakthroughs in unraveling the molecular mechanism of higher-order gene regulation. In conjunction with the DNA code, proteins that are involved in chromatin remodeling, histone modification and epigenetic imprinting form a large network of interactions that control the nuclear programming of cell identity. New insight into how chromatin conformations are regulated in plants sheds light on the relationships between chromosome function, cell differentiation and developmental patterns.

Regulation of Glucose Transport in Quiescent, Lactating, and Neoplastic Mammary Epithelia

DTIC Science & Technology

2000-10-01

Manuscripts, Abstracts, Presentations Manuscripts 1. Nemeth, BN, Tsang, ST, Geske , RS, Haney, PM. Golgi targeting of the GLUT 1 glucose transporter in...targeting in lactating mouse mammary gland. Mol. Biol. Cell 1997; 8, 307a (ASCB poster presentation). 6. Geske , S, Haney, PM. Developmental regulation...1995. Characterization of a cis-Golgi matrix protein, GM130. JCellBiol 131:1715-1726. NEMETH BA, TSANG SWY, GESKE RS, HANEY PM, 2000. Golgi targeting

Proteomic Analysis of Silk Viability in Maize Inbred Lines and Their Corresponding Hybrids

PubMed Central

Wang, Yafei; Zhao, Xiaofeng; Zhang, Fangfang; Tang, Jihua; Fu, Zhiyuan

2015-01-01

A long period of silk viability is critical for a good seed setting rate in maize (Zea mays L.), especially for inbred lines and hybrids with a long interval between anthesis and silking. To explore the molecular mechanism of silk viability and its heterosis, three inbred lines with different silk viability characteristics (Xun928, Lx9801, and Zong3) and their two hybrids (Xun928×Zong3 and Lx9801×Zong3) were analyzed at different developmental stages by a proteomic method. The differentially accumulated proteins were identified by mass spectrometry and classified into metabolism, protein biosynthesis and folding, signal transduction and hormone homeostasis, stress and defense responses, and cellular processes. Proteins involved in nutrient (methionine) and energy (ATP) supply, which support the pollen tube growth in the silk, were important for silk viability and its heterosis. The additive and dominant effects at a single locus, as well as complex epistatic interactions at two or more loci in metabolic pathways, were the primary contributors for mid-parent heterosis of silk viability. Additionally, the proteins involved in the metabolism of anthocyanins, which indirectly negatively regulate local hormone accumulation, were also important for the mid-parent heterosis of silk viability. These results also might imply the developmental dependence of heterosis, because many of the differentially accumulated proteins made distinct contributions to the heterosis of silk viability at specific developmental stages. PMID:26630375

Proteomic Analysis of Silk Viability in Maize Inbred Lines and Their Corresponding Hybrids.

PubMed

Ma, Zhihui; Qin, Yongtian; Wang, Yafei; Zhao, Xiaofeng; Zhang, Fangfang; Tang, Jihua; Fu, Zhiyuan

2015-01-01

A long period of silk viability is critical for a good seed setting rate in maize (Zea mays L.), especially for inbred lines and hybrids with a long interval between anthesis and silking. To explore the molecular mechanism of silk viability and its heterosis, three inbred lines with different silk viability characteristics (Xun928, Lx9801, and Zong3) and their two hybrids (Xun928×Zong3 and Lx9801×Zong3) were analyzed at different developmental stages by a proteomic method. The differentially accumulated proteins were identified by mass spectrometry and classified into metabolism, protein biosynthesis and folding, signal transduction and hormone homeostasis, stress and defense responses, and cellular processes. Proteins involved in nutrient (methionine) and energy (ATP) supply, which support the pollen tube growth in the silk, were important for silk viability and its heterosis. The additive and dominant effects at a single locus, as well as complex epistatic interactions at two or more loci in metabolic pathways, were the primary contributors for mid-parent heterosis of silk viability. Additionally, the proteins involved in the metabolism of anthocyanins, which indirectly negatively regulate local hormone accumulation, were also important for the mid-parent heterosis of silk viability. These results also might imply the developmental dependence of heterosis, because many of the differentially accumulated proteins made distinct contributions to the heterosis of silk viability at specific developmental stages.

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

PubMed Central

2012-01-01

Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental stages as well as in barley cultivars with different seed size was evidenced for both genes. The two barley Type I MADS-box genes were found to be induced by ABA and JA. DNA methylation differences in different seed developmental stages and after exogenous application of ABA is suggestive of epigenetic regulation of gene expression. The study of barley Type I-like MADS-box genes extends our investigations of gene regulation during endosperm and seed development in a monocot crop like barley. PMID:22985436

mRNA localization: an orchestration of assembly, traffic and synthesis.

PubMed

Xing, Lei; Bassell, Gary J

2013-01-01

Asymmetrical mRNA localization and subsequent local translation provide efficient mechanisms for protein sorting in polarized cells. Defects in mRNA localization have been linked to developmental abnormalities and neurological diseases. Thus, it is critical to understand the machineries mediating and mechanisms underlying the asymmetrical distribution of mRNA and its regulation. The goal of this review is to summarize recent advances in the understanding of mRNA transport and localization, including the assembly and sorting of transport messenger ribonucleic protein (mRNP) granules, molecular mechanisms of active mRNP transport, cytoskeletal interactions and regulation of these events by extracellular signals. © 2012 John Wiley & Sons A/S.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

A novel zinc-finger protein with a proline-rich domain mediates ABA-regulated seed dormancy in Arabidopsis.

PubMed

He, Yuehui; Gan, Susheng

2004-01-01

Seed dormancy is an important developmental process that prevents pre-harvest sprouting in many grains and other seeds. Abscisic acid (ABA), a plant hormone, plays a crucial role in regulating dormancy but the underlying molecular regulatory mechanisms are not fully understood. An Arabidopsis zinc-finger gene, MEDIATOR OF ABA-REGULATED DORMANCY 1 ( MARD1 ) was identified and functionally analyzed. MARD1 expression is up-regulated by ABA. A T-DNA insertion in the promoter region downstream of two ABA-responsive elements (ABREs) renders MARD1 unable to respond to ABA. The mard1 seeds are less dormant and germinate in total darkness; their germination is resistant to external ABA at the stage of radicle protrusion. These results suggest that this novel zinc-finger protein with a proline-rich N-terminus is an important downstream component of the ABA signaling pathway that mediates ABA-regulated seed dormancy in Arabidopsis.

Ribosomal protein RPS-14 modulates let-7 microRNA function in Caenorhabditis elegans

PubMed Central

Chan, Shih-Peng; Slack, Frank J.

2009-01-01

The let-7 microRNA (miRNA) regulates developmental timing at the larval-to-adult transition in Caenorhabditis elegans. Dysregulation of let-7 results in irregular hypodermal and vulval development. Disrupted let-7 function is also a feature of human lung cancer. However, little is known about the mechanism and co-factors of let-7. Here we demonstrate that ribosomal protein RPS-14 is able to modulate let-7 function in C. elegans. The RPS-14 protein co-immunoprecipitated with the nematode Argonaute homolog, ALG-1. Reduction of rps-14 gene expression by RNAi suppressed the aberrant vulva and hypodermis development phenotypes of let-7(n2853) mutant animals and the mis-regulation of a reporter bearing the lin-41 3′UTR, a well established let-7 target. Our results indicate an interactive relationship between let-7 miRNA function and ribosomal protein RPS-14 in regulation of terminal differentiation that may help in understanding the mechanism of translational control by miRNAs. PMID:19627982

Analysis of Sir2E in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

PubMed

Katayama, Takahiro; Yasukawa, Hiro

2008-10-01

It has been reported that Dictyostelium discoideum encodes four silent information regulator 2 (Sir2) proteins (Sir2A-D) showing sequence similarity to human homologues of Sir2 (SIRT1-3). Further screening in a database revealed that D. discoideum encodes an additional Sir2 homologue (Sir2E). The amino acid sequence of Sir2E is not similar to those of SIRTs but is similar to those of proteins encoded by Giardia lamblia, Cryptosporidium hominis and Cryptosporidium parvum. Fluorescence of Sir2E-green fluorescent protein fusion protein was detected in the D. discoideum nucleus, indicating that Sir2E is a nuclear localizing protein. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that D. discoideum expressed sir2E in amoebae in the growth phase and in prestalk cells in the developmental phase. D. discoideum overexpressing sir2E grew faster than the wild type. These results indicate that Sir2E plays important roles both in the growth phase and developmental phase of D. discoideum.

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

Proteomic analysis of the signaling pathway mediated by the heterotrimeric Gα protein Pga1 of Penicillium chrysogenum.

PubMed

Carrasco-Navarro, Ulises; Vera-Estrella, Rosario; Barkla, Bronwyn J; Zúñiga-León, Eduardo; Reyes-Vivas, Horacio; Fernández, Francisco J; Fierro, Francisco

2016-10-06

The heterotrimeric Gα protein Pga1-mediated signaling pathway regulates the entire developmental program in Penicillium chrysogenum, from spore germination to the formation of conidia. In addition it participates in the regulation of penicillin biosynthesis. We aimed to advance the understanding of this key signaling pathway using a proteomics approach, a powerful tool to identify effectors participating in signal transduction pathways. Penicillium chrysogenum mutants with different levels of activity of the Pga1-mediated signaling pathway were used to perform comparative proteomic analyses by 2D-DIGE and LC-MS/MS. Thirty proteins were identified which showed differences in abundance dependent on Pga1 activity level. By modifying the intracellular levels of cAMP we could establish cAMP-dependent and cAMP-independent pathways in Pga1-mediated signaling. Pga1 was shown to regulate abundance of enzymes in primary metabolic pathways involved in ATP, NADPH and cysteine biosynthesis, compounds that are needed for high levels of penicillin production. An in vivo phosphorylated protein containing a pleckstrin homology domain was identified; this protein is a candidate for signal transduction activity. Proteins with possible roles in purine metabolism, protein folding, stress response and morphogenesis were also identified whose abundance was regulated by Pga1 signaling. Thirty proteins whose abundance was regulated by the Pga1-mediated signaling pathway were identified. These proteins are involved in primary metabolism, stress response, development and signal transduction. A model describing the pathways through which Pga1 signaling regulates different cellular processes is proposed.

[Epigenome: what we learned from Rett syndrome, a neurological disease caused by mutation of a methyl-CpG binding protein].

PubMed

Kubota, Takeo

2013-01-01

Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).

Targeting protein neddylation: a novel therapeutic strategy for the treatment of cancer.

PubMed

Wang, Meng; Medeiros, Bruno C; Erba, Harry P; DeAngelo, Daniel J; Giles, Francis J; Swords, Ronan T

2011-03-01

The NEDD8 (neural precursor cell-expressed developmentally downregulated 8) conjugation pathway regulates the post-translational modification of oncogenic proteins. This pathway has important potential for cancer therapeutics. Several proteins vital in cancer biology are regulated by protein neddylation. These observations led to the development of a small molecule inhibitor that disrupts protein neddylation and leads to cancer cell death and important activity in early phase clinical trials. This review provides an extensive coverage of cellular protein homeostasis with particular emphasis on the NEDD8 conjugation pathway. Insights into a new investigational drug that specifically disrupts the NEDD8 pathway are discussed. The clinical data for this agent are also updated. Neddylation controls key cellular pathways found to be dysregulated in many cancers. Protein neddylation is a relatively under-explored pathway for pharmacologic inhibition in cancer. Selective disruption of this pathway has demonstrated clinical activity in patients with myeloid neoplasms and is worth exploring further in combination with other anti-leukemia agents.

Dual targeting and retrograde translocation: regulators of plant nuclear gene expression can be sequestered by plastids.

PubMed

Krause, Kirsten; Oetke, Svenja; Krupinska, Karin

2012-01-01

Changes in the developmental or metabolic state of plastids can trigger profound changes in the transcript profiles of nuclear genes. Many nuclear transcription factors were shown to be controlled by signals generated in the organelles. In addition to the many different compounds for which an involvement in retrograde signaling is discussed, accumulating evidence suggests a role for proteins in plastid-to-nucleus communication. These proteins might be sequestered in the plastids before they act as transcriptional regulators in the nucleus. Indeed, several proteins exhibiting a dual localization in the plastids and the nucleus are promising candidates for such a direct signal transduction involving regulatory protein storage in the plastids. Among such proteins, the nuclear transcription factor WHIRLY1 stands out as being the only protein for which an export from plastids and translocation to the nucleus has been experimentally demonstrated. Other proteins, however, strongly support the notion that this pathway might be more common than currently believed.

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride

PubMed Central

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E.; Staege, Martin S.; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS. PMID:29515560

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

PubMed

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration

PubMed Central

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2, which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words “neuron” or “axonogenesis” were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer’s, Parkinson’s, and Huntington’s diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell–cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin–radixin–moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2’s importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases. PMID:28798667

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration.

PubMed

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2 , which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words "neuron" or "axonogenesis" were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer's, Parkinson's, and Huntington's diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell-cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin-radixin-moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2's importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases.

Nrf2 and Nrf2-Related Proteins in Development and Developmental Toxicity: Insights from studies in Zebrafish (Danio rerio)

PubMed Central

Hahn, Mark E.; Timme-Laragy, Alicia R.; Karchner, Sibel I.; Stegeman, John J.

2015-01-01

Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap’n’collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. PMID:26130508

Aroclor 1254, a developmental neurotoxicant, alters energy metabolism- and intracellular signaling-associated protein networks in rat cerebellum and hippocampus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodavanti, Prasada Rao S., E-mail: kodavanti.prasada@epa.gov; Osorio, Cristina; Program on Molecular Biology and Biotechnology, University of North Carolina at Chapel Hill, North Carolina

2011-11-15

The vast literature on the mode of action of polychlorinated biphenyls (PCBs) indicates that PCBs are a unique model for understanding the mechanisms of toxicity of environmental mixtures of persistent chemicals. PCBs have been shown to adversely affect psychomotor function and learning and memory in humans. Although the molecular mechanisms for PCB effects are unclear, several studies indicate that the disruption of Ca{sup 2+}-mediated signal transduction plays significant roles in PCB-induced developmental neurotoxicity. Culminating events in signal transduction pathways include the regulation of gene and protein expression, which affects the growth and function of the nervous system. Our previous studiesmore » showed changes in gene expression related to signal transduction and neuronal growth. In this study, protein expression following developmental exposure to PCB is examined. Pregnant rats (Long Evans) were dosed with 0.0 or 6.0 mg/kg/day of Aroclor-1254 from gestation day 6 through postnatal day (PND) 21, and the cerebellum and hippocampus from PND14 animals were analyzed to determine Aroclor 1254-induced differential protein expression. Two proteins were found to be differentially expressed in the cerebellum following PCB exposure while 18 proteins were differentially expressed in the hippocampus. These proteins are related to energy metabolism in mitochondria (ATP synthase, sub unit {beta} (ATP5B), creatine kinase, and malate dehydrogenase), calcium signaling (voltage-dependent anion-selective channel protein 1 (VDAC1) and ryanodine receptor type II (RyR2)), and growth of the nervous system (dihydropyrimidinase-related protein 4 (DPYSL4), valosin-containing protein (VCP)). Results suggest that Aroclor 1254-like persistent chemicals may alter energy metabolism and intracellular signaling, which might result in developmental neurotoxicity. -- Highlights: Black-Right-Pointing-Pointer We performed brain proteomic analysis of rats exposed to the neurotoxicant, Aroclor 1254. Black-Right-Pointing-Pointer Cerebellum and hippocampus were analyzed by 2D DIGE and Mass spectrometry. Black-Right-Pointing-Pointer Proteins affected participate in Energy metabolism, calcium signaling and nervous system growth.« less

Nuclear Lamins

PubMed Central

Dechat, Thomas; Adam, Stephen A.; Taimen, Pekka; Shimi, Takeshi; Goldman, Robert D.

2010-01-01

The nuclear lamins are type V intermediate filament proteins that are critically important for the structural properties of the nucleus. In addition, they are involved in the regulation of numerous nuclear processes, including DNA replication, transcription and chromatin organization. The developmentally regulated expression of lamins suggests that they are involved in cellular differentiation. Their assembly dynamic properties throughout the cell cycle, particularly in mitosis, are influenced by posttranslational modifications. Lamins may regulate nuclear functions by direct interactions with chromatin and determining the spatial organization of chromosomes within the nuclear space. They may also regulate chromatin functions by interacting with factors that epigenetically modify the chromatin or directly regulate replication or transcription. PMID:20826548

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Developmental expression and distribution of nesfatin-1/NUCB2 in the canine digestive system.

PubMed

Jiang, Shudong; Zhou, Weijuan; Zhang, Xingwang; Wang, Dengfeng; Zhu, Hui; Hong, Meizhen; Gong, Yajing; Ye, Jing; Fang, Fugui

2016-03-01

Nesfatin-1/NUCB2 is a neuropeptide that plays important roles in regulating food intake and energy homeostasis. The distribution of nesfatin-1/NUCB2 protein and mRNA has not been investigated in the canine digestive system. The present study was conducted to evaluate the expression of nesfatin-1/NUCB2 protein and NUCB2 mRNA in the canine digestive organs (esophagus, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, liver and pancreas). The tissues of the digestive system were collected from dogs at different developmental stages (infantile, juvenile, pubertal and adult). Nesfatin-1/NUCB2 protein localization in the organs of adult dogs was detected by immunohistochemistry. The expression of NUCB2 mRNA at the four developmental stages was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). Nesfatin-1/NUCB2 protein was distributed in the fundic gland region of the stomach, and the islet area and exocrine portions of the pancreas. However, NUCB2 mRNA was found in all digestive organs, although the expression levels in the pancreas and stomach were higher than those in liver, duodenum and other digestive tract tissues (P<0.05) at the four different developmental stages of the dogs. In this study, nesfatin-1/NUCB2 was found to be present at high levels in the stomach and pancreas at both the protein and mRNA levels; however, NUCB2 expression was found at lower levels in all of the digestive organs. These findings provide the basis of further investigations to elucidate the functions of nefatin-1 in the canine digestive system. Copyright © 2015 Elsevier GmbH. All rights reserved.

The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

PubMed

Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

2011-04-01

The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

Localization of palmitoylated and activated G protein α-subunit in Dictyostelium discoideum.

PubMed

Alamer, Sarah; Kageyama, Yusuke; Gundersen, Robert E

2018-06-01

Guanine nucleotide-binding proteins (G proteins) act as molecular switches to regulate many fundamental cellular processes. The lipid modification, palmitoylation, can be considered as a key factor for proper G protein function and plasma membrane localization. In Dictyostelium discoidum, Gα2 is essential for the chemotactic response to cAMP in their developmental life cycle. However, the regulation of Gα2 with respect to palmitoylation, activation and Gβγ association is less clear. In this study, Gα2 is shown to be palmitoylated on Cys-4 by [ 3 H]palmitate labeling. Loss of this palmitoylation site results in redistribution of Gα2 within the cell and poor D. discoideum development. Cellular re-localization is also observed for activated Gα2. In the membrane fraction, Gα2-wt (YFP) is highly enriched in a low-density membrane fraction, which is palmitoylation-dependent. Activated Gα2 monomer and heterotrimer are shifted to two different higher-density fractions. These results broaden our understanding of how G protein localization and function are regulated inside the cells. © 2018 Wiley Periodicals, Inc.

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

PubMed

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

A Proteomic Study of Brassinosteroid Response in Arabidopsis

PubMed Central

Deng, Zhiping; Zhang, Xin; Tang, Wenqiang; Oses-Prieto, Juan A; Suzuki, Nagi; Gendron, Joshua M; Chen, Huanjing; Guan, Shenheng; Chalkley, Robert J.; Peterman, T. Kaye; Burlingame, Alma L.; Wang, Zhi-Yong

2010-01-01

Summary The plant steroid hormones brassinosteroids (BRs) play an important role in a wide range of developmental and physiological processes. How BR signaling regulates diverse processes remains unclear. To understand the molecular details of BR responses, we have performed a proteomic study of BR-regulated proteins in Arabidopsis using two-dimensional difference gel electrophoresis (2-D DIGE) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). We identified 42 BR-regulated proteins, which are predicted to play potential roles in BR regulation of specific cellular processes, such as signaling, cytoskeleton rearrangement, vesicle trafficking, and biosynthesis of hormones and vitamins. Analyses of the BR insensitive mutant bri1-116 and BR hypersensitive mutant bzr1-1D identified 5 proteins (PATL1, PATL2, THI1, AtMDAR3 and NADP-ME2) affected by both BR-treatment and in the mutants, suggesting their importance in BR action. Selected proteins were further studied using insertion knockout mutants or immunoblotting. Interestingly, about 80% of the BR-responsive proteins were not identified in previous microarray studies, and direct comparison between protein- and RNA changes in BR mutants revealed a very weak correlation. RT-PCR analysis of selected genes revealed gene-specific kinetic relationships between RNA and protein responses. Furthermore, BR-regulated posttranslational modification of BiP2 protein was detected as spot shifts in 2-D DIGE. This study provides novel insights into the molecular networks that link BR signaling to specific cellular and physiological responses. PMID:17848588

Eight RGS and RGS-like Proteins Orchestrate Growth, Differentiation, and Pathogenicity of Magnaporthe oryzae

PubMed Central

Zhang, Haifeng; Tang, Wei; Liu, Kaiyue; Huang, Qian; Zhang, Xin; Yan, Xia; Chen, Yue; Wang, Jiansheng; Qi, Zhongqiang; Wang, Zhengyi; Zheng, Xiaobo; Wang, Ping; Zhang, Zhengguang

2011-01-01

A previous study identified MoRgs1 as an RGS protein that negative regulates G-protein signaling to control developmental processes such as conidiation and appressorium formation in Magnaporthe oryzae. Here, we characterized additional seven RGS and RGS-like proteins (MoRgs2 through MoRgs8). We found that MoRgs1 and MoRgs4 positively regulate surface hydrophobicity, conidiation, and mating. Indifference to MoRgs1, MoRgs4 has a role in regulating laccase and peroxidase activities. MoRgs1, MoRgs2, MoRgs3, MoRgs4, MoRgs6, and MoRgs7 are important for germ tube growth and appressorium formation. Interestingly, MoRgs7 and MoRgs8 exhibit a unique domain structure in which the RGS domain is linked to a seven-transmembrane motif, a hallmark of G-protein coupled receptors (GPCRs). We have also shown that MoRgs1 regulates mating through negative regulation of Gα MoMagB and is involved in the maintenance of cell wall integrity. While all proteins appear to be involved in the control of intracellular cAMP levels, only MoRgs1, MoRgs3, MoRgs4, and MoRgs7 are required for full virulence. Taking together, in addition to MoRgs1 functions as a prominent RGS protein in M. oryzae, MoRgs4 and other RGS and RGS-like proteins are also involved in a complex process governing asexual/sexual development, appressorium formation, and pathogenicity. PMID:22241981

Interplay between the Localization and Kinetics of Phosphorylation in Flagellar Pole Development of the Bacterium Caulobacter crescentus

PubMed Central

Tropini, Carolina; Huang, Kerwyn Casey

2012-01-01

Bacterial cells maintain sophisticated levels of intracellular organization that allow for signal amplification, response to stimuli, cell division, and many other critical processes. The mechanisms underlying localization and their contribution to fitness have been difficult to uncover, due to the often challenging task of creating mutants with systematically perturbed localization but normal enzymatic activity, and the lack of quantitative models through which to interpret subtle phenotypic changes. Focusing on the model bacterium Caulobacter crescentus, which generates two different types of daughter cells from an underlying asymmetric distribution of protein phosphorylation, we use mathematical modeling to investigate the contribution of the localization of histidine kinases to the establishment of cellular asymmetry and subsequent developmental outcomes. We use existing mutant phenotypes and fluorescence data to parameterize a reaction-diffusion model of the kinases PleC and DivJ and their cognate response regulator DivK. We then present a systematic computational analysis of the effects of changes in protein localization and abundance to determine whether PleC localization is required for correct developmental timing in Caulobacter. Our model predicts the developmental phenotypes of several localization mutants, and suggests that a novel strain with co-localization of PleC and DivJ could provide quantitative insight into the signaling threshold required for flagellar pole development. Our analysis indicates that normal development can be maintained through a wide range of localization phenotypes, and that developmental defects due to changes in PleC localization can be rescued by increased PleC expression. We also show that the system is remarkably robust to perturbation of the kinetic parameters, and while the localization of either PleC or DivJ is required for asymmetric development, the delocalization of one of these two components does not prevent flagellar pole development. We further find that allosteric regulation of PleC observed in vitro does not affect the predicted in vivo developmental phenotypes. Taken together, our model suggests that cells can tolerate perturbations to localization phenotypes, whose evolutionary origins may be connected with reducing protein expression or with decoupling pre- and post-division phenotypes. PMID:22876167

Young and old honey bee (Apis mellifera) larvae differentially prime the developmental maturation of their caregivers

USDA-ARS?s Scientific Manuscript database

In eusocial insects daughters rear the offspring of the queen to adulthood. In the honey bee, Apis mellifera, nurses differentially regulate larval nutrition. Among worker-destined larvae, younger instars receive an unrestricted diet paralleling that of queen larvae in protein composition but with r...

Knickkopf protein protects and organizes chitin in the newly synthesized insect exoskeleton

USDA-ARS?s Scientific Manuscript database

New cuticle synthesis and molting are complex developmental processes that all insects must undergo to allow for growth. However, little is known about how insects regulate the selective degradation of the old cuticle while leaving the new one intact. In this study we show that in the red flour beet...

Information Propagation in Developmental Enhancers

NASA Astrophysics Data System (ADS)

Jena, Siddhartha; Levine, Michael

Rather than encoding information about protein sequence, certain lengths of noncoding DNA, called enhancers, interact with protein machinery such as transcription factors to precisely regulate gene expression. Enhancers have been studied extensively in the fruit fly Drosophila melanogaster, where they regulate the expression of developmental genes that establish the blueprint of the adult fly. It has been suggested that enhancer sequences possess a specific but unknown syntax with regards to the placement and strength of transcription factor binding sites. Moreover, studies in divergent fly species have shown that compensatory evolution allows for maintenance of enhancer functionality despite considerable variation in primary DNA sequence. Here, the possible role of enhancers as signal processing modules is studied as a way of explaining these two findings. We first demonstrate how this framework can be used to explain the fine-tuned spatiotemporal dynamics of gene expression. We then explore the evolutionary pressure on enhancer sequences and the resulting emergence of enhancers that are linked by compensatory mutations. This study provides a possible mechanism for the function of multiple enhancers linked to a single gene.

Analyses of advanced rice anther transcriptomes reveal global tapetum secretory functions and potential proteins for lipid exine formation.

PubMed

Huang, Ming-Der; Wei, Fu-Jin; Wu, Cheng-Cheih; Hsing, Yue-Ie Caroline; Huang, Anthony H C

2009-02-01

The anthers in flowers perform important functions in sexual reproduction. Several recent studies used microarrays to study anther transcriptomes to explore genes controlling anther development. To analyze the secretion and other functions of the tapetum, we produced transcriptomes of anthers of rice (Oryza sativa subsp. japonica) at six progressive developmental stages and pollen with sequencing-by-synthesis technology. The transcriptomes included at least 18,000 unique transcripts, about 25% of which had antisense transcripts. In silico anther-minus-pollen subtraction produced transcripts largely unique to the tapetum; these transcripts include all the reported tapetum-specific transcripts of orthologs in other species. The differential developmental profiles of the transcripts and their antisense transcripts signify extensive regulation of gene expression in the anther, especially the tapetum, during development. The transcriptomes were used to dissect two major cell/biochemical functions of the tapetum. First, we categorized and charted the developmental profiles of all transcripts encoding secretory proteins present in the cellular exterior; these transcripts represent about 12% and 30% of the those transcripts having more than 100 and 1,000 transcripts per million, respectively. Second, we successfully selected from hundreds of transcripts several transcripts encoding potential proteins for lipid exine synthesis during early anther development. These proteins include cytochrome P450, acyltransferases, and lipid transfer proteins in our hypothesized mechanism of exine synthesis in and export from the tapetum. Putative functioning of these proteins in exine formation is consistent with proteins and metabolites detected in the anther locule fluid obtained by micropipetting.

Odors regulate Arc expression in neuronal ensembles engaged in odor processing.

PubMed

Guthrie, K; Rayhanabad, J; Kuhl, D; Gall, C

2000-06-26

Synaptic activity is critical to developmental and plastic processes that produce long-term changes in neuronal connectivity and function. Genes expressed by neurons in an activity-dependent fashion are of particular interest since the proteins they encode may mediate neuronal plasticity. One such gene encodes the activity-regulated cytoskeleton-associated protein, Arc. The present study evaluated the effects of odor stimulation on Arc expression in rat olfactory bulb. Arc mRNA was rapidly increased in functionally linked cohorts of neurons topographically activated by odor stimuli. These included neurons surrounding individual glomeruli, mitral cells and transynaptically activated granule cells. Dendritic Arc immunoreactivity was also increased in odor-activated glomeruli. Our results suggest that odor regulation of Arc expression may contribute to activity-dependent structural changes associated with olfactory experience.

Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

PubMed

Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

PubMed Central

Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE PAGES

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.; ...

2014-12-22

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Control of Retrograde Signaling by Rapid Turnover of GENOMES UNCOUPLED11[OPEN

PubMed Central

Chalvin, Camille; Wu, Xu Na

2018-01-01

The exchange of signals between cellular compartments coordinates development and differentiation, modulates metabolic pathways, and triggers responses to environmental conditions. The proposed central regulator of plastid-to-nucleus retrograde signaling, GENOMES UNCOUPLED1 (GUN1), is present at very low levels, which has hampered the discovery of its precise molecular function. Here, we show that the Arabidopsis (Arabidopsis thaliana) GUN1 protein accumulates to detectable levels only at very early stages of leaf development, where it functions in the regulation of chloroplast biogenesis. GUN1 mRNA is present at high levels in all tissues, but GUN1 protein undergoes rapid degradation (with an estimated half-life of ∼4 h) in all tissues where chloroplast biogenesis has been completed. The rapid turnover of GUN1 is controlled mainly by the chaperone ClpC1, suggesting degradation of GUN1 by the Clp protease. Degradation of GUN1 slows under stress conditions that alter retrograde signaling, thus ensuring that the plant has sufficient GUN1 protein. We also find that the pentatricopeptide repeat motifs of GUN1 are important determinants of GUN1 stability. Moreover, overexpression of GUN1 causes an early flowering phenotype, suggesting a function of GUN1 in developmental phase transitions beyond chloroplast biogenesis. Taken together, our results provide new insight into the regulation of GUN1 by proteolytic degradation, uncover its function in early chloroplast biogenesis, and suggest a role in developmental phase transitions. PMID:29367233

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development

PubMed Central

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development. PMID:26039357

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development.

PubMed

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development.

Identification of functional elements and regulatory circuits by Drosophila modENCODE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- andmore » tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions of {approx}40% of the protein and nonprotein-coding genes [FlyBase 5.12 (4)] have been determined from cDNA collections (5, 6), manual curation of gene models (7), gene mutations and comprehensive genome-wide RNA interference screens (8-10), and comparative genomic analyses (11, 12). The Drosophila modENCODE project has generated more than 700 data sets that profile transcripts, histone modifications and physical nucleosome properties, general and specific transcription factors (TFs), and replication programs in cell lines, isolated tissues, and whole organisms across several developmental stages (Fig. 1). Here, we computationally integrate these data sets and report (i) improved and additional genome annotations, including full-length proteincoding genes and peptides as short as 21 amino acids; (ii) noncoding transcripts, including 132 candidate structural RNAs and 1608 nonstructural transcripts; (iii) additional Argonaute (Ago)-associated small RNA genes and pathways, including new microRNAs (miRNAs) encoded within protein-coding exons and endogenous small interfering RNAs (siRNAs) from 3-inch untranslated regions; (iv) chromatin 'states' defined by combinatorial patterns of 18 chromatin marks that are associated with distinct functions and properties; (v) regions of high TF occupancy and replication activity with likely epigenetic regulation; (vi)mixed TF and miRNA regulatory networks with hierarchical structure and enriched feed-forward loops; (vii) coexpression- and co-regulation-based functional annotations for nearly 3000 genes; (viii) stage- and tissue-specific regulators; and (ix) predictive models of gene expression levels and regulator function.« less

The SUMO Pathway Is Developmentally Regulated and Required for Programmed DNA Elimination in Paramecium tetraurelia† ‡

PubMed Central

Matsuda, Atsushi; Forney, James D.

2006-01-01

Extensive genome-wide remodeling occurs during the formation of the somatic macronuclei from the germ line micronuclei in ciliated protozoa. This process is limited to sexual reproduction and includes DNA amplification, chromosome fragmentation, and the elimination of internal segments of DNA. Our efforts to define the pathways regulating these events revealed a gene encoding a homologue of ubiquitin activating enzyme 2 (UBA2) that is upregulated at the onset of macronuclear development in Paramecium tetraurelia. Uba2 enzymes are known to activate the protein called small ubiquitin-related modifier (SUMO) that is covalently attached to target proteins. Consistent with this relationship, Northern analysis showed increased abundance of SUMO transcripts during sexual reproduction in Paramecium. RNA interference (RNAi) against UBA2 or SUMO during vegetative growth had little effect on cell survival or fission rates. In contrast, RNAi of mating cells resulted in failure to form a functional macronucleus. Despite normal amplification of the genome, excision of internal eliminated sequences was completely blocked. Additional experiments showed that the homologous UBA2 and SUMO genes in Tetrahymena thermophila are also upregulated during conjugation. These results provide evidence for the developmental regulation of the SUMO pathway in ciliates and suggest a key role for the pathway in controlling genome remodeling. PMID:16682458

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Genome-wide analysis of Polycomb targets in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.

2006-04-01

Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entiremore » transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.« less

MicroRNA networks in mouse lung organogenesis.

PubMed

Dong, Jie; Jiang, Guoqian; Asmann, Yan W; Tomaszek, Sandra; Jen, Jin; Kislinger, Thomas; Wigle, Dennis A

2010-05-26

MicroRNAs (miRNAs) are known to be important regulators of both organ development and tumorigenesis. MiRNA networks and their regulation of messenger RNA (mRNA) translation and protein expression in specific biological processes are poorly understood. We explored the dynamic regulation of miRNAs in mouse lung organogenesis. Comprehensive miRNA and mRNA profiling was performed encompassing all recognized stages of lung development beginning at embryonic day 12 and continuing to adulthood. We analyzed the expression patterns of dynamically regulated miRNAs and mRNAs using a number of statistical and computational approaches, and in an integrated manner with protein levels from an existing mass-spectrometry derived protein database for lung development. In total, 117 statistically significant miRNAs were dynamically regulated during mouse lung organogenesis and clustered into distinct temporal expression patterns. 11,220 mRNA probes were also shown to be dynamically regulated and clustered into distinct temporal expression patterns, with 3 major patterns accounting for 75% of all probes. 3,067 direct miRNA-mRNA correlation pairs were identified involving 37 miRNAs. Two defined correlation patterns were observed upon integration with protein data: 1) increased levels of specific miRNAs directly correlating with downregulation of predicted mRNA targets; and 2) increased levels of specific miRNAs directly correlating with downregulation of translated target proteins without detectable changes in mRNA levels. Of 1345 proteins analyzed, 55% appeared to be regulated in this manner with a direct correlation between miRNA and protein level, but without detectable change in mRNA levels. Systematic analysis of microRNA, mRNA, and protein levels over the time course of lung organogenesis demonstrates dynamic regulation and reveals 2 distinct patterns of miRNA-mRNA interaction. The translation of target proteins affected by miRNAs independent of changes in mRNA level appears to be a prominent mechanism of developmental regulation in lung organogenesis.

Protein Phosphatase 2A (PP2A)-specific Ubiquitin Ligase MID1 Is a Sequence-dependent Regulator of Translation Efficiency Controlling 3-Phosphoinositide-dependent Protein Kinase-1 (PDPK-1)*

PubMed Central

Aranda-Orgillés, Beatriz; Rutschow, Désirée; Zeller, Raphael; Karagiannidis, Antonios I.; Köhler, Andrea; Chen, Changwei; Wilson, Timothy; Krause, Sven; Roepcke, Stefan; Lilley, David; Schneider, Rainer; Schweiger, Susann

2011-01-01

We have shown previously that the ubiquitin ligase MID1, mutations of which cause the midline malformation Opitz BBB/G syndrome (OS), serves as scaffold for a microtubule-associated protein complex that regulates protein phosphatase 2A (PP2A) activity in a ubiquitin-dependent manner. Here, we show that the MID1 protein complex associates with mRNAs via a purine-rich sequence motif called MIDAS (MID1 association sequence) and thereby increases stability and translational efficiency of these mRNAs. Strikingly, inclusion of multiple copies of the MIDAS motif into mammalian mRNAs increases production of the encoded proteins up to 20-fold. Mutated MID1, as found in OS patients, loses its influence on MIDAS-containing mRNAs, suggesting that the malformations in OS patients could be caused by failures in the regulation of cytoskeleton-bound protein translation. This is supported by the observation that the majority of mRNAs that carry MIDAS motifs is involved in developmental processes and/or energy homeostasis. Further analysis of one of the proteins encoded by a MIDAS-containing mRNA, namely PDPK-1 (3-phosphoinositide dependent protein kinase-1), which is an important regulator of mammalian target of rapamycin/PP2A signaling, showed that PDPK-1 protein synthesis is significantly reduced in cells from an OS patient compared with an age-matched control and can be rescued by functional MID1. Together, our data uncover a novel messenger ribonucleoprotein complex that regulates microtubule-associated protein translation. They suggest a novel mechanism underlying OS and point at an enormous potential of the MIDAS motif to increase the efficiency of biotechnological protein production in mammalian cells. PMID:21930711

Learning the Languages of the Chloroplast: Retrograde Signaling and Beyond.

PubMed

Chan, Kai Xun; Phua, Su Yin; Crisp, Peter; McQuinn, Ryan; Pogson, Barry J

2016-04-29

The chloroplast can act as an environmental sensor, communicating with the cell during biogenesis and operation to change the expression of thousands of proteins. This process, termed retrograde signaling, regulates expression in response to developmental cues and stresses that affect photosynthesis and yield. Recent advances have identified many signals and pathways-including carotenoid derivatives, isoprenes, phosphoadenosines, tetrapyrroles, and heme, together with reactive oxygen species and proteins-that build a communication network to regulate gene expression, RNA turnover, and splicing. However, retrograde signaling pathways have been viewed largely as a means of bilateral communication between organelles and nuclei, ignoring their potential to interact with hormone signaling and the cell as a whole to regulate plant form and function. Here, we discuss new findings on the processes by which organelle communication is initiated, transmitted, and perceived, not only to regulate chloroplastic processes but also to intersect with cellular signaling and alter physiological responses.

Quantitative Profiling Identifies Potential Regulatory Proteins Involved in Development from Dauer Stage to L4 Stage in Caenorhabditis elegans.

PubMed

Kim, Sunhee; Lee, Hyoung-Joo; Hahm, Jeong-Hoon; Jeong, Seul-Ki; Park, Don-Ha; Hancock, William S; Paik, Young-Ki

2016-02-05

When Caenorhabditis elegans encounters unfavorable growth conditions, it enters the dauer stage, an alternative L3 developmental period. A dauer larva resumes larval development to the normal L4 stage by uncharacterized postdauer reprogramming (PDR) when growth conditions become more favorable. During this transition period, certain heterochronic genes involved in controlling the proper sequence of developmental events are known to act, with their mutations suppressing the Muv (multivulva) phenotype in C. elegans. To identify the specific proteins in which the Muv phenotype is highly suppressed, quantitative proteomic analysis with iTRAQ labeling of samples obtained from worms at L1 + 30 h (for continuous development [CD]) and dauer recovery +3 h (for postdauer development [PD]) was carried out to detect changes in protein abundance in the CD and PD states of both N2 and lin-28(n719). Of the 1661 unique proteins identified with a < 1% false discovery rate at the peptide level, we selected 58 proteins exhibiting ≥2-fold up-regulation or ≥2-fold down-regulation in the PD state and analyzed the Gene Ontology terms. RNAi assays against 15 selected up-regulated genes showed that seven genes were predicted to be involved in higher Muv phenotype (p < 0.05) in lin-28(n791), which is not seen in N2. Specifically, two genes, K08H10.1 and W05H9.1, displayed not only the highest rate (%) of Muv phenotype in the RNAi assay but also the dauer-specific mRNA expression, indicating that these genes may be required for PDR, leading to the very early onset of dauer recovery. Thus, our proteomic approach identifies and quantitates the regulatory proteins potentially involved in PDR in C. elegans, which safeguards the overall lifecycle in response to environmental changes.

Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori.

PubMed

Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling

2017-01-01

A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.

Proteome profiling of flax (Linum usitatissimum) seed: characterization of functional metabolic pathways operating during seed development.

PubMed

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Kadoo, Narendra Y; Giri, Ashok P; Gupta, Vidya S

2012-12-07

Flax (Linum usitatissimum L.) seeds are an important source of food and feed due to the presence of various health promoting compounds, making it a nutritionally and economically important plant. An in-depth analysis of the proteome of developing flax seed is expected to provide significant information with respect to the regulation and accumulation of such storage compounds. Therefore, a proteomic analysis of seven seed developmental stages (4, 8, 12, 16, 22, 30, and 48 days after anthesis) in a flax variety, NL-97 was carried out using a combination of 1D-SDS-PAGE and LC-MSE methods. A total 1716 proteins were identified and their functional annotation revealed that a majority of them were involved in primary metabolism, protein destination, storage and energy. Three carbon assimilatory pathways appeared to operate in flax seeds. Reverse transcription quantitative PCR of selected 19 genes was carried out to understand their roles during seed development. Besides storage proteins, methionine synthase, RuBisCO and S-adenosylmethionine synthetase were highly expressed transcripts, highlighting their importance in flax seed development. Further, the identified proteins were mapped onto developmental seed specific expressed sequence tag (EST) libraries of flax to obtain transcriptional evidence and 81% of them had detectable expression at the mRNA level. This study provides new insights into the complex seed developmental processes operating in flax.

Cytochrome c Gene and Protein Expression: Developmental Regulation, Environmental Response, and Pesticide Sensitivity in Aedes aegypti

DTIC Science & Technology

2008-05-01

biological systems. In the mosquito Aedes ae- gypti (L.), a primary vector of dengue and yellow fever viruses, the role of cytochrome c during devel...development of mosquitoes re- quiresmultigene regulation(Seversonet al. 2004,Fon- tenille et al. 2005,Raibaudet al. 2006, Strodeet al. 2006, van den...1.5% RH in an environ- mental chamber (L-C Incubator, Lab-Line Instru- ments, Inc., Melrose Park, IL) for the time course study. Sixty individuals (30

Roles of mTOR Signaling in Brain Development.

PubMed

Lee, Da Yong

2015-09-01

mTOR is a serine/threonine kinase composed of multiple protein components. Intracellular signaling of mTOR complexes is involved in many of physiological functions including cell survival, proliferation and differentiation through the regulation of protein synthesis in multiple cell types. During brain development, mTOR-mediated signaling pathway plays a crucial role in the process of neuronal and glial differentiation and the maintenance of the stemness of neural stem cells. The abnormalities in the activity of mTOR and its downstream signaling molecules in neural stem cells result in severe defects of brain developmental processes causing a significant number of brain disorders, such as pediatric brain tumors, autism, seizure, learning disability and mental retardation. Understanding the implication of mTOR activity in neural stem cells would be able to provide an important clue in the development of future brain developmental disorder therapies.

Morphine Regulated Synaptic Networks Revealed by Integrated Proteomics and Network Analysis*

PubMed Central

Stockton, Steven D.; Gomes, Ivone; Liu, Tong; Moraje, Chandrakala; Hipólito, Lucia; Jones, Matthew R.; Ma'ayan, Avi; Morón, Jose A.; Li, Hong; Devi, Lakshmi A.

2015-01-01

Despite its efficacy, the use of morphine for the treatment of chronic pain remains limited because of the rapid development of tolerance, dependence and ultimately addiction. These undesired effects are thought to be because of alterations in synaptic transmission and neuroplasticity within the reward circuitry including the striatum. In this study we used subcellular fractionation and quantitative proteomics combined with computational approaches to investigate the morphine-induced protein profile changes at the striatal postsynaptic density. Over 2,600 proteins were identified by mass spectrometry analysis of subcellular fractions enriched in postsynaptic density associated proteins from saline or morphine-treated striata. Among these, the levels of 34 proteins were differentially altered in response to morphine. These include proteins involved in G-protein coupled receptor signaling, regulation of transcription and translation, chaperones, and protein degradation pathways. The altered expression levels of several of these proteins was validated by Western blotting analysis. Using Genes2Fans software suite we connected the differentially expressed proteins with proteins identified within the known background protein-protein interaction network. This led to the generation of a network consisting of 116 proteins with 40 significant intermediates. To validate this, we confirmed the presence of three proteins predicted to be significant intermediates: caspase-3, receptor-interacting serine/threonine protein kinase 3 and NEDD4 (an E3-ubiquitin ligase identified as a neural precursor cell expressed developmentally down-regulated protein 4). Because this morphine-regulated network predicted alterations in proteasomal degradation, we examined the global ubiquitination state of postsynaptic density proteins and found it to be substantially altered. Together, these findings suggest a role for protein degradation and for the ubiquitin/proteasomal system in the etiology of opiate dependence and addiction. PMID:26149443

Differential expression of syndecan isoforms during mouse incisor amelogenesis.

PubMed

Muto, Taro; Miyoshi, Keiko; Munesue, Seiichi; Nakada, Hiroshi; Okayama, Minoru; Matsuo, Takashi; Noma, Takafumi

2007-08-01

Syndecans are transmembranous heparan sulfate proteoglycans (HSPGs) with covalently attached glycosaminoglycan side-chains located on the cell surface. The mammalian syndecan family is composed of four types of syndecans (syndecan-1 to -4). Syndecans interact with the intracellular cytoskeleton through the cytoplasmic domains of their core proteins and membrane proteins, extracellular enzymes, growth factors, and matrix components, through their heparan-sulfate chains, to regulate developmental processes.Here, as a first step to assess the possible roles of syndecan proteins in amelogenesis, we examined the expression patterns of all syndecan isoforms in continuously growing mouse incisors, in which we can overview major differentiation stages of amelogenesis at a glance. Understanding the expression domain of each syndecan isoform during specific developmental stages seems useful for investigating their physiological roles in amelogenesis. Immunohistochemical analysis of syndecan core proteins in the lower incisors from postnatal day 1 mice revealed spatially and temporally specific expression patterns, with syndecan-1 expressed in undifferentiated epithelial and mesenchymal cells, and syndecan-2, -3, and -4 in more differentiated cells. These findings suggest that each syndecan isoform functions distinctly during the amelogenesis of the incisors of mice.

A Developmentally Regulated Chaperone Complex for the Endoplasmic Reticulum of Male Haploid Germ Cells

PubMed Central

van Lith, Marcel; Karala, Anna-Riikka; Bown, Dave; Gatehouse, John A.; Ruddock, Lloyd W.; Saunders, Philippa T.K.

2007-01-01

Glycoprotein folding is mediated by lectin-like chaperones and protein disulfide isomerases (PDIs) in the endoplasmic reticulum. Calnexin and the PDI homologue ERp57 work together to help fold nascent polypeptides with glycans located toward the N-terminus of a protein, whereas PDI and BiP may engage proteins that lack glycans or have sugars toward the C-terminus. In this study, we show that the PDI homologue PDILT is expressed exclusively in postmeiotic male germ cells, in contrast to the ubiquitous expression of many other PDI family members in the testis. PDILT is induced during puberty and represents the first example of a PDI family member under developmental control. We find that PDILT is not active as an oxido-reductase, but interacts with the model peptide Δ-somatostatin and nonnative bovine pancreatic trypsin inhibitor in vitro, indicative of chaperone activity. In vivo, PDILT forms a tissue-specific chaperone complex with the calnexin homologue calmegin. The identification of a redox-inactive chaperone partnership defines a new system of testis-specific protein folding with implications for male fertility. PMID:17507649

A genome-wide survey on basic helix-loop-helix transcription factors in giant panda.

PubMed

Dang, Chunwang; Wang, Yong; Zhang, Debao; Yao, Qin; Chen, Keping

2011-01-01

The giant panda (Ailuropoda melanoleuca) is a critically endangered mammalian species. Studies on functions of regulatory proteins involved in developmental processes would facilitate understanding of specific behavior in giant panda. The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including fruit fly, zebrafish, mouse and human. Our present study identified 107 bHLH family members being encoded in giant panda genome. Phylogenetic analyses revealed that they belong to 44 bHLH families with 46, 25, 15, 4, 11 and 3 members in group A, B, C, D, E and F, respectively, while the remaining 3 members were assigned into "orphan". Compared to mouse, the giant panda does not encode seven bHLH proteins namely Beta3a, Mesp2, Sclerax, S-Myc, Hes5 (or Hes6), EBF4 and Orphan 1. These results provide useful background information for future studies on structure and function of bHLH proteins in the regulation of giant panda development.

Conditional deletion of SLP-76 in mature T cells abrogates peripheral immune responses1

PubMed Central

Wu, Gregory F.; Corbo, Evann; Schmidt, Michelle; Smith-Garvin, Jennifer E.; Riese, Matthew J.; Jordan, Martha S.; Laufer, Terri M.; Brown, Eric J.; Maltzman, Jonathan S.

2011-01-01

SUMMARY The adaptor protein Src homology 2 domain-containing leukocyte-specific protein of 76 kDa (SLP-76) is central to the organization of intracellular signaling downstream of the T cell receptor (TCR). Evaluation of its role in mature, primary T cells has been hampered by developmental defects that occur in the absence of wild-type SLP-76 protein in thymocytes. Following tamoxifen-regulated conditional deletion of SLP-76, mature, antigen-inexperienced T cells maintain normal TCR surface expression but fail to transduce TCR generated signals. Conditionally deficient T cells fail to proliferate in response to antigenic stimulation or a lymphopenic environment. Mice with induced deletion of SLP-76 are resistant to induction of the CD4+ T cell mediated autoimmune disease experimental autoimmune encephalomyelitis. Our findings demonstrate the critical role of SLP-76-mediated signaling in initiating T cell-directed immune responses both in vitro and in vivo and highlight the ability to analyze signaling processes in mature T cells in the absence of developmental defects. PMID:21469089

Mucin-Type O-Glycosylation in Invertebrates.

PubMed

Staudacher, Erika

2015-06-09

O-Glycosylation is one of the most important posttranslational modifications of proteins. It takes part in protein conformation, protein sorting, developmental processes and the modulation of enzymatic activities. In vertebrates, the basics of the biosynthetic pathway of O-glycans are already well understood. However, the regulation of the processes and the molecular aspects of defects, especially in correlation with cancer or developmental abnormalities, are still under investigation. The knowledge of the correlating invertebrate systems and evolutionary aspects of these highly conserved biosynthetic events may help improve the understanding of the regulatory factors of this pathway. Invertebrates display a broad spectrum of glycosylation varieties, providing an enormous potential for glycan modifications which may be used for the design of new pharmaceutically active substances. Here, overviews of the present knowledge of invertebrate mucin-type O-glycan structures and the currently identified enzymes responsible for the biosynthesis of these oligosaccharides are presented, and the few data dealing with functional aspects of O-glycans are summarised.

Cytokinin-auxin crosstalk in cell type specification.

PubMed

Chandler, John William; Werr, Wolfgang

2015-05-01

Auxin and cytokinin affect cell fate specification transcriptionally and non-transcriptionally, and their roles have been characterised in several founder cell specification and activation contexts. Similarly to auxin, local cytokinin synthesis and response gradients are instructive, and the roles of ARABIDOPSIS RESPONSE REGULATOR 7/15 (ARR7/15) and the negative cytokinin response regulator ARABIDOPSIS HISTIDINE PHOSPHOTRANSFER PROTEIN 6, as well as auxin signalling via MONOPTEROS/BODENLOS, are functionally conserved across different developmental processes. Auxin and cytokinin crosstalk is tissue- and context-specific, and may be synergistic in the shoot apical meristem (SAM) but antagonistic in the root. We review recent advances in understanding the interactions between auxin and cytokinin in pivotal developmental processes, and show that feedback complexity and the multistep nature of specification processes argue against a single morphogenetic signal. Copyright © 2015 Elsevier Ltd. All rights reserved.

UV-damaged DNA binding protein-1 and de-etiolated-1 regulate golden 2-like transcription factor by assembling a cullin 4-based ubiquitin ligase in tomato

USDA-ARS?s Scientific Manuscript database

Fleshy fruit undergo a novel developmental program that ends in the irreversible process of ripening and eventual tissue senescence. During these maturation processes, fruit undergo numerous physiological, biochemical and structural alterations, making them more attractive to seed dispersal organism...

Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

PubMed

Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

2009-04-01

Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

BDNF regulates the translation of a select group of mRNAs by a mammalian target of rapamycin-phosphatidylinositol 3-kinase-dependent pathway during neuronal development.

PubMed

Schratt, Gerhard M; Nigh, Elizabeth A; Chen, Wen G; Hu, Linda; Greenberg, Michael E

2004-08-18

Local regulation of mRNA translation plays an important role in axon guidance, synaptic development, and neuronal plasticity. Little is known, however, regarding the mechanisms that control translation in neurons, and only a few mRNAs have been identified that are locally translated within axon and dendrites. Using Affymetrix gene arrays to identify mRNAs that are newly associated with polysomes after exposure to BDNF, we identified subsets of mRNAs for which translation is enhanced in neurons at different developmental stages. In mature neurons, many of these mRNAs encode proteins that are known to function at synapses, including CamKIIalpha, NMDA receptor subunits, and the postsynaptic density (PSD) scaffolding protein Homer2. BDNF regulates the translation of Homer2 locally in the synaptodendritic compartment by activating translational initiation via a mammalian target of rapamycin-phosphatidylinositol 3-kinase-dependent pathway. These findings suggest that BDNF likely regulates synaptic function by inducing the local synthesis of numerous synaptic proteins. The local translation of the cytoskeleton-associated protein Homer2 in particular might have important implications for growth cone dynamics and dendritic spine development.

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

Regulation of planar growth by the Arabidopsis AGC protein kinase UNICORN.

PubMed

Enugutti, Balaji; Kirchhelle, Charlotte; Oelschner, Maxi; Torres Ruiz, Ramón Angel; Schliebner, Ivo; Leister, Dario; Schneitz, Kay

2012-09-11

The spatial coordination of growth is of central importance for the regulation of plant tissue architecture. Individual layers, such as the epidermis, are clonally propagated and structurally maintained by symmetric cell divisions that are oriented along the plane of the layer. The developmental control of this process is poorly understood. The simple cellular basis and sheet-like structure of Arabidopsis integuments make them an attractive model system to address planar growth. Here we report on the characterization of the Arabidopsis UNICORN (UCN) gene. Analysis of ucn integuments reveals localized distortion of planar growth, eventually resulting in an ectopic multicellular protrusion. In addition, ucn mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. We further show that UCN encodes an active AGC VIII kinase. Genetic, biochemical, and cell biological data suggest that UCN suppresses ectopic growth in integuments by directly repressing the KANADI transcription factor ABERRANT TESTA SHAPE. Our findings indicate that UCN represents a unique plant growth regulator that maintains planar growth of integuments by repressing a developmental regulator involved in the control of early integument growth and polarity.

Drosophila Fragile X Mental Retardation Protein Developmentally Regulates Activity-Dependent Axon Pruning

PubMed Central

Tessier, Charles R.; Broadie, Kendal

2014-01-01

Summary Fragile X Syndrome (FraX) is a broad-spectrum neurological disorder with symptoms ranging from hyperexcitability to mental retardation and autism. Loss of the fragile X mental retardation 1 (fmr1) gene product, the mRNA-binding translational regulator FMRP, causes structural over-elaboration of dendritic and axonal processes as well as functional alterations in synaptic plasticity at maturity. It is unclear, however, whether FraX is primarily a disease of development, a disease of plasticity or both; a distinction vital for engineering intervention strategies. To address this critical issue, we have used the Drosophila FraX model to investigate the developmental roles of Drosophila FMRP (dFMRP). dFMRP expression and regulation of chickadee/profilin coincides with a transient window of late brain development. During this time, dFMRP is positively regulated by sensory input activity, and required to limit axon growth and for efficient activity-dependent pruning of axon branches in the Mushroom Body learning/memory center. These results demonstrate that dFMRP has a primary role in activity-dependent neural circuit refinement in late brain development. PMID:18321984

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE PAGES

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.; ...

2017-04-26

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

Alcohol exposure during development: Impact on the epigenome.

PubMed

Perkins, Amy; Lehmann, Claudia; Lawrence, R Charles; Kelly, Sandra J

2013-10-01

Fetal alcohol spectrum disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposureresulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol's impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. Copyright © 2013 ISDN. Published by Elsevier Ltd. All rights reserved.

Alcohol exposure during development: Impact on the epigenome

PubMed Central

Perkins, Amy; Lehmann, Claudia; Lawrence, R. Charles; Kelly, Sandra J.

2013-01-01

Fetal Alcohol Spectrum Disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposure resulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol’s impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. PMID:23542005

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TAF-4.

PubMed

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling

2008-10-03

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TFIID component TAF-4

PubMed Central

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M.; Lin, Rueyling

2008-01-01

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1–P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres, but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II following fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wildtype OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators. PMID:18854162

Nrf2 and Nrf2-related proteins in development and developmental toxicity: Insights from studies in zebrafish (Danio rerio).

PubMed

Hahn, Mark E; Timme-Laragy, Alicia R; Karchner, Sibel I; Stegeman, John J

2015-11-01

Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap'n'collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. Copyright © 2015. Published by Elsevier Inc.

Dynamic and Widespread lncRNA Expression in a Sponge and the Origin of Animal Complexity

PubMed Central

Gaiti, Federico; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Calcino, Andrew D.; Yanai, Itai; Tanurdzic, Milos; Degnan, Bernard M.

2015-01-01

Long noncoding RNAs (lncRNAs) are important developmental regulators in bilaterian animals. A correlation has been claimed between the lncRNA repertoire expansion and morphological complexity in vertebrate evolution. However, this claim has not been tested by examining morphologically simple animals. Here, we undertake a systematic investigation of lncRNAs in the demosponge Amphimedon queenslandica, a morphologically simple, early-branching metazoan. We combine RNA-Seq data across multiple developmental stages of Amphimedon with a filtering pipeline to conservatively predict 2,935 lncRNAs. These include intronic overlapping lncRNAs, exonic antisense overlapping lncRNAs, long intergenic nonprotein coding RNAs, and precursors for small RNAs. Sponge lncRNAs are remarkably similar to their bilaterian counterparts in being relatively short with few exons and having low primary sequence conservation relative to protein-coding genes. As in bilaterians, a majority of sponge lncRNAs exhibit typical hallmarks of regulatory molecules, including high temporal specificity and dynamic developmental expression. Specific lncRNA expression profiles correlate tightly with conserved protein-coding genes likely involved in a range of developmental and physiological processes, such as the Wnt signaling pathway. Although the majority of Amphimedon lncRNAs appears to be taxonomically restricted with no identifiable orthologs, we find a few cases of conservation between demosponges in lncRNAs that are antisense to coding sequences. Based on the high similarity in the structure, organization, and dynamic expression of sponge lncRNAs to their bilaterian counterparts, we propose that these noncoding RNAs are an ancient feature of the metazoan genome. These results are consistent with lncRNAs regulating the development of animals, regardless of their level of morphological complexity. PMID:25976353

Identification of Chemicals Inducing Cardiomyocyte Proliferation in Developmental Stage-Specific Manner with Pluripotent Stem Cells

PubMed Central

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A.; Engel, Felix B.; Yamashita, Jun K.

2013-01-01

Background The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provide therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells (PSCs). The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. Methods and Results To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse PSC-derived cardiomyocytes and identified 4 chemical compound groups - inhibitors of glycogen synthase kinase-3 (GSK3), p38 mitogen-activated protein kinase (MAPK) and Ca2+/calmodulin-dependent protein kinase II (CaMKII), and activators of extracellular signal-regulated kinase (ERK). Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human PSCs, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas ERK activators and CaMKII inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, GSK3 and p38 MAPK inhibitors substantially and synergistically induced reentry and progression of cell cycle in not only neonatal but also adult cardiomyocytes. Conclusions Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered PSC-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies. PMID:24141057

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Maturation of the growth axis in marsupials occurs gradually during post-natal life and over an equivalent developmental stage relative to eutherian species.

PubMed

Menzies, Brandon R; Shaw, Geoffrey; Fletcher, Terry P; Pask, Andrew J; Renfree, Marilyn B

2012-02-26

The separation of a nutrition-responsive insulin-like growth factor (IGF) system and a growth hormone (GH) responsive IGF system to control pre- and post-natal growth of developing mammals may originate from the constraints imposed by intra-uterine development. In eutherian species that deliver relatively precocial young, maturation of the GH regulatory system is coincident with the time of birth. We measured the hepatic expression of the four key growth axis genes GH-receptor, IGF-1 and -2, and IGFBBP-3, and plasma protein concentrations of IGF-1 from late fetal life through to adult stages of a marsupial, the tammar wallaby. The data clearly show that maturation of GH-regulated growth in marsupials occurs gradually over the course of post-natal life at an equivalent developmental stage to that of precocial eutherian mammals. This suggests that the timing of GH-regulated growth in marsupials is not related to parturition but instead to the relative developmental stage. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

PCP-B class pollen coat proteins are key regulators of the hydration checkpoint in Arabidopsis thaliana pollen-stigma interactions.

PubMed

Wang, Ludi; Clarke, Lisa A; Eason, Russell J; Parker, Christopher C; Qi, Baoxiu; Scott, Rod J; Doughty, James

2017-01-01

The establishment of pollen-pistil compatibility is strictly regulated by factors derived from both male and female reproductive structures. Highly diverse small cysteine-rich proteins (CRPs) have been found to play multiple roles in plant reproduction, including the earliest stages of the pollen-stigma interaction. Secreted CRPs found in the pollen coat of members of the Brassicaceae, the pollen coat proteins (PCPs), are emerging as important signalling molecules that regulate the pollen-stigma interaction. Using a combination of protein characterization, expression and phylogenetic analyses we identified a novel class of Arabidopsis thaliana pollen-borne CRPs, the PCP-Bs (for pollen coat protein B-class) that are related to embryo surrounding factor (ESF1) developmental regulators. Single and multiple PCP-B mutant lines were utilized in bioassays to assess effects on pollen hydration, adhesion and pollen tube growth. Our results revealed that pollen hydration is severely impaired when multiple PCP-Bs are lost from the pollen coat. The hydration defect also resulted in reduced pollen adhesion and delayed pollen tube growth in all mutants studied. These results demonstrate that AtPCP-Bs are key regulators of the hydration 'checkpoint' in establishment of pollen-stigma compatibility. In addition, we propose that interspecies diversity of PCP-Bs may contribute to reproductive barriers in the Brassicaceae. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Analysis of a developmentally regulated nuclear localization signal in Xenopus

PubMed Central

1992-01-01

The 289 residue nuclear oncoprotein encoded by the adenovirus 5 Ela gene contains two peptide sequences that behave as nuclear localization signals (NLS). One signal, located at the carboxy terminus, is like many other known NLSs in that it consists of a short stretch of basic residues (KRPRP) and is constitutively active in cells. The second signal resides within an internal 45 residue region of E1a that contains few basic residues or sequences that resemble other known NLSs. Moreover, this internal signal functions in injected Xenopus oocytes, but not in transfected Xenopus A6 cells, suggesting that it could be regulated developmentally (Slavicek et al. 1989. J. Virol. 63:4047). In this study, we show that the activity of this signal is sensitive to ATP depletion in vivo, efficiently directs the import of a 50 kD fusion protein and can compete with the E1a carboxy-terminal NLS for nuclear import. In addition, we have delineated the precise amino acid residues that comprise the second E1a NLS, and have assessed its utilization during Xenopus embryogenesis. Using amino acid deletion and substitution analyses, we show that the signal consists of the sequence FV(X)7-20MXSLXYM(X)4MF. By expressing in Xenopus embryos a truncated E1a protein that contains only the second NLS and by monitoring its cytoplasmic/nuclear distribution during development with indirect immunofluorescence, we find that the second NLS is utilized up to the early neurula stage. In addition, there appears to be a hierarchy among the embryonic germ layers as to when the second NLS becomes nonfunctional. For this reason, we refer to this NLS as the developmentally regulated nuclear localization signal (drNLS). The implications of these findings for early development are discussed. PMID:1387407

AoRim15 is involved in conidial stress tolerance, conidiation and sclerotia formation in the filamentous fungus Aspergillus oryzae.

PubMed

Nakamura, Hidetoshi; Kikuma, Takashi; Jin, Feng Jie; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

2016-04-01

The serine-threonine kinase Rim15p is a master regulator of stress signaling and is required for stress tolerance and sexual sporulation in the yeast Saccharomyces cerevisiae. However, in filamentous fungi that reproduce asexually via conidiation, the physiological function of Rim15p homologs has not been extensively analyzed. Here, we functionally characterized the protein homolog of Rim15p in the filamentous fungus Aspergillus oryzae, by deleting and overexpressing the corresponding Aorim15 gene and examining the role of this protein in stress tolerance and development. Deletion of Aorim15 resulted in an increase in the sensitivity of conidia to oxidative and heat stresses, whereas conidia of the Aorim15 overexpressing strain were more resistant to these stresses. These results indicated that AoRim15 functions in stress tolerance, similar to S. cerevisiae Rim15p. Phenotypic analysis revealed that conidiation was markedly reduced by overexpression of Aorim15 in A. oryzae, and was completely abolished in the deletion strain. In addition, the formation of sclerotia, which is another type of developmental structure in filamentous fungi, was decreased by the deletion of Aorim15, whereas Aorim15 overexpression increased the number of sclerotia. These results indicated that AoRim15 is a positive regulator of sclerotia formation and that overexpression of AoRim15 shifts the developmental balance from conidiation towards sclerotia formation. Collectively, we demonstrated that AoRim15 is involved in the stress tolerance of conidia and differentially regulates between the two developmental fates of conidiation and sclerotia formation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

NUP-1 Is a Large Coiled-Coil Nucleoskeletal Protein in Trypanosomes with Lamin-Like Functions

PubMed Central

DuBois, Kelly N.; Alsford, Sam; Holden, Jennifer M.; Buisson, Johanna; Swiderski, Michal; Bart, Jean-Mathieu; Ratushny, Alexander V.; Wan, Yakun; Bastin, Philippe; Barry, J. David; Navarro, Miguel; Horn, David; Aitchison, John D.; Rout, Michael P.; Field, Mark C.

2012-01-01

A unifying feature of eukaryotic nuclear organization is genome segregation into transcriptionally active euchromatin and transcriptionally repressed heterochromatin. In metazoa, lamin proteins preserve nuclear integrity and higher order heterochromatin organization at the nuclear periphery, but no non-metazoan lamin orthologues have been identified, despite the likely presence of nucleoskeletal elements in many lineages. This suggests a metazoan-specific origin for lamins, and therefore that distinct protein elements must compose the nucleoskeleton in other lineages. The trypanosomatids are highly divergent organisms and possess well-documented but remarkably distinct mechanisms for control of gene expression, including polycistronic transcription and trans-splicing. NUP-1 is a large protein localizing to the nuclear periphery of Trypanosoma brucei and a candidate nucleoskeletal component. We sought to determine if NUP-1 mediates heterochromatin organization and gene regulation at the nuclear periphery by examining the influence of NUP-1 knockdown on morphology, chromatin positioning, and transcription. We demonstrate that NUP-1 is essential and part of a stable network at the inner face of the trypanosome nuclear envelope, since knockdown cells have abnormally shaped nuclei with compromised structural integrity. NUP-1 knockdown also disrupts organization of nuclear pore complexes and chromosomes. Most significantly, we find that NUP-1 is required to maintain the silenced state of developmentally regulated genes at the nuclear periphery; NUP-1 knockdown results in highly specific mis-regulation of telomere-proximal silenced variant surface glycoprotein (VSG) expression sites and procyclin loci, indicating a disruption to normal chromatin organization essential to life-cycle progression. Further, NUP-1 depletion leads to increased VSG switching and therefore appears to have a role in control of antigenic variation. Thus, analogous to vertebrate lamins, NUP-1 is a major component of the nucleoskeleton with key roles in organization of the nuclear periphery, heterochromatin, and epigenetic control of developmentally regulated loci. PMID:22479148

Aubergine and piRNAs promote germline stem cell self-renewal by repressing the proto-oncogene Cbl.

PubMed

Rojas-Ríos, Patricia; Chartier, Aymeric; Pierson, Stéphanie; Simonelig, Martine

2017-11-02

PIWI proteins play essential roles in germ cells and stem cell lineages. In Drosophila , Piwi is required in somatic niche cells and germline stem cells (GSCs) to support GSC self-renewal and differentiation. Whether and how other PIWI proteins are involved in GSC biology remains unknown. Here, we show that Aubergine (Aub), another PIWI protein, is intrinsically required in GSCs for their self-renewal and differentiation. Aub needs to be loaded with piRNAs to control GSC self-renewal and acts through direct mRNA regulation. We identify the Cbl proto-oncogene, a regulator of mammalian hematopoietic stem cells, as a novel GSC differentiation factor. Aub stimulates GSC self-renewal by repressing Cbl mRNA translation and does so in part through recruitment of the CCR4-NOT complex. This study reveals the role of piRNAs and PIWI proteins in controlling stem cell homeostasis via translational repression and highlights piRNAs as major post-transcriptional regulators in key developmental decisions. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Prediction of C. elegans Longevity Genes by Human and Worm Longevity Networks

PubMed Central

de Magalhães, João Pedro; Ruvkun, Gary; Fraifeld, Vadim E.; Curran, Sean P.

2012-01-01

Intricate and interconnected pathways modulate longevity, but screens to identify the components of these pathways have not been saturating. Because biological processes are often executed by protein complexes and fine-tuned by regulatory factors, the first-order protein-protein interactors of known longevity genes are likely to participate in the regulation of longevity. Data-rich maps of protein interactions have been established for many cardinal organisms such as yeast, worms, and humans. We propose that these interaction maps could be mined for the identification of new putative regulators of longevity. For this purpose, we have constructed longevity networks in both humans and worms. We reasoned that the essential first-order interactors of known longevity-associated genes in these networks are more likely to have longevity phenotypes than randomly chosen genes. We have used C. elegans to determine whether post-developmental inactivation of these essential genes modulates lifespan. Our results suggest that the worm and human longevity networks are functionally relevant and possess a high predictive power for identifying new longevity regulators. PMID:23144747

Genetic structure and regulation of isoprene synthase in Poplar (Populus spp.).

PubMed

Vickers, Claudia E; Possell, Malcolm; Nicholas Hewitt, C; Mullineaux, Philip M

2010-07-01

Isoprene is a volatile 5-carbon hydrocarbon derived from the chloroplastic methylerythritol 2-C-methyl-D: -erythritol 4-phosphate isoprenoid pathway. In plants, isoprene emission is controlled by the enzyme isoprene synthase; however, there is still relatively little known about the genetics and regulation of this enzyme. Isoprene synthase gene structure was analysed in three poplar species. It was found that genes encoding stromal isoprene synthase exist as a small gene family, the members of which encode virtually identical proteins and are differentially regulated. Accumulation of isoprene synthase protein is developmentally regulated, but does not differ between sun and shade leaves and does not increase when heat stress is applied. Our data suggest that, in mature leaves, isoprene emission rates are primarily determined by substrate (dimethylallyl diphosphate, DMADP) availability. In immature leaves, where isoprene synthase levels are variable, emission levels are also influenced by the amount of isoprene synthase protein. No thylakoid isoforms could be identified in Populus alba or in Salix babylonica. Together, these data show that control of isoprene emission at the genetic level is far more complicated than previously assumed.

Rap Phosphatase of Virulence Plasmid pXO1 Inhibits Bacillus anthracis Sporulation†

PubMed Central

Bongiorni, Cristina; Stoessel, Ricarda; Shoemaker, Dorinda; Perego, Marta

2006-01-01

This study shows that the Bacillus anthracis pXO1 virulence plasmid carries a Rap-Phr system, BXA0205, which regulates sporulation initiation in this organism. The BXA0205Rap protein was shown to dephosphorylate the Spo0F response regulator intermediate of the phosphorelay signal transduction system that regulates the initiation of the developmental pathway in response to environmental, metabolic, and cell cycle signals. The activity of the Rap protein was shown to be inhibited by the carboxy-terminal pentapeptide generated through an export-import processing pathway from the associated BXA0205Phr protein. Deregulation of the Rap activity by either overexpression or lack of the Phr pentapeptide resulted in severe inhibition of sporulation. Five additional Rap-Phr encoding systems were identified on the chromosome of B. anthracis, one of which, BA3790-3791, also affected sporulation initiation. The results suggest that the plasmid-borne Rap-Phr system may provide a selective advantage to the virulence of B. anthracis. PMID:16385039

Rap phosphatase of virulence plasmid pXO1 inhibits Bacillus anthracis sporulation.

PubMed

Bongiorni, Cristina; Stoessel, Ricarda; Shoemaker, Dorinda; Perego, Marta

2006-01-01

This study shows that the Bacillus anthracis pXO1 virulence plasmid carries a Rap-Phr system, BXA0205, which regulates sporulation initiation in this organism. The BXA0205Rap protein was shown to dephosphorylate the Spo0F response regulator intermediate of the phosphorelay signal transduction system that regulates the initiation of the developmental pathway in response to environmental, metabolic, and cell cycle signals. The activity of the Rap protein was shown to be inhibited by the carboxy-terminal pentapeptide generated through an export-import processing pathway from the associated BXA0205Phr protein. Deregulation of the Rap activity by either overexpression or lack of the Phr pentapeptide resulted in severe inhibition of sporulation. Five additional Rap-Phr encoding systems were identified on the chromosome of B. anthracis, one of which, BA3790-3791, also affected sporulation initiation. The results suggest that the plasmid-borne Rap-Phr system may provide a selective advantage to the virulence of B. anthracis.

Thymocyte Maturation Is Regulated by the Activity of the Helix-Loop-Helix Protein, E47

PubMed Central

Bain, Gretchen; Quong, Melanie W.; Soloff, Rachel S.; Hedrick, Stephen M.; Murre, Cornelis

1999-01-01

The E2A proteins, E12 and E47, are required for progression through multiple developmental pathways, including early B and T lymphopoiesis. Here, we provide in vitro and in vivo evidence demonstrating that E47 activity regulates double-positive thymocyte maturation. In the absence of E47 activity, positive selection of both major histocompatibility complex (MHC) class I– and class II–restricted T cell receptors (TCRs) is perturbed. Additionally, development of CD8 lineage T cells in an MHC class I–restricted TCR transgenic background is sensitive to the dosage of E47. Mice deficient for E47 display an increase in production of mature CD4 and CD8 lineage T cells. Furthermore, ectopic expression of an E2A inhibitor helix-loop-helix protein, Id3, promotes the in vitro differentiation of an immature T cell line. These results demonstrate that E2A functions as a regulator of thymocyte positive selection. PMID:10587351

Following Vegetative to Embryonic Cellular Changes in Leaves of Arabidopsis Overexpressing LEAFY COTYLEDON21[W][OPEN

PubMed Central

Feeney, Mistianne; Frigerio, Lorenzo; Cui, Yuhai; Menassa, Rima

2013-01-01

Embryogenesis in flowering plants is controlled by a complex interplay of genetic, biochemical, and physiological regulators. LEAFY COTYLEDON2 (LEC2) is among a small number of key transcriptional regulators that are known to play important roles in controlling major events during the maturation stage of embryogenesis, notably, the synthesis and accumulation of storage reserves. LEC2 overexpression causes vegetative tissues to change their developmental fate to an embryonic state; however, little information exists about the cellular changes that take place. We show that LEC2 alters leaf morphology and anatomy and causes embryogenic structures to form subcellularly in leaves of Arabidopsis (Arabidopsis thaliana). Chloroplasts accumulate more starch, the cytoplasm fills with oil bodies, and lytic vacuoles (LVs) appear smaller in size and accumulate protein deposits. Because LEC2 is responsible for activating the synthesis of seed storage proteins (SSPs) during seed development, SSP accumulation was investigated in leaves. The major Arabidopsis SSP families were shown to accumulate within small leaf vacuoles. By exploiting the developmental and tissue-specific localization of two tonoplast intrinsic protein isoforms, the small leaf vacuoles were identified as protein storage vacuoles (PSVs). Confocal analyses of leaf vacuoles expressing fluorescently labeled tonoplast intrinsic protein isoforms reveal an altered tonoplast morphology resembling an amalgamation of a LV and PSV. Results suggest that as the LV transitions to a PSV, the tonoplast remodels before the large vacuole lumen is replaced by smaller PSVs. Finally, using vegetative and seed markers to monitor the transition, we show that LEC2 induces a reprogramming of leaf development. PMID:23780897

DISPARATE DEVELOPMENTAL NEUROTOXICANTS CONVERGE ON THE CYCLIC AMP SIGNALING CASCADE, REVEALED BY TRANSCRIPTIONAL PROFILES IN VITRO AND IN VIVO

PubMed Central

Adigun, Abayomi A.; Seidler, Frederic J.; Slotkin, Theodore A.

2009-01-01

Cell-signaling cascades are convergent targets for developmental neurotoxicity of otherwise unrelated agents. We compared organophosphates (chlorpyrifos, diazinon), an organochlorine (dieldrin) and a metal (Ni2+) for their effects on neuronotypic PC12 cells, assessing gene transcription involved in the cyclic AMP pathway. Each agent was introduced during neurodifferentiation at a concentration of 30 μM for 24 or 72 hr and we assessed 69 genes encoding adenylyl cyclase isoforms and regulators, G-protein α- and β,γ-subunits, protein kinase A subtypes and the phosphodiesterase family. We found strong concordance among the four agents across all the gene families, with the strongest relationships for the G-proteins, followed by adenylyl cyclase, and lesser concordance for protein kinase A and phosphodiesterase. Superimposed on this pattern, chlorpyrifos and diazinon were surprisingly the least alike, whereas there was strong concordance of dieldrin and Ni2+ with each other and with each individual organophosphate. Further, the effects of chlorpyrifos differed substantially depending on whether cells were undifferentiated or differentiating. To resolve the disparities between chlorpyrifos and diazinon, we performed analyses in rat brain regions after in vivo neonatal exposures; unlike the in vitro results, there was strong concordance. Our results show that unrelated developmental neurotoxicants can nevertheless produce similar outcomes by targeting cell signaling pathways involved in neurodifferentiation during a critical developmental period of vulnerability. Nevertheless, a full evaluation of concordance between different toxicants requires evaluations of in vitro systems that detect direct effects, as well as in vivo systems that allow for more complex interactions that converge on the same pathway. PMID:20026089

Complex regulation of Arabidopsis AGR1/PIN2-mediated root gravitropic response and basipetal auxin transport by cantharidin-sensitive protein phosphatases

NASA Technical Reports Server (NTRS)

Shin, Heungsop; Shin, Hwa-Soo; Guo, Zibiao; Blancaflor, Elison B.; Masson, Patrick H.; Chen, Rujin

2005-01-01

Polar auxin transport, mediated by two distinct plasma membrane-localized auxin influx and efflux carrier proteins/complexes, plays an important role in many plant growth and developmental processes including tropic responses to gravity and light, development of lateral roots and patterning in embryogenesis. We have previously shown that the Arabidopsis AGRAVITROPIC 1/PIN2 gene encodes an auxin efflux component regulating root gravitropism and basipetal auxin transport. However, the regulatory mechanism underlying the function of AGR1/PIN2 is largely unknown. Recently, protein phosphorylation and dephosphorylation mediated by protein kinases and phosphatases, respectively, have been implicated in regulating polar auxin transport and root gravitropism. Here, we examined the effects of chemical inhibitors of protein phosphatases on root gravitropism and basipetal auxin transport, as well as the expression pattern of AGR1/PIN2 gene and the localization of AGR1/PIN2 protein. We also examined the effects of inhibitors of vesicle trafficking and protein kinases. Our data suggest that protein phosphatases, sensitive to cantharidin and okadaic acid, are likely involved in regulating AGR1/PIN2-mediated root basipetal auxin transport and gravitropism, as well as auxin response in the root central elongation zone (CEZ). BFA-sensitive vesicle trafficking may be required for the cycling of AGR1/PIN2 between plasma membrane and the BFA compartment, but not for the AGR1/PIN2-mediated root basipetal auxin transport and auxin response in CEZ cells.

Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower.

PubMed

Silva, Catarina S; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

2015-01-01

Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These "developmental control genes" and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction - LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower.

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development1[OPEN

PubMed Central

2017-01-01

Rice (Oryza sativa) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1, a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. PMID:28500269

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development.

PubMed

Zhou, Li-Juan; Xiao, Lang-Tao; Xue, Hong-Wei

2017-07-01

Rice ( Oryza sativa ) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1 , a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. © 2017 American Society of Plant Biologists. All Rights Reserved.

45 CFR 1385.2 - Purpose of the regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

Developmental Activation of the Proteolipid Protein Promoter Transgene in Neuronal and Oligodendroglial Cells of Neostriatum in Mice

PubMed Central

Fulton, Daniel; Paez, Pablo; Spreur, Vilma; Handley, Vance; Colwell, Christopher S.; Campagnoni, Anthony; Fisher, Robin

2011-01-01

Prior studies suggest that non-canonical proteolipid protein (PLP) gene expression occurs during development in non-myelinating neurons as well as myelinating oligodendroglia in mammalian brain. To assess this possibility in neostriatum, a region of uncertain PLP gene expression in neurons, morphological and electrophysiological tools were used to determine phenotypes of cells with activation of a PLP promoter transgene during the early postnatal period in mice. PLP gene expression is evident in both neuronal and oligodendroglial phenotypes in developing neostriatum, a conclusion based on three novel observations: (1) An enhanced green fluorescent protein (EGFP) reporter of PLP promoter activation was localized in two distinct populations of cells, which exhibit collective, developmental differences of morphological and electrophysiological characteristics in accord with neuronal and oligodendroglial phenotypes of neostriatal cells found during the early postnatal period in both transgenic and wild-type mice. (2) The EGFP reporter of PLP promoter activation was appropriately positioned to serve as a regulator of PLP gene expression. It colocalized with native PLP proteins in both neuronal and oligodendroglial phenotypes; however, only soma-restricted PLP protein isoforms were found in the neuronal phenotype, while classic and soma-restricted PLP protein isoforms were found in the oligodendroglial phenotype. (3) As shown by EGFP reporter, PLP promoter activation was placed to regulate PLP gene expression in only one neuronal phenotype among the several that constitute neostriatum. It was localized in medium spiny neurons, but not large aspiny neurons. These outcomes have significant implications for the non-canonical functional roles of PLP gene expression in addition to myelinogenesis in mammalian brain, and are consistent with potentially independent pathologic loci in neurons during the course of human mutational disorders of PLP gene expression. PMID:21912090

l-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome

PubMed Central

Xu, Baoshan; Sowa, Nenja; Cardenas, Maria E.; Gerton, Jennifer L.

2015-01-01

Cohesinopathies are human genetic disorders that include Cornelia de Lange syndrome (CdLS) and Roberts syndrome (RBS) and are characterized by defects in limb and craniofacial development as well as mental retardation. The developmental phenotypes of CdLS and other cohesinopathies suggest that mutations in the structure and regulation of the cohesin complex during embryogenesis interfere with gene regulation. In a previous project, we showed that RBS was associated with highly fragmented nucleoli and defects in both ribosome biogenesis and protein translation. l-leucine stimulation of the mTOR pathway partially rescued translation in human RBS cells and development in zebrafish models of RBS. In this study, we investigate protein translation in zebrafish models of CdLS. Our results show that phosphorylation of RPS6 as well as 4E-binding protein 1 (4EBP1) was reduced in nipbla/b, rad21 and smc3-morphant embryos, a pattern indicating reduced translation. Moreover, protein biosynthesis and rRNA production were decreased in the cohesin morphant embryo cells. l-leucine partly rescued protein synthesis and rRNA production in the cohesin morphants and partially restored phosphorylation of RPS6 and 4EBP1. Concomitantly, l-leucine treatment partially improved cohesinopathy embryo development including the formation of craniofacial cartilage. Interestingly, we observed that alpha-ketoisocaproate (α-KIC), which is a keto derivative of leucine, also partially rescued the development of rad21 and nipbla/b morphants by boosting mTOR-dependent translation. In summary, our results suggest that cohesinopathies are caused in part by defective protein synthesis, and stimulation of the mTOR pathway through l-leucine or its metabolite α-KIC can partially rescue development in zebrafish models for CdLS. PMID:25378554

L-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome.

PubMed

Xu, Baoshan; Sowa, Nenja; Cardenas, Maria E; Gerton, Jennifer L

2015-03-15

Cohesinopathies are human genetic disorders that include Cornelia de Lange syndrome (CdLS) and Roberts syndrome (RBS) and are characterized by defects in limb and craniofacial development as well as mental retardation. The developmental phenotypes of CdLS and other cohesinopathies suggest that mutations in the structure and regulation of the cohesin complex during embryogenesis interfere with gene regulation. In a previous project, we showed that RBS was associated with highly fragmented nucleoli and defects in both ribosome biogenesis and protein translation. l-leucine stimulation of the mTOR pathway partially rescued translation in human RBS cells and development in zebrafish models of RBS. In this study, we investigate protein translation in zebrafish models of CdLS. Our results show that phosphorylation of RPS6 as well as 4E-binding protein 1 (4EBP1) was reduced in nipbla/b, rad21 and smc3-morphant embryos, a pattern indicating reduced translation. Moreover, protein biosynthesis and rRNA production were decreased in the cohesin morphant embryo cells. l-leucine partly rescued protein synthesis and rRNA production in the cohesin morphants and partially restored phosphorylation of RPS6 and 4EBP1. Concomitantly, l-leucine treatment partially improved cohesinopathy embryo development including the formation of craniofacial cartilage. Interestingly, we observed that alpha-ketoisocaproate (α-KIC), which is a keto derivative of leucine, also partially rescued the development of rad21 and nipbla/b morphants by boosting mTOR-dependent translation. In summary, our results suggest that cohesinopathies are caused in part by defective protein synthesis, and stimulation of the mTOR pathway through l-leucine or its metabolite α-KIC can partially rescue development in zebrafish models for CdLS. © The Author 2014. Published by Oxford University Press.

Strigolactone regulates shoot development through a core signalling pathway

PubMed Central

Müller, Dörte

2016-01-01

ABSTRACT Strigolactones are a recently identified class of hormone that regulate multiple aspects of plant development. The DWARF14 (D14) α/β fold protein has been identified as a strigolactone receptor, which can act through the SCFMAX2 ubiquitin ligase, but the universality of this mechanism is not clear. Multiple proteins have been suggested as targets for strigolactone signalling, including both direct proteolytic targets of SCFMAX2, and downstream targets. However, the relevance and importance of these proteins to strigolactone signalling in many cases has not been fully established. Here we assess the contribution of these targets to strigolactone signalling in adult shoot developmental responses. We find that all examined strigolactone responses are regulated by SCFMAX2 and D14, and not by other D14-like proteins. We further show that all examined strigolactone responses likely depend on degradation of SMXL proteins in the SMXL6 clade, and not on the other proposed proteolytic targets BES1 or DELLAs. Taken together, our results suggest that in the adult shoot, the dominant mode of strigolactone signalling is D14-initiated, MAX2-mediated degradation of SMXL6-related proteins. We confirm that the BRANCHED1 transcription factor and the PIN-FORMED1 auxin efflux carrier are plausible downstream targets of this pathway in the regulation of shoot branching, and show that BRC1 likely acts in parallel to PIN1. PMID:27793831

The role of the megagametophyte in maintaining loblolly pine (Pinus taeda L.) seedling arginase gene expression in vitro.

PubMed

Todd, Christopher D; Gifford, David J

2002-05-01

Following loblolly pine (Pinus taeda L.) seed germination, storage-protein breakdown in the megagametophyte and in the seedling results in a large increase in the seedling's free amino acid pool. A substantial portion of both the storage proteins and the amino acid pool is arginine, a very efficient nitrogen-storage compound. Free arginine is hydrolyzed in the seedling by the enzyme arginase (EC 3.5.3.1), which is under strong developmental control. At present, regulation of arginase in conifers is not well understood. Here we report the utilization of an in vitro culture system to address the separate impacts of the seedling and megagametophyte tissues on arginase enzyme activity, protein levels and patterns of gene expression. We also describe the generation of an anti-arginase antibody prepared from a histidine-tagged loblolly pine arginase fusion protein expressed in Escherichia coli. Our results indicate that arginase gene expression in the seedling is initiated by the seedling itself and then maintained or up-regulated by the megagametophyte. The contribution of storage-protein breakdown and the free amino acid pool, particularly arginine, in this regulation is also addressed.

Pollen tube access to the ovule is mediated by glycoprotein secretion on the obturator of apple (Malus × domestica, Borkh)

PubMed Central

Herrero, Maria

2017-01-01

Background and Aims Within the ovary, the obturator bridges the pathway of the pollen tube from the style to the ovule. Despite its widespread presence among flowering plants, its function has only been studied in a handful of species, and the molecules involved in pollen tube–obturator cross-talk have not been explored hitherto. This work evaluates the involvement of glucans and glycoproteins on pollen tube growth in the obturator of apple flowers (Malus × domestica). Methods Pollen tube kinetics were sequentially examined in the pistil and related to changes occurring on the obturator using histochemistry and inmunocytochemistry. To discriminate between changes in the obturator induced by pollen tubes from those developmentally regulated, both pollinated and unpollinated pistils were examined. Key Results Pollen tube growth rates were slow in the stigma, faster in the style and slow again in the ovary. The arrival of pollen tubes at the obturator was concomitant with the secretion of proteins, saccharides and glycoprotein epitopes belonging to extensins and arabinogalactan proteins (AGPs). While some of these secretions – extensins and AGPs labelled by JIM13 – were developmentally regulated, others – AGPs labelled by JIM8 – were elicited by the presence of pollen tubes. Following pollen tube passage, all these glycoproteins were depleted. Conclusions The results show a timely secretion of glycoproteins on the obturator surface concomitant with pollen tube arrival at this structure. The fact that their secretion is depleted following pollen tube passage strongly suggests their role in regulating pollen tube access to the ovule. Remarkably, both the regulation of the secretion of the different glycoproteins, as well as their association with the performance of pollen tubes exhibit similarities with those observed in the stigma, in line with their common developmental origin. PMID:28137704

Pollen tube access to the ovule is mediated by glycoprotein secretion on the obturator of apple (Malus × domestica, Borkh).

PubMed

Losada, Juan M; Herrero, Maria

2017-04-01

Within the ovary, the obturator bridges the pathway of the pollen tube from the style to the ovule. Despite its widespread presence among flowering plants, its function has only been studied in a handful of species, and the molecules involved in pollen tube-obturator cross-talk have not been explored hitherto. This work evaluates the involvement of glucans and glycoproteins on pollen tube growth in the obturator of apple flowers ( Malus × domestica) . Pollen tube kinetics were sequentially examined in the pistil and related to changes occurring on the obturator using histochemistry and inmunocytochemistry. To discriminate between changes in the obturator induced by pollen tubes from those developmentally regulated, both pollinated and unpollinated pistils were examined. Pollen tube growth rates were slow in the stigma, faster in the style and slow again in the ovary. The arrival of pollen tubes at the obturator was concomitant with the secretion of proteins, saccharides and glycoprotein epitopes belonging to extensins and arabinogalactan proteins (AGPs). While some of these secretions - extensins and AGPs labelled by JIM13 - were developmentally regulated, others - AGPs labelled by JIM8 - were elicited by the presence of pollen tubes. Following pollen tube passage, all these glycoproteins were depleted. The results show a timely secretion of glycoproteins on the obturator surface concomitant with pollen tube arrival at this structure. The fact that their secretion is depleted following pollen tube passage strongly suggests their role in regulating pollen tube access to the ovule. Remarkably, both the regulation of the secretion of the different glycoproteins, as well as their association with the performance of pollen tubes exhibit similarities with those observed in the stigma, in line with their common developmental origin. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com

The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem.

PubMed

Samach, A; Klenz, J E; Kohalmi, S E; Risseeuw, E; Haughn, G W; Crosby, W L

1999-11-01

Genetic and molecular studies have suggested that the UNUSUAL FLORAL ORGANS (UFO) gene, from Arabidopsis thaliana, is expressed in all shoot apical meristems, and is involved in the regulation of a complex set of developmental events during floral development, including floral meristem and floral organ identity. Results from in situ hybridization using genes expressed early in floral development as probes indicate that UFO controls growth of young floral primordia. Transgenic constructs were used to provide evidence that UFO regulates floral organ identity by activating or maintaining transcription of the class B organ-identity gene APETALA 3, but not PISTILLATA. In an attempt to understand the biochemical mode of action of the UFO gene product, we show here that UFO is an F-box protein that interacts with Arabidopsis SKP1-like proteins, both in the yeast two-hybrid system and in vitro. In yeast and other organisms both F-box proteins and SKP1 homologues are subunits of specific ubiquitin E3 enzyme complexes that target specific proteins for degradation. The protein selected for degradation by the complex is specified by the F-box proteins. It is therefore possible that the role of UFO is to target for degradation specific proteins controlling normal growth patterns in the floral primordia, as well as proteins that negatively regulate APETALA 3 transcription.

Imaging C. elegans embryos using an epifluorescent microscope and open source software.

PubMed

Verbrugghe, Koen J C; Chan, Raymond C

2011-03-24

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples(1,2). Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage(3), thus providing an ideal experiment model for studying questions in cell biology(4,5)and development(6-9). C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis(10,11)) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis(12-15)). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters(16,17). These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo(18-21). In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Phospholipase D function in Saccharomyces cerevisiae.

PubMed

Mendonsa, Rima; Engebrecht, JoAnne

2009-09-01

Phosphatidylinositol 4,5-bisphosphate-regulated phosphatidylcholine-specific phospholipase D is conserved from yeast to man. The essential role of this enzyme in yeast is to mediate the fusion of Golgi and endosome-derived vesicles to generate the prospore membrane during the developmental program of sporulation, through the production of the fusogenic lipid phosphatidic acid. In addition to recruiting proteins required for fusion, phosphatidic acid is believed to lower the energy barrier to stimulate membrane curvature. During mitotic growth, phospholipase D activity is dispensable unless the major phosphatidylinositol/phosphatidylcholine transfer protein is absent; it also appears to play a nonessential role in the mating signal transduction pathway. The regulation of phospholipase D activity during both sporulation and mitotic growth is still not fully understood and awaits further characterization.

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

USDA-ARS?s Scientific Manuscript database

The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

Activation by insulin and amino acids of signaling components leading to translation initiation in skeletal muscle of neonatal pigs is developmentally regulated

USDA-ARS?s Scientific Manuscript database

Insulin and amino acids act independently to stimulate protein synthesis in skeletal muscle of neonatal pigs, and the responses decrease with development. The purpose of this study was to compare the separate effects of fed levels of INS and AA on the activation of signaling components leading to tr...

TCP3 interacts with R2R3-MYB proteins, promotes flavonoid biosynthesis and negatively regulates the auxin response in Arabidopsis thaliana.

PubMed

Li, Shutian; Zachgo, Sabine

2013-12-01

TCP proteins belong to the plant-specific bHLH transcription factor family, and function as key regulators of diverse developmental processes. Functional redundancy amongst family members and post-transcriptional down-regulation by miRJAW of several TCP genes complicate their functional characterization. Here, we explore the role of TCP3 by analyzing transgenic plants expressing miRJAW-resistant mTCP3 and dominant-negative TCP3SRDX. Seedlings and seeds of mTCP3 plants were found to hyper-accumulate flavonols, anthocyanins and proanthocyanidins, whereas levels of proanthocyanidins were slightly reduced in TCP3SRDX plants. R2R3-MYB proteins control not only early flavonoid biosynthetic steps but also activate late flavonoid biosynthetic genes by forming ternary R2R3-MYB/bHLH/WD40 (MBW) complexes. TCP3 interacted in yeast with R2R3-MYB proteins, which was further confirmed in planta using BiFC experiments. Yeast three-hybrid assays revealed that TCP3 significantly strengthened the transcriptional activation capacity of R2R3-MYBs bound by the bHLH protein TT8. Transcriptome analysis of mTCP3 and TCP3SRDX plants supported a role for TCP3 in enhancing flavonoid biosynthesis. Moreover, several auxin-related developmental abnormalities were observed in mTCP3 plants. Transcriptome data coupled with studies of an auxin response reporter and auxin efflux carriers showed that TCP3 negatively modulates the auxin response, probably by compromising auxin transport capacity. Genetic experiments revealed that the chalcone synthase mutant tt4-11 lacking flavonoid biosynthesis abrogated the auxin-related defects caused by mTCP3. Together, these data suggest that TCP3 interactions with R2R3-MYBs lead to enhanced flavonoid production, which further negatively modulates the auxin response. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Sequential evolution of bacterial morphology by co-option of a developmental regulator.

PubMed

Jiang, Chao; Brown, Pamela J B; Ducret, Adrien; Brun, Yves V

2014-02-27

What mechanisms underlie the transitions responsible for the diverse shapes observed in the living world? Although bacteria exhibit a myriad of morphologies, the mechanisms responsible for the evolution of bacterial cell shape are not understood. We investigated morphological diversity in a group of bacteria that synthesize an appendage-like extension of the cell envelope called the stalk. The location and number of stalks varies among species, as exemplified by three distinct subcellular positions of stalks within a rod-shaped cell body: polar in the genus Caulobacter and subpolar or bilateral in the genus Asticcacaulis. Here we show that a developmental regulator of Caulobacter crescentus, SpmX, is co-opted in the genus Asticcacaulis to specify stalk synthesis either at the subpolar or bilateral positions. We also show that stepwise evolution of a specific region of SpmX led to the gain of a new function and localization of this protein, which drove the sequential transition in stalk positioning. Our results indicate that changes in protein function, co-option and modularity are key elements in the evolution of bacterial morphology. Therefore, similar evolutionary principles of morphological transitions apply to both single-celled prokaryotes and multicellular eukaryotes.

mus304 encodes a novel DNA damage checkpoint protein required during Drosophila development

PubMed Central

Brodsky, Michael H.; Sekelsky, Jeff J.; Tsang, Garson; Hawley, R. Scott; Rubin, Gerald M.

2000-01-01

Checkpoints block cell cycle progression in eukaryotic cells exposed to DNA damaging agents. We show that several Drosophila homologs of checkpoint genes, mei-41, grapes, and 14-3-3ε, regulate a DNA damage checkpoint in the developing eye. We have used this assay to show that the mutagen-sensitive gene mus304 is also required for this checkpoint. mus304 encodes a novel coiled-coil domain protein, which is targeted to the cytoplasm. Similar to mei-41, mus304 is required for chromosome break repair and for genomic stability. mus304 animals also exhibit three developmental defects, abnormal bristle morphology, decreased meiotic recombination, and arrested embryonic development. We suggest that these phenotypes reflect distinct developmental consequences of a single underlying checkpoint defect. Similar mechanisms may account for the puzzling array of symptoms observed in humans with mutations in the ATM tumor suppressor gene. PMID:10733527

TAM receptor signaling in development.

PubMed

Burstyn-Cohen, Tal

2017-01-01

TYRO3, AXL and MERTK comprise the TAM family of receptor protein tyrosine kinases. Activated by their ligands, protein S (PROS1) and growth-arrest-specific 6 (GAS6), they mediate numerous cellular functions throughout development and adulthood. Expressed by a myriad of cell types and tissues, they have been implicated in homeostatic regulation of the immune, nervous, vascular, bone and reproductive systems. The loss-of-function of TAM signaling in adult tissues culminates in the destruction of tissue homeostasis and diseased states, while TAM gain-of-function in various tumors promotes cancer phenotypes. Combinatorial ligand-receptor interactions may elicit different molecular and cellular responses. Many of the TAM regulatory functions are essentially developmental, taking place both during embryogenesis and postnatally. This review highlights current knowledge on the role of TAM receptors and their ligands during these developmental processes in the immune, nervous, vascular and reproductive systems.

Frodo proteins: modulators of Wnt signaling in vertebrate development.

PubMed

Brott, Barbara K; Sokol, Sergei Y

2005-09-01

The Frodo/dapper (Frd) proteins are recently discovered signaling adaptors, which functionally and physically interact with Wnt and Nodal signaling pathways during vertebrate development. The Frd1 and Frd2 genes are expressed in dynamic patterns in early embryos, frequently in cells undergoing epithelial-mesenchymal transition. The Frd proteins function in multiple developmental processes, including mesoderm and neural tissue specification, early morphogenetic cell movements, and organogenesis. Loss-of-function studies using morpholino antisense oligonucleotides demonstrate that the Frd proteins regulate Wnt signal transduction in a context-dependent manner and may be involved in Nodal signaling. The identification of Frd-associated factors and cellular targets of the Frd proteins should shed light on the molecular mechanisms underlying Frd functions in embryonic development and in cancer.

Kid-1, a putative renal transcription factor: regulation during ontogeny and in response to ischemia and toxic injury.

PubMed Central

Witzgall, R; O'Leary, E; Gessner, R; Ouellette, A J; Bonventre, J V

1993-01-01

We have identified a new putative transcription factor from the rat kidney, termed Kid-1 (for kidney, ischemia and developmentally regulated gene 1). Kid-1 belongs to the C2H2 class of zinc finger genes. Its mRNA accumulates with age in postnatal renal development and is detected predominantly in the kidney. Kid-1 mRNA levels decline after renal injury secondary to ischemia or folic acid administration, two insults which result in epithelial cell dedifferentiation, followed by regenerative hyperplasia and differentiation. The low expression of Kid-1 early in postnatal development, and when renal tissue is recovering after injury, suggests that the gene product is involved in establishment of a differentiated phenotype and/or regulation of the proliferative response. The deduced protein contains 13 C2H2 zinc fingers at the COOH end in groups of 4 and 9 separated by a 32-amino-acid spacer. There are consensus sites for phosphorylation in the NH2 terminus non-zinc finger region as well as in the spacer region between zinc fingers 4 and 5. A region of the deduced protein shares extensive homology with a catalytic region of Raf kinases, a feature shared only with TFIIE among transcription factors. To determine whether Kid-1 can modulate transcription, a chimeric construct encoding the Kid-1 non-zinc finger region (sense or antisense) and the DNA-binding region of GAL4 was transfected into COS and LLC-PK1 cells together with a chloramphenicol acetyltransferase (CAT) reporter plasmid containing GAL4 binding sites, driven by either a minimal promoter or a simian virus 40 enhancer. CAT activity was markedly inhibited in cells transfected with the sense construct compared with the activity in cells transfected with the antisense construct. To our knowledge, this pattern of developmental regulation, kidney expression, and regulation of transcription is unique among the C2H2 class of zinc finger-containing DNA-binding proteins. Images PMID:8382778

Cell type-specific translational repression of Cyclin B during meiosis in males.

PubMed

Baker, Catherine Craig; Gim, Byung Soo; Fuller, Margaret T

2015-10-01

The unique cell cycle dynamics of meiosis are controlled by layers of regulation imposed on core mitotic cell cycle machinery components by the program of germ cell development. Although the mechanisms that regulate Cdk1/Cyclin B activity in meiosis in oocytes have been well studied, little is known about the trans-acting factors responsible for developmental control of these factors in male gametogenesis. During meiotic prophase in Drosophila males, transcript for the core cell cycle protein Cyclin B1 (CycB) is expressed in spermatocytes, but the protein does not accumulate in spermatocytes until just before the meiotic divisions. Here, we show that two interacting proteins, Rbp4 and Fest, expressed at the onset of spermatocyte differentiation under control of the developmental program of male gametogenesis, function to direct cell type- and stage-specific repression of translation of the core G2/M cell cycle component cycB during the specialized cell cycle of male meiosis. Binding of Fest to Rbp4 requires a 31-amino acid region within Rbp4. Rbp4 and Fest are required for translational repression of cycB in immature spermatocytes, with Rbp4 binding sequences in a cell type-specific shortened form of the cycB 3' UTR. Finally, we show that Fest is required for proper execution of meiosis I. © 2015. Published by The Company of Biologists Ltd.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

F-BAR family proteins, emerging regulators for cell membrane dynamic changes-from structure to human diseases.

PubMed

Liu, Suxuan; Xiong, Xinyu; Zhao, Xianxian; Yang, Xiaofeng; Wang, Hong

2015-05-09

Eukaryotic cell membrane dynamics change in curvature during physiological and pathological processes. In the past ten years, a novel protein family, Fes/CIP4 homology-Bin/Amphiphysin/Rvs (F-BAR) domain proteins, has been identified to be the most important coordinators in membrane curvature regulation. The F-BAR domain family is a member of the Bin/Amphiphysin/Rvs (BAR) domain superfamily that is associated with dynamic changes in cell membrane. However, the molecular basis in membrane structure regulation and the biological functions of F-BAR protein are unclear. The pathophysiological role of F-BAR protein is unknown. This review summarizes the current understanding of structure and function in the BAR domain superfamily, classifies F-BAR family proteins into nine subfamilies based on domain structure, and characterizes F-BAR protein structure, domain interaction, and functional relevance. In general, F-BAR protein binds to cell membrane via F-BAR domain association with membrane phospholipids and initiates membrane curvature and scission via Src homology-3 (SH3) domain interaction with its partner proteins. This process causes membrane dynamic changes and leads to seven important cellular biological functions, which include endocytosis, phagocytosis, filopodium, lamellipodium, cytokinesis, adhesion, and podosome formation, via distinct signaling pathways determined by specific domain-binding partners. These cellular functions play important roles in many physiological and pathophysiological processes. We further summarize F-BAR protein expression and mutation changes observed in various diseases and developmental disorders. Considering the structure feature and functional implication of F-BAR proteins, we anticipate that F-BAR proteins modulate physiological and pathophysiological processes via transferring extracellular materials, regulating cell trafficking and mobility, presenting antigens, mediating extracellular matrix degradation, and transmitting signaling for cell proliferation.

Homeodomain protein Otp affects developmental neuropeptide switching in oxytocin neurons associated with a long-term effect on social behavior

PubMed Central

Wircer, Einav; Blechman, Janna; Borodovsky, Nataliya; Tsoory, Michael; Nunes, Ana Rita; Oliveira, Rui F; Levkowitz, Gil

2017-01-01

Proper response to stress and social stimuli depends on orchestrated development of hypothalamic neuronal circuits. Here we address the effects of the developmental transcription factor orthopedia (Otp) on hypothalamic development and function. We show that developmental mutations in the zebrafish paralogous gene otpa but not otpb affect both stress response and social preference. These behavioral phenotypes were associated with developmental alterations in oxytocinergic (OXT) neurons. Thus, otpa and otpb differentially regulate neuropeptide switching in a newly identified subset of OXT neurons that co-express the corticotropin-releasing hormone (CRH). Single-cell analysis revealed that these neurons project mostly to the hindbrain and spinal cord. Ablation of this neuronal subset specifically reduced adult social preference without affecting stress behavior, thereby uncoupling the contribution of a specific OXT cluster to social behavior from the general otpa−/− deficits. Our findings reveal a new role for Otp in controlling developmental neuropeptide balance in a discrete OXT circuit whose disrupted development affects social behavior. DOI: http://dx.doi.org/10.7554/eLife.22170.001 PMID:28094761

Reexpression of a developmentally regulated antigen in Down syndrome and Alzheimer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolozin, B.; Scicutella, A.; Davies, P.

1988-08-01

ALZ-50 is a monoclonal antibody that recognizes a protein of apparent molecular mass 68 kilodaltons (A68). The protein is present in the brains of patients with Alzheimer disease but is not detectable in normal adult brain tissue. The authors report that ALZ-50-reactive neurons are found in normal fetal and neonatal human brain and in brain tissue from neonatal individuals with Down syndrome. Reactive neurons decrease sharply in number after age 2 and reappear in older individuals with Down syndrome and in patients with Alzheimer disease.

Site-Specific Nitrosoproteomic Identification of Endogenously S-Nitrosylated Proteins in Arabidopsis1

PubMed Central

Hu, Jiliang; Huang, Xiahe; Chen, Lichao; Sun, Xuwu; Lu, Congming; Zhang, Lixin; Wang, Yingchun; Zuo, Jianru

2015-01-01

Nitric oxide (NO) regulates multiple developmental events and stress responses in plants. A major biologically active species of NO is S-nitrosoglutathione (GSNO), which is irreversibly degraded by GSNO reductase (GSNOR). The major physiological effect of NO is protein S-nitrosylation, a redox-based posttranslational modification mechanism by covalently linking an NO molecule to a cysteine thiol. However, little is known about the mechanisms of S-nitrosylation-regulated signaling, partly due to limited S-nitrosylated proteins being identified. In this study, we identified 1,195 endogenously S-nitrosylated peptides in 926 proteins from the Arabidopsis (Arabidopsis thaliana) by a site-specific nitrosoproteomic approach, which, to date, is the largest data set of S-nitrosylated proteins among all organisms. Consensus sequence analysis of these peptides identified several motifs that contain acidic, but not basic, amino acid residues flanking the S-nitrosylated cysteine residues. These S-nitrosylated proteins are involved in a wide range of biological processes and are significantly enriched in chlorophyll metabolism, photosynthesis, carbohydrate metabolism, and stress responses. Consistently, the gsnor1-3 mutant shows the decreased chlorophyll content and altered photosynthetic properties, suggesting that S-nitrosylation is an important regulatory mechanism in these processes. These results have provided valuable resources and new clues to the studies on S-nitrosylation-regulated signaling in plants. PMID:25699590

Receptor Complex Mediated Regulation of Symplastic Traffic.

PubMed

Stahl, Yvonne; Faulkner, Christine

2016-05-01

Plant receptor kinases (RKs) and receptor proteins (RPs) are involved in a plethora of cellular processes, including developmental decisions and immune responses. There is increasing evidence that plasmodesmata (PD)-localized RKs and RPs act as nexuses that perceive extracellular signals and convey them into intra- and intercellular responses by regulating the exchange of molecules through PD. How RK/RP complexes regulate the specific and nonspecific traffic of molecules through PD, and how these receptors are specifically targeted to PD, have been elusive but underpin comprehensive understanding of the function and regulation of the symplast. In this review we gather the current knowledge of RK/RP complex function at PD and how they might regulate intercellular traffic. Copyright © 2015 Elsevier Ltd. All rights reserved.

Tropomodulins: pointed-end capping proteins that regulate actin filament architecture in diverse cell types

PubMed Central

Yamashiro, Sawako; Gokhin, David S.; Kimura, Sumiko; Nowak, Roberta B.; Fowler, Velia M.

2012-01-01

Tropomodulins are a family of four proteins (Tmods 1–4) that cap the pointed ends of actin filaments in actin cytoskeletal structures in a developmentally regulated and tissue-specific manner. Unique among capping proteins, Tmods also bind tropomyosins (TMs), which greatly enhance the actin filament pointed-end capping activity of Tmods. Tmods are defined by a tropomyosin (TM)-regulated/Pointed-End Actin Capping (TM-Cap) domain in their unstructured N-terminal portion, followed by a compact, folded Leucine-Rich Repeat/Pointed-End Actin Capping (LRR-Cap) domain. By inhibiting actin monomer association and dissociation from pointed ends, Tmods regulate regulate actin dynamics and turnover, stabilizing actin filament lengths and cytoskeletal architecture. In this review, we summarize the genes, structural features, molecular and biochemical properties, actin regulatory mechanisms, expression patterns, and cell and tissue functions of Tmods. By understanding Tmods’ functions in the context of their molecular structure, actin regulation, binding partners, and related variants (leiomodins 1–3), we can draw broad conclusions that can explain the diverse morphological and functional phenotypes that arise from Tmod perturbation experiments in vitro and in vivo. Tmod-based stabilization and organization of intracellular actin filament networks provide key insights into how the emergent properties of the actin cytoskeleton drive tissue morphogenesis and physiology. PMID:22488942

Comparative proteomics of two life cycle stages of stable isotope-labeled Trypanosoma brucei reveals novel components of the parasite's host adaptation machinery.

PubMed

Butter, Falk; Bucerius, Ferdinand; Michel, Margaux; Cicova, Zdenka; Mann, Matthias; Janzen, Christian J

2013-01-01

Trypanosoma brucei developed a sophisticated life cycle to adapt to different host environments. Although developmental differentiation of T. brucei has been the topic of intensive research for decades, the mechanisms responsible for adaptation to different host environments are not well understood. We developed stable isotope labeling by amino acids in cell culture in trypanosomes to compare the proteomes of two different life cycle stages. Quantitative comparison of 4364 protein groups identified many proteins previously not known to be stage-specifically expressed. The identification of stage-specific proteins helps to understand how parasites adapt to different hosts and provides new insights into differences in metabolism, gene regulation, and cell architecture. A DEAD-box RNA helicase, which is highly up-regulated in the bloodstream form of this parasite and which is essential for viability and proper cell cycle progression in this stage is described as an example.

Mitochondrial Dysfunction Plus High-Sugar Diet Provokes a Metabolic Crisis That Inhibits Growth.

PubMed

Kemppainen, Esko; George, Jack; Garipler, Görkem; Tuomela, Tea; Kiviranta, Essi; Soga, Tomoyoshi; Dunn, Cory D; Jacobs, Howard T

2016-01-01

The Drosophila mutant tko25t exhibits a deficiency of mitochondrial protein synthesis, leading to a global insufficiency of respiration and oxidative phosphorylation. This entrains an organismal phenotype of developmental delay and sensitivity to seizures induced by mechanical stress. We found that the mutant phenotype is exacerbated in a dose-dependent fashion by high dietary sugar levels. tko25t larvae were found to exhibit severe metabolic abnormalities that were further accentuated by high-sugar diet. These include elevated pyruvate and lactate, decreased ATP and NADPH. Dietary pyruvate or lactate supplementation phenocopied the effects of high sugar. Based on tissue-specific rescue, the crucial tissue in which this metabolic crisis initiates is the gut. It is accompanied by down-regulation of the apparatus of cytosolic protein synthesis and secretion at both the RNA and post-translational levels, including a novel regulation of S6 kinase at the protein level.

Mitochondrial Dysfunction Plus High-Sugar Diet Provokes a Metabolic Crisis That Inhibits Growth

PubMed Central

Kemppainen, Esko; George, Jack; Garipler, Görkem; Tuomela, Tea; Kiviranta, Essi; Soga, Tomoyoshi; Dunn, Cory D.; Jacobs, Howard T.

2016-01-01

The Drosophila mutant tko25t exhibits a deficiency of mitochondrial protein synthesis, leading to a global insufficiency of respiration and oxidative phosphorylation. This entrains an organismal phenotype of developmental delay and sensitivity to seizures induced by mechanical stress. We found that the mutant phenotype is exacerbated in a dose-dependent fashion by high dietary sugar levels. tko25t larvae were found to exhibit severe metabolic abnormalities that were further accentuated by high-sugar diet. These include elevated pyruvate and lactate, decreased ATP and NADPH. Dietary pyruvate or lactate supplementation phenocopied the effects of high sugar. Based on tissue-specific rescue, the crucial tissue in which this metabolic crisis initiates is the gut. It is accompanied by down-regulation of the apparatus of cytosolic protein synthesis and secretion at both the RNA and post-translational levels, including a novel regulation of S6 kinase at the protein level. PMID:26812173

The BABY BOOM Transcription Factor Activates the LEC1-ABI3-FUS3-LEC2 Network to Induce Somatic Embryogenesis1[OPEN

PubMed Central

Weemen, Mieke

2017-01-01

Somatic embryogenesis is an example of induced cellular totipotency, where embryos develop from vegetative cells rather than from gamete fusion. Somatic embryogenesis can be induced in vitro by exposing explants to growth regulators and/or stress treatments. The BABY BOOM (BBM) and LEAFY COTYLEDON1 (LEC1) and LEC2 transcription factors are key regulators of plant cell totipotency, as ectopic overexpression of either transcription factor induces somatic embryo formation from Arabidopsis (Arabidopsis thaliana) seedlings without exogenous growth regulators or stress treatments. Although LEC and BBM proteins regulate the same developmental process, it is not known whether they function in the same molecular pathway. We show that BBM transcriptionally regulates LEC1 and LEC2, as well as the two other LAFL genes, FUSCA3 (FUS3) and ABSCISIC ACID INSENSITIVE3 (ABI3). LEC2 and ABI3 quantitatively regulate BBM-mediated somatic embryogenesis, while FUS3 and LEC1 are essential for this process. BBM-mediated somatic embryogenesis is dose and context dependent, and the context-dependent phenotypes are associated with differential LAFL expression. We also uncover functional redundancy for somatic embryogenesis among other Arabidopsis BBM-like proteins and show that one of these proteins, PLETHORA2, also regulates LAFL gene expression. Our data place BBM upstream of other major regulators of plant embryo identity and totipotency. PMID:28830937

New insights into the mechanism of phthalate-induced developmental effects.

PubMed

Mu, Xiyan; Huang, Ying; Li, Jia; Yang, Ke; Yang, Wenbo; Shen, Gongming; Li, Xuxing; Lei, Yunlei; Pang, Sen; Wang, Chengju; Li, Xuefeng; Li, Yingren

2018-06-11

To investigate the biological pathways involved in phthalate-induced developmental effects, zebrafish embryos were exposed to different concentrations of di-(2-ethylhexyl) (DEHP) and di-butyl phthalate (DBP) for 96 h. Embryonic exposure to DEHP and DBP induced body length decrease, yolk sac abnormities, and immune responses (up-regulation of immune proteins and genes). The lipidomic results showed that at a concentration of 50 μg/L, DEHP and DBP significantly reduced the levels of fatty acids, triglycerides, diacylglycerol, and cholesterol. These effects are partly explained by biological pathway enrichment based on data from the transcriptional and proteomic profiles. Co-exposure to DBP and ER antagonist did not significantly relieve the toxic symptoms compared with exposure to DBP alone. This indicates that phthalate-induced developmental abnormities in zebrafish might not be mediated by the ER pathway. In conclusion, we identified the possible biological pathways that mediate phthalate-induced developmental effects and found that these effects may not be driven by estrogenic activation. Copyright © 2018 Elsevier Ltd. All rights reserved.

Functions and regulation of the multitasking FANCM family of DNA motor proteins.

PubMed

Xue, Xiaoyu; Sung, Patrick; Zhao, Xiaolan

2015-09-01

Members of the conserved FANCM family of DNA motor proteins play key roles in genome maintenance processes. FANCM supports genome duplication and repair under different circumstances and also functions in the ATR-mediated DNA damage checkpoint. Some of these roles are shared among lower eukaryotic family members. Human FANCM has been linked to Fanconi anemia, a syndrome characterized by cancer predisposition, developmental disorder, and bone marrow failure. Recent studies on human FANCM and its orthologs from other organisms have provided insights into their biological functions, regulation, and collaboration with other genome maintenance factors. This review summarizes the progress made, with the goal of providing an integrated view of the functions and regulation of these enzymes in humans and model organisms and how they advance our understanding of genome maintenance processes. © 2015 Xue et al.; Published by Cold Spring Harbor Laboratory Press.

TGF-β in tolerance, development and regulation of immunity

PubMed Central

Johnston, Chris J.C.; Smyth, Danielle J.; Dresser, David W.; Maizels, Rick M.

2016-01-01

The TGF-β superfamily is an ancient metazoan protein class which cuts across cell and tissue differentiation, developmental biology and immunology. Its many members are regulated at multiple levels from intricate control of gene transcription, post-translational processing and activation, and signaling through overlapping receptor structures and downstream intracellular messengers. We have been interested in TGF-β homologues firstly as key players in the induction of immunological tolerance, the topic so closely associated with Ray Owen. Secondly, our interests in how parasites may manipulate the immune system of their host has also brought us to study the TGF-β pathway in infections with longlived, essentially tolerogenic, helminth parasites. Finally, within the spectrum of mammalian TGF-β proteins is an exquisitely tightly-regulated gene, anti-Müllerian hormone (AMH), whose role in sex determination underpins the phenotype of freemartin calves that formed the focus of Ray’s seminal work on immunological tolerance. PMID:26617281

Oral transfer of chemical cues, growth proteins and hormones in social insects

PubMed Central

LeBoeuf, Adria C; Waridel, Patrice; Brent, Colin S; Gonçalves, Andre N; Menin, Laure; Ortiz, Daniel; Riba-Grognuz, Oksana; Koto, Akiko; Soares, Zamira G; Privman, Eyal; Miska, Eric A; Benton, Richard; Keller, Laurent

2016-01-01

Social insects frequently engage in oral fluid exchange – trophallaxis – between adults, and between adults and larvae. Although trophallaxis is widely considered a food-sharing mechanism, we hypothesized that endogenous components of this fluid might underlie a novel means of chemical communication between colony members. Through protein and small-molecule mass spectrometry and RNA sequencing, we found that trophallactic fluid in the ant Camponotus floridanus contains a set of specific digestion- and non-digestion related proteins, as well as hydrocarbons, microRNAs, and a key developmental regulator, juvenile hormone. When C. floridanus workers’ food was supplemented with this hormone, the larvae they reared via trophallaxis were twice as likely to complete metamorphosis and became larger workers. Comparison of trophallactic fluid proteins across social insect species revealed that many are regulators of growth, development and behavioral maturation. These results suggest that trophallaxis plays previously unsuspected roles in communication and enables communal control of colony phenotypes. DOI: http://dx.doi.org/10.7554/eLife.20375.001 PMID:27894417

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Characterization of a Smad motif similar to Drosophila mad in the mouse Msx 1 promoter.

PubMed

Alvarez Martinez, Cristina E; Binato, Renata; Gonzalez, Sayonara; Pereira, Monica; Robert, Benoit; Abdelhay, Eliana

2002-03-01

Mouse Msx 1 gene, orthologous of the Drosophila msh, is involved in several developmental processes. BMP family members are major proteins in the regulation of Msx 1 expression. BMP signaling activates Smad 1/5/8 proteins, which associate to Smad 4 before translocating to the nucleus. Analysis of Msx 1 promoter revealed the presence of three elements similar to the consensus established for Mad, the Smad 1 Drosophila counterpart. Notably, such an element was identified in an enhancer important for Msx 1 regulation. Gel shift analysis demonstrated that proteins from 13.5 dpc embryo associate to this enhancer. Remarkably, supershift assays showed that Smad proteins are present in the complex. Purified Smad 1 and 4 also bind to this fragment. We demonstrate that functional binding sites in this enhancer are confined to the Mad motif and flanking region. Our data suggest that this Mad motif may be functional in response to BMP signaling. ©2002 Elsevier Science (USA).

Early developmental gene regulation in Strongylocentrotus purpuratus embryos in response to elevated CO₂ seawater conditions.

PubMed

Hammond, LaTisha M; Hofmann, Gretchen E

2012-07-15

Ocean acidification, or the increased uptake of CO(2) by the ocean due to elevated atmospheric CO(2) concentrations, may variably impact marine early life history stages, as they may be especially susceptible to changes in ocean chemistry. Investigating the regulatory mechanisms of early development in an environmental context, or ecological development, will contribute to increased understanding of potential organismal responses to such rapid, large-scale environmental changes. We examined transcript-level responses to elevated seawater CO(2) during gastrulation and the initiation of spiculogenesis, two crucial developmental processes in the purple sea urchin, Strongylocentrotus purpuratus. Embryos were reared at the current, accepted oceanic CO(2) concentration of 380 microatmospheres (μatm), and at the elevated levels of 1000 and 1350 μatm, simulating predictions for oceans and upwelling regions, respectively. The seven genes of interest comprised a subset of pathways in the primary mesenchyme cell gene regulatory network (PMC GRN) shown to be necessary for the regulation and execution of gastrulation and spiculogenesis. Of the seven genes, qPCR analysis indicated that elevated CO(2) concentrations only had a significant but subtle effect on two genes, one important for early embryo patterning, Wnt8, and the other an integral component in spiculogenesis and biomineralization, SM30b. Protein levels of another spicule matrix component, SM50, demonstrated significant variable responses to elevated CO(2). These data link the regulation of crucial early developmental processes with the environment that these embryos would be developing within, situating the study of organismal responses to ocean acidification in a developmental context.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Proteome profiling of early seed development in Cunninghamia lanceolata (Lamb.) Hook

PubMed Central

Shi, Jisen; Zhen, Yan; Zheng, Ren-Hua

2010-01-01

Knowledge of the proteome of the early gymnosperm embryo could provide important information for optimizing plant cloning procedures and for establishing platforms for research into plant development/regulation and in vitro transgenic studies. Compared with angiosperms, it is more difficult to induce somatic embryogenesis in gymnosperms; success in this endeavour could be increased, however, if proteomic information was available on the complex, dynamic, and multistage processes of gymnosperm embryogenesis in vivo. A proteomic analysis of Chinese fir seeds in six developmental stages was carried out during early embryogenesis. Proteins were extracted from seeds dissected from immature cones and separated by two-dimensional difference gel electrophoresis. Analysis with DeCyder 6.5 software revealed 136 spots that differed in kinetics of appearance. Analysis by liquid chromatography coupled to tandem mass spectrometry and MALDI-TOF mass spectrometry identified proteins represented by 71 of the spots. Functional annotation of these seed proteins revealed their involvement in programmed cell death and chromatin modification, indicating that the proteins may play a central role in determining the number of zygotic embryos generated and controlling embryo patterning and shape remodelling. The analysis also revealed other proteins involved in carbon metabolism, methionine metabolism, energy production, protein storage, synthesis and stabilization, disease/defence, the cytoskeleton, and embryo development. The comprehensive protein expression profiles generated by our study provide new insights into the complex developmental processes in the seeds of the Chinese fir. PMID:20363864

Border control: selectivity of chloroplast protein import and regulation at the TOC-complex

PubMed Central

Demarsy, Emilie; Lakshmanan, Ashok M.; Kessler, Felix

2014-01-01

Plants have evolved complex and sophisticated molecular mechanisms to regulate their development and adapt to their surrounding environment. Particularly the development of their specific organelles, chloroplasts and other plastid-types, is finely tuned in accordance with the metabolic needs of the cell. The normal development and functioning of plastids require import of particular subsets of nuclear encoded proteins. Most preproteins contain a cleavable sequence at their N terminal (transit peptide) serving as a signal for targeting to the organelle and recognition by the translocation machinery TOC–TIC (translocon of outer membrane complex–translocon of inner membrane complex) spanning the dual membrane envelope. The plastid proteome needs constant remodeling in response to developmental and environmental factors. Therefore selective regulation of preprotein import plays a crucial role in plant development. In this review we describe the diversity of transit peptides and TOC receptor complexes, and summarize the current knowledge and potential directions for future research concerning regulation of the different Toc isoforms. PMID:25278954

Border control: selectivity of chloroplast protein import and regulation at the TOC-complex.

PubMed

Demarsy, Emilie; Lakshmanan, Ashok M; Kessler, Felix

2014-01-01

Plants have evolved complex and sophisticated molecular mechanisms to regulate their development and adapt to their surrounding environment. Particularly the development of their specific organelles, chloroplasts and other plastid-types, is finely tuned in accordance with the metabolic needs of the cell. The normal development and functioning of plastids require import of particular subsets of nuclear encoded proteins. Most preproteins contain a cleavable sequence at their N terminal (transit peptide) serving as a signal for targeting to the organelle and recognition by the translocation machinery TOC-TIC (translocon of outer membrane complex-translocon of inner membrane complex) spanning the dual membrane envelope. The plastid proteome needs constant remodeling in response to developmental and environmental factors. Therefore selective regulation of preprotein import plays a crucial role in plant development. In this review we describe the diversity of transit peptides and TOC receptor complexes, and summarize the current knowledge and potential directions for future research concerning regulation of the different Toc isoforms.

Coordinated Regulation of Intestinal Functions in C. elegans by LIN-35/Rb and SLR-2

PubMed Central

Kirienko, Natalia V.; McEnerney, John D. K.; Fay, David S.

2008-01-01

LIN-35 is the sole C. elegans representative of the pocket protein family, which includes the mammalian Retinoblastoma protein pRb and its paralogs p107 and p130. In addition to having a well-established and central role in cell cycle regulation, pocket proteins have been increasingly implicated in the control of critical and diverse developmental and cellular processes. To gain a greater understanding of the roles of pocket proteins during development, we have characterized a synthetic genetic interaction between lin-35 and slr-2, which we show encodes a C2H2-type Zn-finger protein. Whereas animals harboring single mutations in lin-35 or slr-2 are viable and fertile, lin-35; slr-2 double mutants arrest uniformly in early larval development without obvious morphological defects. Using a combination of approaches including transcriptome profiling, mosaic analysis, starvation assays, and expression analysis, we demonstrate that both LIN-35 and SLR-2 act in the intestine to regulate the expression of many genes required for normal nutrient utilization. These findings represent a novel role for pRb family members in the maintenance of organ function. Our studies also shed light on the mechanistic basis of genetic redundancy among transcriptional regulators and suggest that synthetic interactions may result from the synergistic misregulation of one or more common targets. PMID:18437219

Arabidopsis CRY2 and ZTL mediate blue-light regulation of the transcription factor CIB1 by distinct mechanisms

PubMed Central

Liu, Hongtao; Wang, Qin; Liu, Yawen; Zhao, Xiaoying; Imaizumi, Takato; Somers, David E.; Tobin, Elaine M.; Lin, Chentao

2013-01-01

Plants possess multiple photoreceptors to mediate light regulation of growth and development, but it is not well understood how different photoreceptors coordinate their actions to jointly regulate developmental responses, such as flowering time. In Arabidopsis, the photoexcited cryptochrome 2 interacts with the transcription factor CRYPTOCHROME-INTERACTING basic helix–loop–helix 1 (CIB1) to activate transcription and floral initiation. We show that the CIB1 protein expression is regulated by blue light; CIB1 is highly expressed in plants exposed to blue light, but levels of the CIB1 protein decreases in the absence of blue light. We demonstrate that CIB1 is degraded by the 26S proteasome and that blue light suppresses CIB1 degradation. Surprisingly, although cryptochrome 2 physically interacts with CIB1 in response to blue light, it is not the photoreceptor mediating blue-light suppression of CIB1 degradation. Instead, two of the three light–oxygen–voltage (LOV)-domain photoreceptors, ZEITLUPE and LOV KELCH PROTEIN 2, but not FLAVIN-BINDING KELCH REPEAT 1, are required for the function and blue-light suppression of degradation of CIB1. These results support the hypothesis that the evolutionarily unrelated blue-light receptors, cryptochrome and LOV-domain F-box proteins, mediate blue-light regulation of the same transcription factor by distinct mechanisms. PMID:24101505

Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development

PubMed Central

Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A.; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A.

2014-01-01

The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. PMID:25106867

In vivo interference with AtTCP20 function induces severe plant growth alterations and deregulates the expression of many genes important for development.

PubMed

Hervé, Christine; Dabos, Patrick; Bardet, Claude; Jauneau, Alain; Auriac, Marie Christine; Ramboer, Agnès; Lacout, Fabrice; Tremousaygue, Dominique

2009-03-01

AtTCP20 is a transcription factor belonging to the Arabidopsis (Arabidopsis thaliana) TCP-P subfamily, characterized by its capacity to bind to site II motifs (TGGGCY). Our aim was to understand the role of AtTCP20 in plant development. The expression pattern of a translational fusion of Prom(TCP20):CDS20GUSGFP suggested a function for AtTCP20 in several plant organs and stages of development. The role of AtTCP20 was challenged in planta by inducing expression of AtTCP20 proteins fused with either a transcriptional activator domain (VP16) or a repressor domain (EAR). Expression of both modified proteins led to severe developmental phenotypes. In-depth analysis suggested that AtTCP20 may participate in the regulation of cell expansion, cell division, and cell differentiation. Gene expression profiling in roots and hypocotyls revealed that 252 genes were down-regulated in both organs after induction of the AtTCP20EAR repressor gene. Site II motifs (TGGGCY) were underrepresented in their promoters. Conversely, GG(A/T)CCC sequences related to binding sites identified for TCP proteins in rice (Oryza sativa) were overrepresented, and a TCP20 fusion protein was shown to bind to these sequences in vitro. Gene ontology indicated that many targeted genes were involved in cell wall biogenesis and modification during expansion and also encoded numerous transcription factors controlling plant development. Our results are consistent with the previous proposal that AtTCP20 is involved in cell division and growth coordination. Moreover, they further suggest that AtTCP20 also contributes to cell expansion control and indicate a different involvement of this protein in plant morphogenesis depending on the organ and the developmental stage.

ATM Substrate Chk2-interacting Zn2+ Finger (ASCIZ) Is a Bi-functional Transcriptional Activator and Feedback Sensor in the Regulation of Dynein Light Chain (DYNLL1) Expression*

PubMed Central

Jurado, Sabine; Conlan, Lindus A.; Baker, Emma K.; Ng, Jane-Lee; Tenis, Nora; Hoch, Nicolas C.; Gleeson, Kimberly; Smeets, Monique; Izon, David; Heierhorst, Jörg

2012-01-01

The highly conserved DYNLL1 (LC8) protein was originally discovered as a light chain of the dynein motor complex, but is increasingly emerging as a sequence-specific regulator of protein dimerization with hundreds of targets and wide-ranging cellular functions. Despite its important roles, DYNLL1's own regulation remains poorly understood. Here we identify ASCIZ (ATMIN/ZNF822), an essential Zn2+ finger protein with dual roles in the DNA base damage response and as a developmental transcription factor, as a conserved regulator of Dynll1 gene expression. DYNLL1 levels are reduced by ∼10-fold in the absence of ASCIZ in human, mouse and chicken cells. ASCIZ binds directly to the Dynll1 promoter and regulates its activity in a Zn2+ finger-dependent manner. DYNLL1 protein in turn interacts with ten binding sites in the ASCIZ transcription activation domain, and high DYNLL1 levels inhibit the transcriptional activity of ASCIZ. In addition, DYNLL1 was also required for DNA damage-induced ASCIZ focus formation. The dual ability of ASCIZ to activate Dynll1 gene expression and to sense free DYNLL1 protein levels enables a simple dynamic feedback loop to adjust DYNLL1 levels to cellular needs. The ASCIZ-DYNLL1 feedback loop represents a novel mechanism for auto-regulation of gene expression, where the gene product directly inhibits the transcriptional activator while bound at its own promoter. PMID:22167198

Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development.

PubMed

Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

2016-01-01

Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa ( Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and contributes to the understanding of the basic molecular mechanisms during the alfalfa flowering process. These results may offer insight into potential strategies for improving seed yield, quality, and stress tolerance in alfalfa.

Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development

PubMed Central

Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

2016-01-01

Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa (Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and contributes to the understanding of the basic molecular mechanisms during the alfalfa flowering process. These results may offer insight into potential strategies for improving seed yield, quality, and stress tolerance in alfalfa. PMID:27757120

Conditional deletion of SLP-76 in mature T cells abrogates peripheral immune responses.

PubMed

Wu, Gregory F; Corbo, Evann; Schmidt, Michelle; Smith-Garvin, Jennifer E; Riese, Matthew J; Jordan, Martha S; Laufer, Terri M; Brown, Eric J; Maltzman, Jonathan S

2011-07-01

The adaptor protein Src homology 2 domain-containing leukocyte-specific protein of 76 kDa (SLP-76) is central to the organization of intracellular signaling downstream of the T-cell receptor (TCR). Evaluation of its role in mature, primary T cells has been hampered by developmental defects that occur in the absence of WT SLP-76 protein in thymocytes. Here, we show that following tamoxifen-regulated conditional deletion of SLP-76, mature, antigen-inexperienced T cells maintain normal TCR surface expression but fail to transduce TCR-generated signals. Conditionally deficient T cells fail to proliferate in response to antigenic stimulation or a lymphopenic environment. Mice with induced deletion of SLP-76 are resistant to induction of the CD4+ T-cell-mediated autoimmune disease experimental autoimmune encephalomyelitis. Altogether, our findings demonstrate the critical role of SLP-76-mediated signaling in initiating T-cell-directed immune responses both in vitro and in vivo and highlight the ability to analyze signaling processes in mature T cells in the absence of developmental defects. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genome-wide expression analysis of soybean NF-Y genes reveals potential function in development and drought response.

PubMed

Quach, Truyen N; Nguyen, Hanh T M; Valliyodan, Babu; Joshi, Trupti; Xu, Dong; Nguyen, Henry T

2015-06-01

Nuclear factor-Y (NF-Y), a heterotrimeric transcription factor, is composed of NF-YA, NF-YB and NF-YC proteins. In plants, there are usually more than 10 genes for each family and their members have been identified to be key regulators in many developmental and physiological processes controlling gametogenesis, embryogenesis, nodule development, seed development, abscisic acid (ABA) signaling, flowering time, primary root elongation, blue light responses, endoplasmic reticulum (ER) stress response and drought tolerance. Taking the advantages of the recent soybean genome draft and information on functional characterizations of nuclear factor Y (NF-Y) transcription factor family in plants, we identified 21 GmNF-YA, 32 GmNF-YB, and 15 GmNF-YC genes in the soybean (Glycine max) genome. Phylogenetic analyses show that soybean's proteins share strong homology to Arabidopsis and many of them are closely related to functionally characterized NF-Y in plants. Expression analysis in various tissues of flower, leaf, root, seeds of different developmental stages, root hairs under rhizobium inoculation, and drought-treated roots and leaves revealed that certain groups of soybean NF-Y are likely involved in specific developmental and stress responses. This study provides extensive evaluation of the soybean NF-Y family and is particularly useful for further functional characterization of GmNF-Y proteins in seed development, nodulation and drought adaptation of soybean.

New insights into host-parasite ubiquitin proteome dynamics in P. falciparum infected red blood cells using a TUBEs-MS approach.

PubMed

Mata-Cantero, Lydia; Azkargorta, Mikel; Aillet, Fabienne; Xolalpa, Wendy; LaFuente, Maria J; Elortza, Felix; Carvalho, Ana Sofia; Martin-Plaza, Julio; Matthiesen, Rune; Rodriguez, Manuel S

2016-04-29

Malaria, caused by Plasmodium falciparum (P. falciparum), ranks as one of the most baleful infectious diseases worldwide. New antimalarial treatments are needed to face existing or emerging drug resistant strains. Protein degradation appears to play a significant role during the asexual intraerythrocytic developmental cycle (IDC) of P. falciparum. Inhibition of the ubiquitin proteasome system (UPS), a major intracellular proteolytic pathway, effectively reduces infection and parasite replication. P. falciparum and erythrocyte UPS coexist during IDC but the nature of their relationship is largely unknown. We used an approach based on Tandem Ubiquitin-Binding Entities (TUBEs) and 1D gel electrophoresis followed by mass spectrometry to identify major components of the TUBEs-associated ubiquitin proteome of both host and parasite during ring, trophozoite and schizont stages. Ring-exported protein (REX1), a P. falciparum protein located in Maurer's clefts and important for parasite nutrient import, was found to reach a maximum level of ubiquitylation in trophozoites stage. The Homo sapiens (H. sapiens) TUBEs associated ubiquitin proteome decreased during the infection, whereas the equivalent P. falciparum TUBEs-associated ubiquitin proteome counterpart increased. Major cellular processes such as DNA repair, replication, stress response, vesicular transport and catabolic events appear to be regulated by ubiquitylation along the IDC P. falciparum infection. In this work we analyze for the first time the interconnection between Plasmodium and human red blood cells ubiquitin-regulated proteins in the context of infection. We identified a number of human and Plasmodium proteins whose ubiquitylation pattern changes during the asexual infective stage. We demonstrate that ubiquitylation of REX1, a P. falciparum protein located in Maurer's clefts and important for parasite nutrient import, peaks in trophozoites stage. The ubiquitin-proteome from P. falciparum infected red blood cells (iRBCs) revealed a significant host-parasite crosstalk, underlining the importance of ubiquitin-regulated proteolytic activities during the intraerythrocytic developmental cycle (IDC) of P. falciparum. Major cellular processes defined from gene ontology such as DNA repair, replication, stress response, vesicular transport and catabolic events appear to be regulated by ubiquitylation along the IDC P. falciparum infection. Given the importance of ubiquitylation in the development of infectious diseases, this work provides a number of potential drug-target candidates that should be further explored. Copyright © 2016 Elsevier B.V. All rights reserved.

Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by Bilirubin at the Blood-CSF and Blood-Brain Barriers in the Gunn Rat

PubMed Central

Gazzin, Silvia; Berengeno, Andrea Lorena; Strazielle, Nathalie; Fazzari, Francesco; Raseni, Alan; Ostrow, J. Donald; Wennberg, Richard; Ghersi-Egea, Jean-François; Tiribelli, Claudio

2011-01-01

Accumulation of unconjugated bilirubin (UCB) in the brain causes bilirubin encephalopathy. Pgp (ABCb1) and Mrp1 (ABCc1), highly expressed in the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB) respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj) Gunn rats compared to heterozygous, not jaundiced (Jj) littermates at different developmental stages (2, 9, 17 and 60 days after birth). BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16–27% of adult values), despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17–P60, respectively); Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60–70% of the adult values) in both jj and Jj at P2, but was markedly (50%) down-regulated in jj pups starting at P9, particularly in the 4th ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity. PMID:21297965

Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by bilirubin at the blood-CSF and blood-brain barriers in the Gunn rat.

PubMed

Gazzin, Silvia; Berengeno, Andrea Lorena; Strazielle, Nathalie; Fazzari, Francesco; Raseni, Alan; Ostrow, J Donald; Wennberg, Richard; Ghersi-Egea, Jean-François; Tiribelli, Claudio

2011-01-31

Accumulation of unconjugated bilirubin (UCB) in the brain causes bilirubin encephalopathy. Pgp (ABCb1) and Mrp1 (ABCc1), highly expressed in the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB) respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj) Gunn rats compared to heterozygous, not jaundiced (Jj) littermates at different developmental stages (2, 9, 17 and 60 days after birth). BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16-27% of adult values), despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17-P60, respectively); Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60-70% of the adult values) in both jj and Jj at P2, but was markedly (50%) down-regulated in jj pups starting at P9, particularly in the 4(th) ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity.

Regulation of bone morphogenetic proteins in early embryonic development

NASA Astrophysics Data System (ADS)

Yamamoto, Yukiyo; Oelgeschläger, Michael

2004-11-01

Bone morphogenetic proteins (BMPs), a large subgroup of the TGF-β family of secreted growth factors, control fundamental events in early embryonic development, organogenesis and adult tissue homeostasis. The plethora of dose-dependent cellular processes regulated by BMP signalling demand a tight regulation of BMP activity. Over the last decade, a number of proteins have been identified that bind BMPs in the extracellular space and regulate the interaction of BMPs with their cognate receptors, including the secreted BMP antagonist Chordin. In the early vertebrate embryo, the localized secretion of BMP antagonists from the dorsal blastopore lip establishes a functional BMP signalling gradient that is required for the determination of the dorsoventral or back to belly body axis. In particular, inhibition of BMP activity is essential for the formation of neural tissue in the development of vertebrate and invertebrate embryos. Here we review recent studies that have provided new insight into the regulation of BMP signalling in the extracellular space. In particular, we discuss the recently identified Twisted gastrulation protein that modulates, in concert with metalloproteinases of the Tolloid family, the interaction of Chordin with BMP and a family of proteins that share structural similarities with Chordin in the respective BMP binding domains. In addition, genetic and functional studies in zebrafish and frog provide compelling evidence that the secreted protein Sizzled functionally interacts with the Chd BMP pathway, despite being expressed ventrally in the early gastrula-stage embryo. These intriguing discoveries may have important implications, not only for our current concept of early embryonic patterning, but also for the regulation of BMP activity at later developmental stages and tissue homeostasis in the adult.

A knock-in mouse line conditionally expressing the tumor suppressor WTX/AMER1.

PubMed

Boutet, Agnès; Comai, Glenda; Charlet, Aurélie; Jian Motamedi, Fariba; Dhib, Haroun; Bandiera, Roberto; Schedl, Andreas

2017-11-01

WTX/AMER1 is an important developmental regulator, mutations in which have been identified in a proportion of patients suffering from the renal neoplasm Wilms' tumor and in the bone malformation syndrome Osteopathia Striata with Cranial Sclerosis (OSCS). Its cellular functions appear complex and the protein can be found at the membrane, within the cytoplasm and the nucleus. To understand its developmental and cellular function an allelic series for Wtx in the mouse is crucial. Whereas mice carrying a conditional knock out allele for Wtx have been previously reported, a gain-of-function mouse model that would allow studying the molecular, cellular and developmental role of Wtx is still missing. Here we describe the generation of a novel mouse strain that permits the conditional activation of WTX expression. Wtx fused to GFP was introduced downstream a stop cassette flanked by loxP sites into the Rosa26 locus by gene targeting. Ectopic WTX expression is reported after crosses with several Cre transgenic mice in different embryonic tissues. Further, functionality of the fusion protein was demonstrated in the context of a Wtx null allele. © 2017 Wiley Periodicals, Inc.

[Regulation of heat shock gene expression in response to stress].

PubMed

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS protein mRNAs ensure their preferential translation in stress.

Phenotypic regulation of the sphingosine 1-phosphate receptor miles apart by G protein-coupled receptor kinase 2.

PubMed

Burczyk, Martina; Burkhalter, Martin D; Blätte, Tamara; Matysik, Sabrina; Caron, Marc G; Barak, Lawrence S; Philipp, Melanie

2015-01-27

The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m(93) (mil(m93)), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling.

Phenotypic Regulation of the Sphingosine 1-Phosphate Receptor Miles Apart by G Protein-Coupled Receptor Kinase 2

PubMed Central

2016-01-01

The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m93 (milm93), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling. PMID:25555130

Polycomb group protein complexes exchange rapidly in living Drosophila.

PubMed

Ficz, Gabriella; Heintzmann, Rainer; Arndt-Jovin, Donna J

2005-09-01

Fluorescence recovery after photobleaching (FRAP) microscopy was used to determine the kinetic properties of Polycomb group (PcG) proteins in whole living Drosophila organisms (embryos) and tissues (wing imaginal discs and salivary glands). PcG genes are essential genes in higher eukaryotes responsible for the maintenance of the spatially distinct repression of developmentally important regulators such as the homeotic genes. Their absence, as well as overexpression, causes transformations in the axial organization of the body. Although protein complexes have been isolated in vitro, little is known about their stability or exact mechanism of repression in vivo. We determined the translational diffusion constants of PcG proteins, dissociation constants and residence times for complexes in vivo at different developmental stages. In polytene nuclei, the rate constants suggest heterogeneity of the complexes. Computer simulations with new models for spatially distributed protein complexes were performed in systems showing both diffusion and binding equilibria, and the results compared with our experimental data. We were able to determine forward and reverse rate constants for complex formation. Complexes exchanged within a period of 1-10 minutes, more than an order of magnitude faster than the cell cycle time, ruling out models of repression in which access of transcription activators to the chromatin is limited and demonstrating that long-term repression primarily reflects mass-action chemical equilibria.

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

The PHD-containing protein EARLY BOLTING IN SHORT DAYS regulates seed dormancy in Arabidopsis.

PubMed

Narro-Diego, Laura; López-González, Leticia; Jarillo, Jose A; Piñeiro, Manuel

2017-10-01

The Arabidopsis protein EARLY BOLTING IN SHORT DAYS (EBS), a plant-specific transcriptional regulator, is involved in the control of flowering time by repressing the floral integrator FT. The EBS protein binds the H3K4me3 histone mark and interacts with histone deacetylases to modulate gene expression. Here, we show that EBS also participates in the regulation of seed dormancy. ebs mutations cause a reduction in seed dormancy, and the concurrent loss of function of the EBS homologue SHORT LIFE (SHL) enhances this dormancy alteration. Transcriptomic analyses in ebs mutant seeds uncovered the misregulation of several regulators of seed dormancy including the MADS box gene AGAMOUS-LIKE67 (AGL67). AGL67 interacts genetically with EBS in seed dormancy regulation, indicating that both loci act in the same pathway. Interestingly, EBS functions independently of the master regulator gene of dormancy DELAY OF GERMINATION 1 (DOG1) and other genes encoding chromatin remodelling factors involved in the control of seed dormancy. Altogether, these data show that EBS is a central repressor of germination during seed dormancy and that SHL acts redundantly with EBS in the control of this developmental process. Our observations suggest that a tightly regulated crosstalk among histone modifications is necessary for a proper control of seed dormancy. © 2017 John Wiley & Sons Ltd.

Autophagy Driven by a Master Regulator of Hematopoiesis

PubMed Central

Kang, Yoon-A; Sanalkumar, Rajendran; O'Geen, Henriette; Linnemann, Amelia K.; Chang, Chan-Jung; Bouhassira, Eric E.; Farnham, Peggy J.; Keles, Sunduz

2012-01-01

Developmental and homeostatic remodeling of cellular organelles is mediated by a complex process termed autophagy. The cohort of proteins that constitute the autophagy machinery functions in a multistep biochemical pathway. Though components of the autophagy machinery are broadly expressed, autophagy can occur in specialized cellular contexts, and mechanisms underlying cell-type-specific autophagy are poorly understood. We demonstrate that the master regulator of hematopoiesis, GATA-1, directly activates transcription of genes encoding the essential autophagy component microtubule-associated protein 1 light chain 3B (LC3B) and its homologs (MAP1LC3A, GABARAP, GABARAPL1, and GATE-16). In addition, GATA-1 directly activates genes involved in the biogenesis/function of lysosomes, which mediate autophagic protein turnover. We demonstrate that GATA-1 utilizes the forkhead protein FoxO3 to activate select autophagy genes. GATA-1-dependent LC3B induction is tightly coupled to accumulation of the active form of LC3B and autophagosomes, which mediate mitochondrial clearance as a critical step in erythropoiesis. These results illustrate a novel mechanism by which a master regulator of development establishes a genetic network to instigate cell-type-specific autophagy. PMID:22025678

Conservation of Matrix Attachment Region-Binding Filament-Like Protein 1 among Higher Plants1

PubMed Central

Harder, Patricia A.; Silverstein, Rebecca A.; Meier, Iris

2000-01-01

The interaction of chromatin with the nuclear matrix via matrix attachment regions (MARs) on the DNA is considered to be of fundamental importance for higher-order chromatin organization and the regulation of gene expression. We have previously isolated a novel nuclear matrix-localized protein (MFP1) from tomato (Lycopersicon esculentum) that preferentially binds to MAR DNA. Tomato MFP1 has a predicted filament-protein-like structure and is associated with the nuclear envelope via an N-terminal targeting domain. Based on the antigenic relationship, we report here that MFP1 is conserved in a large number of dicot and monocot species. Several cDNAs were cloned from tobacco (Nicotiana tabacum) and shown to correspond to two tobacco MFP1 genes. Comparison of the primary and predicted secondary structures of MFP1 from tomato, tobacco, and Arabidopsis indicates a high degree of conservation of the N-terminal targeting domain, the overall putative coiled-coil structure of the protein, and the C-terminal DNA-binding domain. In addition, we show that tobacco MFP1 is regulated in an organ-specific and developmental fashion, and that this regulation occurs at the level of transcription or RNA stability. PMID:10631266

Systems analysis of a maize leaf developmental gradient redefines the current C4 model and provides candidates for regulation.

PubMed

Pick, Thea R; Bräutigam, Andrea; Schlüter, Urte; Denton, Alisandra K; Colmsee, Christian; Scholz, Uwe; Fahnenstich, Holger; Pieruschka, Roland; Rascher, Uwe; Sonnewald, Uwe; Weber, Andreas P M

2011-12-01

We systematically analyzed a developmental gradient of the third maize (Zea mays) leaf from the point of emergence into the light to the tip in 10 continuous leaf slices to study organ development and physiological and biochemical functions. Transcriptome analysis, oxygen sensitivity of photosynthesis, and photosynthetic rate measurements showed that the maize leaf undergoes a sink-to-source transition without an intermediate phase of C(3) photosynthesis or operation of a photorespiratory carbon pump. Metabolome and transcriptome analysis, chlorophyll and protein measurements, as well as dry weight determination, showed continuous gradients for all analyzed items. The absence of binary on-off switches and regulons pointed to a morphogradient along the leaf as the determining factor of developmental stage. Analysis of transcription factors for differential expression along the leaf gradient defined a list of putative regulators orchestrating the sink-to-source transition and establishment of C(4) photosynthesis. Finally, transcriptome and metabolome analysis, as well as enzyme activity measurements, and absolute quantification of selected metabolites revised the current model of maize C(4) photosynthesis. All data sets are included within the publication to serve as a resource for maize leaf systems biology.

Systems Analysis of a Maize Leaf Developmental Gradient Redefines the Current C4 Model and Provides Candidates for Regulation[W][OA

PubMed Central

Pick, Thea R.; Bräutigam, Andrea; Schlüter, Urte; Denton, Alisandra K.; Colmsee, Christian; Scholz, Uwe; Fahnenstich, Holger; Pieruschka, Roland; Rascher, Uwe; Sonnewald, Uwe; Weber, Andreas P.M.

2011-01-01

We systematically analyzed a developmental gradient of the third maize (Zea mays) leaf from the point of emergence into the light to the tip in 10 continuous leaf slices to study organ development and physiological and biochemical functions. Transcriptome analysis, oxygen sensitivity of photosynthesis, and photosynthetic rate measurements showed that the maize leaf undergoes a sink-to-source transition without an intermediate phase of C3 photosynthesis or operation of a photorespiratory carbon pump. Metabolome and transcriptome analysis, chlorophyll and protein measurements, as well as dry weight determination, showed continuous gradients for all analyzed items. The absence of binary on–off switches and regulons pointed to a morphogradient along the leaf as the determining factor of developmental stage. Analysis of transcription factors for differential expression along the leaf gradient defined a list of putative regulators orchestrating the sink-to-source transition and establishment of C4 photosynthesis. Finally, transcriptome and metabolome analysis, as well as enzyme activity measurements, and absolute quantification of selected metabolites revised the current model of maize C4 photosynthesis. All data sets are included within the publication to serve as a resource for maize leaf systems biology. PMID:22186372

Calcium Signals: The Lead Currency of Plant Information Processing

PubMed Central

Kudla, Jörg; Batistič, Oliver; Hashimoto, Kenji

2010-01-01

Ca2+ signals are core transducers and regulators in many adaptation and developmental processes of plants. Ca2+ signals are represented by stimulus-specific signatures that result from the concerted action of channels, pumps, and carriers that shape temporally and spatially defined Ca2+ elevations. Cellular Ca2+ signals are decoded and transmitted by a toolkit of Ca2+ binding proteins that relay this information into downstream responses. Major transduction routes of Ca2+ signaling involve Ca2+-regulated kinases mediating phosphorylation events that orchestrate downstream responses or comprise regulation of gene expression via Ca2+-regulated transcription factors and Ca2+-responsive promoter elements. Here, we review some of the remarkable progress that has been made in recent years, especially in identifying critical components functioning in Ca2+ signal transduction, both at the single-cell and multicellular level. Despite impressive progress in our understanding of the processing of Ca2+ signals during the past years, the elucidation of the exact mechanistic principles that underlie the specific recognition and conversion of the cellular Ca2+ currency into defined changes in protein–protein interaction, protein phosphorylation, and gene expression and thereby establish the specificity in stimulus response coupling remain to be explored. PMID:20354197

Chloroplast Translation: Structural and Functional Organization, Operational Control, and Regulation[OPEN

PubMed Central

2018-01-01

Chloroplast translation is essential for cellular viability and plant development. Its positioning at the intersection of organellar RNA and protein metabolism makes it a unique point for the regulation of gene expression in response to internal and external cues. Recently obtained high-resolution structures of plastid ribosomes, the development of approaches allowing genome-wide analyses of chloroplast translation (i.e., ribosome profiling), and the discovery of RNA binding proteins involved in the control of translational activity have greatly increased our understanding of the chloroplast translation process and its regulation. In this review, we provide an overview of the current knowledge of the chloroplast translation machinery, its structure, organization, and function. In addition, we summarize the techniques that are currently available to study chloroplast translation and describe how translational activity is controlled and which cis-elements and trans-factors are involved. Finally, we discuss how translational control contributes to the regulation of chloroplast gene expression in response to developmental, environmental, and physiological cues. We also illustrate the commonalities and the differences between the chloroplast and bacterial translation machineries and the mechanisms of protein biosynthesis in these two prokaryotic systems. PMID:29610211

Combinatorial control of messenger RNAs by Pumilio, Nanos and Brain Tumor Proteins

PubMed Central

Arvola, René M.

2017-01-01

ABSTRACT Eukaryotes possess a vast array of RNA-binding proteins (RBPs) that affect mRNAs in diverse ways to control protein expression. Combinatorial regulation of mRNAs by RBPs is emerging as the rule. No example illustrates this as vividly as the partnership of 3 Drosophila RBPs, Pumilio, Nanos and Brain Tumor, which have overlapping functions in development, stem cell maintenance and differentiation, fertility and neurologic processes. Here we synthesize 30 y of research with new insights into their molecular functions and mechanisms of action. First, we provide an overview of the key properties of each RBP. Next, we present a detailed analysis of their collaborative regulatory mechanism using a classic example of the developmental morphogen, hunchback, which is spatially and temporally regulated by the trio during embryogenesis. New biochemical, structural and functional analyses provide insights into RNA recognition, cooperativity, and regulatory mechanisms. We integrate these data into a model of combinatorial RNA binding and regulation of translation and mRNA decay. We then use this information, transcriptome wide analyses and bioinformatics predictions to assess the global impact of Pumilio, Nanos and Brain Tumor on gene regulation. Together, the results support pervasive, dynamic post-transcriptional control. PMID:28318367

Combinatorial control of messenger RNAs by Pumilio, Nanos and Brain Tumor Proteins.

PubMed

Arvola, René M; Weidmann, Chase A; Tanaka Hall, Traci M; Goldstrohm, Aaron C

2017-11-02

Eukaryotes possess a vast array of RNA-binding proteins (RBPs) that affect mRNAs in diverse ways to control protein expression. Combinatorial regulation of mRNAs by RBPs is emerging as the rule. No example illustrates this as vividly as the partnership of 3 Drosophila RBPs, Pumilio, Nanos and Brain Tumor, which have overlapping functions in development, stem cell maintenance and differentiation, fertility and neurologic processes. Here we synthesize 30 y of research with new insights into their molecular functions and mechanisms of action. First, we provide an overview of the key properties of each RBP. Next, we present a detailed analysis of their collaborative regulatory mechanism using a classic example of the developmental morphogen, hunchback, which is spatially and temporally regulated by the trio during embryogenesis. New biochemical, structural and functional analyses provide insights into RNA recognition, cooperativity, and regulatory mechanisms. We integrate these data into a model of combinatorial RNA binding and regulation of translation and mRNA decay. We then use this information, transcriptome wide analyses and bioinformatics predictions to assess the global impact of Pumilio, Nanos and Brain Tumor on gene regulation. Together, the results support pervasive, dynamic post-transcriptional control.

IMPACT Is a Developmentally Regulated Protein in Neurons That Opposes the Eukaryotic Initiation Factor 2α Kinase GCN2 in the modulation of Neurite Outgrowth*

PubMed Central

Roffé, Martín; Hajj, Glaucia N. M.; Azevedo, Hátylas F.; Alves, Viviane S.; Castilho, Beatriz A.

2013-01-01

The product of the mouse Imprinted and Ancient gene, IMPACT, is preferentially expressed in neurons. We have previously shown that IMPACT overexpression inhibits the activation of the protein kinase GCN2, which signals amino acid starvation. GCN2 phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α), resulting in inhibition of general protein synthesis but increased translation of specific messages, such as ATF4. GCN2 is also involved in the regulation of neuronal functions, controlling synaptic plasticity, memory, and feeding behavior. We show here that IMPACT abundance increases during differentiation of neurons and neuron-like N2a cells, whereas GCN2 displays lowered activation levels. Upon differentiation, IMPACT associates with translating ribosomes, enhances translation initiation, and down-regulates the expression of ATF4. We further show that endogenous IMPACT promotes neurite outgrowth whereas GCN2 is a strong inhibitor of spontaneous neuritogenesis. Together, these results uncover the participation of the GCN2-IMPACT module of translational regulation in a highly controlled step in the development of the nervous system. PMID:23447528

IMPACT is a developmentally regulated protein in neurons that opposes the eukaryotic initiation factor 2α kinase GCN2 in the modulation of neurite outgrowth.

PubMed

Roffé, Martín; Hajj, Glaucia N M; Azevedo, Hátylas F; Alves, Viviane S; Castilho, Beatriz A

2013-04-12

The product of the mouse Imprinted and Ancient gene, IMPACT, is preferentially expressed in neurons. We have previously shown that IMPACT overexpression inhibits the activation of the protein kinase GCN2, which signals amino acid starvation. GCN2 phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α), resulting in inhibition of general protein synthesis but increased translation of specific messages, such as ATF4. GCN2 is also involved in the regulation of neuronal functions, controlling synaptic plasticity, memory, and feeding behavior. We show here that IMPACT abundance increases during differentiation of neurons and neuron-like N2a cells, whereas GCN2 displays lowered activation levels. Upon differentiation, IMPACT associates with translating ribosomes, enhances translation initiation, and down-regulates the expression of ATF4. We further show that endogenous IMPACT promotes neurite outgrowth whereas GCN2 is a strong inhibitor of spontaneous neuritogenesis. Together, these results uncover the participation of the GCN2-IMPACT module of translational regulation in a highly controlled step in the development of the nervous system.

Collagen triple helix repeat containing-1 promotes pancreatic cancer progression by regulating migration and adhesion of tumor cells.

PubMed

Park, Eun Hye; Kim, Seokho; Jo, Ji Yoon; Kim, Su Jin; Hwang, Yeonsil; Kim, Jin-Man; Song, Si Young; Lee, Dong-Ki; Koh, Sang Seok

2013-03-01

Collagen triple helix repeat containing-1 (CTHRC1) is a secreted protein involved in vascular remodeling, bone formation and developmental morphogenesis. CTHRC1 has recently been shown to be expressed in human cancers such as breast cancer and melanoma. In this study, we show that CTHRC1 is highly expressed in human pancreatic cancer tissues and plays a role in the progression and metastasis of the disease. CTHRC1 promoted primary tumor growth and metastatic spread of cancer cells to distant organs in orthotopic xenograft tumor mouse models. Overexpression of CTHRC1 in cancer cells resulted in increased motility and adhesiveness, whereas these cellular activities were diminished by down-regulation of the protein. CTHRC1 activated several key signaling molecules, including Src, focal adhesion kinase, paxillin, mitogen-activated protein kinase kinase (MEK), extracellular signal-regulated kinase and Rac1. Treatment with chemical inhibitors of Src, MEK or Rac1 and expression of dominant-negative Rac1 attenuated CTHRC1-induced cell migration and adhesion. Collectively, our results suggest that CTHRC1 has a role in pancreatic cancer progression and metastasis by regulating migration and adhesion activities of cancer cells.

NtKRP, a kinesin-12 protein, regulates embryo/seed size and seed germination via involving in cell cycle progression at the G2/M transition.

PubMed

Tian, Shujuan; Wu, Jingjing; Li, Fen; Zou, Jianwei; Liu, Yuwen; Zhou, Bing; Bai, Yang; Sun, Meng-Xiang

2016-10-25

Kinesins comprise a superfamily of microtubule-based motor proteins involved in essential processes in plant development, but few kinesins have been functionally identified during seed development. Especially, few kinesins that regulate cell division during embryogenesis have been identified. Here we report the functional characterization of NtKRP, a motor protein of the kinesin-12 family. NtKRP is predominantly expressed in embryos and embryonic roots. NtKRP RNAi lines displayed reductions in cell numbers in the meristematic zone, in embryonic root length, and in mature embryo and seed sizes. Furthermore, we also show that CDKA;1 binds to NtKRP at the consensus phosphorylation sites and that the decreased cell numbers in NtKRP-silenced embryos are due to a delay in cell division cycle at the G2/M transition. In addition, binding between the cargo-binding tail domain of NtKRP and CDKA; 1 was also determined. Our results reveal a novel molecular pathway that regulates embryo/seed development and critical role of kinesin in temporal and spatial regulation of a specific issue of embryo developmental.

Feedback control of mammalian Hedgehog signaling by the Hedgehog-binding protein, Hip1, modulates Fgf signaling during branching morphogenesis of the lung

PubMed Central

Chuang, Pao-Tien; Kawcak, T'Nay; McMahon, Andrew P.

2003-01-01

Hedgehog (Hh) signaling plays a major role in multiple aspects of embryonic development. A key issue is how negative regulation of Hh signaling might contribute to generating differential responses over tens of cell diameters. In cells that respond to Hh, two proteins that are up-regulated are Patched1 (Ptch1), the Hh receptor, a general target in both invertebrate and vertebrate organisms, and Hip1, a Hh-binding protein that is vertebrate specific. To address the developmental role of Hip1 in the context of Hh signaling, we generated Hip1 mutants in the mouse. Loss of Hip1 function results in specific defects in two Hh target issues, the lung, a target of Sonic hedgehog (Shh) signaling, and the endochondral skeleton, a target of Indian hedgehog (Ihh) signaling. Hh signaling was up-regulated in Hip1 mutants, substantiating Hip1's general role in negatively regulating Hh signaling. Our studies focused on Hip1 in the lung. Here, a dynamic interaction between Hh and fibroblast growth factor (Fgf) signaling, modulated at least in part by Hip1, controls early lung branching. PMID:12569124

Feedback control of mammalian Hedgehog signaling by the Hedgehog-binding protein, Hip1, modulates Fgf signaling during branching morphogenesis of the lung.

PubMed

Chuang, Pao-Tien; Kawcak, T'Nay; McMahon, Andrew P

2003-02-01

Hedgehog (Hh) signaling plays a major role in multiple aspects of embryonic development. A key issue is how negative regulation of Hh signaling might contribute to generating differential responses over tens of cell diameters. In cells that respond to Hh, two proteins that are up-regulated are Patched1 (Ptch1), the Hh receptor, a general target in both invertebrate and vertebrate organisms, and Hip1, a Hh-binding protein that is vertebrate specific. To address the developmental role of Hip1 in the context of Hh signaling, we generated Hip1 mutants in the mouse. Loss of Hip1 function results in specific defects in two Hh target issues, the lung, a target of Sonic hedgehog (Shh) signaling, and the endochondral skeleton, a target of Indian hedgehog (Ihh) signaling. Hh signaling was up-regulated in Hip1 mutants, substantiating Hip1's general role in negatively regulating Hh signaling. Our studies focused on Hip1 in the lung. Here, a dynamic interaction between Hh and fibroblast growth factor (Fgf) signaling, modulated at least in part by Hip1, controls early lung branching.

Regulatory Role of N6 -methyladenosine (m6 A) Methylation in RNA Processing and Human Diseases.

PubMed

Wei, Wenqiang; Ji, Xinying; Guo, Xiangqian; Ji, Shaoping

2017-09-01

N 6 -methyladenosine (m 6 A) modification is an abundant and conservative RNA modification in bacterial and eukaryotic cells. m 6 A modification mainly occurs in the 3' untranslated regions (UTRs) and near the stop codons of mRNA. Diverse strategies have been developed for identifying m 6 A sites in single nucleotide resolution. Dynamic regulation of m 6 A is found in metabolism, embryogenesis, and developmental processes, indicating a possible epigenetic regulation role along RNA processing and exerting biological functions. It has been known that m 6 A editing involves in nuclear RNA export, mRNA degradation, protein translation, and RNA splicing. Deficiency of m 6 A modification will lead to kinds of diseases, such as obesity, cancer, type 2 diabetes mellitus (T2DM), infertility, and developmental arrest. Some specific inhibitors against methyltransferase and demethylase have been developed to selectively regulate m 6 A modification, which may be advantageous for treatment of m 6 A related diseases. J. Cell. Biochem. 118: 2534-2543, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Role of PIN-mediated auxin efflux in apical hook development of Arabidopsis thaliana.

PubMed

Zádníková, Petra; Petrásek, Jan; Marhavy, Peter; Raz, Vered; Vandenbussche, Filip; Ding, Zhaojun; Schwarzerová, Katerina; Morita, Miyo T; Tasaka, Masao; Hejátko, Jan; Van Der Straeten, Dominique; Friml, Jirí; Benková, Eva

2010-02-01

The apical hook of dark-grown Arabidopsis seedlings is a simple structure that develops soon after germination to protect the meristem tissues during emergence through the soil and that opens upon exposure to light. Differential growth at the apical hook proceeds in three sequential steps that are regulated by multiple hormones, principally auxin and ethylene. We show that the progress of the apical hook through these developmental phases depends on the dynamic, asymmetric distribution of auxin, which is regulated by auxin efflux carriers of the PIN family. Several PIN proteins exhibited specific, partially overlapping spatial and temporal expression patterns, and their subcellular localization suggested auxin fluxes during hook development. Genetic manipulation of individual PIN activities interfered with different stages of hook development, implying that specific combinations of PIN genes are required for progress of the apical hook through the developmental phases. Furthermore, ethylene might modulate apical hook development by prolonging the formation phase and strongly suppressing the maintenance phase. This ethylene effect is in part mediated by regulation of PIN-dependent auxin efflux and auxin signaling.

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower

PubMed Central

Silva, Catarina S.; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

2016-01-01

Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These “developmental control genes” and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction – LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower. PMID:26779227

The super elongation complex (SEC) and MLL in development and disease

PubMed Central

Smith, Edwin; Lin, Chengqi; Shilatifard, Ali

2011-01-01

Transcriptional regulation at the level of elongation is vital for the control of gene expression and metazoan development. The mixed lineage leukemia (MLL) protein and its Drosophila homolog, Trithorax, which exist within COMPASS (complex of proteins associated with Set1)-like complexes, are master regulators of development. They are required for proper homeotic gene expression, in part through methylation of histone H3 on Lys 4. In humans, the MLL gene is involved in a large number of chromosomal translocations that create chimeric proteins, fusing the N terminus of MLL to several proteins that share little sequence similarity. Several frequent translocation partners of MLL were found recently to coexist in a super elongation complex (SEC) that includes known transcription elongation factors such as eleven-nineteen lysine-rich leukemia (ELL) and P-TEFb. Importantly, the SEC is required for HOX gene expression in leukemic cells, suggesting that chromosomal translocations involving MLL could lead to the overexpression of HOX and other genes through the involvement of the SEC. Here, we review the normal developmental roles of MLL and the SEC, and how MLL fusion proteins can mediate leukemogenesis. PMID:21460034

Identification of Arabidopsis MYB56 as a novel substrate for CRL3(BPM) E3 ligases.

PubMed

Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo

2015-02-01

Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work, MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies have indicated that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling flowering time in plants. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

PHF6 Degrees of Separation: The Multifaceted Roles of a Chromatin Adaptor Protein.

PubMed

Todd, Matthew A M; Ivanochko, Danton; Picketts, David J

2015-06-19

The importance of chromatin regulation to human disease is highlighted by the growing number of mutations identified in genes encoding chromatin remodeling proteins. While such mutations were first identified in severe developmental disorders, or in specific cancers, several genes have been implicated in both, including the plant homeodomain finger protein 6 (PHF6) gene. Indeed, germline mutations in PHF6 are the cause of the Börjeson-Forssman-Lehmann X-linked intellectual disability syndrome (BFLS), while somatic PHF6 mutations have been identified in T-cell acute lymphoblastic leukemia (T-ALL) and acute myeloid leukemia (AML). Studies from different groups over the last few years have made a significant impact towards a functional understanding of PHF6 protein function. In this review, we summarize the current knowledge of PHF6 with particular emphasis on how it interfaces with a distinct set of interacting partners and its functional roles in the nucleoplasm and nucleolus. Overall, PHF6 is emerging as a key chromatin adaptor protein critical to the regulation of neurogenesis and hematopoiesis.

Scorched earth strategy

PubMed Central

Wrzaczek, Michael; Brosché, Mikael

2009-01-01

Programmed cell death is a common feature of developmental processes and responses to environmental cues in many multicellular organisms. Examples of programmed cell death in plants are leaf abscission in autumn and the hypersensitive response during pathogen attack. Reactive oxygen species (ROS) have been implicated in the regulation of various types of cell death.1,2 However, the precise mechanics of the involvement of ROS in the processes leading to initiation of cell death and subsequent containment are currently unknown. We recently showed the involvement of an Arabidopsis protein GRIM REAPER in the regulation of ROS-induced cell death under stress conditions.3 Our results indicated that the presence of a truncated protein primes plants for cell death in the presence of ROS leading to ozone sensitivity and increased resistance to hemibiotrophic pathogens. PMID:19820355

Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.

PubMed

Osborn, Daniel P S; Roccasecca, Rosa Maria; McMurray, Fiona; Hernandez-Hernandez, Victor; Mukherjee, Sriparna; Barroso, Inês; Stemple, Derek; Cox, Roger; Beales, Philip L; Christou-Savina, Sonia

2014-01-01

Common intronic variants in the Human fat mass and obesity-associated gene (FTO) are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish) and in vitro (Fto(-/-) MEFs and HEK293T). Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+) pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

NBCe1 (SLC4A4) a potential pH Regulator in Enamel Organ Cells during Enamel Development in the Mouse

PubMed Central

Jalali, R; Guo, J; Zandieh-Doulabi, B; Bervoets, TJM; Paine, ML; Boron, W; Parker, M; Bijvelds, MJC; Medina, JF; DenBesten, PK; Bronckers, ALJJ

2016-01-01

During formation of dental enamel maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by co-transporting HCO3− with Na+. Mutation in SLC4A4 (coding for the Na+ bicarbonate co-transporter NBCe1) induces developmental defects in human and murine enamel. We hypothesized that NBCe1 in dental epithelium is engaged in neutralizing protons released during crystal formation in the enamel space. We immunolocalized NBCe1 protein in mouse wild-type dental epithelium and examined the effect of NBCe1-null mutation on enamel formation in mice. Ameloblasts expressed gene transcripts for NBCe1 isoforms B/D/C/E. In wild-type mice weak to moderate immunostaining for NBCe1 with antibodies that recognize isoforms A/B/D/E and isoform C was seen in ameloblasts in secretory stage, no or very low staining in early maturation-stage but moderately to high staining in late maturation-stage. The papillary layer showed the opposite pattern and immunostained prominently at early maturation-stage but gradually showed less staining at mid- and late maturation-stage. In NBCe1−/− mice ameloblasts were disorganized, the enamel thin and severely hypomineralized. Enamel organs of CFTR−/− and AE2a,b−/− mice (believed to be pH regulators in ameloblasts) contained higher levels of NBCe1 protein than wild-type mice. Our data show that expression of NBCe1 in ameloblast and papillary layer cell depends on developmental stage and possibly responds to pH changes. PMID:25012520

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development

PubMed Central

Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne

2004-01-01

Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937

G protein signaling in plants: minus times minus equals plus.

PubMed

Stateczny, Dave; Oppenheimer, Jara; Bommert, Peter

2016-12-01

Heterotrimeric G proteins are key regulators in the transduction of extracellular signals both in animals and plants. In plants, heterotrimeric G protein signaling plays essential roles in development and in response to biotic and abiotic stress. However, over the last decade it has become clear that plants have unique mechanisms of G protein signaling. Although plants share most of the core components of heterotrimeric G proteins, some of them exhibit unusual properties compared to their animal counterparts. In addition, plants do not share functional GPCRs. Therefore the well-established paradigm of the animal G protein signaling cycle is not applicable in plants. In this review, we summarize recent insights into these unique mechanisms of G protein signaling in plants with special focus on the evident potential of G protein signaling as a target to modify developmental and physiological parameters important for yield increase. Copyright © 2016 Elsevier Ltd. All rights reserved.

Secretome profiles of immortalized dental follicle cells using iTRAQ-based proteomic analysis.

PubMed

Dou, Lei; Wu, Yan; Yan, Qifang; Wang, Jinhua; Zhang, Yan; Ji, Ping

2017-08-04

Secretomes produced by mesenchymal stromal cells (MSCs) were considered to be therapeutic potential. However, harvesting enough primary MSCs from tissue was time-consuming and costly, which impeded the application of MSCs secretomes. This study was to immortalize MSCs and compare the secretomes profile of immortalized and original MSCs. Human dental follicle cells (DFCs) were isolated and immortalized using pMPH86. The secretome profile of immortalized DFCs (iDFCs) was investigated and compared using iTRAQ labeling combined with mass spectrometry (MS) quantitative proteomics. The MS data was analyzed using ProteinPilotTM software, and then bioinformatic analysis of identified proteins was done. A total of 2092 secreted proteins were detected in conditioned media of iDFCs. Compared with primary DFCs, 253 differently expressed proteins were found in iDFCs secretome (142 up-regulated and 111 down-regulated). Intensive bioinformatic analysis revealed that the majority of secreted proteins were involved in cellular process, metabolic process, biological regulation, cellular component organization or biogenesis, immune system process, developmental process, response to stimulus and signaling. Proteomic profile of cell secretome wasn't largely affected after immortalization converted by this piggyBac immortalization system. The secretome of iDFCs may be a good candidate of primary DFCs for regenerative medicine.

Neuropilins are positive regulators of Hedgehog signal transduction

PubMed Central

Hillman, R. Tyler; Feng, Brian Y.; Ni, Jun; Woo, Wei-Meng; Milenkovic, Ljiljana; Hayden Gephart, Melanie G.; Teruel, Mary N.; Oro, Anthony E.; Chen, James K.; Scott, Matthew P.

2011-01-01

The Hedgehog (Hh) pathway is essential for vertebrate embryogenesis, and excessive Hh target gene activation can cause cancer in humans. Here we show that Neuropilin 1 (Nrp1) and Nrp2, transmembrane proteins with roles in axon guidance and vascular endothelial growth factor (VEGF) signaling, are important positive regulators of Hh signal transduction. Nrps are expressed at times and locations of active Hh signal transduction during mouse development. Using cell lines lacking key Hh pathway components, we show that Nrps mediate Hh transduction between activated Smoothened (Smo) protein and the negative regulator Suppressor of Fused (SuFu). Nrp1 transcription is induced by Hh signaling, and Nrp1 overexpression increases maximal Hh target gene activation, indicating the existence of a positive feedback circuit. The regulation of Hh signal transduction by Nrps is conserved between mammals and bony fish, as we show that morpholinos targeting the Nrp zebrafish ortholog nrp1a produce a specific and highly penetrant Hh pathway loss-of-function phenotype. These findings enhance our knowledge of Hh pathway regulation and provide evidence for a conserved nexus between Nrps and this important developmental signaling system. PMID:22051878

Redox proteomics for the assessment of redox-related posttranslational regulation in plants.

PubMed

Mock, Hans-Peter; Dietz, Karl-Josef

2016-08-01

The methodological developments of in vivo and in vitro protein labeling and subsequent detection enable sensitive and specific detection of redox modifications. Such methods are presently applied to diverse cells and tissues, subproteomes and developmental as well as environmental conditions. The chloroplast proteome is particularly suitable for such kind of studies, because redox regulation of chloroplast proteins is well established, many plastid proteins are abundant, redox network components have been inventoried in great depth, and functional consequences explored. Thus the repertoire of redox-related posttranslational modifications on the one hand side and their abundance on the other pose a challenge for the near future to understand their contribution to physiological regulation. The various posttranslational redox modifications are introduced, followed by a description of the available proteomics methods. The significance of the redox-related posttranslational modification is exemplarily worked out using established examples from photosynthesis. This article is part of a Special Issue entitled: Plant Proteomics--a bridge between fundamental processes and crop production, edited by Dr. Hans-Peter Mock. Copyright © 2016. Published by Elsevier B.V.

An Ime2-like mitogen-activated protein kinase is involved in cellulase expression in the filamentous fungus Trichoderma reesei.

PubMed

Chen, Fei; Chen, Xiu-Zhen; Su, Xiao-Yun; Qin, Li-Na; Huang, Zhen-Bang; Tao, Yong; Dong, Zhi-Yang

2015-10-01

Eukaryotic mitogen-activated protein kinases (MAPKs) play crucial roles in transducing environmental and developmental signals inside the cell and regulating gene expression, however, the roles of MAPKs remain largely unknown in Trichoderma reesei. T. reesei ime2 (TrIme2) encodes an Ime2-like MAPK in T. reesei. The deletion of the TrIme2 gene led to 90% increase in cellulase activity against filter paper during earlier period time of cellulase induction as well as the extracellular protein production. Compared to the parent strain, the transcriptional levels of the three major cellulase genes cbh1,cbh2, egl1 were increased by about 9 times, 4 times, 2 times, respectively, at 8 h after cellulase induction in the ΔTrIme2 mutant. In addition, the disruption of TrIme2 caused over 50% reduction of the transcript levels of cellulase transcriptional regulators cre1 and xyr1. TrIme2 functions in regulation of the expression of cellulase gene in T.reesei, and is a good candidate for genetically engineering of T. reesei for higher cellulase production.

The Arabidopsis COP9 SIGNALOSOME INTERACTING F-BOX KELCH 1 protein forms an SCF ubiquitin ligase and regulates hypocotyl elongation.

PubMed

Franciosini, Anna; Lombardi, Benedetta; Iafrate, Silvia; Pecce, Valeria; Mele, Giovanni; Lupacchini, Leonardo; Rinaldi, Gianmarco; Kondou, Youichi; Gusmaroli, Giuliana; Aki, Shiori; Tsuge, Tomohiko; Deng, Xing-Wang; Matsui, Minami; Vittorioso, Paola; Costantino, Paolo; Serino, Giovanna

2013-09-01

The regulation of protein turnover by the ubiquitin proteasome system (UPS) is a major posttranslational mechanism in eukaryotes. One of the key components of the UPS, the COP9 signalosome (CSN), regulates 'cullin-ring' E3 ubiquitin ligases. In plants, CSN participates in diverse cellular and developmental processes, ranging from light signaling to cell cycle control. In this work, we isolated a new plant-specific CSN-interacting F-box protein, which we denominated CFK1 (COP9 INTERACTING F-BOX KELCH 1). We show that, in Arabidopsis thaliana, CFK1 is a component of a functional ubiquitin ligase complex. We also show that CFK1 stability is regulated by CSN and by proteasome-dependent proteolysis, and that light induces accumulation of the CFK1 transcript in the hypocotyl. Analysis of CFK1 knockdown, mutant, and overexpressing seedlings indicates that CFK1 promotes hypocotyl elongation by increasing cell size. Reduction of CSN levels enhances the short hypocotyl phenotype of CFK1-depleted seedlings, while complete loss of CSN activity suppresses the long-hypocotyl phenotype of CFK1-overexpressing seedlings. We propose that CFK1 (and its regulation by CSN) is a novel component of the cellular mechanisms controlling hypocotyl elongation.

Contributions of mRNA abundance, ribosome loading, and post- or peri-translational effects to temporal repression of C. elegans heterochronic miRNA targets

PubMed Central

Stadler, Michael; Artiles, Karen; Pak, Julia; Fire, Andrew

2012-01-01

miRNAs are post-transcriptional regulators of gene activity that reduce protein accumulation from target mRNAs. Elucidating precise molecular effects that animal miRNAs have on target transcripts has proven complex, with varied evidence indicating that miRNA regulation may produce different molecular outcomes in different species, systems, and/or physiological conditions. Here we use high-throughput ribosome profiling to analyze detailed translational parameters for five well-studied targets of miRNAs that regulate C. elegans developmental timing. For two targets of the miRNA lin-4 (lin-14 and lin-28), functional down-regulation was associated with decreases in both overall mRNA abundance and ribosome loading; however, these changes were of substantially smaller magnitude than corresponding changes observed in protein abundance. For three functional targets of the let-7 miRNA family for which down-regulation is critical in temporal progression of the animal (daf-12, hbl-1, and lin-41), we observed only modest changes in mRNA abundance and ribosome loading. lin-41 provides a striking example in that populations of ribosome-protected fragments from this gene remained essentially unchanged during the L3–L4 time interval when lin-41 activity is substantially down-regulated by let-7. Spectra of ribosomal positions were also examined for the five lin-4 and let-7 target mRNAs as a function of developmental time, with no indication of miRNA-induced ribosomal drop-off or significant pauses in translation. These data are consistent with models in which physiological regulation by this set of C. elegans miRNAs derives from combinatorial effects including suppressed recruitment/activation of translational machinery, compromised stability of target messages, and post- or peri-translational effects on lifetimes of polypeptide products. PMID:22855835

A protective role of autophagy in TDCIPP-induced developmental neurotoxicity in zebrafish larvae.

PubMed

Li, Ruiwen; Zhang, Ling; Shi, Qipeng; Guo, Yongyong; Zhang, Wei; Zhou, Bingsheng

2018-06-01

Tris (1, 3-dichloro-2-propyl) phosphate (TDCIPP), an extensively used organophosphorus flame retardant, is frequently detected in various environmental media and biota, and has been demonstrated as neurotoxic. Autophagy has been proposed as a protective mechanism against toxicant-induced neurotoxicity. The purpose of the present study was to investigate the effect of TDCIPP exposure on autophagy, and its role in TDCIPP-induced developmental neurotoxicity. Zebrafish embryos (2-120 h post-fertilization [hpf]) were exposed to TDCIPP (0, 5, 50 and 500 μg/l) and a model neurotoxic chemical, chlorpyrifos (CPF, 100 μg/l). The developmental endpoints, locomotive behavior, cholinesterase activities, gene and protein expression related to neurodevelopment and autophagy were measured in the larvae. Our results demonstrate that exposure to TDCIPP (500 μg/l) and CPF causes developmental toxicity, including reduced hatching and survival rates and increased malformation rate (e.g., spinal curvature), as well as altered locomotor behavior. The expression of selected neurodevelopmental gene and protein markers (e.g., mbp, syn2a, and α1-tubulin) was significantly down-regulated in CPF and TDCIPP exposed zebrafish larvae. Treatment with CPF significantly inhibits AChE and BChE, while TDCIPP (0-500 μg/l) exerts no effects on these enzymes. Furthermore, the conversion of microtubule-associated protein I (LC3 I) to LC3 II was significantly increased in TDCIPP exposed zebrafish larvae. In addition, exposure to TDCIPP also activates transcription of several critical genes in autophagy (e.g. Becn1, atg3, atg5, map1lc3b and sqstm1). To further investigate the role of autophagy in TDCIPP induced developmental neurotoxicity, an autophagy inducer (rapamycin, Rapa, 1 nM) and inhibitor (chloroquine, CQ, 1 μM) were used. The results demonstrate that the hatching rate, survival rate, and the expression of mbp and а1-tubulin proteins were all significantly increased in larvae treated with TDCIPP (500 μg/l) and Rapa compared to TDCIPP alone. In contrast, co-treatment with the autophagy inhibitor CQ results in exacerbated neurodevelopmental toxicity. Taken together, our results confirm that exposure to TDCIPP induces autophagy, which plays a protective role in TDCIPP-induced developmental neurotoxicity in zebrafish embryos and larvae. Copyright © 2018. Published by Elsevier B.V.

Remodeling of the postsynaptic plasma membrane during neural development.

PubMed

Tulodziecka, Karolina; Diaz-Rohrer, Barbara B; Farley, Madeline M; Chan, Robin B; Di Paolo, Gilbert; Levental, Kandice R; Waxham, M Neal; Levental, Ilya

2016-11-07

Neuronal synapses are the fundamental units of neural signal transduction and must maintain exquisite signal fidelity while also accommodating the plasticity that underlies learning and development. To achieve these goals, the molecular composition and spatial organization of synaptic terminals must be tightly regulated; however, little is known about the regulation of lipid composition and organization in synaptic membranes. Here we quantify the comprehensive lipidome of rat synaptic membranes during postnatal development and observe dramatic developmental lipidomic remodeling during the first 60 postnatal days, including progressive accumulation of cholesterol, plasmalogens, and sphingolipids. Further analysis of membranes associated with isolated postsynaptic densities (PSDs) suggests the PSD-associated postsynaptic plasma membrane (PSD-PM) as one specific location of synaptic remodeling. We analyze the biophysical consequences of developmental remodeling in reconstituted synaptic membranes and observe remarkably stable microdomains, with the stability of domains increasing with developmental age. We rationalize the developmental accumulation of microdomain-forming lipids in synapses by proposing a mechanism by which palmitoylation of the immobilized scaffold protein PSD-95 nucleates domains at the postsynaptic plasma membrane. These results reveal developmental changes in lipid composition and palmitoylation that facilitate the formation of postsynaptic membrane microdomains, which may serve key roles in the function of the neuronal synapse. © 2016 Tulodziecka et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Pre-mRNA Splicing in Plants: In Vivo Functions of RNA-Binding Proteins Implicated in the Splicing Process

PubMed Central

Meyer, Katja; Koester, Tino; Staiger, Dorothee

2015-01-01

Alternative pre-messenger RNA splicing in higher plants emerges as an important layer of regulation upon exposure to exogenous and endogenous cues. Accordingly, mutants defective in RNA-binding proteins predicted to function in the splicing process show severe phenotypic alterations. Among those are developmental defects, impaired responses to pathogen threat or abiotic stress factors, and misregulation of the circadian timing system. A suite of splicing factors has been identified in the model plant Arabidopsis thaliana. Here we summarize recent insights on how defects in these splicing factors impair plant performance. PMID:26213982

Comparative proteomic analysis of developing rhizomes of the ancient vascular plant Equisetum hyemale and different monocot species.

PubMed

Salvato, Fernanda; Balbuena, Tiago S; Nelson, William; Rao, R Shyama Prasad; He, Ruifeng; Soderlund, Carol A; Gang, David R; Thelen, Jay J

2015-04-03

The rhizome is responsible for the invasiveness and competitiveness of many plants with great economic and agricultural impact worldwide. Besides its value as an invasive organ, the rhizome plays a role in the establishment and massive growth of forage, providing biomass for biofuel production. Despite these features, little is known about the molecular mechanisms that contribute to rhizome growth, development, and function in plants. In this work, we characterized the proteome of rhizome apical tips and elongation zones from different species using a GeLC-MS/MS (one-dimensional electrophoresis in combination with liquid chromatography coupled online with tandem mass spectrometry) spectral-counting proteomics strategy. Five rhizomatous grasses and an ancient species were compared to study the protein regulation in rhizomes. An average of 2200 rhizome proteins per species were confidently identified and quantified. Rhizome-characteristic proteins showed similar functional distributions across all species analyzed. The over-representation of proteins associated with central roles in cellular, metabolic, and developmental processes indicated accelerated metabolism in growing rhizomes. Moreover, 61 rhizome-characteristic proteins appeared to be regulated similarly among analyzed plants. In addition, 36 showed conserved regulation between rhizome apical tips and elongation zones across species. These proteins were preferentially expressed in rhizome tissues regardless of the species analyzed, making them interesting candidates for more detailed investigative studies about their roles in rhizome development.

Tunable Protein Stabilization In Vivo Mediated by Shield-1 in Transgenic Medaka

PubMed Central

Froschauer, Alexander; Kube, Lisa; Kegler, Alexandra; Rieger, Christiane; Gutzeit, Herwig O.

2015-01-01

Techniques for conditional gene or protein expression are important tools in developmental biology and in the analysis of physiology and disease. On the protein level, the tunable and reversible expression of proteins can be achieved by the fusion of the protein of interest to a destabilizing domain (DD). In the absence of its specific ligand (Shield-1), the protein is degraded by the proteasome. The DD-Shield system has proven to be an excellent tool to regulate the expression of proteins of interests in mammalian systems but has not been applied in teleosts like the medaka. We present the application of the DD-Shield technique in transgenic medaka and show the ubiquitous conditional expression throughout life. Shield-1 administration to the water leads to concentration-dependent induction of a YFP reporter gene in various organs and in spermatogonia at the cellular level. PMID:26148066

The Role of TSC Proteins in Regulating Cell Adhesion and Motility

DTIC Science & Technology

2006-09-01

Pennsylvania Philadelphia, Pennsylvania 19104-6270 9 . SPONSORING...from seizures, mental retardation, and autism . Thus, TSC represents a major cause of developmental disorders and epilepsy in the pediatric...images are from 138 microinjected cells 2. 0 20 40 60 80 100 * * GF P C el l m ig ra tio n, % Pɘ.001 TS C2 TS C2 -C TS C2 -N Figure 9 . N-terminal

MeHG Stimulates Antiapoptotic Signaling in Stem Cells

DTIC Science & Technology

2010-07-01

Soane, L., Siegel, Z. T., Schuh, R. A. & Fiskum, G. (2008). Postnatal developmental regulation of Bcl - 2 family proteins in brain mitochondria. J...resulting in neutralization of the anti-apoptotic members Bcl -xL and Bcl - 2 [26]. In neurons, the absence or inhibition of p53 activity protects...Tiwari M and Godbole MM (2003) Hypothyroidism alters the expression of Bcl - 2 family genes to induce enhanced apoptosis in the developing

Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

PubMed

Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

2016-02-01

Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

The expression of the cerato-platanin gene is related to hyphal growth and chlamydospores formation in Ceratocystis platani.

PubMed

Baccelli, Ivan; Comparini, Cecilia; Bettini, Priscilla P; Martellini, Federica; Ruocco, Michelina; Pazzagli, Luigia; Bernardi, Rodolfo; Scala, Aniello

2012-02-01

Cerato-platanin (CP) is a protein produced by Ceratocystis platani, the causal agent of canker stain disease of plane trees. CP is the first member of the 'cerato-platanin family', and its role as a pathogen-associated molecular pattern (PAMP), inducing defence responses both in host and nonhost plants, is established. However, the primary role of CP and its homologues in the fungal life remains unknown. In the present work, we investigated the regulation of the cp gene during the in vitro growth of C. platani in different conditions and under the effect of potential stress factors. Fungal growth and conidiogenesis were also analysed. Results showed that cp is a single-copy gene whose expression level is strictly associated with hyphal growth and with chlamydospores formation. The analysis of a 1368 bp 5'-flanking region revealed putative motifs that could be involved in the regulation of gene expression in response to stress and developmental cues. Taking into account the localization of CP in the fungal cell wall and the recently published 3D structure of the protein, our results support a role for CP in growth and developmental processes of C. platani. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Developmentally regulated, alternative splicing of the Rpn10 gene generates multiple forms of 26S proteasomes

PubMed Central

Kawahara, Hiroyuki; Kasahara, Masanori; Nishiyama, Atsuya; Ohsumi, Keita; Goto, Tetsuya; Kishimoto, Takeo; Saeki, Yasushi; Yokosawa, Hideyoshi; Shimbara, Naoki; Murata, Shigeo; Chiba, Tomoki; Suzuki, Koichi; Tanaka, Keiji

2000-01-01

The 26S proteasome is a multisubunit protein- destroying machinery that degrades ubiquitin-tagged proteins. To date only a single species of Rpn10, which possibly functions as a multiubiquitin chain-binding subunit, has been identified in various organisms. Here we report that mouse Rpn10 mRNAs occur in at least five distinct forms, named Rpn10a to Rpn10e, and that they are generated from a single gene by developmentally regulated, alternative splicing. Rpn10a is ubiquitously expressed, whereas Rpn10e is expressed only in embryos, with the highest levels of expression in the brain. Both forms of Rpn10 are components of the 26S proteasome, with an apparently similar affinity for multiubiquitylated [125I]lysozyme in vitro. However, they exert markedly divergent effects on the destruction of B-type cyclin in Xenopus egg extracts. Thus, the 26S proteasome occurs in at least two functionally distinct forms: one containing a ubiquitously expressed Rpn10a and the other a newly identified, embryo-specific Rpn10e. While the former is thought to perform proteolysis constitutively in a wide variety of cells, the latter may play a specialized role in early embryonic development. PMID:10921894

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

The unique structural and biochemical development of single cell C4 photosynthesis along longitudinal leaf gradients in Bienertia sinuspersici and Suaeda aralocaspica (Chenopodiaceae)

PubMed Central

Koteyeva, Nuria K.; Voznesenskaya, Elena V.; Berry, James O.; Cousins, Asaph B.; Edwards, Gerald E.

2016-01-01

Temporal and spatial patterns of photosynthetic enzyme expression and structural maturation of chlorenchyma cells along longitudinal developmental gradients were characterized in young leaves of two single cell C4 species, Bienertia sinuspersici and Suaeda aralocaspica. Both species partition photosynthetic functions between distinct intracellular domains. In the C4-C domain, C4 acids are formed in the C4 cycle during capture of atmospheric CO2 by phosphoenolpyruvate carboxylase. In the C4-D domain, CO2 released in the C4 cycle via mitochondrial NAD-malic enzyme is refixed by Rubisco. Despite striking differences in origin and intracellular positioning of domains, these species show strong convergence in C4 developmental patterns. Both progress through a gradual developmental transition towards full C4 photosynthesis, with an associated increase in levels of photosynthetic enzymes. Analysis of longitudinal sections showed undeveloped domains at the leaf base, with Rubisco rbcL mRNA and protein contained within all chloroplasts. The two domains were first distinguishable in chlorenchyma cells at the leaf mid-regions, but still contained structurally similar chloroplasts with equivalent amounts of rbcL mRNA and protein; while mitochondria had become confined to just one domain (proto-C4-D). The C4 state was fully formed towards the leaf tips, Rubisco transcripts and protein were compartmentalized specifically to structurally distinct chloroplasts in the C4-D domains indicating selective regulation of Rubisco expression may occur by control of transcription or stability of rbcL mRNA. Determination of CO2 compensation points showed young leaves were not functionally C4, consistent with cytological observations of the developmental progression from C3 default to intermediate to C4 photosynthesis. PMID:26957565

Efficient ASK-assisted system for expression and purification of plant F-box proteins.

PubMed

Li, Haiou; Yao, Ruifeng; Ma, Sui; Hu, Shuai; Li, Suhua; Wang, Yupei; Yan, Chun; Xie, Daoxin; Yan, Jianbin

2017-11-01

Ubiquitin-mediated protein degradation plays an essential role in plant growth and development as well as responses to environmental and endogenous signals. F-box protein is one of the key components of the SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex, which recruit specific substrate proteins for subsequent ubiquitination and 26S proteasome-mediated degradation to regulate developmental processes and signaling networks. However, it is not easy to obtain purified F-box proteins with high activity due to their unstable protein structures. Here, we found that Arabidopsis SKP-like proteins (ASKs) can significantly improve soluble expression of F-box proteins and maintain their bioactivity. We established an efficient ASK-assisted method to express and purify plant F-box proteins. The method meets a broad range of criteria required for the biochemical analysis or protein crystallization of plant F-box proteins. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Surviving an Identity Crisis: A Revised View of Chromatin Insulators in the Genomics Era

PubMed Central

Matzat, Leah H.; Lei, Elissa P.

2013-01-01

The control of complex, developmentally regulated loci and partitioning of the genome into active and silent domains is in part accomplished through the activity of DNA-protein complexes termed chromatin insulators. Together, the multiple, well-studied classes of insulators in Drosophila melanogaster appear to be generally functionally conserved. In this review, we discuss recent genomic-scale experiments and attempt to reconcile these newer findings in the context of previously defined insulator characteristics based on classical genetic analyses and transgenic approaches. Finally, we discuss the emerging understanding of mechanisms of chromatin insulator regulation. PMID:24189492

Polypyrimidine Tract Binding Protein Homologs from Arabidopsis Are Key Regulators of Alternative Splicing with Implications in Fundamental Developmental Processes[W

PubMed Central

Rühl, Christina; Stauffer, Eva; Kahles, André; Wagner, Gabriele; Drechsel, Gabriele; Rätsch, Gunnar; Wachter, Andreas

2012-01-01

Alternative splicing (AS) generates transcript variants by variable exon/intron definition and massively expands transcriptome diversity. Changes in AS patterns have been found to be linked to manifold biological processes, yet fundamental aspects, such as the regulation of AS and its functional implications, largely remain to be addressed. In this work, widespread AS regulation by Arabidopsis thaliana Polypyrimidine tract binding protein homologs (PTBs) was revealed. In total, 452 AS events derived from 307 distinct genes were found to be responsive to the levels of the splicing factors PTB1 and PTB2, which predominantly triggered splicing of regulated introns, inclusion of cassette exons, and usage of upstream 5′ splice sites. By contrast, no major AS regulatory function of the distantly related PTB3 was found. Dependent on their position within the mRNA, PTB-regulated events can both modify the untranslated regions and give rise to alternative protein products. We find that PTB-mediated AS events are connected to diverse biological processes, and the functional implications of selected instances were further elucidated. Specifically, PTB misexpression changes AS of PHYTOCHROME INTERACTING FACTOR6, coinciding with altered rates of abscisic acid–dependent seed germination. Furthermore, AS patterns as well as the expression of key flowering regulators were massively changed in a PTB1/2 level-dependent manner. PMID:23192226

Rgs1 regulates multiple Gα subunits in Magnaporthe pathogenesis, asexual growth and thigmotropism

PubMed Central

Liu, Hao; Suresh, Angayarkanni; Willard, Francis S; Siderovski, David P; Lu, Shen; Naqvi, Naweed I

2007-01-01

Regulators of G-protein signaling (RGS proteins) negatively regulate heterotrimeric G-protein cascades that enable eukaryotic cells to perceive and respond to external stimuli. The rice-blast fungus Magnaporthe grisea forms specialized infection structures called appressoria in response to inductive surface cues. We isolated Magnaporthe RGS1 in a screen for mutants that form precocious appressoria on non-inductive surfaces. We report that a thigmotropic cue is necessary for initiating appressoria and for accumulating cAMP. Similar to an RGS1-deletion strain, magAG187S (RGS-insensitive Gαs) and magAQ208L (GTPase-dead) mutants accumulated excessive cAMP and elaborated appressoria on non-inductive surfaces, suggesting that Rgs1 regulates MagA during pathogenesis. Rgs1 was also found to negatively regulate the Gαi subunit MagB during asexual development. Deficiency of MAGB suppressed the hyper-conidiation defect in RGS1-deletion strain, whereas magBG183S and magBQ204L mutants produced more conidia, similar to the RGS1-deletion strain. Rgs1 physically interacted with GDP·AlF4−-activated forms of MagA, MagB and MagC (a GαII subunit). Thus, Rgs1 serves as a negative regulator of all Gα subunits in Magnaporthe and controls important developmental events during asexual and pathogenic development. PMID:17255942

Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/β-catenin signaling

PubMed Central

Amen, Melanie; Espinoza, Herbert M.; Cox, Carol; Liang, Xiaowen; Wang, Jianbo; Link, Todd M. E.; Brennan, Richard G.; Martin, James F.; Amendt, Brad A.

2008-01-01

Homeodomain (HD) transcriptional activities are tightly regulated during embryogenesis and require protein interactions for their spatial and temporal activation. The chromatin-associated high mobility group protein (HMG-17) is associated with transcriptionally active chromatin, however its role in regulating gene expression is unclear. This report reveals a unique strategy in which, HMG-17 acts as a molecular switch regulating HD transcriptional activity. The switch utilizes the Wnt/β-catenin signaling pathway and adds to the diverse functions of β-catenin. A high-affinity HMG-17 interaction with the PITX2 HD protein inhibits PITX2 DNA-binding activity. The HMG-17/PITX2 inactive complex is concentrated to specific nuclear regions primed for active transcription. β-Catenin forms a ternary complex with PITX2/HMG-17 to switch it from a repressor to an activator complex. Without β-catenin, HMG-17 can physically remove PITX2 from DNA to inhibit its transcriptional activity. The PITX2/HMG-17 regulatory complex acts independently of promoter targets and is a general mechanism for the control of HD transcriptional activity. HMG-17 is developmentally regulated and its unique role during embryogenesis is revealed by the early embryonic lethality of HMG-17 homozygous mice. This mechanism provides a new role for canonical Wnt/β-catenin signaling in regulating HD transcriptional activity during development using HMG-17 as a molecular switch. PMID:18045789

Proteomic analysis reveals O-GlcNAc modification on proteins with key regulatory functions in Arabidopsis.

PubMed

Xu, Shou-Ling; Chalkley, Robert J; Maynard, Jason C; Wang, Wenfei; Ni, Weimin; Jiang, Xiaoyue; Shin, Kihye; Cheng, Ling; Savage, Dasha; Hühmer, Andreas F R; Burlingame, Alma L; Wang, Zhi-Yong

2017-02-21

Genetic studies have shown essential functions of O-linked N -acetylglucosamine (O-GlcNAc) modification in plants. However, the proteins and sites subject to this posttranslational modification are largely unknown. Here, we report a large-scale proteomic identification of O-GlcNAc-modified proteins and sites in the model plant Arabidopsis thaliana Using lectin weak affinity chromatography to enrich modified peptides, followed by mass spectrometry, we identified 971 O-GlcNAc-modified peptides belonging to 262 proteins. The modified proteins are involved in cellular regulatory processes, including transcription, translation, epigenetic gene regulation, and signal transduction. Many proteins have functions in developmental and physiological processes specific to plants, such as hormone responses and flower development. Mass spectrometric analysis of phosphopeptides from the same samples showed that a large number of peptides could be modified by either O-GlcNAcylation or phosphorylation, but cooccurrence of the two modifications in the same peptide molecule was rare. Our study generates a snapshot of the O-GlcNAc modification landscape in plants, indicating functions in many cellular regulation pathways and providing a powerful resource for further dissecting these functions at the molecular level.

Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

PubMed

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

PubMed Central

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

Non-invasive fluorescent imaging of gliosis in transgenic mice for profiling developmental neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Gideon; Zhang Chunyan; Zhuo Lang

2007-05-15

Gliosis is a universal response of Brain to almost all types of neural insults, including neurotoxicity, neurodegeneration, viral infection, and stroke. A hallmark of gliotic reaction is the up-regulation of the astrocytic biomarker GFAP (glial fibrillary acidic protein), which often precedes the anatomically apparent damages in Brain. In this study, neonatal transgenic mice at postnatal day (PD) 4 expressing GFP (green fluorescent protein) under the control of a widely used 2.2-kb human GFAP promoter in Brain are treated with two model neurotoxicants, 1-methyl-4(2'-methylphenyl)-1,2,3,6-tetrahydropyridine (2'-CH{sub 3}-MPTP), and kainic acid (KA), respectively, to induce gliosis. Here we show that the neurotoxicant-induced acutemore » gliosis can be non-invasively imaged and quantified in Brain of conscious (un-anesthetized) mice in real-time, at 0, 2, 4, 6, and 8 h post-toxicant dosing. Therefore the current methodology could be a useful tool for studying the developmental aspects of neuropathies and neurotoxicity.« less

AMP-Activated Protein Kinase as a Reprogramming Strategy for Hypertension and Kidney Disease of Developmental Origin.

PubMed

Tain, You-Lin; Hsu, Chien-Ning

2018-06-12

Suboptimal early-life conditions affect the developing kidney, resulting in long-term programming effects, namely renal programming. Adverse renal programming increases the risk for developing hypertension and kidney disease in adulthood. Conversely, reprogramming is a strategy aimed at reversing the programming processes in early life. AMP-activated protein kinase (AMPK) plays a key role in normal renal physiology and the pathogenesis of hypertension and kidney disease. This review discusses the regulation of AMPK in the kidney and provides hypothetical mechanisms linking AMPK to renal programming. This will be followed by studies targeting AMPK activators like metformin, resveratrol, thiazolidinediones, and polyphenols as reprogramming strategies to prevent hypertension and kidney disease. Further studies that broaden our understanding of AMPK isoform- and tissue-specific effects on renal programming are needed to ultimately develop reprogramming strategies. Despite the fact that animal models have provided interesting results with regard to reprogramming strategies targeting AMPK signaling to protect against hypertension and kidney disease with developmental origins, these results await further clinical translation.

AHCYL1 Is Mediated by Estrogen-Induced ERK1/2 MAPK Cell Signaling and MicroRNA Regulation to Effect Functional Aspects of the Avian Oviduct

PubMed Central

Ahn, Suzie E.; Lee, Sang In; Bazer, Fuller W.; Han, Jae Yong; Song, Gwonhwa

2012-01-01

S-adenosylhomocysteine hydrolase-like protein 1 (AHCYL1), also known as IP3 receptor-binding protein released with IP3 (IRBIT), regulates IP3-induced Ca2+ release into the cytoplasm of cells. AHCYL1 is a critical regulator of early developmental stages in zebrafish, but little is known about the function of AHCYL1 or hormonal regulation of expression of the AHCYL1 gene in avian species. Therefore, we investigated differential expression profiles of the AHCYL1 gene in various adult organs and in oviducts from estrogen-treated chickens. Chicken AHCYL1 encodes for a protein of 540 amino acids that is highly conserved and has considerable homology to mammalian AHCYL1 proteins (>94% identity). AHCYL1 mRNA was expressed abundantly in various organs of chickens. Further, the synthetic estrogen agonist induced AHCYL1 mRNA and protein predominantly in luminal and glandular epithelial cells of the chick oviduct. In addition, estrogen activated AHCYL1 through the ERK1/2 signal transduction cascade and that activated expression of AHCYL1 regulated genes affecting oviduct development in chicks as well as calcium release in epithelial cells of the oviduct. Also, microRNAs, miR-124a, miR-1669, miR-1710 and miR-1782 influenced AHCYL1 expression in vitro via its 3′-UTR which suggests that post-transcriptional events are involved in the regulation of AHCYL1 expression in the chick oviduct. In conclusion, these results indicate that AHCYL1 is a novel estrogen-stimulated gene expressed in epithelial cells of the chicken oviduct that likely affects growth, development and calcium metabolism of the mature oviduct of hens via an estrogen-mediated ERK1/2 MAPK cell signaling pathway. PMID:23145124

Molecular Cloning of Drebrin: Progress and Perspectives.

PubMed

Kojima, Nobuhiko

2017-01-01

Chicken drebrin isoforms were first identified in the optic tectum of developing brain. Although the time course of protein expression was different in each drebrin isoform, the similarity between their protein structures was suggested by biochemical analysis of purified protein. To determine their protein structures, the cloning of drebrin cDNAs was conducted. Comparison between the cDNA sequences shows that all drebrin cDNAs are identical except that the internal insertion sequences are present or absent in their sequences. Chicken drebrin are now classified into three isoforms, namely, drebrins E1, E2, and A. Genomic cloning demonstrated that the three isoforms are generated by an alternative splicing of individual exons encoding the insertion sequences from single drebrin gene. The mechanism should be precisely regulated in cell-type-specific and developmental stage-specific fashion. Drebrin protein, which is well conserved in various vertebrate species, although mammalian drebrin has only two isoforms, namely, drebrin E and drebrin A, is different from chicken drebrin that has three isoforms. Drebrin belongs to an actin-depolymerizing factor homology (ADF-H) domain protein family. Besides the ADF-H domain, drebrin has other domains, including the actin-binding domain and Homer-binding motifs. Diversity of protein isoform and multiple domains of drebrin could interact differentially with the actin cytoskeleton and other intracellular proteins and regulate diverse cellular processes.

Root morphogenic pathways in Eucalyptus grandis are modified by the activity of protein arginine methyltransferases.

PubMed

Plett, Krista L; Raposo, Anita E; Bullivant, Stephen; Anderson, Ian C; Piller, Sabine C; Plett, Jonathan M

2017-03-09

Methylation of proteins at arginine residues, catalysed by members of the protein arginine methyltransferase (PRMT) family, is crucial for the regulation of gene transcription and for protein function in eukaryotic organisms. Inhibition of the activity of PRMTs in annual model plants has demonstrated wide-ranging involvement of PRMTs in key plant developmental processes, however, PRMTs have not been characterised or studied in long-lived tree species. Taking advantage of the recently available genome for Eucalyptus grandis, we demonstrate that most of the major plant PRMTs are conserved in E. grandis as compared to annual plants and that they are expressed in all major plant tissues. Proteomic and transcriptomic analysis in roots suggest that the PRMTs of E. grandis control a number of regulatory proteins and genes related to signalling during cellular/root growth and morphogenesis. We demonstrate here, using chemical inhibition of methylation and transgenic approaches, that plant type I PRMTs are necessary for normal root growth and branching in E. grandis. We further show that EgPRMT1 has a key role in root hair initiation and elongation and is involved in the methylation of β-tubulin, a key protein in cytoskeleton formation. Together, our data demonstrate that PRMTs encoded by E. grandis methylate a number of key proteins and alter the transcription of a variety of genes involved in developmental processes. Appropriate levels of expression of type I PRMTs are necessary for the proper growth and development of E. grandis roots.

Cloning, characterization, and heat stress-induced redistribution of a protein homologous to human hsp27 in the zebrafish Danio rerio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mao Li; Bryantsev, Anton L.; Chechenova, Maria B.

Hsp27 is a small heat shock protein (shsp) regulating stress tolerance and increasingly thought to play roles in tissue homeostasis and differentiation. The zebrafish Danio rerio is an important model for the study of developmental processes, but little is known regarding shsps in this animal. Here, we report the sequence, expression, regulation, and function of a zebrafish protein (zfHsp27) homologous to human Hsp27. zfHsp27 contains three conserved phosphorylatable serines and a cysteine important for regulation of apoptosis, but it lacks much of a C-terminal tail domain and shows low homology in two putative actin interacting domains that are features ofmore » mammalian Hsp27. zfHsp27 mRNA is most abundant in adult skeletal muscle and heart and is upregulated during early embryogenesis. zfHsp27 expressed in mammalian fibroblasts was phosphorylated in response to heat stress and anisomycin, and this phosphorylation was prevented by treatment with SB202190, an inhibitor of p38 MAPK. Expression of zfHsp27 and human Hsp27 in mammalian fibroblasts promoted a similar degree of tolerance to heat stress. zfHsp27 fusion proteins entered the nucleus and associated with the cytoskeleton of heat stressed cells in vitro and in zebrafish embryos. These results reveal conservation in regulation and function of mammalian and teleost Hsp27 proteins and define zebrafish as a new model for the study of Hsp27 function.« less

Ribosomal protein NtRPL17 interacts with kinesin-12 family protein NtKRP and functions in the regulation of embryo/seed size and radicle growth.

PubMed

Tian, Shujuan; Wu, Jingjing; Liu, Yuan; Huang, Xiaorong; Li, Fen; Wang, Zhaodan; Sun, Meng-Xiang

2017-11-28

We previously reported that a novel motor protein belonging to the kinesin-12 family, NtKRP, displays critical roles in regulating embryo and seed size establishment. However, it remains unknown exactly how NtKRP contributes to this developmental process. Here, we report that a 60S ribosomal protein NtRPL17 directly interacts with NtKRP. The phenotypes of NtRPL17 RNAi lines show notable embryo and seed size reduction. Structural observations of the NtRPL17-silenced embryos/seeds reveal that the embryo size reduction is due to a decrease in cell number. In these embryos, cell division cycle progression is delayed at the G2/M transition. These phenotypes are similar to that in NtKRP-silenced embryos/seeds, indicating that NtKRP and NtRPL17 function as partners in the same regulatory pathway during seed development and specifically regulate cell cycle progression to control embryo/seed size. This work reveals that NtRPL17, as a widely distributed ribosomal protein, plays a critical role in seed development and provides a new clue in the regulation of seed size. Confirmation of the interaction between NtKRP and NtRPL17 and their co-function in the control of the cell cycle also suggests that the mechanism might be conserved in both plants and animals. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Evolutionary Analysis of DELLA-Associated Transcriptional Networks.

PubMed

Briones-Moreno, Asier; Hernández-García, Jorge; Vargas-Chávez, Carlos; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico; Blázquez, Miguel A

2017-01-01

DELLA proteins are transcriptional regulators present in all land plants which have been shown to modulate the activity of over 100 transcription factors in Arabidopsis, involved in multiple physiological and developmental processes. It has been proposed that DELLAs transduce environmental information to pre-wired transcriptional circuits because their stability is regulated by gibberellins (GAs), whose homeostasis largely depends on environmental signals. The ability of GAs to promote DELLA degradation coincides with the origin of vascular plants, but the presence of DELLAs in other land plants poses at least two questions: what regulatory properties have DELLAs provided to the behavior of transcriptional networks in land plants, and how has the recruitment of DELLAs by GA signaling affected this regulation. To address these issues, we have constructed gene co-expression networks of four different organisms within the green lineage with different properties regarding DELLAs: Arabidopsis thaliana and Solanum lycopersicum (both with GA-regulated DELLA proteins), Physcomitrella patens (with GA-independent DELLA proteins) and Chlamydomonas reinhardtii (a green alga without DELLA), and we have examined the relative evolution of the subnetworks containing the potential DELLA-dependent transcriptomes. Network analysis indicates a relative increase in parameters associated with the degree of interconnectivity in the DELLA-associated subnetworks of land plants, with a stronger effect in species with GA-regulated DELLA proteins. These results suggest that DELLAs may have played a role in the coordination of multiple transcriptional programs along evolution, and the function of DELLAs as regulatory 'hubs' became further consolidated after their recruitment by GA signaling in higher plants.

Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development.

PubMed

Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A

2014-09-01

The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Polycomb-group protein SlMSI1 represses the expression of fruit-ripening genes to prolong shelf life in tomato.

PubMed

Liu, Dan-Dan; Zhou, Li-Jie; Fang, Mou-Jing; Dong, Qing-Long; An, Xiu-Hong; You, Chun-Xiang; Hao, Yu-Jin

2016-08-25

Polycomb-group (PcG) protein MULTICOPY SUPPRESSOR OF IRA1 (MSI1) protein is an evolutionarily conserved developmental suppressor and plays a crucial role in regulating epigenetic modulations. However, the potential role and function of MSI1 in fleshy fruits remain unknown. In this study, SlMSI1 was cloned and transformed into tomato to explore its function. The quantitative real-time PCR results showed that SlMSI1 was highly expressed in flowers and fruits and that its transcript and protein levels were significantly decreased in fruits after the breaker stage. Additionally, SlMSI1-overexpressing transgenic tomatoes displayed abnormal non-ripening fruit formation, whereas its suppression promoted fruit ripening in transgenic tomatoes. Quantitative real-time PCR assays also showed that RIN and its regulons were decreased in SlMSI1 overexpression transgenic tomato fruits. Furthermore, RNA-seq analysis demonstrated that SlMSI1 inhibits fruit ripening by negatively regulating a large set of fruit-ripening genes in addition to RIN and its regulons. Finally, genetic manipulation of SlMSI1 and RIN successfully prolonged the fruit shelf life by regulating the fruit-ripening genes in tomato. Our findings reveal a novel regulatory function of SlMSI1 in fruit ripening and provide a new regulator that may be useful for genetic engineering and modification of fruit shelf life.

Polycomb-group protein SlMSI1 represses the expression of fruit-ripening genes to prolong shelf life in tomato

PubMed Central

Liu, Dan-Dan; Zhou, Li-Jie; Fang, Mou-Jing; Dong, Qing-Long; An, Xiu-Hong; You, Chun-Xiang; Hao, Yu-Jin

2016-01-01

Polycomb-group (PcG) protein MULTICOPY SUPPRESSOR OF IRA1 (MSI1) protein is an evolutionarily conserved developmental suppressor and plays a crucial role in regulating epigenetic modulations. However, the potential role and function of MSI1 in fleshy fruits remain unknown. In this study, SlMSI1 was cloned and transformed into tomato to explore its function. The quantitative real-time PCR results showed that SlMSI1 was highly expressed in flowers and fruits and that its transcript and protein levels were significantly decreased in fruits after the breaker stage. Additionally, SlMSI1-overexpressing transgenic tomatoes displayed abnormal non-ripening fruit formation, whereas its suppression promoted fruit ripening in transgenic tomatoes. Quantitative real-time PCR assays also showed that RIN and its regulons were decreased in SlMSI1 overexpression transgenic tomato fruits. Furthermore, RNA-seq analysis demonstrated that SlMSI1 inhibits fruit ripening by negatively regulating a large set of fruit-ripening genes in addition to RIN and its regulons. Finally, genetic manipulation of SlMSI1 and RIN successfully prolonged the fruit shelf life by regulating the fruit-ripening genes in tomato. Our findings reveal a novel regulatory function of SlMSI1 in fruit ripening and provide a new regulator that may be useful for genetic engineering and modification of fruit shelf life. PMID:27558543

Geranylgeranyl Diphosphate Synthase Modulates Fetal Lung Branching Morphogenesis Possibly through Controlling K-Ras Prenylation.

PubMed

Jia, Wen-Jun; Jiang, Shan; Tang, Qiao-Li; Shen, Di; Xue, Bin; Ning, Wen; Li, Chao-Jun

2016-06-01

G proteins play essential roles in regulating fetal lung development, and any defects in their expression or function (eg, activation or posttranslational modification) can lead to lung developmental malformation. Geranylgeranyl diphosphate synthase (GGPPS) can modulate protein prenylation that is required for protein membrane-anchoring and activation. Here, we report that GGPPS regulates fetal lung branching morphogenesis possibly through controlling K-Ras prenylation during fetal lung development. GGPPS was continuously expressed in lung epithelium throughout whole fetal lung development. Specific deletion of geranylgeranyl diphosphate synthase 1 (Ggps1) in lung epithelium during fetal lung development resulted in neonatal respiratory distress syndrome-like disease. The knockout mice died at postnatal day 1 of respiratory failure, and the lungs showed compensatory pneumonectasis, pulmonary atelectasis, and hyaline membranes. Subsequently, we proved that lung malformations in Ggps1-deficient mice resulted from the failure of fetal lung branching morphogenesis. Further investigation revealed Ggps1 deletion blocked K-Ras geranylgeranylation and extracellular signal-related kinase 1 or 2/mitogen-activated protein kinase signaling, which in turn disturbed fibroblast growth factor 10 regulation on fetal lung branching morphogenesis. Collectively, our data suggest that GGPPS is essential for maintaining fetal lung branching morphogenesis, which is possibly through regulating K-Ras prenylation. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Analysis of Autoregulation at the Level of Pre-mRNA Splicing of the Suppressor-of-White-Apricot Gene in Drosophila

PubMed Central

Zachar, Z.; Chou, T. B.; Kramer, J.; Mims, I. P.; Bingham, P. M.

1994-01-01

The Drosophila suppressor-of-white-apricot [su(w(a))] protein regulates/modulates at least two somatic RNA processing events. It is a potent regulator of its own expression. We report here new studies of this autoregulatory circuit. Among other things, our studies show the following. First, new evidence that su(w(a)) expression is autoregulated at the level of pre-mRNA splicing is reported. su(w(a)) protein represses accumulation of the fully spliced su(w(a)) mRNA encoding it and promotes accumulation of high levels of incompletely spliced su(w(a)) pre-mRNA. Second, the fully spliced su(w(a)) mRNA is sufficient for all known su(w(a)) genetic functions indicating that it encodes the sole su(w(a)) protein. Third, the incompletely spliced su(w(a)) pre-mRNAs resulting from autoregulation are not translated (probably as a result of nuclear retention) and apparently represent nonfunctional by-products. Fourth, the special circumstances of su(w(a)) expression during oogenesis allows maternal deposition exclusively of fully spliced su(w(a)) mRNA. Fifth, su(w(a)) protein immunolocalizes to nuclei consistent with its being a direct regulator of pre-mRNA processing. We discuss the implications of our results for mechanisms of splicing regulation and for developmental control of su(w(a)) expression. PMID:8056305

Expression of the Hsp23 chaperone during Drosophila embryogenesis: association to distinct neural and glial lineages

PubMed Central

Michaud, Sébastien; Tanguay, Robert M

2003-01-01

Background In addition to their strong induction following stress, small heat shock proteins (Hsp) are also expressed during development in a wide variety of organisms. However, the precise identity of cell(s) expressing these proteins and the functional contribution of small heat shock proteins in such developmental context remain to be determined. The present study provides a detailed description of the Drosophila small heat shock protein Hsp23 expression pattern during embryogenesis and evaluates its functional contribution to central nervous system development. Results Throughout embryogenesis, Hsp23 is expressed in a stage-specific manner by a restricted number of neuronal and glial lineages of the central nervous system. Hsp23 is also detected in the amnioserosa and within a single lateral chordotonal organ. Its expression within the MP2 lineage does not require the presence of a functional midline nor the activity of the Notch signaling pathway. Transactivation assays demonstrate that transcription factors implicated in the differentiation of the midline also regulate hsp23 promoter activity. Phenotypic analysis of a transgenic line exhibiting loss of Hsp23 expression in the central nervous system suggests that Hsp23 is not required for development and function of this tissue. Likewise, its overexpression does not cause deleterious effects, as development remains unaffected. Conclusions Based on the presented data, we suggest that the tightly regulated developmental expression of Hsp23 is not actively involved in cell differentiation and central nervous system development per se but rather reflects a putative role in preventive "pre-stress" neuroprotection or in non-vital process(es) common to the identified cell lineages. PMID:14617383

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of Lmo1 as part of a Hox-dependent regulatory network for hindbrain patterning.

PubMed

Matis, Christelle; Oury, Franck; Remacle, Sophie; Lampe, Xavier; Gofflot, Françoise; Picard, Jacques J; Rijli, Filippo M; Rezsohazy, René

2007-09-01

The embryonic functions of Hox proteins have been extensively investigated in several animal phyla. These transcription factors act as selectors of developmental programmes, to govern the morphogenesis of multiple structures and organs. However, despite the variety of morphogenetic processes Hox proteins are involved in, only a limited set of their target genes has been identified so far. To find additional targets, we used a strategy based upon the simultaneous overexpression of Hoxa2 and its cofactors Pbx1 and Prep in a cellular model. Among genes whose expression was upregulated, we identified LMO1, which codes for an intertwining LIM-only factor involved in protein-DNA oligomeric complexes. By analysing its expression in Hox knockout mice, we show that Lmo1 is differentially regulated by Hoxa2 and Hoxb2, in specific columns of hindbrain neuronal progenitors. These results suggest that Lmo1 takes part in a Hox paralogue 2-dependent network regulating anteroposterior and dorsoventral hindbrain patterning. (c) 2007 Wiley-Liss, Inc.

Sir-two-homolog 2 (Sirt2) modulates peripheral myelination through polarity protein Par-3/atypical protein kinase C (aPKC) signaling.

PubMed

Beirowski, Bogdan; Gustin, Jason; Armour, Sean M; Yamamoto, Hiroyasu; Viader, Andreu; North, Brian J; Michán, Shaday; Baloh, Robert H; Golden, Judy P; Schmidt, Robert E; Sinclair, David A; Auwerx, Johan; Milbrandt, Jeffrey

2011-10-25

The formation of myelin by Schwann cells (SCs) occurs via a series of orchestrated molecular events. We previously used global expression profiling to examine peripheral nerve myelination and identified the NAD(+)-dependent deacetylase Sir-two-homolog 2 (Sirt2) as a protein likely to be involved in myelination. Here, we show that Sirt2 expression in SCs is correlated with that of structural myelin components during both developmental myelination and remyelination after nerve injury. Transgenic mice lacking or overexpressing Sirt2 specifically in SCs show delays in myelin formation. In SCs, we found that Sirt2 deacetylates Par-3, a master regulator of cell polarity. The deacetylation of Par-3 by Sirt2 decreases the activity of the polarity complex signaling component aPKC, thereby regulating myelin formation. These results demonstrate that Sirt2 controls an essential polarity pathway in SCs during myelin assembly and provide insights into the association between intracellular metabolism and SC plasticity.

Gas1 extends the range of Hedgehog action by facilitating its signaling

PubMed Central

Martinelli, David C.; Fan, Chen-Ming

2007-01-01

Cellular signaling initiated by Hedgehog binding to Patched1 has profound importance in mammalian embryogenesis, genetic disease, and cancer. Hedgehog acts as a morphogen to specify distinctive cell fates using different concentration thresholds, but our knowledge of how the concentration gradient is interpreted into the activity gradient is incomplete. The membrane protein Growth Arrest-Specific Gene 1 (GAS1) was thought to be a negative regulator of the Hedgehog concentration gradient. Here, we report unexpected genetic evidence that Gas1 positively regulates Hedgehog signaling in multiple developmental contexts, an effect particularly noticeable at regions where Hedgehog acts at low concentration. Using a combination of in vitro cell culture and in ovo electroporation assays, we demonstrate that GAS1 acts cooperatively with Patched1 for Hedgehog binding and enhances signaling activity in a cell-autonomous manner. Our data support a model in which GAS1 helps transform the Hedgehog protein gradient into the observed activity gradient. We propose that Gas1 is an evolutionarily novel, vertebrate-specific Hedgehog pathway regulator. PMID:17504940

Grappling with the HOX network in hematopoiesis and leukemia.

PubMed

McGonigle, Glenda J; Lappin, Terence R J; Thompson, Alexander

2008-05-01

The mammalian HOX gene network encodes a family of proteins which act as master regulators of developmental processes such as embryogenesis and hematopoiesis. The complex arrangement, regulation and co-factor association of HOX has been an area of intense research, particularly in cancer biology, for over a decade. The concept of redeployment of embryonic regulators in the neoplastic arena has received support from many quarters. Observations of altered HOX gene expression in various solid tumours and leukemia appear to support the thesis that 'oncology recapitulates ontogeny' but the identification of critical HOX subsets and their functional role in cancer onset and maintenance requires further investigation. The application of novel techniques and model systems will continue to enhance our understanding of the HOX network in the years to come. Better understanding of the intricacy of the complex as well as identification of functional pathways and direct targets of the encoded proteins will permit harnessing of this family of genes for clinical application.

humpty dumpty is required for developmental DNA amplification and cell proliferation in Drosophila.

PubMed

Bandura, Jennifer L; Beall, Eileen L; Bell, Maren; Silver, Hannah R; Botchan, Michael R; Calvi, Brian R

2005-04-26

The full complement of proteins required for the proper regulation of genome duplication are yet to be described. We employ a genetic DNA-replication model system based on developmental amplification of Drosophila eggshell (chorion) genes [1]. Hypomorphic mutations in essential DNA replication genes result in a distinct thin-eggshell phenotype owing to reduced amplification [2]. Here, we molecularly identify the gene, which we have named humpty dumpty (hd), corresponding to the thin-eggshell mutant fs(3)272-9 [3]. We confirm that hd is essential for DNA amplification in the ovary and show that it also is required for cell proliferation during development. Mosaic analysis of hd mutant cells during development and RNAi in Kc cells reveal that depletion of Hd protein results in severe defects in genomic replication and DNA damage. Most Hd protein is found in nuclear foci, and some may traverse the nuclear envelope. Consistent with a role in DNA replication, expression of Hd protein peaks during late G1 and S phase, and it responds to the E2F1/Dp transcription factor. Hd protein sequence is conserved from plants to humans, and published microarrays indicate that expression of its putative human ortholog also peaks at G1/S [4]. Our data suggest that hd defines a new gene family likely required for cell proliferation in all multicellular eukaryotes.

PreImplantation factor (PIF*) promotes embryotrophic and neuroprotective decidual genes: effect negated by epidermal growth factor.

PubMed

Duzyj, Christina M; Paidas, Michael J; Jebailey, Lellean; Huang, Jing Shun; Barnea, Eytan R

2014-01-01

Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF's embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. PIF's effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer's and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases-autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development and hormone signaling, while downregulating genes protecting against xenobiotic response leading to connective tissue disorders. In both HESC and FTDC, PIF affects neural development and transmission pathways. In HESC interactome, PIF promotes FUS gene, which controls genome integrity, while in FTDC, PIF upregulates STAT3 critical transcription signal. EGF abolished PIF's effect on HESC, decreasing metalloproteinase and prolactin receptor genes, thereby interfering with decidualization, while in FTDC, EGF co-cultured with PIF reduced ZHX2, gene that regulates neural AFP secretion. PIF promotes decidual trophic genes and proteins to regulate neural development. By regulating the uterine milieu, PIF may decrease embryo vulnerability to post-natal neurodevelopmental disorders. Examination of PIF-based intervention strategies used during embryogenesis to improve pregnancy prognosis and reduce post-natal vulnerability is clearly in order.

PreImplantation factor (PIF*) promotes embryotrophic and neuroprotective decidual genes: effect negated by epidermal growth factor

PubMed Central

2014-01-01

Background Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF’s embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. Methods PIF’s effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. Results In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer’s and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases—autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development and hormone signaling, while downregulating genes protecting against xenobiotic response leading to connective tissue disorders. In both HESC and FTDC, PIF affects neural development and transmission pathways. In HESC interactome, PIF promotes FUS gene, which controls genome integrity, while in FTDC, PIF upregulates STAT3 critical transcription signal. EGF abolished PIF’s effect on HESC, decreasing metalloproteinase and prolactin receptor genes, thereby interfering with decidualization, while in FTDC, EGF co-cultured with PIF reduced ZHX2, gene that regulates neural AFP secretion. Conclusions PIF promotes decidual trophic genes and proteins to regulate neural development. By regulating the uterine milieu, PIF may decrease embryo vulnerability to post-natal neurodevelopmental disorders. Examination of PIF-based intervention strategies used during embryogenesis to improve pregnancy prognosis and reduce post-natal vulnerability is clearly in order. PMID:26085845

RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells.

PubMed

Pandolfini, Luca; Luzi, Ettore; Bressan, Dario; Ucciferri, Nadia; Bertacchi, Michele; Brandi, Rossella; Rocchiccioli, Silvia; D'Onofrio, Mara; Cremisi, Federico

2016-05-06

Embryonic stem cells are intrinsically unstable and differentiate spontaneously if they are not shielded from external stimuli. Although the nature of such instability is still controversial, growing evidence suggests that protein translation control may play a crucial role. We performed an integrated analysis of RNA and proteins at the transition between naïve embryonic stem cells and cells primed to differentiate. During this transition, mRNAs coding for chromatin regulators are specifically released from translational inhibition mediated by RNA-induced silencing complex (RISC). This suggests that, prior to differentiation, the propensity of embryonic stem cells to change their epigenetic status is hampered by RNA interference. The expression of these chromatin regulators is reinstated following acute inactivation of RISC and it correlates with loss of stemness markers and activation of early cell differentiation markers in treated embryonic stem cells. We propose that RISC-mediated inhibition of specific sets of chromatin regulators is a primary mechanism for preserving embryonic stem cell pluripotency while inhibiting the onset of embryonic developmental programs.

Profiling the transcriptome of Gracilaria changii (Rhodophyta) in response to light deprivation.

PubMed

Ho, Chai-Ling; Teoh, Seddon; Teo, Swee-Sen; Rahim, Raha Abdul; Phang, Siew-Moi

2009-01-01

Light regulates photosynthesis, growth and reproduction, yield and properties of phycocolloids, and starch contents in seaweeds. Despite its importance as an environmental cue that regulates many developmental, physiological, and biochemical processes, the network of genes involved during light deprivation are obscure. In this study, we profiled the transcriptome of Gracilaria changii at two different irradiance levels using a cDNA microarray containing more than 3,000 cDNA probes. Microarray analysis revealed that 93 and 105 genes were up- and down-regulated more than 3-fold under light deprivation, respectively. However, only 50% of the transcripts have significant matches to the nonredundant peptide sequences in the database. The transcripts that accumulated under light deprivation include vanadium chloroperoxidase, thioredoxin, ferredoxin component, and reduced nicotinamide adenine dinucleotide dehydrogenase. Among the genes that were down-regulated under light deprivation were genes encoding light harvesting protein, light harvesting complex I, phycobilisome 7.8 kDa linker polypeptide, low molecular weight early light-inducible protein, and vanadium bromoperoxidase. Our findings also provided important clues to the functions of many unknown sequences that could not be annotated using sequence comparison.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

TOO MANY MOUTHS promotes cell fate progression in stomatal development of Arabidopsis stems.

PubMed

Bhave, Neela S; Veley, Kira M; Nadeau, Jeanette A; Lucas, Jessica R; Bhave, Sanjay L; Sack, Fred D

2009-01-01

Mutations in TOO MANY MOUTHS (TMM), which encodes a receptor-like protein, cause stomatal patterning defects in Arabidopsis leaves but eliminate stomatal formation in stems. Stomatal development in wild-type and tmm stems was analyzed to define TMM function. Epidermal cells in young tmm stems underwent many asymmetric divisions characteristic of entry into the stomatal pathway. The resulting precursor cells, meristemoids, appropriately expressed cell fate markers such as pTMM:GFP. However, instead of progressing developmentally by forming a guard mother cell, the meristemoids arrested, dedifferentiated, and enlarged. Thus asymmetric divisions are necessary but not sufficient for stomatal formation in stems, and TMM promotes the fate and developmental progression of early precursor cells. Comparable developmental and mature stomatal phenotypes were also found in tmm hypocotyls and in the proximal flower stalk. TMM is also a positive regulator of meristemoid division in leaves suggesting that TMM generally promotes meristemoid activity. Our results are consistent with a model in which TMM interacts with other proteins to modulate precursor cell fate and progression in an organ and domain-specific manner. Finally, the consistent presence of a small number of dedifferentiated meristemoids in mature wild-type stems suggests that precursor cell arrest is a normal feature of Arabidopsis stem development.

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

PubMed

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome Analysis Identified a Novel Mutation in the RBP4 Gene in a Consanguineous Pedigree with Retinal Dystrophy and Developmental Abnormalities

PubMed Central

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V.; Chavali, Venkata R. M.; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G. Bhanuprakash; Sieving, Paul A.; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism. PMID:23189188

Class IA phosphoinositide 3-kinase regulates heart size and physiological cardiac hypertrophy.

PubMed

Luo, Ji; McMullen, Julie R; Sobkiw, Cassandra L; Zhang, Li; Dorfman, Adam L; Sherwood, Megan C; Logsdon, M Nicole; Horner, James W; DePinho, Ronald A; Izumo, Seigo; Cantley, Lewis C

2005-11-01

Class I(A) phosphoinositide 3-kinases (PI3Ks) are activated by growth factor receptors, and they regulate, among other processes, cell growth and organ size. Studies using transgenic mice overexpressing constitutively active and dominant negative forms of the p110alpha catalytic subunit of class I(A) PI3K have implicated the role of this enzyme in regulating heart size and physiological cardiac hypertrophy. To further understand the role of class I(A) PI3K in controlling heart growth and to circumvent potential complications from the overexpression of dominant negative and constitutively active proteins, we generated mice with muscle-specific deletion of the p85alpha regulatory subunit and germ line deletion of the p85beta regulatory subunit of class I(A) PI3K. Here we show that mice with cardiac deletion of both p85 subunits exhibit attenuated Akt signaling in the heart, reduced heart size, and altered cardiac gene expression. Furthermore, exercise-induced cardiac hypertrophy is also attenuated in the p85 knockout hearts. Despite such defects in postnatal developmental growth and physiological hypertrophy, the p85 knockout hearts exhibit normal contractility and myocardial histology. Our results therefore provide strong genetic evidence that class I(A) PI3Ks are critical regulators for the developmental growth and physiological hypertrophy of the heart.

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Reduced expression of the global regulator protein CsrA in Legionella pneumophila affects virulence-associated regulators and growth in Acanthamoeba castellanii.

PubMed

Forsbach-Birk, Vera; McNealy, Tamara; Shi, Chunwei; Lynch, Damien; Marre, Reinhard

2004-07-01

Legionella bacteria have a developmental cycle in which they go from existing in the aquatic environment to replicating inside eukaryotic host cells. The adaptation to the new environment requires an efficient regulatory system. Overexpression of CsrA, a global regulatory protein found in a variety of gram-negative bacteria has been shown to suppress virulence-associated traits in Legionella pneumophila. Since evidence resulting only from overproduction may not be sufficient to validate the role of a regulatory protein, a csrA mutant strain, CsrA(-), with a drastically reduced production of CsrA, was created. Using RNA slot blots and Western blotting it was shown that fliA and flaA, genes which contribute to flagellation, were expressed early in the mutant. Additionally, in CsrA(-) the levels of the stationary-phase sigma factor, RpoS, and a recently described regulator of virulence traits, LetE, were increased. Growth curves of CsrA(-) bacteria were delayed with pigment production occurring at the same OD578 but at reduced levels in the mutant. Replication ability of the CsrA(-) mutant in amoebae was also affected. Based on these results, we could show that CsrA is involved in the regulation of the bacterial switch from the replicative to the transmissible form.

Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

PubMed Central

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2013-01-01

Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

It’s a lipid’s world: Bioactive lipid metabolism and signaling in neural stem cell differentiation

PubMed Central

Bieberich, Erhard

2012-01-01

Lipids are often considered membrane components whose function is to embed proteins into cell membranes. In the last two decades, studies on brain lipids have unequivocally demonstrated that many lipids have critical cell signaling functions; they are called “bioactive lipids”. Pioneering work in Dr. Robert Ledeen’s laboratory has shown that two bioactive brain sphingolipids, sphingomyelin and the ganglioside GM1 are major signaling lipids in the nuclear envelope. In addition to derivatives of the sphingolipid ceramide, the bioactive lipids discussed here belong to the classes of terpenoids and steroids, eicosanoids, and lysophospholipids. These lipids act mainly through two mechanisms: 1) direct interaction between the bioactive lipid and a specific protein binding partner such as a lipid receptor, protein kinase or phosphatase, ion exchanger, or other cell signaling protein; and 2) formation of lipid microdomains or rafts that regulate the activity of a group of raft-associated cell signaling proteins. In recent years, a third mechanism has emerged, which invokes lipid second messengers as a regulator for the energy and redox balance of differentiating neural stem cells (NSCs). Interestingly, developmental niches such as the stem cell niche for adult NSC differentiation may also be metabolic compartments that respond to a distinct combination of bioactive lipids. The biological function of these lipids as regulators of NSC differentiation will be reviewed and their application in stem cell therapy discussed. PMID:22246226

Comprehensive interactome of Otx2 in the adult mouse neural retina.

PubMed

Fant, Bruno; Samuel, Alexander; Audebert, Stéphane; Couzon, Agnès; El Nagar, Salsabiel; Billon, Nathalie; Lamonerie, Thomas

2015-11-01

The Otx2 homeodomain transcription factor exerts multiple functions in specific developmental contexts, probably through the regulation of different sets of genes. Protein partners of Otx2 have been shown to modulate its activity. Therefore, the Otx2 interactome may play a key role in selecting a precise target-gene repertoire, hence determining its function in a specific tissue. To address the nature of Otx2 interactome, we generated a new recombinant Otx2(CTAP-tag) mouse line, designed for protein complexes purification. We validated this mouse line by establishing the Otx2 interactome in the adult neural retina. In this tissue, Otx2 is thought to have overlapping function with its paralog Crx. Our analysis revealed that, in contrary to Crx, Otx2 did not develop interactions with proteins that are known to regulate phototransduction genes but showed specific partnership with factors associated with retinal development. The relationship between Otx2 and Crx in the neural retina should therefore be considered as complementarity rather than redundancy. Furthermore, study of the Otx2 interactome revealed strong associations with RNA processing and translation machineries, suggesting unexpected roles for Otx2 in the regulation of selected target genes all along the transcription/translation pathway. The Otx2(CTAP-tag) line, therefore, appears suitable for a systematic approach to Otx2 protein-protein interactions. genesis 53:685-694, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator

PubMed Central

Grants, Jennifer M.; Goh, Grace Y. S.; Taubert, Stefan

2015-01-01

The Mediator multiprotein complex (‘Mediator’) is an important transcriptional coregulator that is evolutionarily conserved throughout eukaryotes. Although some Mediator subunits are essential for the transcription of all protein-coding genes, others influence the expression of only subsets of genes and participate selectively in cellular signaling pathways. Here, we review the current knowledge of Mediator subunit function in the nematode Caenorhabditis elegans, a metazoan in which established and emerging genetic technologies facilitate the study of developmental and physiological regulation in vivo. In this nematode, unbiased genetic screens have revealed critical roles for Mediator components in core developmental pathways such as epidermal growth factor (EGF) and Wnt/β-catenin signaling. More recently, important roles for C. elegans Mediator subunits have emerged in the regulation of lipid metabolism and of systemic stress responses, engaging conserved transcription factors such as nuclear hormone receptors (NHRs). We emphasize instances where similar functions for individual Mediator subunits exist in mammals, highlighting parallels between Mediator subunit action in nematode development and in human cancer biology. We also discuss a parallel between the association of the Mediator subunit MED12 with several human disorders and the role of its C. elegans ortholog mdt-12 as a regulatory hub that interacts with numerous signaling pathways. PMID:25634893

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Crustaceans as a model for microgravity-induced muscle atrophy

NASA Astrophysics Data System (ADS)

Mykles, D. L.

Atrophy of skeletal muscles is a serious problem in a microgravity environment. It is hypothesized that the unloading of postural muscles, which no longer must resist gravity force, causes an accelerated breakdown of contractile proteins, resulting in a reduction in muscle mass and strength. A crustacean model using the land crab, Gecarcinus lateralis, to assess the effects of spaceflight on protein metabolism is presented. The model is compared to a developmentally-regulated atrophy in which a premolt reduction in muscle mass allows the withdrawal of the large claws at molt. The biochemical mechanisms underlying protein breakdown involves both Ca^2+-dependent and multicatalytic proteolytic enzymes. Crustacean claw muscle can be used to determine the interactions between shortening and unloading at the molecular level.

Final Report: Proteomic study of brassinosteroid responses in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Zhiyong; Burlingame, Alma

2017-11-29

The steroid hormone brassinosteroid (BR) is a major growth-promoting phytohormone. The specific aim of the current project is to identify BR-regulated proteins and characterize their functions in various aspects of plant growth, development, and adaptation. Our research has significantly advanced our understanding of how BR signal is transduced from the receptor at the cell surface to changes of nuclear gene expression and other cellular responses such as vesicle trafficking, as well as developmental transitions such as seed germination and flowering. We have also developed effective proteomic methods for quantitative analysis of protein phosphorylation and for identification of glycosylated proteins. Throughmore » this DOE funding, we have performed several proteomic experiments and made major discoveries.« less

Crustaceans as a model for microgravity-induced muscle atrophy

NASA Technical Reports Server (NTRS)

Mykles, D. L.

1996-01-01

Atrophy of skeletal muscles is a serious problem in a microgravity environment. It is hypothesized that the unloading of postural muscles, which no longer must resist gravity force, causes an accelerated breakdown of contractile proteins, resulting in reduction in muscle mass and strength. A crustacean model using the land crab, Gecarcinus lateralis, to assess the effects of spaceflight on protein meatabolism is presented. The model is compared to a developmentally-regulated atrophy in which a premolt reduction in muscle mass allows the withdrawal of the large claws at molt. The biochemical mechanisms underlying protein breakdown involves both Ca2(+) -dependent and multicatalytic proteolytic enzymes. Crustacean claw muscle can be used to determine the interactions between shortening and unloading at the molecular level.

A Change in SHATTERPROOF Protein Lies at the Origin of a Fruit Morphological Novelty and a New Strategy for Seed Dispersal in Medicago Genus1[C][W

PubMed Central

Fourquin, Chloé; del Cerro, Carolina; Victoria, Filipe C.; Vialette-Guiraud, Aurélie; de Oliveira, Antonio C.; Ferrándiz, Cristina

2013-01-01

Angiosperms are the most diverse and numerous group of plants, and it is generally accepted that this evolutionary success owes in part to the diversity found in fruits, key for protecting the developing seeds and ensuring seed dispersal. Although studies on the molecular basis of morphological innovations are few, they all illustrate the central role played by transcription factors acting as developmental regulators. Here, we show that a small change in the protein sequence of a MADS-box transcription factor correlates with the origin of a highly modified fruit morphology and the change in seed dispersal strategies that occurred in Medicago, a genus belonging to the large legume family. This protein sequence modification alters the functional properties of the protein, affecting the affinities for other protein partners involved in high-order complexes. Our work illustrates that variation in coding regions can generate evolutionary novelties not based on gene duplication/subfunctionalization but by interactions in complex networks, contributing also to the current debate on the relative importance of changes in regulatory or coding regions of master regulators in generating morphological novelties. PMID:23640757

Identification of Arabidopsis MYB56 as a novel substrate for CRL3BPM E3 ligases.

PubMed

Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo

2014-10-24

Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies pointed out that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling the flowering time point in plants. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

Capsicum annuum WRKY transcription factor d (CaWRKYd) regulates hypersensitive response and defense response upon Tobacco mosaic virus infection.

PubMed

Huh, Sung Un; Choi, La Mee; Lee, Gil-Je; Kim, Young Jin; Paek, Kyung-Hee

2012-12-01

WRKY transcription factors regulate biotic, abiotic, and developmental processes. In terms of plant defense, WRKY factors have important roles as positive and negative regulators via transcriptional regulation or protein-protein interaction. Here, we report the characterization of the gene encoding Capsicum annuum WRKY transcription factor d (CaWRKYd) isolated from microarray analysis in the Tobacco mosaic virus (TMV)-P(0)-inoculated hot pepper plants. CaWRKYd belongs to the WRKY IIa group, a very small clade in the WRKY subfamily, and WRKY IIa group has positive/negative regulatory roles in Arabidopsis and rice. CaWRKYd transcripts were induced by various plant defense-related hormone treatments and TMV-P(0) inoculation. Silencing of CaWRKYd affected TMV-P(0)-mediated hypersensitive response (HR) cell death and accumulation of TMV-P(0) coat protein in local and systemic leaves. Furthermore, expression of some pathogenesis-related (PR) genes and HR-related genes was reduced in the CaWRKYd-silenced plants compared with TRV2 vector control plants upon TMV-P(0) inoculation. CaWRKYd was confirmed to bind to the W-box. Thus CaWRKYd is a newly identified Capsicum annuum WRKY transcription factor that appears to be involved in TMV-P(0)-mediated HR cell death by regulating downstream gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Cryptococcus neoformans Mediator Protein Ssn8 Negatively Regulates Diverse Physiological Processes and Is Required for Virulence

PubMed Central

Wang, Lin-Ing; Lin, Yu-Sheng; Liu, Kung-Hung; Jong, Ambrose Y.; Shen, Wei-Chiang

2011-01-01

Cryptococcus neoformans is a ubiquitously distributed human pathogen. It is also a model system for studying fungal virulence, physiology and differentiation. Light is known to inhibit sexual development via the evolutionarily conserved white collar proteins in C. neoformans. To dissect molecular mechanisms regulating this process, we have identified the SSN8 gene whose mutation suppresses the light-dependent CWC1 overexpression phenotype. Characterization of sex-related phenotypes revealed that Ssn8 functions as a negative regulator in both heterothallic a-α mating and same-sex mating processes. In addition, Ssn8 is involved in the suppression of other physiological processes including invasive growth, and production of capsule and melanin. Interestingly, Ssn8 is also required for the maintenance of cell wall integrity and virulence. Our gene expression studies confirmed that deletion of SSN8 results in de-repression of genes involved in sexual development and melanization. Epistatic and yeast two hybrid studies suggest that C. neoformans Ssn8 plays critical roles downstream of the Cpk1 MAPK cascade and Ste12 and possibly resides at one of the major branches downstream of the Cwc complex in the light-mediated sexual development pathway. Taken together, our studies demonstrate that the conserved Mediator protein Ssn8 functions as a global regulator which negatively regulates diverse physiological and developmental processes and is required for virulence in C. neoformans. PMID:21559476

Transcriptomics insights into the genetic regulation of root apical meristem exhaustion and determinate primary root growth in Pachycereus pringlei (Cactaceae).

PubMed

Rodriguez-Alonso, Gustavo; Matvienko, Marta; López-Valle, Mayra L; Lázaro-Mixteco, Pedro E; Napsucialy-Mendivil, Selene; Dubrovsky, Joseph G; Shishkova, Svetlana

2018-06-04

Many Cactaceae species exhibit determinate growth of the primary root as a consequence of root apical meristem (RAM) exhaustion. The genetic regulation of this growth pattern is unknown. Here, we de novo assembled and annotated the root apex transcriptome of the Pachycereus pringlei primary root at three developmental stages, with active or exhausted RAM. The assembled transcriptome is robust and comprehensive, and was used to infer a transcriptional regulatory network of the primary root apex. Putative orthologues of Arabidopsis regulators of RAM maintenance, as well as putative lineage-specific transcripts were identified. The transcriptome revealed putative orthologues of most proteins involved in housekeeping processes, hormone signalling, and metabolic pathways. Our results suggest that specific transcriptional programs operate in the root apex at specific developmental time points. Moreover, the transcriptional state of the P. pringlei root apex as the RAM becomes exhausted is comparable to the transcriptional state of cells from the meristematic, elongation, and differentiation zones of Arabidopsis roots along the root axis. We suggest that the transcriptional program underlying the drought stress response is induced during Cactaceae root development, and that lineage-specific transcripts could contribute to RAM exhaustion in Cactaceae.

A Recurrent De Novo PACS2 Heterozygous Missense Variant Causes Neonatal-Onset Developmental Epileptic Encephalopathy, Facial Dysmorphism, and Cerebellar Dysgenesis.

PubMed

Olson, Heather E; Jean-Marçais, Nolwenn; Yang, Edward; Heron, Delphine; Tatton-Brown, Katrina; van der Zwaag, Paul A; Bijlsma, Emilia K; Krock, Bryan L; Backer, E; Kamsteeg, Erik-Jan; Sinnema, Margje; Reijnders, Margot R F; Bearden, David; Begtrup, Amber; Telegrafi, Aida; Lunsing, Roelineke J; Burglen, Lydie; Lesca, Gaetan; Cho, Megan T; Smith, Lacey A; Sheidley, Beth R; Moufawad El Achkar, Christelle; Pearl, Phillip L; Poduri, Annapurna; Skraban, Cara M; Tarpinian, Jennifer; Nesbitt, Addie I; Fransen van de Putte, Dietje E; Ruivenkamp, Claudia A L; Rump, Patrick; Chatron, Nicolas; Sabatier, Isabelle; De Bellescize, Julitta; Guibaud, Laurent; Sweetser, David A; Waxler, Jessica L; Wierenga, Klaas J; Donadieu, Jean; Narayanan, Vinodh; Ramsey, Keri M; Nava, Caroline; Rivière, Jean-Baptiste; Vitobello, Antonio; Tran Mau-Them, Frédéric; Philippe, Christophe; Bruel, Ange-Line; Duffourd, Yannis; Thomas, Laurel; Lelieveld, Stefan H; Schuurs-Hoeijmakers, Janneke; Brunner, Han G; Keren, Boris; Thevenon, Julien; Faivre, Laurence; Thomas, Gary; Thauvin-Robinet, Christel

2018-05-03

Developmental and epileptic encephalopathies (DEEs) represent a large clinical and genetic heterogeneous group of neurodevelopmental diseases. The identification of pathogenic genetic variants in DEEs remains crucial for deciphering this complex group and for accurately caring for affected individuals (clinical diagnosis, genetic counseling, impacting medical, precision therapy, clinical trials, etc.). Whole-exome sequencing and intensive data sharing identified a recurrent de novo PACS2 heterozygous missense variant in 14 unrelated individuals. Their phenotype was characterized by epilepsy, global developmental delay with or without autism, common cerebellar dysgenesis, and facial dysmorphism. Mixed focal and generalized epilepsy occurred in the neonatal period, controlled with difficulty in the first year, but many improved in early childhood. PACS2 is an important PACS1 paralog and encodes a multifunctional sorting protein involved in nuclear gene expression and pathway traffic regulation. Both proteins harbor cargo(furin)-binding regions (FBRs) that bind cargo proteins, sorting adaptors, and cellular kinase. Compared to the defined PACS1 recurrent variant series, individuals with PACS2 variant have more consistently neonatal/early-infantile-onset epilepsy that can be challenging to control. Cerebellar abnormalities may be similar but PACS2 individuals exhibit a pattern of clear dysgenesis ranging from mild to severe. Functional studies demonstrated that the PACS2 recurrent variant reduces the ability of the predicted autoregulatory domain to modulate the interaction between the PACS2 FBR and client proteins, which may disturb cellular function. These findings support the causality of this recurrent de novo PACS2 heterozygous missense in DEEs with facial dysmorphim and cerebellar dysgenesis. Copyright © 2018 American Society of Human Genetics. All rights reserved.

Brassinosteroids regulate pavement cell growth by mediating BIN2-induced microtubule stabilization.

PubMed

Liu, Xiaolei; Yang, Qin; Wang, Yuan; Wang, Linhai; Fu, Ying; Wang, Xuelu

2018-02-23

Brassinosteroids (BRs), a group of plant steroid hormones, play important roles in regulating plant development. The cytoskeleton also affects key developmental processes and a deficiency in BR biosynthesis or signaling leads to abnormal phenotypes similar to those of microtubule-defective mutants. However, how BRs regulate microtubule and cell morphology remains unknown. Here, using liquid chromatography-tandem mass spectrometry, we identified tubulin proteins that interact with Arabidopsis BRASSINOSTEROID INSENSITIVE2 (BIN2), a negative regulator of BR responses in plants. In vitro and in vivo pull-down assays confirmed that BIN2 interacts with tubulin proteins. High-speed co-sedimentation assays demonstrated that BIN2 also binds microtubules. The Arabidopsis genome also encodes two BIN2 homologs, BIN2-LIKE 1 (BIL1) and BIL2, which function redundantly with BIN2. In the bin2-3 bil1 bil2 triple mutant, cortical microtubules were more sensitive to treatment with the microtubule-disrupting drug oryzalin than in wild-type, whereas in the BIN2 gain-of-function mutant bin2-1, cortical microtubules were insensitive to oryzalin treatment. These results provide important insight into how BR regulates plant pavement cell and leaf growth by mediating the stabilization of microtubules by BIN2.

Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.

PubMed

Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

2016-02-01

Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.

Multiple Roles of Integrin-Linked Kinase in Epidermal Development, Maturation and Pigmentation Revealed by Molecular Profiling

PubMed Central

Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E.; Dagnino, Lina

2012-01-01

Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function. PMID:22574216

Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

PubMed

Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

2012-01-01

Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

PubMed

Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

2017-01-11

A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

PubMed

Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

2017-07-01

The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

Developmental regulation of the gene for chimeric calcium/calmodulin-dependent protein kinase in anthers

NASA Technical Reports Server (NTRS)

Poovaiah, B. W.; Xia, M.; Liu, Z.; Wang, W.; Yang, T.; Sathyanarayanan, P. V.; Franceschi, V. R.

1999-01-01

Chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) was cloned from developing anthers of lily (Lilium longiflorum Thumb. cv. Nellie White) and tobacco (Nicotiana tabacum L. cv. Xanthi). Previous biochemical characterization and structure/function studies had revealed that CCaMK has dual modes of regulation by Ca(2+) and Ca(2+)/calmodulin. The unique structural features of CCaMK include a catalytic domain, a calmodulin-binding domain, and a neural visinin-like Ca(2+)-binding domain. The existence of these three features in a single polypeptide distinguishes it from other kinases. Western analysis revealed that CCaMK is expressed in a stage-specific manner in developing anthers. Expression of CCaMK was first detected in pollen mother cells and continued to increase, reaching a peak around the tetrad stage of meiosis. Following microsporogenesis, CCaMK expression rapidly decreased and at later stages of microspore development, no expression was detected. A tobacco genomic clone of CCaMK was isolated and transgenic tobacco plants were produced carrying the CCaMK promoter fused to the beta-glucuronidase reporter gene. Both CCaMK mRNA and protein were detected in the pollen sac and their localizations were restricted to the pollen mother cells and tapetal cells. Consistent results showing a stage-specific expression pattern were obtained by beta-glucuronidase analysis, in-situ hybridization and immunolocalization. The stage- and tissue-specific appearance of CCaMK in anthers suggests that it could play a role in sensing transient changes in free Ca(2+) concentration in target cells, thereby controlling developmental events in the anther.

Finasteride inhibited brain dopaminergic system and open-field behaviors in adolescent male rats.

PubMed

Li, Li; Kang, Yun-Xiao; Ji, Xiao-Ming; Li, Ying-Kun; Li, Shuang-Cheng; Zhang, Xiang-Jian; Cui, Hui-Xian; Shi, Ge-Ming

2018-02-01

Finasteride inhibits the conversion of testosterone to dihydrotestosterone. Because androgen regulates dopaminergic system in the brain, it could be hypothesized that finasteride may inhibit dopaminergic system. The present study therefore investigates the effects of finasteride in adolescent and early developmental rats on dopaminergic system, including contents of dopamine and its metabolites (dihydroxy phenyl acetic acid and homovanillic acid) and tyrosine hydroxylase expressions both at gene and protein levels. Meanwhile, open-field behaviors of the rats are examined because of the regulatory effect of dopaminergic system on the behaviors. Open-field behaviors were evaluated by exploratory and motor behaviors. Dopamine and its metabolites were assayed by liquid chromatography-mass spectrometry. Tyrosine hydroxylase mRNA and protein expressions were determined by real-time qRT-PCR and western blot, respectively. It was found that in adolescent male rats, administration of finasteride at doses of 25 and 50 mg/kg for 14 days dose dependently inhibited open-field behaviors, reduced contents of dopamine and its metabolites in frontal cortex, hippocampus, caudate putamen, nucleus accumbens, and down-regulated tyrosine hydroxylase mRNA and protein expressions in substantia nigra and ventral tegmental area. However, there was no significant change of these parameters in early developmental rats after finasteride treatment. These results suggest that finasteride inhibits dopaminergic system and open-field behaviors in adolescent male rats by inhibiting the conversion of testosterone to dihydrotestosterone, and imply finasteride as a potential therapeutic option for neuropsychiatric disorders associated with hyperactivities of dopaminergic system and androgen. © 2017 John Wiley & Sons Ltd.

Dual Functions of ASCIZ in the DNA Base Damage Response and Pulmonary Organogenesis

PubMed Central

Tenis, Nora; Hammet, Andrew; Hewitt, Kimberly; Ng, Jane-Lee; McNees, Carolyn J.; Kozlov, Sergei V.; Oka, Hayato; Kobayashi, Masahiko; Conlan, Lindus A.; Cole, Timothy J.; Yamamoto, Ken-ichi; Taniguchi, Yoshihito; Takeda, Shunichi; Lavin, Martin F.; Heierhorst, Jörg

2010-01-01

Zn2+-finger proteins comprise one of the largest protein superfamilies with diverse biological functions. The ATM substrate Chk2-interacting Zn2+-finger protein (ASCIZ; also known as ATMIN and ZNF822) was originally linked to functions in the DNA base damage response and has also been proposed to be an essential cofactor of the ATM kinase. Here we show that absence of ASCIZ leads to p53-independent late-embryonic lethality in mice. Asciz-deficient primary fibroblasts exhibit increased sensitivity to DNA base damaging agents MMS and H2O2, but Asciz deletion or knock-down does not affect ATM levels and activation in mouse, chicken, or human cells. Unexpectedly, Asciz-deficient embryos also exhibit severe respiratory tract defects with complete pulmonary agenesis and severe tracheal atresia. Nkx2.1-expressing respiratory precursors are still specified in the absence of ASCIZ, but fail to segregate properly within the ventral foregut, and as a consequence lung buds never form and separation of the trachea from the oesophagus stalls early. Comparison of phenotypes suggests that ASCIZ functions between Wnt2-2b/ß-catenin and FGF10/FGF-receptor 2b signaling pathways in the mesodermal/endodermal crosstalk regulating early respiratory development. We also find that ASCIZ can activate expression of reporter genes via its SQ/TQ-cluster domain in vitro, suggesting that it may exert its developmental functions as a transcription factor. Altogether, the data indicate that, in addition to its role in the DNA base damage response, ASCIZ has separate developmental functions as an essential regulator of respiratory organogenesis. PMID:20975950

BAC-recombineering for studying plant gene regulation: developmental control and cellular localization of SnRK1 kinase subunits.

PubMed

Bitrián, Marta; Roodbarkelari, Farshad; Horváth, Mihály; Koncz, Csaba

2011-03-01

Recombineering, permitting precise modification of genes within bacterial artificial chromosomes (BACs) through homologous recombination mediated by lambda phage-encoded Red proteins, is a widely used powerful tool in mouse, Caenorhabditis and Drosophila genetics. As Agrobacterium-mediated transfer of large DNA inserts from binary BACs and TACs into plants occurs at low frequency, recombineering is so far seldom exploited in the analysis of plant gene functions. We have constructed binary plant transformation vectors, which are suitable for gap-repair cloning of genes from BACs using recombineering methods previously developed for other organisms. Here we show that recombineering facilitates PCR-based generation of precise translational fusions between coding sequences of fluorescent reporter and plant proteins using galK-based exchange recombination. The modified target genes alone or as part of a larger gene cluster can be transferred by high-frequency gap-repair into plant transformation vectors, stably maintained in Agrobacterium and transformed without alteration into plants. Versatile application of plant BAC-recombineering is illustrated by the analysis of developmental regulation and cellular localization of interacting AKIN10 catalytic and SNF4 activating subunits of Arabidopsis Snf1-related (SnRK1) protein kinase using in vivo imaging. To validate full functionality and in vivo interaction of tagged SnRK1 subunits, it is demonstrated that immunoprecipitated SNF4-YFP is bound to a kinase that phosphorylates SnRK1 candidate substrates, and that the GFP- and YFP-tagged kinase subunits co-immunoprecipitate with endogenous wild type AKIN10 and SNF4. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

Emerging roles of Na+/H+ exchangers in epilepsy and developmental brain disorders

PubMed Central

Falgoust, Lindsay; Pan, Jullie W.; Sun, Dandan; Zhang, Zhongling

2016-01-01

Epilepsy is a common central nervous system (CNS) disease characterized by recurrent transient neurological events occurring due to abnormally excessive or synchronous neuronal activity in the brain. The CNS is affected by systemic acid–base disorders, and epileptic seizures are sensitive indicators of underlying imbalances in cellular pH regulation. Na+/H+ exchangers (NHEs) are a family of membrane transporter proteins actively involved in regulating intracellular and organellar pH by extruding H+ in exchange for Na+ influx. Altering NHE function significantly influences neuronal excitability and plays a role in epilepsy. This review gives an overview of pH regulatory mechanisms in the brain with a special focus on the NHE family and the relationship between epilepsy and dysfunction of NHE isoforms. We first discuss how cells translocate acids and bases across the membrane and establish pH homeostasis as a result of the concerted effort of enzymes and ion transporters. We focus on the specific roles of the NHE family by detailing how the loss of NHE1 in two NHE mutant mice results in enhanced neuronal excitability in these animals. Furthermore, we highlight new findings on the link between mutations of NHE6 and NHE9 and developmental brain disorders including epilepsy, autism, and attention deficit hyperactivity disorder (ADHD). These studies demonstrate the importance of NHE proteins in maintaining H+ homeostasis and their intricate roles in the regulation of neuronal function. A better understanding of the mechanisms underlying NHE1, 6, and 9 dysfunctions in epilepsy formation may advance the development of new epilepsy treatment strategies. PMID:26965387

FKBPL Is a Critical Antiangiogenic Regulator of Developmental and Pathological Angiogenesis

PubMed Central

Yakkundi, Anita; Bennett, Rachel; Hernández-Negrete, Ivette; Delalande, Jean-Marie; Hanna, Mary; Lyubomska, Oksana; Arthur, Kenneth; Short, Amy; McKeen, Hayley; Nelson, Laura; McCrudden, Cian M.; McNally, Ross; McClements, Lana; McCarthy, Helen O.; Burns, Alan J.; Bicknell, Roy; Kissenpfennig, Adrien

2015-01-01

Objective— The antitumor effects of FK506-binding protein like (FKBPL) and its extracellular role in angiogenesis are well characterized; however, its role in physiological/developmental angiogenesis and the effect of FKBPL ablation has not been evaluated. This is important as effects of some angiogenic proteins are dosage dependent. Here we evaluate the regulation of FKBPL secretion under angiogenic stimuli, as well as the effect of FKBPL ablation in angiogenesis using mouse and zebrafish models. Approach and Results— FKBPL is secreted maximally by human microvascular endothelial cells and fibroblasts, and this was specifically downregulated by proangiogenic hypoxic signals, but not by the angiogenic cytokines, VEGF or IL8. FKBPL’s critical role in angiogenesis was supported by our inability to generate an Fkbpl knockout mouse, with embryonic lethality occurring before E8.5. However, whilst Fkbpl heterozygotic embryos showed some vasculature irregularities, the mice developed normally. In murine angiogenesis models, including the ex vivo aortic ring assay, in vivo sponge assay, and tumor growth assay, Fkbpl+/− mice exhibited increased sprouting, enhanced vessel recruitment, and faster tumor growth, respectively, supporting the antiangiogenic function of FKBPL. In zebrafish, knockdown of zFkbpl using morpholinos disrupted the vasculature, and the phenotype was rescued with hFKBPL. Interestingly, this vessel disruption was ineffective when zcd44 was knocked-down, supporting the dependency of zFkbpl on zCd44 in zebrafish. Conclusions— FKBPL is an important regulator of angiogenesis, having an essential role in murine and zebrafish blood vessel development. Mouse models of angiogenesis demonstrated a proangiogenic phenotype in Fkbpl heterozygotes. PMID:25767277

Emerging roles of Na⁺/H⁺ exchangers in epilepsy and developmental brain disorders.

PubMed

Zhao, Hanshu; Carney, Karen E; Falgoust, Lindsay; Pan, Jullie W; Sun, Dandan; Zhang, Zhongling

2016-01-01

Epilepsy is a common central nervous system (CNS) disease characterized by recurrent transient neurological events occurring due to abnormally excessive or synchronous neuronal activity in the brain. The CNS is affected by systemic acid-base disorders, and epileptic seizures are sensitive indicators of underlying imbalances in cellular pH regulation. Na(+)/H(+) exchangers (NHEs) are a family of membrane transporter proteins actively involved in regulating intracellular and organellar pH by extruding H(+) in exchange for Na(+) influx. Altering NHE function significantly influences neuronal excitability and plays a role in epilepsy. This review gives an overview of pH regulatory mechanisms in the brain with a special focus on the NHE family and the relationship between epilepsy and dysfunction of NHE isoforms. We first discuss how cells translocate acids and bases across the membrane and establish pH homeostasis as a result of the concerted effort of enzymes and ion transporters. We focus on the specific roles of the NHE family by detailing how the loss of NHE1 in two NHE mutant mice results in enhanced neuronal excitability in these animals. Furthermore, we highlight new findings on the link between mutations of NHE6 and NHE9 and developmental brain disorders including epilepsy, autism, and attention deficit hyperactivity disorder (ADHD). These studies demonstrate the importance of NHE proteins in maintaining H(+) homeostasis and their intricate roles in the regulation of neuronal function. A better understanding of the mechanisms underlying NHE1, 6, and 9 dysfunctions in epilepsy formation may advance the development of new epilepsy treatment strategies. Published by Elsevier Ltd.

Transforming growth factor β family members in regulation of vascular function: in the light of vascular conditional knockouts.

PubMed

Jakobsson, Lars; van Meeteren, Laurens A

2013-05-15

Blood vessels are composed of endothelial cells, mural cells (smooth muscle cells and pericytes) and their shared basement membrane. During embryonic development a multitude of signaling components orchestrate the formation of new vessels. The process is highly dependent on correct dosage, spacing and timing of these signaling molecules. As vessels mature some cascades remain active, albeit at very low levels, and may be reactivated upon demand. Members of the Transforming growth factor β (TGF-β) protein family are strongly engaged in developmental angiogenesis but are also regulators of vascular integrity in the adult. In humans various genetic alterations within this protein family cause vascular disorders, involving disintegration of vascular integrity. Here we summarize and discuss recent data gathered from conditional and endothelial cell specific genetic loss-of-function of members of the TGF-β family in the mouse. Copyright © 2013 Elsevier Inc. All rights reserved.

A Jasmonate ZIM-Domain Protein NaJAZd Regulates Floral Jasmonic Acid Levels and Counteracts Flower Abscission in Nicotiana attenuata Plants

PubMed Central

Oh, Youngjoo; Baldwin, Ian T.; Galis, Ivan

2013-01-01

Jasmonic acid is an important regulator of plant growth, development and defense. The jasmonate-ZIM domain (JAZ) proteins are key regulators in jasmonate signaling ubiquitously present in flowering plants but their functional annotation remains largely incomplete. Recently, we identified 12 putative JAZ proteins in native tobacco, Nicotiana attenuata, and initiated systematic functional characterization of these proteins by reverse genetic approaches. In this report, Nicotiana attenuata plants silenced in the expression of NaJAZd (irJAZd) by RNA interference were used to characterize NaJAZd function. Although NaJAZd transcripts were strongly and transiently up-regulated in the rosette leaves by simulated herbivory treatment, we did not observe strong defense-related phenotypes, such as altered herbivore performance or the constitutive accumulation of defense-related secondary metabolites in irJAZd plants compared to wild type plants, both in the glasshouse and the native habitat of Nicotiana attenuata in the Great Basin Desert, Utah, USA. Interestingly, irJAZd plants produced fewer seed capsules than did wild type plants as a result of increased flower abscission in later stages of flower development. The early- and mid-developmental stages of irJAZd flowers had reduced levels of jasmonic acid and jasmonoyl-L-isoleucine, while fully open flowers had normal levels, but these were impaired in NaMYB305 transcript accumulations. Previously, NaMYB305-silenced plants were shown to have strong flower abscission phenotypes and contained lower NECTARIN 1 transcript levels, phenotypes which are copied in irJAZd plants. We propose that the NaJAZd protein is required to counteract flower abscission, possibly by regulating jasmonic acid and jasmonoyl-L-isoleucine levels and/or expression of NaMYB305 gene in Nicotiana attenuata flowers. This novel insight into the function of JAZ proteins in flower and seed development highlights the diversity of functions played by jasmonates and JAZ proteins. PMID:23469091

Drosophila Polypyrimidine Tract-Binding Protein (DmPTB) Regulates Dorso-Ventral Patterning Genes in Embryos

PubMed Central

Huntley, Jim; Wesley, Cedric S.; Singh, Ravinder

2014-01-01

The Drosophila polypyrimidine tract-binding protein (dmPTB or hephaestus) plays an important role during embryogenesis. A loss of function mutation, heph03429, results in varied defects in embryonic developmental processes, leading to embryonic lethality. However, the suite of molecular functions that are disrupted in the mutant remains unknown. We have used an unbiased high throughput sequencing approach to identify transcripts that are misregulated in this mutant. Misregulated transcripts show evidence of significantly altered patterns of splicing (exon skipping, 5′ and 3′ splice site switching), alternative 5′ ends, and mRNA level changes (up and down regulation). These findings are independently supported by reverse-transcription-polymerase chain reaction (RT-PCR) analysis and in situ hybridization. We show that a group of genes, such as Zerknüllt, z600 and screw are among the most upregulated in the mutant and have been functionally linked to dorso-ventral patterning and/or dorsal closure processes. Thus, loss of dmPTB function results in specific misregulated transcripts, including those that provide the missing link between the loss of dmPTB function and observed developmental defects in embryogenesis. This study provides the first comprehensive repertoire of genes affected in vivo in the heph mutant in Drosophila and offers insight into the role of dmPTB during embryonic development. PMID:25014769

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis

PubMed Central

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K.

2012-01-01

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3′ untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior. PMID:22645327

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis.

PubMed

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K

2012-06-12

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3' untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior.

BIIDXI, the At4g32460 DUF642 gene, is involved in pectin methyl esterase regulation during Arabidopsis thaliana seed germination and plant development.

PubMed

Zúñiga-Sánchez, Esther; Soriano, Diana; Martínez-Barajas, Eleazar; Orozco-Segovia, Alma; Gamboa-deBuen, Alicia

2014-12-02

DUF642 proteins constitute a highly conserved family of proteins that are associated with the cell wall and are specific to spermatophytes. Transcriptome studies have suggested that members of this family are involved in seed development and germination processes. Previous in vitro studies have revealed that At4g32460- and At5g11420-encoded proteins interact with the catalytic domain of pectin methyl esterase 3 (AtPME3, which is encoded by At3g14310). PMEs play an important role in plant development, including seed germination. The aim of this study was to evaluate the function of the DUF642 gene At4g32460 during seed germination and plant development and to determine its relation to PME activity regulation. Our results indicated that the DUF642 proteins encoded by At4g32460 and At5g11420 could be positive regulators of PME activity during several developmental processes. Transgenic lines overexpressing these proteins showed increased PME activity during seed germination, and improved seed germination performance. In plants expressing At4g32460 antisense RNA, PME activity was decreased in the leaves, and the siliques were very short and contained no seeds. This phenotype was also present in the SALK_142260 and SALK_054867 lines for At4g32460. Our results suggested that the DUF642 family contributes to the complexity of the methylesterification process by participating in the fine regulation of pectin status during plant development.

Proteomic Identification of Putative MicroRNA394 Target Genes in Arabidopsis thaliana Identifies Major Latex Protein Family Members Critical for Normal Development*

PubMed Central

Litholdo, Celso G.; Parker, Benjamin L.; Eamens, Andrew L.; Larsen, Martin R.; Cordwell, Stuart J.; Waterhouse, Peter M.

2016-01-01

Expression of the F-Box protein Leaf Curling Responsiveness (LCR) is regulated by microRNA, miR394, and alterations to this interplay in Arabidopsis thaliana produce defects in leaf polarity and shoot apical meristem organization. Although the miR394-LCR node has been documented in Arabidopsis, the identification of proteins targeted by LCR F-box itself has proven problematic. Here, a proteomic analysis of shoot apices from plants with altered LCR levels identified a member of the Latex Protein (MLP) family gene as a potential LCR F-box target. Bioinformatic and molecular analyses also suggested that other MLP family members are likely to be targets for this post-translational regulation. Direct interaction between LCR F-Box and MLP423 was validated. Additional MLP members had reduction in protein accumulation, in varying degrees, mediated by LCR F-Box. Transgenic Arabidopsis lines, in which MLP28 expression was reduced through an artificial miRNA technology, displayed severe developmental defects, including changes in leaf patterning and morphology, shoot apex defects, and eventual premature death. These phenotypic characteristics resemble those of Arabidopsis plants modified to over-express LCR. Taken together, the results demonstrate that MLPs are driven to degradation by LCR, and indicate that MLP gene family is target of miR394-LCR regulatory node, representing potential targets for directly post-translational regulation mediated by LCR F-Box. In addition, MLP28 family member is associated with the LCR regulation that is critical for normal Arabidopsis development. PMID:27067051

Molecular evolution of a novel marsupial S100 protein (S100A19) which is expressed at specific stages of mammary gland and gut development.

PubMed

Kwek, Joly H L; Wynne, Alicia; Lefèvre, Christophe; Familari, Mary; Nicholas, Kevin R; Sharp, Julie A

2013-10-01

S100 proteins are calcium-binding proteins involved in controlling diverse intracellular and extracellular processes such as cell growth, differentiation, and antimicrobial function. We recently identified a S100-like cDNA from the tammar wallaby (Macropus eugenii) stomach. Phylogentic analysis shows wallaby S100A19 forms a new clade with other marsupial and monotreme S100A19, while this group shows similarity to eutherian S100A7 and S100A15 genes. This is also supported by amino acid and domain comparisons. We show S100A19 is developmentally-regulated in the tammar wallaby gut by demonstrating the gene is expressed in the forestomach of young animals at a time when the diet consists of only milk, but is absent in older animals when the diet is supplemented with herbage. During this transition the forestomach phenotype changes from a gastric stomach into a fermentation sac and intestinal flora changes with diet. We also show that S100A19 is expressed in the mammary gland of the tammar wallaby only during specific stages of lactation; the gene is up-regulated during pregnancy and involution and not expressed during the milk production phase of lactation. Comparison of the tammar wallaby S100A19 protein sequence with S100 protein sequences from eutherian, monotreme and other marsupial species suggest the marsupial S100A19 has two functional EF hand domains, and an extended His tail. An evolutionary analysis of S100 family proteins was carried out to gain a better understanding of the relationship between the S100 family member functions. We propose that S100A19 gene/protein is the ancestor of the eutherian S100A7 gene/protein, which has subsequently modified its original function in eutherians. This modified function may have arisen due to differentiation of evolutionary pressures placed on gut and mammary gland developmental during mammal evolution. The highly regulated differential expression patterns of S100A19 in the tammar wallaby suggests that S100A19 may play a role in gut development, which differs between metatherians and eutherians, and/or include a potential antibacterial role in order to establish the correct flora and protect against spiral bacteria in the immature forestomach. In the mammary gland it may protect the tissue from infection at times of vulnerability during the lactation cycle. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

Extensive Use of RNA-Binding Proteins in Drosophila Sensory Neuron Dendrite Morphogenesis

PubMed Central

Olesnicky, Eugenia C.; Killian, Darrell J.; Garcia, Evelyn; Morton, Mary C.; Rathjen, Alan R.; Sola, Ismail E.; Gavis, Elizabeth R.

2013-01-01

The large number of RNA-binding proteins and translation factors encoded in the Drosophila and other metazoan genomes predicts widespread use of post-transcriptional regulation in cellular and developmental processes. Previous studies identified roles for several RNA-binding proteins in dendrite branching morphogenesis of Drosophila larval sensory neurons. To determine the larger contribution of post-transcriptional gene regulation to neuronal morphogenesis, we conducted an RNA interference screen to identify additional Drosophila proteins annotated as either RNA-binding proteins or translation factors that function in producing the complex dendritic trees of larval class IV dendritic arborization neurons. We identified 88 genes encoding such proteins whose knockdown resulted in aberrant dendritic morphology, including alterations in dendritic branch number, branch length, field size, and patterning of the dendritic tree. In particular, splicing and translation initiation factors were associated with distinct and characteristic phenotypes, suggesting that different morphogenetic events are best controlled at specific steps in post-transcriptional messenger RNA metabolism. Many of the factors identified in the screen have been implicated in controlling the subcellular distributions and translation of maternal messenger RNAs; thus, common post-transcriptional regulatory strategies may be used in neurogenesis and in the generation of asymmetry in the female germline and embryo. PMID:24347626

The insulator protein BEAF-32 is required for Hippo pathway activity in the terminal differentiation of neuronal subtypes.

PubMed

Jukam, David; Viets, Kayla; Anderson, Caitlin; Zhou, Cyrus; DeFord, Peter; Yan, Jenny; Cao, Jinshuai; Johnston, Robert J

2016-07-01

The Hippo pathway is crucial for not only normal growth and apoptosis but also cell fate specification during development. What controls Hippo pathway activity during cell fate specification is incompletely understood. In this article, we identify the insulator protein BEAF-32 as a regulator of Hippo pathway activity in Drosophila photoreceptor differentiation. Though morphologically uniform, the fly eye is composed of two subtypes of R8 photoreceptor neurons defined by expression of light-detecting Rhodopsin proteins. In one R8 subtype, active Hippo signaling induces Rhodopsin 6 (Rh6) and represses Rhodopsin 5 (Rh5), whereas in the other subtype, inactive Hippo signaling induces Rh5 and represses Rh6. The activity state of the Hippo pathway in R8 cells is determined by the expression of warts, a core pathway kinase, which interacts with the growth regulator melted in a double-negative feedback loop. We show that BEAF-32 is required for expression of warts and repression of melted Furthermore, BEAF-32 plays a second role downstream of Warts to induce Rh6 and prevent Rh5 fate. BEAF-32 is dispensable for Warts feedback, indicating that BEAF-32 differentially regulates warts and Rhodopsins. Loss of BEAF-32 does not noticeably impair the functions of the Hippo pathway in eye growth regulation. Our study identifies a context-specific regulator of Hippo pathway activity in post-mitotic neuronal fate, and reveals a developmentally specific role for a broadly expressed insulator protein. © 2016. Published by The Company of Biologists Ltd.

Microarray Analyses of Gene Expression during Adventitious Root Development in Pinus contorta1[w

PubMed Central

Brinker, Monika; van Zyl, Leonel; Liu, Wenbin; Craig, Deborah; Sederoff, Ronald R.; Clapham, David H.; von Arnold, Sara

2004-01-01

In order to investigate the gene expression pattern during adventitious root development, RNA of Pinus contorta hypocotyls, pulse-treated with the auxin indole-3-butyric acid and harvested at distinct developmental time points of root development, was hybridized to microarrays containing 2,178 cDNAs from Pinus taeda. Over the period of observation of root development, the transcript levels of 220 genes changed significantly. During the root initiation phase, genes involved in cell replication and cell wall weakening and a transcript encoding a PINHEAD/ZWILLE-like protein were up-regulated, while genes related to auxin transport, photosynthesis, and cell wall synthesis were down-regulated. In addition, there were changes in transcript abundance of genes related to water stress. During the root meristem formation phase the transcript abundances of genes involved in auxin transport, auxin responsive transcription, and cell wall synthesis, and of a gene encoding a B-box zinc finger-like protein, increased, while those encoding proteins involved in cell wall weakening decreased. Changes of transcript abundance of genes related to water stress during the root meristem formation and root formation phase indicate that the plant roots had become functional in water transport. Simultaneously, genes involved in auxin transport were up-regulated, while genes related to cell wall modification were down-regulated. Finally, during the root elongation phase down-regulation of transcripts encoding proteins involved in cell replication and stress occurred. Based on the observed changes in transcript abundances, we suggest hypotheses about the relative importance of various physiological processes during the auxin-induced development of roots in P. contorta. PMID:15247392

Molecular Characterization of abLIM, a Novel Actin-binding and Double Zinc Finger Protein

PubMed Central

Roof, Dorothy J.; Hayes, Annmarie; Adamian, Michael; Chishti, Athar H.; Li, Tiansen

1997-01-01

Molecules that couple the actin-based cytoskeleton to intracellular signaling pathways are central to the processes of cellular morphogenesis and differentiation. We have characterized a novel protein, the actin-binding LIM (abLIM) protein, which could mediate such interactions between actin filaments and cytoplasmic targets. abLIM protein consists of a COOH-terminal cytoskeletal domain that is fused to an NH2-terminal domain consisting of four double zinc finger motifs. The cytoskeletal domain is ∼50% identical to erythrocyte dematin, an actin-bundling protein of the red cell membrane skeleton, while the zinc finger domains conform to the LIM motif consensus sequence. In vitro expression studies demonstrate that abLIM protein can bind to F-actin through the dematin-like domain. Transcripts corresponding to three distinct isoforms have a widespread tissue distribution. However, a polypeptide corresponding to the full-length isoform is found exclusively in the retina and is enriched in biochemical extracts of retinal rod inner segments. abLIM protein also undergoes extensive phosphorylation in light-adapted retinas in vivo, and its developmental expression in the retina coincides with the elaboration of photoreceptor inner and outer segments. Based on the composite primary structure of abLIM protein, actin-binding capacity, potential regulation via phosphorylation, and isoform expression pattern, we speculate that abLIM may play a general role in bridging the actin-based cytoskeleton with an array of potential LIM protein-binding partners. The developmental time course of abLIM expression in the retina suggests that the retina-specific isoform may have a specialized role in the development or elaboration of photoreceptor inner and outer segments. PMID:9245787

Proteomic analysis of JAZ interacting proteins under methyl jasmonate treatment in finger millet.

PubMed

Sen, Saswati; Kundu, Sangeeta; Dutta, Samir Kr

2016-11-01

Jasmonic acid (JA) signaling pathway in plants is activated against various developmental processes as well as biotic and abiotic stresses. The Jasmonate ZIM-domain (JAZ) protein family, the key regulator of plant JA signaling pathway, also participates in phytohormone crosstalk. This is the first study revealing the in vivo interactions of finger millet (Eleusine coracana (L.) Gaertn.) JAZ protein (EcJAZ) under methyl jasmonate (MJ) treatment. The aim of the study was to explore not only the JA signaling pathway but also the phytohormone signaling crosstalk of finger millet, a highly important future crop. From the MJ-treated finger millet seedlings, the EcJAZ interacting proteins were purified by affinity chromatography with the EcJAZ-matrix. Twenty-one proteins of varying functionalities were successfully identified by MALDI-TOF-TOF Mass spectrometry. Apart from the previously identified JAZ binding proteins, most prominently, EcJAZ was found to interact with transcription factors like NAC, GATA and also with Cold responsive protein (COR), etc. that might have extended the range of functionalities of JAZ proteins. Moreover, to evaluate the interactions of EcJAZ in the JA-co-receptor complex, we generated ten in-silico models containing the EcJAZ degron and the COI1-SKP1 of five monocot cereals viz., rice, wheat, maize, Sorghum and Setaria with JA-Ile or coronatine. Our results indicated that the EcJAZ protein of finger millet could act as the signaling hub for the JA and other phytohormone signaling pathways, in response to a diverse set of stressors and developmental cues to provide survival fitness to the plant. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Developmental distribution of the plasma membrane-enriched proteome in the maize primary root growth zone.

PubMed

Zhang, Zhe; Voothuluru, Priyamvada; Yamaguchi, Mineo; Sharp, Robert E; Peck, Scott C

2013-01-01

Within the growth zone of the maize primary root, there are well-defined patterns of spatial and temporal organization of cell division and elongation. However, the processes underlying this organization remain poorly understood. To gain additional insights into the differences amongst the defined regions, we performed a proteomic analysis focusing on fractions enriched for plasma membrane (PM) proteins. The PM is the interface between the plant cell and the apoplast and/or extracellular space. As such, it is a key structure involved in the exchange of nutrients and other molecules as well as in the integration of signals that regulate growth and development. Despite the important functions of PM-localized proteins in mediating these processes, a full understanding of dynamic changes in PM proteomes is often impeded by low relative concentrations relative to total proteins. Using a relatively simple strategy of treating microsomal fractions with Brij-58 detergent to enrich for PM proteins, we compared the developmental distribution of proteins within the root growth zone which revealed a number of previously known as well as novel proteins with interesting patterns of abundance. For instance, the quantitative proteomic analysis detected a gradient of PM aquaporin proteins similar to that previously reported using immunoblot analyses, confirming the veracity of this strategy. Cellulose synthases increased in abundance with increasing distance from the root apex, consistent with expected locations of cell wall deposition. The similar distribution pattern for Brittle-stalk-2-like protein implicates that this protein may also have cell wall related functions. These results show that the simplified PM enrichment method previously demonstrated in Arabidopsis can be successfully applied to completely unrelated plant tissues and provide insights into differences in the PM proteome throughout growth and development zones of the maize primary root.

An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis

PubMed Central

Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM

2014-01-01

Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953

IT-25DEVELOPMENTALLY REGULATED ANTIGENS FOR IMMUNOLOGIC TARGETING OF MEDULLOBLASTOMA SUBTYPES

PubMed Central

Pham, Christina; Flores, Catherine; Pei, Yanxin; Wechsler-Reya, Robert; Mitchell, Duane

2014-01-01

INTRODUCTION: Medulloblastoma (MB) remains incurable in one third of patients despite aggressive multi-modality standard therapies. Immunotherapy presents a promising alternative by specifically targeting cancer cells. To date, there have been no successful immunologic applications targeting MB. Emerging evidence from integrated genomic studies has suggested MB variants arise from deregulation of pathways affecting proliferation of progenitor cell populations within the developing cerebellum. Using total embryonic RNA as a source of tumor rejection antigens is attractive because it can be delivered as a single vaccine, target both known and unknown fetal proteins, and can be refined to preferentially treat distinct MB subtypes. METHODS: We have created two transplantable, syngeneic animal MB models recapitulating human SHH and Group 3 variants to investigate the immunologic targeting of different MB subtypes. We generated T cells specific to the developing mouse cerebellum (P5) and tested their reactivity to target cells pulsed with total RNA from two MB subtypes and the normal brain. Immune responses were evaluated by measuring cytokine secretion following re-stimulation of activated T cells with both normal and tumor cell targets. In vivo antitumor efficacy was also tested in survival studies of intracranial tumor-bearing animals. RESULTS: We generated T cells specific to the developing cerebellum in vitro, confirming the immunogenicity of developmentally regulated antigens. Additionally, we have shown that developmental antigen-specific T cells produce high levels of Th1-type cytokines in response to tumor cells of two immunologically distinct subtypes of MB. Interestingly, developmental antigen specific T cells do not show cross reactivity with the normal brain or subsequent stages of the developing brain after P5. Targeting developmental antigens also conferred a significant survival benefit in a treatment model of Group 3 tumor bearing animals. CONCLUSIONS: Developmental antigens can safely target multiple MB subtypes with equal effectiveness compared to previously established total tumor strategies.

Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice.

PubMed

Zhao, Yangang; Yu, Yanlan; Zhang, Yuanyuan; He, Li; Qiu, Linli; Zhao, Jikai; Liu, Mengying; Zhang, Jiqiang

2017-03-01

In the hippocampus, local estrogens (E 2 ) derived from testosterone that is catalyzed by aromatase play important roles in the regulation of hippocampal neural plasticity, but the underlying mechanisms remain unclear. The actin cytoskeleton contributes greatly to hippocampal synaptic plasticity; however, whether it is regulated by local E 2 and the related mechanisms remain to be elucidated. In this study, we first examined the postnatal developmental profiles of hippocampal aromatase and specific proteins responsible for actin cytoskeleton dynamics. Then we used aromatase inhibitor letrozole (LET) to block local E 2 synthesis and examined the changes of these proteins and steroid receptor coactivator-1 (SRC-1), the predominant coactivator for steroid nuclear receptors. Finally, SRC-1 specific RNA interference was used to examine the effects of SRC-1 on the expression of these actin remodeling proteins. The results showed a V-type profile for aromatase and increased profiles for actin cytoskeleton proteins in both male and female hippocampus without obvious sex differences. LET treatment dramatically decreased the F-actin/G-actin ratio, the expression of Rictor, phospho-AKT (ser473), Profilin-1, phospho-Cofilin (Ser3), and SRC-1 in a dose-dependent manner. In vitro studies demonstrated that LET induced downregulation of these proteins could be reversed by E 2 , and E 2 induced increase of these proteins were significantly suppressed by SRC-1 shRNA interference. These results for the first time clearly demonstrated that local E 2 inhibition could induce aberrant actin polymerization; they also showed an important role of SRC-1 in the mediation of local E 2 action on hippocampal synaptic plasticity by regulation of actin cytoskeleton dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.

MAP kinase pathways in the yeast Saccharomyces cerevisiae

NASA Technical Reports Server (NTRS)

Gustin, M. C.; Albertyn, J.; Alexander, M.; Davenport, K.; McIntire, L. V. (Principal Investigator)

1998-01-01

A cascade of three protein kinases known as a mitogen-activated protein kinase (MAPK) cascade is commonly found as part of the signaling pathways in eukaryotic cells. Almost two decades of genetic and biochemical experimentation plus the recently completed DNA sequence of the Saccharomyces cerevisiae genome have revealed just five functionally distinct MAPK cascades in this yeast. Sexual conjugation, cell growth, and adaptation to stress, for example, all require MAPK-mediated cellular responses. A primary function of these cascades appears to be the regulation of gene expression in response to extracellular signals or as part of specific developmental processes. In addition, the MAPK cascades often appear to regulate the cell cycle and vice versa. Despite the success of the gene hunter era in revealing these pathways, there are still many significant gaps in our knowledge of the molecular mechanisms for activation of these cascades and how the cascades regulate cell function. For example, comparison of different yeast signaling pathways reveals a surprising variety of different types of upstream signaling proteins that function to activate a MAPK cascade, yet how the upstream proteins actually activate the cascade remains unclear. We also know that the yeast MAPK pathways regulate each other and interact with other signaling pathways to produce a coordinated pattern of gene expression, but the molecular mechanisms of this cross talk are poorly understood. This review is therefore an attempt to present the current knowledge of MAPK pathways in yeast and some directions for future research in this area.

SEPALLATA3: the 'glue' for MADS box transcription factor complex formation

PubMed Central

Immink, Richard GH; Tonaco, Isabella AN; de Folter, Stefan; Shchennikova, Anna; van Dijk, Aalt DJ; Busscher-Lange, Jacqueline; Borst, Jan W; Angenent, Gerco C

2009-01-01

Background Plant MADS box proteins play important roles in a plethora of developmental processes. In order to regulate specific sets of target genes, MADS box proteins dimerize and are thought to assemble into multimeric complexes. In this study a large-scale yeast three-hybrid screen is utilized to provide insight into the higher-order complex formation capacity of the Arabidopsis MADS box family. SEPALLATA3 (SEP3) has been shown to mediate complex formation and, therefore, special attention is paid to this factor in this study. Results In total, 106 multimeric complexes were identified; in more than half of these at least one SEP protein was present. Besides the known complexes involved in determining floral organ identity, various complexes consisting of combinations of proteins known to play a role in floral organ identity specification, and flowering time determination were discovered. The capacity to form this latter type of complex suggests that homeotic factors play essential roles in down-regulation of the MADS box genes involved in floral timing in the flower via negative auto-regulatory loops. Furthermore, various novel complexes were identified that may be important for the direct regulation of the floral transition process. A subsequent detailed analysis of the APETALA3, PISTILLATA, and SEP3 proteins in living plant cells suggests the formation of a multimeric complex in vivo. Conclusions Overall, these results provide strong indications that higher-order complex formation is a general and essential molecular mechanism for plant MADS box protein functioning and attribute a pivotal role to the SEP3 'glue' protein in mediating multimerization. PMID:19243611

Subcellular localization of the Snf1 kinase is regulated by specific β subunits and a novel glucose signaling mechanism

PubMed Central

Vincent, Olivier; Townley, Robert; Kuchin, Sergei; Carlson, Marian

2001-01-01

The Snf1/AMP-activated protein kinase family has broad roles in transcriptional, metabolic, and developmental regulation in response to stress. In Saccharomyces cerevisiae, Snf1 is required for the response to glucose limitation. Snf1 kinase complexes contain the α (catalytic) subunit Snf1, one of the three related β subunits Gal83, Sip1, or Sip2, and the γ subunit Snf4. We present evidence that the β subunits regulate the subcellular localization of the Snf1 kinase. Green fluorescent protein fusions to Gal83, Sip1, and Sip2 show different patterns of localization to the nucleus, vacuole, and/or cytoplasm. We show that Gal83 directs Snf1 to the nucleus in a glucose-regulated manner. We further identify a novel signaling pathway that controls this nuclear localization in response to glucose phosphorylation. This pathway is distinct from the glucose signaling pathway that inhibits Snf1 kinase activity and responds not only to glucose but also to galactose and sucrose. Such independent regulation of the localization and the activity of the Snf1 kinase, combined with the distinct localization of kinases containing different β subunits, affords versatility in regulating physiological responses. PMID:11331606

Citrinin induces apoptosis via a mitochondria-dependent pathway and inhibition of survival signals in embryonic stem cells, and causes developmental injury in blastocysts

PubMed Central

Chan, Wen-Hsiung

2007-01-01

The mycotoxin CTN (citrinin), a natural contaminant in foodstuffs and animal feeds, has cytotoxic and genotoxic effects on various mammalian cells. CTN is known to cause cell injury, including apoptosis, but the precise regulatory mechanisms of CTN action, particularly in stem cells and embryos, are currently unclear. In the present paper, I report that CTN has cytotoxic effects on mouse embryonic stem cells and blastocysts, and is associated with defects in their subsequent development, both in vitro and in vivo. Experiments in embryonic stem cells (ESC-B5) showed that CTN induces apoptosis via ROS (reactive oxygen species) generation, increased Bax/Bcl-2 ratio, loss of MMP (mitochondrial membrane potential), induction of cytochrome c release, and activation of caspase 3. In this model, CTN triggers cell death via inactivation of the HSP90 [a 90 kDa isoform of the HSP (heat-shock protein) family proteins]/multichaperone complex and subsequent degradation of Ras and Raf-1, further inhibiting anti-apoptotic processes, such as the Ras→ERK (extracellular-signal-regulated kinase) signal transduction pathway. In addition, CTN causes early developmental injury in mouse ESCs and blastocysts in vitro. Lastly, using an in vivo mouse model, I show that consumption of drinking water containing 10 μM CTN results in blastocyst apoptosis and early embryonic developmental injury. Collectively, these findings show for the first time that CTN induces ROS and mitochondria-dependent apoptotic processes, inhibits Ras→ERK survival signalling via inactivation of the HSP90/multichaperone complex, and causes developmental injury in vivo. PMID:17331071

Ribosome profiling reveals changes in translational status of soybean transcripts during immature cotyledon development

PubMed Central

Shamimuzzaman, Md.

2018-01-01

To understand translational capacity on a genome-wide scale across three developmental stages of immature soybean seed cotyledons, ribosome profiling was performed in combination with RNA sequencing and cluster analysis. Transcripts representing 216 unique genes demonstrated a higher level of translational activity in at least one stage by exhibiting higher translational efficiencies (TEs) in which there were relatively more ribosome footprint sequence reads mapping to the transcript than were present in the control total RNA sample. The majority of these transcripts were more translationally active at the early stage of seed development and included 12 unique serine or cysteine proteases and 16 2S albumin and low molecular weight cysteine-rich proteins that may serve as substrates for turnover and mobilization early in seed development. It would appear that the serine proteases and 2S albumins play a vital role in the early stages. In contrast, our investigation of profiles of 19 genes encoding high abundance seed storage proteins, such as glycinins, beta-conglycinins, lectin, and Kunitz trypsin inhibitors, showed that they all had similar patterns in which the TE values started at low levels and increased approximately 2 to 6-fold during development. The highest levels of these seed protein transcripts were found at the mid-developmental stage, whereas the highest ribosome footprint levels of only up to 1.6 TE were found at the late developmental stage. These experimental findings suggest that the major seed storage protein coding genes are primarily regulated at the transcriptional level during normal soybean cotyledon development. Finally, our analyses also identified a total of 370 unique gene models that showed very low TE values including over 48 genes encoding ribosomal family proteins and 95 gene models that are related to energy and photosynthetic functions, many of which have homology to the chloroplast genome. Additionally, we showed that genes of the chloroplast were relatively translationally inactive during seed development. PMID:29570733

Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

PubMed

Kovacs, Maria; Lopez-Duran, Nestor L

2012-04-01

For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

HSF-1 activates the ubiquitin proteasome system to promote non-apoptotic developmental cell death in C. elegans.

PubMed

Kinet, Maxime J; Malin, Jennifer A; Abraham, Mary C; Blum, Elyse S; Silverman, Melanie R; Lu, Yun; Shaham, Shai

2016-03-08

Apoptosis is a prominent metazoan cell death form. Yet, mutations in apoptosis regulators cause only minor defects in vertebrate development, suggesting that another developmental cell death mechanism exists. While some non-apoptotic programs have been molecularly characterized, none appear to control developmental cell culling. Linker-cell-type death (LCD) is a morphologically conserved non-apoptotic cell death process operating in Caenorhabditis elegans and vertebrate development, and is therefore a compelling candidate process complementing apoptosis. However, the details of LCD execution are not known. Here we delineate a molecular-genetic pathway governing LCD in C. elegans. Redundant activities of antagonistic Wnt signals, a temporal control pathway, and mitogen-activated protein kinase kinase signaling control heat shock factor 1 (HSF-1), a conserved stress-activated transcription factor. Rather than protecting cells, HSF-1 promotes their demise by activating components of the ubiquitin proteasome system, including the E2 ligase LET-70/UBE2D2 functioning with E3 components CUL-3, RBX-1, BTBD-2, and SIAH-1. Our studies uncover design similarities between LCD and developmental apoptosis, and provide testable predictions for analyzing LCD in vertebrates.

Differential assembly of alpha- and gamma-filagenins into thick filaments in Caenorhabditis elegans

NASA Technical Reports Server (NTRS)

Liu, F.; Ortiz, I.; Hutagalung, A.; Bauer, C. C.; Cook, R. G.; Epstein, H. F.

2000-01-01

Muscle thick filaments are highly organized supramolecular assemblies of myosin and associated proteins with lengths, diameters and flexural rigidities characteristic of their source. The cores of body wall muscle thick filaments of the nematode Caenorhabditis elegans are tubular structures of paramyosin sub-filaments coupled by filagenins and have been proposed to serve as templates for the assembly of native thick filaments. We have characterized alpha- and gamma-filagenins, two novel proteins of the cores with calculated molecular masses of 30,043 and 19,601 and isoelectric points of 10.52 and 11.49, respectively. Western blot and immunoelectron microscopy using affinity-purified antibodies confirmed that the two proteins are core components. Immunoelectron microscopy of the cores revealed that they assemble with different periodicities. Immunofluorescence microscopy showed that alpha-filagenin is localized in the medial regions of the A-bands of body wall muscle cells whereas gamma-filagenin is localized in the flanking regions, and that alpha-filagenin is expressed in 1.5-twofold embryos while gamma-filagenin becomes detectable only in late vermiform embryos. The expression of both proteins continues throughout later stages of development. C. elegans body wall muscle thick filaments of these developmental stages have distinct lengths. Our results suggest that the differential assembly of alpha- and gamma-filagenins into thick filaments of distinct lengths may be developmentally regulated.

The immunoglobulin-like domains 1 and 2 of the protein tyrosine phosphatase LAR adopt an unusual horseshoe-like conformation

PubMed Central

Biersmith, Bridget H.; Hammel, Michal; Geisbrecht, Erika R.; Bouyain, Samuel

2011-01-01

Neurogenesis depends on exquisitely regulated interactions between macromolecules on the cell surface and in the extracellular matrix. In particular, interactions between proteoglycans and members of the type IIa subgroup of receptor protein tyrosine phosphatases underlie critical developmental processes such as the formation of synapses at the neuromuscular junction and the migration of axons to their appropriate targets. We report here the crystal structures of the first and second immunoglobulin-like domains of the Drosophila type IIa receptor Dlar and its mouse homologue LAR. These two domains adopt an unusual antiparallel arrangement that has not been previously observed in tandem repeats of immunoglobulin-like domains and that is presumably conserved in all type IIa receptor protein tyrosine phosphatases. PMID:21402080

RAPTOR controls developmental growth transitions by altering the hormonal and metabolic balance.

PubMed

Salem, Mohamed A; Li, Yan; Bajdzienko, Krzysztof; Fisahn, Joachim; Watanabe, Mutsumi; Hoefgen, Rainer; Schöttler, Mark Aurel; Giavalisco, Patrick

2018-04-23

Vegetative growth requires the systemic coordination of numerous cellular processes, which are controlled by regulatory proteins that monitor extra- and intra-cellular cues and translate them into growth decisions. In eukaryotes, one of the central factors regulating growth is the Ser/Thr protein kinase Target of Rapamycin (TOR), which forms complexes with regulatory proteins. To understand the function of one such regulatory protein, Regulatory-Associated Protein of TOR 1B (RAPTOR1B) in plants, we analyzed the effect of raptor1b mutations on growth and physiology in Arabidopsis thaliana by detailed phenotyping, metabolomic, lipidomic, and proteomic analysis. Mutation of RAPTR1B resulted in a strong reduction of TOR kinase activity, leading to massive changes in central carbon and nitrogen metabolism, accumulation of excess starch, and induction of autophagy. These shifts led to a significant, reduction of plant growth that occurred non-linearly during developmental stage transtions.. This phenotype was accompanied by changes in cell morphology and tissue anatomy. In contrast to previous studies in rice, we found that the Arabidopsis raptor1b mutation did not affect chloroplast development or photosynthetic electron transport efficiency; however, it resulted in decreased CO2 assimilation rate and increased stomatal conductance. The raptor1b mutants also had reduced abscisic acid levels. Surprisingly, ABA feeding experiments resulted in partial complementation of the growth phenotypes, indicating the tight interaction between TOR function and hormone synthesis and signaling in plants. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs

PubMed Central

Goodale, B. C.; La Du, J.; Tilton, S. C.; Sullivan, C. M.; Bisson, W. H.; Waters, K. M.; Tanguay, R. L.

2015-01-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. PMID:26141390

Immunolocalization of a Histidine-Rich Epidermal Differentiation Protein in the Chicken Supports the Hypothesis of an Evolutionary Developmental Link between the Embryonic Subperiderm and Feather Barbs and Barbules

PubMed Central

Alibardi, Lorenzo; Holthaus, Karin Brigit; Sukseree, Supawadee; Hermann, Marcela; Tschachler, Erwin

2016-01-01

The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC) encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine), which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14–18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs). Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP) and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm. PMID:27936131

Evolution of developmental regulation in the vertebrate FgfD subfamily.

PubMed

Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

2010-01-15

Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

C. elegans microRNAs.

PubMed

Vella, Monica C; Slack, Frank J

2005-09-21

MicroRNAs (miRNAs) are small, non-coding regulatory RNAs found in many phyla that control such diverse events as development, metabolism, cell fate and cell death. They have also been implicated in human cancers. The C. elegans genome encodes hundreds of miRNAs, including the founding members of the miRNA family lin-4 and let-7. Despite the abundance of C. elegans miRNAs, few miRNA targets are known and little is known about the mechanism by which they function. However, C. elegans research continues to push the boundaries of discovery in this area. lin-4 and let-7 are the best understood miRNAs. They control the timing of adult cell fate determination in hypodermal cells by binding to partially complementary sites in the mRNA of key developmental regulators to repress protein expression. For example, lin-4 is predicted to bind to seven sites in the lin-14 3' untranslated region (UTR) to repress LIN-14, while let-7 is predicted to bind two let-7 complementary sites in the lin-41 3' UTR to down-regulate LIN-41. Two other miRNAs, lsy-6 and mir-273, control left-right asymmetry in neural development, and also target key developmental regulators for repression. Approximately one third of the C. elegans miRNAs are differentially expressed during development indicating a major role for miRNAs in C. elegans development. Given the remarkable conservation of developmental mechanism across phylogeny, many of the principles of miRNAs discovered in C. elegans are likely to be applicable to higher animals.

Discovery of nitrate-CPK-NLP signalling in central nutrient-growth networks

PubMed Central

Liu, Kun-hsiang; Niu, Yajie; Konishi, Mineko; Wu, Yue; Du, Hao; Sun Chung, Hoo; Li, Lei; Boudsocq, Marie; McCormack, Matthew; Maekawa, Shugo; Ishida, Tetsuya; Zhang, Chao; Shokat, Kevan; Yanagisawa, Shuichi; Sheen, Jen

2018-01-01

Nutrient signalling integrates and coordinates gene expression, metabolism and growth. However, its primary molecular mechanisms remain incompletely understood in plants and animals. Here we report novel Ca2+ signalling triggered by nitrate with live imaging of an ultrasensitive biosensor in Arabidopsis leaves and roots. A nitrate-sensitized and targeted functional genomic screen identifies subgroup III Ca2+-sensor protein kinases (CPKs) as master regulators orchestrating primary nitrate responses. A chemical switch with the engineered CPK10(M141G) kinase enables conditional analyses of cpk10,30,32 to define comprehensive nitrate-associated regulatory and developmental programs, circumventing embryo lethality. Nitrate-CPK signalling phosphorylates conserved NIN-LIKE PROTEIN (NLP) transcription factors (TFs) to specify reprogramming of gene sets for downstream TFs, transporters, N-assimilation, C/N-metabolism, redox, signalling, hormones, and proliferation. Conditional cpk10,30,32 and nlp7 similarly impair nitrate-stimulated system-wide shoot growth and root establishment. The nutrient-coupled Ca2+ signalling network integrates transcriptome and cellular metabolism with shoot-root coordination and developmental plasticity in shaping organ biomass and architecture. PMID:28489820

An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

PubMed

Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

2002-08-01

Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

Discovery of nitrate-CPK-NLP signalling in central nutrient-growth networks.

PubMed

Liu, Kun-Hsiang; Niu, Yajie; Konishi, Mineko; Wu, Yue; Du, Hao; Sun Chung, Hoo; Li, Lei; Boudsocq, Marie; McCormack, Matthew; Maekawa, Shugo; Ishida, Tetsuya; Zhang, Chao; Shokat, Kevan; Yanagisawa, Shuichi; Sheen, Jen

2017-05-18

Nutrient signalling integrates and coordinates gene expression, metabolism and growth. However, its primary molecular mechanisms remain incompletely understood in plants and animals. Here we report unique Ca 2+ signalling triggered by nitrate with live imaging of an ultrasensitive biosensor in Arabidopsis leaves and roots. A nitrate-sensitized and targeted functional genomic screen identifies subgroup III Ca 2+ -sensor protein kinases (CPKs) as master regulators that orchestrate primary nitrate responses. A chemical switch with the engineered mutant CPK10(M141G) circumvents embryo lethality and enables conditional analyses of cpk10 cpk30 cpk32 triple mutants to define comprehensive nitrate-associated regulatory and developmental programs. Nitrate-coupled CPK signalling phosphorylates conserved NIN-LIKE PROTEIN (NLP) transcription factors to specify the reprogramming of gene sets for downstream transcription factors, transporters, nitrogen assimilation, carbon/nitrogen metabolism, redox, signalling, hormones and proliferation. Conditional cpk10 cpk30 cpk32 and nlp7 mutants similarly impair nitrate-stimulated system-wide shoot growth and root establishment. The nutrient-coupled Ca 2+ signalling network integrates transcriptome and cellular metabolism with shoot-root coordination and developmental plasticity in shaping organ biomass and architecture.

MEDIATOR18 and MEDIATOR20 confer susceptibility to Fusarium oxysporum in Arabidopsis thaliana

PubMed Central

Stiller, Jiri; Davoine, Celine; Björklund, Stefan; Manners, John M.; Kazan, Kemal; Schenk, Peer M.

2017-01-01

The conserved protein complex known as Mediator conveys transcriptional signals by acting as an intermediary between transcription factors and RNA polymerase II. As a result, Mediator subunits play multiple roles in regulating developmental as well as abiotic and biotic stress pathways. In this report we identify the head domain subunits MEDIATOR18 and MEDIATOR20 as important susceptibility factors for Fusarium oxysporum infection in Arabidopsis thaliana. Mutants of MED18 and MED20 display down-regulation of genes associated with jasmonate signaling and biosynthesis while up-regulation of salicylic acid associated pathogenesis related genes and reactive oxygen producing and scavenging genes. We propose that MED18 and MED20 form a sub-domain within Mediator that controls the balance of salicylic acid and jasmonate associated defense pathways. PMID:28441405

A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.

PubMed

Neal, Scott J; Park, JiSoo; DiTirro, Danielle; Yoon, Jason; Shibuya, Mayumi; Choi, Woochan; Schroeder, Frank C; Butcher, Rebecca A; Kim, Kyuhyung; Sengupta, Piali

2016-05-03

Animals must constantly assess their surroundings and integrate sensory cues to make appropriate behavioral and developmental decisions. Pheromones produced by conspecific individuals provide critical information regarding environmental conditions. Ascaroside pheromone concentration and composition are instructive in the decision of Caenorhabditis elegans to either develop into a reproductive adult or enter into the stress-resistant alternate dauer developmental stage. Pheromones are sensed by a small set of sensory neurons, and integrated with additional environmental cues, to regulate neuroendocrine signaling and dauer formation. To identify molecules required for pheromone-induced dauer formation, we performed an unbiased forward genetic screen and identified phd (pheromone response-defective dauer) mutants. Here, we describe new roles in dauer formation for previously identified neuronal molecules such as the WD40 domain protein QUI-1 and MACO-1 Macoilin, report new roles for nociceptive neurons in modulating pheromone-induced dauer formation, and identify tau tubulin kinases as new genes involved in dauer formation. Thus, phd mutants define loci required for the detection, transmission, or integration of pheromone signals in the regulation of dauer formation. Copyright © 2016 Neal et al.

Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

PubMed Central

Kaneko, Kunihiko

2011-01-01

The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

Drosophila Suppressor of Sable Protein [Su(s)] Promotes Degradation of Aberrant and Transposon-Derived RNAs▿

PubMed Central

Kuan, Yung-Shu; Brewer-Jensen, Paul; Bai, Wen-Li; Hunter, Cedric; Wilson, Carrie B.; Bass, Sarah; Abernethy, John; Wing, James S.; Searles, Lillie L.

2009-01-01

RNA-binding proteins act at various stages of gene expression to regulate and fine-tune patterns of mRNA accumulation. One protein in this class is Drosophila Su(s), a nuclear protein that has been previously shown to inhibit the accumulation of mutant transcripts by an unknown mechanism. Here, we have identified several additional RNAs that are downregulated by Su(s). These Su(s) targets include cryptic wild-type transcripts from the developmentally regulated Sgs4 and ng1 genes, noncoding RNAs derived from tandemly repeated αβ/αγ elements within an Hsp70 locus, and aberrant transcripts induced by Hsp70 promoter transgenes inserted at ectopic sites. We used the αβ RNAs to investigate the mechanism of Su(s) function and obtained evidence that these transcripts are degraded by the nuclear exosome and that Su(s) promotes this process. Furthermore, we showed that the RNA binding domains of Su(s) are important for this effect and mapped the sequences involved to a 267-nucleotide region of an αβ element. Taken together, these results suggest that Su(s) binds to certain nascent transcripts and stimulates their degradation by the nuclear exosome. PMID:19687295

Functional O-GlcNAc modifications: Implications in molecular regulation and pathophysiology

PubMed Central

Wells, Lance

2016-01-01

O-linked β-N-acetylglucosamine (O-GlcNAc) is a regulatory post-translational modification of intracellular proteins. The dynamic and inducible cycling of the modification is governed by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) in response to UDP-GlcNAc levels in the hexosamine biosynthetic pathway (HBP). Due to its reliance on glucose flux and substrate availability, a major focus in the field has been on how O-GlcNAc contributes to metabolic disease. For years this post-translational modification has been known to modify thousands of proteins implicated in various disorders, but direct functional connections have until recently remained elusive. New research is beginning to reveal the specific mechanisms through which O-GlcNAc influences cell dynamics and disease pathology including clear examples of O-GlcNAc modification at a specific site on a given protein altering its biological functions. The following review intends to focus primarily on studies in the last half decade linking O-GlcNAc modification of proteins with chromatin-directed gene regulation, developmental processes, and several metabolically related disorders including Alzheimer’s, heart disease and cancer. These studies illustrate the emerging importance of this post-translational modification in biological processes and multiple pathophysiologies. PMID:24524620

Regulatory coding of lymphoid lineage choice by hematopoietic transcription factors

NASA Technical Reports Server (NTRS)

Warren, Luigi A.; Rothenberg, Ellen V.

2003-01-01

During lymphopoiesis, precursor cells negotiate a complex regulatory space, defined by the levels of several competing and cross-regulating transcription factors, before arriving at stable states of commitment to the B-, T- and NK-specific developmental programs. Recent perturbation experiments provide evidence that this space has three major axes, corresponding to the PU.1 versus GATA-1 balance, the intensity of Notch signaling through the CSL pathway, and the ratio of E-box transcription factors to their Id protein antagonists.

Spaceflight Activates Protein Kinase C Alpha Signaling and Modifies the Developmental Stage of Human Neonatal Cardiovascular Progenitor Cells.

PubMed

Baio, Jonathan; Martinez, Aida F; Bailey, Leonard; Hasaniya, Nahidh; Pecaut, Michael J; Kearns-Jonker, Mary

2018-02-12

Spaceflight impacts cardiovascular function in astronauts; however, its impact on cardiac development and the stem cells that form the basis for cardiac repair is unknown. Accordingly, further research is needed to uncover the potential relevance of such changes to human health. Using simulated microgravity (SMG) generated by two-dimensional clinorotation and culture aboard the International Space Station (ISS), we assessed the effects of mechanical unloading on human neonatal cardiovascular progenitor cell (CPC) developmental properties and signaling. Following 6-7 days of SMG and 12 days of ISS culture, we analyzed changes in gene expression. Both environments induced the expression of genes that are typically associated with an earlier state of cardiovascular development. To understand the mechanism by which such changes occurred, we assessed the expression of mechanosensitive small RhoGTPases in SMG-cultured CPCs and observed decreased levels of RHOA and CDC42. Given the effect of these molecules on intracellular calcium levels, we evaluated changes in noncanonical Wnt/calcium signaling. After 6-7 days under SMG, CPCs exhibited elevated levels of WNT5A and PRKCA. Similarly, ISS-cultured CPCs exhibited elevated levels of calcium handling and signaling genes, which corresponded to protein kinase C alpha (PKCα), a calcium-dependent protein kinase, activation after 30 days. Akt was activated, whereas phosphorylated extracellular signal-regulated kinase levels were unchanged. To explore the effect of calcium induction in neonatal CPCs, we activated PKCα using hWnt5a treatment on Earth. Subsequently, early cardiovascular developmental marker levels were elevated. Transcripts induced by SMG and hWnt5a-treatment are expressed within the sinoatrial node, which may represent embryonic myocardium maintained in its primitive state. Calcium signaling is sensitive to mechanical unloading and directs CPC developmental properties. Further research both in space and on Earth may help refine the use of CPCs in stem cell-based therapies and highlight the molecular events of development.

Sensitivity of hiPSC-derived neural stem cells (NSC) to Pyrroloquinoline quinone depends on their developmental stage.

PubMed

Augustyniak, J; Lenart, J; Zychowicz, M; Lipka, G; Gaj, P; Kolanowska, M; Stepien, P P; Buzanska, L

2017-12-01

Pyrroloquinoline quinone (PQQ) is a factor influencing on the mitochondrial biogenesis. In this study the PQQ effect on viability, total cell number, antioxidant capacity, mitochondrial biogenesis and differentiation potential was investigated in human induced Pluripotent Stem Cells (iPSC) - derived: neural stem cells (NSC), early neural progenitors (eNP) and neural progenitors (NP). Here we demonstrated that sensitivity to PQQ is dependent upon its dose and neural stage of development. Induction of the mitochondrial biogenesis by PQQ at three stages of neural differentiation was evaluated at mtDNA, mRNA and protein level. Changes in NRF1, TFAM and PPARGC1A gene expression were observed at all developmental stages, but only at eNP were correlated with the statistically significant increase in the mtDNA copy numbers and enhancement of SDHA, COX-1 protein level. Thus, the "developmental window" of eNP for PQQ-evoked mitochondrial biogenesis is proposed. This effect was independent of high antioxidant capacity of PQQ, which was confirmed in all tested cell populations, regardless of the stage of hiPSC neural differentiation. Furthermore, a strong induction of GFAP, with down regulation of MAP2 gene expression upon PQQ treatment was observed. This indicates a possibility of shifting the balance of cell differentiation in the favor of astroglia, but more research is needed at this point. Copyright © 2017 Elsevier Ltd. All rights reserved.

PIN6 auxin transporter at endoplasmic reticulum and plasma membrane mediates auxin homeostasis and organogenesis in Arabidopsis.

PubMed

Simon, Sibu; Skůpa, Petr; Viaene, Tom; Zwiewka, Marta; Tejos, Ricardo; Klíma, Petr; Čarná, Mária; Rolčík, Jakub; De Rycke, Riet; Moreno, Ignacio; Dobrev, Petre I; Orellana, Ariel; Zažímalová, Eva; Friml, Jiří

2016-07-01

Plant development mediated by the phytohormone auxin depends on tightly controlled cellular auxin levels at its target tissue that are largely established by intercellular and intracellular auxin transport mediated by PIN auxin transporters. Among the eight members of the Arabidopsis PIN family, PIN6 is the least characterized candidate. In this study we generated functional, fluorescent protein-tagged PIN6 proteins and performed comprehensive analysis of their subcellular localization and also performed a detailed functional characterization of PIN6 and its developmental roles. The localization study of PIN6 revealed a dual localization at the plasma membrane (PM) and endoplasmic reticulum (ER). Transport and metabolic profiling assays in cultured cells and Arabidopsis strongly suggest that PIN6 mediates both auxin transport across the PM and intracellular auxin homeostasis, including the regulation of free auxin and auxin conjugates levels. As evidenced by the loss- and gain-of-function analysis, the complex function of PIN6 in auxin transport and homeostasis is required for auxin distribution during lateral and adventitious root organogenesis and for progression of these developmental processes. These results illustrate a unique position of PIN6 within the family of PIN auxin transporters and further add complexity to the developmentally crucial process of auxin transport. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

PubMed

Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

2017-10-01

The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

Behind the curtain of non-coding RNAs; long non-coding RNAs regulating hepatocarcinogenesis

PubMed Central

El Khodiry, Aya; Afify, Menna; El Tayebi, Hend M

2018-01-01

Hepatocellular carcinoma (HCC) is one of the most common and aggressive cancers worldwide. HCC is the fifth common malignancy in the world and the second leading cause of cancer death in Asia. Long non-coding RNAs (lncRNAs) are RNAs with a length greater than 200 nucleotides that do not encode proteins. lncRNAs can regulate gene expression and protein synthesis in several ways by interacting with DNA, RNA and proteins in a sequence specific manner. They could regulate cellular and developmental processes through either gene inhibition or gene activation. Many studies have shown that dysregulation of lncRNAs is related to many human diseases such as cardiovascular diseases, genetic disorders, neurological diseases, immune mediated disorders and cancers. However, the study of lncRNAs is challenging as they are poorly conserved between species, their expression levels aren’t as high as that of mRNAs and have great interpatient variations. The study of lncRNAs expression in cancers have been a breakthrough as it unveils potential biomarkers and drug targets for cancer therapy and helps understand the mechanism of pathogenesis. This review discusses many long non-coding RNAs and their contribution in HCC, their role in development, metastasis, and prognosis of HCC and how to regulate and target these lncRNAs as a therapeutic tool in HCC treatment in the future. PMID:29434445

Ecdysone-Induced Receptor Tyrosine Phosphatase PTP52F Regulates Drosophila Midgut Histolysis by Enhancement of Autophagy and Apoptosis

PubMed Central

Santhanam, Abirami; Peng, Wen-Hsin; Yu, Ya-Ting; Sang, Tzu-Kang

2014-01-01

The rapid removal of larval midgut is a critical developmental process directed by molting hormone ecdysone during Drosophila metamorphosis. To date, it remains unclear how the stepwise events can link the onset of ecdysone signaling to the destruction of larval midgut. This study investigated whether ecdysone-induced expression of receptor protein tyrosine phosphatase PTP52F regulates this process. The mutation of the Ptp52F gene caused significant delay in larval midgut degradation. Transitional endoplasmic reticulum ATPase (TER94), a regulator of ubiquitin proteasome system, was identified as a substrate and downstream effector of PTP52F in the ecdysone signaling. The inducible expression of PTP52F at the puparium formation stage resulted in dephosphorylation of TER94 on its Y800 residue, ensuring the rapid degradation of ubiquitylated proteins. One of the proteins targeted by dephosphorylated TER94 was found to be Drosophila inhibitor of apoptosis 1 (DIAP1), which was rapidly proteolyzed in cells with significant expression of PTP52F. Importantly, the reduced level of DIAP1 in response to inducible PTP52F was essential not only for the onset of apoptosis but also for the initiation of autophagy. This study demonstrates a novel function of PTP52F in regulating ecdysone-directed metamorphosis via enhancement of autophagic and apoptotic cell death in doomed Drosophila midguts. PMID:24550005

Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells

PubMed Central

Pauwels, Laurens; Morreel, Kris; De Witte, Emilie; Lammertyn, Freya; Van Montagu, Marc; Boerjan, Wout; Inzé, Dirk; Goossens, Alain

2008-01-01

Jasmonates (JAs) are plant-specific signaling molecules that steer a diverse set of physiological and developmental processes. Pathogen attack and wounding inflicted by herbivores induce the biosynthesis of these hormones, triggering defense responses both locally and systemically. We report on alterations in the transcriptome of a fast-dividing cell culture of the model plant Arabidopsis thaliana after exogenous application of methyl JA (MeJA). Early MeJA response genes encoded the JA biosynthesis pathway proteins and key regulators of MeJA responses, including most JA ZIM domain proteins and MYC2, together with transcriptional regulators with potential, but yet unknown, functions in MeJA signaling. In a second transcriptional wave, MeJA reprogrammed cellular metabolism and cell cycle progression. Up-regulation of the monolignol biosynthesis gene set resulted in an increased production of monolignols and oligolignols, the building blocks of lignin. Simultaneously, MeJA repressed activation of M-phase genes, arresting the cell cycle in G2. MeJA-responsive transcription factors were screened for their involvement in early signaling events, in particular the regulation of JA biosynthesis. Parallel screens based on yeast one-hybrid and transient transactivation assays identified both positive (MYC2 and the AP2/ERF factor ORA47) and negative (the C2H2 Zn finger proteins STZ/ZAT10 and AZF2) regulators, revealing a complex control of the JA autoregulatory loop and possibly other MeJA-mediated downstream processes. PMID:18216250

The Production of Curli Amyloid Fibers Is Deeply Integrated into the Biology of Escherichia coli

PubMed Central

Smith, Daniel R.; Price, Janet E.; Burby, Peter E.; Blanco, Luz P.; Chamberlain, Justin; Chapman, Matthew R.

2017-01-01

Curli amyloid fibers are the major protein component of the extracellular matrix produced by Enterobacteriaceae during biofilm formation. Curli are required for proper biofilm development and environmental persistence by Escherichia coli. Here, we present a complete and vetted genetic analysis of functional amyloid fiber biogenesis. The Keio collection of single gene deletions was screened on Congo red indicator plates to identify E. coli mutants that had defective amyloid production. We discovered that more than three hundred gene products modulated curli production. These genes were involved in fundamental cellular processes such as regulation, environmental sensing, respiration, metabolism, cell envelope biogenesis, transport, and protein turnover. The alternative sigma factors, σS and σE, had opposing roles in curli production. Mutations that induced the σE or Cpx stress response systems had reduced curli production, while mutant strains with increased σS levels had increased curli production. Mutations in metabolic pathways, including gluconeogenesis and the biosynthesis of lipopolysaccharide (LPS), produced less curli. Regulation of the master biofilm regulator, CsgD, was diverse, and the screen revealed several proteins and small RNAs (sRNA) that regulate csgD messenger RNA (mRNA) levels. Using previously published studies, we found minimal overlap between the genes affecting curli biogenesis and genes known to impact swimming or swarming motility, underlying the distinction between motile and sessile lifestyles. Collectively, the diversity and number of elements required suggest curli production is part of a highly regulated and complex developmental pathway in E. coli. PMID:29088115

Bovine oocytes and early embryos express Staufen and ELAVL RNA-binding proteins.

PubMed

Calder, M D; Madan, P; Watson, A J

2008-05-01

RNA-binding proteins (RBP) influence RNA editing, localization, stability and translation and may contribute to oocyte developmental competence by regulating the stability and turnover of oogenetic mRNAs. The expression of Staufen 1 and 2 and ELAVL1, ELAVL2 RNA-binding proteins during cow early development was characterized. Cumulus-oocyte complexes were collected from slaughterhouse ovaries, matured, inseminated and subjected to embryo culture in vitro. Oocyte or preimplantation embryo pools were processed for RT-PCR and whole-mount immunofluorescence analysis of mRNA expression and protein distribution. STAU1 and STAU2 and ELAVL1 mRNAs and proteins were detected throughout cow preimplantation development from the germinal vesicle (GV) oocyte to the blastocyst stage. ELAVL2 mRNAs were detectable from the GV to the morula stage, whereas ELAVL2 protein was in all stages examined and localized to both cytoplasm and nuclei. The findings provide a foundation for investigating the role of RBPs during mammalian oocyte maturation and early embryogenesis.

A MADS box protein interacts with a mating-type protein and is required for fruiting body development in the homothallic ascomycete Sordaria macrospora.

PubMed

Nolting, Nicole; Pöggeler, Stefanie

2006-07-01

MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Deltamcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development.

Transcriptional regulation of mammalian selenoprotein expression

PubMed Central

Stoytcheva, Zoia R.; Berry, Marla J.

2009-01-01

Background Selenoproteins contain the twenty-first amino acid, selenocysteine, and are involved in cellular defenses against oxidative damage, important metabolic and developmental pathways, and responses to environmental challenges. Elucidating the mechanisms regulating selenoprotein expression at the transcriptional level is key to understanding how these mechanisms are called into play to respond to the changing environment. Methods This review summarizes published studies on transcriptional regulation of selenoprotein genes, focused primarily on genes whose encoded protein functions are at least partially understood. This is followed by in silico analysis of predicted regulatory elements in selenoprotein genes, including those in the aforementioned category as well as the genes whose functions are not known. Results Our findings reveal regulatory pathways common to many selenoprotein genes, including several involved in stress-responses. In addition, tissue-specific regulatory factors are implicated in regulating many selenoprotein genes. Conclusions These studies provide new insights into how selenoprotein genes respond to environmental and other challenges, and the roles these proteins play in allowing cells to adapt to these changes. General Significance Elucidating the regulatory mechanisms affecting selenoprotein expression is essential for understanding their roles in human diseases, and for developing diagnostic and potential therapeutic approaches to address dysregulation of members of this gene family. PMID:19465084

Defining pancreatic endocrine precursors and their descendants.

PubMed

White, Peter; May, Catherine Lee; Lamounier, Rodrigo N; Brestelli, John E; Kaestner, Klaus H

2008-03-01

The global incidence of diabetes continues to increase. Cell replacement therapy and islet transplantation offer hope, especially for severely affected patients. Efforts to differentiate insulin-producing beta-cells from progenitor or stem cells require knowledge of the transcriptional programs that regulate the development of the endocrine pancreas. Differentiation toward the endocrine lineage is dependent on the transcription factor Neurogenin 3 (Neurog3, Ngn3). We utilize a Neurog3-enhanced green fluorescent protein knock-in mouse model to isolate endocrine progenitor cells from embryonic pancreata (embryonic day [E]13.5 through E17.5). Using advanced genomic approaches, we generate a comprehensive gene expression profile of these progenitors and their immediate descendants. A total of 1,029 genes were identified as being temporally regulated in the endocrine lineage during fetal development, 237 of which are transcriptional regulators. Through pathway analysis, we have modeled regulatory networks involving these proteins that highlight the complex transcriptional hierarchy governing endocrine differentiation. We have been able to accurately capture the gene expression profile of the pancreatic endocrine progenitors and their descendants. The list of temporally regulated genes identified in fetal endocrine precursors and their immediate descendants provides a novel and important resource for developmental biologists and diabetes researchers alike.

In silico analysis of single-cell RNA sequencing data from 3 and 7 days old mouse spermatogonial stem cells to identify their differentially expressed genes and transcriptional regulators.

PubMed

Sisakhtnezhad, Sajjad

2018-05-11

Spermatogonial stem cells (SSCs), which are at the basis of spermatogenesis process, are valuable cells with different applications in biotechnology and regenerative medicine. Understanding the molecular basis of SSC self-renewal and differentiation at various developmental stages of the male organism is crucial to find key factors in the SSCs fate and function. Therefore, this study was aimed to use single-cell RNA-sequencing dataset analysis for identification of differentially expressed genes (DEGs) and their regulators in 3 and 7 days old mouse-derived single SSCs (mSSCs). Results showed 68 upregulated and 203 downregulated genes in 7 days old mouse-derived SSCs compared to 3 days old mSSCs, which were associated with 1493 and 3077 biological processes, respectively. It also found that DAZL, FKBP6, PAIP2, DDX4, H3F3B, TEX15, XRN2, MAEL, and SOD1 are important factors with the higher gene expression pattern, which may be pivotal for mSSCs fate and function during development of germ cells. Moreover, NR3C1, RXRA, NCOA, ESR1, PML, ATF2, BMI1, POU5F1, and CHD1 were the main central regulators for the upregulated DEGs, while HNF1A, C/EBPα, and NFATC1 were the master regulators for the downregulated DEGs. In this regard, two significant protein complexes were found in the protein-protein interactions network for the upregulated DEGs regulators. Furthermore, 24 protein kinases detected upstream of the main central regulators of DEGs. In conclusion, this study presents DEGs and their transcriptional regulators that are crucial for inducing and regulating SSCs commitment during development, and for developing efficient protocols to identify and isolate SSCs for different applications. © 2018 Wiley Periodicals, Inc.

Altered cell-matrix associated ADAM proteins in Alzheimer disease.

PubMed

Gerst, J L; Raina, A K; Pirim, I; McShea, A; Harris, P L; Siedlak, S L; Takeda, A; Petersen, R B; Smith, M A

2000-03-01

Alterations in cell-matrix 'contact' are often related to a disruption of cell cycle regulation and, as such, occur variously in neoplasia. Given the recent findings showing cell cycle alterations in Alzheimer disease, we undertook a study of ADAM-1 and 2 (A Disintegrin And Metalloprotease), developmentally-regulated, integrin-binding, membrane-bound metalloproteases. Our results show that whereas ADAM-1 and 2 are found in susceptible hippocampal neurons in Alzheimer disease, these proteins were not generally increased in similar neuronal populations in younger or age-matched controls except in association with age-related neurofibrillary alterations. This increase in both ADAM-1 and 2 in cases of Alzheimer disease was verified by immunoblot analysis (P < 0.05). An ADAM-induced loss of matrix integration would effectively "reset" the mitotic clock and thereby stimulate re-entry into the cell cycle in neurons in Alzheimer disease. Furthermore, given the importance of integrins in maintaining short-term memory, alterations in ADAM proteins or their proteolytic activity could also play a proximal role in the clinico-pathological manifestations of Alzheimer disease. Copyright 2000 Wiley-Liss, Inc.

Egfl6 is involved in zebrafish notochord development.

PubMed

Wang, Xueqian; Wang, Xin; Yuan, Wei; Chai, Renjie; Liu, Dong

2015-08-01

The epidermal growth factor (EGF) repeat motif defines a superfamily of diverse protein involved in regulating a variety of cellular and physiological processes, such as cell cycle, cell adhesion, proliferation, migration, and neural development. Egfl6, an EGF protein, also named MAGE was first cloned in human tissue. Up to date, the study of zebrafish Egfl6 expression pattern and functional analysis of Egfl6 involved in embryonic development of vertebrate in vivo is thus far lacking. Here we reported that Egfl6 was involved in zebrafish notochord development. It was shown that Egfl6 mRNA was expressed in zebrafish, developing somites, fin epidermis, pharyngeal arches, and hindbrain region. Particularly the secreted Egfl6 protein was significantly accumulated in notochord. Loss of Egfl6 function in zebrafish embryos resulted in curved body with distorted notochord in the posterior trunk. It was observed that expression of all Notch ligand and receptors in notochord of 28 hpf Egfl6 morphants was not affected, except notch2, which was up-regulated. We found that inhibition of Notch signaling by DAPT efficiently rescued notochord developmental defect of Egfl6 deficiency embryos.

Regulatory functions of SnRK1 in stress-responsive gene expression and in plant growth and development.

PubMed

Cho, Young-Hee; Hong, Jung-Woo; Kim, Eun-Chul; Yoo, Sang-Dong

2012-04-01

Sucrose-nonfermentation1-related protein kinase1 (SnRK1) is an evolutionarily conserved energy sensor protein that regulates gene expression in response to energy depletion in plants. Efforts to elucidate the functions and mechanisms of this protein kinase are hampered, however, by inherent growth defects of snrk1-null mutant plants. To overcome these limitations and study SnRK1 functions in vivo, we applied a method combining transient expression in leaf mesophyll protoplasts and stable expression in transgenic plants. We found that both rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana) SnRK1 activities critically influence stress-inducible gene expression and the induction of stress tolerance. Genetic, molecular, and chromatin immunoprecipitation analyses further revealed that the nuclear SnRK1 modulated target gene transcription in a submergence-dependent manner. From early seedling development through late senescence, SnRK1 activities appeared to modulate developmental processes in the plants. Our findings offer insight into the regulatory functions of plant SnRK1 in stress-responsive gene regulation and in plant growth and development throughout the life cycle.