Bone Densitometry (Bone Density Scan)
... News Physician Resources Professions Site Index A-Z Bone Densitometry (DEXA) Bone densitometry, also called dual-energy ... limitations of DEXA Bone Densitometry? What is a Bone Density Scan (DEXA)? Bone density scanning, also called ...
... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis - BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...
Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi
2015-01-01
Objective: To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. Methods: 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. Results: The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). Conclusion: US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age. PMID:27027001
Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi
2011-01-01
To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age.
The Factors Affecting Bone Density in Cirrhosis
Hajiabbasi, Asghar; Shafaghi, Afshin; Fayazi, Haniyeh Sadat; Shenavar Masooleh, Irandokht; Hedayati Emami, Mohammad Hassan; Ghavidel Parsa, Pooneh; Amir Maafi, Alireza
2015-01-01
Background: Bone loss is common in cirrhosis. However, the prevalence of osteopenia and osteoporosis has been heterogeneous in different reports. Reduction in bone formation with or without increase in bone resorption appears to be responsible for bone loss in these patients. Objectives: We aimed to investigate bone loss in patients with cirrhosis at different anatomical sites and key factors that might affect it. Patients and Methods: In this cross-sectional study, 97 patients with cirrhosis who were referred to Razi Hospital, Rasht, Iran, from 2008 to 2010, were studied. Cirrhosis was diagnosed using biopsy and/or clinical and paraclinical findings. Bone mineral densitometry was done in L2 through L4 lumbar spine (LS) and femoral neck (FN), using dual-energy X-ray absorptiometry (DEXA) (QDR 1000, Hologic DEXA Inc, Waltham, Massachusetts, the United States). Statistical analysis was performed using SPSS 18. A P value < 0.05 was considered statistically significant. Results: A total of 97 patients with cirrhosis (55.7% male) and the mean age of 51 ± 13 years and median body mass index (BMI) of 22.7 kg/m2 were recruited over a two-year period. Etiologies of cirrhosis were hepatitis C (40.2%), hepatitis B (26.8%), cryptogenic (21.6%), and other causes (11.4%). Child A, B, and C, were seen in 16.5%, 47.4%, and 36.1% of patients, respectively. The DEXA results were abnormal in 78.4% of our participants (osteopenia, 45.4%; osteoporosis, 33%). BMI and calculated glomerular filtration rate (GFRc) had moderate positive and Child score had moderate negative significant correlation with T score in both anatomical sites. There was no significant association between abnormal DEXA and the causes of cirrhosis. The univariate analysis showed that the risk of abnormal results in DEXA was significantly higher in those with low BMI, current smoking, higher Child score, and low GFRc; however, in multivariate analysis, the abnormal results were more frequent in those with lower vitamin D, higher Child score, and less GFRc. Conclusions: Abnormal DEXA was highly prevalent among patients with cirrhosis. The risk of this finding was increased by lower vitamin D levels, advanced disease, and impaired renal function. PMID:25977695
Gupta, Supriya; Wu, Xianrui; Moore, Travis; Shen, Bo
2014-02-01
Bone loss in patients with inflammatory bowel disease (IBD) with ostomy has not been systemically studied. The aims of the study were to evaluate the frequency, risk factors, and sequelae of bone loss in patients with IBD and stomas and to monitor the change in bone mineral density (BMD) over time after ostomy. A total of 126 patients met the inclusion criteria (i.e., those with IBD diagnosis and stoma), including ileostomy (N = 120), colostomy (N = 3), and jejunostomy (N = 3). BMD was measured on dual-energy X-ray absorptiometry (DEXA). Patients were classified as having normal or low BMD based on the International Society for Clinical Densitometry criteria. Thirty-two demographic and clinical variables were evaluated with logistic regression models. At a median of 6.6 years (interquartile range, 2-18.7 yr) after stoma, 37 (29.4%) patients had a low BMD. On univariate analysis, there were no significant differences between the normal and low BMD groups in the following variables: gender, race, age at diagnosis of IBD, prevalence of Crohn's disease and ulcerative colitis, age at ostomy, duration from diagnosis to DEXA and from ostomy to DEXA, menopausal age, diabetes, hypothyroidism, renal stones, short bowel syndrome, history of smoking or excessive alcohol use, family history of IBD or osteoporosis, daily calcium and vitamin D supplement, estrogen replacement, and steroid use. Body mass index was significantly lower in the low BMD group than the normal BMD group (23.3 ± 5.5 versus 26.0 ± 5.2, P = 0.013). Fragility fracture occurred in 8 (21.6%) patients in low BMD group and 4 (4.5%) patients in normal BMD group (P = 0.006). In a multivariate analysis, low body mass index was the only covariate-adjusted factor associated with low BMD. In patients with multiple DEXA scans available over time after ostomy, hip BMD was found to improve marginally, and the lumbar and femoral BMD remained stable. Low BMD was common in patients with IBD after ostomy, largely based on the findings in patients with CD with ileostomy. Fragility fracture was 5 times more frequent in patients with ostomy with low BMD compared with those with normal BMD. The low BMD was associated with a low body mass index. Screening and surveillance of BMD should routinely be performed, particularly in these patients at risk. Bone mass tends to stabilize over time after stoma.
Effects of combined ovariectomy with dexamethasone on rat lumbar vertebrae.
Ren, Hui; Liang, De; Shen, Gengyang; Yao, Zhensong; Jiang, Xiaobing; Tang, Jingjing; Cui, Jianchao; Lin, Shunxin
2016-04-01
This study investigated the effects of combined ovariectomy with dexamethasone treatment on rat lumbar vertebrae in comparison with osteoporosis induced via ovariectomy or dexamethasone alone, and analysis of the associated molecular mechanism. Sixty-two female Sprague-Dawley rats (3 months' old) were randomly divided into five treatment groups: an untreated baseline (BL) group; those receiving a sham operation (SHAM); those receiving a dexamethasone injection alone (DEXA); those undergoing bilateral ovariectomy (OVX); and those subjected to both ovariectomy and dexamethasone injection (OVX-DEXA). Animals in the BL group were euthanized at the beginning of the experiment, whereas animals in the remaining groups were euthanized at the end of the first month (M1), second month (M2), or third month (M3). Bone mineral density, bone microarchitecture, biomechanical properties of vertebrae, and serum levels of estrogen, amino-terminal propeptide of type I collagen (PINP), and β-C-telopeptide of type I collagen (β-CTX) were measured. In addition, we examined biglycan, runt-related transcription factor 2 (RUNX2), osteoprotegerin (OPG), lipoprotein receptor-related protein-5 (LRP-5), cathepsin K (CTSK), and sclerostin mRNA expression. Bone mineral content and bone mineral density were markedly lower in the OVX-DEXA group compared with the OVX group at all time points examined. The relative bone surface (BS/TV, mm(-1), relative bone volume (BV/TV,%), and trabecular number (Tb.N, 1/mm) were markedly lower in the OVX-DEXA group compared with the remaining groups, whereas trabecular separation (Tb.Sp, mm) was markedly higher in the OVX-DEXA group compared with the remaining groups at M2 or M3. The OVX-DEXA group showed lower compressive strength and lower stiffness compared with the other groups at M2 and M3. Compressive displacement and energy absorption capacity were also markedly lower in the OVX-DEXA group compared with the OVX group at M3. Estradiol levels were markedly lower in the OVX-DEXA group compared with the other groups. Biglycan, runt-related transcription factor 2, osteoprotegerin, and lipoprotein receptor-related protein-5 were down-regulated in the DEXA, OVX, and OVX-DEXA groups compared with the BL and SHAM groups, whereas cathepsin K and sclerostin were up-regulated in the OVX-DEXA group compared with the DEXA and OVX groups. Ovariectomy combined with dexamethasone induced more serious osteoporosis in the rat lumbar spine than either ovariectomy or dexamethasone alone. The combined effect may be due to a combination of suppressed bone formation and increased bone resorption related to an estradiol deficit.
Zaman, Farasat; Chrysis, Dionisios; Huntjens, Kirsten; Fadeel, Bengt; Sävendahl, Lars
2012-01-01
Dexamethasone (Dexa) is a widely used glucocorticoid to treat inflammatory diseases; however, a multitude of undesired effects have been reported to arise from this treatment including osteoporosis, obesity, and in children decreased longitudinal bone growth. We and others have previously shown that glucocorticoids induce apoptosis in growth plate chondrocytes. Here, we hypothesized that Bax, a pro-apoptotic member of the Bcl-2 family, plays a key role in Dexa-induced chondrocyte apoptosis and bone growth impairment. Indeed, experiments in the human HCS-2/8 chondrocytic cell line demonstrated that silencing of Bax expression using small-interfering (si) RNA efficiently blocked Dexa-induced apoptosis. Furthermore, ablation of Bax in female mice protected against Dexa-induced bone growth impairment. Finally, Bax activation by Dexa was confirmed in human growth plate cartilage specimens cultured ex vivo. Our findings could therefore open the door for new therapeutic approaches to prevent glucocorticoid-induced bone growth impairment through specific targeting of Bax.
Clinical value of bone densitometry.
Sartoris, D J
1994-07-01
The purpose of this article is to provide insight into the long-standing controversy over the clinical value of noninvasive measurement of bone mass. Results of recent studies have increasingly supported the judicious use of bone densitometry as a clinical tool [1]. These reports contradict editorials on the limitations of bone densitometry that have appeared in a variety of subspecialty publications [2,3]. The importance of bone mass measurement is underscored by the lack of success in predicting bone density from various combinations of anthropometric and historical variables. Growing evidence suggests that densitometry is a useful tool for determining which women near menopause are at risk for osteoporosis and, therefore, are candidates for estrogen-replacement therapy. This article summarizes current concepts on the subject and attempts to prove that bone densitometry is a beneficial and indicated procedure for selected patients.
Peppa, Melpomeni; Stefanaki, Charikleia; Papaefstathiou, Athanasios; Boschiero, Dario; Dimitriadis, George; Chrousos, George P
2017-04-01
We aimed at evaluating the efficiency of a newly developed, advanced Bioimpedance Analysis (BIA-ACC®) device as a screening tool for determining the degree of obesity and osteosarcopenia in postmenopausal women with normal or decreased bone density determined by Dual-Energy X-Ray absorptiometry (DEXA) in a representative sample of Greek postmenopausal women. This is a single-gate cross-sectional study of body composition measured by BIA-ACC® and DEXA. Postmenopausal females with BMI ranging from 18.5 to 40 kg/m2 were subjected to two consecutive measurements of DEXA and BIA-ACC® within 5-10 minutes of each other. We used Pearson's co-efficient to examine linear correlations, the intraclass correlation co-efficient (ICC) to test reliability, Bland-Atman plots to assess bias and Deming regressions to establish the agreement in parameters measured by BIA-ACC® and DEXA. Last, we used ANOVA, with Bonferroni correction and Dunnett T3 post hoc tests, for assessing the differences between quantitative and Pearson's x2 between qualitative variables. Our sample consisted of 84 overweight/obese postmenopausal women, aged 39-83 years, of whom 22 had normal bone density, 38 had osteopenia and 24 had osteoporosis based on DEXA measurements, using quota sampling. ICCs and Deming regressions showed strong agreement between BIA-ACC® and DEXA and demonstrated minimal proportional differences of no apparent clinical significance. Bland-Altman plots indicated minimal biases. Fat, skeletal and bone mass measured by BIA-ACC® and DEXA were increased in the non-osteopenic/non-osteoporotic women compared with those of the osteopenic and osteoporotic groups. BIA-ACC® is a rapid, bloodless and useful screening tool for determining body composition adiposity and presence of osteo-sarcopenic features in postmenopausal women. Women with osteopenia and osteoporosis evaluated by DEXA had decreased fat, skeletal and bone mass compared with normal bone density women, suggesting concordance in the change of these three organ masses in postmenopausal women.
Schousboe, J T; Gourlay, M; Fink, H A; Taylor, B C; Orwoll, E S; Barrett-Connor, E; Melton, L J; Cummings, S R; Ensrud, K E
2013-01-01
We used a microsimulation model to estimate the threshold body weights at which screening bone densitometry is cost-effective. Among women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to identify those for whom bone densitometry is cost-effective. Bone densitometry may be more cost-effective for those with lower body weight since the prevalence of osteoporosis is higher for those with low body weight. Our purpose was to estimate weight thresholds below which bone densitometry is cost-effective for women and men without a prior clinical fracture at ages 55, 60, 65, 75, and 80 years. We used a microsimulation model to estimate the costs and health benefits of bone densitometry and 5 years of fracture prevention therapy for those without prior fracture but with femoral neck osteoporosis (T-score ≤ -2.5) and a 10-year hip fracture risk of ≥3%. Threshold pre-test probabilities of low BMD warranting drug therapy at which bone densitometry is cost-effective were calculated. Corresponding body weight thresholds were estimated using data from the Study of Osteoporotic Fractures (SOF), the Osteoporotic Fractures in Men (MrOS) study, and the National Health and Nutrition Examination Survey (NHANES) for 2005-2006. Assuming a willingness to pay of $75,000 per quality adjusted life year (QALY) and drug cost of $500/year, body weight thresholds below which bone densitometry is cost-effective for those without a prior fracture were 74, 90, and 100 kg, respectively, for women aged 55, 65, and 80 years; and were 67, 101, and 108 kg, respectively, for men aged 55, 75, and 80 years. For women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to select those for whom bone densitometry is cost-effective.
Vaccaro, Calogero; Busetto, Roberto; Bernardini, Daniele; Anselmi, Carlo; Zotti, Alessandro
2012-03-01
To evaluate the precision and accuracy of assessing bone mineral density (BMD) by use of mean gray value (MGV) on digitalized and digital images of conventional and digital radiographs, respectively, of ex vivo bovine and equine bone specimens in relation to the gold-standard technique of dual-energy x-ray absorptiometry (DEXA). Left and right metatarsal bones from 11 beef cattle and right femurs from 2 horses. Bovine specimens were imaged by use of conventional radiography, whereas equine specimens were imaged by use of computed radiography (digital radiography). Each specimen was subsequently scanned by use of the same DEXA equipment. The BMD values resulting from each DEXA scan were paired with the MGVs obtained by use of software on the corresponding digitalized or digital radiographic image. The MGV analysis of digitalized and digital x-ray images was a precise (coefficient of variation, 0.1 and 0.09, respectively) and highly accurate method for assessing BMD, compared with DEXA (correlation coefficient, 0.910 and 0.937 for conventional and digital radiography, respectively). The high correlation between MGV and BMD indicated that MGV analysis may be a reliable alternative to DEXA in assessing radiographic bone density. This may provide a new, inexpensive, and readily available estimate of BMD.
2004-01-01
Following publication of the proceedings from the first Position Development Conference (PDC) of the International Society for Clinical Densitometry (ISCD), members of the ISCD Scientific Advisory Committee (SAC) addressed additional topics of interest in the field of bone densitometry. These topics were addressed at a subsequent PDC, which was held in Cincinnati, Ohio, July 25-27, 2003. Five topics were chosen for discussion: (1) the diagnosis of osteoporosis in men, premenopausal women, and children; (2) technical standardization for dual-energy X-ray absorptiometry (DXA); (3) indications for bone densitometry; (4) reporting of bone density results; and (5) nomenclature and decimal places for bone densitometry. This report describes the methodology used for the development, presentation, and finalization of PDC positions. These positions are discussed in the following papers.
Assessment of vitamin K2 levels in osteoporotic patients: a case control study.
Noori, Akram; Lashkari, Mahin; Oveisi, Sonia; Khair Khah, Mohamad Reza; Zargar, Ali
2014-07-14
The aim of this study was to measure the level of Vitamin K2 (Vit K2) in osteoporotic patients and individuals with normal bone density as controls. This case-control study was done in Outpatient Department of Rheumatology at Qazvin Boo-ali Sina Hospital in 2013. Participants were 50 patients with osteoporotic densitometry measured by DEXA (T score? -2.5) who were matched with 48 persons in control group with normal bone density (T score> -1). The level of Vit K2 in samples was measured using enzyme linked immunosorbent assay (ELISA). Data were analyzed by Mann-Whitney U test and Chi-square test. The level of Vit K2 in patients with osteoporosis was not significantly different from the control group (Median: 75.95 vs. 71.35 nmol/L, respectively; P-value: 0.709). The authors determined cut-offs 75 percentile of vitamin K2 in all participants that was 85 nmol/L and percentages of persons in two groups were similar. Although Vit K2 level in patients with osteoporosis was not significantly different from the control group, further studies are necessary to confirm the association of osteoporosis and Vit K2.
Petropoulou, Anna D; Porcher, Raphael; Herr, Andrée-Laure; Devergie, Agnès; Brentano, Thomas Funck; Ribaud, Patricia; Pinto, Fernando O; Rocha, Vanderson; Peffault de Latour, Régis; Orcel, Philippe; Socié, Gérard; Robin, Marie
2010-06-15
Bone complications after hematopoietic stem-cell transplantation (HSCT) are relatively frequent. Evaluation of biomarkers of bone turnover and dual energy x-ray absorptiometry (DEXA) are not known in this context. We prospectively evaluated bone mineral density, biomarkers of bone turnover, and the cumulative incidence of bone complications after allogeneic HSCT. One hundred forty-six patients were included. Bone mineral density was measured by DEXA 2-month and 1-year post-HSCT. The markers of bone turnover were serum C-telopeptide (C-TP), 5 tartrate-resistant acid phosphatase (bone resorption), and osteocalcin (bone formation) determined pre-HSCT and 2 months and 1 year thereafter. Potential association between osteoporosis at 2 months, osteoporotic fracture or avascular necrosis and, individual patient's characteristics and biologic markers were tested. C-TP was high before and 2 months after transplant. At 2 months, DEXA detected osteoporosis in more than half the patients tested. Male sex, median age less than or equal to 15 years, and abnormal C-TP before HSCT were risk factors significantly associated with osteoporosis. Three-year cumulative incidences of fractures and avascular necrosis were 8% and 11%, respectively. Children were at higher risk of fracture, whereas corticosteroid treatment duration was a significant risk factor for developing a clinical bone complication post-HSCT. Bone complications and osteoporosis are frequent after HSCT. Bone biologic markers and DEXA showed that subclinical bone abnormalities appeared early post-HSCT. The risk factors, age, gender, and C-TP easily available at the time of transplantation were identified. Biphosphonates should probably be given to patients with those risk factors.
High resolution bone mineral densitometry with a gamma camera
NASA Technical Reports Server (NTRS)
Leblanc, A.; Evans, H.; Jhingran, S.; Johnson, P.
1983-01-01
A technique by which the regional distribution of bone mineral can be determined in bone samples from small animals is described. The technique employs an Anger camera interfaced to a medical computer. High resolution imaging is possible by producing magnified images of the bone samples. Regional densitometry of femurs from oophorectomised and bone mineral loss.
Measurement of hard tissue density based on image density of intraoral radiograph
NASA Astrophysics Data System (ADS)
Katsumata, Akitoshi; Fukui, Tatsumasa; Shimoda, Shinji; Kobayashi, Kaoru; Hayashi, Tatsuro
2018-02-01
We developed a DentalSCOPE computer program to measure the bone mineral density (BMD) of the alveolar bone. Mineral density measurement of alveolar bone may be useful to predict possible patients who will occur medication-related osteonecrosis of the jaw (MRONJ). Because these osteoporosis medicines affect the mineral density of alveolar bone significantly. The BMD of alveolar bone was compared between dual-energy X-ray absorptiometry (DEXA) and the DentalSCOPE program. A high correlation coefficient was revealed between the DentalSCOPE measurement and the DEXA measurement.
Dependence of Long Bone Flexural Properties on Bone Mineral Distribution
NASA Technical Reports Server (NTRS)
Katz, BethAnn; Cleek, Tammy M.; Whalen, Robert T.; Connolly, James P. (Technical Monitor)
1995-01-01
The objective of this study is to assess whether a non-invasive determination of long bone cross-sectional areal properties using bone densitometry accurately estimates true long bone flexural properties. In this study, section properties of two pairs of human female embalmed tibiae were compared using two methods: special analysis of bone densitometry data, and experimental determination of flexural regidities from bone surface strain measurements during controlled loading.
NASA Astrophysics Data System (ADS)
Shimura, Kazuo; Nakajima, Nobuyoshi; Tanaka, Hiroshi; Ishida, Masamitsu; Kato, Hisatoyo
1993-09-01
Dual-energy X-ray absorptiometry (DXA) is one of the bone densitometry techniques to diagnose osteoporosis, and has been gradually getting popular due to its high degree of precision. However, DXA involves a time-consuming examination because of its pencil-beam scan, and the equipment is expensive. In this study, we examined a new bone densitometry technique (CR-DXA) utilizing an X-ray imaging system and Computed Radiography (CR) used for medical X-ray image diagnosis. High level of measurement precision and accuracy could be achieved by X-ray rube voltage/filter optimization and various nonuniformity corrections based on simulation and experiment. The phantom study using a bone mineral block showed precision of 0.83% c.v. (coefficient of variation), and accuracy of 0.01 g/cm2, suggesting that a practically equivalent degree of measurement precision and accuracy to that of the DXA approach is achieved. CR-DXA is considered to provide bone mineral densitometry to facilitate simple, quick and precise bone mineral density measurement.
Effect of the “protein diet” and bone tissue.
Nascimento da Silva, Zoraide; Azevedo de Jesuz, Vanessa; De Salvo Castro, Eduardo; Soares da Costa, Carlos Alberto; Teles Boaventura, Gilson; Blondet de Azeredo, Vilma
2014-01-01
The aim of this study is to evaluate the effect of the hyperproteic diet consumption on bone tissue. The study was conducted during sixty days. Twenty eight Wistar albinus rats, adults, originated from Laboratory of Experimental Nutrition were divided in four groups: (n = 7); Control 1 (C1), Control 2 (C2), Hyperproteic 1 (HP1) e Hyperproteic 2 (HP2). The C2 and HP2 groups were submitted to 30% of food restriction. The hyperproteic diet was based on the Atkins diet and prepared to simulate the protein diet. At the end of the study the animals were anesthetized to performer bone densitometry analyses by DEXA and blood and tissue collection. Serum and bone minerals analyses were conducted by colorimetric methods in automated equipment. The total bone mineral density (BMD) of the pelvis and the spine of the food restriction groups (HP2 e C2) were lower (p < 0.05) than C1 e HP1 groups. While the femur BMD of the HP2 was lower (p < 0.05) related to others groups. It had been observed reduction (p < 0.05) in the medium point of the width of femur diaphysis and in bone calcium level in the hyperproteic groups (HP1 e HP2). It was observed similar effect on the osteocalcin level, that presented lower (p < 0.05) in the hyperproteic groups. The insulin level was lower only in HP2 and serum calcium of the HP1 and HP2 groups was lower than C1. The protein diet promotes significant bone change on femur and in the hormones levels related to bone synthesis and maintenance of this tissue.
[Relationship between weight, body composition and bone mass in peritoneal dialysis].
Negri, A L; Barone, R; Bogado, C E; Zanchetta, J R
2005-01-01
Patients in chronic dialysis show a decrease in total bone mass. The factors that determine this decrease are not well known. In normal populations weight and its compartments are important determinants of bone mass. We studied total bone mineral content (TBMC), a measure of bone mass, and body composition using DEXA densitometry in 65 patients (45 females and 20 males) who had been in peritoneal dialysis for a mean of 40.3 +/- 23.2 months. Forty-eight patients (73.8%) had been previously in hemodialysis. The mean total time in dialysis for these patients was 76.8 months. As a group patients showed a very significant positive correlation between TBMC and weight, height, and lean body mass. A negative correlation was found between TBMC with the time in dialysis and iPTH. In men we found significant simple positive correlations between TBMC and weight, height and lean body mass. In women we found simple positive correlations of TBMC with weight, height and lean body mass and a negative correlation with iPTH. In the multiple regression analysis, lean body mass was the only body composition parameter that had a significantly positive correlation with TBMC in men; in women only height correlated positively with TBMC and iPTH continued to correlate negatively with bone mass. When we considered pre and postmenopausal women separately, bone mass was correlated positively with height and lean body mass and negatively with iPTH in postmenopausal women and only with height in pre-menopausal females. We conclude that the lean body mass compartment. is the most important component of weight that determines TBMC in peritoneal dialysis patients particularly in males and postmenopausal women. In postmenopausal women, secondary hyperparathyroidism seems to be particularly detrimental on bone mass.
NASA Astrophysics Data System (ADS)
Favus, Murray J.
2008-09-01
Hypercalciuria plays an important causal role in many patients with calcium oxalate (CaOx) stones. The source of the hypercalciuria includes increased intestinal Ca absorption and decreased renal tubule Ca reabsorption. In CaOx stone formers with idiopathic hypercalciuria (IH), Ca metabolic balance studies have revealed negative Ca balance and persistent hypercalciuria in the fasting state and during low dietary Ca intake. Bone resorption may also contribute to the high urine Ca excretion and increase the risk of bone loss. Indeed, low bone mass by DEXA scanning has been discovered in many IH patients. Thiazide diuretic agents reduce urine Ca excretion and may increase bone mineral density (BMD), thereby reducing fracture risk. Dietary Ca restriction that has been used unsuccessfully in the treatment of CaOx nephrolithiasis in the past may enhance negative Ca balance and accelerate bone loss. DEXA scans may demonstrate low BMD at the spine, hip, or forearm, with no predictable pattern. The unique pattern of bone histologic changes in IH differs from other causes of low DEXA bone density including postmenopausal osteoporosis, male hypogonadal osteoporosis, and glucocorticoid-induced osteoporosis. Hypercalciuria appears to play an important pathologic role in the development of low bone mass, and therefore correction of urine Ca losses should be a primary target for treatment of the bone disease accompanying IH.
Direct-to-consumer marketing of osteoporosis drugs and bone densitometry.
Hollon, Matthew F; Larson, Eric B; Koepsell, Thomas D; Downer, Ann E
2003-01-01
To determine whether there is an association between a woman's exposure to direct-to-consumer (DTC) advertisements for 2 osteoporosis drugs and presentation for bone densitometry. A matched case-control study was conducted between October and December 1998 at an academic primary care clinic in Seattle, WA. Seventeen women from the study population (aged >/=18 y, seen in the previous 2 y at the academic primary care clinic) presented for bone densitometry. All 51 women completed a self-administered questionnaire. Women familiar with 1 of 2 osteoporosis drugs due to exposure to advertisements had 9 times the odds of densitometry (unadjusted OR 9.3, 95% CI 1.0 to 86). Multivariate analysis, including confounders such as education level and whether a woman had previously had 3 screening tests (mammography, Pap smear, serum cholesterol), revealed a significant and strong association between exposure to advertisements and densitometry (adjusted OR 29, 95% CI 1.6 to 511). DTC marketing may increase health services utilization. Further independent evaluation of DTC marketing based on available observational evidence is feasible and warranted.
NASA Technical Reports Server (NTRS)
2002-01-01
The accuDEXA(R) Bone Mineral Density Assessment System, manufactured by Schick Technologies, Inc., utilizes "camera on a chip" sensor technology invented and developed by NASA's Jet Propulsion Laboratory. Schick's accuDEXA system offers several advantages over traditional osteoporosis tests, which assess bone density loss in the hip and spine, and require specialized personnel to conduct. With accuDEXA, physicians can test the entire body's bone density at a peripheral site, such as the finger, without applying gels or having patients remove garments. Results are achieved in 30 seconds and printed out in less than a minute, compared to the estimated exam time of 15 minutes for hip and spine density analyses. Schick has also applied the CMOS APS technology to a new software product that performs dental radiography using up to 90 percent less radiation exposure than conventional X-rays. Called Computed Dental Radiography(R), the new digital imaging product utilizes an electronic sensor in place of X-ray film to generate sharp and clear images that appear on a computer screen within 3 seconds, and can be enlarged and enhanced to identify problems.
Stagraczyński, Maciej; Kulczyk, Tomasz; Leszczyński, Piotr; Męczekalski, Błażej
2015-10-01
Profound hypoestrogenism causes increased risk of osteoporosis and bone fracture in menopause. This period of women life is also characterized by decrease number of teeth and deterioration of oral cavity health. The aim of the study was to assess the number of teeth, hormonal profile (Follicle-stimualting hormone (FSH), estradiol (E2), testosterone (T) and dehydroepiandrosterone sulphate (DHEA-S) and the bone mineral density (BMD) of the lumbar part of the spine in postmenopausal women with osteoporosis, osteopenia and normal BMD. The next step of the study was to determine whether there was a correlation between vertebral mineral bone density, the hormonal profile and the number of teeth. A total number of 47 women was involved in the study. Based on the results of densitometry tests (DEXA) of vertebral column the subjects were divided into 3 groups: 10 with osteoporosis, 20 with osteopenia and 17 with normal BMD. All the subjects had undergone a hormonal assessment which included blood serum estimation for FSH, E2, DHEA-S and T levels. Also the total number of teeth present was recorded. Serum estradiol and testosterone levels in postmenopausal women were found to be positively correlated with the number of teeth present. A negative correlation was found between age and the number of maxillary teeth in postmenopausal women with osteopenia. There was no influence of serum FSH, estradiol, testosterone and DHEA-S levels on vertebral BMD loss in postmenopausal women. There was no correlation between teeth number and BMD of vertebral column. Serum levels of estradiol and testosterone in postmenopausal women positively correlate with teeth numbers. Age is the main risk factor for teeth loss in postmenopausal women. © 2015 MEDPRESS.
Comparison of instruments for dual-energy X-ray bone mineral densitometry.
Vainio, P; Ahonen, E; Leinonen, K; Sievänen, H; Koski, E
1992-04-01
While bone mineral densitometry has become a common laboratory test, it is important to pay attention to the compatibility of the results from different instruments. In this study results from three commercially available bone densitometers are compared using both patient and phantom studies. Overall correlation between instruments was good but there were systematic discrepancies in the results. The three instruments provided bone mineral density (BMD) values that differed by as much as 13.5% due to differences as large as 6% in bone mineral content and as large as 7% in bone area. Thus, the BMD values obtained from different manufacturers' instruments are not directly comparable.
Progress in Development of Methods in Bone Densitometry
NASA Technical Reports Server (NTRS)
Whedon, G. D.; Neumann, William F.; Jenkins, Dale W.
1966-01-01
The effects of weightlessness and decreased activity on the astronaut's musculoskeletal system during prolonged space flight, missions are of concern to NASA. This problem was anticipated from the knowledge that human subjects lose significant quantities of calcium from the skeleton during periods of bedrest, immobilization, and water immersion. An accurate method of measurement of the changes in mineral content of the skeleton is required not only in the space program but also in the biological, medical, and dental fields for mineral metabolism studies and for studying various pathological conditions of the skeleton and teeth. This method is a difficult one requiring the coordinated efforts of physiologists, biophysicists, radiologists, and clinicians. The densitometry methods reported in this conference which have been used or are being developed include X-ray, beta excited X-rays, radioisotopes, sonic vibration, and neutron activation analysis Studies in the Gemini, Biosatellite, and Apollo flights use the X-ray bone densitometry method which requires making X-rays before and after the flights. An in-flight method of bone densitometry would be valuable, and use of radioisotope sources has been suggested. Many advances in bone densitometry have been made in the last five years, and the urgency of the requirement makes this working conference timely and valuable. In such a rapidly developing field with investigators working independently in a variety of scientific disciplines, a working conference is of great value in exchanging information and ideas, critically evaluating approaches and methods, and pointing out new research pathways.
NASA Astrophysics Data System (ADS)
Hofmann, Philipp; Sedlmair, Martin; Krauss, Bernhard; Wichmann, Julian L.; Bauer, Ralf W.; Flohr, Thomas G.; Mahnken, Andreas H.
2016-03-01
Osteoporosis is a degenerative bone disease usually diagnosed at the manifestation of fragility fractures, which severely endanger the health of especially the elderly. To ensure timely therapeutic countermeasures, noninvasive and widely applicable diagnostic methods are required. Currently the primary quantifiable indicator for bone stability, bone mineral density (BMD), is obtained either by DEXA (Dual-energy X-ray absorptiometry) or qCT (quantitative CT). Both have respective advantages and disadvantages, with DEXA being considered as gold standard. For timely diagnosis of osteoporosis, another CT-based method is presented. A Dual Energy CT reconstruction workflow is being developed to evaluate BMD by evaluating lumbar spine (L1-L4) DE-CT images. The workflow is ROI-based and automated for practical use. A dual energy 3-material decomposition algorithm is used to differentiate bone from soft tissue and fat attenuation. The algorithm uses material attenuation coefficients on different beam energy levels. The bone fraction of the three different tissues is used to calculate the amount of hydroxylapatite in the trabecular bone of the corpus vertebrae inside a predefined ROI. Calibrations have been performed to obtain volumetric bone mineral density (vBMD) without having to add a calibration phantom or to use special scan protocols or hardware. Accuracy and precision are dependent on image noise and comparable to qCT images. Clinical indications are in accordance with the DEXA gold standard. The decomposition-based workflow shows bone degradation effects normally not visible on standard CT images which would induce errors in normal qCT results.
Using bone densitometry to monitor therapy in treating osteoporosis: pros and cons.
Deal, C L
2001-06-01
Measurement of bone density is crucial for evaluating fracture risk. Low bone mass is a powerful predictor of fracture and is necessary to assess the need for treatment. Dual energy x-ray absorptiometry is accurate and precise. Use of bone density for monitoring therapy is an important tool for evaluating response to therapy, but an understanding of the limitations of the procedure are important for the practicing physician. Precision error of the technology and what change in density is clinically significant (least significant change) are important concepts to interpret results and make appropriate treatment decisions. This article reviews the use of bone densitometry as a tool for monitoring treatment in patients with low bone mass.
Govindarajan, Parameswari; Schlewitz, Gudrun; Schliefke, Nathalie; Weisweiler, David; Alt, Volker; Thormann, Ulrich; Lips, Katrin Susanne; Wenisch, Sabine; Langheinrich, Alexander C.; Zahner, Daniel; Hemdan, Nasr Y.; Böcker, Wolfgang; Schnettler, Reinhard; Heiss, Christian
2013-01-01
Background Osteoporosis is a multi-factorial, chronic, skeletal disease highly prevalent in post-menopausal women and is influenced by hormonal and dietary factors. Because animal models are imperative for disease diagnostics, the present study establishes and evaluates enhanced osteoporosis obtained through combined ovariectomy and deficient diet by DEXA (dual-energy X-ray absorptiometry) for a prolonged time period. Material/Methods Sprague-Dawley rats were randomly divided into sham (laparotomized) and OVX-diet (ovariectomized and fed with deficient diet) groups. Different skeletal sites were scanned by DEXA at the following time points: M0 (baseline), M12 (12 months post-surgery), and M14 (14 months post-surgery). Parameters analyzed included BMD (bone mineral density), BMC (bone mineral content), bone area, and fat (%). Regression analysis was performed to determine the interrelationships between BMC, BMD, and bone area from M0 to M14. Results BMD and BMC were significantly lower in OVX-diet rats at M12 and M14 compared to sham rats. The Z-scores were below −5 in OVX-diet rats at M12, but still decreased at M14 in OVX-diet rats. Bone area and percent fat were significantly lower in OVX-diet rats at M14 compared to sham rats. The regression coefficients for BMD vs. bone area, BMC vs. bone area, and BMC vs. BMD of OVX-diet rats increased with time. This is explained by differential percent change in BMD, BMC, and bone area with respect to time and disease progression. Conclusions Combined ovariectomy and deficient diet in rats caused significant reduction of BMD, BMC, and bone area, with nearly 40% bone loss after 14 months, indicating the development of severe osteoporosis. An increasing regression coefficient of BMD vs. bone area with disease progression emphasizes bone area as an important parameter, along with BMD and BMC, for prediction of fracture risk. PMID:23446183
Govindarajan, Parameswari; Schlewitz, Gudrun; Schliefke, Nathalie; Weisweiler, David; Alt, Volker; Thormann, Ulrich; Lips, Katrin Susanne; Wenisch, Sabine; Langheinrich, Alexander C; Zahner, Daniel; Hemdan, Nasr Y; Böcker, Wolfgang; Schnettler, Reinhard; Heiss, Christian
2013-02-28
Osteoporosis is a multi-factorial, chronic, skeletal disease highly prevalent in post-menopausal women and is influenced by hormonal and dietary factors. Because animal models are imperative for disease diagnostics, the present study establishes and evaluates enhanced osteoporosis obtained through combined ovariectomy and deficient diet by DEXA (dual-energy X-ray absorptiometry) for a prolonged time period. Sprague-Dawley rats were randomly divided into sham (laparotomized) and OVX-diet (ovariectomized and fed with deficient diet) groups. Different skeletal sites were scanned by DEXA at the following time points: M0 (baseline), M12 (12 months post-surgery), and M14 (14 months post-surgery). Parameters analyzed included BMD (bone mineral density), BMC (bone mineral content), bone area, and fat (%). Regression analysis was performed to determine the interrelationships between BMC, BMD, and bone area from M0 to M14. BMD and BMC were significantly lower in OVX-diet rats at M12 and M14 compared to sham rats. The Z-scores were below -5 in OVX-diet rats at M12, but still decreased at M14 in OVX-diet rats. Bone area and percent fat were significantly lower in OVX-diet rats at M14 compared to sham rats. The regression coefficients for BMD vs. bone area, BMC vs. bone area, and BMC vs. BMD of OVX-diet rats increased with time. This is explained by differential percent change in BMD, BMC, and bone area with respect to time and disease progression. Combined ovariectomy and deficient diet in rats caused significant reduction of BMD, BMC, and bone area, with nearly 40% bone loss after 14 months, indicating the development of severe osteoporosis. An increasing regression coefficient of BMD vs. bone area with disease progression emphasizes bone area as an important parameter, along with BMD and BMC, for prediction of fracture risk.
What Are the Treatments for Other Symptoms of Menopause?
... vaginal dryness Treatment of sleep problems Treatment for Osteoporosis and Bone Loss Related to Menopause Because bone ... X-ray absorptiometry (DEXA) scan . If you have osteoporosis or are at risk for it, your health ...
Rapidly assessing changes in bone mineral balance using natural stable calcium isotopes
Morgan, Jennifer L. L.; Skulan, Joseph L.; Gordon, Gwyneth W.; Romaniello, Stephen J.; Smith, Scott M.; Anbar, Ariel D.
2012-01-01
The ability to rapidly detect changes in bone mineral balance (BMB) would be of great value in the early diagnosis and evaluation of therapies for metabolic bone diseases such as osteoporosis and some cancers. However, measurements of BMB are hampered by difficulties with using biochemical markers to quantify the relative rates of bone resorption and formation and the need to wait months to years for altered BMB to produce changes in bone mineral density large enough to resolve by X-ray densitometry. We show here that, in humans, the natural abundances of Ca isotopes in urine change rapidly in response to changes in BMB. In a bed rest experiment, use of high-precision isotope ratio MS allowed the onset of bone loss to be detected in Ca isotope data after about 1 wk, long before bone mineral density has changed enough to be detectable with densitometry. The physiological basis of the relationship between Ca isotopes and BMB is sufficiently understood to allow quantitative translation of changes in Ca isotope abundances to changes in bone mineral density using a simple model. The rate of change of bone mineral density inferred from Ca isotopes is consistent with the rate observed by densitometry in long-term bed rest studies. Ca isotopic analysis provides a powerful way to monitor bone loss, potentially making it possible to diagnose metabolic bone disease and track the impact of treatments more effectively than is currently possible. PMID:22652567
Dabaja, Ali A; Bryson, Campbell F; Schlegel, Peter N; Paduch, Darius A
2015-03-01
To evaluate the relationship of testosterone-enhancing therapy on alkaline phosphatase (AP) in relation to bone mineral density (BMD) in hypogonadal men. Retrospective review of 140 men with testosterone levels of <350 ng/dL undergoing testosterone-enhancing therapy and followed for 2 years. Follicle-stimulating hormone, luteinising hormone, free testosterone, total testosterone, sex hormone binding globulin, calcium, AP, vitamin D, parathyroid hormone, and dual-energy X-ray absorptiometry (DEXA) scans were analysed. A subgroup of 36 men with one DEXA scan before and one DEXA 2 years after initiating treatment was performed. Analysis of the relationship between testosterone and AP at initiation of therapy using stiff linear splines suggested that bone turnover occurs at total testosterone levels of <250 ng/dL. In men with testosterone levels of <250 ng/dL, there was a negative correlation between testosterone and AP (R(2) = -0.347, P < 0.001), and no correlation when testosterone levels were between 250 and 350 ng/dL. In the subgroup analysis, the mean (sd) testosterone level was 264 (103) ng/dL initially and 701 (245), 539 (292), and 338 (189) ng/dL at 6, 12, and 24 months, respectively. AP decreased from a mean (sd) of 87 (38) U/L to 57 (12) U/L (P = 0.015), 60 (17) U/L (P < 0.001), and 55 (10) U/L (P = 0.03) at 6, 12, and 24 months, respectively. The BMD increased by a mean (sd) of 20 (39)% (P = 0.003) on DEXA. In hypogonadal men, the decrease in AP is associated with an increase in BMD on DEXA testing. This result suggests the use of AP as a marker of response to therapy. © 2014 The Authors. BJU International © 2014 BJU International.
A systematic quality assurance study in bone densitometry devices
NASA Astrophysics Data System (ADS)
Tuncman, Duygu; Kovan, Hatice; Kovan, Bilal; Demir, Bayram; Turkmen, Cuneyt
2015-07-01
Osteoporosis is the most common metabolic bone disease and can result in devastating physical, psychosocial, and economic consequences. It occurs in women after menopause and affects most elderly. Dual-energy x-ray absorptiometry (DXA) is currently the most widely used method for the measurement of areal Bone Mineral Density (BMD) (g/cm2) .DXA is based on the variable absorption of X-ray by the different body components and uses high and low energy X-ray photons. There are two important values in the assessment of the DXA. These values are T-score and Z-score. The T-score is calculated by taking the difference between a patient's measured BMD with the mean BMD of the young normal population, matched for gender and ethnicity, and then by dividing the difference with the standard deviation (SD) of the BMD of the young normal population. T-score and also Z-score are directly depends on the Bone Mineral Density (BMD). BMD measurements should be made periodically in a patient life. But mostly, it is not possible with the same device. Therefore, in this study, for the quality assurance of bone densitometry devices, we evaluated the BMD results measured in the different Bone Densitometry (DXA) devices using a spine phantom.
Birtane, Murat; Ekuklu, Galip; Cermik, Fikret; Tuna, Filiz; Kokino, Siranus
2008-01-01
Purpose Efforts for the early detection of bone loss and subsequent fracture risk by quantitative ultrasound (QUS), which is a non-invasive, radiation free, and cheaper method, seem rational to reduce the management costs. We aimed in this study to assess the probable correlation of speed of sound (SOS) values obtained by QUS with bone mineral density (BMD) as measured by the gold standard method, dual energy X-ray absorptiometry (DEXA), and to investigate the diagnostic value of QUS to define low BMD. Materials and Methods One hundred twenty-two postmenopausal women having prior standard DEXA measurements were included in the study. Spine and proximal femur (neck, trochanter and Ward's triangle) BMD were assessed in a standard protocol by DEXA. The middle point of the right tibia was chosen for SOS measurement by tibial QUS. Results The SOS values were observed to be significantly higher in the normal BMD (t score > - 1) group at all measurement sites except for the lumbar region, when compared with the low BMD group (t score < - 1). SOS was negatively correlated with age (r = - 0.66) and month since menopause (r = - 0.57). The sensitivity, specificity, and positive and negative predictive values for QUS t score to diagnose low BMD did not seem to be satisfactory at either of the measurement sites. Conclusion Tibial SOS was correlated weakly with BMD values of femur and lumbar spine as measured by DEXA and its diagnostic value did not seem to be high for discriminating between normal and low BMD, at these sites. PMID:18581594
Benbassat, Carlos A; Eshed, Varda; Kamjin, Moshe; Laron, Zvi
2003-10-01
Severe short stature resulting from a deficiency in IGF-I is a prominent feature of Laron syndrome (LS). Although low bone mineral density (BMD) has been noted in LS patients examined by dual energy x-ray absorptiometry (DEXA), this technique does not take volume into account and may therefore underestimate the true bone density in patients with small bones. The aim of the present study was to evaluate the BMD yielded by DEXA in our LS patients using estimated volumetric values. Volumetric density was calculated with the following formulas: bone mineral apparent density (BMAD) = bone mineral content (BMC)/(area)(3/2) for the lumbar spine and BMAD = BMC/area(2) for the femoral neck. The study sample included 12 patients (mean age, 43.9 yr; mean height, 123.7 cm). Findings were compared with 10 osteopenic subjects without developmental abnormalities (mean age, 56 yr; mean height, 164.8 cm) and 10 healthy control subjects matched for sex and age to the LS patients (mean height, 165.5 cm). BMAD in the LS group was 0.201 +/- 0.02 g/cm(3) at the lumbar spine and 0.201 +/- 0.04 g/cm(3) at the femoral neck; corresponding values for the osteopenic group were 0.130 +/- 0.01 and 0.140 +/- 0.01 g/cm(3), and for the controls, 0.178 +/- 0.03 and 0.192 +/- 0.02 g/cm(3). Although areal BMD was significantly lower in the LS and osteopenic subjects compared with controls (P < 0.02) at both the lumbar spine and femoral neck, BMAD was low (P < 0.01) in the osteopenic group only. In conclusion, DEXA does not seem to be a reliable measure of osteoporosis in patients with LS.
Axial and appendicular bone density predict fractures in older women
NASA Technical Reports Server (NTRS)
Black, D. M.; Cummings, S. R.; Genant, H. K.; Nevitt, M. C.; Palermo, L.; Browner, W.
1992-01-01
To determine whether measurement of hip and spine bone mass by dual-energy x-ray absorptiometry (DEXA) predicts fractures in women and to compare the predictive value of DEXA with that of single-photon absorptiometry (SPA) of appendicular sites, we prospectively studied 8134 nonblack women age 65 years and older who had both DEXA and SPA measurements of bone mass. A total of 208 nonspine fractures, including 37 wrist fractures, occurred during the follow-up period, which averaged 0.7 years. The risk of fracture was inversely related to bone density at all measurement sites. After adjusting for age, the relative risks per decrease of 1 standard deviation in bone density for the occurrence of any fracture was 1.40 for measurement at the proximal femur (95% confidence interval 1.20-1.63) and 1.35 (1.15-1.58) for measurement at the spine. Results were similar for all regions of the proximal femur as well as SPA measurements at the calcaneus, distal radius, and proximal radius. None of these measurements was a significantly better predictor of fractures than the others. Furthermore, measurement of the distal radius was not a better predictor of wrist fracture (relative risk 1.64: 95% CI 1.13-2.37) than other sites, such as the lumbar spine (RR 1.56; CI 1.07-2.26), the femoral neck (RR 1.65; CI 1.12-2.41), or the calcaneus (RR 1.83; CI 1.26-2.64). We conclude that the inverse relationship between bone mass and risk of fracture in older women is similar for absorptiometric measurements made at the hip, spine, and appendicular sites.
Effect of cisplatin on bone transport osteogenesis in dogs.
Ehrhart, Nicole; Eurell, Jo Ann C; Tommasini, Matteo; Constable, Peter D; Johnson, Ann L; Feretti, Antonio
2002-05-01
To document effects of cisplatin on regenerate bone formation during the distraction and consolidation phases of bone transport osteogenesis. 10 skeletally mature hounds. Bone transport osteogenesis was performed to reconstruct a 3-cm defect in the radius of each dog. Five dogs were randomly selected to receive cisplatin (70 mg/m2, IV, q 21 d for 4 cycles), and 5 were administered saline (0.9% NaCl) solution. Bone mineral density was measured by use of dual-energy x-ray absorptiometry (DEXA) on days 24, 55, and 90 after surgery. Dogs were euthanatized 90 days after surgery. Histomorphometry was performed on nondecalcified sections of regenerate bone. Bone mineral density and histomorphometric indices of newly formed bone were compared between groups. Densitometric differences in regenerate bone mineral density were not detected between groups at any time period. Cisplatin-treated dogs had decreased mineralized bone volume, decreased percentage of woven bone volume, decreased percentage of osteoblast-covered bone, increased porosity, and increased percentage of osteoblast-covered surfaces, compared with values for control dogs. Lamellar bone volume and osteoid volume did not differ significantly between groups. Regenerate bone will form and remodel during administration of cisplatin. Results of histomorphometric analysis suggest that bone formation and resorption may be uncoupled in cisplatin-treated regenerate bone as a result of increased osteoclast activity or delayed secondary bone formation during remodeling. These histomorphometric differences were modest in magnitude and did not result in clinically observable complications or decreased bone mineral density as measured by use of DEXA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riggs, B.L. Melton III, L.J.
This book contains 20 chapters. Some of the titles are: Radiology of asteoporosis; Quantitative computed tomography in assessment of osteoporosis; Nuclear medicine and densitometry; Assessment of bone turnover by histormorphometry in osteoporosis; and The biochemistry of bone.
Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone
de Mesquita, Alessandro Queiroz; Barbieri, Giuliano; Barbieri, Claudio Henrique
2016-01-01
OBJECTIVE: To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. METHODS: The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. RESULTS: Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. CONCLUSION: We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density. PMID:27982167
Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone.
Mesquita, Alessandro Queiroz de; Barbieri, Giuliano; Barbieri, Claudio Henrique
2016-11-01
To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density.
Barnes, K; Lanz, O; Werre, S; Clapp, K; Gilley, R
2015-01-01
To compare optical values in the osteotomy gap created after a tibial tuberosity advancement (TTA) treated with autogenous cancellous bone graft, extracorporeal shock wave therapy, a combination of autogenous cancellous bone graft and extracorporeal shock wave therapy, and absence of both autogenous cancellous bone graft and extracorporeal shock wave therapy using densitometry. Dogs that were presented for surgical repair of a cranial cruciate ligament rupture were randomly assigned to one of four groups: TTA with autogenous cancellous bone graft (TTA-G), TTA with autogenous cancellous bone graft and extracorporeal shock wave therapy (TTA-GS), TTA with extracorporeal shock wave therapy (TTA-S), and TTA with no additional therapy (TTA-O). Mediolateral radiographs at zero, four and eight weeks after surgery were evaluated to compare healing of the osteotomy gap via densitometry. An analysis of variance was used to compare the densitometric values between groups. At four weeks after surgery, a significant difference in osteotomy gap density was noted between TTA-GS (8.4 millimetres of aluminium equivalent [mmAleq]) and TTA-S (6.1 mmAleq), and between TTA-GS (8.4 mmAleq) and TTA-O (6.4 mmAleq). There were no significant differences noted between any groups at the eight week re-evaluation. There were no significant differences in the osteotomy gap density at eight weeks after surgery regardless of the treatment modality used. The combination of autogenous cancellous bone graft and extracorporeal shock wave therapy may lead to increased radiographic density of the osteotomy gap in the first four weeks after surgery. Densitometry using an aluminium step wedge is a feasible method for comparison of bone density after TTA in dogs.
Densitometric and biochemical values of broiler tibias at different ages.
Barreiro, F R; Sagula, A L; Junqueira, O M; Pereira, G T; Baraldi-Artoni, S M
2009-12-01
The objective of this experiment was to determine the normal values of bone radiographic density (BRD) by using the optical densitometry in radiographic images and the biochemical values represented by serum calcium, ash percentage, and minerals (calcium, phosphorus, and magnesium) from tibia ash of Cobb broilers at 8, 22, and 43 d of age. A total of 14 broilers were used for densitometric analysis, and 15 were used for biochemical dosages. The BRD values increased (P < 0.05) with age and in all tibia regions (proximal epiphysis, diaphysis, and distal epiphysis), concluding that growth was a determinative factor for bone performance, demanding a higher BRD during broiler development. Tibia proximal epiphysis presented higher BRD values in relation to the other bone regions (P < 0.05), as a result of a possible biomechanical adaptation to ligaments and tension of the muscle tendons at this region, allowing the support of the muscle mass increase. The serum calcium values were kept constant, as a result of the appropriate nutritional levels of the diet that supported the animal homeostasis. The bone ash and mineral percentage increased (P < 0.05) at 22 d of age, due to the higher mineral requirement in this age. The correlation between bone densitometry and the invasive techniques showed that the bone densitometry can substitute the determination of mineral percentage in the ash. This experiment presented normal values of the noninvasive and invasive methods more used in aviculture, allowing us to compare, subsequently, pathological and physiological values or results of broilers fed with different diets.
Cai, David J; Zhao, Yongdong; Glasier, Jennifer; Cullen, Diane; Barnes, Stephen; Turner, Charles H; Wastney, Meryl; Weaver, Connie M
2005-05-01
This study provided a comprehensive investigation on the effect of soy protein and soy isoflavones on both calcium and bone metabolism in virgin adult rats. The measurements included bone histology, calcium kinetic modeling, calcium balance, bone densitometry, and whole body densitometry. Results confirmed the bone-preserving effect of estrogen but did not support a bone-sparing role of soy isoflavones. Several animal and short-term human studies have indicated that soy protein isolate enriched with isoflavones may be used as an alternative therapy to estrogen replacement therapy. However, none of the previous studies have investigated this estrogenic effect on both calcium and bone metabolism in animals or humans, which is essential in ascertaining the mode of action of isoflavones. This study was designed to determine the effects of soy protein versus isoflavones on calcium and bone metabolism in an ovariectomized rat model. Unmated 6-month-old ovariectomized and sham-operated female Sprague-Dawley rats were randomly assigned to nine groups (16 rats/group) and pair-fed soy- or casein-based diets with or without isoflavones for 8 weeks. A reference group was administered estrogen through subcutaneous implants (20-35 pg/liter plasma). Bone densitometry, histomorphometry, and mechanical testing were used to study bone metabolism and quality. Calcium metabolism was studied using calcium tracer balance and kinetics. After ovariectomy, estrogen prevented bone loss in trabecular bone and suppressed formation on both trabecular and cortical bone surfaces. Isoflavones given as enriched soy protein isolate or supplements did not prevent trabecular bone loss. Combining isoflavones with estrogen had no additional benefits over estrogen alone. There were no differences in response to isoflavones caused by protein source. None of the treatments significantly affected either total Ca balance or (45)Ca absorption. However, soy protein showed significant effects on reducing urinary loss of Ca in animals, irrespective of isoflavone level, perhaps because of the lower amount of sulfur-containing amino acids in soy protein. Estrogen, but not isoflavones at the levels tested, suppressed bone remodeling in both trabecular and cortical bone after ovariectomy.
The cementless Bicontact stem in a prospective dual-energy X-ray absorptiometry study.
Lerch, Matthias; Kurtz, Agnes; Windhagen, Henning; Bouguecha, Anas; Behrens, Bernd A; Wefstaedt, Patrick; Stukenborg-Colsman, Christina M
2012-11-01
The cementless Bicontact total hip arthroplasty (THA) system (AESCULAP AG, Tuttlingen, Germany) was introduced in 1986/1987 and has been in successful clinical use in an unaltered form up to today. Although good long-term results with the Bicontact stem have been published, it is questionable whether the implant provides the criteria for a state-of-the-art stem regarding proximal bone stock preservation. The purpose of the study was to monitor the periprosthetic bone mineral density (BMD) in a prospective two-year follow-up dual-energy X-ray absorptiometry (DEXA) study. After power analysis, a consecutive series of 25 patients with unilateral Bicontact stem implantation was examined clinically and underwent DEXA examinations. Scans of seven regions of interest were taken preoperatively and at one week, six months, and one and two years. One patient required stem revision due to a deep infection. The Harris Hip Score increased significantly by 44 points. The most significant bone loss was observed in the calcar region (R7) in the first six months (-19.2 %). It recovered in the following 18 months to -8.5 %. The BMD in the greater trochanter dropped significantly after six months and remained stable at this level. BMD exceeded baseline values in distal regions and even more in the lesser trochanter region after two years. We conclude that the Bicontact stem provides adequate proximal bone stock preservation. We observed some signs of stress shielding at the tip of the stem, which is inevitable to some degree in THA with cementless straight stems. However, in this prospective DEXA investigation, we showed that proximal off-loading does not occur after THA with the Bicontact system. Thus, we believe that this stem is still a state-of-the-art implant.
Van der Wal, B C H; Rahmy, A I A; Grimm, B; Blake, G M; Heyligers, I C; Tonino, A J
2006-01-01
Proximal bone resorption and an increased fracture rate in the ABG-I stem has been shown. For these reasons the ABG-I stem design was changed to the ABG-II. In this study periprosthetic bone loss around the ABG-I vs ABG-II is compared to verify if the design changes resulted in improved proximal bone preservation. 51 patients were randomised to either the ABG-I or ABG-II hip prosthesis. Periprosthetic BMD change at various time points was measured using DEXA. Between the two groups (age, gender, weight etc.) no statistical difference was encountered. Compared to the baseline at two years the ABG-II preserved bone better proximally (e.g. zone 7: ABG-II: -3.7%, ABG-I: -11.9%, p=0.05) than the ABG-I. Distally, the trend was opposite and less bone loss was measured for the ABG-I than the ABG-II in zones 3, 4 and 5 (n.s.). this study confirms the philosophy behind the design changes from the ABG-I to ABG-II stem where increased elasticity, more proximal HA-coating, a shorter and distally polished stem, were meant to reduce proximal bone resorption. In future this may lead to fewer periprosthetic fractures and to less complicated revision surgery.
Long-term therapy in COPD: any evidence of adverse effect on bone?
Langhammer, Arnulf; Forsmo, Siri; Syversen, Unni
2009-01-01
Patients with COPD have high risk for osteoporosis and fractures. Hip and vertebral fractures might impair mobility, and vertebral fractures further reduce lung function. This review discusses the evidence of bone loss due to medical treatment opposed to disease severity and risk factors for COPD, and therapeutic options for the prevention and treatment of osteoporosis in these patients. A review of the English-language literature was conducted using the MEDLINE database until June 2009. Currently used bronchodilators probably lack adverse effect on bone. Oral corticosteroids (OCS) increase bone resorption and decrease bone formation in a dose response relationship, but the fracture risk is increased more than reflected by bone densitometry. Inhaled corticosteroids (ICS) have been associated with both increased bone loss and fracture risk. This might be a result of confounding by disease severity, but high doses of ICS have similar effects as equipotent doses of OCS. The life-style factors should be modified, use of regular OCS avoided and use of ICS restricted to those with evidenced effect and probably kept at moderate doses. The health care should actively reveal risk factors, include bone densitometry in fracture risk evaluation, and give adequate prevention and treatment for osteoporosis. PMID:19888355
Numeric simulation of bone remodelling patterns after implantation of a cementless straight stem.
Lerch, Matthias; Windhagen, Henning; Stukenborg-Colsman, Christina M; Kurtz, Agnes; Behrens, Bernd A; Almohallami, Amer; Bouguecha, Anas
2013-12-01
For further development of better bone-preserving implants in total hip arthroplasty (THA), we need to look back and analyse established and clinically approved implants to find out what made them successful. Finite element analysis can help do this by simulating periprosthetic bone remodelling under different conditions. Our aim was thus to establish a numerical model of the cementless straight stem for which good long-term results have been obtained. We performed a numeric simulation of a cementless straight stem, which has been successfully used in its unaltered form since 1986/1987. We have 20 years of experience with this THA system and implanted it 555 times in 2012. We performed qualitative and quantitative validation using bone density data derived from a prospective dual-energy X-ray absorptiometry (DEXA) investigation. Bone mass loss converged to 9.25% for the entire femur. No change in bone density was calculated distal to the tip of the prosthesis. Bone mass decreased by 46.2% around the proximal half of the implant and by 7.6% in the diaphysis. The numeric model was in excellent agreement with DEXA data except for the calcar region, where deviation was 67.7%. The higher deviation in the calcar region is possibly a sign of the complex interactions between the titanium coating on the stem and the surrounding bone. We developed a validated numeric model to simulate bone remodelling for different stem-design modifications. We recommend that new THA implants undergo critical numeric simulation before clinical application.
Soy isoflavone tablets reduce osteoporosis risk factors and obesity in middle-aged Japanese women.
Mori, Mari; Aizawa, Toru; Tokoro, Minoru; Miki, Tomohiro; Yamori, Yukio
2004-12-01
1. This study examines whether the supplementation of isoflavones (ISO) exerts beneficial effects on the bone mineral density (BMD) measured by dual energy X-ray absorptiometry (DEXA). 2. Eighty-one healthy Japanese pre- and postmenopausal women were randomly assigned to the following two groups taking either ISO (100 mg) tablets (ISO group) or placebo tablets (P group) containing vitamins C (25 mg) and E (5 mg) daily for 24 weeks in a double-blind placebo controlled parallel design. 3. Seventy women completed the intervention study (34 on ISO, 36 on P), only ISO group was proven to increase significantly BMD (P < 0.05 vs before) and to significantly decrease body fat measured by the DEXA (P < 0.0001 vs before and P < 0.05 vs P group), while BMI was maintained in ISO group despite significant BMI increase in P group. Thus, percent changes in BMI were significantly different between ISO and P groups (P < 0.05) 24 weeks after the intervention. 4. This prospective DEXA study confirmed a long-term ISO supplementation, 100 mg/day could not only prevent menopausal bone resorption but also increase BMD and decrease body fat concomitantly with BMI reduction. Enough ISO supplementation may contribute to the risk reduction of osteoporosis and obesity and, thus to overall health promotion in menopausal women.
Outcomes of bone density measurements in coeliac disease.
Bolland, Mark J; Grey, Andrew; Rowbotham, David S
2016-01-29
Some guidelines recommend that patients with newly diagnosed coeliac disease undergo bone density scanning. We assessed the bone density results in a cohort of patients with coeliac disease. We searched bone density reports over two 5-year periods in all patients from Auckland District Health Board (2008-12) and in patients under 65 years from Counties Manukau District Health Board (2009-13) for the term 'coeliac.' Reports for 137 adults listed coeliac disease as an indication for bone densitometry. The average age was 47 years, body mass index (BMI) 25 kg/m(2), and 77% were female. The median time between coeliac disease diagnosis and bone densitometry was 261 days. The average bone density Z-score was slightly lower than expected (Z-score -0.3 to 0.4) at the lumbar spine, total hip and femoral neck, but 88-93% of Z-scores at each site lay within the normal range. Low bone density was strongly related to BMI: the proportions with Z-score <-2 for BMI <20, 20-25, 25-30, and >30 kg/m(2) were 28%, 15%, 6% and 0% respectively. Average bone density was normal, suggesting that bone density measurement is not indicated routinely in coeliac disease, but could be considered on a case-by-case basis for individuals with strong risk factors for fracture.
Bone Mineral Density in Boys Diagnosed with Autism Spectrum Disorder: A Case-Control Study
ERIC Educational Resources Information Center
Barnhill, Kelly; Ramirez, Lucas; Gutierrez, Alan; Richardson, Wendy; Marti, C. Nathan; Potts, Amy; Shearer, Rebeca; Schutte, Claire; Hewitson, Laura
2017-01-01
This study compared bone mineral density (BMD) of the spine obtained by dual-energy X-ray absorptiometry (DEXA), nutritional status, biochemical markers, and gastrointestinal (GI) symptoms in 4-8 year old boys with Autism Spectrum Disorder (ASD) with a group of age-matched, healthy boys without ASD. Boys with ASD had significantly lower spine BMD…
[Evaluation of bone mineral density in children with sickle cell disease].
Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E
2015-04-01
To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.
Lerch, Matthias; von der Haar-Tran, Annelene; Windhagen, Henning; Behrens, Bernd A; Wefstaedt, Patrick; Stukenborg-Colsman, Christina M
2012-03-01
On the basis of positive clinical results with mid- and long-term follow-up using the Mayo short stem, the Metha neck-preserving stem (BBraun, Aesculap, Tuttlingen, Germany) was introduced. The purpose of this study was to validate the implant design by direct acquisition of bone remodelling data from total hip arthroplasty (THA) recipients using dual-energy X-ray absorptiometry (DEXA). After power analysis, 25 patients were included in this prospective study. Patients were examined clinically and underwent DEXA examinations preoperatively and postoperatively at one week, six months and one and two years after THA. Gruen zones were adapted to the short stem design (R1-R7). The Harris Hip Score (HHS) increased significantly by 31 points. No stem had to be revised. Bone mineral density (BMD) in the greater trochanter decreased significantly from 0.78 g/cm(2) postoperatively to 0.72 g/cm(2) two years after surgery. Marginal changes were seen in the lateral distal regions (R4-R5). In the minor trochanter region, BMD increased significantly after two years by 12.9%. In the calcar region, BMD exceeded the baseline value by 6.1% two years after implantation. Stress shielding seems to occur at the greater trochanter due to the vast cross-section of the implant. However, the aim of proximal load transfer of the Metha stem seems to be partially achieved. DEXA analysis revealed a concentrated load distribution on the medial portion of the femur, which is an important region to guarantee long-term implant survival.
Lo, Huan-Chu; Kuo, Duen-Pang; Chen, Yen-Lin
2017-08-01
The aim of this study was to determine the best site for bone mineral density (BMD) measurements based on T -scores, age, and beverage consumption. In this prospective study, 271 women stratified by age (average age: 61.9 years) underwent dual energy X-ray absorptiometry (DEXA) scanning of their lumbar spine, hips, and forearms. Osteoporosis was defined as a BMD of 2.5 standard deviations or more below the mean peak bone mass based on a reference population of adult women (translated as a T -score ≤ -2.5), as measured by DEXA. Participants were also evaluated regarding alcohol and caffeine consumption by a semiquantitative questionnaire. A significant discrepancy was observed in the classification of osteoporosis at different locations, with hip and forearm showing the best correlation (Pearson's r = 0.627, p < 0.001). In addition, for participants over 50 years of age, hip and forearm showed the best correlation. Significant correlations were also noted between forearm T -scores and caffeine consumed and, to a lesser extent, the level of alcohol consumption. In the group ≤ 50 years of age, lumbar spine and forearm T -scores were only associated with alcohol consumption. In the group over 50 years of age, hip and forearm T -scores were only associated with caffeine consumption. Bone mineral density measurements at the hip and forearm correlated with caffeine consumption in elderly Taiwanese women. This is an important finding since age and caffeine consumption are known risk factors for osteoporosis.
[Bone quantitative ultrasound].
Matsukawa, Mami
2016-01-01
The conventional ultrasonic bone densitometry system can give us information of bone as ultrasonic wave velocity and attenuation. However, the data reflect both structural and material properties of bone. In order to focus only on the bone matrix properties without the effect of bone structure, studies of microscopic Brillouin scattering technique are introduced. The wave velocity in a trabecula was anisotropic and depended on the position and structure of the cancellous bone. The glycation also affected on the wave velocities in bone. As a new bone quality, the piezoelectricity of bone is also discussed.
Smith, Scott M; Heer, Martina A; Shackelford, Linda C; Sibonga, Jean D; Ploutz-Snyder, Lori; Zwart, Sara R
2012-09-01
Exercise has shown little success in mitigating bone loss from long-duration spaceflight. The first crews of the International Space Station (ISS) used the "interim resistive exercise device" (iRED), which allowed loads of up to 297 lb(f) (or 1337 N) but provided little protection of bone or no greater protection than aerobic exercise. In 2008, the Advanced Resistive Exercise Device (ARED), which allowed absolute loads of up to 600 lb(f) (1675 N), was launched to the ISS. We report dietary intake, bone densitometry, and biochemical markers in 13 crewmembers on ISS missions from 2006 to 2009. Of these 13, 8 had access to the iRED and 5 had access to the ARED. In both groups, bone-specific alkaline phosphatase tended to increase during flight toward the end of the mission (p = 0.06) and increased 30 days after landing (p < 0.001). Most markers of bone resorption were also increased in both groups during flight and 30 days after landing (p < 0.05). Bone densitometry revealed significant interactions (time and exercise device) for pelvis bone mineral density (BMD) and bone mineral content (p < 0.01), hip femoral neck BMD (p < 0.05), trochanter BMD (p < 0.05), and total hip BMD (p < 0.05). These variables were unchanged from preflight only for ARED crewmembers, who also returned from flight with higher percent lean mass and lower percent fat mass. Body mass was unchanged after flight in both groups. All crewmembers had nominal vitamin D status (75 ± 17 nmol/L) before and during flight. These data document that resistance exercise, coupled with adequate energy intake (shown by maintenance of body mass determined by dual-energy X-ray absorptiometry [DXA]) and vitamin D, can maintain bone in most regions during 4- to 6-month missions in microgravity. This is the first evidence that improving nutrition and resistance exercise during spaceflight can attenuate the expected BMD deficits previously observed after prolonged missions. Copyright © 2012 American Society for Bone and Mineral Research.
Quantitative data standardization of X-ray based densitometry methods
NASA Astrophysics Data System (ADS)
Sergunova, K. A.; Petraikin, A. V.; Petrjajkin, F. A.; Akhmad, K. S.; Semenov, D. S.; Potrakhov, N. N.
2018-02-01
In the present work is proposed the design of special liquid phantom for assessing the accuracy of quantitative densitometric data. Also are represented the dependencies between the measured bone mineral density values and the given values for different X-ray based densitometry techniques. Shown linear graphs make it possible to introduce correction factors to increase the accuracy of BMD measurement by QCT, DXA and DECT methods, and to use them for standardization and comparison of measurements.
Rodent bone densitometer on the International Space Station: Instrument design and performance
NASA Astrophysics Data System (ADS)
Vellinger, John C.; Barton, Kenneth; Faget, Paul; Todd, Paul; Boland, Eugene
2016-07-01
The study of bone loss dynamics, mechanisms and countermeasures has been a publicly stated purpose of biomedical research aboard the International Space Station. Rodent research has always played a major role in terrestrial laboratories studying bone loss. The "gold standard" for assessing bone loss in human patients has been dual-energy x-ray absorptiometry (DEXA). DEXA is also widely applied to the study of bone loss in laboratory animals, so this technology has been added to the ISS inventory of analytical tools in the form of the ISS Bone Densitometer (BD) designed, constructed, tested and integrated by Techshot, Inc. (Greenville, Indiana, USA). The BD is a re-packaged COTS device known as PIXImus (GE-Lunar, USA), which was installed on ISS in November 2014 after launching on SpaceX-4. To facilitate operations in microgravity and to meet spaceflight facility and safety requirements the commercial x-ray source, control electronics and imaging system were modified and packaged by Techshot into a drawer that fits into a single EXPRESS Locker replacement. A space-rated "Exam Box" is also supplied for containment of the anesthetized subject during transfer into the BD and during exposure. The commercial software package controls four paired-energy exposures, 80 and 35 kV, and applies DEXA algorithms to the fluorescence images and displays bone mineral density (BMD), bone mineral content, lean mass, fat mass, total mass and per cent fat. The BD is therefore also a means for measuring mass and body composition making it a versatile tool for many types of rodent studies on orbit. The BD has been operated multiple times on orbit, and its performance has not differed significantly from its performance on the ground. It has been shown to measure body mass with a precision of +/- 0.1 g and on-orbit accuracy of -0.3 g. It is expected to detect BMD losses of approximately 2%. The image data are stored in a manner that allows post-test data analysis especially including the identification of a region of interest (ROI) by the investigator who wishes to assess BMD changes in femur only or spine only, for example. This research was supported by the Center for Advancement of Science in Space (CASIS) and NASA Contract NNJ13GA01C.
Kröger, N; Zeller, W; Fehse, N; Hassan, H T; Krüger, W; Gutensohn, K; Lölliger, C; Zander, A R
1998-09-01
We compared retrospectively the efficacy of granulocyte colony stimulating factor (G-CSF) alone with chemotherapy plus G-CSF in mobilizing CD34-positive cells in patients with malignant lymphoma. 35 patients underwent peripheral blood stem cell (PBSC) collection following mobilization either with 24 microg/kg G-CSF for 4 consecutive days (n = 18) or Dexa-BEAM chemotherapy plus 5 microg/kg G-CSF (n = 17). High-dose G-CSF was well tolerated with only slight bone pain and/or myalgia. The Dexa-BEAM therapy required hospitalization with a median duration of 21 d. The median number of apheresis procedures in both groups was two (range two to four), resulting in a median of 5.3 and 5.1 x 10(6) CD34+ cells/kg. No patients in the G-CSF group, but one in the Dexa-BEAM group, failed to reach the target of collecting >2.0 x 10(6) CD34+ cells/kg. The number of CFU-GM (10.4 v 6.0 x 10(5)/kg) and of BFU-E (10.6 v 4.5 x 10(5)/kg; P = 0.04) was higher in the G-CSF group than in the Dexa-BEAM group. A subset analysis of CD34+ cells was performed in 16 patients showing a higher mean of Thy-1 (CD90w) coexpression in the G-CSF than in the Dexa-BEAM group (4.8 v 1.8%, P = 0.12). Additionally the percentage of CD34+/CD38- cells was higher in the G-CSF group (10.66% v 8.8%). However, these differences were not statistically significant. The median time to leucocyte and platelet engraftment after high-dose chemotherapy was slightly shorter in the G-CSF than in the Dexa-BEAM group (9 v 10 and 12 v 13.5 d, respectively). These results demonstrate that high-dose G-CSF is as effective as Dexa-BEAM plus G-CSF in mobilizing peripheral blood stem cells and produces prompt engraftment. The major advantages of G-CSF mobilization were the safe outpatient self-application and the fixed-day apheresis.
Low bone mineral density and associated risk factors in HIV-infected patients
Chiţu-Tișu, Cristina-Emilia; Barbu, Ecaterina-Constanţa; Lazăr, Mihai; Ion, Daniela Adriana; Bădărău, Ioana Anca
2016-01-01
Background Aging of persons with human immunodeficiency virus (HIV) resulted in high rates of osteopenia and osteoporosis. Multiple cohort studies have reported an increased prevalence of bone demineralization among HIV-infected individuals. The aim of this study was to evaluate bone mineral density (BMD) and risk factors for osteopenia/osteoporosis among HIV-positive patients attending the National Institute for Infectious Diseases “Prof.Dr. Matei Balș”, Bucharest, Romania. Methods We performed a cross-sectional study that enrolled 60 patients with HIV. The association between BMD and lifestyle habits (smoking), body mass index (BMI), nadir cluster of differentiation 4 (CD4) cell count, current CD4 cell count, HIV viral load and history of combination antiretroviral therapy (cART) were investigated. The BMD was measured at the lumbar spine, hips and total body using dual-energy X-ray absorptiometry (DEXA). Results In the present study, DEXA evaluation showed an overall prevalence of osteoporosis of 16.66% (ten patients) and a prevalence of osteopenia of 48.33% (29 patients). In men, low BMI and cigarette smoking showed significant association with the diagnosis of lumbar spine demineralization (p=0.034 and p=0.041, respectively). Duration of exposure to cART classes in relation to BMD was also evaluated. The use of non-nucleoside reverse-transcriptase inhibitors (NNRTIs) was associated with low lumbar spine BMD in all patients (p=0.015). Reduced BMD was significantly associated with protease inhibitors (PIs)-containing treatment (p=0.043) in women. Conclusion At lumbar spine DEXA, male gender was statistically associated with reduced BMD. At the left hip Ward’s area, decreased BMD T scores were significantly associated with aging. The reduced BMD was higher in patients receiving PI- or NNRTI-containing regimens. PMID:27482514
76 FR 55069 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-06
... health problem primarily affecting the elderly and women after menopause. More specifically, the... automated bone mineral densitometry in a single examination. J Comput Assist Tomogr. 2011 Mar- Apr;35(2):212...
Bošković, Lidija; Gašparić, Maja; Petković, Marija; Gugić, Damir; Lovasić, Ingrid Belac; Soldić, Željko; Miše, Branka Petrić; Dabelić, Nina; Vazdar, Ljubica; Vrdoljak, Eduard
2017-02-01
Randomized trials involving aromatase inhibitors (AIs) in the adjuvant treatment of breast cancer patients have reported increased osteoporosis risk. Bone loss can be reduced with appropriate life style, vitamin D and calcium supplements, and with bisphosphonate therapy. The aim of this analysis was to investigate adherence to vitamin D and calcium in postmenopausal breast cancer patients receiving adjuvant non-steroidal AIs, and oncologists' adherence to the bone health guidelines. This prospective study included 438 newly diagnosed patients and those who have already been receiving non-steroidal AIs for up to 3.5 years. Median endocrine therapy duration before recruitment in the study was 10.5 months (interquartile 4.8-26.6). Densitometry was performed on 142 patients (32.4%) before initiation of endocrine therapy, and on additional 38 (8.6%) patients at second study visit. Densitometry was not performed on 258 (59%) patients. Vitamin D and calcium were prescribed to 329/438 (75.1%) patients at some point during the study. Patients who took more than 80% of the prescribed dose were considered adherent. Self-reported adherence was 88.4%. Osteoporosis was diagnosed in 24 patients (5.5%) of the total study population, bearing in mind that 258/438 (59%) patients did not have densitometry. Bisphosphonates were prescribed to 54/438 (12.3%) patients, whilst only 19 (35.2%) of those had osteoporosis. In this analysis, lack of oncologists' adherence to the bone health guidelines was observed. In addition, a significant proportion of the patients did not adhere to the vitamin D and calcium. Copyright © 2016 Elsevier Ltd. All rights reserved.
Osteoporosis Prevention and Management.
Pai, Muralidhar V
2017-08-01
Osteoporosis, defined by BMD at the hip or lumbar spine that is less than or equal to 2.5 standard deviations below the mean BMD of a young-adult reference population, is the most common bone disease in humans affecting both sexes and all races. It's a silent killer affecting the quality of life due to fractures and postural changes. In osteoporosis there is an imbalance between bone formation and bone resorption in favor of latter. Preventive measures and treatments are available to combat this evil. Counseling is the integral part of prevention as well as treatment of osteoporosis. Preventive strategy includes life style changes, exercise, intake of calcium and vitamin D, avoiding alcohol, smoking and excessive intake of salt. Estrogen therapy/estrogen+progesterone therapy (ET/EPT) is no longer recommended as a first-line therapy for the prevention of osteoporosis. They may be used in the therapy for osteoporosis in women under 60. Diagnosis and classification are made by assessment of BMD using DEXA or ultrasound and laboratory investigations. Management includes estimation of 10-year fracture risk using FRAX, life style and diet modification and pharmacological therapy. The drugs used in osteoporosis may be those that inhibit bone resorption-bisphosphonates, denosumab, calcitonin, SERMs, estrogen and progesterone-or that stimulate bone formation-PTH, Teriparatide. Combination therapies are not recommended as they do not have proven additional BMD/fracture benefits. No therapy should be indefinite in duration. There are no uniform recommendations to all patients. Duration decisions need to be individualized. While on treatment monitoring should be done with BMD assessment by DEXA/ultrasound and bone turnover markers.
Tatara, Marcin R; Krupski, Witold; Majer-Dziedzic, Barbara
2017-10-01
Currently available approaches to osteoporosis treatment include application of antiresorptive and anabolic agents influencing bone tissue metabolism. The aim of the study was to present bone mineral density (BMD) changes of lumbar spine in osteoporotic patient treated with bisphosphonates such as ibandronic acid and pamidronic acid, and beta-hydroxy-beta-methylbutyrate (HMB). BMD and volumetric BMD (vBMD) of lumbar spine were measured during the 6 year observation period with the use of dual-energy X-ray absorptiometry (DEXA) and quantitative computed tomography (QCT). The described case report of osteoporotic patient with family history of severe osteoporosis has shown site-dependent response of bone tissue to antiosteoporotic treatment with bisphosphonates. Twenty-five-month treatment with ibandronic acid improved proximal femur BMD with relatively poor effects on lumbar spine BMD. Over 15-month therapy with pamidronic acid was effective to improve lumbar spine BMD, while in the proximal femur the treatment was not effective. A total of 61-week long oral administration with calcium salt of HMB improved vBMD of lumbar spine in the trabecular and cortical bone compartments when monitored by QCT. Positive effects of nearly 2.5 year HMB treatment on BMD of lumbar spine and femur in the patient were also confirmed using DEXA method. The results obtained indicate that HMB may be applied for the effective treatment of osteoporosis in humans. Further studies on wider human population are recommended to evaluate mechanisms influencing bone tissue metabolism by HMB.
Smilic, Tanja N; Novakovic, Tatjana R; Markovic-Jovanovic, Snezana R; Smilic, Ljiljana L J; Mitic, Javorka S; Radunovic, Miodrag L
2017-11-02
In general, markers of bone formation and markers of bone resorption are changing synergistically, so the monitoring of any osteoclastic and any osteoblastic marker should reflect the rate of bone transformation. The aim of the study is to monitor the bone metabolism markers in postmenopausal women with osteoporosis and osteopenia along with the variations caused by the effects of bisphosphonate therapy. The study involved 55 women of average age of 57.95 years, with osteopenia or osteoporosis. The patients with osteoporosis were treated with bisphosphonates (75 mg once a week); the laboratory tests were performed before the treatment and 6 months later. Patients with osteopenia were evaluated at the first assessment and 6 months later. The tests included bone densitometry, dual-energy X-ray absorptiometry, osteocalcin, alkaline phosphatase, collagen 1 N-terminal pro-peptide (P1NP), and beta C telopeptide of type I collagen (CTX). The mean T-score was -2.80 ± 0.63 before therapy and -2.64 ± 0.45 6 months later (p < 0.001). Women with osteoporosis had elevated levels of osteocalcin and P1NP at the first assessment, whereas the alkaline phosphatase level did not change with the treatment. After the introduction of antiresorptive therapy, the levels of osteocalcin and P1NP significantly decreased (p < 0.001). In the group with osteopenia, the biochemical markers activity were increased in both assessments. In patients with osteoporosis, Beta-CTX was increased in the first evaluation, and decreased after treatment (p = 0.001). The results indicate that the assessment of biochemical markers of bone metabolism show excellent results in the assessment of prognosis, monitoring the course and the response to various treatment regimens of osteoporosis and evince strong correlation with standard densitometry and dual-energy X-ray absorptiometry procedures. P1NP and CTX show better diagnostic applicability compared with osteocalcin and alkaline phosphatase. The analysis of the activity of biochemical markers may obtain early information on the therapeutic response, before definitive assessment by bone density measurements. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
30years of DXA technology innovations.
Glüer, Claus-C
2017-11-01
As the successor of Dual Photon Absorptiometry (DPA), Dual X-ray Absorptiometry (DXA) has seen 30years of continuous technological innovations. Implementation of measures for standardization and quality assurance made DXA a reliable and clinically useful approach. Its use in clinical multicenter drug studies in osteoporosis lead to general acceptance as the standard technique of bone densitometry. The limitations of DXA are well established. As a measure of areal bone mineral density (aBMD) it depends on bone size and is biased by overlaying soft tissue and calcified structures. To some extent these errors can be reduced by estimation of bone depth and/or lateral imaging. DXA based aBMD can be supplemented by additional information obtainable from DXA scans: geometric indices such as hip axis length or complex models like 2-D finite element analysis have been developed and tested. Given the drastic improvement in image quality current DXA scans can be used for Vertebral Fracture Analysis (VFA) or grading of Abdominal Aortic Calcifications. A textural measure, Trabecular Bone Score (TBS) provides independent information on fracture risk. DXA devices can also be used for assessments beyond bone density. Periprosthetic aBMD changes can be monitored to study the mechanical fitting of bone implants. Total body composition measurements are increasingly being used in studies on nutrition, obesity, and sarcopenia. 30years after its inception DXA is the undisputed standard imaging technique for the assessment of osteoporotic fracture risk with new applications beyond bone densitometry adding to its value. Copyright © 2017 Elsevier Inc. All rights reserved.
Dual Energy X-Ray Densitometry Apparatus and Method Using Single X-Ray Pulse
1999-10-13
future bone fracture risk. Bone mineral loss is associated with aging and is more rapid in post-menopausal women. In addition, bone mineral loss is... parameters of the x-ray tube of Figures 1 and 2 illustrating, respectively, the calculated current, voltage and power; and Figures 4(a) and 4(d) are...assumed to be that of water. The bone mineral is hydroxyapatite (Ca5P30i3H) with an assumed density of 0.25 g/cm3 based on the lumbar vertebra metrology
Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny
2016-01-01
We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity.
National protocol for quality assurance in DXA-bone densitometry
NASA Astrophysics Data System (ADS)
Slavchev, A.; Avramova-Cholakova, S.; Vassileva, J.
2008-01-01
Osteoporosis becomes largely one of the most important socially significant and costly diseases. Modern techniques (DXA, US) are applied for bone densitometry. The paper presents a protocol for quality assurance especially of DXA-bone densitometers including quality control made in compliance with international standards (ISCD, IOF). The methodology has been tested in practice by measurements on site-functional assessment, entrance dose, radiation protection, calibration,
Van Schaik, Fiona D M; Verhagen, Marc A M T; Siersema, Peter D; Oldenburg, Bas
2008-09-01
Osteopenia and osteoporosis are frequently encountered in patients with Inflammatory Bowel Disease (IBD). Our aims were to evaluate the actual practice of screening for low bone mineral density (BMD) by dual energy X-ray absorptiometry (DEXA), to determine the prevalence of low BMD and to investigate the risk factors associated with a low BMD in the IBD population of a regional Dutch hospital. A retrospective chart review was performed in 474 patients (259 with ulcerative colitis, 210 with Crohn's disease and 5 with indeterminate colitis). DEXA results and potential predictive factors of low BMD were documented. Predictive factors of low BMD were assessed by logistic regression. DEXA was performed in 168 IBD patients (35.4%). A low BMD (T-score<-1) was present in 64.3%. Osteoporosis (T-score<-2.5) was found in 23.8%. Low BMI, older age at the moment of diagnosis and male gender were found to be predictive factors of low BMD. For patients with osteoporosis, disease duration was an additional predictive factor. After subgroup analysis predictive factors were found to be the same in patients with Crohn's disease. The prevalence of osteopenia and osteoporosis in IBD patients in a regional centre is as high as the prevalence rates reported from tertiary referral centres. A low BMI, an older age at the moment of diagnosis and male gender were predictive factors of low BMD. Prediction of osteoporosis and osteopenia using risk factors identified in this and previous studies is presently not feasible.
Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C
2014-03-01
Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.
Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A
2011-01-01
Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Charles, H. K. Jr; Beck, T. J.; Feldmesser, H. S.; Magee, T. C.; Spisz, T. S.; Pisacane, V. L.
2001-01-01
An advanced, multiple projection, dual energy x-ray absorptiometry (AMPDXA) scanner system is under development. The AMPDXA is designed to make precision bone and muscle loss measurements necessary to determine the deleterious effects of microgravity on astronauts as well as develop countermeasures to stem their bone and muscle loss. To date, a full size test system has been developed to verify principles and the results of computer simulations. Results indicate that accurate predictions of bone mechanical properties can be determined from as few as three projections, while more projections are needed for a complete, three-dimensional reconstruction. c 2001. Elsevier Science Ltd. All rights reserved.
Forsmo, Siri; Langhammer, Arnulf; Schei, Berit
2009-01-01
The aim of this study was to investigate the association between bone loss and weight change before and concurrently to the assessment of forearm bone loss over 4.6 years in a population-based cohort of middle-aged women followed for more than 15 years. Among 8,856 women aged 45 to 60 years attending the first Nord-Trøndelag Health Study study, Norway (1984-1986), a 35% random sample was invited for forearm densitometry at Nord-Trøndelag Health Study 2 (1995-1997), and 2,188 women (78%) attended. After an average period of 4.6 years, they were subsequently invited for follow-up densitometry in 2001, and 1,421 women (67.8%) met. Weight and height were measured on all three occasions. During the total period of observation since baseline (15.5 y), the mean weight had increased by 3.4 kg, mostly in the youngest women. Weight loss had an accelerating and weight gain a decelerating effect on bone loss, and this was observed both for weight change occurring before the bone mineral density follow-up and for concurrent weight change. The relationship between prior weight gain or loss and bone loss seemed to persist, independent of the weight change observed during the period of bone loss assessment. Despite no mechanical impact of body weight on the forearm, weight loss in midlife women seems to be associated with a long-lasting negative effect on bone and vice versa for weight gain. This is presumably explained by humoral factors.
Effect of the menstrual cycle in ethanol pharmacokinetics.
Haddad, L; Milke, P; Zapata, L; de la Fuente, J R; Vargas-Vorácková, F; Lorenzana-Jiménez, M; Corte, G; Tamayo, J; Kaplan, M; Márquez, M; Kershenobich, D
1998-01-01
Differences in ethanol pharmacokinetics within the menstrual cycle have previously been reported and attributed to variations in body composition, hormonal influences and gastric emptying. To establish the role of the menstrual cycle in ethanol pharmacokinetics associated with changes in body composition, ethanol blood concentrations were measured in nine healthy women during the midfollicular (P1, days 8-10) and midluteal (P2, days 22-24) phases of the menstrual cycle after a postprandial oral ethanol dose (0.3 g kg(-1)). Total body water was assessed by dual-energy x-ray densitometry (DEXA) on both occasions. Median total body water did not vary during either phase of the menstrual cycle (P1 = 54.54%, P2 = 54.66%; P = 0.9296). Median area under the ethanol concentration-time curve (AUC) was lower during P1 (215.33 mg.h dl(-1)) than during P2 (231.33 mg.h dl(-1))(P = 0.8253). No significant differences were found on ethanol pharmacokinetics in either phase of the menstrual cycle.
Fad diets and obesity--Part I: Measuring weight in a clinical setting.
Moyad, Mark A
2004-04-01
Obesity is a recognized epidemic in many regions around the world and billions of dollars are spent each year in attempting to combat this problem. However, before a discussion of the different conventional and alternative treatments for obesity can be initiated, it is first critical to determine whether or not a certain individual is actually overweight, obese, or has an excess of adipose tissue. Therefore, a review of the various popular and unpopular measurements of obesity is needed. A variety of measurements exist such as bioelectrical impedance, body mass index (BMI), crude weight, densitometry, dual energy x-ray absorptiometry (DEXA), lean body mass (LBM), skinfold thickness, and waist-to-hip ratio (WHR). All of these measurements contain inherent advantages and disadvantages, but many of these can still be used in a clinical setting. Health professionals should acquaint themselves with these different measurements in order to take the first step in bringing attention to and potentially treating a condition that affects virtually every medical discipline.
Incidence of Osteoporosis in Patients with Urolithiasis
Bijelic, Radojka; Milicevic, Snjezana; Balaban, Jagoda
2014-01-01
ABSTRACT Introduction. Clinical researches have shown an increased bone disintegration and lower bone mass in patients with calcium urolithiasis. Goal. The goal of our research was to establish the incidence of osteoporosis in adult patients with calcium urolithiasis, on the basis of measuring mineral bone density, using DEXA method, with a special reflection on age subgroups. Material and methods. Clinical research was prospective and it was implemented at the University Clinical Center of Banja Luka, at the Clinic for Endocrinology, Diabetes and Metabolic Diseases and at the Urology Clinic. Material in this research consisted of patients divided in two groups, a working and a control group. One hundred and twenty (120) patients were included in both these groups, divided in three age subgroups: 20-40, 40-60 and over 60. The working group consisted of the patients with calcium urolithiasis and the control group consisted of patients without calcium urolithiasis. Establishing of mineral bone density at L2-L4 of lumbal spine vertebrae and hip was done for the patients in both these groups, using DEXA method. Results. Analysis of mineral bone density using DEXA method in patients in age groups of working and control groups, as well as in the total sample of working and control groups, have shown that the patients of the working group, over 60, had a decreased mineral bone density (30% of osteopenia and 15% osteoporosis) significantly more expressed when compared to the other two age groups (12.5% in the subgroup 20-40 and 17.5% in the subgroup 40-60), which presents a statistically significant difference (p<0.05). In the control group, when taking into account age groups, osteopenia and osteoporosis were marked in 37.5% and 2.5% in the group of patients over 60, whereas in the youngest population, 5% of osteopenia was found, which presents a statistically significant difference (p<0.05). When observing the total sample of working and control group, there was a statistically significant difference in the working and control group (p<0.01); incidence of osteoporosis in the working group amounted to 7.5% and in the control group it was 0.8%. Conclusion. Urolithiasis and osteoporosis are two multifactorial diseases which are evidently reciprocal. This is why we suggest that educating the population about the risk factors for occurrence of these diseases as well as preventive measures that may contribute to their decrease should begin as early as possible. PMID:25568567
2017-10-01
Cincinnati enrollment center CGRP = Clinical Genetics Research Program DEXA = dual energy x-ray absorptiometry Ddrops = formulation of...cholecalciferol (vitamin D3) DXA = dual energy x-ray absorptiometry FDA= Federal Drug Administration HAM = University of Hamburg enrollment center IRB
2004-01-01
The International Society for Clinical Densitometry (ISCD) held a Position Development Conference in July 2003, at which time positions developed and researched by the organization's Scientific Advisory Committee were presented to a panel of international experts in the field of bone density testing. This panel reached agreement on a series of positions that were subsequently approved by the Board of Directors of the ISCD and are now official policy of the ISCD. These positions, which are outlined in this article and discussed in greater detail in subsequent articles in this journal, include (1) affirmation of the use of the World Health Organization classification for the diagnosis of osteoporosis in postmenopausal women; (2) the diagnosis of osteoporosis in men; (3) the diagnosis of osteoporosis in premenopausal women; (4) the diagnosis of osteoporosis in children; (5) technical standards for skeletal regions of interest by dual-energy X-ray absorptiometry (DXA); (6) the use of new technologies, such as vertebral fracture assessment; (7) technical standards for quality assurance, including phantom scanning and calibration; (8) technical standards for the performance of precision assessment at bone density testing centers, and for cross-calibration of DXA devices; (9) indications for bone density testing; (10) appropriate information for a bone density report; and (11) nomenclature and decimal places for bone density reporting.
Determination of Small Animal Long Bone Properties Using Densitometry
NASA Technical Reports Server (NTRS)
Breit, Gregory A.; Goldberg, BethAnn K.; Whalen, Robert T.; Hargens, Alan R. (Technical Monitor)
1996-01-01
Assessment of bone structural property changes due to loading regimens or pharmacological treatment typically requires destructive mechanical testing and sectioning. Our group has accurately and non-destructively estimated three dimensional cross-sectional areal properties (principal moments of inertia, Imax and Imin, and principal angle, Theta) of human cadaver long bones from pixel-by-pixel analysis of three non-coplanar densitometry scans. Because the scanner beam width is on the order of typical small animal diapbyseal diameters, applying this technique to high-resolution scans of rat long bones necessitates additional processing to minimize errors induced by beam smearing, such as dependence on sample orientation and overestimation of Imax and Imin. We hypothesized that these errors are correctable by digital image processing of the raw scan data. In all cases, four scans, using only the low energy data (Hologic QDR-1000W, small animal mode), are averaged to increase image signal-to-noise ratio. Raw scans are additionally processed by interpolation, deconvolution by a filter derived from scanner beam characteristics, and masking using a variable threshold based on image dynamic range. To assess accuracy, we scanned an aluminum step phantom at 12 orientations over a range of 180 deg about the longitudinal axis, in 15 deg increments. The phantom dimensions (2.5, 3.1, 3.8 mm x 4.4 mm; Imin/Imax: 0.33-0.74) were comparable to the dimensions of a rat femur which was also scanned. Cross-sectional properties were determined at 0.25 mm increments along the length of the phantom and femur. The table shows average error (+/- SD) from theory of Imax, Imin, and Theta) over the 12 orientations, calculated from raw and fully processed phantom images, as well as standard deviations about the mean for the femur scans. Processing of phantom scans increased agreement with theory, indicating improved accuracy. Smaller standard deviations with processing indicate increased precision and repeatability. Standard deviations for the femur are consistent with those of the phantom. We conclude that in conjunction with digital image enhancement, densitometry scans are suitable for non-destructive determination of areal properties of small animal bones of comparable size to our phantom, allowing prediction of Imax and Imin within 2.5% and Theta within a fraction of a degree. This method represents a considerable extension of current methods of analyzing bone tissue distribution in small animal bones.
Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M.; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R.; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny
2016-01-01
Objectives We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. Methods An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Results Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. Conclusion A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity. PMID:26849438
Effects of anticonvulsants and inactivity on bone disease in epileptics
Murchison, Lilian E.; Bewsher, P. D.; Chesters, Marion; Gilbert, J.; Catto, G.; Law, Elizabeth; McKay, E.; Ross, H. S.
1975-01-01
No significant biochemical or radiological features of vitamin D deficiency were found in groups of juvenile and adult epileptics and control groups of non-epileptic patients in hospitals for the mentally retarded. There was evidence of hepatic enzyme induction in patients on anticonvulsants, in that urinary D-glucaric acid concentration and excretion were raised. No effect was found of prolonged anticonvulsant therapy on bone densitometry, but in children immobility was closely associated with decreased bone density. The evidence suggests that disuse osteoporosis is the major bone disease in these mentally retarded children. PMID:1161672
Sepúlveda-Rivera, Vanessa; Donato-Santana, Christian; Diaz-Vega, Gil
2017-12-01
This study was meant to be the first step in bridging a gap in the literature concerning Puerto Rican geriatric patients' levels of knowledge concerning 4 preventive care screening tests: mammography, bone densitometry, colonoscopy, and lipid panels. Patients 65 years old and older were interviewed at the University of Puerto Rico (UPR), Medical Sciences Campus, primary care clinics. Fisher's exact test was used to assess knowledge status for each screening test. Fifty-three participants, 53% being women, took part in the study. All the women (100%) reported having knowledge about mammography screening as well as about bone densitometry scans (71%); 91% of the participants reported having knowledge concerning colonoscopy. Only 34% understood what information results from a lipid panel. The majority of the participants were not aware of precisely when each of the screening tests under discussion should be undertaken. For all the screenings, level of education and provider recommendation were associated with increased levels of knowledge (though statistically significant only for bone densitometry and lipid panels). Elderly Puerto Ricans appear to have knowledge about screening tests; however, there is an overall lack of knowledge about the timing of screening. Risk factors for this lack of knowledge are having a relatively lower level of education, the lack of healthcare-provider recommendation, and the lack of patient education. Understanding when to have tests is vital for interventions, in order to improve patient outcomes, which can include death from treatable conditions or diseases. Future research should include larger samples as well as studies of outcomes associated with these screening tests. These will help researchers and policymakers better understand this issue and aid in the development and implementation of interventions for both patients and physicians.
Age dependence of the normal/abnormal difference of bone mineral density in osteoporotic women.
Bagur, A; Vega, E; Mautalen, C
1994-09-01
Bone mineral density (BMD) is the major factor in bone strength and in the risk of suffering osteoporotic fractures. The aim of this study was to examine the normal/abnormal difference for antero-posterior (AP) spine, lateral spine, proximal femur and total body BMD to assess if age influences discrimination at three different decades between 50 and 80 years of age. The BMD was determined in 61 control women and 60 osteoporotic women (at least one vertebral wedge fracture readily visible in the lateral X-rays of the thoracic or lumbar spine). Measurements were made by DEXA with a total body scanner. The BMD of the whole group of osteoporotic women was markedly lower than that of age-matched controls at all skeletal areas (P < 0.001) except at the arms where the difference was smaller (P < 0.02). The Z-score (the difference between osteoporotic patients and age-matched control divided by the intrapopulation S.D.) was similar (approximately -1.7) over the AP spine, femoral neck, Ward's triangle, total body and legs. It was significantly lower at the arms (-0.8, P < 0.001), lateral spine (-1.4, P < 0.01) and trochanter (-1.3, P < 0.001) compared with the Z-score of the AP spine. The analysis of the results by decades of age disclosed that the higher Z-score on the 6th and 7th decades corresponded to the AP lumbar spine (approximately -2.0). A high descrimination was also observed for the femoral neck, Ward's triangle and legs while the Z-score of the lateral lumbar spine, total body, trochanter and arms were significantly lower than that of the AP lumbar spine. However on the 8th decade the Z-score of the AP lumbar spine diminished to -1.2 and was only significantly higher than the Z-score of the arms (P < 0.01). The study showed that, in women 50-60 years of age--the period where the majority of studies are made for prevention of osteoporosis, none of the other skeletal areas were superior to the AP spine in discrimination for spinal osteoporosis. Proximal femur and legs densitometry gave lower but not significantly different Z-score than the AP spine, while the remaining areas were significantly inferior to AP spine in separating osteoporotic and normal women.
Abbasi, Mahnaz; Farzam, Seyed Amir; Mamaghani, Zahra; Yazdi, Zohreh
2017-11-01
Prevention of osteoporosis and bone fracture and the relationship between metabolic syndrome and bone density are controversial issues. The aim of this study was to evaluate the association between metabolic syndrome and its components with bone mineral density in post menopausal women referred for bone mineral density (BMD) test. A total of 143 postmenopausal women with at least one year of menopause experience participated in this cross-sectional study. Demographic and anthropometric characteristics for all participants were collected. Also, biochemical parameters including fasting blood sugar, Cholesterol (HDL and LDL), triglyceride were measured. Association between the components of metabolic syndrome and bone densitometry were analyzed by statistical methods. In this study, 72% of participants did not have metabolic syndrome. Among them, 43.4% and 28.7% had osteoporosis and normal density, respectively. Of remaining participants with metabolic syndrome, 12.6% and 15.4% had osteoporosis and normal density, respectively. Among the metabolic syndrome components, waist circumference, HDL cholesterol, and waist to hip ratio were significantly associated with bone mass (P<0.05). Osteoporotic women had lower waist circumference and waist to hip ratio and higher HDL than women without osteoporosis. On the other hand, women with metabolic syndrome did not have significant differences than women without metabolic syndrome in terms of lumbar and femoral neck density (P>0.05). Results from this study showed that metabolic syndrome and its components did not induce bone mass loss. The discrepancies of the studies in this area call for more large scale studies in population so as to prevent women problems in this area. Copyright © 2016 Diabetes India. Published by Elsevier Ltd. All rights reserved.
Hamilton Jr, David A; Reilly, Danielle; Wipf, Felix; Kamineni, Srinath
2015-01-01
AIM: To determine whether use of a precontoured olecranon plate provides adequate fixation to withstand supraphysiologic force in a comminuted olecranon fracture model. METHODS: Five samples of fourth generation composite bones and five samples of fresh frozen human cadaveric left ulnae were utilized for this study. The cadaveric specimens underwent dual-energy X-ray absorptiometry (DEXA) scanning to quantify the bone quality. The composite and cadaveric bones were prepared by creating a comminuted olecranon fracture and fixed with a pre-contoured olecranon plate with locking screws. Construct stiffness and failure load were measured by subjecting specimens to cantilever bending moments until failure. Fracture site motion was measured with differential variable resistance transducer spanning the fracture. Statistical analysis was performed with two-tailed Mann-Whitney-U test with Monte Carlo Exact test. RESULTS: There was a significant difference in fixation stiffness and strength between the composite bones and human cadaver bones. Failure modes differed in cadaveric and composite specimens. The load to failure for the composite bones (n = 5) and human cadaver bones (n = 5) specimens were 10.67 nm (range 9.40-11.91 nm) and 13.05 nm (range 12.59-15.38 nm) respectively. This difference was statistically significant (P ˂ 0.007, 97% power). Median stiffness for composite bones and human cadaver bones specimens were 5.69 nm/mm (range 4.69-6.80 nm/mm) and 7.55 nm/mm (range 6.31-7.72 nm/mm). There was a significant difference for stiffness (P ˂ 0.033, 79% power) between composite bones and cadaveric bones. No correlation was found between the DEXA results and stiffness. All cadaveric specimens withstood the physiologic load anticipated postoperatively. Catastrophic failure occurred in all composite specimens. All failures resulted from composite bone failure at the distal screw site and not hardware failure. There were no catastrophic fracture failures in the cadaveric specimens. Failure of 4/5 cadaveric specimens was defined when a fracture gap of 2 mm was observed, but 1/5 cadaveric specimens failed due to a failure of the triceps mechanism. All failures occurred at forces greater than that expected in postoperative period prior to healing. CONCLUSION: The pre-contoured olecranon plate provides adequate fixation to withstand physiologic force in a composite bone and cadaveric comminuted olecranon fracture model. PMID:26495247
Is bone mineral density measurement using dual-energy X-ray absorptiometry affected by gamma rays?
Xie, Liang-Jun; Li, Jian-Fang; Zeng, Feng-Wei; Jiang, Hang; Cheng, Mu-Hua; Chen, Yi
2013-01-01
The objective of this study was to determine whether the gamma rays emitted from the radionuclide effect bone mineral density (BMD) measurement. Nine subjects (mean age: 56 ± 17.96 yr) scheduled for bone scanning underwent BMD measurement using dual-energy X-ray absorptiometry (DXA) (Hologic/Discovery A) before and 1, 2, and 4 h after injection of technetium-99m-methylene diphosphonate (99mTc-MDP). Ten subjects (mean age: 41 ± 15.47 yr) scheduled for therapy of differentiated thyroid carcinoma with iodine-131 underwent BMD measurement before and 2 h after therapeutic radionuclide administration. All patients were given whole body BMD measurement, including head, arm, ribs, lumbar spine, pelvis, and leg sites. Besides, patients who referred to radioiodine therapy were given total hip and femoral neck BMD measurement as well. No statistically significant changes in BMD values were detected after 99mTc-MDP and iodine-131 administration for all measurement sites (p > 0.05), and individual difference of BMD before and after radionuclide imaging or therapy was less than the least significant change in lumbar spine, total hip, and femoral neck. In conclusion, BMD measurements are not influenced by the gamma rays emitted from technetium-99m and iodine-131. DXA bone densitometry may be performed simultaneously with bone scanning and radioiodine therapy. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Validation of Long Bone Mechanical Properties from Densitometry
NASA Technical Reports Server (NTRS)
Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)
1995-01-01
The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.
Usefulness of the Trabecular Bone Score for assessing the risk of osteoporotic fracture.
Redondo, L; Puigoriol, E; Rodríguez, J R; Peris, P; Kanterewicz, E
2018-04-01
The trabecular bone score (TBS) is an imaging technique that assesses the condition of the trabecular microarchitecture. Preliminary results suggest that TBS, along with the bone mineral density assessment, could improve the calculation of the osteoporotic fracture risk. The aim of this study was to analyse TBS values and their relationship with the clinical characteristics, bone mineral density and history of fractures of a cohort of posmenopausal women. We analysed 2,257 posmenopausal women from the FRODOS cohort, which was created to determine the risk factors for osteoporotic fracture through a clinical survey and bone densitometry with vertebral morphometry. TBS was applied to the densitometry images. TBS values ≤1230 were considered indicative of degraded microarchitecture. We performed a simple and multiple linear regression to determine the factors associated with this index. The mean TBS value in L1-L4 was 1.203±0.121. Some 55.3% of the women showed values indicating degraded microarchitecture. In the multiple linear regression analysis, the factors associated with low TBS values were age, weight, height, spinal T-score, glucocorticoid treatment, presence of type 2 diabetes and a history of fractures due to frailty. TBS showed microarchitecture degradation values in the participants of the FRODOS cohort and was associated with anthropometric factors, low bone mineral density values, the presence of fractures, a history of type 2 diabetes mellitus and the use of glucocorticoids. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.
Bennett, Herbert S; Dienstfrey, Andrew; Hudson, Lawrence T; Oreskovic, Tammy; Fuerst, Thomas; Shepherd, John
2006-01-01
This article reports and discusses the results of the recent ISCD-NIST Workshop on Standards and Measurements for Assessing Bone Health. The purpose of the workshop was to assess the status of efforts to standardize and compare results from dual-energy X-ray absorptiometry (DXA) scans, and then to identify and prioritize ongoing measurement and standards needs.
Hatefi, Masoud; Ahmadi, Mohammad Reza Hafezi; Rahmani, Asghar; Dastjerdi, Masoud Moghadas; Asadollahi, Khairollah
2018-06-01
Osteoporosis is one of the most common problems of patients with spinal cord injuries (SCIs). The current study aimed to evaluate the antiosteoporotic effects of curcumin on densitometry parameters and biomarkers of bone turnovers among patients with SCI. The current controlled clinical trial was conducted among 100 patients with SCI referred to an outpatient clinic of rehabilitation in Ilam City, Iran, in 2013-2015. The intervention group received 110/mg/kg/day curcumin for 6 months and the control group received placebo. Bone mineral density (BMD) was measured in all patients. The level of procollagen type I N-terminal propeptide, serum carboxy-terminal telopeptide of type I collagen, osteocalcin, and bone-specific alkaline phosphates were compared before and after study. BMD indicators of lumbar, femoral neck, and total hip in the control group significantly decreased compared with the beginning of study. However, in the curcumin group, a significant increase was observed in BMD indicators of lumbar, femoral neck, and hip at the end of study compared with the beginning. There was also a significant difference between interventional and control groups for the mean BMD of femoral neck and hip at the end of study (0.718 ± 0.002 g/cm 2 vs. 0.712 ± 0.003 g/cm 2 and 0.742 ± 0.031 g/cm 2 vs. 0.692 ± 0.016 g/cm 2 , respectively). Curcumin, via modulation of densitometry indices and bone resorption markers, showed inhibitory effects on the process of osteoporosis. Treatment with curcumin was significantly associated with a decrease in the osteoporosis progression and bone turnover markers of patients with SCI after 6 months. Copyright © 2018 Elsevier Inc. All rights reserved.
Preliminary research on dual-energy X-ray phase-contrast imaging
NASA Astrophysics Data System (ADS)
Han, Hua-Jie; Wang, Sheng-Hao; Gao, Kun; Wang, Zhi-Li; Zhang, Can; Yang, Meng; Zhang, Kai; Zhu, Pei-Ping
2016-04-01
Dual-energy X-ray absorptiometry (DEXA) has been widely applied to measure the bone mineral density (BMD) and soft-tissue composition of the human body. However, the use of DEXA is greatly limited for low-Z materials such as soft tissues due to their weak absorption, while X-ray phase-contrast imaging (XPCI) shows significantly improved contrast in comparison with the conventional standard absorption-based X-ray imaging for soft tissues. In this paper, we propose a novel X-ray phase-contrast method to measure the area density of low-Z materials, including a single-energy method and a dual-energy method. The single-energy method is for the area density calculation of one low-Z material, while the dual-energy method aims to calculate the area densities of two low-Z materials simultaneously. Comparing the experimental and simulation results with the theoretical ones, the new method proves to have the potential to replace DEXA in area density measurement. The new method sets the prerequisites for a future precise and low-dose area density calculation method for low-Z materials. Supported by Major State Basic Research Development Program (2012CB825800), Science Fund for Creative Research Groups (11321503) and National Natural Science Foundation of China (11179004, 10979055, 11205189, 11205157)
Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System
2005-10-01
00 A AA 0 A (C) (D) \\ " 5- Ŕ -.- o 0 AA .0 0 *A 000 L 0 000 SPearson r -0.6401 UW 2 ,_.p=0.0032, n=18 Pearsonr-72 p<O.01, n18 625 650 675 700 72 750...measured by dual-energy X-ray absorptiometry (DEXA) using a reached in the group with PIXImus soft-X-ray densitometer (Lunar, Madison WI) and analysis...dietary and lifestyle factors and their I 1q12-13 with low bone mineral density at the lumbar spine in the association with bone mass in men and women
[Secondary osteoporosis and glucocorticoid-induced osteoporosis].
Orcel, P; Krane, S M
2000-10-01
In order to assess properly the diagnosis of osteoporosis, a short clinical investigation is required to address potential causes for bone loss. Osteoporosis used to be suspected in a patient with vertebral demineralization, but nowadays it is often diagnosed in a patient with a low bone mass on a screening dual-energy X-ray absorptiometry (DEXA). In this setting, it is important for the clinician to look for secondary osteoporosis, especially in men in whom secondary osteoporosis is more frequent than in women, before discussing any specific therapy. The major causes are longterm glucocorticoid therapy, endocrine (hypogonadism, primary hyperparathyroidism, hyperthyroidism), or digestive diseases.
Radiation safety analysis of the ISS bone densitometer
NASA Astrophysics Data System (ADS)
Todd, Paul; Vellinger, John C.; Barton, Kenneth; Faget, Paul
A Bone Densitometer (BD) has been developed for installation on the International Space Station (ISS) with delivery by the Space-X Dragon spacecraft planned for mid 2014. After initial tests on orbit the BD will be used in longitudinal measurements of bone mineral density in experimental mice as a means of evaluating countermeasures to bone loss. The BD determines bone mineral density (and other radiographic parameters) by dual energy x-ray absorptiometry (DEXA). In a single mouse DEXA “scan” its 80 kV x-ray tube is operated for 15 seconds at 35 kV and 3 seconds at 80 kV in four repetitions, giving the subject a total dose of 2.5 mSv. The BD is a modification of a commercial mouse DEXA product known as PIXImus(TM). Before qualifying the BD for utilization on ISS it was necessary to evaluate its radiation safety features and any level of risk to ISS crew members. The BD design reorients the PIXImus so that it fits in an EXPRESS locker on ISS with the x-ray beam directed into the crew aisle. ISS regulation SSP 51700 considers the production of ionizing radiation to be a catastrophic-level hazard. Accidental exposure is prevented by three independent levels of on-off control as required for a catastrophic hazard. The ALARA (As Low as Reasonably Achievable) principle was applied to the BD hazard just as would be done on the ground, so deliberate exposure is limited by lead shielding according to ALARA. Hot spots around the BD were identified by environmental dosimetry using a Ludlum 9DP pressurized ionization chamber survey meter. Various thicknesses of lead were applied to the BD housing in areas where highest dose-per-scan readings were made. It was concluded that 0.4 mm of lead shielding at strategic locations, adding only a few kg of mass to the payload, would accomplish ALARA. With shielding in place the BD now exposes a crew member floating 40 cm away to less than 0.08 microSv per mouse scan. There is an upper limit of 20 scans per day, or 1.6 microSv per day, which may occur a few times per year. This dose may be compared with the 400 microSv per day received by crew members in low earth orbit. The designed shielding level also protects adjacent payloads by maintaining less than 2 mrad/day at 5 cm - a requirement for the protection of electronic instrumentation. It is concluded that the ISS Bone Densitometer minimizes ionizing radiation risks associated with its operation. Research supported by NASA Contract NNJ13GA01C and the Center for the Advancement of Science in Space (CASIS).
Jeong, Seong Han; Lee, Jeong A; Kim, Jin A; Lee, Mun Woo; Chae, Hee Bok; Choi, Won Jun; Shin, Hyoung Shik; Lee, Ki Hyeong; Youn, Sei Jin; Koong, Sung Soo; Park, Seon Mee
1999-01-01
Objectives The aim of this study was to evaluate changes of body composition in cirrhotic patients. Dual energy x-ray absorptiometry (DEXA) and anthropometry were used, and the values obtained were compared. Methods Mid-arm fat and muscle areas were calculated by anthropometry in 66 cirrhotic patients and 94 healthy controls. In 37 of the cirrhotic patients and 39 of the controls, fat mass, lean soft tissue mass and bone mineral contents were measured with DEXA. Results The number of cirrhotic patients with measured values below the fifth percentile of normal controls was 21 (31.8%) by mid-arm fat area, six (9.1%) by mid-arm muscle area, 15 (40.5%) by fat mass and 0 (0%) by lean soft tissue mass. The fat mass in cirrhotic patients was less than in controls, whereas lean soft tissue mass and bone mineral content were not different. Fat depletion was severe in Child-class C patients and with severe ascites. Mid-arm fat area and fat mass showed close correlation (r = 0.85, p<0.01), but mid-arm muscle area and lean soft tissue mass showed poor correlation (r = 0.32, p<0.05). Conclusion Cirrhotic patients showed lower fat component, with preserved lean soft tissue mass and bone mineral content. In clinical practice, the measurement of mid-arm fat area was useful for the assessment of fat mass. PMID:10461427
Dexamethasone Alleviates Tumor-Associated Brain Damage and Angiogenesis
Fan, Zheng; Sehm, Tina; Rauh, Manfred; Buchfelder, Michael
2014-01-01
Children and adults with the most aggressive form of brain cancer, malignant gliomas or glioblastoma, often develop cerebral edema as a life-threatening complication. This complication is routinely treated with dexamethasone (DEXA), a steroidal anti-inflammatory drug with pleiotropic action profile. Here we show that dexamethasone reduces murine and rodent glioma tumor growth in a concentration-dependent manner. Low concentrations of DEXA are already capable of inhibiting glioma cell proliferation and at higher levels induce cell death. Further, the expression of the glutamate antiporter xCT (system Xc −; SLC7a11) and VEGFA is up-regulated after DEXA treatment indicating early cellular stress responses. However, in human gliomas DEXA exerts differential cytotoxic effects, with some human glioma cells (U251, T98G) resistant to DEXA, a finding corroborated by clinical data of dexamethasone non-responders. Moreover, DEXA-resistant gliomas did not show any xCT alterations, indicating that these gene expressions are associated with DEXA-induced cellular stress. Hence, siRNA-mediated xCT knockdown in glioma cells increased the susceptibility to DEXA. Interestingly, cell viability of primary human astrocytes and primary rodent neurons is not affected by DEXA. We further tested the pharmacological effects of DEXA on brain tissue and showed that DEXA reduces tumor-induced disturbances of the microenvironment such as neuronal cell death and tumor-induced angiogenesis. In conclusion, we demonstrate that DEXA inhibits glioma cell growth in a concentration and species-dependent manner. Further, DEXA executes neuroprotective effects in brains and reduces tumor-induced angiogenesis. Thus, our investigations reveal that DEXA acts pleiotropically and impacts tumor growth, tumor vasculature and tumor-associated brain damage. PMID:24714627
Midgley, Stewart; Schleich, Nanette
2015-05-01
A novel method for dual-energy X-ray analysis (DEXA) is tested using measurements of the X-ray linear attenuation coefficient μ. The key is a mathematical model that describes elemental cross sections using a polynomial in atomic number. The model is combined with the mixture rule to describe μ for materials, using the same polynomial coefficients. Materials are characterized by their electron density Ne and statistical moments Rk describing their distribution of elements, analogous to the concept of effective atomic number. In an experiment with materials of known density and composition, measurements of μ are written as a system of linear simultaneous equations, which is solved for the polynomial coefficients. DEXA itself involves computed tomography (CT) scans at two energies to provide a system of non-linear simultaneous equations that are solved for Ne and the fourth statistical moment R4. Results are presented for phantoms containing dilute salt solutions and for a biological specimen. The experiment identifies 1% systematic errors in the CT measurements, arising from third-harmonic radiation, and 20-30% noise, which is reduced to 3-5% by pre-processing with the median filter and careful choice of reconstruction parameters. DEXA accuracy is quantified for the phantom as the mean absolute differences for Ne and R4: 0.8% and 1.0% for soft tissue and 1.2% and 0.8% for bone-like samples, respectively. The DEXA results for the biological specimen are combined with model coefficients obtained from the tabulations to predict μ and the mass energy absorption coefficient at energies of 10 keV to 20 MeV.
Three Dimensional Cross-Sectional Properties From Bone Densitometry
NASA Technical Reports Server (NTRS)
Cleek, Tammy M.; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)
2001-01-01
Bone densitometry has previously been used to obtain cross-sectional properties of bone in a single scan plane. Using three non-coplanar scans, we have extended the method to obtain the principal area Moments of inertia and orientations of the principal axes at each cross-section along the length of the scan. Various 5 aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of mass distribution. Factors considered included X-ray photon energy, initial scan orientation, the included angle of the 3 scans, and Imin/Imax ratios. Principal moments of inertia were accurate to within 3.1% and principal angles were within 1 deg. of the expected value for phantoms scanned with included angles of 60 deg. and 90 deg. at the higher X-ray photon energy. Low standard deviations in error also 10 indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 deg. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (Imin/Imax) values when various included angles are used make this technique viable for future in vivo studies.
Chepulis, L; Starkey, N
2008-01-01
To determine whether honey and sucrose would have differential effects on weight gain during long-term feeding, 45 2-mo-old Sprague Dawley rats were fed a powdered diet that was either sugar-free or contained 7.9% sucrose or 10% honey ad libitum for 52 wk (honey is 21% water). Weight gain was assessed every 1 to 2 wk and food intake was measured every 2 mo. At the completion of the study blood samples were removed for measurement of blood sugar (HbA1c) and a fasting lipid profile. DEXA analyses were then performed to determine body composition and bone mineral densities. Overall weight gain and body fat levels were significantly higher in sucrose-fed rats and similar for those fed honey or a sugar-free diet. HbA1c levels were significantly reduced, and HDL-cholesterol significantly increased, in honey-fed compared with rats fed sucrose or a sugar free diet, but no other differences in lipid profiles were found. No differences in bone mineral density were observed between honey- and sucrose-fed rats, although it was significantly increased in honey-fed rats compared with those fed the sugar-free diet.
Bone remodelling around HA-coated acetabular cups
Nielsen, P. T.; Søballe, K.
2006-01-01
This study was designed to investigate bone remodelling around the cup in cementless THA. Previous studies indicate an advantage of better sealing of the bone-prosthesis interface by HA/TCP coating of implants, inhibiting polyethylene-induced osteolysis. One hundred patients gave informed consent to participate in a controlled randomized study between porous coated Trilogy versus Trilogy Calcicoat (HA/TCP coated). The cup was inserted in press-fit fixation. The femoral component was a cementless porous coated titanium alloy stem (Bi-Metric), with a modular 28-mm CrCo head. The Harris Hip Score (HHS) and bone mineral density (BMD) determined by DEXA scanning were used to study the effect. Measurements revealed no difference between the two groups after 3 years either in the clinical outcome or in terms of periprosthetic bone density. Patients with a body mass index above normal regained more bone mineral than patients with normal weight. This finding supports the assumption that load is beneficial to bone remodelling. PMID:16761153
Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H
2005-07-01
To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.
Martínez, C; Virgili, N; Cuerda, C; Chicharro, L; Gómez, P; Moreno, J M; Álvarez, J; Martí, E; Matía, P; Penacho, M A; Garde, C; De Luis, D; Gonzalo, M; Lobo, G
2010-01-01
Patients with intestinal failure who receive HPN are at high risk of developing MBD. The origin of this bone alteration is multifactorial and depends greatly on the underlying disease for which the nutritional support is required. Data on the prevalence of this disease in our environment is lacking, so NADYA-SEMPE group has sponsored this transversal study with the aim of knowing the actual MBD prevalence. Retrospective data from 51 patients from 13 hospitals were collected. The questionnaire included demographic data as well as the most clinically relevant for MBD data. Laboratory data (calciuria, PTH, 25 -OH -vitamin D) and the results from the first and last bone densitometry were also registered. Bone mineral density had only been assessed by densitometry in 21 patients at the moment HPN was started. Bone quality is already altered before HPN in a significant percentage of cases (52%). After a mean follow up of 6 years, this percentage increases up to 81%. Due to retrospective nature of the study and the low number of subjects included it has not been possible to determine the role that HPN plays in MBD etiology. Only 35% of patients have vitamin D levels above the recommended limits and the majority of them is not on specific supplementation. HPN is associated with very high risk of MBD, therefore, management protocols that can lead to early detection of the problem as well as guiding for follow up and treatment of these patients are needed.
Fan-beam densitometry of the growing skeleton: are we measuring what we think we are?
Cole, Jacqueline H; Scerpella, Tamara A; van der Meulen, Marjolein C H
2005-01-01
Magnification error in fan-beam densitometers varies with distance from the X-ray source to the bone measured and might obscure bone mineral changes in the growing skeleton. Magnification was examined by scanning aluminum rods of different shapes (square, rectangular, solid round, and hollow round) at four distances above the X-ray source in two orientations, with rods aligned parallel (SI) and perpendicular (ML) to the longitudinal axis of the scanning table. Measured area (cm(2)) decreased linearly with distance above the X-ray source for all rods in the SI orientation (p < 0.005). Measured mineral content (g) decreased linearly with distance but only for SI round rods (p < 0.0001) and for ML hollow round rods (p < 0.005). Area and mineral content decreased 1.6-1.8% per centimeter above the source for round rods. Measured mineral density (g/cm(2)) decreased linearly with distance from the source only for ML hollow round rods (p < 0.005). Variation in area, mineral content, and mineral density measurements was 6.6-6.9%, 6.9-7.5%, and 1.9-2.3%, respectively, for SI round rods. Magnification errors of this magnitude are problematic for clinical studies using fan-beam densitometry. Particularly in pediatric subjects, increases in soft tissue during normal growth could increase a bone's distance from the fan-beam source and result in apparent reductions in area and bone mineral content.
Advanced imaging of the macrostructure and microstructure of bone
NASA Technical Reports Server (NTRS)
Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.
2000-01-01
Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.
Bone mineral measurement using dual energy x ray densitometry
NASA Technical Reports Server (NTRS)
Smith, Steven W.
1989-01-01
Bone mineral measurements before and after space missions have shown that weightlessness greatly accelerates bone demineralization. Bone mineral losses as high as 1 to 3 percent per month were reported. Highly precise instrumentation is required to monitor this loss and thereby test the efficacy of treatment. During the last year, a significant improvement was made in Dual-Photon Absorptiometry by replacing the radioactive source with an x ray tube. Advantages of this system include: better precision, lower patient dose, better spacial resolution, and shorter scan times. The high precision and low radiation dose of this technique will allow detection of bone mineral changes of less than 1 percent with measurements conducted directly at the sites of interest. This will allow the required bone mineral studies to be completed in a shorter time with greater confidence.
Factors Influencing Quality of Life of Hungarian Postmenopausal Women Screened by Osteodensitometry
ERIC Educational Resources Information Center
Maroti-Nagy, Agnes; Paulik, Edit
2011-01-01
The aim of our study was to evaluate factors influencing health related quality of life in Hungarian postmenopausal women who underwent osteodensitometry. A questionnaire-based cross-sectional study was carried out; 359 women aged over 40 years were involved, attending the outpatient Bone Densitometry Centre of Szeged. Two kinds of tools were…
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
Bisphosphonate Treatment for Children With Disabling Conditions
Boyce, Alison M.; Tosi, Laura L.; Paul, Scott M.
2014-01-01
Fractures are a frequent source of morbidity in children with disabling conditions. The assessment of bone density in this population is challenging, because densitometry is influenced by dynamic forces affecting the growing skeleton and may be further confounded by positioning difficulties and surgical hardware. First-line treatment for pediatric osteoporosis involves conservative measures, including optimizing the management of underlying conditions, maintaining appropriate calcium and vitamin D intake, encouraging weight-bearing physical activity, and monitoring measurements of bone mineral density. Bisphosphonates are a class of medications that increase bone mineral density by inhibiting bone resorption. Although bisphosphonates are commonly prescribed for treatment of adult osteoporosis, their use in pediatric patients is controversial because of the lack of long-term safety and efficacy data. PMID:24368091
Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René
2011-01-01
The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Silverman, Stuart L; Cummings, Steven R; Watts, Nelson B
2008-01-01
A panel of experts representing ASBMR, NOF, and ISCD reviewed evidence and reached consensus that regulatory approval of treatments for osteoporosis should be based on trials with fracture endpoints, lasting 18-24 mo, and extending treatment to 5 yr; other indications could be approved based on BMD and turnover markers. In response to an FDA request for clinical trial guidance in osteoporosis, an expert panel was convened with representatives from the American Society of Bone and Mineral Research, the International Society of Clinical Densitometry, and the National Osteoporosis Foundation. The panel used a validated evidence-based expert panel process (the Rand Appropriateness Method) to address issues of trial duration, trial design, use of intermediate endpoints as outcomes, and use of placebo-controlled trials in high-risk patients. The panel concluded that placebo-controlled trials with fracture endpoints are appropriate and, with informed consent, are ethical for registration of new compounds. Trials may be 18-24 mo in duration for efficacy, assuming longer duration to 5 yr for safety and demonstration of sustained fracture reduction. Once fracture efficacy has been established for a particular agent, intermediate endpoints (e.g., BMD and bone turnover markers) may be used as outcomes for new indications other than corticosteroid-induced osteoporosis.
Cross-sectional structural parameters from densitometry
NASA Technical Reports Server (NTRS)
Cleek, Tammy M.; Whalen, Robert T.
2002-01-01
Bone densitometry has previously been used to obtain cross-sectional properties of bone from a single X-ray projection across the bone width. Using three unique projections, we have extended the method to obtain the principal area moments of inertia and orientations of the principal axes at each scan cross-section along the length of the scan. Various aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of cross-sectional properties. Factors considered included X-ray photon energy, initial scan orientation, the angle spanned by the three scans (included angle), and I(min)/I(max) ratios. Principal moments of inertia were accurate to within +/-3.1% and principal angles were within +/-1 degrees of the expected value for phantoms scanned with included angles of 60 degrees and 90 degrees at the higher X-ray photon energy (140 kVp). Low standard deviations in the error (0.68-1.84%) also indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 degrees. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (I(min)/I(max)) values when various included angles are used make this technique viable for future in vivo studies.
Shaarawy, Mohamed; Abassi, Asmaa Farid; Hassan, Hany; Salem, Mahmoud E
2003-04-01
To determine whether leptin is involved in bone remodeling in patients with postmenopausal osteoporosis. Cross-sectional study. Department of Obstetrics and Gynecology, Faculty of Medicine, Cairo University. Ninety postmenopausal osteoporotic women (37 obese and 53 nonobese) and 30 healthy premenopausal women from the same clinic served as controls. Lumbar spine bone mineral density (LS-BMD) of osteoporotic patients was more than 2.5 SD below the normal mean of healthy premenopausal women. Serum levels of leptin, osteocalcin (OC), bone alkaline phosphatase (B-ALP), urinary deoxypyridinoline (DPyr), and N-telopeptide of type 1 collagen (NTX) as well as LS-BMD using dual energy X-ray absorptiometry (DEXA). The serum leptin level in obese postmenopausal osteoporotic patients was significantly increased compared with nonobese osteoporotic patients. There were no significant differences of bone formation markers (B-ALP, OC), bone resorption markers (DPyr, NTX), or LS-BMD between the obese and nonobese groups. There were no significant correlations between serum leptin and any biomarkers of bone turnover and BMD. In postmenopausal osteoporotic patients with increased bone turnover, serum leptin concentration is not correlated with BMD or with the biomarkers of bone formation or bone resorption.
Bone's mechanostat: a 2003 update.
Frost, Harold M
2003-12-01
The still-evolving mechanostat hypothesis for bones inserts tissue-level realities into the former knowledge gap between bone's organ-level and cell-level realities. It concerns load-bearing bones in postnatal free-living bony vertebrates, physiologic bone loading, and how bones adapt their strength to the mechanical loads on them. Voluntary mechanical usage determines most of the postnatal strength of healthy bones in ways that minimize nontraumatic fractures and create a bone-strength safety factor. The mechanostat hypothesis predicts 32 things that occur, including the gross anatomical bone abnormalities in osteogenesis imperfecta; it distinguishes postnatal situations from baseline conditions at birth; it distinguishes bones that carry typical voluntary loads from bones that have other chief functions; and it distinguishes traumatic from nontraumatic fractures. It provides functional definitions of mechanical bone competence, bone quality, osteopenias, and osteoporoses. It includes permissive hormonal and other effects on bones, a marrow mediator mechanism, some limitations of clinical densitometry, a cause of bone "mass" plateaus during treatment, an "adaptational lag" in some children, and some vibration effects on bones. The mechanostat hypothesis may have analogs in nonosseous skeletal organs as well. Copyright 2003 Wiley-Liss, Inc.
Wanderley, Maria I; Saraiva, Karina L A; César Vieira, Juliany S B; Peixoto, Christina A; Udrisar, Daniel P
2013-06-01
The aim of this study was to examine the effect of maternal exposure to Panax ginseng extract (GE) on the prenatal dexamethasone (DEXA)-induced increase in testosterone production by isolated Leydig cells in adult rats. Pregnant rats were treated with (i) GE (200 mg/kg) or vehicle on days 10-21; (ii) DEXA (100 μg/kg) or vehicle on days 14-21; or (iii) a combination of GE plus DEXA at the same doses and with the same regimen. Testosterone production was induced either by the activator of protein kinase A (dbcAMP) or substrates of steroidogenesis [22(R)-hydroxycholesterol (22(R)-OH-C)] and pregnenolone. The capacity of rat Leydig cells exposed to DEXA to synthesize testosterone induced by dbcAMP, 22(R)-OH-C or pregnenolone was increased in comparison with the control group. Combined exposure to DEXA + GE prevented the effect of DEXA on the responsiveness of Leydig cells to all inductors of testosterone synthesis, whereas GE alone did not modify the response to inductors. No modifications in testosterone production were observed under basal conditions. StAR immunoexpression in Leydig cells was not modified by prenatal exposure to DEXA, GE or DEXA + GE. P450scc and glucocorticoid receptor immunoexpression was higher in offspring exposed to DEXA in comparison with the control group. This increased expression was prevented by combined treatment with DEXA + GE. The present findings demonstrate that GE is capable of reversing the effect of DEXA on testosterone synthesis by rat Leydig cells. © 2013 The Authors. International Journal of Experimental Pathology © 2013 International Journal of Experimental Pathology.
Atorvastatin, a double weapon in osteoporosis treatment: an experimental and clinical study.
El-Nabarawi, Naglaa; El-Wakd, Mohamed; Salem, Mostafa
2017-01-01
The aim of this study was to evaluate the effect of atorvastatin on the bone formation and resorption markers in ovariectomized rats (experimental study), and to study its effect on the bone mineral density (BMD) in postmenopausal osteoporotic women (clinical study). The study involved experimental and clinical aspects. In the experimental aspect, 42 female Wistar rats were divided into five groups: Group I (n=6; sham-operated), Group II (n=6; 1 mL of carboxymethyl cellulose [CMC] was administered orally), Group III (n=6; 20 mg/kg orally of atorvastatin was administered), Group IV (n=12; untreated ovariectomized [OVX] rats and served as a model of osteoporosis [OP]) and Group V (n=12; 20 mg/kg orally of atorvastatin was administered to ovariectomized rats). After 4 weeks, serum acid phosphatase, alkaline phosphatase, osteocalcin, total calcium and inorganic phosphorus were assessed. Then, 3 µm thickness lumbar and femur sections were examined using a light microscope to assess cortical thickness, trabecular area, numbers of osteoblasts and osteoclasts. In the clinical aspect, 85 post-menopausal osteoporotic females with recently detected hyperlipidemia participated in the study. Atorvastatin 40 mg/day, calcium carbonate 500 mg/day and vitamin D 800 international units were given to all patients for a period of 18 months. BMD was measured at the start and at the end of the study by dual-energy X-ray absorptiometry (DEXA). In the experiment aspect, the biomarkers of bone remodeling were notably elevated in the OVX group. Administration of atorvastatin produced a significant decrease in the level of these bone metabolic markers. Atorvastatin significantly ameliorates osteoporotic changes induced by ovariectomy. In the clinical aspect, after 18 months the DEXA showed improvement in the T-score for the three measured zones; however, these changes were statistically significant only in the femoral neck area. Atorvastatin was able to decrease the rate of bone metabolism and increase osteogenic activity. It has dual mode of action; both anabolic and antiresorptive effect on bone. This lipophilic statin member may act as a double weapon drug.
Reconstruction of Canine Mandibular Bone Defects Using a Bone Transport Reconstruction Plate
Elsalanty, Mohammed E.; Zakhary, Ibrahim; Akeel, Sara; Benson, Byron; Mulone, Timothy; Triplett, Gilbert R.; Opperman, Lynne A.
2010-01-01
Objectives Reconstruction of mandibular segmental bone defects is a challenging task. This study tests a new device used for reconstructing mandibular defects based on the principle of bone transport distraction osteogenesis. Methods Thirteen beagle dogs were divided into control and experimental groups. In all animals, a 3 cm defect was created on one side of the mandible. In eight control animals, the defect was stabilized with a reconstruction plate without further reconstruction and the animals were sacrificed two to three months after surgery. The remaining five animals were reconstructed with a bone transport reconstruction plate (BTRP), comprising a reconstruction plate with attached intraoral transport unit, and were sacrificed after one month of consolidation. Results Clinical evaluation, cone-beam CT densitometry, three-dimensional histomorphometry, and docking site histology revealed significant new bone formation within the defect in the distracted group. Conclusion The physical dimensions and architectural parameters of the new bone were comparable to the contralateral normal bone. Bone union at the docking site remains a problem. PMID:19770704
The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment.
Stagi, Stefano; Cavalli, Loredana; Seminara, Salvatore; de Martino, Maurizio; Brandi, Maria Luisa
2014-06-07
In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed.
Ethnic Differences in Bone Health
Zengin, Ayse; Prentice, Ann; Ward, Kate Anna
2015-01-01
There are differences in bone health between ethnic groups in both men and in women. Variations in body size and composition are likely to contribute to reported differences. Most studies report ethnic differences in areal bone mineral density (aBMD), which do not consistently parallel ethnic patterns in fracture rates. This suggests that other parameters beside aBMD should be considered when determining fracture risk between and within populations, including other aspects of bone strength: bone structure and microarchitecture, as well as muscle strength (mass, force generation, anatomy) and fat mass. We review what is known about differences in bone-densitometry-derived outcomes between ethnic groups and the extent to which they account for the differences in fracture risk. Studies are included that were published primarily between 1994 and 2014. A “one size fits all approach” should definitely not be used to understand better ethnic differences in fracture risk. PMID:25852642
The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment
2014-01-01
In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed. PMID:24906390
Current methods and advances in bone densitometry
NASA Technical Reports Server (NTRS)
Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.
1995-01-01
Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.
[Epidemiologic variables in postmenopausal women].
Murillo-Uribe, A; Carranza-Lira, S; Martínez-Trejo, N A; Santos González, J E
1999-10-01
The objective was to know the characteristics of presentation, its clinical aspects and the modification in the diagnostic tools in a selected population of Mexican women with spontaneous menopause. The age at menarche, age at menopause, marital status, age at marriage, number of pregnancies and occupation of 1,099 women with spontaneous menopause were studied. In 619 women which were not receiving nor had received hormone replacement therapy the clinical, laboratory such as glucose, lipids, hormones, bone remodeling biochemistry; and X ray studies such as densitometry and mammography were analyzed. The age average of menarche presentation was at 13 years, and that of spontaneous menopause at 48.1 years 78% were married, with an age at marriage of 23 years, 66% had home duties. The screening tests showed that 30% of patients required cardiovascular evaluation, 40% showed alterations on lipids levels and at least 40% had some alteration on bone remodeling biochemistry or in densitometry. The mammography was normal in 81%. This study showed that most of the data in these group of women were similar to those of other populations, and many of them need intensive surveillance and adequate therapeutic prescriptions to diminish risk factors.
Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A
2011-01-01
FRAX(®) is a fracture risk assessment algorithm developed by the World Health Organization in cooperation with other medical organizations and societies. Using easily available clinical information and femoral neck bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA), when available, FRAX(®) is used to predict the 10-year probability of hip fracture and major osteoporotic fracture. These values may be included in country specific guidelines to aid clinicians in determining when fracture risk is sufficiently high that the patient is likely to benefit from pharmacological therapy to reduce that risk. Since the introduction of FRAX(®) into clinical practice, many practical clinical questions have arisen regarding its use. To address such questions, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundations (IOF) assigned task forces to review the best available medical evidence and make recommendations for optimal use of FRAX(®) in clinical practice. Questions were identified and divided into three general categories. A task force was assigned to investigating the medical evidence in each category and developing clinically useful recommendations. The BMD Task Force addressed issues that included the potential use of skeletal sites other than the femoral neck, the use of technologies other than DXA, and the deletion or addition of clinical data for FRAX(®) input. The evidence and recommendations were presented to a panel of experts at the ISCD-IOF FRAX(®) Position Development Conference, resulting in the development of ISCD-IOF Official Positions addressing FRAX(®)-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Zeh, Alexander; Pankow, Franziska; Röllinhoff, Marc; Delank, Stefan; Wohlrab, David
2013-04-01
The aim of this study was to analyze the bone remodeling around the Nanos stem (Smith & Nephew, Marl, Germany) after primary total hip arthroplasty for coxarthrosis. In 25 patients (15 male, 10 female, mean age 59.9 years) with the diagnosis of coxarthrosis, a DEXA scan was performed immediately after surgery, 97 days (SD 6.1 days) and 368 days (SD 6.2 days) after implantation of a Nanos prosthesis. Plain radiographs were analyzed digitally for radiolucent lines, varus-valgus femoral stem alignment, measurement of stem migration and changes in varus-valgus femoral stem alignment. The position of the center of rotation (COR) and the offset were assessed pre- and postoperatively. Harris Hip Score was used to evaluate the clinical outcome. The DEXA scan showed a significant and relevant increase in BMD (Bone Mineral Density) in Gruen-Zone 6 (12%) and a decrease in Zone 1 (15%), 2 (5%) and 7 (12%), which was interpreted as reflecting a distal load transfer in the metaphysis of the femur. There was no clinically relevant migration or tilting of the Nanos stem. Radiolucent lines were noted in 12 cases, mainly at the polished tip area of the prosthesis; this was not regarded as a sign of impaired osseointegration. There was no significant difference between the position of the COR and the pre- and postoperative offset. The absence of stem migration, angulation, or relevant radiolucent lines is seen as evidence for an unimpaired osseointegration of the Nanos stem approximately 12 months after implantation. It is concluded that the Nanos prosthesis can reduce loss of BMD of the proximal femur composed with conventional stems or other short-stemmed implants.
Clinical Implications of Hip Flexion in the Measurement of Spinal Bone Mineral Density.
Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Kato, Hiroyuki
2016-01-01
The aim of this study was to investigate if differences in leg positioning affect spinal bone mineral density (BMD) measurements and the detection of low bone mass. Subjects included 1039 Japanese patients, 878 women and 161 men (mean ages: 67 and 71 years, respectively). Spinal BMD (L1-4) was measured using dual-energy X-ray absorptiometry (DXA) with patients lying in 2 different positions: (1) supine on the scanning table with hips flexed and knees flexed over a 90° support pad (the standard position) and (2) simply supine (the supine position). Predictive indices were calculated for spinal DXA acquired with patients in the supine position. A BMD T-score of -2.5 or lower was set as the threshold for low bone mass. For the standard and the supine positions during scanning in women, BMDs were 0.911 and 0.915 g/cm(2), respectively; in men, they were 1.117 and 1.124 g/cm(2), respectively. The estimated systematic bias in BMD between the positions was 0.42% (95% confidence interval: 0.24, 0.59; p = 0.009). Random errors in the densitometry measurements for the standard and supine positions were 0.66% and 0.84%, respectively. There was no significant difference between the errors (p= 0.164). The likelihood ratios of a positive and negative test for the detection of low bone mass following supine DXA were 121.0 and 0.066, respectively, compared with results acquired using the standard position. In conclusion, DXA measurements acquired with patients in the supine position slightly overestimated BMD vs the standard position. However, the clinical equivalency between the positioning methods for DXA is preserved to the extent that low bone mass can be reliably detected in the supine position. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Mouse Models for Bone Research to Assess Military Stress Fracture Risk
2005-04-01
analyses. DEXA scanning by PIXImus: The PIXImus densitometer (GE-Lunar, Madison , WI) was used to assess whole body areal (a)BMD and body composition...between sexes in 18 of the 28 strains. Sex differences for whole body BMD (aBMD) and BcD of the lumbar spine are not congruent, consequently predicting...cannot be used to predict aBMD, either whole body or at the lumbar spine, or body cornposition compartments. It is important to note that in this
Kasukawa, Yuji; Baylink, David J.; Guo, Rongqing; Mohan, Subburaman
2010-01-01
We previously found that the magnitude of skeletal deficits caused by GH deficiency varied during different growth periods. To test the hypothesis that the sensitivity to GH is growth period dependent, we treated GH-deficient lit/lit mice with GH (4 mg/kg body weight·d) or vehicle during the prepubertal and pubertal (d 7–34), pubertal (d 23–34), postpubertal (d 42–55), and adult (d 204–217) periods and evaluated GH effects on the musculoskeletal system by dual energy x-ray absorptiometry (DEXA) and peripheral quantitative computed tomography. GH treatment during different periods significantly increased total body bone mineral content, bone mineral density (BMD), bone area, and lean body mass and decreased percentage of fat compared with vehicle; however, the magnitude of change varied markedly depending on the treatment period. For example, the increase in total body BMD was significantly (P < 0.01) greater when GH was administered between d 42–55 (15%) compared with pubertal (8%) or adult (7.7%) periods, whereas the net loss in percentage of body fat was greatest (−56%) when GH was administered between d 204 and 216 and least (−27%) when GH was administered between d 7 and 35. To determine whether GH-induced anabolic effects on the musculoskeletal system are maintained after GH withdrawal, we performed DEXA measurements 3–7 wk after stopping GH treatment. The increases in total body bone mineral content, BMD, and lean body mass, but not the decrease in body fat, were sustained after GH withdrawal. Our findings demonstrate that the sensitivity to GH in target tissues is growth period and tissue type dependent and that continuous GH treatment is necessary to maintain body fat loss but not BMD gain during a 3–7 wk follow-up. PMID:12933669
Computation of bone remodelling after Duracon knee arthroplasty using a thermodynamic-based model.
Bougherara, H; Nazgooei, S; Sayyidmousavi, A; Marsik, F; Marík, I A
2011-07-01
The present study utilizes a recently developed literature model for the bone remodelling process to predict the evolution of bone density following Duracon total knee arthroplasty (TKA). In this model, which is based on chemical kinetics and irreversible thermodynamics, bone is treated as a self-organizing system capable of exchanging matter, energy, and entropy with its surroundings. Unlike previous models in which mechanical loading is regarded as the only stimulus for bone remodelling, the present model establishes a unique coupling between mechanical loading and the chemical reactions involved in the process of bone remodelling. This model was incorporated into the finite element software ANSYS by means of a macro to compute density distribution in distal femoral bone both before and after TKA. Consistent with dual-energy X-ray absorptiometry (DEXA) scans reported in the literature, the results showed that the most severe bone loss occurs in the anterior region of the distal femur and that there is more bone resorption in the lateral than the medial condyle following TKA. Furthermore, the bone density distribution predicted using the present model showed a gradual and uniform pattern and thus a more realistic bone evolution contrary to the strain energy density model, where there is no gradual bone density evolution.
Pilot study of bone mineral density in breast cancer patients treated with adjuvant chemotherapy
NASA Technical Reports Server (NTRS)
Headley, J. A.; Theriault, R. L.; LeBlanc, A. D.; Vassilopoulou-Sellin, R.; Hortobagyi, G. N.
1998-01-01
The objective of this cross-sectional study was to determine lumbar spine bone mineral density (BMD) in breast cancer patients previously treated with adjuvant chemotherapy. Sixteen of 27 patients who received adjuvant chemotherapy became permanently amenorrheic as a result of chemotherapy. BMD was measured at the lumbar spine using dual energy X-ray absorptiometry (DEXA). Chemotherapy drugs and dosages along with a history of risk factors for reduced bone density including activity level, tobacco and/or alcohol use, metabolic bone disease, family history, and hormone exposure were identified. Results showed that women who became permanently amenorrheic as a result of chemotherapy had BMD 14% lower than women who maintained menses after chemotherapy. Chemotherapy-treated women who maintained ovarian function had normal BMD. This study suggests that women who have premature menopause as a result of chemotherapy for breast cancer are at increased risk of bone loss and may be at risk for early development of osteoporosis. Women who maintain menses do not appear to be at risk for accelerated trabecular bone loss.
Vitamin D and nutritional status are related to bone fractures in alcoholics.
González-Reimers, Emilio; Alvisa-Negrín, Julio; Santolaria-Fernández, Francisco; Candelaria Martín-González, M; Hernández-Betancor, Iván; Fernández-Rodríguez, Camino M; Viña-Rodríguez, J; González-Díaz, Antonieta
2011-01-01
Bone fractures are common in alcoholics. To analyse which factors (ethanol consumption; liver function impairment; bone densitometry; hormone changes; nutritional status, and disrupted social links and altered eating habits) are related to bone fractures in 90 alcoholic men admitted to our hospitalization unit because of organic problems. Bone homoeostasis-related hormones were measured in patients and age- and sex-matched controls. Whole-body densitometry was performed by a Hologic QDR-2000 (Waltham, MA, USA) densitometer, recording bone mineral density (BMD) and fat and lean mass; nutritional status and liver function were assessed. The presence of prevalent fractures was assessed by anamnesis and chest X-ray film. Forty-nine patients presented at least one fracture. We failed to find differences between patients with and without fractures regarding BMD parameters. Differences regarding fat mass were absent, but lean mass was lower among patients with bone fracture. The presence of fracture was significantly associated with impaired subjective nutritional evaluation (χ² = 5.79, P = 0.016), lower vitamin D levels (Z = 2.98, P = 0.003) and irregular eating habits (χ² = 5.32, P = 0.02). Reduced lean mass and fat mass, and altered eating habits were more prevalent among patients with only rib fractures (n = 36) than in patients with multiple fractures and/or fractures affecting other bones (n = 13). These last were more closely related to decompensated liver disease. Serum vitamin D levels showed a significant relationship with handgrip strength (ρ = 0.26, P = 0.023) and lean mass at different parts of the body, but not with fat mass. By logistic regression analysis, only vitamin D and subjective nutritional evaluation were significantly, independently related with fractures. Prevalent fractures are common among heavy alcoholics. Their presence is related more closely to nutritional status, lean mass and vitamin D levels than to BMD. Lean mass is more reduced, nutritional status is more impaired and there is a trend to more altered eating habits among patients with rib fractures, whereas multiple fractures depend more heavily on advanced liver disease.
Flöter, Michelle; Bittar, Cíntia Kelly; Zabeu, José Luis; Carneiro, Ana Carolina
2011-01-01
To assess the utility of quantitative ultrasound (QUS) of the calcaneus for diagnosing osteoporosis compared to the gold standard, bone densitometry using dual-emission X-ray absorptiometry (DXA), according to published reports. In this systematic review, the Medline/PUBMED, Medline Ovid and Journals@Ovid, and Wilson General Sciences Full Text database were used. The search strategy involved use of the following MeSH descriptors: [osteoporosis AND (densitometry OR ultrasonography)], and 39 articles published between 2001 and April 2010 were assessed. However, only six articles met the inclusion criteria: sensitivity and specificity of QUS, sample (women or men with no treatment or other disease likely to change bone mass index), devices used, comparative T-score between QUS of the calcaneus and DXA. The GE-Lunar Achilles and Hologic Sahara devices were used in most of the tests reported and were effective. All studies assessed compared QUS of the calcaneus to DXA of the lumbar spine or femoral neck, as the gold standard. QUS sensitivity ranged from 79% to 93% and specificity ranged from 28% to 90% when at the lower threshold. It is a controversial parameter, because the gold-standard threshold (T-score < -2.5, DXA) could not be used for QUS without errors in osteoporosis diagnosis. All studies had a threshold determined by the authors’ criteria, with a variability of -1.7 (pDXA T--score) and -2.4 for QUS, leading to the same prevalence of osteoporosis, and a T-score of < -3.65 for QUS was equivalent to a T-score < -2.5 for DXA. Based on the analysis of seven studies, we conclude that QUS of the calcaneus still cannot be used to confirm diagnosis of osteoporosis by comparing the results to those of patients who had already received such a diagnosis based on DXA. However, further research should be conducted in this area, because it is possible to improve the number diagnoses by varying the cutoff T-score. Furthermore, using QUS of the calcaneus was a helpful tool for assessing pathological fractures, whether or not they were associated with osteoporosis.
Schneider, Gary B; Grecco, Kristina J; Safadi, Fayez F; Popoff, Steven N
2003-01-01
Vitamin D-binding protein-macrophage activating factor (DBP-MAF) has previously been shown to stimulate bone resorption and correct the skeletal defects associated with osteopetrosis in two nonallelic mutations in rats. This same protein and a small fragment of the protein have now been shown to demonstrate an anabolic effect on the skeleton of both newborn and young adult, intact rats. The novel peptide fragment was synthetically produced based on the human amino acid sequence at the site of glycosylation in the third domain of the native protein (DBP). The peptide tested is 14 amino acids in length and demonstrates no homologies other than to that region of DBP. Newborn rats were injected i.p. with saline, peptide (0.4 ng/g body wt.) or DBP-MAF (2 ng/g body wt.) every other day from birth to 14 days of age. On day 16 the rats were euthanized and the long bones collected for bone densitometry by pQCT. After 2 weeks of treatment with either the whole protein (DBP-MAF) or the small peptide, bone density was significantly increased in the treated animals compared to the saline controls. Young adult female rats (180 grams) were given s.c. injections of saline or peptide (0.4 ng/g body wt. or 5 ng/g body wt.) every other day for 2 weeks; 2 days after the final injections, the rats were euthanized and the femurs and tibias collected for bone densitometry. Both doses of the peptide resulted in significant increases in bone density as determined by pQCT. Young adult rats were injected locally with a single dose of the peptide (1 microg) or saline into the marrow cavity of the distal femur. One week after the single injection, the bones were collected for radiographic and histological evaluation. The saline controls showed no evidence of new bone formation, whereas the peptide-treated animals demonstrated osteoinduction in the marrow cavity and osteogenesis of surrounding cortical and metaphyseal bone. These data suggest that DBP-MAF and the synthetic peptide represent therapeutic opportunities for the treatment of a number of bone diseases and skeletal disorders. Systemic administration could be used to treat osteoporosis and a number of other osteopenias, and local administration could be effective in fractures, bony defect repairs, spinal surgery, and joint replacement.
[Hearing and balance in metabolic bone diseases].
Zatoński, Tomasz; Temporale, Hanna; Krecicki, Tomasz
2012-03-01
There are reports that hearing loss is one of the clinical manifestations of metabolic bone diseases. Demineralization can lead to a reduction in ossicular mass. Paget's disease can reveal loss of mineral density of the cochlear bone. Ear bone remodeling in osteoporosis is similar to the changes in otosclerosis. Moreover, osteoporosis, osteogenesis imperfecta and otosclerosis have a similar genetic mechanism. According to some researchers osteopenia and osteoporosis may well be associated with idiopathic benign positional vertigo (BPV). Dysfunction of the organ of hearing and balance in patients with renal insufficiency may be due to disturbances in calcium phosphate balance and renal osteodystrophy in the course of the disease. Proving the presence of hearing loss in patients with metabolic bone diseases may lead to determining the new indications for bone densitometry in some patients with hearing impairment. Furthermore, audiological examination in patients with osteoporosis may be important because of the impact of hearing loss on prognosis for patients with metabolic bone diseases.
Kim, Y-H
2008-03-01
This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.
Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T
2011-01-01
Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Avram, Diana; Ranta, Felicia; Hennige, Anita M; Berchtold, Susanne; Hopp, Sabine; Häring, Hans-Ulrich; Lang, Florian; Ullrich, Susanne
2008-01-01
Appropriate insulin secretion depends on beta-cell mass that is determined by the balance between cell proliferation and death. IGF-1 stimulates proliferation and protects against apoptosis. In contrast, glucocorticoids promote cell death. In this study we examined molecular interactions of the glucocorticoid dexamethasone (dexa) with IGF-1 signalling pathways in insulin secreting INS-1 cells. IGF-1 (50 ng/ml) increased the growth rate and stimulated BrdU incorporation, while dexa (100 nmol/l) inhibited cell growth, BrdU incorporation and induced apoptosis. Dexa-induced cell death was partially antagonized by IGF-1. This protection was further increased by LY294002 (10 micromol/l), an inhibitor of PI3 kinase. In contrast, MAP kinase inhibitor PD98059 (10 micromol/l) significantly reduced the protective effect of IGF-1. The analysis of signalling pathways by Western blotting revealed that dexa increased IRS-2 protein abundance while the expression of PI3K, PKB and ERK remained unchanged. Despite increased IRS-2 protein,IRS-2 tyrosine phosphorylation stimulated by IGF-1 was inhibited by dexa. Dexa treatment reduced basal PKB phosphorylation. However, IGF-1-mediated stimulation of PKB phosphorylation was not affected by dexa, but ERK phosphorylation was reduced. LY294002 restored IGF-1-induced ERK phosphorylation. These data suggest that dexa induces apoptosis in INS-1 cells by inhibiting phosphorylation of IRS-2, PKB and ERK. IGF-1 counteracts dexa-mediated apoptosis in the presence of reduced PKB but increased ERK phosphorylation. (c) 2008 S. Karger AG, Basel.
Kayan, K; de Takats, D; Ashford, R; Kanis, J; McCloskey, E
2003-01-01
Background: A case finding strategy based on a number of established risk factors has been suggested by Royal College of Physicians' (RCP) guidelines to optimise bone densitometry referrals for assessment of osteoporosis. Objective: The performance of clinical referral criteria was examined in women and men aged <65 years referred for bone mineral density (BMD) assessment. Study design: Cross sectional observational study over six months. Results: Though BMD tended to be lower in patients with multiple criteria for referral, differences from those referred with a single criterion were not statistically significant. The overall prevalence of osteoporosis was higher than expected in both sexes, 11.6% in women and 27.5% in men (expected prevalences were 8% and <1% respectively). BMD was significantly lower in patients referred with a single criterion compatible with the RCP guidelines than in age matched controls or in those patients referred with non-RCP criteria (mean (SD) Z score –0.47(1.38) v 0.35(1.41), p<0.001). Low body mass index was also significantly associated with a lower than expected BMD. In contrast, spine BMD was higher than expected in those with self reported back pain, loss of height, or spinal curvature (p = NS). Conclusion: Most of the criteria recommended by the RCP performed well in identifying relatively younger patients with low BMD and osteoporosis. However, prior fractures and corticosteroid use did not reach statistical significance probably due to inclusion of all energy fractures, and current or past steroid use of unspecified dose or duration. Criteria like loss of height and/or spine curvature perform relatively poorly, reflecting the need for further investigation to better identify those needing BMD assessment. PMID:14612601
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berry, Jonna Elizabeth
This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less
An update on childhood bone health: mineral accrual, assessment and treatment.
Sopher, Aviva B; Fennoy, Ilene; Oberfield, Sharon E
2015-02-01
To update the reader's knowledge about the factors that influence bone mineral accrual and to review the advances in the assessment of bone health and treatment of bone disorders. Maternal vitamin D status influences neonatal calcium levels, bone mineral density (BMD) and bone size. In turn, BMD z-score tends to track in childhood. These factors highlight the importance of bone health as early as fetal life. Dual-energy x-ray absorptiometry is the mainstay of clinical bone health assessment in this population because of the availability of appropriate reference data. Recently, more information has become available about the assessment and treatment of bone disease in chronically ill pediatric patients. Bone health must become a health focus starting prenatally in order to maximize peak bone mass and to prevent osteoporosis-related bone disease in adulthood. Vitamin D, calcium and weight-bearing activity are the factors of key importance throughout childhood in achieving optimal bone health as BMD z-score tracks through childhood and into adulthood. Recent updates of the International Society for Clinical Densitometry focus on the appropriate use of dual-energy x-ray absorptiometry in children of all ages, including children with chronic disease, and on the treatment of pediatric bone disease.
Hypericum perforatum L. treatment restored bone mass changes in swimming stressed rats.
Seferos, Nikos; Petrokokkinos, Loukas; Kotsiou, Antonia; Rallis, George; Tesseromatis, Christine
2016-01-01
Stress, via corticosteroids release, influences bone mass density. Hypericum perforatum (Hp) a traditional remedy possess antidepressive activity (serotonin reuptake inhibitor) and wound healing properties. Hp preparation contains mainly hypericin, hyperforin, hyperoside and flavonoids exerting oestrogen-mimetic effect. Cold swimming represents an experimental model of stress associating mental strain and corporal exhaustion. This study investigates the Hp effect on femur and mandible bone mass changes in rats under cold forced swimming procedure. 30 male Wistar rats were randomized into three groups. Group A was treated with Methanolic extract of Hp (Jarsin®) via gastroesophageal catheter, and was submitted to cold swimming stress for 10 min/daily. Group B was submitted to cold stress, since group C served as control. Experiment duration was 10 days. Haematocrite and serum free fatty acids (FFA) were estimated. Furthermore volume and specific weight of each bone as well as bone mass density via dual energy X-Ray absorptiometry (DEXA) were measured. Statistic analysis by t-test. Hp treatment restores the stress injuries. Adrenals and bone mass density regain their normal values. Injuries occurring by forced swimming stress in the rats are significantly improved by Hp treatment. Estrogen-like effects of Hp flavonoids eventually may act favorable in bone remodeling.
NASA Astrophysics Data System (ADS)
Schwiedrzik, Jakob; Raghavan, Rejin; Bürki, Alexander; Lenader, Victor; Wolfram, Uwe; Michler, Johann; Zysset, Philippe
2014-07-01
Ageing societies suffer from an increasing incidence of bone fractures. Bone strength depends on the amount of mineral measured by clinical densitometry, but also on the micromechanical properties of the hierarchical organization of bone. Here, we investigate the mechanical response under monotonic and cyclic compression of both single osteonal lamellae and macroscopic samples containing numerous osteons. Micropillar compression tests in a scanning electron microscope, microindentation and macroscopic compression tests were performed on dry ovine bone to identify the elastic modulus, yield stress, plastic deformation, damage accumulation and failure mechanisms. We found that isolated lamellae exhibit a plastic behaviour, with higher yield stress and ductility but no damage. In agreement with a proposed rheological model, these experiments illustrate a transition from a ductile mechanical behaviour of bone at the microscale to a quasi-brittle response driven by the growth of cracks along interfaces or in the vicinity of pores at the macroscale.
Licata, Angelo A; Binkley, Neil; Petak, Steven M; Camacho, Pauline M
2018-02-01
High-quality dual-energy X-ray absorptiometry (DXA) scans are necessary for accurate diagnosis of osteoporosis and monitoring of therapy; however, DXA scan reports may contain errors that cause confusion about diagnosis and treatment. This American Association of Clinical Endocrinologists/American College of Endocrinology consensus statement was generated to draw attention to many common technical problems affecting DXA report conclusions and provide guidance on how to address them to ensure that patients receive appropriate osteoporosis care. The DXA Writing Committee developed a consensus based on discussion and evaluation of available literature related to osteoporosis and osteodensitometry. Technical errors may include errors in scan acquisition and/or analysis, leading to incorrect diagnosis and reporting of change over time. Although the International Society for Clinical Densitometry advocates training for technologists and medical interpreters to help eliminate these problems, many lack skill in this technology. Suspicion that reports are wrong arises when clinical history is not compatible with scan interpretation (e.g., dramatic increase/decrease in a short period of time; declines in previously stable bone density after years of treatment), when different scanners are used, or when inconsistent anatomic sites are used for monitoring the response to therapy. Understanding the concept of least significant change will minimize erroneous conclusions about changes in bone density. Clinicians must develop the skills to differentiate technical problems, which confound reports, from real biological changes. We recommend that clinicians review actual scan images and data, instead of relying solely on the impression of the report, to pinpoint errors and accurately interpret DXA scan images. AACE = American Association of Clinical Endocrinologists; BMC = bone mineral content; BMD = bone mineral density; DXA = dual-energy X-ray absorptiometry; ISCD = International Society for Clinical Densitometry; LSC = least significant change; TBS = trabecular bone score; WHO = World Health Organization.
McCloskey, Eugene V; Vasikaran, Samuel; Cooper, Cyrus
2011-01-01
The best indirect evidence that increased bone turnover contributes to fracture risk is the fact that most of the proven therapies for osteoporosis are inhibitors of bone turnover. The evidence base that we can use biochemical markers of bone turnover in the assessment of fracture risk is somewhat less convincing. This relates to natural variability in the markers, problems with the assays, disparity in the statistical analyses of relevant studies and the independence of their contribution to fracture risk. More research is clearly required to address these deficiencies before biochemical markers might contribute a useful independent risk factor for inclusion in FRAX(®). Copyright © 2011. Published by Elsevier Inc.
Biochemical markers in the assessment of bone disease
NASA Technical Reports Server (NTRS)
Bikle, D. D.
1997-01-01
As the mean age of our population increases, increasing attention has been paid to the diseases associated with aging, including diseases of the skeleton such as osteoporosis. Effective means of treating and possibly preventing such skeletal disorders are emerging, making their early recognition an important goal for the primary care physician. Although bone density measurements and skeletal imaging studies remain of primary diagnostic importance in this regard, a large number of assays for biochemical markers of bone formation and resorption are being developed that promise to complement the densitometry measurements and imaging studies, providing an assessment of the rates of bone turnover and an earlier evaluation of the effects of therapy. In this review, emphasizing the recent literature, the major biochemical markers currently in use or under active investigation are described, and their application in a number of diseases of the skeleton including osteoporosis is evaluated.
Quantification of bone strength by intraoperative torque measurement: a technical note.
Suhm, Norbert; Haenni, Markus; Schwyn, Ronald; Hirschmann, Michael; Müller, Andreas Marc
2008-06-01
Bone strength describes the resistance of bone against mechanical failure. Bone strength depends on both the amount of bone and the bone's quality, and the bone strength may be looked upon as a relevant parameter to judge an osteosynthesis' stability. Information about bone strength was barely available intraoperatively in the past. The previous work of our group reported on development and laboratory evaluation of mechanical torque measurement as a method for the intraoperative quantification of bone strength. With the clinical series presented here we intend to verify that the im gesamten Text DensiProbe instrumentation for intraoperative torque measurement and the related measurement method are eligible for intraoperative use based on the following criteria: application of the method may not create complications, the measurement can be performed by the surgeon himself and may only cause a limited increase in the procedure time. From December 2006 until May 2007 ten patients with a pertrochanteric femoral fracture or a lateral femoral neck fracture eligible for stabilization with DHS were included in the study after having received informed consent. Any medication and comorbidity that might have influenced bone quality or bone mineral density (BMD) in these patients was documented. Bone strength was intraoperatively measured with DensiProbe. Complications that were obviously related with torque measurement were documented as well as any deviation from the suggested procedure; 6 and 12 weeks postoperative follow-up included clinical and radiological examination. The time required for torque measurement, the overall operating time and the number of persons present in the operating room were protocolled. BMD values of the contralateral femoral neck were postoperatively assessed by dual energy X-ray absorptiometry (DEXA) and compared to intraoperative peak torque values measured by DensiProbe. No major complication was observed during intraoperative application of DensiProbe by trained surgeons. The unintended extraction of the guide wire together with the torque measurement probe was reported only once and is looked upon as a minor complication. Fracture healing was uneventful in all patients. The mean time for torque measurement was 2.35 +/- 0.9 min accounting for 2.2 +/- 1.1% of total surgery time. The presence of an additional person was not required to perform torque measurement but to protocol the data. There was a tendency towards correlation between BMD values of the femoral neck and intraoperative peak torque values. The data presented clearly indicate that the DensiProbe instrumentation and measurement principle are eligible for routine intraoperative use by trained surgeons. Interpretation of possible correlations between BMD values measured by means of DEXA and the Peak Torque values assessed by DensiProbe has to be considered very carefully, because BMD and Peak Torque analyse bone at a different scale. Only within the framework of a multicenter study it will be possible to include a sufficient number of patients for calculation of the methods' predictive value towards implant failure and to verify acceptance of the method by the surgeons.
Corneal Densitometry as a Tool to Measure Epithelial Ingrowth After Laser In Situ Keratomileusis.
Adran, Daniel; Vaillancourt, Louis; Harissi-Dagher, Mona; Kruh, Jonathan N; Syed, Zeba A; Robinson, Steven; Melki, Samir
2017-04-01
This study evaluates the correlation between corneal densitometry and epithelial ingrowth (EI) after laser in situ keratomileusis (LASIK). Corneal densitometry of 3 patients who developed EI after LASIK was measured with the Oculus Pentacam. Corneal densitometry readings of each patient were obtained preoperatively and postoperatively after ingrowth was discovered. Densitometry was recorded at the central nest of opacity and at the leading edges of EI. For all patients, the most severe stages of EI observed on slit-lamp photographs correlated with the highest densitometry readings, with peak densitometry ranging from 73.3 to 95.1. These values were much higher than preoperative densitometry readings, which ranged from 21.8 to 27.2. In 2 cases, the Pentacam densitometry map revealed progression of EI toward the visual axis that was only faintly detectable or not detectable at all on the corresponding slit-lamp photographs. Corneal densitometry seems to be an objective measure of the severity and progression of EI after LASIK.
BMDO Technology Applications in Biomedicine
1996-01-01
capacitance and low- noise detectors. NOVA’s systems could also be used for bone densitometry and panoramic dental X-rays. Potential Use to Medicine Dr...receiver coils, increasing signal-to- noise ratio by a factor of two in some cases. This change is especially important in low-strength MRI fields...ongoing in this area. Receivers for this technology must be even more sensitive than for conventional MRI, because the " noise " level in these tissue
Assessment of bone metabolism in premenopausal females with hyperthyroidism and hypothyroidism.
Tuchendler, Dominika; Bolanowski, Marek
2013-01-01
Osteoporosis is one of the commonest metabolic diseases of bone. Its possible causes may include thyroid hormonal dysfunction. The objective of this study was to evaluate the effects of hyperthyroidism and hypothyroidism on osseous tissue metabolism in premenopausal women. 38 women with hyperthyroidism, 40 with hypothyroidism and 41 healthy women participated in this study. Initially after 6 and 12 months, each patient underwent selected hormonal, immunological and biochemical tests, measurement of concentrations of bone turnover markers and densitometry were also performed. On initial evaluation, lower cortical bone density was found in patients with hyperthyroidism (femoral neck). After 12 months, an increase in BMD was seen, but it was still lower than in the control group. Statistically significantly higher concentrations of bone turnover markers, decreasing from the sixth month of treatment, were noted only in the group with hyperthyroidism. Statistically significant differences were not noted in the femoral neck nor in the lumbar spine BMD in patients with hypothyroidism. Hyperthyroidism poses a negative effect on bone metabolism. Hypothyroidism in premenopausal females does not have any influence on bone density.
Heiss, Christian; Govindarajan, Parameswari; Schlewitz, Gudrun; Hemdan, Nasr Y A; Schliefke, Nathalie; Alt, Volker; Thormann, Ulrich; Lips, Katrin Susanne; Wenisch, Sabine; Langheinrich, Alexander C; Zahner, Daniel; Schnettler, Reinhard
2012-06-01
As women are the population most affected by multifactorial osteoporosis, research is focused on unraveling the underlying mechanism of osteoporosis induction in rats by combining ovariectomy (OVX) either with calcium, phosphorus, vitamin C and vitamin D2/D3 deficiency, or by administration of glucocorticoid (dexamethasone). Different skeletal sites of sham, OVX-Diet and OVX-Steroid rats were analyzed by Dual Energy X-ray Absorptiometry (DEXA) at varied time points of 0, 4 and 12 weeks to determine and compare the osteoporotic factors such as bone mineral density (BMD), bone mineral content (BMC), area, body weight and percent fat among different groups and time points. Comparative analysis and interrelationships among osteoporotic determinants by regression analysis were also determined. T scores were below-2.5 in OVX-Diet rats at 4 and 12 weeks post-OVX. OVX-diet rats revealed pronounced osteoporotic status with reduced BMD and BMC than the steroid counterparts, with the spine and pelvis as the most affected skeletal sites. Increase in percent fat was observed irrespective of the osteoporosis inducers applied. Comparative analysis and interrelationships between osteoporotic determinants that are rarely studied in animals indicate the necessity to analyze BMC and area along with BMD in obtaining meaningful information leading to proper prediction of probability of osteoporotic fractures. Enhanced osteoporotic effect observed in OVX-Diet rats indicates that estrogen dysregulation combined with diet treatment induces and enhances osteoporosis with time when compared to the steroid group. Comparative and regression analysis indicates the need to determine BMC along with BMD and area in osteoporotic determination.
Figeac, Florence; Andersen, Ditte C; Nipper Nielsen, Casper A; Ditzel, Nicholas; Sheikh, Søren P; Skjødt, Karsten; Kassem, Moustapha; Jensen, Charlotte H; Abdallah, Basem M
2018-05-01
Soluble delta-like 1 homolog (DLK1) is a circulating protein that belongs to the Notch/Serrate/delta family, which regulates many differentiation processes including osteogenesis and adipogenesis. We have previously demonstrated an inhibitory effect of DLK1 on bone mass via stimulation of bone resorption and inhibition of bone formation. Further, serum DLK1 levels are elevated and positively correlated to bone turnover markers in estrogen (E)-deficient rodents and women. In this report, we examined whether inhibition of serum DLK1 activity using a neutralizing monoclonal antibody protects from E deficiency-associated bone loss in mice. Thus, we generated mouse monoclonal anti-mouse DLK1 antibodies (MAb DLK1) that enabled us to reduce and also quantitate the levels of bioavailable serum DLK1 in vivo. Ovariectomized (ovx) mice were injected intraperitoneally twice weekly with MAb DLK1 over a period of one month. DEXA-, microCT scanning, and bone histomorphometric analyses were performed. Compared to controls, MAb DLK1 treated ovx mice were protected against ovx-induced bone loss, as revealed by significantly increased total bone mass (BMD) due to increased trabecular bone volume fraction (BV/TV) and inhibition of bone resorption. No significant changes were observed in total fat mass or in the number of bone marrow adipocytes. These results support the potential use of anti-DLK1 antibody therapy as a novel intervention to protect from E deficiency associated bone loss. Copyright © 2018 Elsevier Inc. All rights reserved.
Ramírez-Vélez, Robinson; Correa-Bautista, Jorge Enrique; González-Ruíz, Katherine; Vivas, Andrés; García-Hermoso, Antonio; Triana-Reina, Hector Reynaldo
2016-01-01
The body adiposity index (BAI) is a recent anthropometric measure proven to be valid in predicting body fat percentage (BF%) in some populations. However, the results have been inconsistent across populations. This study was designed to verify the validity of BAI in predicting BF% in a sample of overweight/obese adults, using dual-energy X-ray absorptiometry (DEXA) as the reference method. A cross-sectional study was conducted in 48 participants (54% women, mean age 41.0 ± 7.3 years old). DEXA was used as the “gold standard” to determine BF%. Pearson’s correlation coefficient was used to evaluate the association between BAI and BF%, as assessed by DEXA. A paired sample t-test was used to test differences in mean BF% obtained with BAI and DEXA methods. To evaluate the concordance between BF% as measured by DEXA and as estimated by BAI, we used Lin’s concordance correlation coefficient and Bland–Altman agreement analysis. The correlation between BF% obtained by DEXA and that estimated by BAI was r = 0.844, p < 0.001. Paired t-test showed a significant mean difference in BF% between methods (BAI = 33.3 ± 6.2 vs. DEXA 39.0 ± 6.1; p < 0.001). The bias of the BAI was −6.0 ± 3.0 BF% (95% CI = −12.0 to 1.0), indicating that the BAI method significantly underestimated the BF% compared to the reference method. Lin’s concordance correlation coefficient was considered stronger (ρc = 0.923, 95% CI = 0.862 to 0.957). In obese adults, BAI presented low agreement with BF% measured by DEXA; therefore, BAI is not recommended for BF% prediction in this overweight/obese sample studied. PMID:27916871
Stephens, Kelly I; Rubinsztain, Leon; Payan, John; Rentsch, Chris; Rimland, David; Tangpricha, Vin
2016-04-01
We evaluated the utility of the World Health Organization (WHO) Fracture Risk Assessment Tool (FRAX) in assessing fracture risk in patients with human immunodeficiency virus (HIV) and vitamin D deficiency. This was a retrospective study of HIV-infected patients with co-existing vitamin D deficiency at the Atlanta Veterans Affairs Medical Center. Bone mineral density (BMD) was assessed by dual-energy X-ray absorptiometry (DEXA), and the 10-year fracture risk was calculated by the WHO FRAX algorithm. Two independent radiologists reviewed lateral chest radiographs for the presence of subclinical vertebral fractures. We identified 232 patients with HIV and vitamin D deficiency. Overall, 15.5% of patients met diagnostic criteria for osteoporosis on DEXA, and 58% had low BMD (T-score between -1 and -2.5). The median risk of any major osteoporotic and hip fracture by FRAX score was 1.45 and 0.10%, respectively. Subclinical vertebral fractures were detected in 46.6% of patients. Compared to those without fractures, those with fractures had similar prevalence of osteoporosis (15.3% versus 15.7%; P>.999), low BMD (53.2% versus 59.3%; P = .419), and similar FRAX hip scores (0.10% versus 0.10%; P = .412). While the FRAX major score was lower in the nonfracture group versus fracture group (1.30% versus 1.60%; P = .025), this was not clinically significant. We found a high prevalence of subclinical vertebral fractures among vitamin D-deficient HIV patients; however, DEXA and FRAX failed to predict those with fractures. Our results suggest that traditional screening tools for fragility fractures may not be applicable to this high-risk patient population.
Reproducibility of CT bone densitometry: operator versus automated ROI definition.
Louis, O; Luypaert, R; Kalender, W; Osteaux, M
1988-05-01
Intrasubject reproducibility with repeated determination of vertebral mineral density from a given set of CT images was investigated. The region of interest (ROI) in 10 patient scans was selected by four independent operators either manually or with an automated procedure separating cortical and spongeous bone, the operators being requested to interact in ROI selection. The mean intrasubject variation was found to be much lower with the automated process (0.3 to 0.6%) than with the conventional method (2.5 to 5.2%). In a second study, 10 patients were examined twice to determine the reproducibility of CT slice selection by the operator. The errors were of the same order of magnitude as in ROI selection.
Dimai, Hans P; Chandran, Manju
2011-01-01
The worldwide prevalence of smoking has been estimated at about 50% in men, and 10% in women, with larger variations among different populations studied. Smoking has been shown to affect many organ systems resulting in severe morbidity and increased mortality. In addition, smoking has been identified as a predictor of ten-year fracture risk in men and women, largely independent of an individual's bone mineral density. This finding has eventually lead to incorporation of this risk factor into FRAX®, an algorithm that has been developed to calculate an individual's ten-year fracture risk. However, only little, or conflicting data is available on a possible association between smoking dose, duration, length of time after cessation, type of tobacco and fracture risk, limiting this risk factor's applicability in the context of FRAX®. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Oral contraceptive use and bone density in adolescent and young adult women
Scholes, Delia; Ichikawa, Laura; LaCroix, Andrea Z.; Spangler, Leslie; Beasley, Jeannette M.; Reed, Susan; Ott, Susan M.
2009-01-01
Background Most of the millions of oral contraceptive (OC) users are under age 30 years and in the critical period for bone mass accrual. Study Design This cross-sectional study of 606 women aged 14–30 years examined both OC duration and estrogen dose and their association with bone mineral density (BMD) at the hip, spine, and whole-body (DEXA). Results Of 389 OC users and 217 nonusers enrolled, 50% were adolescents (14–18 years). Of OC users, 38% used “low-dose” OCs [<30 mcg ethinyl estradiol (EE)]. In adolescents, mean BMD differed by neither OC duration nor EE dose. However, 19–30 year-old women’s mean BMD was lower with longer OC use for spine and whole-body (p=0.004, p=0.02, respectively) and lowest for >12 months of low-dose OCs for the hip, spine and whole-body (p=0.02, 0.003 and 0.002, respectively). Conclusions Prolonged use of today’s OCs, particularly <30 mcg EE, may adversely impact young adult women’s bone density while ingesting these agents. PMID:20004271
Butezloff, Mariana Maloste; Zamarioli, Ariane; Leoni, Graziela Bianchi; Sousa-Neto, Manoel Damião; Volpon, Jose Batista
2015-11-01
To investigate the effect of vibration therapy on the bone callus of fractured femurs and the bone quality of intact femurs in ovariectomized rats. Fifty-six rats aged seven weeks were divided into four groups: control with femoral fracture (CON, n=14), ovariectomized with femoral fracture (OVX, n=14), control with femoral fracture plus vibration therapy (CON+VT, n=14), and ovariectomized with femoral fracture plus vibration therapy (OVX+VT, n=14). Three months after ovariectomy or sham surgery, a complete fracture was produced at the femoral mid-diaphysis and stabilized with a 1-mm-diameter intramedullary Kirschner wire. X-rays confirmed the fracture alignment and fixation. Three days later, the VT groups underwent vibration therapy (1 mm, 60 Hz for 20 minutes, three times per week for 14 or 28 days). The bone and callus quality were assessed by densitometry, three-dimensional microstructure, and mechanical test. Ovariectomized rats exhibited a substantial loss of bone mass and severe impairment in bone microarchitecture, both in the non-fractured femur and the bone callus. Whole-body vibration therapy exerted an important role in ameliorating the bone and fracture callus parameters in the osteoporotic bone. Vibration therapy improved bone quality and the quality of the fracture bone callus in ovariectomized rats.
Management of hypogonadism in adolescent girls and adult women with Prader-Willi syndrome.
Eldar-Geva, Talia; Hirsch, Harry J; Pollak, Yehuda; Benarroch, Fortu; Gross-Tsur, Varda
2013-12-01
Prader-Willi syndrome (PWS) is a neurodevelopmental disorder characterized by an insatiable appetite, dysmorphic features, cognitive and behavioral difficulties, and hypogonadism. The heterogeneous reproductive hormone profiles indicate that some PWS women may have symptoms of hypoestrogenism, while others may potentially be fertile. We describe our experience in the assessment and treatment of hypogonadism in adolescents and adult females with PWS. The study population consisted of 20 PWS females, age ≥16 years (27.3 ± 7.9 years), followed in our clinic (12 deletion, 7 uniparental disomy, 1 imprinting-center defect). General physical examination, pubertal assessment, body mass index (BMI), gynecological examination, ultrasonography, bone densitometry, and hormonal profiles [FSH, LH, inhibin B, estradiol, prolactin, and TSH] were performed. The relevant assessed factors were: FSH and inhibin B, menstrual cycles (oligo/amenorrhea or irregular bleeding), ultrasound findings (endometrial thickness, uterine/ovarian abnormalities), BMI, bone densitometry, and patient/caregivers attitude. We classified seven women with inhibin B >20 ng/ml as potentially fertile. Following the assessment of the above factors, we recommended the individual-specific treatment; contraceptive pills, intra-uterine device, estrogen/progesterone replacement, and cyclic progesterone, in 3, 1, 4, and 1 patients, respectively. Four patients did not follow our recommendations due to poor compliance or family refusal. We recommended contraception pills for one 26-year-old woman with inhibin B and FSH levels 53 ng/ml and 6.4 IU/L; however, she refused treatment, conceived spontaneously and had an abortion. Guidelines for hormonal replacement therapy in PWS need to be tailored individually depending on physical development, hormonal profiles, bone density, and emotional and social needs of each PWS adolescent and adult. © 2013 Wiley Periodicals, Inc.
Skeletal Maturation and Mineralisation of Children with Moderate to Severe Spastic Quadriplegia.
Sharawat, Indar Kumar; Sitaraman, Sadasivan
2016-06-01
Diminished bone mineral density and delayed skeletal maturation are common in children with spastic quadriplegia. The purpose of our study was to evaluate the Bone Mineral Density (BMD) of children with moderate to severe spastic quadriplegia and its relationship with other variables like nutrition and growth. This was a hospital based, cross- sectional, case-control study. Forty-two (28 males, 14 females) children with spastic quadriplegia and 42 (24 males, 18 females) healthy children were included in the study. BMD of cases and control were measured by Dual Energy X-ray Absorptiometry (DEXA). Radiographs of left hand and wrist of cases and controls were taken and bone age was determined. BMD values of upper extremity, lower extremity, thoraco-lumbar spine and pelvis in cases were lower than those of controls (p <0.0001). In children with non severe malnutrition, 75% of the cases had lower bone age than chronological age, whereas all cases with severe malnutrition had lower bone age than chronological age. Step wise regression analysis showed that nutritional status independently contributed to lower BMD values but the BMD values did not correlate significantly with the use of anticonvulsant drugs and presence of physical therapy. Decreased BMD and delayed bone age is prevalent in children with spastic quadriplegia and nutritional status is an important contributing factor.
Tyrrell, V J; Richards, G; Hofman, P; Gillies, G F; Robinson, E; Cutfield, W S
2001-02-01
To determine the accuracy of foot-to-foot bioelectrical impedance analysis (BIA) and anthropometric indices as measures of body composition in children. Comparison of foot-to-foot BIA and anthropometry to dual-energy X-ray absorptiometry (DEXA)-derived body composition in a multi-ethnic group of children. : Eighty-two European, NZ Maori and Pacific Island children aged 4.9-10.9 y. DEXA body composition, foot-to-foot bioelectrical impedance, height, weight, hip and waist measurements. Using a BIA prediction equation derived from our study population we found a high correlation between DEXA and BIA in the estimation of fat-free mass (FFM), fat mass (FM) and percentage body fat (PBF) (r=0.98, 0.98 and 0.94, respectively). BIA-FFM underestimated DEXA-FFM by a mean of 0.75 kg, BIA-FM overestimated DEXA-FM by a mean of 1.02 kg and BIA-PBF overestimated DEXA-PBF by a mean of 2.53%. The correlation between six anthropometric indices (body mass index (BMI), ponderal index, Chinn's weight-for-height index, BMI standard deviation score, weight-for-length index and Cole's weight-for-height index) and DEXA were also examined. The correlation of these indices with PBF was remarkably similar (r=0.85-0.87), more variable with FM (r=0.77-0.94) and poor with FFM (r=0.41-0.75). BIA correlated better than anthropometric indices in the estimation of FFM, FM and PBF. Foot-to-foot BIA is an accurate technique in the measurement of body composition.
Hanley, David A; Whiting, Susan J
2013-01-01
A popular concept in nutrition and lay literature is that of the role of a diet high in acid or protein in the pathogenesis of osteoporosis. A diet rich in fruit and vegetable intake is thought to enhance bone health as the result of its greater potassium and lower "acidic" content than a diet rich in animal protein and sodium. Consequently, there have been a number of studies of diet manipulation to enhance potassium and "alkaline" content of the diet to improve bone density or other parameters of bone health. Although acid loading or an acidic diet featuring a high protein intake may be associated with an increase in calciuria, the evidence supporting a role of these variables in the development of osteoporosis is not consistent. Similarly, intervention studies with a more alkaline diet or use of supplements of potassium citrate or bicarbonate have not consistently shown a bone health benefit. In the elderly, inadequate protein intake is a greater problem for bone health than protein excess. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Dietary coral calcium and zeolite protects bone in a mouse model for postmenopausal bone loss.
Banu, Jameela; Varela, Erika; Guerra, Juan M; Halade, Ganesh; Williams, Paul J; Bahadur, Ali N; Hanaoka, Kokichi; Fernandes, Gabriel
2012-12-01
In patients diagnosed with osteoporosis, calcium is lost from bones making them weaker and easily susceptible to fractures. Supplementation of calcium is highly recommended for such conditions. However, the source of calcium plays an important role in the amount of calcium that is assimilated into bone. We hypothesize that naturally occurring coral calcium and zeolite may prevent ovariectomy-induced bone loss. We have measured bone loss in ovariectomized mice supplemented with coral calcium and Zeolite. Female C57BL/6 mice were either sham-operated or ovariectomized and fed diets containing coral calcium or zeolite for 6 months. Serum was analyzed for bone biochemical markers and cytokines. Bones were analyzed using dual x-ray absorbtiometry, peripheral quantitative computed tomography, and micro-computed tomography densitometry. In the distal femoral metaphysis, total bone and cortical bone mass was restored and the endocortical surface was significantly decreased in coral calcium and zeolite fed ovariectomized (OVX) mice. Trabecular number and the ratio of bone volume to total volume was higher in OVX mice after coral calcium and zeolite feeding, while trabecular separation decreased in the different treatment OVX groups. Coral calcium protected bone to a lesser extent in the proximal tibia and lumbar vertebrae. Overall, coral calcium and zeolite may protect postmenopausal bone loss. Copyright © 2012 Elsevier Inc. All rights reserved.
Response of the skeletal system to helicopter-unique vibration.
Gearhart, J R
1978-01-01
An 18-month prospective skeletal system study was conducted on flying and nonflying personnel relative to chronic low-frequency vibration as experienced in helicopter flight. The aviators were initial entry students in rotary-wing training while the non-flying participants were beginning basic military training. Comparisons were made on the basis of anthropometric measurements, radiological studies, and bone mineral density changes as measured by photon absorption. The bone mineral densitometry showed no significant variation in the aviator group. A short-term 10% demineralization of the distal ulna in the non-flying group was noted immediately following the physical training. The final bone mineral density of basic training subjects returned to the initial level 18 months after the physical training. It was concluded that the helicopter aircrew members under study were exposed to levels of vibration below the threshold of vibration required to produce a measurable change in the skeletal system.
Osteoporosis: primary prevention in the community.
Loh, K Y; Shong, H K
2007-10-01
The incidence of osteoporosis is increasing worldwide. It has great impact on the life of the elderly population. The most significant medical consequence of osteoporosis is fragility fracture which without proper treatment will cause severe medical and psychosocial complications. The overall cost in managing osteoporosis and its related fractures is escalating. Using bone densitometry to measure bone mineral density is useful in the diagnosis of osteoporosis but it is costly and not feasible in the community. Drugs such as estrogen replacement, raloxifene and calcitonin are effective in prevention and treatment of osteoporosis but they are also expensive. Identifying modifiable risk factors such as smoking, lack of exercise, low dietary calcium and vitamin D intake and healthy life style remain strategy in the primary prevention of osteoporosis in the community.
Heiss, Christian; Govindarajan, Parameswari; Schlewitz, Gudrun; Hemdan, Nasr Y.A.; Schliefke, Nathalie; Alt, Volker; Thormann, Ulrich; Lips, Katrin Susanne; Wenisch, Sabine; Langheinrich, Alexander C.; Zahner, Daniel; Schnettler, Reinhard
2012-01-01
Summary Background As women are the population most affected by multifactorial osteoporosis, research is focused on unraveling the underlying mechanism of osteoporosis induction in rats by combining ovariectomy (OVX) either with calcium, phosphorus, vitamin C and vitamin D2/D3 deficiency, or by administration of glucocorticoid (dexamethasone). Material/Methods Different skeletal sites of sham, OVX-Diet and OVX-Steroid rats were analyzed by Dual Energy X-ray Absorptiometry (DEXA) at varied time points of 0, 4 and 12 weeks to determine and compare the osteoporotic factors such as bone mineral density (BMD), bone mineral content (BMC), area, body weight and percent fat among different groups and time points. Comparative analysis and interrelationships among osteoporotic determinants by regression analysis were also determined. Results T scores were below-2.5 in OVX-Diet rats at 4 and 12 weeks post-OVX. OVX-diet rats revealed pronounced osteoporotic status with reduced BMD and BMC than the steroid counterparts, with the spine and pelvis as the most affected skeletal sites. Increase in percent fat was observed irrespective of the osteoporosis inducers applied. Comparative analysis and interrelationships between osteoporotic determinants that are rarely studied in animals indicate the necessity to analyze BMC and area along with BMD in obtaining meaningful information leading to proper prediction of probability of osteoporotic fractures. Conclusions Enhanced osteoporotic effect observed in OVX-Diet rats indicates that estrogen dysregulation combined with diet treatment induces and enhances osteoporosis with time when compared to the steroid group. Comparative and regression analysis indicates the need to determine BMC along with BMD and area in osteoporotic determination. PMID:22648240
Jung, Sangeun; Kim, Mee Gang; Lee, Jong In
2017-10-01
To identify the prevalence of lumbar scoliosis in breast cancer patients and to investigate the potential risk factors of lumbar scoliosis. A retrospective chart review was performed in breast cancer patients aged more than 40 years who underwent dual energy X-ray absorptiometry (DEXA) scanning between January 2014 and December 2014. We divided the patients into control and experimental groups in order to investigate the influence of breast cancer treatment. The curvature of the lumbar spine was measured by using the Cobb method on a DEXA scan. Scoliosis was defined by the presence of a curvature 10° or larger. The variables, including age, bone mineral density (BMD), body mass index (BMI), and breast cancer treatments, were also obtained from the medical chart. Prevalence of lumbar scoliosis was evaluated, and it was compared between the two groups. The relationships between lumbar scoliosis and these variables were also investigated. Lumbar scoliosis was present in 16 out of our 652 breast cancer patients. There was no difference in the prevalence of lumbar scoliosis between the control group (7/316) and the experimental group (9/336) (p=0.70). According to the logistic regression analysis, lumbar scoliosis had no significant association with operation, chemotherapy, hormone therapy, BMI, and BMD (p>0.05). However, age showed a significant relationship with prevalence of lumbar scoliosis (p<0.001; odds ratio, 1.11; 95% confidence interval, 1.054-1.170). Prevalence of lumbar scoliosis in patients with breast cancer was 2.45%. Lumbar scoliosis had no association with breast cancer treatments, BMD, and BMI. Age was the only factor related to the prevalence of lumbar scoliosis.
Licata, Angelo A
2015-07-01
Bone loss due to weightlessness is a significant concern for astronauts' mission safety and health upon return to Earth. This problem is monitored with bone densitometry (DXA), the clinical tool used to assess skeletal strength. DXA has served clinicians well in assessing fracture risk and has been particularly useful in diagnosing osteoporosis in the elderly postmenopausal population for which it was originally developed. Over the past 1-2 decades, however, paradoxical and contradictory findings have emerged when this technology was widely employed in caring for diverse populations unlike those for which it was developed. Although DXA was originally considered the surrogate marker for bone strength, it is now considered one part of a constellation of factors-described collectively as bone quality-that makes bone strong and resists fracturing, independent of bone density. These characteristics are beyond the capability of routine DXA to identify, and as a result, DXA can be a poor prognosticator of bone health in many clinical scenarios. New clinical tools are emerging to make measurement of bone strength more accurate. This article reviews the historical timeline of bone density measurement (dual X-ray absorptiometry), expands upon the clinical observations that modified the relationship of DXA and bone strength, discusses some of the new clinical tools to predict fracture risk, and highlights the challenges DXA poses in the assessment of fracture risk in astronauts.
Pieltain, C; de Halleux, V; Senterre, Th; Rigo, J
2013-01-01
Recent advances in neonatal care significantly increases survival rate in preterm and particularly in extremely low birth weight infants (ELBW infants) and nutrition is becoming one of the most challenging issue to improve short and long term health and developmental outcomes. Nutrition is also relevant for bone development and mineralization reducing the risk of osteopenia and metabolic bone disease (MBD). Osteopenia of prematurity is a multifactorial disease including predominantly nutritional but also biomechanical and environmental factors. At birth, the fetal active mineral transfer is interrupted and the preterm becomes related to the parenteral and enteral mineral supplies. On the other hand, physiological adaptation of bone to extra uterine life leads to an increase in bone resorption. This process occurring earlier in preterm than in term infants can be accompanied by an increased risk of bone fragility and fractures. Early provision of highly bioavailable mineral supplies, correction of vitamin D deficiency and the screening of serum phosphorus concentration combined to urinary mineral excretion appears to be helpful for the prevention of MBD. When available, DEXA is more sensitive than ultrasound for quantifying osteopenia in VLBW infants at the time of discharge. Catch-up of mineralization is rapidly observed during the post term period and osteopenia of prematurity seems to be a self-resolving disease although the potential long-term consequences on the attainment of peak bone mass remains uncertain. Copyright © 2013 S. Karger AG, Basel.
Morphological texture assessment of oral bone as a screening tool for osteoporosis
NASA Astrophysics Data System (ADS)
Analoui, Mostafa; Eggertsson, Hafsteinn; Eckert, George
2001-07-01
Three classes of texture analysis approaches have been employed to assess the textural characteristic of oral bone. A set of linear structuring elements was used to compute granulometric features of trabecular bone. Multifractal analysis was also used to compute the fractal dimension of the corresponding tissues. In addition, some statistical features and histomorphometric parameters were computed. To assess the proposed approach we acquired digital intraoral radiographs of 47 subjects (14 males and 33 females). All radiographs were captured at 12 bits/pixel. Images were converted to binary form through a sliding locally adaptive thresholding approach. Each subject was scanned by DEXA for bone dosimetry. Subject were classified into one of the following three categories according World Health Organization (WHO) standard (1) healthy, (2) with osteopenia and (3) osteoporosis. In this study fractal dimension showed very low correlation with bone mineral density (BMD) measurements, which did not reach a level of statistical significance (p<0.5). However, entropy of pattern spectrum (EPS), along with statistical features and histomorphometric parameters, has shown correlation coefficients ranging from low to high, with statistical significance for both males and females. The results of this study indicate the utility of this approach for bone texture analysis. It is conjectured that designing a 2-D structuring element, specially tuned to trabecular bone texture, will increase the efficacy of the proposed method.
Estimating Trabecular Bone Mechanical Properties From Non-Invasive Imaging
NASA Technical Reports Server (NTRS)
Hogan, Harry A.; Webster, Laurie
1997-01-01
An important component in developing countermeasures for maintaining musculoskeletal integrity during long-term space flight is an effective and meaningful method of monitoring skeletal condition. Magnetic resonance imaging (MRI) is an attractive non-invasive approach because it avoids the exposure to radiation associated with X-ray based imaging and also provides measures related to bone microstructure rather than just density. The purpose of the research for the 1996 Summer Faculty Fellowship period was to extend the usefulness of the MRI data to estimate the mechanical properties of trabecular bone. The main mechanical properties of interest are the elastic modulus and ultimate strength. Correlations are being investigated between these and fractal analysis parameters, MRI relaxation times, apparent densities, and bone mineral densities. Bone specimens from both human and equine donors have been studied initially to ensure high-quality MR images. Specimens were prepared and scanned from human proximal tibia bones as well as the equine distal radius. The quality of the images from the human bone appeared compromised due to freezing artifact, so only equine bone was included in subsequent procedures since these specimens could be acquired and imaged fresh before being frozen. MRI scans were made spanning a 3.6 cm length on each of 5 equine distal radius specimens. The images were then sent to Dr. Raj Acharya of the State University of New York at Buffalo for fractal analysis. Each piece was cut into 3 slabs approximately 1.2 cm thick and high-resolution contact radiographs were made to provide images for comparing fractal analysis with MR images. Dual energy X-ray absorptiometry (DEXA) scans were also made of each slab for subsequent bone mineral density determination. Slabs were cut into cubes for mechanical using a slow-speed diamond blade wafering saw (Buehler Isomet). The dimensions and wet weights of each cube specimen were measured and recorded. Wet weights were also recorded. Each specimen was labeled and marked to denote anatomic orientations, i.e. superior/inferior (S/I), media/lateral (M/L), and anterior/posterior (A/P). The actual locations of each cube cut were documented and images distributed to define ROI locations for other analyses (to Raj Acharya for fractal analysis, to Jon Richardson at Baylor College of Medicine for DEXA, and to Chen Lin at Baylor College of Medicine for T2* MRI analysis). Quasistatic mechanical testing consisted of compressive loading in all three mutually perpendicular anatomic directions. Cyclic loading was applied for 10 cycles to precondition the specimen and results calculated for the eleventh. For one of three directions tested on each specimen, the 10 cycles were followed with loading to failure. Testing is currently proceeding and once completed the results will be correlated with data from the other analyses. One of the main points of interest is the relationship between fractal dimension and mechanical properties. Throughout preparation and testing all specimens were maintained hydrated with physiological saline and stored frozen when not being used.
Alves, F D; Souza, G C; Biolo, A; Clausell, N
2014-12-01
The utilisation of bioelectrical impedance analysis (BIA) in heart failure can be affected by many factors and its applicability remains controversial. The present study aimed to verify the adequacy of single-frequency BIA (SF-BIA) and multifrequency BIA (MF-BIA) compared to dual-energy x-ray absorptiometry (DEXA) for evaluating body composition in outpatients with heart failure. In this cross-sectional study, 55 patients with stable heart failure and left ventricle ejection fraction ≤45% were evaluated for fat mass percentage, fat mass and fat-free mass by DEXA and compared with the results obtained by SF-BIA (single frequency of 50 kHz) and MF-BIA (frequencies of 20 and 100 kHz). MF-BIA and DEXA gave similar mean values for fat mass percentage, fat mass and fat-free mass, whereas values from SF-BIA were significantly different from DEXA. Both SF-BIA and MF-BIA measures of body composition correlated strongly with DEXA (r > 0.8; P < 0.001), except for fat mass assessed by SF-BIA, which showed a moderate correlation (r = 0.760; P < 0.001). MF-BIA also showed a better agreement with DEXA by Bland-Altman analysis in all measurements. However, both types of equipment showed wide limits of agreement and a significant relationship between variance and bias (Pitmans's test P > 0.05), except MF-BIA for fat-free mass. Compared with DEXA, MF-BIA showed better accuracy than SF-BIA, although both types of equipment showed wide limits of agreement. The BIA technique should be used with caution, and regression equations might be useful for correcting the observed variations, mainly in extreme values of body composition. © 2014 The British Dietetic Association Ltd.
Lera, Lydia; Ángel, Bárbara; Sánchez, Hugo; Picrin, Yaisy; Hormazabal, María José; Quiero, Andrea; Albala, Cecilia
2014-09-28
To estimate and validate cut-off points of skeletal muscle mass index (SMI) in Chilean population, for using in an algorithm for a diagnosis of sarcopenia developed by European Working Group on Sarcopenia in Older People (EWGSOP). Secondary analysis of Cross-sectional data in 440 Chilean older subjects to estimate cut-off points of SMI determined by DEXA and predicted by an anthropometric equation. Afterward a cross-sectional validation in a sample of 164 older people was performed. Anthropometric measures, self-reported health status, physical performance tests and DEXA were carried out. Decreased muscle strength was defined as handgrip strength <15 kg in women and <27 kg in male. Cut-off points of SMI were defined as values under 20th percentile for DEXA measures and estimated through ROC curves for the anthropometric model. Biological validity of the algorithm was tested by contrasting the diagnosis with physical performance tests and functionality. Cut-off points of SMI obtained by DEXA were 7.19 kg/m² in men and 5.77 kg/m² in women and 7.45 kg/ m² and 5.88 kg/m², respectively for the predicted by the model. Sensibility and specificity of estimations vs DEXA measures were 80% and 92% in men and 77% and 89% in women. We obtained cut-off points of SMI for DEXA and for a prediction equation for older adults Chilean, with good sensibility and specificity for the measurement by DEXA. It will allow to apply the EWGSOP algorithm to the early diagnosis of sarcopenia and to develop programs for prevention, delay or reversion this syndrome. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Lee, Jiwon; Park, Hee-Pyoung; Jeong, Mu-Hui; Kim, Hyun-Chang
2017-12-01
Postoperative sore throat (POST) after general anesthesia with endotracheal intubation is a common and undesirable complication. In this study, we evaluated the combined effects of paracetamol and dexamethasone on the prevention of POST in patients after general anesthesia. A total of 226 patients scheduled for urologic surgery under general anesthesia were randomly assigned to one of two groups. In the DexaPara group (n = 113), dexamethasone (10 mg) and paracetamol (1000 mg) was infused. In the Dexa group (n = 113), dexamethasone (10 mg) alone was given. POST, hoarseness, and dysphagia were monitored. The postoperative wound pain score and perioperative opioid requirements were compared. In addition, complications related to opioids were compared between the groups. The overall incidence of POST was lower in the DexaPara group than in the Dexa group [42 (37%) vs. 72 (64%), p < 0.001]. The incidence of POST while resting at postoperative 1 and 6 h was lower in the DexaPara group than in the Dexa group (p = 0.008 and p = 0.004, respectively). The incidence of postoperative nausea, vomiting, drowsiness, shivering, and headache was comparable between the groups. Paracetamol and dexamethasone infusion reduced the incidence of POST without serious complications in patients for urologic surgery under general anesthesia.
Dexamethasone Effects in the Strongyloides venezuelensis Infection in A Murine Model
Machado, Eleuza R.; Carlos, Daniela; Sorgi, Carlos A.; Ramos, Simone G.; Souza, Daniela I.; Soares, Edson G.; Costa-Cruz, Julia M.; Ueta, Marlene T.; Aronoff, David M.; Faccioli, Lúcia H.
2011-01-01
The aim of this study was to investigate the immunomodulatory effects of glucocorticoids on the immune response to Strongyloides venezuelensis in mice. Balb/c mice were infected with S. venezuelensis and treated with Dexamethasone (Dexa) or vehicle. Dexa treatment increased circulating blood neutrophil numbers and inhibited eosinophil and mononuclear cell accumulation in the blood, bronchoalveolar, and peritoneal fluid compared with control animals. Moreover, Dexa decreased tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), interleukin-3 (IL-3), IL-4, IL-5, IL-10, and IL-12 production in the lungs and circulating immunoglobulin G1 (IgG1), IgG2a, and IgE antibody levels while increasing the overall parasite burden in the feces and intestine. Dexa treatment enhanced the fertility of female nematodes relative to untreated and infected mice. In summary, the alterations in the immune response induced by Dexa resulted in a blunted, aberrant immune response associated with increased parasite burden. This phenomenon is similar to that observed in S. stercoralis-infected humans who are taking immunosuppressive or antiinflammatory drugs, including corticosteroids. PMID:21633034
Santos, Raquel Souza; Silva, Pedro Leme; de Oliveira, Gisele Pena; Santos, Cintia Lourenço; Cruz, Fernanda Ferreira; de Assis, Edson Fernandes; de Castro-Faria-Neto, Hugo Caire; Capelozzi, Vera Luiza; Morales, Marcelo Marcos; Pelosi, Paolo; Gattass, Cerli Rocha; Rocco, Patricia Rieken Macedo
2013-12-01
We compared the effects of oleanolic acid (OA) vs. dexamethasone on lung mechanics and histology, inflammation, and apoptosis in lung and distal organs in experimental sepsis. Seventy-eight BALB/c mice were randomly divided into two groups. Sepsis was induced by cecal ligation and puncture, while the control group underwent sham surgery. 1h after surgery, all animals were further randomized to receive saline (SAL), OA and dexamethasone (DEXA) intraperitoneally. Both OA and DEXA improved lung mechanics and histology, which were associated with fewer lung neutrophils and less cell apoptosis in lung, liver, and kidney than SAL. However, only animals in the DEXA group had lower levels of interleukin (IL)-6 and KC (murine analog of IL-8) in bronchoalveolar lavage fluid than SAL animals. Conversely, OA was associated with lower inducible nitric oxide synthase expression and higher superoxide dismutase than DEXA. In the experimental sepsis model employed herein, OA and DEXA reduced lung damage and distal organ apoptosis through distinct anti-inflammatory mechanisms. Copyright © 2013 Elsevier B.V. All rights reserved.
Mineral distribution in rat skeletons after exposure to a microgravity model
NASA Technical Reports Server (NTRS)
Arnaud, Sara B.; Harper, Jennifer S.; Navidi, Meena
1995-01-01
Exposure to space flight models induces changes in the distribution of bone mineral in the human skeleton that has the features of a gravitational gradient. Regional bone mineral measurements with dual energy x-ray absorptiometry (DEXA) in male adults exposed to head-down tilt bed rest for 30 days shown non-significant decrements in the pelvis and legs with 10% increases in the head region. Horizontal bed rest for 17 weeks reveals losses of bone mineral ranging from 2.2 to 10.4% from the lumbar spine to the calcaneus and an increase of 3.4% in the skull. Investigation of this phenomena would be most definitively carried out in an animal model. One candidate is the flight simulation model in the rat which removes body weight from the hind limbs and induces a cephalad fluid shift by suspending the animal by the tail. Weanling rats exposed to this model showed bone mineral to be lower in the hind limbs and higher in the skull after 3 weeks. These finds are similar in older 200 g animals after 2 weeks tail suspension. The purpose of this study was to determine the effect of age on the distribution of skeletal mineral in this model.
Freitag, Tobias; Hein, Marie-Anne; Wernerus, Dirk; Reichel, Heiko; Bieger, Ralf
2016-01-01
Short stem prostheses have been developed to preserve proximal femoral bone stock. This prospective, randomized study compared periprosthetic bone remodelling following short and straight stem implantation 1 year after surgery. One hundred and forty-four consecutive patients undergoing total hip arthroplasty were randomized to either a Fitmore short or a cementless straight stem (both Zimmer, Winterthur, Switzerland). Periprosthetic bone mineral density (BMD) was measured using dual-energy X-ray absorptiometry performed the day before surgery and at 7 days, 3 months and 1 year postoperatively. Furthermore, the HHS and the WOMAC were obtained. One hundred and thirty-eight patients completed 1-year follow-up. Periprosthetic BMD changes at 1 year were most pronounced in the proximal medial region of interest (ROI) 7 with -17.2% after short stem and -16.7% after straight implantation (p = 0.67). However, there was significantly less BMD reduction in ROI 6 following short (-4.7%) versus straight stem (-10.8%) implantation (p = 0.01). There were no significant differences between the two groups in terms of the HHS and the WOMAC either before or after surgery. One year after surgery, both stems showed an implant-specific periprosthetic bone remodelling. Nevertheless, proximal load transfer was more pronounced after short stem implantation than with a straight stem.
Kimel-Naor, Shani; Abboud, Shimon; Arad, Marina
2016-08-01
Osteoporosis is defined as bone microstructure deterioration resulting a decrease of bone's strength. Measured bone mineral density (BMD) constitutes the main tool for Osteoporosis diagnosis, management, and defines patient's fracture risk. In the present study, parametric electrical impedance tomography (pEIT) method was examined for monitoring BMD, using a computerized simulation model and preliminary real measurements. A numerical solver was developed to simulate surface potentials measured over a 3D computerized pelvis model. Varying cortical and cancellous BMD were simulated by changing bone conductivity and permittivity. Up to 35% and 16% change was found in the real and imaginary modules of the calculated potential, respectively, while BMD changes from 100% (normal) to 60% (Osteoporosis). Negligible BMD relative error was obtained with SNR>60 [dB]. Position changes errors indicate that for long term monitoring, measurement should be taken at the same geometrical configuration with great accuracy. The numerical simulations were compared to actual measurements that were acquired from a healthy male subject using a five electrodes belt bioimpedance device. The results suggest that pEIT may provide an inexpensive easy to use tool for frequent monitoring BMD in small clinics during pharmacological treatment, as a complementary method to DEXA test. Copyright © 2016. Published by Elsevier Ltd.
[In vitro study with techniques of imaging of the composition of urinary calculi].
Tellez Martínez-Fornés, M; Burgos Revilla, F J; Sáez Garrido, J C; Soria Descalzo, J; Barbero González, J; Sánchez Corral, J; Minaya Minaya, A; Vallejo Herrador, J
1997-02-01
Pre-treatment knowledge of the lithiasic composition can be useful to design the most appropriate therapeutic scheme for each kind of stone. The relationship between the stone's densitometry information provided by the different imaging techniques, conventional radiology (RX), computerized axial tomography (CAT) and dual energy radiographic densitometry (DO) is analyzed, as well as the elemental composition determined by the microanalysis of fragments obtained post-lithotrity using a scanning electronic microscope (SEM) associated to X-ray dispersion energy (XDE). 60 stones, 12 for each pure composition selected (calcium oxalate mono and dihydro, phosphocarbonate, magnesium ammonium phosphate and uric acid), were studied with XR, CAT and DO and were later subjected to lithofragmentation in vitro. Fragments analysis was carried out post-lithotrity with SEM associated to XDE. The X-ray does not allow to establish the composition of some calculi. CAT quantifies the mineral contents of the oxalocalcic and infective calculi and differentiates the uric acid from the other compositions because the mean density values are under 500 Hounsfield Units. DO evaluates the lithiasic content in phosphocarbonate salts which are structurally similar to bone hydroxyapatite.
McCloskey, Eugene V; Binkley, Neil
2011-01-01
The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.
Saki, Forough; Ranjbar Omrani, Gholamhossein; Jeddi, Marjan; Bakhshaieshkaram, Marzie; Dabbaghmanesh, Mohammad Hossein
2017-01-01
Background Improving peak bone mass and bone strength in the first years of life and enhancing it during young adulthood could prevent osteoporosis and fractures in the last years of life. We evaluated the prevalence of low bone mass in the lumbar and femoral neck and its associated factors in southern Iranian children. Methods This is a cross-sectional study on healthy Iranian children aged 9 - 18 years old during 2011 - 2012. Dual energy X-ray absorptiometry (DEXA) was used for measuring bone mineral density (BMD). BMD Z-score ≤ -2 was considered as low. Anthropometric data, physical activity, sun exposure, puberty, and mineral biochemical parameters were assessed. Data were analyzed using SPSS v.15. Results 477 normal children, including 236 (49.5%) girls and 241 (50.5%) boys, aged 13.8 ± 2.7 years were enrolled. Prevalence of low bone mass (LBM) in the femoral and lumbar region was 10.7% and 18.7%, respectively. The prevalence of LBM in femur of girls is twice more than boys. Fat mass index, BMI Z-score, and physical activity were associated with lumbar low bone mass. BMI Z-score and physical activity were associated with femoral low bone mass. Conclusions High prevalence of low bone mineral density in children 9 to 18 years in south of the country is concerned and is needed to plan for prevention and treatment. BMI-Z score, fat mass index, and physical activity were the 3 most important preventive factors in developing low bone mass in children. PMID:29344033
Osteopenia in anorexia nervosa: specific mechanisms of bone loss.
Lennkh, C; de Zwaan, M; Bailer, U; Strnad, A; Nagy, C; el-Giamal, N; Wiesnagrotzki, S; Vytiska, E; Huber, J; Kasper, S
1999-01-01
Osteopenia is a well recognized medical complication of anorexia nervosa (AN). The mechanism of bone loss is not fully understood and there is uncertainty about its management. New markers of bone turnover have been developed. C-terminal type 1 propeptide (PICP) is a measure of bone formation and urinary pyridinolines such as deoxypyridinoline (DPYRX) and serum carboxyterminal crosslinked telopeptide (ICTP) are markers of bone resorption. The aim of this study was to examine these bone markers in patients with AN. Twenty female patients with AN and 12 healthy controls were included in the study. Bone mineral density (BMD) of AN patients was measured by dual energy X-ray absorptiometry (DEXA). Lumbar bone density was significantly reduced in the AN group compared to standardised values of thirty year old adults (t-score 83.2%, S.D. 12.1). Femoral neck bone density showed an even greater reduction (t-score 79.4%, S.D. 13.5). We found a significant negative correlation between femoral BMD and the duration of the illness. Femoral BMD correlated significantly with minimal body weight (r(16) = 0.504, p = 0.033). The markers of bone resorption were significantly higher in the patients with AN compared to the values of the control group (ICTP t(30) = -2.15, p = 0.04, DPYRX t(25) = -2.26, p = 0.033), whereas the markers of bone formation did not differ significantly between the groups. AN appears to be a low turn over state associated with increased bone resorption without concomitant bone formation. This pattern differs from osteopenia in menopausal women and should, therefore, lead to the development of specific therapeutic strategies in AN associated osteopenia. Hormone replacement therapy as well as calcium and vitamine D-supplementation are so far discussed controversially. Long-term treatment studies are warranted.
Dionello, C.F.; Sá-Caputo, D.; Pereira, H.V.F.S.; Sousa-Gonçalves, C.R.; Maiworm, A.I.; Morel, D.S.; Moreira-Marconi, E.; Paineiras-Domingos, L.L.; Bemben, D.; Bernardo-Filho, M.
2016-01-01
Objectives: The aim of this study was to review the literature about the effect of whole body vibration exercise in the BMD in patients with postmenopausal osteoporosis without medications. Methods: A systematic review was performed. Results: The frequency of the mechanical vibration used in the protocols has varied from 12 to 90 Hz. The time used in the protocols varied from 2 up to 22 months. Techniques with X-rays were used in nine of the twelve publications analyzed, the Dual energy X-ray absorptiometry (DEXA) in eight studies and the High resolution peripheral quantitative computed tomography (HR-pQCT) in one publication. The concentration of some biomarkers was determined, as the sclerostin, the bone alkaline phosphatase, N-telopeptide X and 25-hydroxyvitamin D. Among the twelve articles analyzed, seven of them have shown an improvement of the BMD of some bone of postmenopausal women exposed to whole body vibration exercises not associated to medications; as well as modifications in biomarkers. PMID:27609034
Bone mineral density and correlation factor analysis in normal Taiwanese children.
Shu, San-Ging
2007-01-01
Our aim was to establish reference data and linear regression equations for lumbar bone mineral density (BMD) in normal Taiwanese children. Several influencing factors of lumbar BMD were investigated. Two hundred fifty-seven healthy children were recruited from schools, 136 boys and 121 girls, aged 4-18 years were enrolled on a voluntary basis with written consent. Their height, weight, blood pressure, puberty stage, bone age and lumbar BMD (L2-4) by dual energy x-ray absorptiometry (DEXA) were measured. Data were analyzed using Pearson correlation and stepwise regression tests. All measurements increased with age. Prior to age 8, there was no gender difference. Parameters such as height, weight, and bone age (BA) in girls surpassed boys between ages 8-13 without statistical significance (p> or =0.05). This was reversed subsequently after age 14 in height (p<0.05). BMD difference had the same trend but was not statistically significant either. The influencing power of puberty stage and bone age over BMD was almost equal to or higher than that of height and weight. All the other factors correlated with BMD to variable powers. Multiple linear regression equations for boys and girls were formulated. BMD reference data is provided and can be used to monitor childhood pathological conditions. However, BMD in those with abnormal bone age or pubertal development could need modifications to ensure accuracy.
Skeletal Maturation and Mineralisation of Children with Moderate to Severe Spastic Quadriplegia
Sitaraman, Sadasivan
2016-01-01
Introduction Diminished bone mineral density and delayed skeletal maturation are common in children with spastic quadriplegia. Aim The purpose of our study was to evaluate the Bone Mineral Density (BMD) of children with moderate to severe spastic quadriplegia and its relationship with other variables like nutrition and growth. Materials and Methods This was a hospital based, cross- sectional, case-control study. Forty-two (28 males, 14 females) children with spastic quadriplegia and 42 (24 males, 18 females) healthy children were included in the study. BMD of cases and control were measured by Dual Energy X-ray Absorptiometry (DEXA). Radiographs of left hand and wrist of cases and controls were taken and bone age was determined. Results BMD values of upper extremity, lower extremity, thoraco-lumbar spine and pelvis in cases were lower than those of controls (p <0.0001). In children with non severe malnutrition, 75% of the cases had lower bone age than chronological age, whereas all cases with severe malnutrition had lower bone age than chronological age. Step wise regression analysis showed that nutritional status independently contributed to lower BMD values but the BMD values did not correlate significantly with the use of anticonvulsant drugs and presence of physical therapy. Conclusion Decreased BMD and delayed bone age is prevalent in children with spastic quadriplegia and nutritional status is an important contributing factor. PMID:27504366
Krynytska, I; Marushchak, M; Zaets, T; Savchenko, I; Habor, H
2017-06-01
The majority of the studies have shown that individuals with cardiovascular diseases have a higher risk of experiencing bone loss and thus greater predisposition to risk of fracture. On the other hand there is growing evidence that individuals with low bone mass have higher mortality for cardiovascular events compared to patients with cardiovascular disease with normal bone mass. This research aims to investigate bone mineralization in patients with coronary heart disease complicated by stage II-A chronic heart failure. The study involved 33 men with coronary heart disease complicated by Stage II-A chronic heart failure. Bone mineral density was measured using dual energy x-ray densitometry of lumbar region of spine. Structural and functional changes of bone tissue of the lumbar spine have been found in 49,2% patients with coronary heart disease complicated by Stage II-A chronic heart failure, in particular, I stage of osteopenia - in 44,6%, II stage of osteopenia - in 27,7%, III stage of osteopenia - in 10,8% and osteoporosis - in 16,9%. It was established the same type of downward trend for BMD decreasing in L1 of patients with different stages of osteopenia, but in case of osteoporosis mineralization decreased equally in all vertebrae.
Guimarães, Ana Paula Franttini Garcia Moreno; Butezloff, Mariana Maloste; Zamarioli, Ariane; Issa, João Paulo Mardegan; Volpon, José Batista
2017-11-01
To evaluate the influence of nandrolone decanoate on fracture healing and bone quality in normal rats. Male rats were assigned to four groups (n=28/group): Control group consisting of animals without any intervention, Nandrolone decanoate (DN) group consisting of animals that received intramuscular injection of nandrolone decanoate, Fracture group consisting of animals with a fracture at the mid-diaphysis of the femur, and Fracture and nandrolone decanoate group consisting of animals with a femur fracture and treatment with nandrolone decanoate. Fractures were created at the mid-diaphysis of the right femur by a blunt trauma and internally fixed using an intramedullary steel wire. The DN was injected intramuscularly twice per week (10 mg/kg of body mass). The femurs were measured and evaluated by densitometry and mechanical resistance after animal euthanasia. The newly formed bone and collagen type I levels were quantified in the callus. The treated animals had longer femurs after 28 days. The quality of the intact bone was not significantly different between groups. The bone callus did show a larger mass in the treated rats. The administration of nandrolone decanoate did not affect the quality of the intact bone, but might have enhanced the bone callus formation.
Body Fat Measurements in Singaporean Adults Using Four Methods
Bi, Xinyan; Loo, Yi Ting
2018-01-01
Few studies have been conducted to measure body composition in Asian populations. In this study, we determined the percent body fat (PBF) by using dual-energy X-ray absorptiometry (DEXA), air-displacement plethysmography (ADP or BOD POD), bioelectrical impedance analysis (BIA) and skinfold (SKF) in 445 healthy Singaporean adults. We observed that the BOD POD, BIA and SKF estimates of PBF were highly correlated with that from DEXA (as a reference method) among Singaporean adults. However, they all underestimated PBF (differences of 3.9% for BOD POD, 5.6% for BIA and 12.5% for SKF). Our results filled a gap in the literature by testing the relationships between DEXA and BOD POD, BIA and SKF in a large sample with a wide range of body mass index (BMI) from 16.1 to 37.5 kg/m2 and age from 21 to 69.2 years. The differences of PBF measured by different methods were dependent on age, gender and ethnicity. No significant difference was observed between DEXA and BOD POD in men aged > 40 or in BMI tertile 3. However, the mean difference between DEXA and BOD POD was significant in women. Different measuring methods of estimating PBF therefore must be cautiously interpreted. PMID:29510545
Consensus and controversy regarding osteoporosis in the pediatric population.
Bachrach, Laura Keyes
2007-09-01
To review current consensus and controversy surrounding the diagnosis and treatment of osteoporosis in childhood and adolescence. The medical literature was reviewed with emphasis on the importance of early skeletal health, risk factors for bone fragility, and the diagnosis and management of children at risk for osteoporosis. Childhood and adolescence are critical periods for optimizing bone growth and mineral accrual. Bone strength is determined by bone size, geometry, quality, and mass-variables that are influenced by genetic factors, activity, nutrition, and hormones. For children with genetic skeletal disorders or chronic disease, bone growth and mineral accrual may be compromised, increasing the lifetime risk of osteoporosis. The goal for the clinician is to identify children at greatest risk for future fragility fracture. Bone densitometry and turnover markers are challenging to interpret in children. Prevention and treatment of bone fragility in children are less well established than in adults. Optimizing nutrition and activity may not restore bone health, but the drug armamentarium is limited. Sex steroid replacement has not proven effective in restoring bone mass in patients with anorexia nervosa or exercise-associated amenorrhea. Bisphosphonates can increase bone mass and may reduce bone pain and fractures, most convincingly in patients with osteogenesis imperfecta. Further studies are needed to establish the safety, efficacy, and optimal drug, duration, and dosage in pediatric patients. Bone health during the first 2 decades contributes to the lifetime risk of osteoporosis. Further research is needed to develop evidence-based recommendations for the diagnosis and treatment of osteoporosis in childhood.
Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K
2017-10-17
Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Hand bone mineral density reference values in a Turkish healthy female population.
Alioglu, Kenan; Dogu, Beril; Sirzai, Hulya; Yilmaz, Figen; Kuran, Banu
2017-12-01
In this study we aimed at identifying the bone mineral density (BMD) reference values of hands, according to age, measured by dual-energy X-ray absorptiometry (DEXA) and assessing the correlation of these values with lumbar and femoral BMD values. A total of 403 healthy women aged between 20 and 70 participated in our study. All BMD measurements are performed by DEXA method on both hands, anteroposterior lumbar spine (L2-L4) and right femur (femoral neck, total femur) regions. BMD results of all the patients were divided to 10-year age categories and evaluated in five subgroups in total (20-30 to 61-70). Among the 10-year age categories we found both dominant and non-dominant hand peak bone mass values in the 31-40 years age group (0.423 ± 0.039 g/cm², 0.410 ± 0.043 g/cm², respectively). Statistically significant positive correlation was defined between dominant and non-dominant hand BMD values and L2-L4 spine, femur neck and total femur values (for dominant hand r = 0.636, P = 0.0001; r = 0.645, P = 0.0001; r = 0.623; P = 0.0001; for non-dominant hand r = 0.624, P = 0.0001; r = 0.637, P = 0.0001, r = 0.623, P = 0.0001, respectively). Regarding the relationship of age and menopause with BMD results, a negative statistical relationship was observed among dominant and non-dominant hand, L2-L4 spine, femoral neck and total femur BMD values (P = 0.0001). Our study has provided hand BMD reference values in women aged between 20-70 years; further studies are needed to investigate the role of these values in identifying diseases causing osteoporosis in the hand and in evaluating treatment. © 2013 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.
Saetung, Sunee; Chailurkit, La-or; Ongphiphadhanakul, Boonsong
2010-07-01
Mechanical loadings by active exercise or passive low amplitude vibration have been demonstrated to enhance bone mass or delay bone loss. Traditional Thai massage can be anabolic to bone due to the application of physical loading on the body in a rhythmic fashion. To explore the skeletal effect of Thai traditional massage by examining the changes in biochemical markers of bone turnover immediately after the massage. Subjects consisted of 30 healthy females aged 20-40 years. Each subject received Thai traditional massage for 2 hours by a single masseuse. Bone mineral density (BMD) at baseline was measured by dual-energy X-ray absorptiometry (DEXA). C-terminal telopeptide of type 1 collagen (CTx-I) and total procollagen type 1 amino-terminal propeptide (P1NP) were determined by electrochemiluminescence immunoassay. There was a 4.8% increase in serum P1NP concentrations after massage (median 43.4 ng/ml vs. 41.3 ng/ml, p < 0.05). Serum CTx-I also decreased after massage (median 2-hour vs. baseline 0.29 ng/ml vs. 0.31 ng/ml, p < 0.05). There was a nearly significant negative correlation between the percentage change in serum P1NP and BMD at the total femur (r = -0.37, p = 0.056) whereas the statistically significant correlation disappeared between percentage change in bone turnover and the other sites of BMD. Thai traditional massage induces acute changes in bone formation and resorption markers. Study on the more prolonged effects of Thai traditional massage is warranted to explore its implication in the enhancement of bone health.
Thormann, Ulrich; El Khawassna, Thaqif; Ray, Seemun; Duerselen, Lutz; Kampschulte, Marian; Lips, Katrin; von Dewitz, Helena; Heinemann, Sascha; Heiss, Christian; Szalay, Gabor; Langheinrich, Alexander C; Ignatius, Anita; Schnettler, Reinhard; Alt, Volker
2014-03-01
Discrepancies in bone healing between osteoporotic and non-osteoporotic bone remain uncertain. The focus of the current work is to evaluate potential healing discrepancies in a metaphyseal defect model in rat femora. Female Sprague-Dawley rats were either ovariectomized (OVX, n=14) and combined with a calcium-, phosphorus- and vitamin D3-, soy- and phytoestrogen-free diet or received SHAM operation with standard diet rat (SHAM, n=14). Three months post-ovariectomy, DEXA measurement showed a reduction of bone mineral density reflecting an osteoporotic bone status in OVX rats. Rats then underwent a 3 mm wedge-shaped osteotomy at the distal metaphyseal area of the left femur stabilized with a T-shaped mini-plate and allowed to heal for 6 weeks. Biomechanical competence by means of a non-destructive three-point bending test showed significant lower flexural rigidity in the OVX rats at 3 mm lever span compared to SHAM animals (p=0.048) but no differences at 10 mm lever span. Microcomputer tomography (μCT) showed bridging cortices and consolidation of the defect in both groups, however, no measurable differences were found in either total ossified tissue or vascular volume fraction. Furthermore, histology showed healing discrepancies that were characterized by cartilaginous remnant and more unmineralized tissue presence in the OVX rats compared to more mature consolidation appearance in the SHAM group. In summary, bone defect healing in metaphyseal bone slightly differs between osteoporotic and non-osteoporotic bone in the current 3 mm defect model in both 3mm lever span biomechanical testing and histology. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hamidi, Maryam S; Gajic-Veljanoski, Olga; Cheung, Angela M
2013-01-01
Vitamin K has been purported to play an important role in bone health. It is required for the gamma-carboxylation of osteocalcin (the most abundant noncollagenous protein in bone), making osteocalcin functional. There are 2 main forms (vitamin K1 and vitamin K2), and they come from different sources and have different biological activities. Epidemiologic studies suggest a diet high in vitamin K is associated with a lower risk of hip fractures in aging men and women. However, randomized controlled trials of vitamin K1 or K2 supplementation in white populations did not increase bone mineral density at major skeletal sites. Supplementation with vitamin K1 and K2 may reduce the risk of fractures, but the trials that examined fractures as an outcome have methodological limitations. Large well-designed trials are needed to compare the efficacies of vitamin K1 and K2 on fractures. We conclude that currently there is not enough evidence to recommend the routine use of vitamin K supplements for the prevention of osteoporosis and fractures in postmenopausal women. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Methods and application of bone densitometry in clinical diagnosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wahner, H.W.; Riggs, B.L.
1986-01-01
With the awareness of osteoporosis as a major health problem for an aging population, there is great interest in early recognition and treatment of abnormal bone loss. Effective prevention of bone loss has to occur prior to the occurrence of irreparable damage. Standard radiographic procedures are not sensitive enough for the task. Therefore, a number of alternative procedures to estimate bone loss have been developed over the years, ranging from efforts to quantitate information obtained from radiographic images to sophisticated procedures such as neutron activation analysis or procedures based on the Compton scatter phenomenon. Only two procedures, photon absorptiometry andmore » computed tomography (CT), have emerged as applicable for routine clinical use. In photon absorptiometry the entire bone mineral (cortical and trabecular bone) of a specific skeletal site is measured. CT allows measuring of bone mineral of trabecular or cortical bone alone. Normally, bone mass reaches a maximum in the third decade and then continuously declines. This age-related bone loss is greater in women in whom an accelerated rate of loss occurs at the menopause. When bone density reaches a critical fracture threshold, skeletal fractures occur (spine, hip, and distal long bones). The age at which this critical fracture threshold is reached depends on the maximal bone mass achieved in early adulthood and the rate of loss with increasing age. With the exception of NaF, present-day therapeutic efforts only retard or prevent bone loss but do not significantly add bone mineral to the skeleton. Recognition of high-risk groups and early treatment are therefore required. 79 references.« less
Maïmoun, Laurent; Coste, Olivier; Philibert, Pascal; Briot, Karine; Mura, Thibault; Galtier, Florence; Mariano-Goulart, Denis; Paris, Françoise; Sultan, Charles
2013-08-01
Intensive physical training may have a sport-dependent effect on bone mass acquisition. This cross-sectional study evaluated bone mass acquisition in girls practicing sports that put different mechanical loads on bone. Eighty girls from 10.7 to 18.0 years old (mean 13.83 ± 1.97) were recruited: 20 artistic gymnasts (AG; high-impact activity), 20 rhythmic gymnasts (RG; medium-impact activity), 20 swimmers (SW, no-impact activity), and 20 age-matched controls (CON; leisure physical activity <3h/wk). Areal bone mineral density (aBMD) was determined using DEXA. Hip structural analysis applied at the femur evaluated cross-sectional area (CSA, cm(2)), section modulus (Z, cm(3)), and buckling ratio. Bone turnover markers and OPG/RANKL levels were analyzed. AG had higher aBMD than SW and CON at all bone sites and higher values than RG in the lumbar spine and radius. RG had higher aBMD than SW and CON only in the femoral region. CSA and mean cortical thickness were significantly higher and the buckling ratio was significantly lower in both gymnast groups compared with SW and CON. In RG only, endocortical diameter and width were reduced, while Z was only increased in AG compared with SW and CON. Reduced bone remodeling was observed in RG compared with AG only when groups were subdivided according to menarcheal status. All groups showed similar OPG concentrations, while RANKL concentrations increased with age and were decreased in SW. High-impact activity clearly had a favorable effect on aBMD and bone geometry during the growth period, although the bone health benefits seem to be more marked after menarche. Copyright © 2013 Elsevier Inc. All rights reserved.
Niziolek, Paul J; Bullock, Whitney; Warman, Matthew L; Robling, Alexander G
2015-01-01
The low density lipoprotein receptor-related protein-5 (LRP5), a co-receptor in the Wnt signaling pathway, modulates bone mass in humans and in mice. Lrp5 knock-out mice have severely impaired responsiveness to mechanical stimulation whereas Lrp5 gain-of-function knock-in and transgenic mice have enhanced responsiveness to mechanical stimulation. Those observations highlight the importance of Lrp5 protein in bone cell mechanotransduction. It is unclear if and how high bone mass-causing (HBM) point mutations in Lrp5 alter the bone-wasting effects of mechanical disuse. To address this issue we explored the skeletal effects of mechanical disuse using two models, tail suspension and Botulinum toxin-induced muscle paralysis, in two different Lrp5 HBM knock-in mouse models. A separate experiment employing estrogen withdrawal-induced bone loss by ovariectomy was also conducted as a control. Both disuse stimuli induced significant bone loss in WT mice, but Lrp5 A214V and G171V were partially or fully protected from the bone loss that normally results from disuse. Trabecular bone parameters among HBM mice were significantly affected by disuse in both models, but these data are consistent with DEXA data showing a failure to continue growing in HBM mice, rather than a loss of pre-existing bone. Ovariectomy in Lrp5 HBM mice resulted in similar protection from catabolism as was observed for the disuse experiments. In conclusion, the Lrp5 HBM alleles offer significant protection from the resorptive effects of disuse and from estrogen withdrawal, and consequently, present a potential mechanism to mimic with pharmaceutical intervention to protect against various bone-wasting stimuli.
Protective Effects of Vildagliptin against Pioglitazone-Induced Bone Loss in Type 2 Diabetic Rats
Kwak, Kyung Min; Kim, Ju-Young; Yu, Seung Hee; Lee, Sihoon; Kim, Yeun Sun; Park, Ie Byung; Kim, Kwang-Won; Lee, Kiyoung
2016-01-01
Long-term use of thiazolidinediones (TZDs) is associated with bone loss and an increased risk of fracture in patients with type 2 diabetes (T2DM). Incretin-based drugs (glucagon-like peptide-1 (GLP-1) agonists and dipeptidylpeptidase-4 (DPP-4) inhibitors) have several benefits in many systems in addition to glycemic control. In a previous study, we reported that exendin-4 might increase bone mineral density (BMD) by decreasing the expression of SOST/sclerostin in osteocytes in a T2DM animal model. In this study, we investigated the effects of a DPP-4 inhibitor on TZD-induced bone loss in a T2DM animal model. We randomly divided 12-week-old male Zucker Diabetic Fatty (ZDF) rats into four groups; control, vildagliptin, pioglitazone, and vildagliptin and pioglitazone combination. Animals in each group received the respective treatments for 5 weeks. We performed an intraperitoneal glucose tolerance test (IPGTT) before and after treatment. BMD and the trabecular micro-architecture were measured by DEXA and micro CT, respectively, at the end of the treatment. The circulating levels of active GLP-1, bone turnover markers, and sclerostin were assayed. Vildagliptin treatment significantly increased BMD and trabecular bone volume. The combination therapy restored BMD, trabecular bone volume, and trabecular bone thickness that were decreased by pioglitazone. The levels of the bone formation marker, osteocalcin, decreased and that of the bone resorption marker, tartrate-resistant acid phosphatase (TRAP) 5b increased in the pioglitazone group. These biomarkers were ameliorated and the pioglitazone-induced increase in sclerostin level was lowered to control values by the addition of vildagliptin. In conclusion, our results indicate that orally administered vildagliptin demonstrated a protective effect on pioglitazone-induced bone loss in a type 2 diabetic rat model. PMID:27997588
Protective Effects of Vildagliptin against Pioglitazone-Induced Bone Loss in Type 2 Diabetic Rats.
Eom, Young Sil; Gwon, A-Ryeong; Kwak, Kyung Min; Kim, Ju-Young; Yu, Seung Hee; Lee, Sihoon; Kim, Yeun Sun; Park, Ie Byung; Kim, Kwang-Won; Lee, Kiyoung; Kim, Byung-Joon
2016-01-01
Long-term use of thiazolidinediones (TZDs) is associated with bone loss and an increased risk of fracture in patients with type 2 diabetes (T2DM). Incretin-based drugs (glucagon-like peptide-1 (GLP-1) agonists and dipeptidylpeptidase-4 (DPP-4) inhibitors) have several benefits in many systems in addition to glycemic control. In a previous study, we reported that exendin-4 might increase bone mineral density (BMD) by decreasing the expression of SOST/sclerostin in osteocytes in a T2DM animal model. In this study, we investigated the effects of a DPP-4 inhibitor on TZD-induced bone loss in a T2DM animal model. We randomly divided 12-week-old male Zucker Diabetic Fatty (ZDF) rats into four groups; control, vildagliptin, pioglitazone, and vildagliptin and pioglitazone combination. Animals in each group received the respective treatments for 5 weeks. We performed an intraperitoneal glucose tolerance test (IPGTT) before and after treatment. BMD and the trabecular micro-architecture were measured by DEXA and micro CT, respectively, at the end of the treatment. The circulating levels of active GLP-1, bone turnover markers, and sclerostin were assayed. Vildagliptin treatment significantly increased BMD and trabecular bone volume. The combination therapy restored BMD, trabecular bone volume, and trabecular bone thickness that were decreased by pioglitazone. The levels of the bone formation marker, osteocalcin, decreased and that of the bone resorption marker, tartrate-resistant acid phosphatase (TRAP) 5b increased in the pioglitazone group. These biomarkers were ameliorated and the pioglitazone-induced increase in sclerostin level was lowered to control values by the addition of vildagliptin. In conclusion, our results indicate that orally administered vildagliptin demonstrated a protective effect on pioglitazone-induced bone loss in a type 2 diabetic rat model.
Diamant, Zuzana; Samuelsson Palmgren, Gabriella; Westrin, Bengt; Bjermer, Leif
2017-01-01
Introduction : Systemic corticosteroids are anti-inflammatory agents with dexamethasone among the most potent in the class. Within (respiratory) allergy, systemic corticosteroids are usually applied in medical emergencies. In these situations, patients may experience physical or logistic problems taking tablets. To fulfil a practical unmet need for outpatients, Dexa ODF, an oral dissolvable film containing dexamethasone, was developed. Objectives : We compared the safety, tolerability and pharmacokinetics (PK) of Dexa ODF with Fortecortin tablets in healthy subjects. Methods : Thirty subjects participated in this open label, two-way, cross-over study, consisting of two treatment visits separated by 5-10 days. On both treatment visits, subjects randomly received one single dose of Dexa ODF (one strip; 8 mg dexamethasone) or one single dose of Fortecortin (two 4 mg tablets). Safety evaluations and blood sampling for PK were conducted until 48 h post-dose and bioequivalence analysis was performed on AUC(0-t), AUC(0-∞) and Cmax. Results : All subjects were dosed. Forty-five adverse events (AEs) were reported by 17 subjects and approximately 50% were deemed 'possibly treatment related' (14 on Dexa ODF; 12 on Fortecortin) with no significant difference between treatments. For all three bioequivalence parameters the 90% CIs were within the acceptance limits of bioequivalence (0.8;1.25). Conclusion : We demonstrated good tolerability and bioequivalence of Dexa ODF (8 mg dexamethasone) compared to Fortecortin tablets (2 × 4 mg dexamethasone). Dexa ODF is currently under development as an innovative treatment for use within respiratory and allergic conditions, including emergencies.
Ward, L M; Rauch, F; Travers, R; Roy, M; Montes, J; Chabot, G; Glorieux, F H
2004-08-15
Osteopathia striata with cranial sclerosis (OS-CS) is a rare skeletal dysplasia characterized by linear striations of the long bones, osteosclerosis of the cranium, and extra-skeletal anomalies. We provide a comprehensive description of the skeletal phenotype in a French-Canadian girl with a moderate to severe form of sporadic OS-CS. Multiple medical problems, including anal stenosis and the Pierre-Robin sequence, were evident in the first few years of life. At 14 years, she was fully mobile, with normal intellect and stature. She suffered chronic lower extremity pain in the absence of fractures, as well as severe headaches, unilateral facial paralysis, and bilateral mixed hearing loss. Biochemical indices of bone and mineral metabolism were within normal limits. Bone densitometry showed increased areal bone mineral density in the skull, trunk, and pelvis, but not in the upper and lower extremities. An iliac bone biopsy specimen revealed an increased amount of trabecular bone. Trabeculae were abnormally thick, but there was no evidence of disturbed bone remodeling. In a cranial bone specimen, multiple layers of periosteal bone were found that covered a compact cortical compartment containing tightly packed haversian canals. Bone lamellation was normal in both the iliac and skull samples. Osteoclast differentiation studies showed that peripheral blood osteoclast precursors from this patient formed functional osteoclasts in vitro. Thus, studies of bone metabolism did not explain why bone mass is increased in most skeletal areas of this patient. Cranial histology points to exuberant periosteal bone formation as a potential cause of the cranial sclerosis.
Establishing a method to measure bone structure using spectral CT
NASA Astrophysics Data System (ADS)
Ramyar, M.; Leary, C.; Raja, A.; Butler, A. P. H.; Woodfield, T. B. F.; Anderson, N. G.
2017-03-01
Combining bone structure and density measurement in 3D is required to assess site-specific fracture risk. Spectral molecular imaging can measure bone structure in relation to bone density by measuring macro and microstructure of bone in 3D. This study aimed to optimize spectral CT methodology to measure bone structure in excised bone samples. MARS CT with CdTe Medipix3RX detector was used in multiple energy bins to calibrate bone structure measurements. To calibrate thickness measurement, eight different thicknesses of Aluminium (Al) sheets were scanned one in air and the other around a falcon tube and then analysed. To test if trabecular thickness measurements differed depending on scan plane, a bone sample from sheep proximal tibia was scanned in two orthogonal directions. To assess the effect of air on thickness measurement, two parts of the same human femoral head were scanned in two conditions (in the air and in PBS). The results showed that the MARS scanner (with 90μm voxel size) is able to accurately measure the Al (in air) thicknesses over 200μm but it underestimates the thicknesses below 200μm because of partial volume effect in Al-air interface. The Al thickness measured in the highest energy bin is overestimated at Al-falcon tube interface. Bone scanning in two orthogonal directions gives the same trabecular thickness and air in the bone structure reduced measurement accuracy. We have established a bone structure assessment protocol on MARS scanner. The next step is to combine this with bone densitometry to assess bone strength.
Zinc deficiency reduces bone mineral density in the spine of young adult rats: a pilot study.
Ryz, Natasha R; Weiler, Hope A; Taylor, Carla G
2009-01-01
The objective of this study was to investigate the effects of zinc deficiency initiated during adolescence on skeletal densitometry, serum markers of bone metabolism, femur minerals and morphometry in young adult rats. Ten-week-old male rats were fed a <1-mg Zn/kg diet (9ZD), a 5-mg Zn/kg diet (9MZD) or a 30-mg Zn/kg diet (9CTL) for up to 9 weeks. Analyses included bone mineral density, serum osteocalcin and C-terminal peptides of type I collagen, serum zinc, femur zinc, calcium and phosphorus, and femur morphometry. Bone mineral density was 14% lower in the spine of 9ZD, but was not altered in the whole body, tibia or femur, or in any of the aforementioned sites in 9MZD, compared to 9CTL. When adjusted for size, spine bone mineral apparent density was still 8% lower in 9ZD than 9CTL. Serum osteocalcin, a marker for bone formation, was approximately 33% lower in 9ZD compared to both 9MZD and 9CTL. The 9ZD and 9MZD had 57% lower femur zinc and 56-88% lower serum zinc concentrations compared to 9CTL. These findings indicate that severe zinc deficiency initiated during adolescence may have important implications for future bone health, especially with regards to bone consolidation in the spine. 2009 S. Karger AG, Basel.
Aakre, Kenneth T; Valley, Timothy B; O'Connor, Michael K
2010-03-01
Lean Six Sigma process improvement methodologies have been used in manufacturing for some time. However, Lean Six Sigma process improvement methodologies also are applicable to radiology as a way to identify opportunities for improvement in patient care delivery settings. A multidisciplinary team of physicians and staff conducted a 100-day quality improvement project with the guidance of a quality advisor. By using the framework of DMAIC (define, measure, analyze, improve, and control), time studies were performed for all aspects of patient and technologist involvement. From these studies, value stream maps for the current state and for the future were developed, and tests of change were implemented. Comprehensive value stream maps showed that before implementation of process changes, an average time of 20.95 minutes was required for completion of a bone densitometry study. Two process changes (ie, tests of change) were undertaken. First, the location for completion of a patient assessment form was moved from inside the imaging room to the waiting area, enabling patients to complete the form while waiting for the technologist. Second, the patient was instructed to sit in a waiting area immediately outside the imaging rooms, rather than in the main reception area, which is far removed from the imaging area. Realignment of these process steps, with reduced technologist travel distances, resulted in a 3-minute average decrease in the patient cycle time. This represented a 15% reduction in the initial patient cycle time with no change in staff or costs. Radiology process improvement projects can yield positive results despite small incremental changes.
Biomedical technology transfer. Applications of NASA science and technology
NASA Technical Reports Server (NTRS)
Harrison, D. C.
1980-01-01
Ongoing projects described address: (1) intracranial pressure monitoring; (2) versatile portable speech prosthesis; (3) cardiovascular magnetic measurements; (4) improved EMG biotelemetry for pediatrics; (5) ultrasonic kidney stone disintegration; (6) pediatric roentgen densitometry; (7) X-ray spatial frequency multiplexing; (8) mechanical impedance determination of bone strength; (9) visual-to-tactile mobility aid for the blind; (10) Purkinje image eyetracker and stabilized photocoalqulator; (11) neurological applications of NASA-SRI eyetracker; (12) ICU synthesized speech alarm; (13) NANOPHOR: microelectrophoresis instrument; (14) WRISTCOM: tactile communication system for the deaf-blind; (15) medical applications of NASA liquid-circulating garments; and (16) hip prosthesis with biotelemetry. Potential transfer projects include a person-portable versatile speech prosthesis, a critical care transport sytem, a clinical information system for cardiology, a programmable biofeedback orthosis for scoliosis a pediatric long-bone reconstruction, and spinal immobilization apparatus.
Corneal densitometry and its correlation with age, pachymetry, corneal curvature, and refraction.
Garzón, Nuria; Poyales, Francisco; Illarramendi, Igor; Mendicute, Javier; Jáñez, Óscar; Caro, Pedro; López, Alfredo; Argüeso, Francisco
2017-12-01
To determine normative corneal densitometry values in relation to age, sex, refractive error, corneal thickness, and keratometry, measured using the Oculus Pentacam system. Three hundred and thirty-eight healthy subjects (185 men; 153 women) with no corneal disease underwent an exhaustive ocular examination. Corneal densitometry was expressed in standardized grayscale units (GSU). The mean corneal densitometry over the total area was 16.46 ± 1.85 GSU. The Pearson correlation coefficient for total densitometry was r = 0.542 (p < 0.001). Statistically significant differences were found between men and women for the total area (p = 0.006), with readings of 16.22 ± 1.54 GSU and 16.60 ± 1.83 GSU, respectively. When the cornea was divided into layers of different depths, a significant correlation was found for all layers and age: r = 0.447 (p < 0.001), r = 0.563 (p < 0.001), and r = 0.520 (p < 0.001) for the anterior, central, and posterior layers, respectively. However, when the cornea was divided into concentric annuli starting from the center of the cornea, densitometry was strongly correlated only with age in the 6-10-mm annulus (p < 0.001). Neither mean keratometry nor spherical equivalent was correlated with corneal densitometry in any zone of the cornea (p > 0.05). This is the first report of normative corneal densitometry values in relation to keratometry, corneal thickness, and spherical equivalent measured with the latest Oculus Pentacam software. Corneal densitometry increases with age, but corneal keratometry and refractive parameters do not affect light scattering in the human cornea.
Cho, Hyung-Rae; Park, Dong-Chan; Jung, Go-Woon
2018-01-01
The present study assessed the beneficial skeletal muscle-preserving effects of extracellular polysaccharides from Aureobasidium pullulans SM-2001 (Polycan) (EAP) on dexamethasone (DEXA)-induced catabolic muscle atrophy in mice. To investigate whether EAP prevented catabolic DEXA-induced muscle atrophy, and to examine its mechanisms of action, EAP (100, 200 and 400 mg/kg) was administered orally, once a day for 24 days. EAP treatment was initiated 2 weeks prior to DEXA treatment (1 mg/kg, once a day for 10 days) in mice. Body weight alterations, serum biochemistry, calf thickness, calf muscle strength, gastrocnemius muscle thickness and weight, gastrocnemius muscle antioxidant defense parameters, gastrocnemius muscle mRNA expression, histology and histomorphometry were subsequently assessed. After 24 days, DEXA control mice exhibited muscle atrophy according to all criteria indices. However, these muscle atrophy symptoms were significantly inhibited by oral treatment with all three doses of EAP. Regarding possible mechanisms of action, EAP exhibited favorable ameliorating effects on DEXA-induced catabolic muscle atrophy via antioxidant and anti-inflammatory effects; these effects were mediated by modulation of the expression of genes involved in muscle protein synthesis (AKT serine/threonine kinase 1, phosphatidylinositol 3-kinase, adenosine A1 receptor and transient receptor potential cation channel subfamily V member 4) and degradation (atrogin-1, muscle RING-finger protein-1, myostatin and sirtuin 1). Therefore, these results indicated that EAP may be helpful in improving muscle atrophies of various etiologies. EAP at 400 mg/kg exhibited favorable muscle protective effects against DEXA-induced catabolic muscle atrophy, comparable with the effects of oxymetholone (50 mg/kg), which has been used to treat various muscle disorders. PMID:29138805
Bone density and depressive disorder: a meta-analysis.
Schweiger, Julietta Ursula; Schweiger, Ulrich; Hüppe, Michael; Kahl, Kai G; Greggersen, Wiebke; Fassbinder, Eva
2016-08-01
The aim of this study was to evaluate the evidence of low bone mineral density (BMD) in depression. Low BMD is a major risk factor for osteoporotic fractures and frailty. The searched database was Pubmed, Meta-analysis included human studies in men and women fulfilling the following criteria: (1) assessment of BMD in the lumbar spine, the femur or the total hip; (2) comparison of BMD between depressed individuals and the healthy control group; (3) measurement of BMD using dual-energy X-ray absorptiometry (DEXA); and (4) data on the mean, standard deviation, or standard error of BMD. Twenty-one studies were identified, encompassing 1842 depressed and 17,401 nondepressed individuals. Significant negative composite weighted mean effect sizes were identified for the lumbar spine (d = -0.15, 95%CL -0.22 to -0.08), femur (d = -0.34, 95%CL -0.64 to -0.05), and total hip (d = -0.14, 95%CL -0.23 to -0.05) indicating low BMD in depression. Examining men and women shows low bone density in the lumbar spine and femur in women and low bone density in the hip in men. The differences between men and women with MDD and the comparison group tended to be higher when examined by expert interviewers. Low bone density was found in all age groups. Bone mineral density is reduced in patients with depressive disorders. The studies provide little evidence for potential relevant mediating factors.
Kattimani, Vivekanand S; Chakravarthi, Srinivas P; Neelima Devi, K Naga; Sridhar, Meka S; Prasad, L Krishna
2014-01-01
Bone grafts are frequently used in the treatment of bone defects. Bone harvesting can cause postoperative complications and sometimes does not provide a sufficient quantity of bone. Therefore, synthetic biomaterials have been investigated as an alternative to autogenous bone grafts. The aim of this study was to evaluate and compare bovine derived hydroxyapatite (BHA) and synthetic hydroxyapatite (SHA) graft material as bone graft substitute in maxillary cystic bony defects. Patients were analyzed by computerized densitometric study and digital radiography. In this study, 12 patients in each group were included randomly after clinical and radiological evaluation. The integration of hydroxyapatite was assessed with mean bone density, surgical site margin, and radiological bone formation characteristics, of the successful graft cases using computer densitometry and radio-visiograph. Statistical analysis was carried out using Mann-Whitney U-test, Wilcoxon matched pairs test and paired t-test. By the end of 24 th week, the grafted defects radiologically and statistically showed similar volumes of bone formation. However, the significant changes observed in the formation of bone and merging of material and surgical site margin at 1 st week to 1 st month. The results were significant and correlating with all the parameters showing the necessity of the grafting for early bone formation. However, the bone formation pattern is different in both BHA and SHA group at 3 rd month interval with significant P value. Both BHA and SHA graft materials are biocompatible for filling bone defects, showing less resorption and enhanced bone formation with similar efficacy. Our study showed maximum bone healing within 12 weeks of grafting of defects. The BHA is economical; however, price difference between the two is very nominal.
Osteoporosis screening is unjustifiably low in older African-American women.
Wilkins, Consuelo H.; Goldfeder, Jason S.
2004-01-01
BACKGROUND: More than one million Americans suffer osteoporotic fractures yearly, resulting in a marked increase in morbidity and mortality. Despite a decrease in bone mineral density with increasing age in all ethnic groups and both genders, preventative and therapeutics efforts in osteoporosis have been focused on caucasian and Asian women. This study assesses the osteoporosis screening practices and the frequency of low bone density in a primarily African-American population of older women. METHODS: Medical records of 252 women at risk for osteoporosis were reviewed for the diagnosis of osteoporosis, prior osteoporosis screening, prior breast cancer screening, and the use of calcium, vitamin D or estrogen. Subsequently, 128 women were assessed for risk factors for osteoporosis, and their bone mineral density was measured using a peripheral bone densitometer. RESULTS: Osteoporosis screening had been performed in 11.5% of the subjects. Of the women evaluated by peripheral bone densitometry, 44.5% of all women, 40.4% of African-American women, and 53.3% of caucasian women had abnormally low bone density measurements. The frequency of abnormal bone density increased with both increasing age and decreasing body mass index. CONCLUSIONS: Although few women in this population were previously screened for osteoporosis, low bone density occurred in African-American women at substantial rates. Increasing age and low body mass are important risk factors for low bone density in African-American women. Ethnicity should not be used as an exclusion criterion for screening for osteoporosis. PMID:15101666
Brinkmann, V; Radetzki, F; Gutteck, N; Delank, S; Zeh, A
2017-03-01
The aim of this study was to analyze bone remodeling around the Nanos® (Smith & Nephew) and Metha® (Aesculap AG) implants as a function of varus/valgus stem positioning. In 75 patients with diagnosed coxarthrosis, either Nanos® (n= 51) or Metha® (n= 24) prostheses were implanted. Digital assessment of plain radiographs immediately, 97 days, and 381 days after THA showed no clinically-relevant migration, angulation, or change in offset and center of rotation. The DEXA scans showed significant BMD changes in Gruen zones 1 (-12.8%), 2 (-3.3%), 6 (+6.4%), and 7(-7.8%)(t-test). The pre/postoperative CCD for the Nanos® was 129°/ 135° and for the Metha® 131°/ 127°. Linear regression analysis showed no prediction for BMD by postoperative CCD or stem type. In conclusion, there was no clinically-relevant influence on proximal femur BMD according to varus/valgus implantation of the Nanos® or Metha® prostheses.
Familial exudative vitreoretinopathy and related retinopathies
Gilmour, D F
2015-01-01
Familial exudative vitreoretinopathy (FEVR) is a rare inherited disorder of retinal angiogenesis. Cases can be autosomal dominant, autosomal recessive, or X-linked. FEVR patients have an avascular peripheral retina which, depending on the degree of ischaemia, causes the secondary complications of the disease. Expressivity may be asymmetric and is highly variable. Five genes have been identified that when mutated, cause FEVR; NDP (X-linked), FZD4 (autosomal dominant and recessive), LRP5 (autosomal dominant and recessive), TSPAN12 (autosomal dominant and recessive), and ZNF408 (autosomal dominant). Four of these genes have been shown to have a central role in Norrin/Frizzled4 signalling, suggesting a critical role for this pathway in retinal angiogenesis. In addition to the ocular features, LRP5 mutations can cause osteopenia and osteoporosis. All FEVR patients in whom molecular testing is not easily accessible should have dual energy X-ray absorptiometry (DEXA) scans to assess bone mineral density, as treatment can be initiated to reduce the risk of bone fractures. PMID:25323851
Dietary supplements and medical foods for osteopenia and osteoporosis.
Morgan, Sarah L
2013-01-01
Dietary supplements, medical foods, and pharmaceutical agents are all used in the management of metabolic bone disease. The intended populations, governing regulations, safety standards scientific requirements, physician supervision, and distribution vary markedly between supplements, medical foods, and drugs. This article will review characteristics of dietary supplements and medical foods and their use in osteoporosis care. A study that compares the pharmacokinetics of a supplement and a medical food containing similar ingredients is used to contrast the categories of dietary supplements and medical foods. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods
NASA Technical Reports Server (NTRS)
Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.
1990-01-01
Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.
Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods
NASA Technical Reports Server (NTRS)
Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.
1990-01-01
Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.
Clifton, Kari B; Conover, Cheryl A
2015-12-01
Intermittent parathyroid hormone (PTH) is a potent anabolic therapy for bone, and several studies have implicated local insulin-like growth factor (IGF) signaling in mediating this effect. The IGF system is complex and includes ligands and receptors, as well as IGF binding proteins (IGFBPs) and IGFBP proteases. Pregnancy-associated plasma protein-A (PAPP-A) is a metalloprotease expressed by osteoblasts in vitro that has been shown to enhance local IGF action through cleavage of inhibitory IGFBP-4. This study was set up to test two specific hypotheses: 1) Intermittent PTH treatment increases the expression of IGF-I, IGFBP-4 and PAPP-A in bone in vivo, thereby increasing local IGF activity. 2) In the absence of PAPP-A, local IGF activity and the anabolic effects of PTH on bone are reduced. Wild-type (WT) and PAPP-A knock-out (KO) mice were treated with 80 μg/kg human PTH 1-34 or vehicle by subcutaneous injection five days per week for six weeks. IGF-I, IGFBP-4 and PAPP-A mRNA expression in bone were significantly increased in response to PTH treatment. PTH treatment of WT mice, but not PAPP-A KO mice, significantly increased expression of an IGF-responsive gene. Bone mineral density (BMD), as measured by DEXA, was significantly decreased in femurs of PAPP-A KO compared to WT mice with PTH treatment. Volumetric BMD, as measured by pQCT, was significantly decreased in femoral midshaft (primarily cortical bone), but not metaphysis (primarily trabecular bone), of PAPP-A KO compared to WT mice with PTH treatment. These data suggest that stimulation of PAPP-A expression by intermittent PTH treatment contributes to PTH bone anabolism in mice. Copyright © 2015 Elsevier Inc. All rights reserved.
Bekić, Marijo; Davila, Slavko; Hrskanović, Mato; Bekić, Marijana; Seiwerth, Sven; Erdeljić, Viktorija; Capak, Darko; Butković, Vladimir
2008-12-01
Previous studies have shown substantial effect thermal damage can have on new bone formation following osteotomy. In this study we evaluated the extent of thermal damage which occurs in four different methods of osteotomy and the effects it can have on bone healing. We further wanted to test whether a special osteotomy plate we constructed can lead to diminished heat generation during osteotomy and enhanced bone healing. The four methods evaluated included osteotomy performed by chisel, a newly constructed osteotomy plate, Gigly and oscillating saw. Twelve adult sheep underwent osteotomy performed on both tibiae. Bone fragments were stabilized using a fixation plate. Callus size was assessed using standard radiographs. Densitometry and histological evaluation were performed at 8 weeks following osteotomy. Temperature measurements were performed both in vivo during the operation, and ex vivo on explanted tibiae. The defects healed without complications and showed typical course of secondary fracture healing with callus ingrowth into the osteotomy gap. Radiographic examination of bone healing showed a tendency towards more callus formation in bones osteotomized using Gigly and oscillating saw, but this difference lacked significance. Use of Gigly and oscillating saw elicited much higher temperatures at the bone cortex surface, which subsequently lead to slightly impaired bone healing according to histological analysis. BMD was equal among all bones. In conclusion, the time required for complete healing of the defect differed depended greatly on the instruments used. The newly constructed osteotomy plate showed best results based on histological findings of capillary and osteoblast density.
Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A
2016-02-01
Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. Copyright © 2015. Published by Elsevier Inc.
Mutiple Spontaneous Rib Fractures in Patient with Cushing's Syndrome.
Lee, Hyun Jung; Je, Ji Hye; Seo, Ji Hye; Na, Young Ju; Yoo, Hye Jin
2014-11-01
Glucocorticoid (GC) excess, including Cushing's syndrome, is a common cause of secondary osteoporosis. Thirty to fifty percent of Cushing's syndrome patients experience non-traumatic fractures, which is often the presenting manifestation of Cushing's syndrome. However, there have been rare cases of Cushing's syndrome diagnosed only based upon bone manifestations. We describe a case of Cushing's syndrome that was diagnosed in a 44-year-old woman who initially visited our hospital due to multiple non-traumatic rib fractures. She did not exhibit any other manifestations of Cushing's syndrome such as moon face, buffalo hump or abdominal striae. Initially, we evaluated her for bone metastases from a cancer of unknown origin, but there was no evidence of metastatic cancer. Instead, we found a left adrenal incidentaloma. As a result of the hormone study, she was diagnosed as having Cushing's syndrome. Interestingly, her bony manifestation of Cushing's syndrome, which was evident in the bone scan and bone mineral densitometry, completely recovered after a left adrenalectomy. Therefore, the possibility of Cushing's syndrome as a cause of secondary osteoporosis should be considered in young patients with non-traumatic multiple fractures, with or without any other typical features of Cushing's syndrome.
Rauma, Päivi H; Koivumaa-Honkanen, Heli; Williams, Lana J; Tuppurainen, Marjo T; Kröger, Heikki P; Honkanen, Risto J
2014-01-01
The purpose of this study was to determine whether and how global life satisfaction is associated with bone mineral density (BMD) and bone loss. A total of 2167 women from a cohort of Finnish women born in 1932 to 1941 were included in the cross-sectional and 1147 women in the 10-year longitudinal part of the present study. Participants responded to a postal enquiry and underwent femoral BMD densitometry in 1999 (baseline) and 2009 (follow-up). During the follow-up, their life satisfaction was repeatedly measured using a four-item scale. Self-reported data on health, life-style, and medication were used to adjust the multivariate linear regression models. Mean (standard deviation) femoral BMD decreased over the 10-year follow-up from 880 (125) to 846 (122) mg/cm. In the multivariate model, life satisfaction (p = .028) and its improvement (p = .001) predicted reduced bone loss, whereas hospitalization due to depression predicted increased bone loss (B = -0.523 annual % change, standard error = 0.212, p = .014). These effects were independent of each other. Easily assessed global life satisfaction should be taken into account when effects of aging and prevention of osteoporosis as well as health promotion in postmenopausal women are considered.
BIOCHEMICAL ANALYSIS AND BONE REMODELING IN RESPONSE TO OOPHORECTOMY AND AQUATIC TRAINING
SOUZA, HELENA RIBEIRO; GIROL, ANA PAULA; SCHIAVETO, ADRIANA PAULA SANCHEZ; GEROMEL, MAIRTO ROBERIS; IYOMASA, MELINA MIZUSAKI; ARRUDA, MAURÍCIO FERRAZ DE
2016-01-01
ABSTRACT Objective: To investigate whether swimming could prevent bone loss and could be indicated to assist in treatment of osteoporosis. Methods: Female rats were divided into 4 groups (n=6), two of them were oophorectomized. Animals from two groups, one oophorectomized and another not oophorectomized, underwent aquatic training for eight weeks. After training, the animals were sacrificed and their blood was collected for calcium and alkaline phosphatase serum dosage; the femur was removed and subjected to radiological and histological densitometry analysis to assess bone loss and osteoclast counting on femoral head and neck. Results: Increase in serum calcium was not observed. There was an increasing activity of alkaline phosphatase in the oophorectomized groups. The radiographs suggest that there was a greater bone mass density in the trained groups. Concerning histology, the trained groups had better tissue structural organization than the sedentary groups. In the oophorectomized and sedentary group, higher presence of osteoclasts was observed a. Conclusion: Exercise and oophorectomy did not promote changes in serum calcium levels. The decrease of sex steroids caused by oophorectomy was responsible for severe bone loss, but swimming exercise was able to reduce this loss. Oophorectomy promoted the proliferation of osteoclasts and the exercise proved to be able to diminish it. Level of Evidence I, Experimental Study. PMID:28149187
Broy, Susan B; Tanner, S Bobo
2011-01-01
Rheumatoid arthritis is the only secondary cause of osteoporosis that is considered independent of bone density in the FRAX(®) algorithm. Although input for rheumatoid arthritis in FRAX(®) is a dichotomous variable, intuitively, one would expect that more severe or active disease would be associated with a greater risk for fracture. We reviewed the literature to determine if specific disease parameters or medication use could be used to better characterize fracture risk in individuals with rheumatoid arthritis. Although many studies document a correlation between various parameters of disease activity or severity and decreased bone density, fewer have associated these variables with fracture risk. We reviewed these studies in detail and concluded that disability measures such as HAQ (Health Assessment Questionnaire) and functional class do correlate with clinical fractures but not morphometric vertebral fractures. One large study found a strong correlation with duration of disease and fracture risk but additional studies are needed to confirm this. There was little evidence to correlate other measures of disease such as DAS (disease activity score), VAS (visual analogue scale), acute phase reactants, use of non-glucocorticoid medications and increased fracture risk. We concluded that FRAX(®) calculations may underestimate fracture probability in patients with impaired functional status from rheumatoid arthritis but that this could not be quantified at this time. At this time, other disease measures cannot be used for fracture prediction. However only a few, mostly small studies addressed other disease parameters and further research is needed. Additional questions for future research are suggested. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Effect of Positioning of the ROI on BMD of the Forearm and Its Subregions.
Rosen, Elizabeth O; McNamara, Elizabeth A; Whittaker, LaTarsha G; Malabanan, Alan O; Rosen, Harold N
2018-03-21
Inconsistent positioning of patients and region of interest (ROI) is known to influence the precision of bone mineral density (BMD) measurements in the spine and hip. However, it is unknown whether minor shifts in the positioning of the ROI along the shaft of the radius affect the measurement of forearm BMD and its subregions. The ultradistal (UD-), mid-, one-third, and total radius BMDs of 50 consecutive clinical densitometry patients were acquired. At baseline the distal end of the ROI was placed at the tip of the ulnar styloid as usual, and then the forearm was reanalyzed 10 more times, each time shifting the ROI 1 mm proximally. No corrections for multiple comparisons were necessary since the differences that were significant were significant at p < 0.001. The UD-radius BMD increased as the ROI was shifted proximally; the increase was significant when shifted even 1 mm proximally (p < 0.001). These same findings held true for the mid- and total radius bone density, though the percent increase with moving proximally was significantly greater for the UD radius than for the other subregions. However, there was no significant change in the one-third radius BMD when shifted proximally 1-10 mm. Minor proximal shifts of the forearm ROI substantially affect the BMD of the UD-, mid- and total radius, while having no effect on the one-third radius BMD. Since the one-third radius is the only forearm region usually reported, minor proximal shifts of the ROI should not influence forearm BMD results significantly. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Goossens, Liesbet; Vanderoost, Jef; Jaecques, Siegfried; Boonen, Steven; D'hooge, Jan; Lauriks, Walter; Van der Perre, Georges
2008-01-01
For the clinical assessment of osteoporosis (i.e., a degenerative bone disease associated with increased fracture risk), ultrasound has been proposed as an alternative or supplement to the dual-energy X-ray absorptiometry (DEXA) technique. However, the interaction of ultrasound waves with (trabecular) bone remains relatively poorly understood. The present study aimed to improve this understanding by simulating ultrasound wave propagation in 15 trabecular bone samples from the human lumbar spine, using microcomputed tomography-based finite-element modeling. The model included only the solid bone, without the bone marrow. Two structural parameters were calculated: the bone volume fraction (BV/TV) and the structural (apparent) elastic modulus (E(s)), and the ultrasound propagation parameter speed of sound (SOS). Relations between BV/TV and E(s) were similar to published experimental relations. At 1 MHz, correlations between SOS and the structural parameters BV/TV and Es were rather weak, but the results can be explained from the specific features of the trabecular structure and the intrinsic material elastic modulus E(i). In particular, the systematic differences between the three main directions provide information on the trabecular structure. In addition, at 1 MHz the correlation found between the simulated SOS values and those calculated from the simple bar equation was poor when the three directions are considered separately. Hence, under these conditions, the homogenization approach-including the bar equation-is not valid. However, at lower frequencies (50-300 kHz) this correlation significantly improved. It is concluded that detailed analysis of ultrasound wave propagation through the solid structure in various directions and with various frequencies, can yield much information on the structural and mechanical properties of trabecular bone.
Partial hypopituitarism and Langerhans cell histiocytosis
Balaguruswamy, S; Chattington, P D
2011-01-01
A case of multisystem Langerhans cell histiocytosis with pituitary involvement nearly 20 years after initial presentation. A 48-year-old man had histiocytosis X 22 years ago initially involving the groin; subsequently his external auditory meatus, scalp, gum, mandibular bone, perineum and axilla were involved and treated. The pituitary gland was involved 4 years ago. A thyrotropin-releasing hormone test showed delayed response suggestive of hypothalamic disease. Prolactin levels were normal. A gonadotropin-releasing hormone test showed impaired testosterone and gonadotrophin response in keeping with pituitary disease. A glucagon stimulation test showed an impaired growth hormone response but a normal cortisol increase. MRI pituitary showed an empty sella. There was no evidence of diabetes insipidus. Bone mineral densitometry was normal. He has partial hypopituitarism needing thyroxine and testosterone replacement. He also developed type 2 diabetes mellitus 9 years ago. He is closely monitored for any development of diabetes insipidus and the need for growth hormone supplementation. PMID:22715201
Scheibel, Paula Cabrini; Ramos, Adilson Luiz; Iwaki, Lilian Cristina Vessoni; Micheletti, Kelly Regina
2014-01-01
OBJECTIVE: The aim of the present study was to investigate the correlation between initial alveolar bone density of upper central incisors (ABD-UI) and external apical root resorption (EARR) after 12 months of orthodontic movement in cases without extraction. METHODS: A total of 47 orthodontic patients 11 years old or older were submitted to periapical radiography of upper incisors prior to treatment (T1) and after 12 months of treatment (T2). ABD-UI and EARR were measured by means of densitometry. RESULTS: No statistically significant correlation was found between initial ABD-UI and EARR at T2 (r = 0.149; p = 0.157). CONCLUSION: Based on the present findings, alveolar density assessed through periapical radiography is not predictive of root resorption after 12 months of orthodontic treatment in cases without extraction. PMID:25715722
Pregnancy associated osteoporosis--a case report.
Dytfeld, Joanna; Horst-Sikorska, Wanda
2012-05-01
Loss of bone mineral density (BMD)--usually temporary--occurs during pregnancy and lactation. Pregnancy associated osteoporosis (PAO) is an uncommon disease of unknown etiology. We present a case of a 35-year old woman with PAO, manifesting initially at the end of the first pregnancy as back pain. It reappeared in the second pregnancy four years later X-ray revealed multilevel compression fractures of Th12, L1, L2. DEXA showed L2-L4 T-score: -3.3 SD, hip T-score: -2.09 SD. Laboratory findings were irrelevant. She was put on antiresorptive treatment, calcium and vitamin D. Although there has been an improvement in BMD, the patient is a definite candidate for vertebral kyphoplasty due to disabling pain.
Purposing Division Strategy for Pharmaceutical Producer Dexa Medica in the Demanding Market
ERIC Educational Resources Information Center
Setiawati, Cut Irna; Wahyono, Agatha Christy
2017-01-01
This research aims to purpose the division strategy for a pharmaceutical producer in Kalimantan area, named Dexa Medica Samarinda. Currently, this firm is facing a competitive market condition and evolving a decline position in the market. This research uses qualitative research method by organising intensive interview to important informants so…
Santos, Raquel S; Silva, Pedro L; Oliveira, Gisele P; Cruz, Fernanda F; Ornellas, Débora S; Morales, Marcelo M; Fernandes, Janaina; Lanzetti, Manuella; Valença, Samuel S; Pelosi, Paolo; Gattass, Cerli R; Rocco, Patricia R M
2011-12-15
We analysed the effects of oleanolic acid (OA) on lung mechanics and histology and its possible mechanisms of action in experimental acute lung injury (ALI). BALB/c mice were randomly divided into Control (saline, ip) and ALI (paraquat, 25 mg/kg, ip) groups. At 1 h, both groups were treated with saline (SAL, 50 μl ip), OA (10 mg/kg ip), or dexamethasone (DEXA, 1 mg/kg ip). At 24 h, lung static elastance, viscoelastic pressure, and alveolar collapse reduced more after OA compared to DEXA administration. Tumour necrosis factor-α, macrophage migration inhibitory factor, interleukin-6, interferon-γ, and transforming growth factor-β mRNA expressions in lung tissue diminished similarly after OA or DEXA. Conversely, only OA avoided reactive oxygen species generation and yielded a significant decrease in nitrite concentration. OA and DEXA restored the reduced glutathione/oxidized glutathione ratio and catalase activity while increasing glutathione peroxidase induced by paraquat. In conclusion, OA improved lung morphofunction by modulating the release of inflammatory mediators and oxidative stress. Copyright © 2011 Elsevier B.V. All rights reserved.
Dhakad, Raghvendra Singh; Tekade, Rakesh Kumar; Jain, Narendra Kumar
2013-08-01
The objective of this investigation was aimed to explore the cancer targeting potential of folate conjugated dendrimer (polypropylene imine, PPI) under strategic influence of folate receptor up-regulators (all trans Retinoic acid, ATRA and Dexamethasone, DEXA). The folate conjugated dendrimer nanoconjugate (FPPI) was synthesized and characterized by FTIR, and (1)H-NMR spectroscopy. The cell line studies investigations were performed on MCF-7 cells. ATRA and DEXA caused 2.17 and 1.65 folds selective up-regulation of folate receptor respectively, when compared with untreated control, after 48 h of pretreatment. ATRA caused 50.47±2.11% more up regulation of folate receptor, than DEXA treated cell. Both up regulators showed a lag phase of 12 h in up-regulating the folate receptors. After 48 h, the IC50 values of naked docetaxel (DTX) and DTX loaded dendrimer (PPI-DTX) were found to be 678.93±11.99 nM and 663.51±15.23 nM, respectively, while DTX loaded folate-anchored dendrimer (FPPI-DTX) showed a selectively lowered IC50 value of 468.56±20.86 nM. FPPI-DTX further showed a significant reduction in IC50 value in ATRA and DEXA pretreated cells, wherein IC50 values of 184.21 nM and 290.40±14.05 nM, respectively were observed. The study also concludes ATRA to be a superior receptor up-regulator as well as promoter of folate based targeting compared to DEXA.
Pellé, Gaëlle; Branche, Isabelle; Kossari, Niloufar; Tricot, Leila; Delahousse, Michel; Dreyfus, Jean-François
2013-09-01
Metabolic disorders, in particular weight gain, increase cardiovascular mortality risk and can cause serious problems after renal transplantation. Weight and body mass index are imprecise indicators of nutritional status. Accurate determination of the body composition of renal transplant patients is essential; therefore, a simple tool that allows appropriate patient monitoring is crucial. A new device, the Body Composition Monitor (BCM, Fresenius Medical Care, Bad Homburg, Germany), expresses body weight in terms of adipose tissue, lean tissue mass, and excess fluid. We compared the performance of this 3-compartment model with dual-energy X-ray absorptiometry (DEXA) as a reference method in determining body composition in a renal transplant population. Thirty-three clinically stable renal transplant patients were studied. Bland-Altman plots and Passing-Bablok regression were used to compare methods. Mean lean mass was 51.8 ± 12.3 kg with DEXA and 39.0 ± 9.9 kg with BCM. Despite the Passing-Bablok regression failing to find significant differences, the predictive value of BCM for DEXA was poor. Mean fat mass was 19.4 ± 9.7 kg with DEXA and 30.0 ± 16.0 kg with BCM. The slope of the regression line of BCM over DEXA significantly differed from 1. We conclude that, in this population, these methods cannot be substituted for one another. Copyright © 2013 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Body Fat Composition: A Predictive Factor for Sleep Related Breathing Disorder in Obese Children.
Bhatia, Rajeev; Lesser, Daniel J; Oliveira, Flavia G S A; Tran, Winston H; Keens, Thomas G; Khoo, Michael C K; Davidson Ward, Sally L
2015-09-15
The association between body fat composition as measured by dual energy x-ray absorptiometry (DEXA) scanning and pediatric sleep related breathing disorder (SRBD) is not well established. We investigated the relationship between body mass index (BMI) and DEXA parameters and their association with SRBD in obese children. Overnight polysomnography was performed on obese/overweight children (10-17 years) with habitual snoring. Total body fat mass (g), trunk fat mass (g), total body % fat, and trunk % fat were determined by DEXA. Forty-one subjects were studied. Logarithm (Log) total arousal index correlated with BMI (p < 0.01, r = 0.473), total body fat mass (p < 0.05, r = 0.331), and trunk fat mass (p < 0.05, r = 0.319). Log desaturation index correlated with BMI (p < 0.05, r = 0.313), total body fat mass (p < 0.05, r = 0.375), and trunk fat mass (p < 0.05, r = 0.391), whereas obstructive apnea hypopnea index (OAHI) did not. In males 10-12 years, there was a significant correlation between Log total arousal index and obesity parameters, but not for males aged 13-17 years. BMI correlated with DEXA parameters in all subjects: total body fat mass (p < 0.001, r = 0.850); total body % fat (p < 0.01, r = 0.425); trunk fat mass (p < 0.001, r = 0.792) and trunk % fat (p < 0.05, r = 0.318) and in 10-12 year old males. This relationship was not significant in males aged 13-17 years. Total body fat mass and trunk fat mass as well as BMI correlated with total arousal index and desaturation index. BMI correlated with DEXA parameters in 10-12 year old males but not in 13-17 year old males. The value of using DEXA scanning to study the relationship between obesity and SRBD may depend on age and pubertal stage. © 2015 American Academy of Sleep Medicine.
A case of pathological rib fractures: focal osteolysis or osteoporosis?
Vrbanić, T S L; Novak, S; Sestan, B; Tudor, A; Gulan, G
2008-03-01
This paper reports on a unique, previously unreported, successful outcome in the case of a patient with focal osteolytic lesions of the ribs as a first sign of osteoporosis. The lesions were detected by chance after acute cough-induced rib fractures were seen on plain chest radiographs. The diagnosis had to be approached as a diagnosis of exclusion since known causes of the osteolytic process had to be eliminated. The authors describe multiple focal osteolytic lesions with rib fractures appearing in a pattern that could be confused with metastases. Laboratory results were normal. Final diagnosis was based on plain radiography, bone scan and bone densitometry. Pharmacomedical treatments for osteoporosis were applied. The patient was observed between the year 2000 and 2005. Five years later radiological and bone scintigraphy revealed resolution of the lesion. We conclude that osteoporosis should be included in the differential diagnosis of asymptomatic focal osteolysis of the ribs with rib fractures as a complication of acute cough. The case suggests that focal osteolytic lesions of the ribs may regress over time and become scintigraphically inactive.
Doping dose of salbutamol and exercise training: impact on the skeleton of ovariectomized rats.
Bonnet, N; Laroche, N; Beaupied, H; Vico, L; Dolleans, E; Benhamou, C L; Courteix, D
2007-08-01
Previous studies in healthy rats have demonstrated a deleterious bone impact of beta-agonist treatment. The purpose of this study was to examine the trabecular and cortical effects of beta(2)-agonists at doping dose on treadmill exercising rats with estrogen deficiency. Adult female rats were ovariectomized (OVX; n = 44) or sham operated (n = 12). Then, OVX rats received a subcutaneous injection of salbutamol (SAB) or vehicle with (EXE) or without treadmill exercise for 10 wk. Bone mineral density (BMD) was analyzed by densitometry. Microcomputed tomography and histomorphometric analysis were performed to study trabecular bone structure and bone cell activities. After 10 wk, SAB rats presented a much more marked decrease of BMD and trabecular parameters. Exercise did not change the high level of bone resorption in OVX EXE SAB compared with OVX SAB group (both on COOH-terminal collagen cross-links and osteoclast number). These results confirm the deleterious effect of beta(2)-agonists on bone quantity (femoral BMD gain: OVX EXE, +6.8%, vs. OVX EXE SAB, -1.8%; P < 0.01) and quality (-8.0% of femoral trabecular thickness in OVX EXE SAB vs. OVX EXE), indicating that SAB suppresses the effect of EXE in OVX rats. Furthermore, we notice that the slight beneficial effect of exercise was mainly localized in the tibia. These findings indicate the presence of a bone alteration threshold below which there is no more alteration in structural bone quantity and quality. The negative effects of SAB on bone observed in this study in trained rats may indicate potential complications in doping female athletes with exercise-induced amenorrhea.
A high-fat diet can affect bone healing in growing rats.
Yamanaka, Jéssica Suzuki; Yanagihara, Gabriela Rezende; Carlos, Bruna Leonel; Ramos, Júnia; Brancaleon, Brígida Batista; Macedo, Ana Paula; Issa, João Paulo Mardegan; Shimano, Antônio Carlos
2018-05-01
A high-fat diet (HFD) can have a negative effect on bone quality in young and old people. Although bone healing in children is normally efficient, there is no evidence that children who have a diet rich in fat have compromised bone fracture regeneration compared with children with recommended dietary fat levels. The purpose of the present study was to evaluate the effects of an HFD on bone healing in growing female rats. Twenty-six postweaning female Wistar rats were divided into two groups (13 animals per group): a standard diet (SD) group and an HFD (with 60% of energy from fat) group. The rats received the assigned diets for 5 weeks, and in the third week they were submitted to an osteotomy procedure of the left tibia. Body mass and feed intake were recorded during the experiment. One day before euthanasia, an insulin tolerance test was performed. After euthanasia, the tibiae were removed and analyzed by densitometry, mechanical testing, histomorphometry, stereology and immunohistochemistry. An HFD caused an adaptive response to maintain energetic balance by decreasing feed intake and causing insulin insensitivity. There was no change in bone mineral density, collagen amount and immunostaining for bone formation, but maximal load and stiffness were decreased in the HFD group. In addition, bone volume had a tendency to be higher in the SD group than in the HFD group. Compared with rats receiving an SD, growing rats receiving an HFD for 5 weeks had similar bone mineral density but altered mechanical properties at the osteotomy defect site.
Sands, Dorota; Mielus, Monika; Umławska, Wioleta; Lipowicz, Anna; Oralewska, Beata; Walkowiak, Jarosław
2015-09-01
The aim of the study was to evaluate factors related to bone formation and resorption in Polish children and adolescents with cystic fibrosis and to examine the effect of nutritional status, biochemical parameters and clinical status on bone mineral density. The study group consisted of 100 children and adolescents with cystic fibrosis with a mean age 13.4 years old. Anthropometric measurements, included body height, body mass and body mass index (BMI); bone mineral densitometry and biochemical testing were performed. Bone mineral density was measured using a dual-energy X-ray absorption densitometer. Biochemical tests included serum calcium, phosphorus, parathyroid hormone and vitamin D concentrations, as well as 24-h urine calcium and phosphorus excretion. Pulmonary function was evaluated using FEV1%, and clinical status was estimated using the Shwachman-Kulczycki score. Standardized body height, body mass and BMI were significantly lower than in the reference population. Mean serum vitamin D concentration was decreased. Pulmonary disease was generally mild, with a mean FEV1% of 81%. Multivariate linear regression revealed that the only factors that had a significant effect on bone marrow density were BMI and FEV1%. There were no significant correlations between bone mineral density and the results of any of the biochemical tests performed. Nutritional status and bone mineral density were significantly decreased in children and adolescents with cystic fibrosis. In spite of abnormalities in biochemical testing, the factors that were found to have the strongest effect on bone mineral density were standardized BMI and clinical status. Copyright © 2015. Published by Elsevier Urban & Partner Sp. z o.o.
Shedd-Wise, Kristine M; Alekel, D Lee; Hofmann, Heike; Hanson, Kathy B; Schiferl, Dan J; Hanson, Laura N; Van Loan, Marta D
2011-01-01
Soy isoflavones exert inconsistent bone density-preserving effects, but the bone strength-preserving effects in humans are unknown. Our double-blind randomized controlled trial examined 2 soy isoflavone doses (80 or 120mg/d) vs placebo tablets on volumetric bone mineral density (vBMD) and strength (by means of peripheral quantitative computed tomography) in healthy postmenopausal women (46-63yr). We measured 3-yr changes in cortical BMD (CtBMD), cortical thickness (CtThk), periosteal circumference (PC), endosteal circumference (EC), and strength-strain index (SSI) at 1/3 midshaft femur (N=171), and trabecular BMD (TbBMD), PC, and SSI at 4% distal tibia (N=162). We found no treatment effect on femur CtThk, PC, or EC, or tibia TbBMD or PC. The strongest predictors (negative) of tibia TbBMD and SSI and femur CtBMD were timepoint and bone resorption; whole-body fat mass was protective of SSI. As time since last menstrual period (TLMP) increased (p=0.012), 120-mg/d dose was protective of CtBMD. The strongest predictors of femur SSI were timepoint, bone resorption, and TLMP (protective). Isoflavone tablets were negative predictors of SSI, but 80-mg/d dose became protective as bone turnover increased (p=0.011). Soy isoflavone treatment for 3yr was modestly beneficial for midshaft femur vBMD as TLMP increased and for midshaft femur SSI as bone turnover increased. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Effect of modified alkaline supplementation on bone metabolic turnover in rats.
Chui, D H; Marotta, F; Liu, T; Minelli, E; Yadav, H; Signorelli, P; Lorenzetti, A; Jain, S
2008-01-01
This study aims to determine the effects of a high protein diet and alkaline supplementation on bone metabolic turnover in rats. Eight-week-old male Sprague-Dawley rats were investigated by bone status, including bone mineral density (BMD) and biomechanical markers from blood and urine. Thirty rats were randomly divided into three groups and treated for 8 weeks as follows: baseline control group (n. 10, C), high-protein supplemented diet group (n. 10, chronic acidosis, CA group) and supplemented chronic acidosis (n.10, SCA). Diet-treated rats were fed an acidic high-protein diet and the supplementation consisted in a modified alkaline formula (Basenpulver, NaMed, Italy). At the end of the experimental period, the rats were sacrificed, blood samples were drawn and femur and tibia were removed for analysis of bone mineral density (BMD) by dual energy X-ray absorptiometry (DEXA). In the CA group, 24-hour urinary calcium (Ca) and phosphorus (P) excretion were increased 2.1-fold (p<0.05 vs normal diet controls) as well as kidney weight. However, serum Ca and P concentration, as well as urinary Dpd excretion were not significantly changed. Femural and tibial BMD was significantly decreased in the CA group (p<0.05), but alkaline supplementation prevented such phenomenon (p<0.05 vs CA). These results suggest that blood Ca and P concentrations in chronic acidosis condition during the 12-week supplementation might be maintained by hypercalciuria and hyperphosphaturia at the expenses of bone structure. However, modified alkaline supplementation is able to prevent such derangements.
Kunt, Halil; Şentürk, İhsan; Gönül, Yücel; Korkmaz, Mehmet; Ahsen, Ahmet; Hazman, Ömer; Bal, Ahmet; Genç, Abdurrahman; Songur, Ahmet
2016-01-01
Background In the literature, some articles report that the incidence of numerous diseases increases among the individuals who live around high-voltage electric transmission lines (HVETL) or are exposed vocationally. However, it was not investigated whether HVETL affect bone metabolism, oxidative stress, and the prevalence of thyroid nodule. Methods Dual-energy X-ray absorptiometry (DEXA) bone density measurements, serum free triiodothyronine (FT3), free thyroxine (FT4), RANK, RANKL, osteoprotegerin (OPG), alkaline phosphatase (ALP), phosphor, total antioxidant status (TAS), total oxidant status (TOS), and oxidative stress index (OSI) levels were analyzed to investigate this effect. Results Bone mineral density levels of L1–L4 vertebrae and femur were observed significantly lower in the electrical workers. ALP, phosphor, RANK, RANKL, TOS, OSI, and anteroposterior diameter of the left thyroid lobe levels were significantly higher, and OPG, TAS, and FT4 levels were detected significantly lower in the study group when compared with the control group. Conclusion Consequently, it was observed that the balance between construction and destruction in the bone metabolism of the electrical workers who were employed in HVETL replaced toward destruction and led to a decrease in OPG levels and an increase in RANK and RANKL levels. In line with the previous studies, long-term exposure to an electromagnetic field causes disorders in many organs and systems. Thus, it is considered that long-term exposure to an electromagnetic field affects bone and thyroid metabolism and also increases OSI by increasing the TOS and decreasing the antioxidant status. PMID:26929645
Factors affecting bone mineral density in postmenopausal women.
Heidari, Behzad; Hosseini, Reza; Javadian, Yahya; Bijani, Ali; Sateri, Mohammad Hassan; Nouroddini, Haj Ghorban
2015-01-01
This study aimed to determine the relationship between bone mineral density (BMD) and demographic, biochemical, and clinical features according to BMD measurement sites. The results indicated that BMD correlates negatively with menopause duration, parity, and history of fractures but positively correlates with obesity, physical activity, education, and serum ferritin. Osteoporosis (OP) is an important cause of morbidity and mortality in the elderly people. The impacts of various factors on bone mineral density (BMD) differ across diverse population. We hypothesized that the influences of factors which affect BMD vary according to BMD measurement sites. The aim of this study was to determine the relationship between BMD in the femoral neck (FN) and lumbar spine (LS) with some common clinical, demographic, and biochemical parameters in postmenopausal women. In this cross-sectional case-control study, all postmenopausal women of the Amirkola Health and Ageing Project (AHAP) who performed bone densitometry were included. BMD at FN and LS was measured by DXA method. Data regarding clinical, demographic, and biochemical characteristics were provided. OP was diagnosed by the International Society for Clinical Densitometry criteria. Pearson correlation and multivariate regression analyses with simultaneous adjustment were performed to determine relationship. Five hundred thirty-seven women with mean age of 67.9 ± 6.7 years and mean menopause duration (MD) of 15.8 ± 5.1 years were studied. MD correlated negatively with FN-BMD and LS-BMD g/cm(2) (r = -0.405, p = 0.001 and r = -0.217, p = 0.001). Body mass index (BMI) correlated positively with FN and LS-BMD g/cm(2) (r = 0.397, p = 0.001 and r = 0.311, p = 0.001). The association of MD with risk of FN-OP was stronger than LS-OP. Obesity and metabolic syndrome (MS) and higher serum ferritin reduced the risk of OP at both LS and FN similarly, whereas the impacts of parity, prior fracture, high level of education, and physical activity were significantly different across BMD measurement sites. The results of this study indicated a significant association between OP and MD, obesity, parity, MS, history of fracture, serum ferritin, level of education, and physical activity. However, the direction and the strength of association varied across BMD measurement sites.
Bone mineral density in relation to body mass index among young women: a prospective cohort study.
Elgán, Carina; Fridlund, Bengt
2006-08-01
To identify important predictors among lifestyle behaviours and physiological factors of bone mineral density (BMD) in relation to body mass index (BMI) among young women over a 2-year period. DESIGN, SAMPLE AND MEASUREMENTS: Data were collected in 1999 and 2001. Healthy young women (n=152) completed a questionnaire. BMD measurements were performed by DEXA in the calcaneus. The women were subdivided into three categories according to baseline BMI. Baseline bodyweight explained 25% of the variability in BMD at follow-up in the BMI<19 category, and high physical activity seemed to hinder BMD development. In the BMI>24 category, a difference in time spent outdoors during winter between baseline and follow-up was the single most important factor for BMD levels. Overweight women with periods of amenorrhoea had lower BMD than overweight women without such periods. Predictors and lifestyle behaviours associated with BMD are likely to be based on women of normal weight. BMI should be considered when advising on physical activity, since high physical activity seems to impair BMD development among underweight young women, possibly due to energy imbalance. Among overweight women, sleep satisfaction is the greatest predictor associated with BMD change and may indicate better bone formation conditions. Energy balance and sleep quality may be prerequisites of bone health and should be considered in prevention.
Bone mass in physicians: a Howard University Hospital pilot study.
Reyes, May O; Archer, Juanita A; Nunlee-Bland, Gail; Daniel, Gilbert; Morgan, Odette A; Makambi, Kepher
2004-03-01
This observational cross-sectional study was done to determine bone mass in physicians and to determine if variables, such as calcium intake and exercise, were related to their bone mass. One-hundred physicians of different ethnicities (African, African American, Asian, Caribbean, and Hispanic) were studied. Using dual-energy x-ray absorptiometry (DEXA), bone mass (BMD) of the lumbar spine and hips was measured. A validated questionnaire was used to determine the daily calcium intake and exercise. Student t-test, logistic regression, and Pearson chi-square were used to analyze the data. The study population consisted of 52% men and 48% women, with a mean age of 42 years old and a body mass index of 18.5 to 39.9 kg/m2. Low BMD occurred in 68% of the physicians (osteoporosis in 12%, osteopenia in 56%). Low calcium intake was found in 71%-14% of whom had osteoporosis and 49% osteopenia. Two-thirds of the physicians had inadequate exercise; 57% of this group had decreased BMD (osteoporosis in 9%, osteopenia in 38%). There was no statistical significance between BMD and calcium intake or exercise. A high percentage of the physicians in this unique study had a reduced BMD. Most of the physicians with low BMD were less than 45 years of age. This study indicates the need to define BMD in a larger cohort of young, ethnically diverse clinicians, and other health workers.
Sahin, Gunsah; Guler, Hayal; Sezgin, Melek; Incel, Nurgul Arinci; Polat, Gurbuz
2006-07-01
The aim is to investigate the differences in the circulating nitric oxide (NO) levels of rheumatoid arthritis (RA) patients, healthy controls and osteoporotic (OP) patients. We also examined whether the circulating NO levels may be correlated with bone mineral density (BMD) in RA patients. Forty-five patients with RA, 30 healthy women and 30 osteoporotic patients were recruited from the outpatient clinic. All the subjects were female and postmenopausal. Serum NO levels were measured (Nitrite/Nitrate, calorimetric method 1746081, Roche diagnostics, Mannheim, Germany) and BMD was measured at the spine and hip using dual energy X-Ray absorbtiometry (DEXA, Norland XR-46). Height and weight were measured and body mass index was calculated. Circulating NO levels were significantly higher in RA patients than other groups. Moreover, the RA group showed significantly higher BMD at lumbar spine and femoral neck regions compared to osteoporotic patients. However, the RA group showed significantly lower BMD at all sites than the controls. There was no correlation between circulating NO levels and BMD in all groups. We suggest that, unlike postmenopausal osteoporosis, inflammation induced osteoporosis is associated with RA is characterised by relatively preserved bone mass at the axial bone regions, and circulating NO levels as a parameter or determinant of inflammation are not correlated with axial BMD in RA patients.
Kardos, Zsófia; Oláh, Csaba; Sepsi, Mariann; Sas, Attila; Kostyál, László; Bóta, Tünde; Bhattoa, Harjit Pal; Hodosi, Katalin; Kerekes, György; Tamási, László; Bereczki, Dániel; Szekanecz, Zoltán
2018-05-01
Assessment of intracranial vessels includes transcranial Doppler (TCD). TCD performance requires intact temporal acoustic windows (TAW). Failure of TAW (TAWF) is present in 8-20% of people. There have been no reports on TAWF in rheumatoid arthritis (RA). Altogether, 62 female RA patients were included. Among them, 20 were MTX-treated and biologic-free, 20 received infliximab, and 22 tocilizumab. The controls included 60 non-RA women. TAWF, temporal bone thickness, and texture were determined by ultrasound and CT. BMD and T-scores of multiple bones were determined by DEXA. Several bone biomarkers were assessed by ELISA. In RA, 54.8% of the patients had TAWF on at least one side. Neither TAW could be identified in 34% of RA subjects. In contrast, only 20.0% of control subjects had TAWF on either or both sides (p < 0.001). In RA vs controls, 53.0 vs 2.9% of subjects exerted the trilayer, "sandwich-like" structure of TAW (p < 0.001). Finally, in RA vs controls, the mean temporal bone thickness values of the right TAW were 3.58 ± 1.43 vs 2.92 ± 1.22 mm (p = NS), while those of the left TAW were 4.16 ± 1.56 vs 2.90 ± 1.16 mm (p = 0.001). There was close association between TAWF, bone thickness, and texture (p < 0.05). These TAW parameters all correlated with age; however, TAW failure and texture also correlated with serum osteoprotegerin. TAW bone thickness inversely correlated with hip BMD (p < 0.05). TAWF, thicker, and heterogeneous temporal bones were associated with RA. These features have been associated with bone loss and OPG production. Bone loss seen in RA may result in OPG release and stimulation of bone formation around TAW.
NASA Astrophysics Data System (ADS)
Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.
2015-03-01
Purpose: Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods: Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results: For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion: Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.
Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.
2015-01-01
Purpose Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 – 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI. PMID:26045631
Zbijewski, W; Sisniega, A; Stayman, J W; Thawait, G; Packard, N; Yorkston, J; Demehri, S; Fritz, J; Siewerdsen, J H
2015-02-21
Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.
Growth, body composition, and bone density following pediatric liver transplantation.
Sheikh, Amin; Cundy, Tim; Evans, Helen Maria
2018-04-24
Patients transplanted for cholestatic liver disease are often significantly fat-soluble vitamin deficient and malnourished pretransplant, with significant corticosteroid exposure post-transplant, with increasing evidence of obesity and metabolic syndrome post-LT. Our study aimed to assess growth, body composition, and BMD in patients post-pediatric LT. Body composition and bone densitometry scans were performed on 21 patients. Pre- and post-transplant anthropometric data were analyzed. Bone health was assessed using serum ALP, calcium, phosphate, and procollagen-1-N-peptide levels. Median ages at transplant and at this assessment were 2.7 and 10.6 years, respectively. Physiological markers of bone health, median z-scores for total body, and lumbar spine aBMD were normal. Bone area was normal for height and BMAD at L3 was normal for age, indicating, respectively, normal cortical and trabecular bone accrual. Median z-scores for weight, height, and BMI were 0.6, -0.9, 1.8 and 0.6, 0.1, 0.8 pre- and post-transplant, respectively. Total body fat percentages measured on 21 body composition scans revealed 2 underweight, 7 normal, 6 overweight, and 6 obese. Bone mass is preserved following pediatric LT with good catch-up height. About 52% of patients were either overweight/obese post-transplant, potentially placing them at an increased risk of metabolic syndrome and its sequelae in later life. BMI alone is a poor indicator of nutritional status post-transplant. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Barou, O; Lafage-Proust, M H; Martel, C; Thomas, T; Tirode, F; Laroche, N; Barbier, A; Alexandre, C; Vico, L
1999-10-01
The effects of antiresorptive drugs on bone loss remain unclear. Using three-dimensional microtomography, dual X-ray/densitometry, and histomorphometry, we evaluated tiludronate effects in the bone loss model of immobilization in tail-suspended rats after 7, 13, and 23 days. Seventy-eight 12-week-old Wistar male rats were assigned to 13 groups: 1 baseline group, and for each time point, 1 control group treated with vehicle and three tail-suspended groups treated with either tiludronate (0.5 or 5 mg/kg) or vehicle, administered s. c. every other day, during the last week before sacrifice. In primary spongiosa (ISP), immobilization-induced bone loss plateaued after day 7 and was prevented by tiludronate. In secondary spongiosa (IISP), bone loss appeared at day 13 with a decrease in trabecular thickness and trabecular number (Tb.N) as assessed by three-dimensional microtomography. Osteoclastic parameters did not differ in tail-suspended rats versus control rats, whereas bone formation showed a biphasic pattern: after a marked decrease at day 7, osteoblastic activity and recruitment normalized at days 13 and 23, respectively. At day 23, the 80% decrease in bone mass was fully prevented by high-dose tiludronate with an increase in Tb.N without preventing trabecular thinning. In summary, at day 7, tiludronate prevented bone loss in ISP. After day 13, tiludronate prevented bone loss in ISP and IISP despite a further decrease in bone formation. Thus, the preventive effects of tiludronate in this model may be related to the alteration in bone modeling with an increase in Tb.N in ISP and subsequently in IISP.
Bone and vitamin D metabolism in HIV.
Panayiotopoulos, Aristotle; Bhat, Nandini; Bhangoo, Amrit
2013-06-01
Human immunodeficiency virus (HIV) infection has progressed to a chronic disease and HIV positive individuals are living longer lives. This has lead to an increase in morbidity and mortality due to secondary issues, one being HIV bone disease. HIV infected pediatric and adult populations have a greater incidence in reduction of BMD as compared to the controls. Osteoporosis has been reported to be present in up to 15 % of HIV positive patients. We are starting to understand the mechanism behind the changes in HIV bone disease. Viral proteins interfere with osteoblastic activity either by direct interaction or by the inflammatory process that they induce. Anti-viral management, including highly active antiretroviral therapy (HAART), protease inhibitors, and nucleoside/nucleotide reverse transcriptase inhibitors (NRTI) also are involved in disrupting proper bone metabolism. Vitamin D levels have strong correlation with bone disease in HIV patients, and are dependent not only to chronic disease state, but interaction of pharmacologic management and inflammatory process as well. Work up of the secondary causes of osteopenia and osteoporosis should be undertaken in all patients. DEXA scan is recommended in all post-menopausal women with HIV, all HIV infected men 50 years of age or older and in those with a history of fragility fractures regardless of age or gender. Preventive measures include adequate nutrition, calcium and Vitamin D intake daily, muscle strengthening and balance exercises to increase BMD and reduce fractures. Bisphosphonates are considered to be the first line for the treatment of HIV associated bone disease. This review will describe how the balanced mechanism of bone metabolism is interrupted by the HIV infection itself, the complications that arise from HIV/AIDS, and its treatment options.
Partial gravity unloading inhibits bone healing responses in a large animal model.
Gadomski, Benjamin C; McGilvray, Kirk C; Easley, Jeremiah T; Palmer, Ross H; Santoni, Brandon G; Puttlitz, Christian M
2014-09-22
The reduction in mechanical loading associated with space travel results in dramatic decreases in the bone mineral density (BMD) and mechanical strength of skeletal tissue resulting in increased fracture risk during spaceflight missions. Previous rodent studies have highlighted distinct bone healing differences in animals in gravitational environments versus those during spaceflight. While these data have demonstrated that microgravity has deleterious effects on fracture healing, the direct translation of these results to human skeletal repair remains problematic due to substantial differences between rodent and human bone. Thus, the objective of this study was to investigate the effects of partial gravitational unloading on long-bone fracture healing in a previously-developed large animal Haversian bone model. In vivo measurements demonstrated significantly higher orthopedic plate strains (i.e. load burden) in the Partial Unloading (PU) Group as compared to the Full Loading (FL) Group following the 28-day healing period due to inhibited healing in the reduced loading environment. DEXA BMD in the metatarsus of the PU Group decreased 17.6% (p<0.01) at the time of the ostectomy surgery. Four-point bending stiffness of the PU Group was 4.4 times lower than that of the FL Group (p<0.01), while µCT and histomorphometry demonstrated reduced periosteal callus area (p<0.05), mineralizing surface (p<0.05), mineral apposition rate (p<0.001), bone formation rate (p<0.001), and periosteal/endosteal osteoblast numbers (p<0.001/p<0.01, respectively) as well as increased periosteal osteoclast number (p<0.05). These data provide strong evidence that the mechanical environment dramatically affects the fracture healing cascade, and likely has a negative impact on Haversian system healing during spaceflight. Copyright © 2014 Elsevier Ltd. All rights reserved.
Collection of wood quality data by X-ray densitometry: a case study with three southern pines
Thomas L. Eberhardt; Lisa J. Samuelson
2015-01-01
X-ray densitometry is a technique often used in tree growth and wood quality studies to incrementally measure density (specific gravity) along a radial strip of wood. Protocols for this technique vary between laboratories because of differences in species, equipment, tree age, and other factors. Here, the application of X-ray densitometry is discussed in terms of a...
Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A
2012-01-01
The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo
2006-06-01
The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.
Bieńko, Marek; Radzki, Radosław Piotr; Wolski, Dariusz
2017-09-21
This study evaluates the effects of three different doses of chromium sulphate on bone density and the tomographic parameters of skeletal tissue of rats. The experiment was performed on 40 male Wistar rats which received, by gavage, during 90 days, a chromium sulphate in either a daily dose of 400, 600 or 800 µg/kg BW. At the end of experiment, the rats were scanned using the densitometry method (DXA) to determine the bone mineral density, bone mineral content of total skeleton and vertebral column (L2-L4) and parameters of body composition (Lean Mass and Fat Mass). The isolated femora were scanned using peripheral a quantitative computed tomography method (pQCT) for a separate analysis of the trabecular and cortical bone tissue. The ultimate strength, work to ultimate and the Young modulus of femora was also investigated by the three-point bending test. The negative impact of chromium was observed in relation to bone tissue. All doses significantly decreased total skeleton density and mineral content, and also had impact upon the isolated femora and vertebral column. Trabecular volumetric bone mineral density and trabecular bone mineral content measured by pQCT in distal femur metaphysis were significantly lower in the experimental groups than in the control. Higher doses of chromium also significantly decreased values of ultimate strength and Young modulus in the investigated femora. The results of the experiment demonstrate that chromium sulphate is dose dependent, and exerts a disadvantageous effect on the skeleton, as it decreases bone density and resistance.
Wang, Lin; Hui, Stanley Sai-chuen; Wong, Stephen Heung-sang
2014-11-15
The current study aimed to examine the validity of various published bioelectrical impedance analysis (BIA) equations in estimating FFM among Chinese children and adolescents and to develop BIA equations for the estimation of fat-free mass (FFM) appropriate for Chinese children and adolescents. A total of 255 healthy Chinese children and adolescents aged 9 to 19 years old (127 males and 128 females) from Tianjin, China, participated in the BIA measurement at 50 kHz between the hand and the foot. The criterion measure of FFM was also employed using dual-energy X-ray absorptiometry (DEXA). FFM estimated from 24 published BIA equations was cross-validated against the criterion measure from DEXA. Multiple linear regression was conducted to examine alternative BIA equation for the studied population. FFM estimated from the 24 published BIA equations yielded high correlations with the directly measured FFM from DEXA. However, none of the 24 equations was statistically equivalent with the DEXA-measured FFM. Using multiple linear regression and cross-validation against DEXA measurement, an alternative prediction equation was determined as follows: FFM (kg)=1.613+0.742×height (cm)2/impedance (Ω)+0.151×body weight (kg); R2=0.95; SEE=2.45 kg; CV=6.5, 93.7% of the residuals of all the participants fell within the 95% limits of agreement. BIA was highly correlated with FFM in Chinese children and adolescents. When the new developed BIA equations are applied, BIA can provide a practical and valid measurement of body composition in Chinese children and adolescents.
Wang, Lin; Hui, Stanley Sai-chuen; Wong, Stephen Heung-sang
2014-01-01
Background The current study aimed to examine the validity of various published bioelectrical impedance analysis (BIA) equations in estimating FFM among Chinese children and adolescents and to develop BIA equations for the estimation of fat-free mass (FFM) appropriate for Chinese children and adolescents. Material/Methods A total of 255 healthy Chinese children and adolescents aged 9 to 19 years old (127 males and 128 females) from Tianjin, China, participated in the BIA measurement at 50 kHz between the hand and the foot. The criterion measure of FFM was also employed using dual-energy X-ray absorptiometry (DEXA). FFM estimated from 24 published BIA equations was cross-validated against the criterion measure from DEXA. Multiple linear regression was conducted to examine alternative BIA equation for the studied population. Results FFM estimated from the 24 published BIA equations yielded high correlations with the directly measured FFM from DEXA. However, none of the 24 equations was statistically equivalent with the DEXA-measured FFM. Using multiple linear regression and cross-validation against DEXA measurement, an alternative prediction equation was determined as follows: FFM (kg)=1.613+0.742×height (cm)2/impedance (Ω)+0.151×body weight (kg); R2=0.95; SEE=2.45kg; CV=6.5, 93.7% of the residuals of all the participants fell within the 95% limits of agreement. Conclusions BIA was highly correlated with FFM in Chinese children and adolescents. When the new developed BIA equations are applied, BIA can provide a practical and valid measurement of body composition in Chinese children and adolescents. PMID:25398209
Pasqualini, Leonella; Leli, Christian; Ministrini, Stefano; Schillaci, Giuseppe; Zappavigna, Rosa M; Lombardini, Rita; Scarponi, Anna M; Mannarino, Elmo
2017-03-01
Peak of bone mass (PBM) is generally reached about the age of 18 both in boys and girls. Maximizing PBM during growth may contribute to fracture risk reduction in adulthood and in the elderly. The aim of our study was to evaluate the effects on bone mineral density (BMD) of global physical activity (PA), carried out in the past 15 years, in a population of 70 healthy, young male and female subjects aged 22 to 25. BMD of the lumbar spine and total hip was measured using dual-energy X-ray absorptiometry (DEXA); global PA, resulting from sports-related, occupational and commuting PA, was evaluated using validated questionnaires. Women spent more time than men both in sports-related, occupational and commuting PA in the age range between 10-15 years. In the female group global PA positively correlated with BMD of the lumbar spine (r=0.38; P=0.02) and the total hip (r=0.36; P=0.04) and BMD of the lumbar spine was independently predicted by global PA and Body Mass Index. Our retrospective cross-sectional study indicates that global PA, not only sports-related PA, performed during prepubertal age, is associated with a greater PBM in women.
Zhang, Y D; Zhang, Z; Zhou, N F; Jia, W T; Cheng, X G; Wei, X J
2014-08-28
Primary osteoporosis is a common health problem in postmenopausal women. This study aimed to detect the association of the g.19074G>A genetic variant in the osteoprotegerin gene (OPG) with bone mineral density (BMD) and primary osteoporosis. The created restriction site-polymerase chain reaction method was used to investigate the g.19074G>A genetic variant. The BMD of the femoral neck hip, lumbar spine (L2-4), and total hip were assessed by dual-energy X-ray absorptiometry (DEXA) in 856 unrelated Chinese postmenopausal women. We found significant differences in the BMDs of the femoral neck hip, lumbar spine (L2-4), and total hip among different genotypes; individuals with the GG genotype had significantly higher BMDs than those with the GA and AA genotypes (P < 0.05). Our results indicated that the A allele was an increased risk factor for primary osteoporosis and the g.19074G>A genetic variant of the OPG gene was associated with BMD and primary osteoporosis in Chinese postmenopausal women.
Physical activity and dark skin tone: protective factors against low bone mass in Mexican men.
Vivanco-Muñoz, Nalleli; Jo, Talavera; Gerardo, Huitron-Bravo; Juan, Tamayo; Clark, Patricia
2012-01-01
A cross-sectional study was conducted on 268 Mexican men between the ages of 13 and 80 yr to evaluate the association of clinical factors related with bone mass. Men from high schools, universities, and retirement homes were invited to participate. Body mass index (BMI) was measured, and bone mineral density (BMD) was assessed using dual-energy X-ray absorptiometry for L1-L4 and total hip. Factors related to bone mass were assessed by questionnaire and analyzed using a logistic regression model. Demographic factors (age, education, and occupation), clinical data (BMI, skin tone, previous fracture, history of osteoporosis [OP], and history of fractures), and lifestyle variables (diet, physical activity, sun exposure, and smoking) were evaluated. Physical activity (≥ 60 min/5 times a week) reduced the risk for low BMD for age, osteopenia, and OP at the spine and total hip (odds ratio [OR]: 0.276; 95% confidence interval [CI]: 0.099-0.769; p=0.014; and OR: 0.184; 95% CI: 0.04-0.849; p=0.03, respectively). Dark skin tone was a protective factor, decreasing the risk by up to 70%. In this population of healthy Mexican men (aged 13-80 yr), dark skin and physical activity were protective factors against low bone mass. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Chapurlat, Roland; Pialat, Jean-Baptiste; Merle, Blandine; Confavreux, Elisabeth; Duvert, Florence; Fontanges, Elisabeth; Khacef, Farida; Peres, Sylvie Loiseau; Schott, Anne-Marie; Lespessailles, Eric
2017-12-27
The diagnostic performance of densitometry is inadequate. New techniques of non-invasive evaluation of bone quality may improve fracture risk prediction. Testing the value of these techniques is the goal of the QUALYOR cohort. The bone mineral density (BMD) of postmenopausal women who sustain osteoporotic fracture is generally above the World Health Organization definition for osteoporosis. Therefore, new approaches to improve the detection of women at high risk for fracture are warranted. We have designed and recruited a new cohort to assess the predictive value of several techniques to assess bone quality, including high-resolution peripheral quantitative computerized tomography (HRpQCT), hip QCT, calcaneus texture analysis, and biochemical markers. We have enrolled 1575 postmenopausal women, aged at least 50, with an areal BMD femoral neck or lumbar spine T-score between - 1.0 and - 3.0. Clinical risk factors for fracture have been collected along with serum and blood samples. We describe the design of the QUALYOR study. Among these 1575 women, 80% were aged at least 60. The mean femoral neck T-score was - 1.6 and the mean lumbar spine T-score was -1.2. This cohort is currently being followed up. QUALYOR will provide important information on the relationship between bone quality variables and fracture risk in women with moderately decreased BMD.
Sritara, Chanika; Thakkinstian, Ammarin; Ongphiphadhanakul, Boonsong; Pornsuriyasak, Prapaporn; Warodomwichit, Daruneewan; Akrawichien, Tawatchai; Vathesatogkit, Prin; Sritara, Piyamitr
2015-01-01
A number of healthy workers rarely exercise because of a lack of time or resources. Physical activity related to work and everyday travel may be more feasible, but evidence of its beneficial effect on bone health is scarce. We assessed if this form of physical activity was associated with higher bone mineral density (BMD) and stiffness index (SI) when adjusted for recreational physical activity, age, body mass index, smoking, alcohol consumption, education, and serum level of 25-hydroxyvitamin D. Healthy workers, aged 25-54 yr, of the Electricity Generating Authority of Thailand were surveyed. The outcomes were BMD (lumbar spine, femoral neck, and total hip) and calcaneal SI. Physical activity was estimated using the global physical activity questionnaire and considered active when >600 metabolic equivalent tasks (min). Of 2268 subjects, 74% were men. Active male subjects had significantly higher BMD at the femoral neck and total hip (p<0.005). However, the association was not significant with male lumbar spine BMD, male SI, or any bone parameters in women (p>0.05). In men, work and travel physical activity seems beneficial to male bone health; hence, it should be encouraged. Furthermore, smoking appeared harmful while moderate alcohol consumption was beneficial. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Wong, A.K.O.
2016-01-01
The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses. PMID:27973379
Wong, A K
2016-12-14
The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses.
Lead exposure is a risk for worsening bone mineral density in middle-aged male workers.
Akbal, Ayla; Tutkun, Engin; Yılmaz, Hınç
2014-09-01
Lead exposure linked to osteoporosis in women. However, there is no direct evidence whether lead exposure has effects on bone metabolism in middle-aged male subjects. Therefore, the present study investigated the relationship between bone mineral densitometry measurements, bone markers, endocrine hormones and blood lead levels. The present study included lead exposure patients (n: 30) and control subjects (n: 32). We recorded information on patient demographics and risk factors of osteoporosis. Blood lead levels were evaluated using Varian AA 240Z atomic absorption spectrophotometry. Bone mineral density measurements were measured using dual-energy X-ray absorptiometry. Each lumbar T and Z scores in the lead exposure group were lower than the control group. There were no significant differences in femur neck and femur total T and Z scores between two groups. Blood lead levels were also negatively correlated with lumbar 2-4 T score, total lumbar T score, lumbar 2-4 Z score and total lumbar Z score. Urinary hydroxyproline and urinary deoxypyridinoline levels in the lead exposure group were significantly higher compared to controls. Blood lead levels were strong, positively correlated with urinary deoxypyridinoline. Endocrine hormone levels and 1,25-dihydroxy-vitamin D3 levels were comparable between lead exposure and control group. Lead exposure in male workers is an important factor for deterioration in bone mineral density. We should be screening blood lead levels and history of lead exposure in male osteoporosis.
Shen, Wei; Velasquez, Gilbert; Chen, Jun; Jin, Ye; Heymsfield, Steven B; Gallagher, Dympna; Pi-Sunyer, F Xavier
2014-01-01
Several large-scale studies have reported the presence of an inverse relationship between bone mineral density (BMD) and bone marrow adipose tissue (BMAT) in adults. We aim to determine if there is an inverse relationship between pelvic volumetric BMD (vBMD) and pelvic BMAT in children and to compare this relationship in children and adults. Pelvic BMAT and bone volume (BV) was evaluated in 181 healthy children (5-17yr) and 495 healthy adults (≥18yr) with whole-body magnetic resonance imaging (MRI). Pelvic vBMD was calculated using whole-body dual-energy X-ray absorptiometry to measure pelvic bone mineral content and MRI-measured BV. An inverse correlation was found between pelvic BMAT and pelvic vBMD in both children (r=-0.374, p<0.001) and adults (r=-0.650, p<0.001). In regression analysis with pelvic vBMD as the dependent variable and BMAT as the independent variable, being a child or adult neither significantly contribute to the pelvic BMD (p=0.995) nor did its interaction with pelvic BMAT (p=0.415). The inverse relationship observed between pelvic vBMD and pelvic BMAT in children extends previous findings that found the inverse relationship to exist in adults and provides further support for a reciprocal relationship between adipocytes and osteoblasts. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Impact of Weight Loss With Intragastric Balloon on Bone Density and Microstructure in Obese Adults.
Madeira, Eduardo; Madeira, Miguel; Guedes, Erika Paniago; Mafort, Thiago Thomaz; Moreira, Rodrigo Oliveira; de Mendonça, Laura Maria Carvalho; Lima, Inayá Correa Barbosa; Neto, Leonardo Vieira; de Pinho, Paulo Roberto Alves; Lopes, Agnaldo José; Farias, Maria Lucia Fleiuss
2018-03-21
The historical concept that obesity protects against bone fractures has been questioned. Weight loss appears to reduce bone mineral density (BMD); however, the results in young adults are inconsistent, and data on the effects of weight loss on bone microstructure are limited. This study aimed to evaluate the impact of weight loss using an intragastric balloon (IGB) on bone density and microstructure. Forty obese patients with metabolic syndrome (mean age 35.1 ± 7.3 yr) used an IGB continuously for 6 mo. Laboratory tests, areal BMD, and body composition measurements via dual-energy X-ray absorptiometry, and volumetric BMD and bone microstructure measurements via high-resolution peripheral quantitative computed tomography were conducted before IGB placement and after IGB removal. The mean weight loss was 11.5%. After 6 mo, there were significant increases in vitamin D and carboxyterminal telopeptide of type 1 collagen levels. After IGB use, areal BMD increased in the spine but decreased in the total femur and the 33% radius. Cortical BMD increased in the distal radius but tended to decrease in the distal tibia. The observed trabecular bone loss in the distal tibia contributed to the decline in the total volumetric BMD at this site. There was a negative correlation between the changes in leptin levels and the measures of trabecular quality in the tibia on high-resolution peripheral quantitative computed tomography. Weight loss may negatively impact bone microstructure in young patients, especially for weight-bearing bones, in which obesity has a more prominent effect. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Infant milk feeding influences adult bone health: a prospective study from birth to 32 years.
Pirilä, Satu; Taskinen, Mervi; Viljakainen, Heli; Kajosaari, Merja; Turanlahti, Maila; Saarinen-Pihkala, Ulla M; Mäkitie, Outi
2011-04-27
Peak bone mass, attained by early adulthood, is influenced by genetic and life-style factors. Early infant feeding and duration of breastfeeding in particular, associate with several health-related parameters in childhood. The aim of this study was to examine whether the effects of early infant feeding extend to peak bone mass and other bone health characteristics at adult age. A cohort of 158 adults (76 males) born in Helsinki, Finland, 1975, prospectively followed up from birth, underwent physical examination and bone densitometry to study bone area, bone mineral content (BMC), and bone mineral density (BMD) at 32 years of age. Life-style factors relevant for bone health were recorded. For data analysis the cohort was divided into three equal-size groups according to the total duration of breastfeeding (BF): Short (≤3 months), Intermediate and Prolonged (≥7 months) BF groups. In males short BF is associated with higher bone area, BMC, and BMD compared to longer BF. Males in the Short BF group had on average 4.7% higher whole body BMD than males in the Prolonged BF group. In multivariate analysis, after controlling for multiple confounding factors, the influence of BF duration on adult bone characteristics persisted in males. Differences between the three feeding groups were observed in lumbar spine bone area and BMC, and whole body BMD (MANCOVA; p = 0.025, p = 0.013, and p = 0.048, respectively), favoring the Short BF group. In women no differences were observed. In men, early infant milk feeding may have a significant impact on adult bone health. A potential explanation is that the calcium and phosphate contents were strikingly higher in formula milk and commercial cow milk/cow milk dilutions as opposed to human milk. Our novel finding merits further studies to determine means to ensure optimal bone mass development in infants with prolonged breastfeeding.
Novel equations to estimate lean body mass in maintenance hemodialysis patients.
Noori, Nazanin; Kovesdy, Csaba P; Bross, Rachelle; Lee, Martin; Oreopoulos, Antigone; Benner, Deborah; Mehrotra, Rajnish; Kopple, Joel D; Kalantar-Zadeh, Kamyar
2011-01-01
Lean body mass (LBM) is an important nutritional measure representing muscle mass and somatic protein in hemodialysis patients, for whom we developed and tested equations to estimate LBM. A study of diagnostic test accuracy. The development cohort included 118 hemodialysis patients with LBM measured using dual-energy x-ray absorptiometry (DEXA) and near-infrared (NIR) interactance. The validation cohort included 612 additional hemodialysis patients with LBM measured using a portable NIR interactance technique during hemodialysis. 3-month averaged serum concentrations of creatinine, albumin, and prealbumin; normalized protein nitrogen appearance; midarm muscle circumference (MAMC); handgrip strength; and subjective global assessment of nutrition. LBM measured using DEXA in the development cohort and NIR interactance in validation cohorts. In the development cohort, DEXA and NIR interactance correlated strongly (r = 0.94, P < 0.001). DEXA-measured LBM correlated with serum creatinine level, MAMC, and handgrip strength, but not with other nutritional markers. Three regression equations to estimate DEXA-measured LBM were developed based on each of these 3 surrogates and sex, height, weight, and age (and urea reduction ratio for the serum creatinine regression). In the validation cohort, the validity of the equations was tested against the NIR interactance-measured LBM. The equation estimates correlated well with NIR interactance-measured LBM (R² ≥ 0.88), although in higher LBM ranges, they tended to underestimate it. Median (95% confidence interval) differences and interquartile range for differences between equation estimates and NIR interactance-measured LBM were 3.4 (-3.2 to 12.0) and 3.0 (1.1-5.1) kg for serum creatinine and 4.0 (-2.6 to 13.6) and 3.7 (1.3-6.0) kg for MAMC, respectively. DEXA measurements were obtained on a nondialysis day, whereas NIR interactance was performed during hemodialysis treatment, with the likelihood of confounding by volume status variations. Compared with reference measures of LBM, equations using serum creatinine level, MAMC, or handgrip strength and demographic variables can estimate LBM accurately in long-term hemodialysis patients. Copyright © 2010 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Novel Equations to Estimate Lean Body Mass in Maintenance Hemodialysis Patients
Noori, Nazanin; Kovesdy, Csaba P; Bross, Rachelle; Lee, Martin; Oreopoulos, Antigone; Benner, Deborah; Mehrotra, Rajnish; Kopple, Joel D; Kalantar-Zadeh, Kamyar
2010-01-01
Background Lean body mass (LBM) is an important nutritional measure representing muscle mass and somatic protein in hemodialysis patients, in whom we developed and tested equations to estimate LBM. Study Design A study of diagnostic test accuracy. Setting and Participants The development cohort included 118 hemodialysis patients, with LBM measured using dual-energy -X-ray absorptiometry (DEXA) and near-infrared (NIR) interactance. The validation cohort included 612 additional hemodialysis patients with LBM measured using portable NIR interactance technique during hemodialysis. Index Tests 3-month averaged serum concentrations of creatinine, albumin and prealbumin, normalized protein-nitrogen-appearance, mid-arm muscle circumference (MAMC), handgrip strength, and subjective global assessment of nutrition. Reference Test LBM measured via DEXA in the development cohort and via NIR interactance in validation cohorts. Results In the development cohort, DEXA and NIR interactance were strongly correlated (r=0.94, p<0.001). DEXA-measured LBM correlated with serum creatinine, MAMC, handgrip strength but not with other nutritional markers. Three regression equations to estimate DEXA-measured LBM were developed based on each of these three surrogates and gender, height, weight, and age (and urea reduction ratio for the serum creatinine regression). In the validation cohort, the validity of the equations were tested against the NIR interactance measured LBM. The equation estimates correlated well with NIR interactance measured LBM (R221 ≥0.88), although in higher LBM ranges they tended to underestimate it. Median differences between equation estimates and NIR interactance-measured LBM were 3.4 (25th–75th percentile, −3.2 to 12.0) and 3.0 (25th–75th percentile, 1.1–5.1) kg for serum creatinine and 4.0 (25th–75th percentile, −2.6 to 13.6) and 3.7 (25th–75th percentile, 1.3–6.0) kg for MAMC. Limitations DEXA measurements were performed on a non-dialysis day whereas NIR interactance was obtained during the hemodialysis treatment, with likelihood of confounding by volume status variations. Conclusions Comparing to reference measures of LBM, equations using serum creatinine, MAMC, or handgrip strength and demographic variables can accurately estimate LBM in long-term hemodialysis patients. PMID:21184920
Shin, S; Sung, J; Joung, H
2015-04-01
Osteoporosis is a major health problem that will grow in burden with ageing of the global population. Modifiable risk factors for osteoporosis, including diet, have significant implications for disease prevention. We examined associations between dietary patterns and bone mineral density (BMD) in a Korean adult population. In total, 1828 individuals from the Healthy Twin Cohort were included as subjects. Information on general characteristics, lifestyles and health status was obtained through a health examination, and BMD was assessed using DEXA. Dietary intake was assessed using a 3-day food record, and dietary patterns were examined by factor analysis. Associations between dietary patterns and BMD were examined using mixed linear regression, adjusting for family and twin structure as well as other potential risk factors for bone health. Four dietary patterns were identified (Rice and kimchi; eggs, meat and flour; Fruit, milk and whole grains; and Fast food and soda). The 'Fruit, milk and whole grains' pattern was associated with a reduced risk of having low BMD in men (odds ratio (OR)=0.38; 95% confidence interval (CI)=0.22-0.67) and women (OR=0.45; 95% CI=0.28-0.72) and was positively associated with BMD at multiple sites. The 'rice and kimchi' pattern had a positive association with only whole-arm BMD in men and women. Our results suggest that a dietary pattern with high intake of dairy products, fruits and whole grains may contribute positively to bone health in a Korean adult population, and dietary pattern-based strategies could have potential in promoting bone health.
Bone mineral density of vegetarian and non-vegetarian adults in Taiwan.
Wang, Yuh-Feng; Chiu, Jainn-Shiun; Chuang, Mei-Hua; Chiu, Jing-Er; Lin, Chin-Lon
2008-01-01
Diet is thought to be one of the leading causes of bone mineral loss in aging people. In this study, we explored the potential impact of a vegetarian diet on bone mineral density (BMD) in adult Taiwanese men and women. This was a cross-sectional study of the relationship between diet (vegetarian versus non-vegetarian) and BMD and the incidence of osteoporosis. Bone mineral density was determined in a cohort of 1865 adult male and female patients who underwent routine examination in a regional teaching hospital in Taiwan between February 2003 and February 2004. Subjects with definite vertebral problems, known osteopathy, or poor posture were excluded. Dual-energy X-ray absorptiometry (DEXA) was used to determine BMD, on the right hip in men and on lumbar vertebrae L2 to L4 in women. The subjects were grouped according to sex and diet, and were then stratified by age within each of the four groups. The outcome measures were the BMD value and the incidence of osteopenia or osteoporosis according to defined criteria. Bone mineral density gradually declined with increasing age in Taiwanese men, while Taiwanese women showed a precipitous decrease in BMD after the 5th decade. However, no statistical differences in BMD were observed between vegetarians and non-vegetarians of either sex. The proportion of subjects with osteopenia or osteoporosis also appeared comparable between vegetarians and non-vegetarians of either sex. BMD shows an age-related decline in Taiwanese men and women, and eating a vegetarian diet does not appear to affect this decline.
Tastan, Yasemin; Kann, Peter Herbert; Tinneberg, Hans-Rudolf; Hadji, Peyman; Müller-Ladner, Ulf; Lange, Uwe
2016-11-01
Patients with osteoporosis have a low bone mass resulting in an increased risk for bone fractures, morbidity and mortality. One hundred thirty-one female pre-menopausal participants (98 Turkish immigrants living in Germany in comparison with 33 age-matched healthy Germans) were recruited for this study which explored vitamin D deficiency and specific genetic modifications of bone metabolism. The subjects were investigated for their femoral and lumbar bone mineral density (BMD) by dual-energy X-ray absorptiometry (DEXA) of the right total femur and the lumbar spine. Serum levels of osteologic parameters were determined: parathormone (PTH), calcium (Ca), osteocalcin (OC), phosphate (P), alkaline phosphatase (AP), beta-crossLaps (CL), tartrate-resistant acid phosphatase isoform 5b (TRAP5b), and 25-vitamin D 3 (25-OH D 3 ). The Bsml- and Fokl-polymorphisms of the vitamin D receptor (VDR) gene and the collagen type I alpha 1 (COLIA1)-gene polymorphism were also genotyped. An extremely high prevalence of vitamin D deficiency could be found in the immigrant cohort (87.8 %). Osteoporosis but not osteopenia was more prevalent in this group. Among immigrants with osteoporosis, TRAP5b was elevated in 42.9 % and beta-CL in 28.6 %. Only the Fokl FF-genotype of the VDR polymorphism was significantly more prevalent among the Turkish women, Ff-genotyped immigrants showed significantly decreased BMD. A significant correlation between the COLIA1-gene polymorphism and BMD could not be identified in the two groups. Vitamin D deficiency and osteoporosis appear to be dominant and unrecognized problem among female Turkish immigrants in Germany. Therefore, in this population, osteologic parameters and BMD should be routinely analyzed and deficiencies be treated immediately.
Fan, Shengxian; Ni, Xiaodong; Wang, Jian; Zhang, Yongliang; Tao, Shen; Kong, Wencheng; Li, Yousheng; Li, Jieshou
2017-04-01
Previous studies have noticed the high incidence of suboptimal vitamin D (VtD) status and bone loss in short bowel syndrome (SBS) with parenteral nutrition (PN) dependence. However, limited data have focused on adult SBS without PN dependence. Therefore, our objective was to investigate the incidence and risk factors of suboptimal VtD status and bone loss in adult SBS even after weaning off PN. We performed a prospective study of 60 adult patients with SBS. Serum 25-hydroxyvitamin D (25-OHD) was measured by radioimmunoassay. Bone mineral density (BMD) was measured using dual-energy x-ray absorptiometry (DEXA). Medical records and various laboratory parameters were collected in all participants. Suboptimal VtD status was identified in all individuals, including 3 (5.0%) with VtD insufficiency and 57 (95.0%) with VtD deficiency. Residual small bowel length (B, 0.072, P = .001) and duration of SBS (B, -0.066, P = .020) were both significantly correlated with suboptimal VtD levels. Overall, only 2 patients presented a normal BMD; osteopenia and osteoporosis were noted in 41 (68.3%) and 17 (28.3%) individuals, respectively. Low 25-OHD concentration was associated with a decreased BMD (B, 0.065, P = .029). There were no other demographic characteristics or clinical examinations associated with suboptimal VtD levels and bone loss. Suboptimal VtD status and bone loss were common in adult SBS even after weaning off PN. Despite routine oral VtD supplementation, most patients did not achieve satisfactory status. This emphasizes the critical importance of routine surveillance of 25-OHD and BMD, as well as consideration of alternative methods of supplementation after weaning off PN.
Associated Factors of Bone Mineral Density and Osteoporosis in Elderly Males
Heidari, Behzad; Muhammadi, Abdollah; Javadian, Yahya; Bijani, Ali; Hosseini, Reza; Babaei, Mansour
2016-01-01
Background Low bone mineral density and osteoporosis is prevalent in elderly subjects. This study aimed to determine the associated factors of bone mineral density and osteoporosis in elderly males. Methods All participants of the Amirkola health and ageing project cohort aged 60 years and older entered the study. Bone mineral density at femoral neck and lumbar spine was assessed by the dual energy X-ray absorptiometry (DXA) method. Osteoporosis was diagnosed by the international society for clinical densitometry criteria and the association of bone mineral density and osteoporosis with several clinical, demographic and biochemical parameters. Multiple logistic regression analysis was used to determine independent associations. Results A total of 553 patients were studied and 90 patients (16.2%) had osteoporosis at either femoral neck or lumbar spine. Diabetes, obesity, metabolic syndrome, overweight, and quadriceps muscle strength > 30 kg, metabolic syndrome, abdominal obesity and education level were associated with higher bone mineral density and lower prevalence of osteoporosis, whereas age, anemia, inhaled corticosteroids and fracture history were associated with lower bone mineral density and higher prevalence of osteoporosis (P = 0.001). After adjustment for all covariates, osteoporosis was negatively associated only with diabetes, obesity, overweight, and QMS > 30 kg and positively associated with anemia and fracture history. The association of osteoporosis with other parameters did not reach a statistical level. Conclusions The findings of the study indicate that in elderly males, diabetes, obesity and higher muscle strength was associated with lower prevalence of osteoporosis and anemia, and prior fracture with higher risk of osteoporosis. This issue needs further longitudinal studies. PMID:28835759
The role of bone shape in determining gender differences in vertebral bone mass.
Barlow, Tricia; Carlino, Will; Blades, Heather Z; Crook, Jon; Harrison, Rachel; Arundel, Paul; Bishop, Nick J
2011-01-01
Dual-energy X-ray absorptiometry (DXA) measures of bone mineral density (BMD) in children fail to account for growth because bone depth is unmeasured. While multiple adjustment methods have been proposed using body or bone size, the effect of vertebral shape is relatively unknown. Our study aimed to determine gender differences in vertebral shape and their impact on areal BMD (aBMD). We recruited 189 children, including 107 boys, aged 4-17 years, who attended the emergency department due to trauma. None had fractured. Height, weight, Tanner stage, and DXA measurements of the lumbar spine (LS) and total body were obtained. Cylindrical models were used to predict relationships between vertebral width (VW) and areal density for a given vertebral area assuming uniform volumetric density. The actual relationships between VW, bone area, and aBMD for the LS in the children were then determined. The theoretical models predicted a positive relationship between width and areal density for a constant vertebral area. Actual vertebral measurements demonstrated that boys had greater VW for a given vertebral area but lower aBMD for a given VW than girls at any age. The most likely explanation for the apparent paradox was that vertebral cortical thickness relative to width was greater in girls. This difference remained after adjusting for lean mass, suggesting that bone's response to mechanical stimulation may vary between the sexes during growth with consequent evolutionary advantage for girls approaching reproductive age. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Analysis of fracture healing in osteopenic bone caused by disuse: experimental study.
Paiva, A G; Yanagihara, G R; Macedo, A P; Ramos, J; Issa, J P M; Shimano, A C
2016-03-01
Osteoporosis has become a serious global public health issue. Hence, osteoporotic fracture healing has been investigated in several previous studies because there is still controversy over the effect osteoporosis has on the healing process. The current study aimed to analyze two different periods of bone healing in normal and osteopenic rats. Sixty, 7-week-old female Wistar rats were randomly divided into four groups: unrestricted and immobilized for 2 weeks after osteotomy (OU2), suspended and immobilized for 2 weeks after osteotomy (OS2), unrestricted and immobilized for 6 weeks after osteotomy (OU6), and suspended and immobilized for 6 weeks after osteotomy (OS6). Osteotomy was performed in the middle third of the right tibia 21 days after tail suspension, when the osteopenic condition was already set. The fractured limb was then immobilized by orthosis. Tibias were collected 2 and 6 weeks after osteotomy, and were analyzed by bone densitometry, mechanical testing, and histomorphometry. Bone mineral density values from bony calluses were significantly lower in the 2-week post-osteotomy groups compared with the 6-week post-osteotomy groups (multivariate general linear model analysis, P<0.000). Similarly, the mechanical properties showed that animals had stronger bones 6 weeks after osteotomy compared with 2 weeks after osteotomy (multivariate general linear model analysis, P<0.000). Histomorphometry indicated gradual bone healing. Results showed that osteopenia did not influence the bone healing process, and that time was an independent determinant factor regardless of whether the fracture was osteopenic. This suggests that the body is able to compensate for the negative effects of suspension.
Handball Practice Enhances Bone Mass in Specific Sites Among Prepubescent Boys.
Missawi, Kawther; Zouch, Mohamed; Chakroun, Yosra; Chaari, Hamada; Tabka, Zouhair; Bouajina, Elyès
2016-01-01
This investigation's purpose is to focus on the effects of practicing handball for at least 2 yr on bone acquisition among prepubescent boys. One hundred prepubescent boys aged 10.68 ± 0.85 yr were divided into 2 groups: 50 handball players (HP group) and 50 controls (C group). Bone mineral density (BMD), bone mineral content (BMC), and bone area (BA) were evaluated by using dual-photon X-ray absorptiometry on the whole body, lumbar spine (L2-L4), legs, arms, femoral necks, hips and radiuses. Results showed greater values of BMD in both right and left femoral neck and total hip in handball players than in controls. In addition, handball players had higher values of legs and right total hip BMC than controls without any obvious variation of BA measurement in all sites between groups. All results of the paired t-test displayed an obviously marked variation of bone mass parameters between the left and right sides in the trained group without any marked variation among controls. Data showed an increased BMD of the supporting sites between the left and the right leg among handball players. However, "BMC" results exhibited higher values in the right than in the left total hip, and in the right total radius than in the left correspondent site. In addition, differences in the "BA" measurements were observed in the left total hip and in the right arm. Specific bone sites are markedly stimulated by handball training in prepubescent boys. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Effect of age and disease on bone mass in Japanese patients with schizophrenia.
Sugawara, Norio; Yasui-Furukori, Norio; Umeda, Takashi; Tsuchimine, Shoko; Fujii, Akira; Sato, Yasushi; Saito, Manabu; Furukori, Hanako; Danjo, Kazuma; Matsuzaka, Masashi; Takahashi, Ippei; Kaneko, Sunao
2012-02-20
There have been a limited number of studies comparing bone mass between patients with schizophrenia and the general population. The aim of this study was to compare the bone mass of schizophrenia patients with that of healthy subjects in Japan. We recruited patients (n = 362), aged 48.8 ± 15.4 (mean ± SD) years who were diagnosed with schizophrenia or schizoaffective disorder based on the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV). Bone mass was measured using quantitative ultrasound densitometry of the calcaneus. The osteosono-assessment index (OSI) was calculated as a function of the speed of sound and the transmission index. For comparative analysis, OSI data from 832 adults who participated in the Iwaki Health Promotion Project 2009 was used as representative of the general community. Mean OSI values among male schizophrenic patients were lower than those in the general population in the case of individuals aged 40 and older. In females, mean OSI values among schizophrenic patients were lower than those in the general community in those aged 60 and older. In an analysis using the general linear model, a significant interaction was observed between subject groups and age in males. Older schizophrenic patients exhibit lower bone mass than that observed in the general population. Our data also demonstrate gender and group differences among schizophrenic patients and controls with regard to changes in bone mass associated with aging. These results indicate that intervention programs designed to delay or prevent decreased bone mass in schizophrenic patients might be tailored according to gender.
Silver, HJ; Niswender, KD; Kullberg, J; Berglund, J; Johansson, L; Bruvold, M; Avison, MJ; Welch, EB.
2012-01-01
Improved understanding of how depot-specific adipose tissue mass predisposes to obesity-related comorbidities could yield new insights into the pathogenesis and treatment of obesity as well as metabolic benefits of weight loss. We hypothesized that three-dimensional contiguous “fat-water” MR imaging (FWMRI) covering the majority of a whole-body field of view (FOV) acquired at 3 Tesla (3T) and coupled with automated segmentation and quantification of amount, type and distribution of adipose and lean soft tissue would show great promise in body composition methodology. Precision of adipose and lean soft tissue measurements in body and trunk regions were assessed for 3T FWMRI and compared to DEXA. Anthropometric, FWMRI and DEXA measurements were obtained in twelve women with BMI 30–39.9 kg/m2. Test-retest results found coefficients of variation for FWMRI that were all under 3%: gross body adipose tissue (GBAT) 0.80%, total trunk adipose tissue (TTAT) 2.08%, visceral adipose tissue (VAT) 2.62%, subcutaneous adipose tissue (SAT) 2.11%, gross body lean soft tissue (GBLST) 0.60%, and total trunk lean soft tissue (TTLST) 2.43%. Concordance correlation coefficients between FWMRI and DEXA were 0.978, 0.802, 0.629, and 0.400 for GBAT, TTAT, GBLST and TTLST, respectively. While Bland Altman plots demonstrated agreement between FWMRI and DEXA for GBAT and TTAT, a negative bias existed for GBLST and TTLST measurements. Differences may be explained by the FWMRI FOV length and potential for DEXA to overestimate lean soft tissue. While more development is necessary, the described 3T FWMRI method combined with fully-automated segmentation is fast (<30 minutes total scan and post-processing time), noninvasive, repeatable and cost effective. PMID:23712980
Noninvasive markers of bone metabolism in the rhesus monkey: normal effects of age and gender
NASA Technical Reports Server (NTRS)
Cahoon, S.; Boden, S. D.; Gould, K. G.; Vailas, A. C.
1996-01-01
Measurement of bone turnover in conditions such as osteoporosis has been limited by the need for invasive iliac bone biopsy to reliably determine parameters of bone metabolism. Recent advances in the area of serum and urinary markers of bone metabolism have raised the possibility for noninvasive measurements; however, little nonhuman primate data exist for these parameters. The purpose of this experiment was to define the normal range and variability of several of the newer noninvasive bone markers which are currently under investigation in humans. The primary intent was to determine age and gender variability, as well as provide some normative data for future experiments in nonhuman primates. Twenty-four rhesus macaques were divided into equal groups of male and female according to the following age groupings: 3 years, 5-10 years, 15-20 years, and > 25 years. Urine was collected three times daily for a four-day period and measured for several markers of bone turnoverm including pyridinoline (PYD), deoxypyrodinoline (DPD), hydroxyproline, and creatinine. Bone mineral density measurements of the lumbar spine were performed at the beginning and end of the study period. Serum was also obtained at the time of bone densitometry for measurement of osteocalcin levels by radioimmunoassay. There were no significant differences in bone mineral density, urine PYD, or urine DPD based on gender. Bone density was lowest in the youngest animals, peaked in the 15-20-year group, but again decreased in the oldest animals. The osteocalcin, PYD, and DPD levels followed an inversely related pattern to bone density. The most important result was the relative age insensitivity of the ratio of PYD:DPD in monkeys up to age 20 years. Since bone density changes take months or years to become measurable and iliac biopsies are invasive, the PYD/DPD marker ratio may have important implications for rapid noninvasive measurement of the effects of potential treatments for osteoporosis in the non-human primate model.
Bone mass in physicians: a Howard University Hospital pilot study.
Reyes, May O.; Archer, Juanita A.; Nunlee-Bland, Gail; Daniel, Gilbert; Morgan, Odette A.; Makambi, Kepher
2004-01-01
PURPOSE: This observational cross-sectional study was done to determine bone mass in physicians and to determine if variables, such as calcium intake and exercise, were related to their bone mass. METHODS: One-hundred physicians of different ethnicities (African, African American, Asian, Caribbean, and Hispanic) were studied. Using dual-energy x-ray absorptiometry (DEXA), bone mass (BMD) of the lumbar spine and hips was measured. A validated questionnaire was used to determine the daily calcium intake and exercise. Student t-test, logistic regression, and Pearson chi-square were used to analyze the data. RESULTS: The study population consisted of 52% men and 48% women, with a mean age of 42 years old and a body mass index of 18.5 to 39.9 kg/m2. Low BMD occurred in 68% of the physicians (osteoporosis in 12%, osteopenia in 56%). Low calcium intake was found in 71%-14% of whom had osteoporosis and 49% osteopenia. Two-thirds of the physicians had inadequate exercise; 57% of this group had decreased BMD (osteoporosis in 9%, osteopenia in 38%). There was no statistical significance between BMD and calcium intake or exercise. CONCLUSION: A high percentage of the physicians in this unique study had a reduced BMD. Most of the physicians with low BMD were less than 45 years of age. This study indicates the need to define BMD in a larger cohort of young, ethnically diverse clinicians, and other health workers. Images Figure 1 Figure 2 PMID:15040511
Reproducibility of regional DEXA examinations of abdominal fat and lean tissue.
Tallroth, Kaj; Kettunen, Jyrki A; Kujala, Urho M
2013-01-01
The aim of this study was to develop and test the validity of a new repeatable method to delimit abdominal areas for follow-up of fat mass (FM) and lean tissue mass (LM) in DEXA examinations. 37 male volunteers underwent two DEXA examinations. Total body FM and LM measurements and corresponding abdominal measurements in a carefully defined region were calculated from the first scan. After repositioning of the subjects and a second scan, the delimited region was copied and the abdominal tissues re-calculated. The mean LM of the abdominal area was 2.804 kg (SD 0.556), and the mean FM was 1.026 kg (SD 0.537). The intra-class correlation coefficient for the repeated abdominal LM, FM, and LM/FM ratio measurements was 0.99. The mean difference (bias) for the repeated abdominal LM measurements was -13 g (95% confidence interval (CI) -193.0 to 166.8), and for the repeated abdominal FM measurements it was -35 g (95% CI -178.9 to 108.5). The results indicate that regional DEXA is a sensitive method with excellent reproducibility in the measurements of the abdominal fat and lean tissues. The method may serve as a useful tool for evaluation and follow-up of various dietary and training programmes.
Reproducibility of Regional DEXA Examinations of Abdominal Fat and Lean Tissue
Tallroth, Kaj; Kettunen, Jyrki A.; Kujala, Urho M.
2013-01-01
Objective The aim of this study was to develop and test the validity of a new repeatable method to delimit abdominal areas for follow-up of fat mass (FM) and lean tissue mass (LM) in DEXA examinations. Methods 37 male volunteers underwent two DEXA examinations. Total body FM and LM measurements and corresponding abdominal measurements in a carefully defined region were calculated from the first scan. After repositioning of the subjects and a second scan, the delimited region was copied and the abdominal tissues re-calculated. Results The mean LM of the abdominal area was 2.804 kg (SD 0.556), and the mean FM was 1.026 kg (SD 0.537). The intra-class correlation coefficient for the repeated abdominal LM, FM, and LM/FM ratio measurements was 0.99. The mean difference (bias) for the repeated abdominal LM measurements was −13 g (95% confidence interval (CI) −193.0 to 166.8), and for the repeated abdominal FM measurements it was −35 g (95% CI −178.9 to 108.5). Conclusions The results indicate that regional DEXA is a sensitive method with excellent reproducibility in the measurements of the abdominal fat and lean tissues. The method may serve as a useful tool for evaluation and follow-up of various dietary and training programmes. PMID:23615566
El Amir, Azza M; Tanious, Dalia G; Mansour, Hanaa A
2017-11-01
Pseudomonas aeruginosa (P. aeruginosa) is a gram-negative bacterium that causes a variety of diseases in compromised hosts. Bacterial endotoxins such as lipopolysaccharide (LPS) are the major outer surface membrane components that are present in almost all gram-negative bacteria and act as extremely strong stimulators of innate immunity and inflammation of the airway. This study was undertaken to determine the effect of combined administration of Gentamicin (GENT) as an antibiotic and Dexamethasone (DEXA) as an anti-inflammatory drug on some immunological and histological parameters. After determination of LD 50 of P. aeruginosa, mice groups were injected with DEXA, GENT and lipopolysaccharide alone or in combination. Lipopolysaccharide single injection caused a significant increase of total leukocyte count, lymphocytes, neutrophils and levels of IgM and IgG. DEXA induced an increase of neutrophilia and lymphopenia. Immunological examination demonstrated that combined treatment has a significant effect of decreasing lymphocytes and IgG levels than single treatment does. Histological examination demonstrated that the inflammation of thymus, spleen, lymph node and liver decreases in mice that received combined treatment than those that received individual treatment. Concurrent administration of DEXA and GENT has a great effect on protecting organs against damage in case of endotoxemia. Copyright © 2017 Elsevier B.V. All rights reserved.
Astronaut Bones: Stable Calcium Isotopes in Urine as a Biomarker of Bone Mineral Balance
NASA Astrophysics Data System (ADS)
Skulan, J.; Gordon, G. W.; Romaniello, S. J.; Anbar, A. D.; Smith, S. M.; Zwart, S.
2016-12-01
Bone loss is a common health concern, in conditions ranging from osteoporosis to cancer. Bone loss due to unloading is also an important health issue for astronauts. We demonstrate stable calcium isotopes, a tool developed in geochemistry, are capable of detecting real-time quantitative changes in net bone mineral balance (BMB) using serum and urine [1]. We validated this technique by comparing with DEXA and biomarker data in subjects during bed rest, a ground-based analog of space flight effects [2-4]. We now apply this tool to assess changes in astronauts' BMB before, during and after 4-6 month space missions. There is stable isotope fractionation asymmetry between bone formation and resorption. During bone formation there is a mass-dependent preference for "lighter" calcium isotopes to be removed from serum and incorporated into bone mineral. During bone resorption, there is no measurable isotopic discrimination between serum and bone. Hence, when bone formation rates exceed that of resorption, serum and urine become isotopically "heavy" due to the sequestration of "light" calcium in bone. Conversely, when bone resorption exceeds bone formation, serum and urine become isotopically "light" due to the release of the sequestered light calcium from bone. We measured Ca isotopes in urine of thirty International Space Station astronauts. Average Ca isotope values in astronauts' urine shift isotopically lighter during microgravity, consistent with negative net BMB. Within a month of return to Earth, astronauts returned to within error of their δ44Ca value prior to departure. Urine samples from astronauts testing bone loss countermeasures showed bisphosphonates provide a viable pharmacological countermeasure. Some, but not all, individuals appear able to resist bone loss through diet and intensive resistive exercise alone. This is a promising new technique for monitoring BMB in astronauts, and hopefully someday on the way to/from Mars, this also has important clinical applications for human health and terrestrial medicine [5]. REFERENCES [1] Morgan, J.L. et al (2011) Anal Chem 83, 6956-6962. [2] Skulan, J.L. et al. (2007) Clin Chem 53, 1155-1158. [3] Morgan, J.L. et al (2012) PNAS 109, 9989-9994. [4] Channon, M.B. et al (2015) Bone 77, 69-74. [5] Gordon, G.W. et al (2014) Leukemia 28, 2112-2115.
Hyassat, Dana; Alyan, Taghreed; Jaddou, Hashem; Ajlouni, Kamel M.
2017-01-01
Abstract To assess the prevalence of osteoporosis and osteopenia among Jordanian postmenopausal women attending the National Center for Diabetes, Endocrinology, and Genetics (NCDEG), and to determine the potential associated risk factors. A cross-sectional study was conducted at (NCDEG) in Amman, Jordan. A total of 1079 Jordanian postmenopausal women aged between 45 and 84 years were included in this study that was conducted during the period between April 2013 and December 2014. All patients underwent bone mineral density measurement through dual-energy X-ray absorptiometry (DEXA) scan. DEXA scan was interpreted in terms of T score as per World Health Organization guidelines. The overall prevalence of osteoporosis and osteopenia was 37.5% and 44.6%, respectively. The maximum prevalence of osteoporosis was observed at the lumbar spine (32.4%) followed by the left femoral neck (14.4%), while the maximum prevalence of osteopenia was observed at the left femoral neck (56.1%) followed by the lumbar spine (41.3%). Patients with longer menopausal duration, normal or overweight body mass index, high parity, physical inactivity, positive family history of osteoporosis, inadequate sun exposure, high daily caffeine intake, low daily calcium intake, and delay in the age of menarche were all positively associated with osteoporosis. On the other hand, women with type 2 diabetes mellitus had lower risk of osteoporosis. There is a high prevalence of osteoporosis and osteopenia among Jordanian postmenopausal women. Necessary steps are needed for more public education and a wider dissemination of information about osteoporosis and its prevention. PMID:28736691
Hypervitaminosis D: case report of pediatric osteoporosis secondary to cystic fibrosis.
Cialdella, Pietro; Carella, Francesco
2011-09-01
The objective of the study is to evaluate alterations of bone metabolism in adolescence and adult CF, determining the rate of osteoporosis, osteopenia and vertebral and non-vertebral fractures. We took into account the clinical case of a child who right from the age of seven years has presented joint pain.The little girl was diagnosed with osteopenia taken with therapy of calcium and vitamin D; after few years despite treatment nephrocalcinosis and osteoporosis take over.It was examined a cohort of patients with cystic fibrosis of the southern Italy, 24 patients aged between 12 and 44 years, 12 females and 12 males with BMD assessment methods like dual energy X-rays (DXA) and calcaneal ultrasound densitometry in a few cases, ultrasonography was used jointly.From this case study we tried to establish the relationship between cystic fibrosis and osteoporosis etiopathogenetic, the adoptive therapy and the impact of therapies on patients.It was concluded that, given the high number of unrecognized patients with impaired bone mineralization, we must implement and integrate a more aggressive treatment with bisphosphonates and prevention programs that can combat the lifestyle and new eating habits of our young people that facilitate the loss of bone mass.
Bone Metabolism on ISS Missions
NASA Technical Reports Server (NTRS)
Smith, S. M.; Heer, M. A.; Shackelford, L. C.; Zwart, S. R.
2014-01-01
Spaceflight-induced bone loss is associated with increased bone resorption (1, 2), and either unchanged or decreased rates of bone formation. Resistive exercise had been proposed as a countermeasure, and data from bed rest supported this concept (3). An interim resistive exercise device (iRED) was flown for early ISS crews. Unfortunately, the iRED provided no greater bone protection than on missions where only aerobic and muscular endurance exercises were available (4, 5). In 2008, the Advanced Resistive Exercise Device (ARED), a more robust device with much greater resistance capability, (6, 7) was launched to the ISS. Astronauts who had access to ARED, coupled with adequate energy intake and vitamin D status, returned from ISS missions with bone mineral densities virtually unchanged from preflight (7). Bone biochemical markers showed that while the resistive exercise and adequate energy consumption did not mitigate the increased bone resorption, bone formation was increased (7, 8). The typical drop in circulating parathyroid hormone did not occur in ARED crewmembers. In 2014, an updated look at the densitometry data was published. This study confirmed the initial findings with a much larger set of data. In 42 astronauts (33 male, 9 female), the bone mineral density response to flight was the same for men and women (9), and those with access to the ARED did not have the typical decrease in bone mineral density that was observed in early ISS crewmembers with access to the iRED (Figure 1) (7). Biochemical markers of bone formation and resorption responded similarly in men and women. These data are encouraging, and represent the first in-flight evidence in the history of human space flight that diet and exercise can maintain bone mineral density on long-duration missions. However, the maintenance of bone mineral density through bone remodeling, that is, increases in both resorption and formation, may yield a bone with strength characteristics different from those that existed before space flight. Studies to assess bone strength after flight are underway at NASA, to better understand the results of bone remodeling. Studies are also underway to evaluate optimized exercise protocols and nutritional countermeasures. Regardless, there is clear evidence of progress being made to protect bone during spaceflight.
Bone metabolism of male rats chronically exposed to cadmium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brzoska, Malgorzata M.; Moniuszko-Jakoniuk, Janina
2005-09-15
Recently, based on a female rat model of human exposure, we have reported that low-level chronic exposure to cadmium (Cd) has an injurious effect on the skeleton. The purpose of the current study was to investigate whether the exposure may also affect bone metabolism in a male rat model and to estimate the gender-related differences in the bone effect of Cd. Young male Wistar rats received drinking water containing 0, 1, 5, or 50 mg Cd/l for 12 months. The bone effect of Cd was evaluated using bone densitometry and biochemical markers of bone turnover. Renal handling of calcium (Ca)more » and phosphate, and serum concentrations of vitamin D metabolites, calcitonin, and parathormone were estimated as well. At treatment with 1 mg Cd/l, corresponding to the low environmental exposure in non-Cd-polluted areas, the bone mineral content (BMC) and density (BMD) at the femur and lumbar spine (L1-L5) and the total skeleton BMD did not differ compared to control. However, from the 6th month of the exposure, the Z score BMD indicated osteopenia in some animals and after 12 months the bone resorption very clearly tended to an increase. The rats' exposure corresponding to human moderate (5 mg Cd/l) and especially relatively high (50 mg Cd/l) exposure dose- and duration-dependently disturbed the processes of bone turnover and bone mass accumulation leading to formation of less dense than normal bone tissue. The effects were accompanied by changes in the serum concentration of calciotropic hormones and disorders in Ca and phosphate metabolism. It can be concluded that low environmental exposure to Cd may be only a subtle risk factor for skeletal demineralization in men. The results together with our previous findings based on an analogous model using female rats give clear evidence that males are less vulnerable to the bone effects of Cd compared to females.« less
Hamed, Enas A; Faddan, Nagla H Abu; Elhafeez, Hebh A Adb; Sayed, Douaa
2011-09-01
Skeletal involvement in patients with type 1 diabetes mellitus (T1DM) has complex pathogenesis and despite numerous researches on this problem, many questions remain unanswered. This study aimed to assess bone status by measurement parathormone (PTH), 25-hydroxy vitamin D [25(OH)D] serum levels in children and adolescents with T1DM and its relation to insulin-like growth factor-1 (IGF-1), disease duration, puberty stage, and metabolic control. This study included 36 children and adolescents with T1DM and 15 apparently healthy controls. Serum levels of 25(OH)D, PTH, IGF-1 measured using enzyme-linked immunosorbent assay (ELISA), while glycosylated hemoglobin (HbA1c), calcium (Ca), inorganic phosphorus (PO(4) ) using autoanalyzer. Bone quality assessed using dual energy X-ray absorptiometry (DEXA). Diabetic patients showed significant increase in PO(4) and PTH levels, while significant decrease in Ca, IGF-1, and 25(OH)D serum levels. As much as 52.8% of patients showed reduced 25(OH)D, and 30.65% showed elevated PTH serum levels. In diabetic patients, abnormal bone status (osteopenia-osteoporosis) found mostly in total body (94.40%) then lumber-spine (88.90%), ribs (88.90%), pelvis (86.10%), thoracic-spine (80.60%), arms (80.60%) and legs (77.80%), while head bones showed no abnormalities. Long diabetic duration had negative; meanwhile PTH, onset age, and puberty age had positive impact on bone status. Children and adolescent with T1DM have abnormal bone status mostly in axial skeleton which may be contributed to impairment of formation of 25(OH)D and IGF-1. Physical activity, calcium and vitamin D supplement seem important in T1DM. Elevated serum PTH level in diabetic patients is not uncommon and its positive correlation with bone status needs further investigations. © 2011 John Wiley & Sons A/S.
Frassetto, L A; Hardcastle, A C; Sebastian, A; Aucott, L; Fraser, W D; Reid, D M; Macdonald, H M
2012-12-01
In vitro studies demonstrate that bone is degraded in an acidic environment due to chemical reactions and through effects on bone cells. Clinical evidence is insufficient to unequivocally resolve whether the diet net acid or base load bone affects breakdown in humans. Increasing dietary salt (sodium chloride, NaCl) mildly increases blood acidity in humans and in rats with increased sensitivity to the blood pressure effects of salt, whereas increased potassium (K) intake can decrease blood pressure. Blood pressure responses to NaCl or K may potentially be a marker for increased bone turnover or lower bone mineral density (BMD) in women at higher risk for osteoporosis and fracture. We retrospectively analysed data from two data sets (California and NE Scotland) of postmenopausal women (n=266) enrolled in long-term randomized, placebo-controlled studies of the effects of administration of low- or high-dose dietary K alkali supplementation on bone turnover in relation to sodium or chloride excretion (a marker of dietary salt intake). Mean arterial pressure (MAP) was calculated from blood pressure measures, MAP was divided into tertiles and its influence on the effect of dietary NaCl and K alkali supplementation on deoxypyridinoline markers of bone resorption and BMD by DEXA was tested. Data was analysed for each data set separately and then combined. Percentage change in BMD after 24 months was less for California compared with North East Scotland (hip: -0.6 ± 2.8% and -1.5 ± 2.4%, respectively (P=0.027); spine: -0.5 ± 3.4% and -2.6 ± 3.5%, (P<0.001). We found no effect of dietary alkali treatment on BMD change or bone resorption for either centre. Adjusting for the possible calcium- or potassium-lowering effects on blood pressure did not alter the results. Blood pressure responses to Na, Cl or K intake did not help predict a BMD response to diet alkali therapy.
Spector, Tim D; Calomme, Mario R; Anderson, Simon H; Clement, Gail; Bevan, Liisa; Demeester, Nathalie; Swaminathan, Rami; Jugdaohsingh, Ravin; Berghe, Dirk A Vanden; Powell, Jonathan J
2008-01-01
Background Mounting evidence supports a physiological role for silicon (Si) as orthosilicic acid (OSA, Si(OH)4) in bone formation. The effect of oral choline-stabilized orthosilicic acid (ch-OSA) on markers of bone turnover and bone mineral density (BMD) was investigated in a double-blind placebo-controlled trial. Methods Over 12-months, 136 women out of 184 randomized (T-score spine < -1.5) completed the study and received, daily, 1000 mg Ca and 20 μg cholecalciferol (Vit D3) and three different ch-OSA doses (3, 6 and 12 mg Si) or placebo. Bone formation markers in serum and urinary resorption markers were measured at baseline, and after 6 and 12 months. Femoral and lumbar BMD were measured at baseline and after 12 months by DEXA. Results Overall, there was a trend for ch-OSA to confer some additional benefit to Ca and Vit D3 treatment, especially for markers of bone formation, but only the marker for type I collagen formation (PINP) was significant at 12 months for the 6 and 12 mg Si dose (vs. placebo) without a clear dose response effect. A trend for a dose-corresponding increase was observed in the bone resorption marker, collagen type I C-terminal telopeptide (CTX-I). Lumbar spine BMD did not change significantly. Post-hoc subgroup analysis (baseline T-score femur < -1) however was significant for the 6 mg dose at the femoral neck (T-test). There were no ch-OSA related adverse events observed and biochemical safety parameters remained within the normal range. Conclusion Combined therapy of ch-OSA and Ca/Vit D3 had a potential beneficial effect on bone collagen compared to Ca/Vit D3 alone which suggests that this treatment is of potential use in osteoporosis. NTR 1029 PMID:18547426
Osteoporosis Care in the United States After Declines in Reimbursements for DXA
Hayes, Burton L.; Curtis, Jeffrey R.; Laster, Andrew; Saag, Kenneth; Tanner, S. Bobo; Liu, Caiqin; Womack, Catherine; Johnson, Karen C.; Khaliq, Fazila; Carbone, Laura D.
2015-01-01
In January 2007, in the United States (US), Medicare initiated a series of cuts to reimbursement for dual-energy X-ray absorptiometry (DXA) services performed in the nonfacility setting that by January 2010 reduced payments for these services by more than 60% compared with 2006 levels. The objectives of this study were to determine if a temporal association exists between Medicare Physician Fee Schedule changes in office-based DXA reimbursement and attendance at educational conferences for osteoporosis, physicians’ perceptions of changes in their medical practices, or national trends in retail prescription medications for osteoporosis in those aged 65 and older. Compared with the 2 yr before the decline in Medicare reimbursement for DXA (2005–2006), attendance at educational meetings for osteoporosis in the US declined in the 2 yr after these cuts (2007–2008) by 6%; declines in attendance were only present in meetings selective for bone densitometry. Survey participants reported changes in DXA services with approximately one-third indicating that they had either decreased the number of DXAs they performed or declined service contracts or hardware/software updates compared with 2005–2006. The number of retail prescriptions for Food and Drug Administratione–approved osteoporosis drugs (excluding estrogen compounds and raloxifene) in the age 65 and older population increased by 5.5% in the time period 2007–2008 compared with 2005–2006. However, in the last year of the study (2008), total retail prescriptions for these drugs experienced for the first time over the interval of the study, a decline (1.4%) compared with the previous year. This occurred despite a 2.6% increase in the US population age 65 and older. In conclusion, there were temporal associations noted between Medicare cuts in DXA payments in attendance at educational conferences for bone densitometry, self-report of office-based provision of DXA services in the US, and retail prescriptions for osteoporosis therapies. PMID:21029972
Direct Comparison of the Precision of the New Hologic Horizon Model With the Old Discovery Model.
Whittaker, LaTarsha G; McNamara, Elizabeth A; Vath, Savoun; Shaw, Emily; Malabanan, Alan O; Parker, Robert A; Rosen, Harold N
2017-11-22
Previous publications suggested that the precision of the new Hologic Horizon densitometer might be better than that of the previous Discovery model, but these observations were confounded by not using the same participants and technologists on both densitometers. We sought to study this issue methodically by measuring in vivo precision in both densitometers using the same patients and technologists. Precision studies for the Horizon and Discovery models were done by acquiring spine, hip, and forearm bone mineral density twice on 30 participants. The set of 4 scans on each participant (2 on the Discovery, 2 on the Horizon) was acquired by the same technologist using the same scanning mode. The pairs of data were used to calculate the least significant change according to the International Society for Clinical Densitometry guidelines. The significance of the difference between least significant changes was assessed using a Wilcoxon signed-rank test of the difference between the mean square error of the absolute value of the differences between paired measurements on the Discovery (Δ-Discovery) and the mean square error of the absolute value of the differences between paired measurements on the Horizon (Δ-Horizon). At virtually all anatomic sites, there was a nonsignificant trend for the precision to be better for the Horizon than for the Discovery. As more vertebrae were excluded from analysis, the precision deteriorated on both densitometers. The precision between densitometers was almost identical when reporting only 1 vertebral body. (1) There was a nonsignificant trend for greater precision on the new Hologic Horizon compared with the older Discovery model. (2) The difference in precision of the spine bone mineral density between the Horizon and the Discovery models decreases as fewer vertebrae are included. (3) These findings are substantially similar to previously published results which had not controlled as well for confounding from using different subjects and technologists. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Single x-ray transmission system for bone mineral density determination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jimenez-Mendoza, Daniel; Vargas-Vazquez, Damian; Espinosa-Arbelaez, Diego G.
2011-12-15
Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many differentmore » applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm{sup 2})], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.« less
Single x-ray transmission system for bone mineral density determination
NASA Astrophysics Data System (ADS)
Jimenez-Mendoza, Daniel; Espinosa-Arbelaez, Diego G.; Giraldo-Betancur, Astrid L.; Hernandez-Urbiola, Margarita I.; Vargas-Vazquez, Damian; Rodriguez-Garcia, Mario E.
2011-12-01
Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many different applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm2)], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.
Minami, Keiichiro; Honbo, Masato; Mori, Yosai; Kataoka, Yasushi; Miyata, Kazunori
2015-11-01
To compare area densitometry analysis using rotating Scheimpflug photography in quantifications of posterior capsule opacification (PCO) and surface light scattering with previous anterior-segment analyzer measurement. Miyata Eye Hospital, Miyazaki, Japan. Prospective observational case series. Scheimpflug images of eyes with foldable intraocular lenses (IOLs) were obtained using rotating and fixed Scheimpflug photography. Area densitometry on the posterior and anterior surfaces was conducted for PCO and surface light scattering analyses, respectively, with an identical area size. Correlation between two measurements was analyzed using linear regression. The study included 105 eyes of 74 patients who received IOLs 1 to 18 years (mean, 4.9 ± 4.5 years) postoperatively. In the PCO analysis on the posterior IOL surface, there was a significant correlation between the two measurements (P < .001, R(2) = 0.60). In the surface light scattering analysis, a significant and higher correlation was obtained (P < .001, R(2) = 0.91) until the fixed Scheimpflug photography exhibited saturation due to intensive scatterings. Area densitometry combined with a rotating Scheimpflug photography was exchangeable to previously established densitometry measurement, and allowed successive evaluation in longer-term observations. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Lage, Andrea Z; Brandão, Cynthia A; Mendes, Judite R T; Huayllas, Martha K; Liberman, Bernardo; Mendonça, Berenice B; Costa, Elaine M F; Verreschi, Ieda T; Lazaretti-Castro, Marise
2005-01-01
Low bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA) has been described in Turner's syndrome (TS). One of the error factors of DXA is short stature, a common finding in TS patients. Aimed to evaluate the influence of a low stature on BMD, we compared the two-dimensional (2D) or conventional BMD (cBMD) with three-dimensional (3D) or volumetric BMD (vBMD) in 62 females (10 to 48 yr old) with TS diagnosis in a case control study. They were compared to 102 normal females (7 to 45 yr old) grouped by age-ranges. All patients were subjected to a lumbar spine densitometry by DXA in the PA and lateral projections, obtained the cBMD and vBMD and calculated for the apparent BMD (appBMD). In TS, the mean of Z-score for cBMD was significantly lower than that for vBMD and for appBMD (-2.31 +/- 1.42; -0.64 +/- 1.55; and -1.72 +/- 1.5; respectively). Most of the patients (83.8%) had a Z-score <-1 for cBMD, whereas the majority (58.1%) had a Z-score <-1 for vBMD. Concluding, the cBMD underestimates the bone mass of the lumbar spine in patients with TS inducing to false diagnoses of bone fragility. Volumetric BMD approached the bone mass of control patients, while appBMD just partially do that.
Hoyer-Kuhn, Heike; Knoop, Kai; Semler, Oliver; Kuhr, Kathrin; Hellmich, Martin; Schoenau, Eckhard; Koerber, Friederike
2016-01-01
Conventional lateral spine and hand radiographs are the standard tools to evaluate vertebral morphometry and bone age in children. Beside bone mineral density analyses, dual-energy X-ray absorptiometry (DXA) measurements with lower radiation exposure provide high-resolution scans which are not approved for diagnostic purposes. Data about the comparability of conventional radiographs and DXA in children are missing yet. The purpose of the trial was to evaluate whether conventional hand and spine radiographs can be replaced by DXA scans to diminish radiation exposure. Thirty-eight children with osteogenesis imperfecta or secondary osteoporosis or short stature (male, n=20; age, 5.0-17.0 yr) were included and assessed once by additional DXA (GE iDXA) of the spine or the left hand. Intraclass correlation coefficients (ICCs) were used to express agreement between X-ray and iDXA assessment. Evaluation of the spine morphometry showed reasonable agreement between iDXA and radiography (ICC for fish-shape, 0.75; for wedge-shape, 0.65; and for compression fractures, 0.70). Bone age determination showed excellent agreement between iDXA and radiography (ICC, 0.97). IDXA-scans of the spine in a pediatric population should be used not only to assess bone mineral density but also to evaluate anatomic structures and vertebral morphometry. Therefore, iDXA can replace some radiographs in children with skeletal diseases. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Interpregnancy interval as a risk factor for postmenopausal osteoporosis.
Sahin Ersoy, Gulcin; Giray, Burak; Subas, Seda; Simsek, Ersin; Sakin, Onder; Turhan, Omer Talip; Bulut, Sadullah
2015-10-01
Bone mass loss associated with pregnancy and lactation is usually regained in the postpartum period. However, it is not known whether the bone loss is completely recovered in women with a shortened interpregnancy interval (IPI). The aim of this study was to analyze the effect of IPI and gynecological history on postmenopausal osteoporosis. The study was conducted among 537 postmenopausal women who were divided into two groups in accordance with the osteoporosis status. Prior to bone densitometry, the patients were questioned about reproductive history. Dual-energy X-ray absorptiometry was used to measure lumbar spinal, femur neck and total femoral bone mineral density. Association between IPI and postmenopausal osteoporosis was analyzed. The comparison of both groups according to the total duration of breastfeeding did not reveal a considerable variation (p=0.288). In the osteoporosis group the age and duration of menopause were found to be significantly higher (p<0.001) whereas the age of first pregnancy and IPI were notably lower in comparison to the controls group (p<0.001). Multivariate logistic regression analyses revealed that women who have 0-12 months interpregnancy interval have the highest risk for osteoporosis (OR: 4.306; 95% CI, 1.684-11.01). This analysis confirmed that the occurrence of first pregnancy under 27 years of age conveyed a higher risk for osteoporosis, as well. Shortened IPI may have a detrimental effect on bone mineral density in postmenopausal age. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Marrow Fat Quality Differences by Sex in Healthy Adults.
Maciel, Jamilly G; de Araújo, Iana M; Carvalho, Adriana L; Simão, Marcelo N; Bastos, Clara M; Troncon, Luiz E A; Salmon, Carlos E G; de Paula, Francisco J A; Nogueira-Barbosa, Marcello H
Several studies have demonstrated the relationship between bone marrow adiposity (BMAT) and bone mass. 1 H magnetic resonance spectroscopy is a noninvasive technique able to assess both BMAT quantity and quality. The aim of our study was to perform quantitative and qualitative analyses of BMAT and to investigate its association with bone mineral density (BMD) in healthy nonobese volunteers. Fifty-one healthy volunteers, 21 men and 30 women, underwent 1.5 T 1 H magnetic resonance spectroscopy of the lumbar spine. BMD was determined by dual-energy X-ray absorptiometry of the lumbar spine. Correlation analysis was performed to evaluate association among lipids fractions, BMD, and age. The female and male volunteers had similar body mass index and BMD (p > 0.05). Our data demonstrated an inverse correlation of BMD and BMAT with age, with a stronger correlation of saturated lipids (r = 0.701; p < 0.0001) compared with unsaturated lipids (UL) (r = 0.278; p = 0.004). Importantly, female subjects had the highest amount of UL (confidence interval: 0.685%-1.722%; p < 0.001). Our study reports that men and women with similar BMD and body mass index have striking differences in bone marrow lipids composition, namely women have higher UL than men. In addition, we believe that our study brings new insights to the complex network involving BMAT and other factors that influence bone integrity. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
An ultrasound wearable system for the monitoring and acceleration of fracture healing in long bones.
Protopappas, Vasilios C; Baga, Dina A; Fotiadis, Dimitrios I; Likas, Aristidis C; Papachristos, Athanasios A; Malizos, Konstantinos N
2005-09-01
An ultrasound wearable system for remote monitoring and acceleration of the healing process in fractured long bones is presented. The so-called USBone system consists of a pair of ultrasound transducers, implanted into the fracture region, a wearable device and a centralized unit. The wearable device is responsible to carry out ultrasound measurements using the axial-transmission technique and initiate therapy sessions of low-intensity pulsed ultrasound. The acquired measurements and other data are wirelessly transferred from the patient-site to the centralized unit, which is located in a clinical setting. The evaluation of the system on an animal tibial osteotomy model is also presented. A dataset was constructed for monitoring purposes consisting of serial ultrasound measurements, follow-up radiographs, quantitative computed tomography-based densitometry and biomechanical data. The animal study demonstrated the ability of the system to collect ultrasound measurements in an effective and reliable fashion and participating orthopaedic surgeons accepted the system for future clinical application. Analysis of the acquired measurements showed that the pattern of evolution of the ultrasound velocity through healing bones over the postoperative period monitors a dynamic healing process. Furthermore, the ultrasound velocity of radiographically healed bones returns to 80% of the intact bone value, whereas the correlation coefficient of the velocity with the material and mechanical properties of the healing bone ranges from 0.699 to 0.814. The USBone system constitutes the first telemedicine system for the out-hospital management of patients sustained open fractures and treated with external fixation devices.
Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D
2008-01-01
Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.
Osteopenia of Prematurity: Are We at Risk?
Mannan, M A; Jahan, I; Rahman, M Z; Hasan, Z; Dey, A C; Shahidullah, M
2015-07-01
The continuous advances in intensive care have led to increased survival of premature infants. As a consequence, the problem of less imminent, slowly progressing disorders such as osteopenia of prematurity has been emerging. Osteopenia of prematurity (OOP) also called metabolic bone disease of prematurity (MBD) or rickets of prematurity is characterized by a reduction in bone mineral content usually manifest between 6th to 12th weeks of corrected gestational age. It occurs in up to 55% of infants born with weight <1000gm and 23% of infants weighing <1500gm. Clinical features of osteopenia of prematurity are mostly non-specific often appears as a late symptoms. Several biochemical markers have frequently been used as screening tools and diagnostic markers, but timing of measurements and the levels at which treatment should be initiated vary widely. Dual energy X-ray absorptiometry (DEXA) and Quantitative ultrasnogram are important diagnostic tool. Standard X-ray, a widely accepted but cannot detect osteopenia unless 20% loss of bone mineralization. The treatment of osteopenia includes provision of adequate mineral supplementation. Monitoring of serum and urinary markers are mandatory. The focus on prevention has largely centered on providing adequate intake of phosphorus and calcium but more research is needed. Till date there are neither enough data regarding clinical risk factors, valid biochemical markers which can detect premature babies at risk of osteopenia nor supplementation as well as appropriate timely management protocol is practicing in Bangladesh.
Mushroom Extracts Decrease Bone Resorption and Improve Bone Formation.
Erjavec, Igor; Brkljacic, Jelena; Vukicevic, Slobodan; Jakopovic, Boris; Jakopovich, Ivan
2016-01-01
Mushroom extracts have shown promising effects in the treatment of cancer and various chronic diseases. Osteoporosis is considered one of the most widespread chronic diseases, for which currently available therapies show mixed results. In this research we investigated the in vitro effects of water extracts of the culinary-medicinal mushrooms Trametes versicolor, Grifola frondosa, Lentinus edodes, and Pleurotus ostreatus on a MC3T3-E1 mouse osteoblast-like cell line, primary rat osteoblasts, and primary rat osteoclasts. In an animal osteoporosis model, rats were ovariectomized and then fed 2 mushroom blends of G. frondosa and L. edodes for 42 days. Bone loss was monitored using densitometry (dual-energy X-ray absorptiometry) and micro computed tomography. In the concentration test, mushroom extracts showed no toxic effect on MC3T3-E1 cells; a dose of 24 µg/mL showed the most proliferative effect. Mushroom extracts of T. versicolor, G. frondosa, and L. edodes inhibited osteoclast activity, whereas the extract of L. edodes increased osteoblast mineralization and the production of osteocalcin, a specific osteoblastic marker. In animals, mushroom extracts did not prevent trabecular bone loss in the long bones. However, we show for the first time that the treatment with a combination of extracts from L. edodes and G. frondosa significantly reduced trabecular bone loss at the lumbar spine. Inhibitory properties of extracts from L. edodes on osteoclasts and the promotion of osteoblasts in vitro, together with the potential to decrease lumbar spine bone loss in an animal osteoporosis model, indicate that medicinal mushroom extracts can be considered as a preventive treatment and/or a supplement to pharmacotherapy to enhance its effectiveness and ameliorate its harmful side effects.
Climent, Marta; Pera, Manuel; Aymar, Isabel; Ramón, José M; Grande, Luis; Nogués, Xavier
2018-07-01
Bone disease in long-term survivors after gastric cancer resection has received little research attention. This study aimed to investigate bone health after curative resection of gastric cancer and the consequences of high-dose vitamin D supplementation in patients with low levels of 25-(OH)-vitamin D. Disease-free patients at least 24 months after gastric cancer resection represented the study cohort. Serum markers of bone metabolism were assessed at baseline and at 3 and 12 months. Bone mineral density and presence of fractures were assessed by X-ray at baseline. Patients with 25-(OH)-vitamin D ≤30 ng/mL at baseline received 16,000 IU of vitamin D3 every 10 days during the 1-year follow-up. Forty patients were included in the study. Mean time from surgery was 48.9 (24-109) months. Vitamin D insufficiency and secondary hyperparathyroidism were observed in 38 and 20 patients, respectively. Densitometry showed osteoporosis in 14 women and seven men and prevalent fractures in 12 women and six men at baseline. After 3 months of vitamin D supplementation, 35 patients reached values of 25-(OH)-vitamin D over 30 ng/mL. After 12 months, 38 patients were in the normal range of 25-(OH)-vitamin D. At the same time, iPTH levels and markers of bone turnover (C-terminal cross-linked telopeptide of type-I collagen, serum concentrations of bone-specific alkaline phosphatase and osteocalcin) significantly decreased after vitamin D intervention. Oral administration of high doses of vitamin D is easily implemented and restored 25-(OH)-vitamin D and iPTH values, which are frequently disturbed after gastric cancer resection.
Osteoporosis, bone mineral density and CKD-MBD complex (I): Diagnostic considerations.
Bover, Jordi; Ureña-Torres, Pablo; Torregrosa, Josep-Vicent; Rodríguez-García, Minerva; Castro-Alonso, Cristina; Górriz, José Luis; Laiz Alonso, Ana María; Cigarrán, Secundino; Benito, Silvia; López-Báez, Víctor; Lloret Cora, María Jesús; daSilva, Iara; Cannata-Andía, Jorge
2018-04-24
Osteoporosis (OP) and chronic kidney disease (CKD) independently influence bone and cardiovascular health. A considerable number of patients with CKD, especially those with stages 3a to 5D, have a significantly reduced bone mineral density leading to a high risk of fracture and a significant increase in associated morbidity and mortality. Independently of classic OP related to age and/or gender, the mechanical properties of bone are also affected by inherent risk factors for CKD ("uraemic OP"). In the first part of this review, we will analyse the general concepts regarding bone mineral density, OP and fractures, which have been largely undervalued until now by nephrologists due to the lack of evidence and diagnostic difficulties in the context of CKD. It has now been proven that a reduced bone mineral density is highly predictive of fracture risk in CKD patients, although it does not allow a distinction to be made between the causes which generate it (hyperparathyroidism, adynamic bone disease and/or senile osteoporosis, etc.). Therefore, in the second part, we will analyse the therapeutic indications in different CKD stages. In any case, the individual assessment of factors which represent a higher or lower risk of fracture, the quantification of this risk (i.e. using tools such as FRAX ® ) and the potential indications for densitometry in patients with CKD could represent an important first step pending new clinical guidelines based on randomised studies which do not exclude CKD patients, all the while avoiding therapeutic nihilism in an area of growing importance. Copyright © 2018 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.
Naz, Marzieh Saei Ghare; Ozgoli, Giti; Aghdashi, Mir Amir; Salmani, Fatemeh
2016-01-01
Background: Osteoporosis is one of the fastest growing health problems around the world. Several factors can affect this silent disease. The current study aimed to determine the prevalence and risk factors of osteoporosis in women in Urmia, a city in northwestern Iran. Methods: This cross-sectional study was performed on 360 non-pregnant women over the age of 15 who referred for bone density testing to the Urmia Imam Khomeini Academic Hospital. Data were collected by questionnaire, and bone mineral density of the femoral neck and lumbar spines L1- L4 was evaluated by dual X-ray absorptiometry. Results: The total prevalence of osteoporosis in this study was 42.2%; prevalence of osteoporosis among women 45 years old or less was 14.3% and over the age of 45 years was 50.7%. The factors such as level of education, history of bone fracture, disease history (rheumatoid arthritis, diabetes, high blood pressure), gravidity and parity values, duration of lactation (p<0.001), nutrition dimension of lifestyle (p=0.03), and green tea consumption (p=002) showed a statistically significant association with the bone mineral density. According to the regression model, age (OR=1.081), history of bone fracture (OR=2.75), and gravidity (OR=1.14) were identified as significant risk factors for osteoporosis, while the body mass index (OR=0.94) was identified as a protector against osteoporosis. Conclusion: The prevalence of osteoporosis in this study was high, and findings showed that the advancement of age, lifestyle, and reproductive factors (especially gravidity and duration of lactation) were determining factors for osteoporosis. Appropriate educational programs and interventions could help to increase the women’s peak bone mass therefore reducing their risk of developing osteoporosis. PMID:26925890
Tse, Sze Man; Kelly, H. William; Litonjua, Augusto; Van Natta, Mark L.; Weiss, Scott T.; Tantisira, Kelan
2012-01-01
Background The adverse effects of corticosteroids on bone mineral accretion (BMA) have been well documented. Vitamin D insufficiency, a prevalent condition in the pediatric population, has also been associated with decreased bone mineral density (BMD). Objective To determine whether children with asthma who have lower vitamin D levels are more susceptible to the negative effects of corticosteroids on BMD over time. Methods Children aged 5–12 years with mild-to-moderate asthma who participated in the Childhood Asthma Management Program were followed for a mean of 4.3 years. Total doses of inhaled and oral corticosteroids (OCS) were recorded, serum 25-hydroxyvitamin D3 levels were measured at the beginning of the trial and serial DEXA scans of the lumbar spine were performed. Annual BMA rates were defined as: [(BMD at 4 years follow-up − BMD at baseline)/4 years]. Results BMA was calculated for 780 subjects. In boys, baseline vitamin D levels significantly modified the relationship between OCS and BMA (vitamin D x OCS interaction, p=0.023). Stratification by vitamin D levels showed a decrease in BMA with increased use of OCS in vitamin D insufficient boys only (p<0.001). Compared to vitamin D sufficient boys, vitamin D insufficient boys exposed to more than 2 courses of oral corticosteroids per year had twice the decrease in BMA rate (relative to boys who were OCS-unexposed). Conclusions Vitamin D levels significantly modified the effect of oral corticosteroids on bone mineral accretion in boys. Further research is needed to examine whether vitamin D supplementation in children with poorly controlled asthma may confer benefits to bone health. PMID:22608570
Andersen, Birgitte; Straarup, Ellen M; Heppner, Kristy M; Takahashi, Diana L; Raffaele, Virginia; Dissen, Gregory A; Lewandowski, Katherine; Bödvarsdottir, Thóra B; Raun, Kirsten; Grove, Kevin L; Kievit, Paul
2018-06-11
Administration of FGF21 and FGF21 analogues reduce body weight; improve insulin sensitivity and dyslipidemia in animal models of obesity and in short term clinical trials. However potential adverse effects identified in mice have raised concerns for the development of FGF21 therapeutics. Therefore, this study was designed to address the actions of FGF21 on body weight, glucose and lipid metabolism and importantly its effects on bone mineral density (BMD), bone markers, and plasma cortisol in high-fat fed obese rhesus macaque monkeys. Obese non-diabetic rhesus macaque monkeys (five males and five ovariectomized (OVX) females) were maintained on a high-fat diet and treated for 12 weeks with escalating doses of FGF21. Food intake was assessed daily and body weight weekly. Bone mineral content (BMC) and BMD were measured by DEXA scanning prior to the study and on several occasions throughout the treatment period as well as during washout. Plasma glucose, glucose tolerance, insulin, lipids, cortisol, and bone markers were likewise measured throughout the study. On average, FGF21 decreased body weight by 17.6 ± 1.6% after 12 weeks of treatment. No significant effect on food intake was observed. No change in BMC or BMD was observed, while a 2-fold increase in CTX-1, a marker of bone resorption, was seen. Overall glucose tolerance was improved with a small but significant decrease in HbA 1C . Furthermore, FGF21 reduced concentrations of plasma triglycerides and very low density lipoprotein cholesterol. No adverse changes in clinical chemistry markers were demonstrated, and no alterations in plasma cortisol were observed during the study. In conclusion, FGF21 reduced body weight in obese rhesus macaque monkeys without reducing food intake. Furthermore, FGF21 had beneficial effects on body composition, insulin sensitivity, and plasma triglycerides. No adverse effects on bone density or plasma cortisol were observed after 12 weeks of treatment.
The effect of nutritional rickets on bone mineral density.
Thacher, Tom D; Fischer, Philip R; Pettifor, John M
2014-11-01
Nutritional rickets is caused by impaired mineralization of growing bone. The effect of nutritional rickets on areal bone mineral density (aBMD) has not been established. Our objective was to determine if aBMD is lower in children with active rickets than in healthy control children. We expected that the reduction in aBMD would vary between the radial and ulnar metaphyses near the growth plates and the proximal diaphyses. Case-control study. Primary care outpatient department of a teaching hospital in Jos, Nigeria. Nigerian children with radiographically-confirmed rickets were compared with a reference group of control children without rickets from the same community. Forearm bone density measurements were performed in all children with pDXA. Age, sex, and height-adjusted bone density parameters were compared between children with rickets and control subjects. A total of 264 children with active rickets (ages 13-120 months) and 660 control children (ages 11-123 months) were included. In multivariate analyses controlling for height, age, and gender, rickets was associated with a 4% greater bone area and 7% lower aBMD of the radial and ulnar metaphyses compared with controls (P < .001). The effects of rickets on the diaphyses of the radius and ulna were more pronounced with an 11% greater bone area, 21% lower aBMD, and 24% lower bone mineral apparent density than controls (P < .001). In children with rickets, aBMD values were unrelated to dairy product intake or serum calcium, phosphorus, alkaline phosphatase, or 25-hydroxyvitamin D. Metaphyseal aBMD was positively associated with radiographic severity score, attributed to bone edge detection artifact by densitometry in active rickets. Rickets results in increased bone area and reduced aBMD, which are more pronounced in the diaphyseal than in the metaphyseal regions of the radius and ulna, consistent with secondary hyperparathyroidism, generalized osteoid expansion and impaired mineralization.
Bahtiri, Elton; Islami, Hilmi; Hoxha, Rexhep; Bytyqi, Hasime Qorraj-; Sermaxhaj, Faton; Halimi, Enis
2014-01-01
Background and objective: There is paucity of evidence in southeastern Europe and Kosovo regarding dairy products consumption and association with bone mineral density (BMD). Therefore, the objective of present study was to assess calcium intake and dairy products consumption and to investigate relationship with total hip BMD in a Kosovo women sample. Methods: This cross-sectional study included a sample of 185 women divided into respective groups according to total hip BMD. All the study participants completed a food frequency questionnaire and underwent dual-energy X-ray absorptiometry (DEXA) to estimate BMD. Nonparametric tests were performed to compare characteristics of the groups. Results: The average dietary calcium intake was 818.41 mg/day. Only 16.75% of the subjects met calcium recommended dietary reference intakes (DRIs). There were no significant differences between low BMD group and normal BMD group regarding average dietary calcium intake, but it was significantly higher in BMDT3 subgroup than in BMDT2 and BMDT1 subgroups. Conclusions: The results of this study demonstrate significant relationship of daily dietary calcium intake with upper BMD tertile. Further initiatives are warranted from this study to highlight the importance of nutrition education. PMID:25568548
[Physical activity/sports and bone mineral density].
Inomoto, Takeaki
2008-09-01
This study observed the amount of exercise of Japanese schoolchildren as recorded by pedometer. Schools are necessary venues to increase children's mobility, but home environments are hotbeds for lack of exercise on weekends and during holidays and vacations. This research measured the L(2 - 4)BMD of 185 male and female primary schoolchildren using a DEXA method. Results showed significant partial correlations for measurements of boys' grip strength, boys' standing broad jump, and girls' grip strength, indicating the influence of mechanical stress. In a parallel study, L(2 - 4)BMD measurements for high school athletic club members (14 and 10 sports for boys and girls respectively) were taken, and it was found that the L(2 - 4)BMD (60 kg/weight) values were significantly higher than the control values for boys' boxing and weightlifting but significantly lower for boys' sumo. No significance was found in L(2 - 4)BMD (50 kg/weight) among the different girls' sports. From both studies, it was concluded that with approximately 2 hours of moderate play and exercise daily, the bone density of children rises with increase of overall muscle quantity, resulting in higher athletic ability and overall physical strength.
Banu, J; Orhii, P B; Okafor, M C; Wang, L; Kalu, D N
2001-06-01
The aim of this study is to determine the effects of growth hormone (GH), exercise (EX), GH+EX and food restriction on cancellous bone in middle-aged female rats. Female F344 rats aged 13 months were divided into (1) age-matched controls; (2) GH treated (2.5 mg/kg. 5 day/week); (3) EX (voluntary wheel running); (4) GH+EX; and (5) food restricted (FR) (fed 60% of the ad libitum food intake). The animals were treated for 18 weeks, at the end of which they were sacrificed. Cancellous bone and cortical bone in the fourth lumbar vertebra, proximal tibial metaphysis (PTM), distal femoral metaphysis (DFM) and femoral neck (NF) were analyzed using peripheral quantitative computerized tomography (pQCT) densitometry. Growth hormone increased cancellous bone area, cancellous bone mineral content, cortical bone area and cortical bone mineral content in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly after GH treatment. Exercise increased the cancellous bone area in the vertebra, PTM and DFM. Cortical bone area and cortical bone mineral content increased after EX in the vertebra, PTM, DFM and NF. No significant change was seen in the tibial muscle wet weight after EX. Growth hormone+EX increased cancellous bone area in the vertebra PTM and DFM but had no effect in neck of the femur. Cancellous bone mineral content, cortical bone area and cortical bone mineral content increased with GH+EX in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly with GH+EX. Food restriction decreased cancellous bone area and cancellous bone mineral content in all the bones studied. The decrease was statistically significant only at the distal femoral metaphysis. The tibial muscle wet weight decreased when compared with the age-matched control, but this decrease was not statistically significant. We conclude that the effect of the dose of GH used and the levels of voluntary wheel running EX used increased cancellous bone in intact rats; the effect of GH is much greater and different bones respond with varying intensities. The effects of combined treatment of GH and EX on cancellous bone are not always significantly higher than those of GH alone. FR at the level studied has a mostly negative effect on cancellous bone.
Mazouri, Ali; Khosravi, Nastaran; Bordbar, Arash; Khalesi, Nasrin; Saboute, Maryam; Taherifard, Pegah; Mirzababaee, Marjan; Ebrahimi, Mehran
2017-06-01
The use of parenteral nutritional supplementation of phosphorus may lead to exhibit higher plasma phosphate concentrations and less radiological features in premature neonates susceptible to osteopenia. The present study aimed to assess the beneficial effects of adding intravenous phosphorus to total parenteral nutrition (TPN) on calcium and phosphorus metabolism in preterm neonates by measuring bone mineral content. This open-labeled randomized clinical trial was conducted on premature neonates who were hospitalized at NICU. The neonates were randomly assigned to two groups received TPN with intravenous sodium glycerophosphate or Glycophos (1.5 mmol/kg/day) or TPN without sodium glycerophosphate. At the end of the four weeks of treatment, the presence of osteopenia was examined using DEXA Scan. After completing treatment protocols, the group received TPN with intravenous Glycophos had significantly lower serum alkaline phosphatase (360±60 versus 762±71, P<0.001), as well as higher serum calcium to creatinine ratio (1.6±0.3 versus 0.44±0.13, P<0.001) compared to the control group received TPN without Glycophos. Those who received TPN with intravenous Glycophos experienced more increase in bone mineral density than those in control group (0.13±0.01 versus 0.10±0.02, P<0.001). There was no significant difference in serum calcium and serum vitamin D between the case and control groups. Adding intravenous sodium glycerophosphate to TPN in premature neonates can compensate the lack of bone mineral content and help to prevent osteopenia.
Prevention and treatment of bone fragility in cancer patient
Ottanelli, Silva
2015-01-01
Summary It is well known that fractures increase the risk of morbidity and mortality. The various mechanisms responsible for bone loss in cancer patients may have a different impact depending on the characteristics of the clinical case and correlates with the therapies used, or caused by the therapies used against cancer. Some hormonal treatments cause hypogonadism, event which contributes to the progressive loss of bone mass. This is detectable in patients with breast cancer receiving determines that estrogen-deprivation and in men with prostate cancer with therapies that determine androgen deprivation. Chemotherapy treatments used in cancer patients have reduced bone mass. In addition, low bone mass is detectable in patients with lymphoma treated with corticosteroids or radiation or alkylating agents. In premenopausal patients suffering from breast cancer, treatment with cytotoxic therapy or ablation of ovarian function, can lead to an 8% reduction in bone mineral density at the spine and 4% in the femur. With a chemotherapy regimen in CMF, the reduction of BMD is 6.5%; this bone loss is not recovered after discontinuation of therapy. Tamoxifen given for five years reduces bone remodeling and cause a 32% increase in the risk of osteoporotic fractures when used in premenopausal. After menopause, tamoxifen has a protective effect on bone mass, with a reduced risk of new fractures. Aromatase inhibitors in post-menopausal women, depending on the formulation can cause different effects on the reduction of BMD and fracture risk. We have in fact steroids, exemestane and nonsteroidal, letrozole and anastrozole. Patients at increased risk of fragility fractures should undergo preventive therapies as soon as possible after tests performed for the study of bone health. They can be used DEXA and the FRAX algorithm, which can define a secondary osteoporosis. Prevention and treatment of the increased risk of osteoporotic fracture is to maintain adequate levels of calcium and vitamin D. Bisphosphonates and denosumab are used for the management of bone remodeling and bone loss induced by cancer treatments. Bisphosphonates also have anti-tumor effects per se, which are expressed in potentially prevent the development of bone metastases. In men with metastatic prostate cancer and which is induced androgen deprivation, it is usefully used denosumab 120 mg monthly or zoledronic acid 4 mg monthly. PMID:26604936
Roztoczyńska, Dorota; Starzyk, Jerzy
2009-01-01
Anorexia nervosa and bulimia nervosa are counted among psychosomatic diseases, whose incidence has been rapidly increasing in the last decades. To date, the etiology, diagnostic and therapeutic management of eating disorders have not been uniformly determined. The objective of the study is determination of the role of a pediatric endocrinologist in diagnostics and management of eating disorders. In the years 1992-2007 in Department of Pediatric and Adolescent Endocrinology Chair of Pediatrics, Polish-American Institute of Pediatrics, Collegium Medicum, Jagiellonian University in Krakow, Poland were hospitalized 164 patients with suspected anorexia nervosa, aged 9-20 years, 150 girls, and 14 boys. All girls were included in psychological and dietetic treatment. Additionally, in group of 36 girls, the 3-years observation of bone mineralization changes was performed. The indications for hospitalization included the assessment of nutritional status, particularly electrolyte imbalance, cardiovascular complications and nutritional treatment. II. Procedure included on department: 1) Correction of general children's state. 2) Monitoring of cardiovascular system disorders. 3) Nutritional treatment. 4) Differential diagnosis. III. Prevention and treatment of late complications was performed in group of 36 girls. In this group, every 6 months were evaluated: body mass index, duration of secondary amenorrhea, serum sex hormone, IGF-I and cortisol levels and 24-hour urine cortisol. Spine densitometry in the AP projection was performed every 12 months, using a Lunar unit (DEXA). The pharmacological treatment of osteoporosis was introduced in girls with duration of secondary amenorrhea lasted for more than 6 months, with decreased bone mineralization BMD < (-) 1SD and body mass deficit < 20%. 16 girls which did not presented disorders of bone mineralization, or refused treatment have not got the pharmacological treatment, while in 20 girls the pharmacological therapy (calcium and vitamin D3 supplementation and hormonal treatment - Estraderm TTS and Provera 5 mg) was provided. Anorexia nervosa was diagnosed in 150 cases, bulimia in 6 cases, in 2 children was diagnosed celiac disease, in 2 patients adrenal insufficiency, in 1 girl myasthenia, in 1 girl diabetes mellitus type 1, in 1 boy hypothalamo-pituitary tumor and in 1 boy psychosis was diagnosed. The nutritional improvement was evaluated in group of 36 girls, which continued treatment in time 3 years. At the beginning of the observation period the mean value of the body mass index (BMI) was 15.95 kg/m2, and after 36 months of the treatment the mean BMI value was 20 kg/m2. Before the treatment one patient was still menstruated despite her body mass loss, 8 girls were pre-menarche, and the remaining 27 patients had secondary amenorrhea of the mean duration of 11.14 months. In the initial period of the follow-up, all the anorectic patients demonstrated a decreased bone mineral density. Before treatment the median Z score in the entire experimental group was (-)1,2 SD whereas after 3 years of treatment value of Z score decreased by 0,5 SD in group of 16 girls without the pharmacological treatment and increased by 0,5 SD in 20 girls on pharmacological treatment. The significant, negative correlation between secondary amenorrhea and Z score value was observed. The role of a pediatrician in therapeutic management of eating disorders is intervention in life-threatening conditions, treatment of acute complications, differential diagnosis, nutritional treatment, prevention and management of late complications. Because of etiology and special way of treatment the management of anorexia nervosa should have been taken by psychiatrist. The duty of endocrinologists and gynecologists is the late complications treatment, such as an amenorrhea and osteoporosis.
Bordbar, Mohammad Reza; Haghpanah, Sezaneh; Dabbaghmanesh, Mohammad Hossein; Omrani, Gholamhossein Ranjbar; Saki, Forough
2016-12-01
Acute leukemia is the most common malignancy in children. We showed that low bone mass is prevalent among children with leukemia, especially in femur. Serum calcium, exercise, chemotherapy protocol, and radiotherapy are the main contributing factors. We suggest that early diagnosis and treatment of this problem could improve bone health in them. Acute leukemia is the most common malignancy in children and has been reported to be associated with low bone mass. Due to lack of sufficient data about the bone mineral density of children with leukemia in the Middle East, and inconsistencies between possible associated factors contributing to decreasing bone density in these children, we aimed to conduct a case-control study in Iran. This case-control study was conducted on 60 children with acute leukemia and 60 age- and sex-matched healthy controls. Anthropometric data, sun exposure, puberty, physical activity, and mineral biochemical parameters were assessed. Bone mineral density (BMD) was measured by dual-energy X-ray absorptiometry (DEXA). Data analysis was done by SPSS software v. 21. Serum calcium was higher in the control group (P = 0.012) while serum phosphorous, alkaline phosphatase, and serum 25(OH)D 3 were higher in children with leukemia with P values of 0.04, 0.002, and 0.036, respectively. Sun exposure and physical activity were more in healthy controls (P values <0.001 and 0.003, respectively). Prevalence of vitamin D deficiency in case and control groups was 57.8 and 79.4 %, respectively. This prevalence was higher in healthy controls (P value = 0.007). Both lumbar and femoral neck bone mineral apparent density (BMAD) were higher in the control group (P value <0.001). Serum calcium, physical activity, and radiotherapy were the most relevant factors associated with lumbar BMAD. Femoral neck BMAD was associated with chemotherapy protocol. Low bone mass for chronological age is prevalent among children with leukemia, especially in the femoral neck. Serum calcium, physical activity, chemotherapy protocol, and radiotherapy are the main contributing factors.
Additive effect of PTH (1-34) and zoledronate in the prevention of disuse osteopenia in rats.
Vegger, Jens Bay; Nielsen, Esben Sommer; Brüel, Annemarie; Thomsen, Jesper Skovhus
2014-09-01
Immobilization is known to cause a rapid bone loss due to increased osteoclastic bone resorption and decreased osteoblastic bone formation. Zoledronate (Zln) is a potent anti-resorptive pharmaceutical, while intermittent PTH is a potent bone anabolic agent. The aim of the present study was to investigate whether PTH or Zln alone or in combination could prevent immobilization-induced osteopenia. Immobilization was achieved by injecting 4IU Botox (BTX) into the right hind limb musculature. Seventy-two 16-week-old female Wistar rats were randomized into 6 groups; baseline (Base), control (Ctrl), BTX, BTX+PTH, BTX+Zln, and BTX+PTH+Zln. PTH (1-34) (80μg/kg) was given 5days/week and Zln (100μg/kg) was given once at study start. The animals were killed after 4weeks of treatment. The bone properties were evaluated using DEXA, μCT, dynamic bone histomorphometry, and mechanical testing. BTX resulted in lower femoral trabecular bone volume fraction (BV/TV) (-25%, p<0.05), lower tibial trabecular bone formation rate (BFR/BS) (-29%, p<0.05), and lower bone strength (Fmax) at the distal femur (-19%, p<0.001) compared with Ctrl. BTX+PTH resulted in higher femoral BV/TV (+31%, p<0.05), higher tibial trabecular BFR/BS (+297%, p<0.05), and higher Fmax at the distal femur (+11%, p<0.05) compared with BTX. BTX+Zln resulted in higher femoral BV/TV (+36%, p<0.05), lower tibial trabecular BFR/BS (-93%, p<0.05), and higher Fmax at the distal femur (+10%, p<0.05) compared with BTX. BTX+PTH+Zln resulted in higher femoral BV/TV (+70%, p<0.001), higher tibial trabecular BFR/BS (+59%, p<0.05), and higher Fmax at the distal femur (+32%, p<0.001) compared with BTX. In conclusion, BTX-induced immobilization led to lower BV/TV, BFR/BS, and Fmax. In general, PTH or Zln alone prevented the BTX-induced osteopenia, whereas PTH and Zln given in combination not only prevented, but also increased BV/TV and BFR/BS, and maintained Fmax at the distal femoral metaphysis compared with Ctrl. Copyright © 2014 Elsevier Inc. All rights reserved.
Deficiency of retinaldehyde dehydrogenase 1 induces BMP2 and increases bone mass in vivo.
Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W; Brown, Jonathan D; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J; Plutzky, Jorge
2013-01-01
The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1(-/-) ) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1(-/-) mice. In serum assays, Aldh1a1(-/-) mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1(-/-) mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1(-/-) mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1(-/-) mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling.
Assessment of Corneal Backward Light Scattering in Diabetic Patients.
Özyol, Pelin; Özyol, Erhan
2016-10-03
To analyze corneal backward light scattering differences in patients with type 2 diabetes mellitus. We enrolled 43 eyes from 43 diabetic patients and 40 eyes from 40 healthy controls. Corneal backward light scattering was evaluated using densitometry measurements from different corneal layers and zones obtained using Scheimpflug tomography (PentacamHR). When densitometry values were divided by depth, anterior layer of diabetic corneas displayed significantly higher corneal backward light scattering values than controls (32.05, 95% confidence intervals [CI], 31.02-33.08 vs. 29.18, 95% CI, 27.60-30.76, P=0.024). Corneal densitometry measurements were also significantly higher in diabetic eyes compared with control eyes, when considered by concentric zones of total cornea in the 0 to 2 mm (21.65, 95% CI, 20.28-23.01 vs. 18.87 95% CI, 18.49-19.25, P=0.020), and anterior layer in the 0 to 2 mm (27.3, 95% CI, 25.04-29.56 vs. 22.31, 95% CI, 20.57-24.05, P<0.001), 2 to 6 mm (26.2, 95% CI, 24.99-27.41 vs. 22.4, 95% CI, 20.18-24.62, P<0.001) and 6 to 10 mm (32.19, 95% CI, 29.98-34.40 vs. 27.2, 95% CI, 25.39-29.01, P=0.022). There was excellent positive correlation between anterior total corneal densitometry measurements and duration of diabetes (r=0.802, P<0.001), although no significant correlation was observed with anterior total corneal densitometry measurements and hemoglobin A1c levels (r=0.080, P=0.621) in diabetic eyes. Backward light scattering values from the anterior layer of the cornea is greater in diabetic eyes than in controls. Anterior total corneal densitometry measurements show positive correlation with the duration of diabetes.
Tomaszewska, Ewa; Dobrowolski, Piotr; Bieńko, Marek; Prost, Łukasz; Szymańczyk, Sylwia; Zdybel, Adam
2015-11-01
The structural quality of the connective tissue is genetically determined and is influenced by hormonal and nutritional modification. An effect of a 2-Ox-rich diet on bone mineralization and structure and expression of non-collagenous protein in articular and growth cartilages of maternal dexamethasone-treated 9-month-old boars was considered in this study. Sows were treated i.m. with dexamethasone at the dose of 0.03 mg kg(-1) body weight every second day during the last 45 days of pregnancy. After the birth, the boars were divided into two groups: administered and not supplemented with 2-Ox for 9 months (0.4 g/kg body weight/day). Dexamethasone given during the prenatal time inhibited the growth and negatively influenced the mechanics, geometry and histomorphometrical parameters of long bones and cartilage irrespective of the diet. Moreover, maternal dexamethasone treatment resulted in expression of osteocalcin in the articular cartilage, and the diet rich in 2-Ox limited the OC expression. This study demonstrated that changes observed in adult boars initiated by dexamethasone treatment in the prenatal period were persistent and long-term use of alimentary 2-Ox supplementation can counteract only some of the destructive changes evoked by prenatal dexamethasone excess.
Katrancioglu, Ozgur; Akkas, Yucel; Arslan, Sulhattin; Sahin, Ekber
2015-07-01
Other than trauma, rib fracture can occur spontaneously due to a severe cough or sneeze. In this study, patients with spontaneous rib fractures were analyzed according to age, sex, underlying pathology, treatment, and complications. Twelve patients who presented between February 2009 and February 2011 with spontaneous rib fracture were reviewed retrospectively. The patients' data were evaluated according to anamnesis, physical examination, and chest radiographs. The ages of the patients ranged from 34 to 77 years (mean 55.91 ± 12.20 years), and 7 (58.4%) were male. All patients had severe cough and chest pain. The fractures were most frequently between 4th and 9th ribs; multiple rib fractures were detected in 5 (41.7%) patients. Eight (66.7%) patients had chronic obstructive pulmonary disease, 2 (16.7%) had bronchial asthma, and 2 (16.7%) had osteoporosis. Bone densitometry revealed a high risk of bone fracture in all patients. Patients with chronic obstructive pulmonary disease or bronchial asthma had been treated with high-dose steroids for over a year. Spontaneous rib fracture due to severe cough may occur in patients with osteoporosis, chronic obstructive pulmonary disease, or bronchial asthma, receiving long-term steroid therapy. If these patients have severe chest pain, chest radiography should be performed to check for bone lesions. © The Author(s) 2015.
Manousaki, D; Rauch, F; Chabot, G; Dubois, J; Fiscaletti, M; Alos, N
2016-09-07
Knowledge of physiological variations of bone mineral density (BMD) in newborns and infants is necessary to evaluate pathological changes associated with fractures. Limited reference data for children under 5 years old are available. This study provides normative data of lumbar BMD for the Lunar Prodigy in young children under 5 years old. We assessed cross-sectionally 155 healthy children (77 boys, 80% Caucasian), ranging in age from newborn to the age of 5 years. Lumbar bone mineral content (BMC) and areal BMD were measured by dual-energy X-ray absorptiometry using a Lunar Prodigy absorptiometer. Volumetric BMD was calculated using the Kroeger and Carter methods. BMC and areal BMD increased from birth to 5 years (p<0.001). Volumetric BMD did not change with age. BMD and BMC correlated with age, weight and height (R(2)≥0.85 for all), with a maximum gain between the ages of 1 and 4 years, which did not follow the same pattern as height velocity. We did not find significant sex difference for any of the three measured parameters. This study provides normative data for lumbar spine densitometry of infants and young children using the Lunar Prodigy DXA system.
Recent development of radiation measurement instrument for industrial and medical applications
NASA Astrophysics Data System (ADS)
Baba, Sueki; Ohmori, Koichi; Mito, Yoshio; Tanoue, Toshiya; Yano, Shigeki; Tokumori, Kenji; Toyofuku, Fukai; Kanda, Shigenobu
2001-02-01
Recently, computer imaging technology has developed very high-quality image and fast processing time. X-rays have been used for many purposes such as medical diagnosis and analyzing the structure of industrial materials. However, as X-rays are hazardous to the human body, it is desirable to reduce its exposed dose to a minimum. For this purpose, it is necessary to use a semiconductor radiation detector with a high efficiency for X-rays. We have developed photon-counting CdTe array detector system for medical and industrial use. The bone densitometer for Dual Energy X-ray Absorptometry (DEXA) has been developed to make diagnosis of osteoporosis, and it is developed to analyze a material element for industrial use. Recently, we have developed a monochromatic X-ray CT using a 256 ch CdTe array detector. We found that the array detector systems are very useful for medical and industrial applications.
NASA Astrophysics Data System (ADS)
Banerjee, Shashwat S.; Chen, Dong-Hwang
2009-05-01
We report a novel nanoformulation for targeted drug delivery which utilizes nanophotonics through the fusion of nanotechnology with biomedical application. The approach involves an energy-transferring magnetic nanoscopic co-assembly fabricated of rhodamine B (RDB) fluorescent dye grafted gum arabic modified Fe3O4 magnetic nanoparticle and photosensitive linker by which dexamethasone drug is conjugated to the magnetic nano-assembly. The advantage offered by this nanoformulation is the indirect photo-triggered-on-demand drug release by efficient up-converting energy of the near-IR (NIR) light to higher energy and intraparticle energy transfer from the dye grafted magnetic nanoparticle to the linker for drug release by cleavage. The synthesized nanoparticles were found to be of ultra-small size (13.33 nm) and are monodispersed in an aqueous suspension. Dexamethasone (Dexa) drug conjugated to RDB-GAMNP by photosensitive linker showed appreciable release of Dexa by photo-triggered response on exposure to radiation having a wavelength in the NIR region whereas no detectable release was observed in the dark. Photo-triggered response for the nanoformulation not bearing the rhodamine B dye was drastically less as less Dexa was released on exposure to NIR radiation which suggest that the photo-cleavage of linker and release of Dexa mainly originated from the indirect excitation through the uphill energy conversions based on donor-acceptor model FRET. The promising pathway of nanophotonics for the on-demand release of the drug makes this nanocarrier very promising for applications in nanomedicine.
Anzolin, Caroline Cristina; Silva, Diego Augusto Santos; Zanuto, Edner Fernando; Cayres, Suziane Ungari; Codogno, Jamile Sanches; Costa Junior, Paulo; Machado, Dalmo Roberto Lopes; Christofaro, Diego Giulliano Destro
To evaluate the sensitivity and specificity of different cutoff points of body mass index for predicting overweight/obesity according to body fat values estimated by DEXA among Brazilian adolescents. Cross-sectional study including 229 male adolescents aged 10-15 years, in which body adiposity and anthropometric measures were assessed. Nutritional status was classified by BMI according to cutoff points described in scientific literature. Moderate agreements were observed between body fat estimated by DEXA and cutoffs proposed by Cole et al. (K=0.61), Conde and Monteiro (K=0.65), Must et al. (K=0.61) and WHO (K=0.63). The BMI in continuous form showed good agreement with the Dexa (ICC=0.72). The highest sensitivity was observed for cutoff by Conde and Monteiro (0.74 [0.62, 0.84]) and the highest specificity by Cole et al. (0.98 [0.94, 0.99]). For the areas under the ROC curve of cutoff points analyzed, significant difference comparing the cutoff points by Cole et al. and Conde and Monteiro (0.0449 [0.00294, 0.0927]) was observed. The cutoff proposed by Conde and Monteiro was more sensitive in identifying overweight and obesity when compared to the reference method, and the cutoff proposed by Cole et al. presented the highest specificity for such outcomes. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
NASA Astrophysics Data System (ADS)
Perera, Kshanthi; Kumara, W. A. S.; Hansen, Fredrik; Mylvaganam, Saba; Time, Rune W.
2018-06-01
Measurement techniques are vital for the control and operation of multiphase oil–water flow in pipes. The development of such techniques depends on laboratory experiments involving flow visualization, liquid fraction (‘hold-up’), phase slip and pressure drop measurements. They provide valuable information by revealing the physics, spatial and temporal structures of complex multiphase flow phenomena. This paper presents the hold-up measurement of oil–water flow in pipelines using gamma densitometry and electrical capacitance tomography (ECT) sensors. The experiments were carried out with different pipe inclinations from ‑5° to +6° for selected mixture velocities (0.2–1.5 m s‑1), and at selected watercuts (0.05–0.95). Mineral oil (Exxsol D60) and water were used as test fluids. Nine flow patterns were identified including a new pattern called stratified wavy and mixed interface flow. As a third direct method, visual observations and high-speed videos were used for the flow regime and interface identification. ECT and gamma densitometry hold-up measurements show similar trends for changes in pipeline inclinations. Changing the pipe inclination affected the flow mostly at lower mixture velocities and caused a change of flow patterns, allowing the highest change of hold-up. ECT hold-up measurements overpredict the gamma densitometry measurements at higher input water cuts and underpredict at intermediate water cuts. Gamma hold-up results showed good agreement with the literature results, having a maximum deviation of 6%, while it was as high as 22% for ECT in comparison to gamma densitometry. Uncertainty analysis of the measurement techniques was carried out with single-phase oil flow. This shows that the measurement error associated with gamma densitometry is approximately 3.2%, which includes 1.3% statistical error and 2.9% error identified as electromagnetically induced noise in electronics. Thus, gamma densitometry can predict hold-up with a higher accuracy in comparison to ECT when applied to oil–water systems at minimized electromagnetic noise.
Automatic Estimation of Osteoporotic Fracture Cases by Using Ensemble Learning Approaches.
Kilic, Niyazi; Hosgormez, Erkan
2016-03-01
Ensemble learning methods are one of the most powerful tools for the pattern classification problems. In this paper, the effects of ensemble learning methods and some physical bone densitometry parameters on osteoporotic fracture detection were investigated. Six feature set models were constructed including different physical parameters and they fed into the ensemble classifiers as input features. As ensemble learning techniques, bagging, gradient boosting and random subspace (RSM) were used. Instance based learning (IBk) and random forest (RF) classifiers applied to six feature set models. The patients were classified into three groups such as osteoporosis, osteopenia and control (healthy), using ensemble classifiers. Total classification accuracy and f-measure were also used to evaluate diagnostic performance of the proposed ensemble classification system. The classification accuracy has reached to 98.85 % by the combination of model 6 (five BMD + five T-score values) using RSM-RF classifier. The findings of this paper suggest that the patients will be able to be warned before a bone fracture occurred, by just examining some physical parameters that can easily be measured without invasive operations.
Evolutionary Origins of the Differences in Osteoporosis Risk in US Populations.
Nelson, Dorothy A
2018-03-23
Over the past 50 years, it has been increasingly evident that there are population differences in bone mass and the risk of osteoporosis. In the United States, many studies have reported a lower prevalence of osteoporosis in African Americans compared with people of European descent. If we trace the trajectory of changes in lifeways from the earliest migrations of early Homo out of Africa over the past two million years or so, to include lower vitamin D levels in higher latitudes; more meat in the diet; increasing sedentism; and a longer lifespan/longer postmenopausal period, it is not surprising that osteoporosis occurs more frequently in populations of European descent. While many scholars have explored the apparent "paradox" of higher bone mass, lower vitamin D levels, and higher parathyroid hormone levels among African Americans, this brief review of evolutionary shifts that affected our species may change the approach to understanding the current population differences in the United States. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Marques, Thyciara Fontenele; Vasconcelos, Renata; Diniz, Erik; Rêgo, Daniela; Griz, Luiz; Bandeira, Francisco
2015-01-01
Objective To describe the characteristics of normocalcemic primary hyperparathyroidism (NPHPT) in patients seen for osteoporosis evaluation. Patients and methods We examined the records of 156 women who came to the hospital to be screened for osteoporosis. Measurements of total calcium, PTH, 25-hydroxy vitamin D, and β-C-telopeptide were recorded. Bone mineral density and T-scores were evaluated by densitometry of the lumbar spine, femoral neck and distal one-third of the radius. The latter was only measured in patients with primary hyperparathyroidism. Nephrolithiasis and bone fractures were documented by a review of the medical records. Results We identified 14 patients with NPHPT, accounting for 8.9% of the population studied. In the medical records, the occurrence of kidney stones was reported in 28.6% of the patients with NPHPT, in contrast with only 0.7% of the noncarriers. Regarding the presence of general fractures, 21.4% of the patients with NPHPT were affected versus 16.2% of noncarriers. Conclusion Data from our study suggest that NPHPT has a diverse phenotypic presentation, implying that this may not be an “indolent” disease. PMID:21881813
Serum Sclerostin in Hepatitis C Virus Infected Patients
López-Prieto, Javier; Pelazas-González, Ricardo; Alemán-Valls, M.Remedios; José de la Vega-Prieto, María; Jorge-Ripper, Carlos; Durán-Castellón, M. Carmen; Santolaria-Fernández, F
2014-01-01
Background Sclerostin inhibits osteoblast functions, differentiations, and survival rates. As an endogenous inhibitor of the Wnt/β-catenin pathway, the sclerostin should be related to decreased bone masses, although several studies indicate opposite results. In addition, it may be related to insulin resistances and carbohydrate metabolisms, a relation shared with other markers of bone metabolisms, such as osteocalcin. Hepatitis C virus (HCV) infected patients may present osteoporosis, and frequently show liver steatosis, which is a consequence of insulin resistance. The behaviour of sclerostin in these patients is yet unknown. The aim of this work is to analyse the relationships between serum sclerostin and osteocalcin levels and bone mineral density (BMD), liver functions, the intensity of liver steatosis and biochemical markers of bone homeostasis and insulin resistance in HCV-infected patients. Methods Forty HCV patients with 20 years of age and gender-matching controls were included in this study and underwent bone densitometry. Serum sclerostin, osteocalcin, collagen telopeptide, adiponectin, leptin, insulin, resistin, tumor necrosis factor (TNF)-α, and interleukin (IL)-6 were determined. Liver fat was histomorphometrically assessed. Results Sclerostin levels were slightly higher in patients than in controls, and were directly related to BMD at different parts of the skeleton, also to the serum telopeptide, and to the liver steatosis and TNF-α. On the contrary, osteocalcin showed a significant direct relationship with serum adiponectin, and an inverse one with IL-6. Conclusions Serum sclerostin levels were within the normal range in HCV patients, and correlated directly with BMD and serum telopeptide. In addition, the relationships of sclerostin and osteocalcin with variables associated with insulin resistance suggested the role of bones for intermediary metabolisms. PMID:24707469
Saarelainen, Jarmo; Kiviniemi, Vesa; Kröger, Heikki; Tuppurainen, Marjo; Niskanen, Leo; Jurvelin, Jukka; Honkanen, Risto
2012-03-01
Obesity protects against osteoporosis, but the magnitude of this association has been difficult to assess from cross-sectional or short term studies. We examined the time course of bone loss as a function of body mass index (BMI) in early and late postmenopausal women. Our study population (n = 300) was a random sample of the population-based Kuopio Osteoporosis Risk Factor and Prevention (OSTPRE) Study, Finland. We excluded women without complete BMD results, premenopausal women during the second bone densitometry and women who had used hormone replacement therapy, bisphosphonates or calcitonin. BMI along with femoral neck and spinal bone mineral density (BMD) were assessed three times by dual-energy X-ray absorptiometry during a mean follow-up of 10.5 years (SD 0.5). The mean baseline age was 53.6 years (SD 2.8), time since menopause 2.9 years (SD 4.3) and BMI 27.3 kg/m(2) (SD 4.4). The data was analyzed by linear mixed models. Thus, we were able to approximate the bone loss up to 20 postmenopausal years. To illustrate, a woman with a baseline BMI of 20 kg/m(2) became osteopenic 2 (spine) and 4 (femoral neck) years after menopause, while obesity (BMI of 30 kg/m(2)) delayed the incidence of osteopenia by 5 (spine) and 9 (femoral neck) years, respectively. The delay was due to high baseline BMD of the obese, while bone loss rate was similar for both lean and obese subjects. This lean versus obese difference may also be partly due to altered X-ray attenuation due to fat mass.
MANRIQUE, Natalia; PEREIRA, Cassiano Costa Silva; GARCIA, Lourdes Maria Gonzáles; MICARONI, Samuel; de CARVALHO, Antonio Augusto Ferreira; PERRI, Sílvia Helena Venturoli; OKAMOTO, Roberta; SUMIDA, Doris Hissako; ANTONIALI, Cristina
2012-01-01
Hypertension is one of the most important public health problems worldwide. If undiagnosed or untreated, this pathology represents a systemic risk factor and offers unfavorable conditions for dental treatments, especially those requiring bone healing. Objectives The purpose of this study was to demonstrate, by analysis of bone mineral density (BMD), that the alveolar bone healing process is altered in spontaneously hypertensive rats (SHRs). Material and Methods Wistar rats and SHRs were submitted to extraction of the upper right incisor and were euthanized 7, 14, 21, 28 and 42 days after surgery. Right maxillae were collected, radiographed and analyzed using Digora software. BMD was expressed as minimum (min), middle (med) and maximum (max) in the medium (MT) and apical (AT) thirds of the dental alveolus. Results The results were compared across days and groups. Wistar showed difference in med and max BMD in the MT between 7 and 28 and also between 14 and 28 days. The AT exhibited significant difference in med and min BMD between 7 and 28 days, as well as difference in min BMD between 28 and 42 days. SHRs showed lower med BMD in the MT at 28 days when compared to 21 and 42 days. Differences were observed across groups in med and min BMD at day 28 in the MT and AT; and in max BMD at 14, 21 and 42 days in the MT. Conclusions These results suggest that the alveolar bone healing process is delayed in SHRs comparing with Wistar rats. PMID:22666841
Protective effect of myo-inositol hexaphosphate (phytate) on bone mass loss in postmenopausal women.
López-González, Angel A; Grases, Félix; Monroy, Nieves; Marí, Bartolome; Vicente-Herrero, Ma Teófila; Tur, Fernando; Perelló, Joan
2013-03-01
The objective of this paper was to evaluate the relationship between urinary concentrations of InsP6, bone mass loss and risk fracture in postmenopausal women. A total of 157 postmenopausal women were included in the study: 70 had low (≤0.76 μM), 42 intermediate (0.76-1.42 μM) and 45 high (≥1.42 μM) urinary phytate concentrations. Densitometry values for neck were measured at enrollment and after 12 months (lumbar spine and femoral neck), and 10-year risk fracture was calculated using the tool FRAX(®). Individuals with low InsP6 levels had significantly greater bone mass loss in the lumbar spine (3.08 ± 0.65 % vs. 0.43 ± 0.55 %) than did those with high phytate levels. Moreover, a significantly greater percentage of women with low than with high InsP6 levels showed more than 2 % of bone mass loss in the lumbar spine (55.6 vs. 20.7 %). The 10-year fracture probability was also significantly higher in the low-phytate group compared to the high-phytate group, both in hip (0.37 ± 0.06 % vs 0.18 ± 0.04 %) and major osteoporotic fracture (2.45 ± 0.24 % vs 1.83 ± 0.11 %). It can be concluded that high urinary phytate concentrations are correlated with reduced bone mass loss in lumbar spine over 12 months and with reduced 10-year probability of hip and major osteoporotic fracture, indicating that increased phytate consumption can prevent development of osteoporosis.
Falls, fractures and bone density in Parkinson's disease - a cross-sectional study.
Tassorelli, Cristina; Berlangieri, Mariangela; Buscone, Simona; Bolla, Monica; De Icco, Roberto; Baricich, Alessio; Pacchetti, Claudio; Cisari, Carlo; Sandrini, Giorgio
2017-04-01
Evidence suggests that falls and associated bone fractures are more frequent in patients suffering from Parkinson's disease (PD) than in the general population. In this cross-sectional study we evaluated the clinical and biochemical characteristics that are associated to falls, fractures and bone health in a population of PD subjects. Forty-two consecutive subjects suffering from idiopathic PD (mild-to-moderate severity) with/without falls in the previous year were included. They were characterized as regards functional independence, balance, fear of falling, bone density (ultrasound densitometry) and plasma levels of vitamin D. Twenty-one age- and sex-matched healthy subjects were evaluated as controls. We detected a greater degree of osteoporosis in PD subjects as compared to controls, more pronounced in males than in females (Z-score: M -3.8 ± 1.6, F -2.28 ± 0.92, p = 0.0006). A positive correlation was found between independence levels and bone density or vitamin D levels. Twenty seven patients (64%) reported falls in the previous year. These were associated to post-traumatic fractures in 16 subjects (59% of fallers). Women fell more than men (fallers: 20 F/7 M; non fallers: 4 F/11 M, χ² test p = 0.02), although the occurrence of post-traumatic fractures among fallers did not differ between sexes (F 11/9, M 5/2, χ² test p > 0.05). Fallers with post-traumatic fractures showed higher degrees of motor impairment. These findings confirm that falls and osteoporosis represent major health issues in PD, already in the middle stages of disease.
Nieves, Jeri W; Melsop, Kathryn; Curtis, Meredith; Kelsey, Jennifer L; Bachrach, Laura K; Greendale, Gail; Sowers, Mary Fran; Sainani, Kristin L
2010-08-01
To identify nutrients, foods, and dietary patterns associated with stress fracture risk and changes in bone density among young female distance runners. Two-year, prospective cohort study. Observational data were collected in the course of a multicenter randomized trial of the effect of oral contraceptives on bone health. One hundred and twenty-five female competitive distance runners ages 18-26 years. Dietary variables were assessed with a food frequency questionnaire. Bone mineral density and content (BMD/BMC) of the spine, hip, and total body were measured annually by dual x-ray absorptiometry (DEXA). Stress fractures were recorded on monthly calendars, and had to be confirmed by radiograph, bone scan, or magnetic resonance imaging. Seventeen participants had at least one stress fracture during follow-up. Higher intakes of calcium, skim milk, and dairy products were associated with lower rates of stress fracture. Each additional cup of skim milk consumed per day was associated with a 62% reduction in stress fracture incidence (P < .05); and a dietary pattern of high dairy and low fat intake was associated with a 68% reduction (P < .05). Higher intakes of skim milk, dairy foods, calcium, animal protein, and potassium were associated with significant (P < .05) gains in whole-body BMD and BMC. Higher intakes of calcium, vitamin D, skim milk, dairy foods, potassium, and a dietary pattern of high dairy and low fat were associated with significant gains in hip BMD. In young female runners, low-fat dairy products and the major nutrients in milk (calcium, vitamin D, and protein) were associated with greater bone gains and a lower stress fracture rate. Potassium intake was also associated with greater gains in hip and whole-body BMD. Copyright © 2010 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
Wu, Zi-xiang; Lei, Wei; Hu, Yun-yu; Wang, Hai-qiang; Wan, Shi-yong; Ma, Zhen-sheng; Sang, Hong-xun; Fu, Suo-chao; Han, Yi-sheng
2008-11-01
Osteoporotic/osteopenia fractures occur most frequently in trabeculae-rich skeletal sites. The purpose of this study was to use a high-resolution micro-computed tomography (micro-CT) and dual energy X-ray absorptionmeter (DEXA) to investigate the changes in micro-architecture and bone mineral density (BMD) in a sheep model resulted from ovariectomy (OVX). Biomechanical tests were performed to evaluate the strength of the trabecular bone. Twenty adult sheeps were randomly divided into three groups: sham group (n=8), group 1 (n=4) and group 2 (n=8). In groups 1 and 2, all sheep were ovariectomized (OVX); in the sham group, the ovaries were located and the oviducts were ligated. In all animals, BMD for lumbar spine was obtained during the surgical procedure. BMD at the spine, femoral neck and femoral condyle was determined 6 months (group 1) and 12 months (group 2) post-OVX. Lumbar spines and femora were obtained and underwent BMD scan, micro-CT analysis. Compressive mechanical properties were determined from biopsies of vertebral bodies and femoral condyles. BMD, micro-architectural parameters and mechanical properties of cancellous bone did not decrease significantly at 6 months post-OVX. Twelve months after OVX, BMD, micro-architectural parameters and mechanical properties decreased significantly. The results of linear regression analyses showed that trabecular thickness (Tb.Th) (r=0.945, R2=0.886) and bone volume fraction (BV/TV) (r=0.783, R2=0.586) had strong (R2>0.5) correlation to compression stress. In OVX sheep, changes in the structural parameters of trabecular bone are comparable to the human situation during osteoporosis was induced. The sheep model presented seems to meet the criteria for an osteopenia model for fracture treatment with respect to morphometric and mechanical properties. But the duration of OVX must be longer than 12 months to ensure the animal model can be established successfully.
Qualitative identification of rigid gas permeable contact lens materials by densitometry.
Arce, C G; Schuman, P D; Schuman, W P
1999-10-01
We describe a practical method to qualitatively identify polymethylmethacrylate (PMMA) and rigid gas permeable (RGP) contact lens materials. By progressive dilution of a saturated saline solution made with distilled or tap water and sodium chloride, we recorded comparative densitometry of rigid contact lens materials using a small hydrometer or by liquid displacement. The method was sensitive enough to separate the polymethylmethacrylate, all silicon-methacrylates, and all but two fluorine-containing silicon-methacrylates. The hydrometer had a precision of three decimals rounded to the nearest 0.005. There was only one RGP product that could have been confused with the PMMA material. Most silicon-methacrylates had lower densities than fluorine containing silicon-methacrylates. Only four of 25 products under 1.117 gm/cm3 contained fluorine. Densitometry with a hydrometer is an effective non-destructive method to identify RGP materials and to verify their quality. The method is easier when lens blanks are tested, but in spite of differences in shape, size, and weight, densitometry may also be used with new or used contact lenses. Its simplicity and low cost makes densitometry feasible for any contact lens laboratory or clinic to use on a routine basis. Only silicon-methacrylates had an inverse relationship between density and oxygen permeability. As the silicon content of the contact lens increases, the Dk increases and the density decreases.
Trabecular Bone Mechanical Properties and Fractal Dimension
NASA Technical Reports Server (NTRS)
Hogan, Harry A.
1996-01-01
Countermeasures for reducing bone loss and muscle atrophy due to extended exposure to the microgravity environment of space are continuing to be developed and improved. An important component of this effort is finite element modeling of the lower extremity and spinal column. These models will permit analysis and evaluation specific to each individual and thereby provide more efficient and effective exercise protocols. Inflight countermeasures and post-flight rehabilitation can then be customized and targeted on a case-by-case basis. Recent Summer Faculty Fellowship participants have focused upon finite element mesh generation, muscle force estimation, and fractal calculations of trabecular bone microstructure. Methods have been developed for generating the three-dimensional geometry of the femur from serial section magnetic resonance images (MRI). The use of MRI as an imaging modality avoids excessive exposure to radiation associated with X-ray based methods. These images can also detect trabecular bone microstructure and architecture. The goal of the current research is to determine the degree to which the fractal dimension of trabecular architecture can be used to predict the mechanical properties of trabecular bone tissue. The elastic modulus and the ultimate strength (or strain) can then be estimated from non-invasive, non-radiating imaging and incorporated into the finite element models to more accurately represent the bone tissue of each individual of interest. Trabecular bone specimens from the proximal tibia are being studied in this first phase of the work. Detailed protocols and procedures have been developed for carrying test specimens through all of the steps of a multi-faceted test program. The test program begins with MRI and X-ray imaging of the whole bones before excising a smaller workpiece from the proximal tibia region. High resolution MRI scans are then made and the piece further cut into slabs (roughly 1 cm thick). The slabs are X-rayed again and also scanned using dual-energy X-ray absorptiometry (DEXA). Cube specimens are then cut from the slabs and tested mechanically in compression. Correlations between mechanical properties and fractal dimension will then be examined to assess and quantify the predictive capability of the fractal calculations.
Assessment of bone in Ehlers Danlos syndrome by ultrasound and densitometry.
Dolan, A L; Arden, N K; Grahame, R; Spector, T D
1998-10-01
Ehlers Danlos syndrome (EDS) is an inherited disorder of connective tissue characterised by hyperextensible skin, joint laxity, and easy bruising. There are phenotypic similarities with osteogenesis imperfecta, but in EDS a tendency to fracture or altered bone mass has not previously been considered to be a cardinal feature. This case-control design study investigates whether 23 patients with EDS had differences in fracture rates, bone mass, and calcaneal ultrasound parameters compared with age and sex matched controls. 23 cases of EDS (mean (SD) age 38.5 (15.5)) were compared with 23 controls (mean age 37.8 (14.5)). A significant reduction in bone density measured by dual energy x ray absorptiometry was found at the neck of femur by 0.9 SD, p = 0.05, and lumbar spine by 0.74 SD, p = 0.02. At the calcaneum, broad band ultrasound attenuation and speed of sound were significantly reduced compared with controls by 0.95 SD (p = 0.004) and 0.49 SD (p = 0.004) for broad band ultrasound attenuation and speed of sound respectively. Broad band ultrasound attenuation and speed of sound remained significantly reduced after adjusting for bone mineral density (BMD). After adjusting for functional status (HAQ), age and sex, hypermobility was inversely correlated with broad band ultrasound attenuation and SOS, but not BMD at hip or spine. Previous fracture was 10 times more common in EDS (p < 0.001), with 86.9% of patients reporting a total of 47 low impact fractures, compared with 8.7% of controls. This study has identified a tendency of EDS patients to fracture, have low bone mass and abnormal bone structure. The aetiology is likely to be multifactorial, with an inherited structural element, accentuated by immobility or reduced exercise. This is one of the first clinical studies to suggest ultrasound can detect structural differences in bone, independent of dual energy x ray absorptiometry.
Biason, Talita Poli; Goldberg, Tamara Beres Lederer; Kurokawa, Cilmery Suemi; Moretto, Maria Regina; Teixeira, Altamir Santos; Nunes, Hélio Rubens de Carvalho
2015-04-03
Low-dose combined oral contraceptives (COCs) can interfere with bone mass acquisition during adolescence. This study aimed to evaluate bone mineral density (BMD) and bone mineral content (BMC) in female adolescents taking a standard low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) over a 1-year period and to compare their data with those of healthy adolescents from the same age group not taking COCs. This was a non-randomized parallel-control study with a 1-year follow-up. Sixty-seven adolescents aged from 12 to 19 years, divided into COC users (n = 41) taking 20 μg ethinylestradiol/150 μg desogestrel and COC non-user controls (n = 26), were evaluated by bone densitometry examinations at baseline and after 12 months. Comparisons between the groups at the study onset were performed using the Mann-Whitney test with the significance level fixed at 5% or p < 0.05. Comparisons between the groups at the study onset and after 12 months were based on variations in the median percentages for bone mass variables. The COC users presented with low bone mass acquisition in the lumbar spine, and had BMD and BMC median variations of 2.07% and +1.57%, respectively, between the measurements at baseline and 12 months. The control group had median variations of +12.16% and +16.84% for BMD and BMC, respectively, over the same period. The total body BMD and BMC showed similar evolutions during the study in both groups. Statistical significance (p < 0.05) was seen for the BMC percentage variation between COC users and non-users. Use of a low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) was associated with lower bone mass acquisition in adolescents during the study period. Registry Number, RBR-5h9b3c.
The Effect of Changing Scan Mode on Trabecular Bone Score Using Lunar Prodigy.
Chen, Weiwen; Slattery, Anthony; Center, Jacqueline; Pocock, Nicholas
2016-10-01
Trabecular bone score (TBS) is a measure of gray scale homogeneity that correlates with trabecular microarchitecture and is an independent predictor of fracture risk. TBS is being increasingly used in the assessment of patients at risk of osteoporosis and has recently been incorporated into FRAX ® . GE Lunar machines acquire spine scans using 1 of 3 acquisition modes depending on abdominal tissue thickness (thin, standard, and thick). From a database review, 30 patients (mean body mass index: 30.8, range 26.2-34.1) were identified who had undergone lumbar spine DXA scans (GE Lunar Prodigy, software 14.10; Lunar Radiation Corporation, Madison, WI) in both standard mode and thick mode, on the same day with no repositioning. Lumbar spine bone mineral density (L1-L4) and TBS were derived from the 30 paired spine scans. There was no significant difference in lumbar spine bone mineral density between the 2 scanning modes. There were, however, significant higher TBS values from the spine scans acquired in thick mode compared to the TBS values derived from spine acquisitions in standard mode (mean TBS difference: 0.24 [20%], standard deviation ±0.10). In conclusion, these preliminary data suggest that TBS values acquired in the GE Lunar Prodigy are dependent on the scanning mode used. Further evaluation is required to confirm the cause and develop appropriate protocols. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Hodovana, O I
2015-01-01
Results of investigation of mineral density condition of skeletal osseous tissue in patients with inflammatory and dystrophic-inflammatory diseases of periodontal tissues with ultrasound densitometry method have been presented. Various changes of osseous tissue of skeletal bones have been detected: osteopenia, osteoporosis and osteosclerosis, which correlated with the severity of pathological process in periodontium. Analysis of the obtained results has been carried out depending on patients' sex as well as form and severity degree of the course of periodontal diseases. It has been established that the peak of detected impairments of mineral density in the skeleton is due to osteopenia, the degree of severity of which deteriorates with the severity of pathological process in periodontal tissues, especially in women.
Bone Mineral Changes in Epilepsy Patients During Initial Years of Antiepileptic Drug Therapy.
Shiek Ahmad, Baemisla; O'Brien, Terence John; Gorelik, Alexandra; Hill, Keith David; Wark, John Dennis
2016-10-01
Antiepileptic drug (AED) therapy is associated with decreased bone mineral density; however, the time course for this development is unclear. The aim of this study was to evaluate bone mineral changes during the initial years of AED therapy in AED-naive, newly diagnosed epilepsy patients compared with non-AED users. In 49 epilepsy patients newly started on AEDs and in 53 non-AED users of both genders, bone mineral density (BMD) and bone mineral content were measured using dual-energy X-ray absorptiometry at baseline (within the first year of therapy) and at least 1 yr later. Bone changes between the 2 assessments, adjusted for age, height, and weight, were calculated as the annual rate of change. The median duration of AED therapy was 3.5 mo at baseline and 27.6 mo at follow-up. No overall difference was found in mean BMD and bone mineral content measures between user and nonuser cohorts in both cross-sectional baseline and the annual rate of change (p > 0.05). However, users on carbamazepine monotherapy (n = 11) had an increased annual rate of total hip (-2.1% vs -0.8%, p = 0.020) and femoral neck BMD loss (-2.1% vs -0.6%, p = 0.032) compared to nonusers. They also had a marginally higher rate of femoral neck BMD loss (-2.1%, p = 0.049) compared with valproate (-0.1%, n = 13) and levetiracetam users (+0.6%, n = 13). During the initial years of AED treatment for epilepsy, no difference was found in bone measures between AED users as a group and nonuser cohorts. However, the data suggested that carbamazepine monotherapy was associated with increased bone loss at the hip regions, compared to users of levetiracetam or valproate and nonusers. Larger studies of longer duration are warranted to better delineate the bone effects of specific AEDs, with further consideration of the role of early dual-energy X-ray absorptiometry scanning and careful AED selection in potentially minimizing the impact on bone health in these patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Osteoporotic risk and physeal closure in prepubertal ovariohysterectomized cats.
Uçmak, Melih; Yılmaz, Özge Turna; Gündüz, Mehmet Can; Uçmak, Zeynep Günay; Duzgun, Oktay; Eskiyurt, Nurten; Oruç, Coşkun Umut; Genç, Sema; Erzengin, Ömer Mehmet; Karaçam, Esra
2015-10-01
We aimed to examine the early effects of prepubertal ovariohysterectomy (P-OHE) on bone loss and proximal physeal closure in cats. Fourteen kittens randomly underwent P-OHE or sham operations (S-OP) at three months (mo) of age and were allocated to group I and group II. Each mo between four and nine mo of age, dual-energy X-ray absorptiometry (DEXA) scans were performed to determine the total body bone mineral density (BMD) and bone mineral content (BMC). Proximal radial physeal closure and radial length were determined by radiography. Bone-specific alkaline phosphatase (BAP), carboxy-terminal collagen teleopeptide (CTX), 17-β estradiol, progesterone, calcium (Ca) and phosphorus (P) were measured in the serum samples. No significant differences were observed between the groups in terms of BMD, BMC, BAP, BAP/CTX, P, progesterone and body weight (BW) (between 4 and 9mo) and for Ca (between 5 and 9mo) and for CTX levels (between 4 and 8mo). The 17-β estradiol was significantly higher at 6, 8 and 9mo of age in the S-OP group due to puberty (P=0.02, P=0.03 and P=0.02 respectively). Although there was a significant difference (P=0.0002) between the P-OHE and S-OP groups in terms of the proximal radial physeal closure times (7.43±0.20mo and 6.14±0.14mo, respectively), no significant difference was observed for the mean radius length (10.59±0.10cm and 10.06±0.27cm, respectively) at the last evaluation time. In conclusion, prepubertal ovariohysterectomized cats do not have any osteoporotic risks until nine mo of age and exhibit a delayed physeal closure time without a change in radius length. Copyright © 2015. Published by Elsevier B.V.
Yoneyama, Kyoko; Ikeda, Junko
2004-12-01
The purpose of this study was to examine the efficacy of an increased calcium (Ca) diet for preventing bone mineral loss in long-term lactating women, considering bone metabolism, and recovery of bone loss caused by long-term lactation with low dietary Ca intake. Two groups of long-term (> 12 mon.) lactating women ... one with an enhanced Ca intake (Group M, n = 22) and the other with diet feeding no cow's milk and no milk products (Group N, n = 16) ... and a control group of 21 non-lactating postpartum women (Group C) were studied. Bone mineral density (BMD) was measured by ultrasonic bone densitometry. Stiffness calculated from the combined value of speed of sound and broadband ultrasound attenuation was used as an index of BMD. BMD and bone metabolic markers in urine and serum (only M and C groups) were assessed from 1 approximately 12 weeks postpartum (initial) at six-month intervals for a maximum of two years and changes were compared among the groups. 1. The mean (+/- SD) dietary Ca intake was 1032 (209) mg/day in the M group. 2. After lactating for one year, the N group demonstrated significant decrease in BMD, with both 1 and 2 babies, whereas the M group had no significant change. 3. The BMD in the N group returned to initial levels at 0.5 approximately 1 year post-weaning, 4. In the N group, compared with the M group, the urinary Hydroxyproline/creatinine ratio was significantly higher at the initial measurement and half a year thereafter, while urinary Ca/ creatinine ratio was significantly lower after a year. However, there were no significant differences between the M and C groups. 5. Serum bone alkaline phosphatase was significantly higher in the M group compared with the C group. Bone loss during long-term lactation can be prevented with adequate dietary Ca intake. Once lost, recovery to initial levels occurs 0.5 approximately 1 year post-weaning.
NASA Astrophysics Data System (ADS)
Bradley, D. A.; Muthuvelu, P.; Ellis, R. E.; Green, E. M.; Attenburrow, D.; Barrett, R.; Arkill, K.; Colridge, D. B.; Winlove, C. P.
2007-10-01
Bone is a dynamic structure, constantly remodelling in response to changing mechanical and environmental factors. This is particularly evident in the mineral component encrusting the collagenous framework. The mineral is principally in the form of calcium apatite, but calcium can exchange with strontium, both during the cellular processes of mineralisation and resorption and by passive exchange with the deposited crystals. Mineralisation is generally characterized by densitometry, but because of the differences in absorption cross sections of calcium and strontium it can be misleading in studies of composition. In this work we have used X-ray diffraction to identify calcium and strontium apatite and X-ray fluorescence to quantify strontium and calcium distribution. With the beam characteristics available from synchrotron radiation, this has enabled us to obtain microscopic resolution on thin sections of bone and cartilage from the equine metacarpophalangeal joint. Two issues have been investigated; the first is the distribution of mineral in the bone-cartilage interface and within individual trabeculae. In trabecular bone the ratio of strontium to calcium concentration was typically 0.0035 ± 0.0020, and higher by a factor of ∼3 at the periphery than in the centre of a trabeculum (possibly reflecting the more rapid turnover of mineral in the surface layer). In the dense subchondral bone the ratio was similar, approximately doubling in the calcified cartilage. The second objective was to explore the changes in mineralisation associated with development of osteoarthrosis. We analysed lesions showing cartilage thinning and changes in the trabecular organization and density of the underlying bone. At the centre of the lesion the ratio of strontium to calcium was much lower than that in normal tissue, although the calcified cartilage still showed a higher ratio than the underlying bone. In the superficially normal tissue around the lesion the calcified cartilage returned to a normal ratio much more rapidly than the underlying bone. These data demonstrate the complex relationship between changes in cartilage and the underlying bone.
Combat sports practice favors bone mineral density among adolescent male athletes.
Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Neffeti, Fadoua; Najjar, Mohamed Fadhel; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair
2015-01-01
The aim of this study was to determine the impact of combat sports practice on bone mineral density (BMD) and to analyze the relationship between bone parameters and anthropometric measurements, bone markers, and activity index (AI). In other words, to detect the most important determinant of BMD in the adolescent period among combat sports athletes. Fifty athletes engaged in combat sports, mean age 17.1±0.2 yr, were compared with 30 sedentary subjects who were matched for age, height, and pubertal stage. For all subjects, the whole-body BMD, lumbar spine BMD (L2-L4), and BMD in the pelvis, arms, and legs was measured by dual-energy X-ray absorptiometry, and anthropometric measurements were evaluated. Daily calcium intake, bone resorption, and formation markers were measured. BMD measurements were greater in the combat sports athletes than in the sedentary group (p<0.01). Weight, body mass index, and lean body mass were significantly correlated with BMD in different sites. Daily calcium consumption lower than daily calcium intake recommended in both athletes and sedentary group. AI was strongly correlated with all BMD measurements particularly with the whole body, legs, and arms. Negative correlations were observed between bone markers and BMD in different sites. The common major predictor of BMD measurements was AI (p<0.0001). AI associated to lean body mass determined whole-body BMD until 74%. AI explained both BMD in arms and L2-L4 at 25%. AI associated to height can account for 63% of the variance in BMD legs. These observations suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the AI. Children and adolescents should be encouraged to participate in combat sports to maximize their bone accrual. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Hayer, Prabhnoor Singh; Deane, Anit Kumar Samuel; Agrawal, Atul; Maheshwari, Rajesh; Juyal, Anil
2016-04-01
Osteoporosis is a metabolic bone disease caused by progressive bone loss. It is characterized by low Bone Mineral Density (BMD) and structural deterioration of bone tissue leading to bone fragility and increased risk of fractures. When classifying a fracture, high reliability and validity are crucial for successful treatment. Furthermore, a classification system should include severity, method of treatment, and prognosis for any given fracture. Since it is known that treatment significantly influences prognosis, a classification system claiming to include both would be desirable. Since there is no such classification system, which includes both the fracture type and the osteoporosis severity, we tried to find a correlation between fracture severity and osteoporosis severity. The aim of the study was to evaluate whether the AO/ASIF fracture classification system, which indicates the severity of fractures, has any relationship with the bone mineral status in patients with primary osteoporosis. We hypothesized that fracture severity and severity of osteoporosis should show some correlation. An observational analytical study was conducted over a period of one year during which 49 patients were included in the study at HIMS, SRH University, Dehradun. The osteoporosis status of all the included patients with a pertrochanteric fracture was documented using a DEXA scan and T-Score (BMD) was calculated. All patients had a trivial trauma. All the fractures were classified as per AO/ASIF classification. Pearson Correlation between BMD and fracture type was calculated. Data was entered on Microsoft Office Excel version 2007 and Interpretation and analysis of obtained data was done using summary statistics. Pearson Correlation between BMD and fracture type was calculated using the SPSS software version 22.0. The average age of the patients included in the study was 71.2 years and the average bone mineral density was -4.9. The correlation between BMD and fracture type was calculated and the r-values obtained was 0.180, which showed low a correlation and p-value was 0.215, which was insignificant. Statistically the pertrochanteric fracture configuration as per AO Classification does not correlate with the osteoporosis severity of the patient.
USDA-ARS?s Scientific Manuscript database
The International Osteoporosis Foundation (IOF) and the International Society for Clinical Densitometry (ISCD) appointed a joint Task Force to develop resource documents in order to make recommendations on how to improve FRAX and better inform clinicians who use FRAX. The Task Force met in November...
Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A
2011-07-01
A high prevalence of bone loss is observed in patients with inflammatory bowel disease (IBD). Leptin, ghrelin, insulin-like growth factor (IGF)-1, and IGF binding protein (IGFBP)-3 have been suggested to interfere in the bone metabolism. The aim of this study was to investigate the role of these peptides in the development of osteoporosis in IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy x-ray absorptiometry at the femoral neck and lumbar spine levels. Serum samples were collected from all patients and analyzed for concentrations of the aforementioned peptides by radioimmunoassay. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. Positive statistically significant correlations were found between body mass index (BMI), leptin, IGFBP-3 levels, and the bone mineral density (BMD) of the femoral neck and lumbar spine. Moreover, an inverse statistically significant correlation was found between BMD of the femoral neck and the lumbar spine, and age, duration of the disease, and ghrelin levels. Multivariate analysis revealed that the most significant factors associated with the BMD were age and BMI. A weak but statistically significant correlation was found between IGFBP-3 and femoral neck BMD (P=0.045) and between ghrelin and spine BMD (P=0.039). No correlation was observed between leptin and BMD. Low BMI is the most important independent risk factor for osteoporosis in IBD patients. There is no independent influence of leptin but ghrelin and IGFBP-3 may play a role in the bone metabolism in the IBD.
Use of cone beam computed tomography in identifying postmenopausal women with osteoporosis.
Brasileiro, C B; Chalub, L L F H; Abreu, M H N G; Barreiros, I D; Amaral, T M P; Kakehasi, A M; Mesquita, R A
2017-12-01
The aim of this study is to correlate radiometric indices from cone beam computed tomography (CBCT) images and bone mineral density (BMD) in postmenopausal women. Quantitative CBCT indices can be used to screen for women with low BMD. Osteoporosis is a disease characterized by the deterioration of bone tissue and the consequent decrease in BMD and increase in bone fragility. Several studies have been performed to assess radiometric indices in panoramic images as low-BMD predictors. The aim of this study is to correlate radiometric indices from CBCT images and BMD in postmenopausal women. Sixty postmenopausal women with indications for dental implants and CBCT evaluation were selected. Dual-energy X-ray absorptiometry (DXA) was performed, and the patients were divided into normal, osteopenia, and osteoporosis groups, according to the World Health Organization (WHO) criteria. Cross-sectional images were used to evaluate the computed tomography mandibular index (CTMI), the computed tomography index (inferior) (CTI (I)) and computed tomography index (superior) (CTI (S)). Student's t test was used to compare the differences between the indices of the groups' intraclass correlation coefficient (ICC). Statistical analysis showed a high degree of interobserver and intraobserver agreement for all measurements (ICC > 0.80). The mean values of CTMI, CTI (S), and CTI (I) were lower in the osteoporosis group than in osteopenia and normal patients (p < 0.05). In comparing normal patients and women with osteopenia, there was no statistically significant difference in the mean value of CTI (I) (p = 0.075). Quantitative CBCT indices may help dentists to screen for women with low spinal and femoral bone mineral density so that they can refer postmenopausal women for bone densitometry.
NASA Astrophysics Data System (ADS)
Boehm, Holger F.; Körner, Markus; Baumert, Bernhard; Linsenmaier, Ulrich; Reiser, Maximilian
2011-03-01
Osteoporosis is a chronic condition characterized by demineralization and destruction of bone tissue. Fractures associated with the disease are becoming an increasingly relevant issue for public health institutions. Prediction of fracture risk is a major focus research and, over the years, has been approched by various methods. Still, bone mineral density (BMD) obtained by dual-energy X-ray absorptiometry (DXA) remains the clinical gold-standard for diagnosis and follow-up of osteoporosis. However, DXA is restricted to specialized diagnostic centers and there exists considerable overlap in BMD results between populations of individuals with and without fractures. Clinically far more available than DXA is conventional x-ray imaging depicting trabecular bone structure in great detail. In this paper, we demonstrate that bone structure depicted by clinical radiographs can be analysed quantitatively by parameters obtained from the Radon Transform (RT). RT is a global analysis-tool for detection of predefined, parameterized patterns, e.g. straight lines or struts, representing suitable approximations of trabecular bone texture. The proposed algorithm differentiates between patients with and without fractures of the hip by application of various texture-metrics based on the Radon-Transform to standard x-ray images of the proximal femur. We consider three different regions-of-interest in the proximal femur (femoral head, neck, and inter-trochanteric area), and conduct an analysis with respect to correct classification of the fracture status. Performance of the novel approach is compared to DXA. We draw the conclusion that performance of RT is comparable to DXA and may become a useful supplement to densitometry for the prediction of fracture risk.
Martínez, Purificación; Galve, Elena; Arrazubi, Virginia; Sala, M Ángeles; Fernández, Seila; Pérez, Clara E; Arango, Juan F; Torre, Iñaki
2017-10-11
Considering the increased fracture risk in early breast cancer patients treated with aromatase inhibitors (AI), we assessed the impact of a preventive intervention conducted by a specialized osteoporosis unit on bone health at AI treatment start. Retrospective cohort of postmenopausal women who started treatment with AI after breast cancer surgical/chemotherapy treatment and were referred to the osteoporosis unit for a comprehensive assessment of bone health. Bone densitometry and fracture screening by plain X-ray were performed at the baseline visit and once a year for 5 years. The final record included 130 patients. At AI treatment start, 49% had at least one high-risk factor for fractures, 55% had osteopenia, and 39% osteoporosis. Based on the baseline assessment, 79% of patients initiated treatment with bisphosphonates, 88% with calcium, and 79% with vitamin D. After a median of 65 (50-77) months, 4% developed osteopenia or osteoporosis, and 14% improved their densitometric diagnosis. Fifteen fractures were recorded in 11 (8.5%) patients, all of them receiving preventive treatment (10 with bisphosphonates). During the follow-up period, patients with one or more high-risk factors for fracture showed a greater frequency of fractures (15% vs. 3%) and experienced the first fracture earlier than those without high-risk factors (mean of 99 and 102 months, respectively; P=0.023). The preventive intervention of a specialized unit at the start of AI treatment in breast cancer survivors allows the identification of patients with high fracture risk and may contribute to preventing bone events in these patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.
Tchanque-Fossuo, Catherine N; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S; Weiss, Daniela M; Buchman, Steven R
2013-11-01
Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine's effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. © 2013.
Tchanque-Fossuo, Catherine N.; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S.; Weiss, Daniela M.
2013-01-01
Background Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine’s effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Materials and Methods Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. Results All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Conclusion Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. PMID:23860272
Vasilkova, Olga; Mokhort, Tatiana; Sanec, Igor; Sharshakova, Tamara; Hayashida, Naomi; Takamura, Noboru
2011-01-01
Although many reports have elucidated pathophysiological characteristics of abnormal bone metabolism in patients with type 2 diabetes mellitus (DT2), determinants of bone mineral density (BMD) in patients with DT2 are still controversial. We examined 168 Belarussian men 45-60 years of age. Plasma total cholesterol (TC), high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol, triglycerides, hemoglobin A(1c) (HbA(1c)), immunoreactive insulin, and C-reactive protein concentrations were assessed. BMD was measured using dual energy X-ray densitometry of the lumbar spine (L(1)-L(4)). Total testosterone (TT) and sex hormone-binding globulin were measured, and free testosterone (FT) was calculated. Using univariate linear regression analysis, BMD of the lumbar spine was significantly correlated with FT (r=0.32, p<0.01) and TT (r=0.36, p<0.01). Using multiple linear regression analysis adjusted for confounding factors, BMD was significantly correlated with TT (β=0.23, p<0.001) and TC (β=-0.029, p=0.005). Age (β=0.005, p=0.071), body mass index (β=0.005, p=0.053), HbA(1c) (β=-0.002, p=0.72) and duration of diabetes (β=0.001, p=0.62) were not significantly correlated with BMD. Our data indicate that androgens are independent determinants of BMD in male patients with DT2.
Andersen, Mikkel R; Winther, Nikkolaj S; Lind, Thomas; Schrøder, Henrik M; Flivik, Gunnar; Petersen, Michael M
2017-07-01
The fixation of uncemented tibia components in total knee arthroplasty may rely on the bone quality of the tibia; however, no previous studies have shown convincing objective proof of this. Component migration is relevant as it has been shown to predict aseptic loosening. We performed 2-year follow-up of 92 patients who underwent total knee arthroplasty surgery with an uncemented tibia component. Bone mineral density (BMD; g/cm 2 ) of the tibia host bone was measured preoperatively using dual energy X-ray absorptiometry. The proximal tibia was divided into 2 regions of interest (ROI) in the part of the tibia bone where the components were implanted. Radiostereometric analysis was performed postoperatively and after 3, 6, 12, and 24 months. The primary outcome was maximum total point motion (MTPM; mm). Regression analysis was performed to evaluate the relation between preoperative BMD and MTPM. We found low preoperative BMD in ROI1 to be significantly related to high MTPM at all follow-ups: after 3 months (R 2 = 20%, P BMD = 0.017), 6 months (R 2 = 29%, P BMD = 0.003), 12 months (R 2 = 33%, P BMD = 0.001), and 24 months (R 2 = 27%, P BMD = 0.001). We also found a significant relation for low BMD in ROI2 and high MTPM: 3 months (R 2 = 19%, P BMD = 0.042), 6 months (R 2 = 28%, P BMD = 0.04), 12 months (R 2 = 32%, P BMD = 0.004), and 24 months (R 2 = 24%, P BMD = 0.005). Low preoperative BMD in the tibia is related to high MTPM. Thus, high migration of uncemented tibia components is to be expected in patients with poor bone quality. Copyright © 2017 Elsevier Inc. All rights reserved.
Fornari, Rachele; Marocco, Chiara; Francomano, Davide; Fittipaldi, Simona; Lubrano, Carla; Bimonte, Viviana M; Donini, Lorenzo M; Nicolai, Emanuele; Aversa, Antonio; Lenzi, Andrea; Greco, Emanuela A; Migliaccio, Silvia
2018-06-01
Obesity is a severe public health problem worldwide, leading to an insulin-resistant state in liver, adipose, and muscle tissue, representing a risk factor for type 2 diabetes mellitus, cardiovascular diseases, and cancer. We have shown that abdominal obesity is associated with homeostasis derangement, linked to several hormonal and paracrine factors. Data regarding potential link between GH/IGF1 axis, bone mineral density, and inflammation in obesity are lacking. Thus, aim of this study was to evaluate correlation among IGF-1, BMD, and inflammation in obese individuals. The study included 426 obese subjects, mean age 44.8 ± 14 years; BMI 34.9 ± 6.1. Exclusion criteria were chronic medical conditions, use of medications affecting bone metabolism, hormonal and nutritional status, recent weight loss, and prior bariatric surgery. Patients underwent measurements of BMD and body composition by DEXA and were evaluated for hormonal, metabolic profile, and inflammatory markers. In this population, IGF-1 was inversely correlated with abdominal FM% (p < 0.001, r 2 = 0.12) and directly correlated with osteocalcin (OSCA) (p < 0.002, r 2 = 0.14). A negative correlation was demonstrated between IGF-1 levels and nonspecific inflammatory index, such as fibrinogen (p < 0.01, r 2 = 0.04) and erythrocyte sedimentation rate (p < 0.0001, r 2 = 0.03). IGF-1 was directly correlated with higher BMD, at both lumbar (p < 0.02, r 2 = 0.03) and femoral site (p < 0.04, r 2 = 0.03). In conclusion, our results show that higher levels of serum IGF-1 in obese patients correlate with lower inflammatory pattern and better skeletal health, as demonstrated by higher BMD and osteocalcin levels. These results lead to speculate the existence of a bone-adipose-muscle interplay modulating energy homeostasis, glucose, bone metabolism, and chronic inflammation in individuals affected by abdominal obesity.
Chen, Weiyi; Wilson, Jenny L.; Khaksari, Mohammad; Cowley, Michael A.
2012-01-01
Clinical studies have demonstrated a strong relationship between visceral fat content and metabolic diseases, such as type 2 diabetes and liver steatosis. Obese mouse models are an excellent tool to study metabolic diseases; however, there are limited methods for the noninvasive measurement of fat distribution in mice. Although micromagnetic resonance imaging and microcomputed tomography are the “gold standards” in the measurement of fat distribution, more economical and accessible methods are required. Dual energy X-ray absorptiometry (DEXA) is an effective method in characterizing fat content; however, it cannot discriminate between visceral and subcutaneous fat depots. We demonstrate that an evaluation of abdominal fat content measured by DEXA through the selection of one localized abdominal area strongly correlates with visceral fat content in C57BL/6J mice. We found that DEXA is able to measure fat pad volume ex vivo with high accuracy; however, the measurement of visceral fat in vivo shows an overestimation caused by subcutaneous tissue interference. The overestimation is almost constant for a wide range of values, and thus it is possible to correct the data for a more accurate estimation of visceral fat content. We demonstrate the utility of this technique in characterizing phenotypes of several obese mouse models (ob/ob, db/db, MC4R-KO, and DIO) and evaluating the effect of treatments on visceral fat content in longitudinal studies. Additionally, we also establish abdominal obesity as a potential biomarker for metabolic abnormalities (liver fat accumulation, insulin resistance/diabetes) in mice, similar to that described in humans. PMID:22761161
Cleary, Jane; Daniells, Suzie; Okely, Anthony D; Batterham, Marijka; Nicholls, Jessie
2008-01-01
Bioelectrical impedance equations are frequently used by food and nutrition professionals to estimate percent fat mass in overweight and obese children. However, it is not known whether they are accurate for such children, as they have been primarily developed for children of varying body weights. The aim of this cross-sectional study was to evaluate the predictive validity of four previously published prediction equations developed for the pediatric population, among a sample of overweight and obese children. Thirty overweight or obese children (mean age=7.57+/-1.28 years) underwent measurement of fat mass, percent fat mass, and fat-free mass using dual-energy x-ray absorptiometry (DEXA) and bioelectrical impedance analysis (BIA). Impedance values from the BIA were entered into the four prediction equations and Pearson correlations used to determine the significance of associations between each of the BIA prediction equations and DEXA for percent fat mass, fat mass, and fat-free mass. For percent fat mass, paired t tests were used to assess differences between the methods and the technique of Bland and Altman was used to determine bias and error. Results showed that the mean percent fat mass as determined by DEXA for this age group was 40.79%. In comparison with other BIA prediction equations, the Schaefer equation had the closest mean value of 41.98%, and was the only equation not to significantly differ from the DEXA (P=0.121). This study suggests that the Schaefer equation is the only accurate BIA prediction equation for assessing percent fat mass in this sample of overweight and obese children from primarily white backgrounds.
Abrahams, Zulfa; Levitt, Naomi; Lesosky, Maia; Maartens, Gary; Dave, Joel
2016-10-01
Long-term use of antiretroviral therapy (ART) increases the risk of developing lipodystrophy. Few studies from Africa have used longitudinal data to assess the development of lipoatrophy and lipohypertrophy. We use clinical anthropometry and dual-energy X-ray absorptiometry (DEXA) to describe changes in body fat distribution over a 24-month period in individuals initiated on ART. A convenience sample of black South Africans (55 men and 132 women) were recruited and followed for 24 months after commencing ART. Body fat distribution was assessed using anthropometric measurements and DEXA scans at baseline and then at 3, 6, 12, 18, and 24 months after commencing ART. DEXA was also used to estimate abdominal visceral adipose tissue (VAT) and subcutaneous adipose tissue (SAT). Women gained more overall weight and more regional fat in all areas analyzed on DEXA scans. Women, not men, experienced a significant increasing trend in trunk fat and a significant decreasing trend in limb fat, when expressed as a percentage of total body fat. In men, the risk of developing lipoatrophy was more than two times greater than that of women, after adjusting for age, baseline body mass index, and ART regimen. Lipohypertrophy occurred similarly in men and women. VAT and SAT increased significantly in men and women, with women gaining considerably more than men. These findings are of great concern as an increased waist circumference is associated with increased mortality in HIV-infected populations. Further investigation is required to understand the mechanisms underlying the sex differences in changes in body fat distribution and its effects on cardiovascular risk.
Deficiency of Retinaldehyde Dehydrogenase 1 Induces BMP2 and Increases Bone Mass In Vivo
Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W.; Brown, Jonathan D.; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J.; Plutzky, Jorge
2013-01-01
The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1−/−) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1−/− mice. In serum assays, Aldh1a1−/− mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1−/− mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1−/− mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1−/− mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling. PMID:23951127
DOE Office of Scientific and Technical Information (OSTI.GOV)
Newby, M.J.; Keim, N.L.; Brown, D.L.
1990-08-01
This study contrasts body compositions (by six methods) of eight cystic fibrosis (CF) subjects with those of eight control subjects matched for age, height, and sex. CF subjects weighed 84% as much as control subjects. Densitometry and two bioelectrical impedance-analysis methods suggested that reduced CF weights were due to less lean tissue (10.7, 9.5, and 10.4 kg). Total-body electrical conductivity (TOBEC) and skinfold-thickness measurements indicated that CF subjects were leaner than control subjects and had less fat (5.4 and 3.6 kg) and less lean (5.2 and 7 kg) tissue. D2O dilution showed a pattern similar to TOBEC (8.3 kg lessmore » lean, 2.7 kg less fat tissue). Densitometry estimates of fat (mass and percent) were not correlated (r less than 0.74, p greater than 0.05) with any other method for CF subjects but were correlated with all other methods for control subjects. CF subjects contained less fat and lean tissue than did control subjects. Densitometry by underwater weighing is unsuitable for assessing body composition of CF patients.« less
Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios Z; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A
2011-01-01
A high prevalence of osteopenia and osteoporosis is observed in patients with inflammatory bowel disease (IBD). Various risk factors of bone loss have been suggested in IBD. The aim of the present study was to investigate the prevalence of low bone mineral density (BMD) and to identify related risk factors in Greek patients with IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy X-ray absorptiometry at the femoral neck and lumbar spine levels. Serum levels of 25 hydroxyvitamin D (25 OH D), 1.25 dihydroxyvitamin D (1.25 OH 2D), osteocalcin, calcitonin and homocysteine were measured in all participants. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. No significant differences between IBD patients with osteopenia or osteoporosis and those with normal BMD concerning the use of steroids and the examined biochemical markers were found. Statistically significant differences among the three groups were found for body mass index (BMI), age and disease duration (P=0.002, P<0.0001 and P=0.03 respectively). Multivariate analysis revealed that the most significant factors associated with BMD were age and BMI (P<0.0001). A weak but statistically significant correlation was also found for disease duration (P=0.04). There is a high prevalence of osteopenia and osteoporosis in Greek patients with IBD. Low BMI, age and disease duration are the most important independent risk factors for osteoporosis in Greek IBD patients.
Sepriano, Alexandre; Roman-Blas, Jorge A; Little, Robert D; Pimentel-Santos, Fernando; Arribas, Jose María; Largo, Raquel; Branco, Jaime C; Herrero-Beaumont, Gabriel
2015-12-01
Subchondral bone mineral density (sBMD) contributes to the initiation and progression of knee osteoarthritis (OA). Reliable methods to assess sBMD status may predict the response of specific OA phenotypes to targeted therapies. While dual-energy X-ray absorptiometry (DXA) of the knee can determine sBMD, no consensus exists regarding its methodology. Construct a semi-standardized protocol for knee DXA to measure sBMD in patients with OA of the knee by evaluating the varying methodologies present in existing literature. We performed a systematic review of original papers published in PubMed and Web of Science from their inception to July 2014 using the following search terms: subchondral bone, osteoarthritis, and bone mineral density. DXA of the knee can be performed with similar reproducibility values to those proposed by the International Society for Clinical Densitometry for the hip and spine. We identified acquisition view, hip rotation, knee positioning and stabilization, ROI location and definition, and the type of analysis software as important sources of variation. A proposed knee DXA protocol was constructed taking into consideration the results of the review. DXA of the knee can be reliably performed in patients with knee OA. Nevertheless, we found substantial methodological variation across previous studies. Methodological standardization may provide a foundation from which to establish DXA of the knee as a valid tool for identification of SB changes and as an outcome measure in clinical trials of disease modifying osteoarthritic drugs. Copyright © 2015 Elsevier Inc. All rights reserved.
Skedros, John G; Knight, Alex N; Pitts, Todd C; O'Rourke, Peter J; Burkhead, Wayne Z
2016-02-01
Methods are needed for identifying poorer quality cadaver proximal humeri to ensure that they are not disproportionately segregated into experimental groups for fracture studies. We hypothesized that measurements made from radiographs of cadaveric proximal humeri are stronger predictors of fracture strength than chronological age or bone density values derived from dual-energy x-ray absorptiometry (DXA) scans. Thirty-three proximal humeri (range: 39-78 years) were analyzed for: (1) bone mineral density (BMD, g/cm(2)) using DXA, (2) bulk density (g/cm(3)) using DXA and volume displacement, (3) regional bone density in millimeters of aluminum (mmAl) using radiographs, and (4) regional mean (medial+lateral) cortical thickness and cortical index (CI) using radiographs. The bones were then fractured simulating a fall. Strongest correlations with ultimate fracture load (UFL) were: mean cortical thickness at two diaphyseal locations (r = 0.71; p < 0.001), and mean mmAl in the humeral head (r = 0.70; p < 0.001). Weaker correlations were found between UFL and DXA-BMD (r = 0.60), bulk density (r = 0.43), CI (r = 0.61), and age (r = -0.65) (p values <0.01). Analyses between UFL and the product of any two characteristics showed six combinations with r-values >0.80, but none included DXA-derived density, CI, or age. Radiographic morphometric and densitometric measurements from radiographs are therefore stronger predictors of UFL than age, CI, or DXA-derived density measurements. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Association between duration of playing video games and bone mineral density in Chinese adolescents.
Shao, Haiyu; Xu, Shaonan; Zhang, Jun; Zheng, Jiayin; Chen, Jinping; Huang, Yazeng; Ru, Bin; Jin, Yongming; Zhang, Qi; Ying, Qifeng
2015-01-01
The aim of the study was to investigate the association between duration of playing video games and bone mineral density (BMD) in Chinese adolescents. Three hundred eighty-four Chinese adolescents aged 14-18 yr (148 males and 236 females) were analyzed. Anthropometric measurements were obtained using standard procedures. Total body and regional BMD were measured using dual-energy X-ray absorptiometry. Duration of playing video games, defined as hours per day, was measured by a self-report questionnaire. We examined the association between duration of playing video games and BMD using multiple linear regression analysis. After adjustment for age, sex, pubertal stage, parental education, body mass index, adolescents with longer video game duration were more likely to have lower legs, trunk, pelvic, spine, and total BMD (p < 0.05). We concluded that duration of video game was negatively associated with BMD in Chinese adolescents. These findings provide support for reducing duration of playing video games as a possible means to increase BMD in adolescents. Future research is needed to elucidate the underlined mechanisms linking playing video games and osteoporosis. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Primary hyperparathyroidism: recent advances.
Walker, Marcella D; Bilezikian, John P
2018-07-01
The purpose of this review is to describe recent advances and changes in the evaluation and management of primary hyperparathyroidism (PHPT). Although it has long been recognized that asymptomatic PHPT is associated with bone loss, particularly at cortical skeletal sites when evaluated with dual-energy X-ray absorptiometry, new imaging techniques suggest that trabecular skeletal deterioration as well as clinically silent vertebral fractures and nephrolithiasis are common. Nonclassical targets of asymptomatic PHPT as well as the effect of vitamin D deficiency and treatment upon PHPT presentation have been the subject of recent intense investigation. Randomized clinical trials are now available regarding the effect of parathyroidectomy (PTX) upon both classical and nonclassical target organs. They have confirmed results from observational studies with regard to the skeletal benefits of PTX but have not consistently shown improvements in nonclassical symptoms. These findings have led to recommendations for more extensive renal and skeletal evaluation and broader criteria for PTX in PHPT. In addition to dual-energy X-ray absorptiometry, vertebral and renal imaging is recommended. When available, trabecular imaging techniques may be helpful. PTX criteria now include subclinical kidney stones, vertebral fractures and hypercalciuria, in addition to those based on age, serum calcium, bone densitometry and renal function.
Nava-González, Edna J; de la Garza-Casas, Yolanda E; Salazar-Montalvo, Raúl G; Gallegos-Cabriales, Esther C
2013-01-01
women with endometriosis may have a decreased bone mineral density (BMD). Several studies have shown that accumulation of adipose tissue profoundly affects BMD. It has also been documented that excess body fat is associated with risk of developing endometriosis. The aim was to analyze the relationship between BMD, fat mass, and the insulin-glucose axis in women with endometriosis. thirty women with a diagnosis of endometriosis established by surgery were enrolled to participate in an observational prospective study. Anthropometry was performed to determine body mass index, and a dual X-ray densitometry to collect data on body composition and BMD. Glucose and insulin determinations were performed. Women were divided in two groups: with normal weight (n = 18) or overweight (n = 12). For the analysis of the results, we used descriptive statistics and Pearson's test. normal weight/overweight: mean age 32.5/35.2 years; body mass index 21.5/30.2; adiposity index: 27.7 %/36.1 %; fat mass index: 35.4/45.8 %; overweight women showed a significant value with p < 0.05. overweight, high values of adiposity index and fat mass index were related to endometriosis. This could support the hypothesis about a common pathogenesis among endometriosis, osteoporosis, diabetes and obesity.
Functional Effects of Prebiotic Fructans in Colon Cancer and Calcium Metabolism in Animal Models.
Rivera-Huerta, Marisol; Lizárraga-Grimes, Vania Lorena; Castro-Torres, Ibrahim Guillermo; Tinoco-Méndez, Mabel; Macías-Rosales, Lucía; Sánchez-Bartéz, Francisco; Tapia-Pérez, Graciela Guadalupe; Romero-Romero, Laura; Gracia-Mora, María Isabel
2017-01-01
Inulin-type fructans are polymers of fructose molecules and are known for their capacity to enhance absorption of calcium and magnesium, to modulate gut microbiota and energy metabolism, and to improve glycemia. We evaluated and compared the effects of Chicory inulin "Synergy 1®" and inulin from Mexican agave "Metlin®" in two experimental models of colon cancer and bone calcium metabolism in mice and rats. Inulins inhibited the development of dextran sulfate sodium-induced colitis and colon cancer in mice; these fructans reduced the concentration of tumor necrosis factor alpha and prevented the formation of intestinal polyps, villous atrophy, and lymphoid hyperplasia. On the other hand, inulin treatments significantly increased bone densitometry (femur and vertebra) in ovariectomized rats without altering the concentration of many serum biochemical parameters and urinary parameters. Histopathology results were compared between different experimental groups. There were no apparent histological changes in rats treated with inulins and a mixture of inulins-isoflavones. Our results showed that inulin-type fructans have health-promoting properties related to enhanced calcium absorption, potential anticancer properties, and anti-inflammatory effects. The use of inulin as a prebiotic can improve health and prevent development of chronic diseases such as cancer and osteoporosis.
Skeletal changes during and after spaceflight.
Vico, Laurence; Hargens, Alan
2018-03-21
Space sojourns are challenging for life. The ability of the human body to adapt to these extreme conditions has been noted since the beginning of human space travel. Skeletal alterations that occur during spaceflight are now better understood owing to tools such as dual-energy X-ray densitometry and high-resolution peripheral quantitative CT, and murine models help researchers to understand cellular and matrix changes that occur in bone and that are difficult to measure in humans. However, questions remain with regard to bone adaptation and osteocyte fate, as well as to interactions of the skeleton with fluid shifts towards the head and with the vascular system. Further investigations into the relationships between the musculoskeletal system, energy metabolism and sensory motor acclimatisation are needed. In this regard, an integrated intervention is required that will address multiple systems simultaneously. Importantly, radiation and isolation-related stresses are gaining increased attention as the prospect of human exploration into deep space draws nearer. Although space is a unique environment, clear parallels exist between the effects of spaceflight, periods of immobilization and ageing, with possibly irreversible features. Space travel offers an opportunity to establish integrated deconditioning and ageing interventions that combine nutritional, physical and pharmaceutical strategies.
Study of the protective effect of dexamethasone on cisplatin-induced ototoxicity in rats.
Capelo, Isabelle Oliveira Jatai; Batista, Avner Marcos Alves; Brito, Yuri Neyson Ferreira; Diniz, Krissia Braga; Brito, Gerly Anne de Castro; Freitas, Marcos Rabelo de
2017-10-01
To evaluate the ability of dexamethasone to protect against cisplatin (CDDP)-induced ototoxicity. Male Wistar rats were divided into the following three groups: 1) Control (C): 6 animals received intraperitoneal (IP) saline solution, 8 ml/kg/day for four days; 2) C + CDDP: 11 animals received 8 ml/kg/day of IP saline and, 90 min after saline administration, 8 mg/kg/day of IP CDDP for four days; and 3) DEXA15 + CDDP: 11 animals received IP dexamethasone 15 mg/kg/day and, 90 min after dexamethasone administration, received 8 mg/kg/day of IP CDDP for four days. It was found that dexamethasone did not protect against weight loss in CDDP-exposed animals. The mortality rate was comparable with that previously reported in the literature. The auditory threshold of animals in the DEXA15 + CDDP group was not significantly altered after exposure to CDDP. The stria vascularis of animals in the DEXA15 + CDDP group was partially preserved after CDDP exposure. Dexamethasone at the dose of 15 mg/kg/day partially protected against CDDP-induced ototoxicity, based on functional evaluation by brainstem evoked response audiontry (BERA) and morphological evaluation by optical microscopy. However, dexamethasone did not protect against systemic toxicity.
Alghadir, Ahmad H; Gabr, Sami A; Al-Eisa, Einas S; Alghadir, Muaz H
2016-01-01
Life style and physical activity play a pivotal role in prevention and treatment of osteoporosis. The mechanism for better bone metabolism and improvement of physical disorders is not clear yet. Trace minerals such as Ca, Mn, Cu, and Zn are essential precursors for most vital biological process, especially those of bone health. The main target of this study was evaluating the effective role of supervised aerobic exercise for 1 hour/day, 3 days/week for 12 weeks in the functions of trace elements in bone health through measuring bone mineral density (BMD), osteoporosis (T-score), bone markers, and trace element concentrations in healthy subjects aged 30-60 years with age average of 41.2±4.9. A total of 100 healthy subjects (47 males, 53 females; age range 30-60 years) were recruited for this study. Based on dual-energy x-ray absorptiometry (DEXA) scan analysis, the participants were classified into three groups: normal (n=30), osteopenic (n=40), and osteoporotic (n=30). Following, 12 weeks of moderate aerobic exercise, bone-specific alkaline phosphatase (BAP), BMD, T-score, and trace elements such as Ca, Mn, Cu, and Zn were assessed at baseline and post-intervention. Significant improvement in serum BAP level, T-score, and BMD were observed in all participants following 12 weeks of moderate exercise. Participants with osteopenia and osteoporosis showed significant increase in serum Ca and Mn, along with decrease in serum Cu and Zn levels following 12 weeks of aerobic training. In control group, the improvements in serum trace elements and body mass index were significantly linked with the enhancement in the levels of BAP, BMD hip, and BMD spine. These results supported the preventive effects of moderate exercise in healthy subjects against osteoporosis. In both sexes, the changes in serum trace elements significantly correlated (P<0.05) with the improvement in BAP, BMD hip, BMD spine, and body mass index in all groups. The observed changes in the levels of Ca, Mn, Cu, and Zn were shown to be positively correlated with improved bone mass density among control and osteoporosis subjects of both sexes. These results demonstrate that aerobic exercise of moderate intensity might protect bone and cartilage by regulation of body trace elements which are involved in the biosynthesis of bone matrix structures and inhibition of bone resorption process via a proposed anti-free radical mechanism.
Leib, Edward S; Saag, Kenneth G; Adachi, Jonathan D; Geusens, Piet P; Binkley, Neil; McCloskey, Eugene V; Hans, Didier B
2011-01-01
Given the significant impact the use of glucocorticoids can have on fracture risk independent of bone density, their use has been incorporated as one of the clinical risk factors for calculating the 10-year fracture risk in the World Health Organization's Fracture Risk Assessment Tool (FRAX(®)). Like the other clinical risk factors, the use of glucocorticoids is included as a dichotomous variable with use of steroids defined as past or present exposure of 3 months or more of use of a daily dose of 5 mg or more of prednisolone or equivalent. The purpose of this report is to give clinicians guidance on adjustments which should be made to the 10-year risk based on the dose, duration of use and mode of delivery of glucocorticoids preparations. A subcommittee of the International Society for Clinical Densitometry and International Osteoporosis Foundation joint Position Development Conference presented its findings to an expert panel and the following recommendations were selected. 1) There is a dose relationship between glucocorticoid use of greater than 3 months and fracture risk. The average dose exposure captured within FRAX(®) is likely to be a prednisone dose of 2.5-7.5 mg/day or its equivalent. Fracture probability is under-estimated when prednisone dose is greater than 7.5 mg/day and is over-estimated when the prednisone dose is less than 2.5 mg/day. 2) Frequent intermittent use of higher doses of glucocorticoids increases fracture risk. Because of the variability in dose and dosing schedule, quantification of this risk is not possible. 3) High dose inhaled glucocorticoids may be a risk factor for fracture. FRAX(®) may underestimate fracture probability in users of high dose inhaled glucocorticoids. 4) Appropriate glucocorticoid replacement in individuals with adrenal insufficiency has not been found to increase fracture risk. In such patients, use of glucocorticoids should not be included in FRAX(®) calculations. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
McNamara, Elizabeth A; Kilim, Holly P; Malabanan, Alan O; Whittaker, LaTarsha G; Rosen, Harold N
The International Society for Clinical Densitometry guidelines recommend using locally derived precision data for spine bone mineral densities (BMDs), but do not specify whether data derived from L1-L4 spines correctly reflect the precision for spines reporting fewer than 4 vertebrae. Our experience suggested that the decrease in precision with successively fewer vertebrae is progressive as more vertebrae are excluded and that the precision for the newer Horizon Hologic model might be better than that for the previous model, and we sought to quantify. Precision studies were performed on Hologic densitometers by acquiring spine BMD in fast array mode twice on 30 patients, according to International Society for Clinical Densitometry guidelines. This was done 10 different times on various Discovery densitometers, and once on a Horizon densitometer. When 1 vertebral body was excluded from analysis, there was no significant deterioration in precision. When 2 vertebrae were excluded, there was a nonsignificant trend to poorer precision, and when 3 vertebrae were excluded, there was significantly worse precision. When 3 or 4 vertebrae were reported, the precision of the spine BMD measurement was significantly better on the Hologic Horizon than on the Discovery, but the difference in precision between densitometers narrowed and was no longer significant when 1 or 2 vertebrae were reported. The results suggest that (1) the measurement of in vivo spine BMD on the new Hologic Horizon densitometer is significantly more precise than on the older Discovery model; (2) the difference in precision between the Horizon and Discovery models decreases as fewer vertebrae are included; (3) the measurement of spine BMD is less precise as more vertebrae are excluded, but still quite reasonable even when only 1 vertebral body is included; and (4) when 3 vertebrae are reported, L1-L4 precision data can reasonably be used to report significance of changes in BMD. When 1 or 2 vertebrae are reported, precision data for 1 or 2 vertebrae, respectively, should be used, because the exclusion of 2-3 vertebrae significantly worsens precision. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Volleyball and Basketball Enhanced Bone Mass in Prepubescent Boys.
Zouch, Mohamed; Chaari, Hamada; Zribi, Anis; Bouajina, Elyès; Vico, Laurence; Alexandre, Christian; Zaouali, Monia; Ben Nasr, Hela; Masmoudi, Liwa; Tabka, Zouhair
2016-01-01
The aim of this study was to examine the effect of volleyball and basketball practice on bone acquisition and to determine which of these 2 high-impact sports is more osteogenic in prepubertal period. We investigated 170 boys (aged 10-12 yr, Tanner stage I): 50 volleyball players (VB), 50 basketball players (BB), and 70 controls. Bone mineral content (BMC, g) and bone area (BA, cm(2)) were measured by dual-energy X-ray absorptiometry at different sites. We found that, both VB and BB have a higher BMC at whole body and most weight-bearing and nonweight-bearing sites than controls, except the BMC in head which was lower in VB and BB than controls. Moreover, only VB exhibited greater BMC in right and left ultra-distal radius than controls. No significant differences were observed between the 3 groups in lumbar spine, femoral neck, and left third D radius BMC. Athletes also exhibited a higher BA in whole body, limbs, lumbar spine, and femoral region than controls. In addition, they have a similar BA in head and left third D radius with controls. The VB exhibited a greater BA in most radius region than controls and a greater femoral neck BA than BB. A significant positive correlation was reported between total lean mass and both BMC and BA in whole body, lumbar spine, total hip, and right whole radius among VB and BB. In summary, we suggest that volleyball and basketball have an osteogenic effect BMC and BA in loaded sites in prepubescent boys. The increased bone mass induced by both volleyball and basketball training in the stressed sites was associated to a decreased skull BMC. Moreover, volleyball practice produces a more sensitive mechanical stress in loaded bones than basketball. This effect seems translated by femoral neck expansion. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Mazurek-Mochol, Małgorzata
2002-01-01
Drug interactions are the side effect of administration of two or more drugs or a drug-food combination. Although some drug interactions are intentional and beneficial to the patient, the majority are unintentional and associated with a potentially harmful effect. The aim of this study was to search for interactions in rats between fluoride and zinc administered orally for 12 weeks and to elucidate any potential toxicological and therapeutic consequences. 60 male Wistar rats were divided into six groups of ten rats each and exposed to: 1. controls (distilled water); 2. sodium fluoride (NaF); 3. low-dose zinc (Zn); 4. high-dose zinc; 5. NaF + low-dose Zn; 6. NaF + high-dose Zn. At the end of the experiment the content of F- and Zn+ in serum, urine, incisors, femur and mandible was measured and densitometry of femoral bones was performed. Serum alkaline phosphatase, alanine and aspartate aminotransferase activities, as well as bilirubin and creatinine concentrations were determined to confirm non-toxicity of fluoride dose. Animals receiving NaF only demonstrated higher content of fluorine in serum, urine bones and teeth. Zinc concentrations in serum, urine, bones and teeth were elevated in rats receiving zinc with or without NaF. Fluorine accumulation in bones and teeth was reduced by Zn, but in general the effect lacked statistical significance. Zinc slightly reduced the concentrations of fluorine in serum and urine. Sodium fluoride slightly reduced the concentration of zinc in serum and urine. Bone mineral content (BMC) was significantly increased by NaF and was not further increased by co-administration of zinc. No changes in serum alkaline phosphatase, alanine and aspartate aminotransferase activities, bilirubin and creatinine concentrations were detected. In conclusion, simultaneous administration of fluorine and zinc may be beneficial for prevention and treatment of pathologic conditions in bones and teeth and is not accompanied by an increase in fluorine levels which could be responsible for toxicological symptoms.
Shimano, R C; Yanagihara, G R; Macedo, A P; Yamanaka, J S; Shimano, A C; Tavares, J M R S; Issa, J P M
2018-05-01
The aim of this study was to evaluate the effects of high-impact physical exercise as a prophylactic and therapeutic means in osteopenic bones of rats submitted to ovariectomy and protein diet intake. A total of 64 Wistar rats were divided into eight groups (n = 8 each), being: OVX, ovx, standard diet and sedentary; OVXE, ovx, standard diet and jump; OVXP, ovx, high-protein diet and sedentary; and OVXEP, ovx, high-protein diet and jump; SH, sham, standard diet and sedentary; SHE, sham, standard diet and jump; SHP, sham, high-protein diet and sedentary; and SHEP, sham, high-protein diet and jump. OVX surgery consists of ovariectomy, and sham was the control surgery. The jumping protocol consisted of 20 jumps/day, 5 days/week. The bone structure was evaluated by densitometry, mechanical tests, histomorphometric, and immunohistochemical analyses. A high-protein diet resulted in increased bone mineral density (P = .049), but decreased maximal load (P = .026) and bone volume fraction (P = .023). The benefits of physical exercise were demonstrated by higher values of the maximal load in the trained groups compared to the sedentary groups (P < .001). The sham groups had decreased immunostaining of osteocalcin (P = .004) and osteopontin (P = .010) compared to ovx groups. However, the high-protein diet (P = .005) and jump exercise (P = .017) resulted in lower immunostaining of osteopontin compared to the standard diet and sedentary groups, respectively. In this experimental model, it was concluded that ovariectomy and a high-fat diet can negatively affect bone tissue and the high-impact exercise was not enough to suppress the deleterious effects caused by the protein diet and ovariectomy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[The effect of group exercise on postmenopausal osteoporosis and osteopenia].
Angin, Erden; Erden, Zafer
2009-01-01
We investigated the effects of group exercise on bone mineral density (BMD), pain, and quality of life in postmenopausal women with osteoporosis and osteopenia. The study included 16 osteoporotic (mean age 55.2 years) and 17 osteopenic (mean age 55.4 years) postmenopausal women whose diagnoses were made by dual energy X-ray absorptiometry (DEXA) showing T-scores of less than -2.5 and in a range of -1 to -2.5, respectively. Subjects having orthopedic, neurological, respiratory, vascular, metabolic, or mental problems were excluded. Each group received the same group exercise program for one hour three times a week for 21 weeks, supervised by a physiotherapist, and including breathing, warm-up, stretching, strengthening, balance, stabilization, and cooling exercises. All participants were evaluated before and after the exercise program by a visual analog scale for pain severity, by DEXA for BMD, and by QUALEFFO-41 (Quality of Life Questionnaire of the European Foundation for Osteoporosis) for quality of life. The two groups were similar with respect to age, height, and body mass index (p>0.05), but osteopenic women had a higher body weight (p<0.05). After the exercise program, both groups exhibited significant improvements in T-score, pain score, BMD, and all parameters of the QUALEFFO-41 (p<0.05). The mean T-scores before and after exercise were -2.7 + or - 0.2 and -2.4 + or - 0.5 in osteoporotic women, and -1.8 + or - 0.5 and -1.4 + or - 0.5 in osteopenic women, respectively. Following exercise, 43.8% of osteoporotic women had a T-score showing osteopenia, and 23.5% of osteopenic women had a T-score falling within the normal range. The two groups did not differ significantly with respect to the differences between the mean improvements obtained after the exercise program (p>0.05). This pilot study demonstrates the effectiveness of physiotherapist-supervised group exercise programs in decreasing pain and increasing BMD and quality of life of both osteoporotic and osteopenic women.
[Endocrine complications of cystic fibrosis in childhood].
Castanet, M; Wieliczko, M-C
2012-05-01
Since the 20 last years, the median age of survival has dramatically improved in children suffering from cystic fibrosis and complications such as growth retardation, pubertal delay and low bone mineral density are now more often than not observed in affected adolescents. The severity of the disease and the poor nutritional status due to pancreatic insufficiency and malabsorption are commonly implicated but recent data suggest that the disease could also play a role though the alteration of the chlore chanel (CFTR). Furthermore an increase prevalence of glucose intolerance and diabetes due to the progressive β cells destruction is observed in these children that make the life sometimes difficult for these adolescents already affected by an heavy chronic disease. The monitoring of the children should thus now become pluridisciplinary and include regular clinical evaluation of height and pubertal status, mineral bone density by DEXA and OGTT every two years since 10 years of age. Therefore, in addition to the standard treatment of cystic fibrosis is now added the vitamin D supplementation, the subcutaneous insulin therapy and may be the growth hormone that could be a new therapeutic demonstrating beneficial effects in these chronic disease. However further studies need to be performed to improve the management of these new endocrine complications more and more frequent in children and adolescents suffering from cystic fibrosis. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Osteopenia as a feature of the androgen insensitivity syndrome.
Soule, S G; Conway, G; Prelevic, G M; Prentice, M; Ginsburg, J; Jacobs, H S
1995-12-01
The syndrome of androgen insensitivity, a paradigm of a hormone resistance syndrome, manifests as failure of masculinization despite normal or high concentrations of serum testosterone. The defect in these 46 XY patients resides in the androgen receptor gene, with consequent defective androgen action and abnormal sexual differentiation. We sought to evaluate whether the adverse sequelae of androgen resistance may extend to skeletal tissue by measuring bone mineral density in six patients with androgen insensitivity. A cross-sectional retrospective study. Bone mineral density was measured by means of a Dexa (Hologic QDR 1000 scanner). The diagnosis of androgen insensitivity was confirmed in each patient by karyotype and assay of sex hormones. The five adult patients with androgen insensitivity had been exposed to both defective androgen action and variable periods of oestrogen deficiency. The latter resulted from the low circulating oestrogen concentrations (for premenopausal females) before gonadectomy and inadequate oestrogen replacement after gonadectomy. All five adults with androgen insensitivity had osteopenia in both the lumbar spine (T-score -1.52 to -3.85) and femoral neck (T-score -1.34 to -4.91). Osteopenia in patients with androgen insensitivity may relate to defective androgen action, oestrogen deficiency or a combination of the two. These observations have implications for the management of patients with androgen insensitivity and may provide insight into the effects of androgens on the female as well as the male skeleton.
Bebeshko, V G; Bruslova, E M; Volodina, T T; Tsvietkova, N M; Lyashenko, L A; Pushkareva, T I; Voloshko, V I; Veselskaya, L P; Chernysh, T A; Trikhleb, I V
2014-12-01
Age and sexual indexies of densitometry at patients with acute leukemia (AL) and healthy children are presented. 31% of children with AL during the initial period of disease had manifestations of the osteopenic syndrome. At patients with AL more often than at healthy children anomalies of development of front part of skull are defined. The partial contribution of free and peptides-connencted oxyproline in urine at AL patients differs in comparison with control group that is caused by modification or deficiency of the corresponding enzymes. 30% of patients with AL had raised concentration of free oxyproline in urine, and lowered glycine concentration that testifies to the increased disintegration of collagen and deficiency of tile plastic material necessary for collagene-forming processes. The obtained data should be considered for forming of risk group on oncohematological pathology at children.
Druzhinin, V N; Shardakova, É F; Cherniĭ, A N
2014-01-01
The studies using multiple X-ray methods covered influence of complex containing working process and occupational environment factors on locomotory apparatus of upper limbs and cervical spine in female seamers engaged into various productions. Comparative analysis involved results of regular (standard X-ray) and special X-ray methods (stereoroentgenography, high definition roentgenography, roentgen densitometry, roentgenogrammetry) in 370 examinees with early and moderate clinical symptoms of occupationally mediated diseases of the stated areas. X-ray studies of locomotory apparatus of upper limbs and cervical spine in clothing manufacture workers, with special diagnostic methods, enabled to determine incidence and severity of functional and structural changes more reliably than via standard examination. The changes revealed were assigned mostly in "early" and "moderate" categories and matched with occupational peculiarities of the workers examined.
Association of unipedal standing time and bone mineral density in community-dwelling Japanese women.
Sakai, A; Toba, N; Takeda, M; Suzuki, M; Abe, Y; Aoyagi, K; Nakamura, T
2009-05-01
Bone mineral density (BMD) and physical performance of the lower extremities decrease with age. In community-dwelling Japanese women, unipedal standing time, timed up and go test, and age are associated with BMD while in women aged 70 years and over, unipedal standing time is associated with BMD. The aim of this study was to clarify whether unipedal standing time is significantly associated with BMD in community-dwelling women. The subjects were 90 community-dwelling Japanese women aged 54.7 years. BMD of the second metacarpal bone was measured by computed X-ray densitometry. We measured unipedal standing time as well as timed up and go test to assess physical performance of the lower extremities. Unipedal standing time decreased with increased age. Timed up and go test significantly correlated with age. Low BMD was significantly associated with old age, short unipedal standing time, and long timed up and go test. Stepwise regression analysis revealed that age, unipedal standing time, and timed up and go test were significant factors associated with BMD. In 21 participants aged 70 years and over, body weight and unipedal standing time, but not age, were significantly associated with BMD. BMD and physical performance of the lower extremities decrease with older age. Unipedal standing time, timed up and go test, and age are associated with BMD in community-dwelling Japanese women. In women aged 70 years and over, unipedal standing time is significantly associated with BMD.
Construction and validation of a population-based bone densitometry database.
Leslie, William D; Caetano, Patricia A; Macwilliam, Leonard R; Finlayson, Gregory S
2005-01-01
Utilization of dual-energy X-ray absorptiometry (DXA) for the initial diagnostic assessment of osteoporosis and in monitoring treatment has risen dramatically in recent years. Population-based studies of the impact of DXA and osteoporosis remain challenging because of incomplete and fragmented test data that exist in most regions. Our aim was to create and assess completeness of a database of all clinical DXA services and test results for the province of Manitoba, Canada and to present descriptive data resulting from testing. A regionally based bone density program for the province of Manitoba, Canada was established in 1997. Subsequent DXA services were prospectively captured in a program database. This database was retrospectively populated with earlier DXA results dating back to 1990 (the year that the first DXA scanner was installed) by integrating multiple data sources. A random chart audit was performed to assess completeness and accuracy of this dataset. For comparison, testing rates determined from the DXA database were compared with physician administrative claims data. There was a high level of completeness of this database (>99%) and accurate personal identifier information sufficient for linkage with other health care administrative data (>99%). This contrasted with physician billing data that were found to be markedly incomplete. Descriptive data provide a profile of individuals receiving DXA and their test results. In conclusion, the Manitoba bone density database has great potential as a resource for clinical and health policy research because it is population based with a high level of completeness and accuracy.
Novel Equations for Estimating Lean Body Mass in Peritoneal Dialysis Patients
Dong, Jie; Li, Yan-Jun; Xu, Rong; Yang, Zhi-Kai; Zheng, Ying-Dong
2015-01-01
♦ Objectives: To develop and validate equations for estimating lean body mass (LBM) in peritoneal dialysis (PD) patients. ♦ Methods: Two equations for estimating LBM, one based on mid-arm muscle circumference (MAMC) and hand grip strength (HGS), i.e., LBM-M-H, and the other based on HGS, i.e., LBM-H, were developed and validated with LBM obtained by dual-energy X-ray absorptiometry (DEXA). The developed equations were compared to LBM estimated from creatinine kinetics (LBM-CK) and anthropometry (LBM-A) in terms of bias, precision, and accuracy. The prognostic values of LBM estimated from the equations in all-cause mortality risk were assessed. ♦ Results: The developed equations incorporated gender, height, weight, and dialysis duration. Compared to LBM-DEXA, the bias of the developed equations was lower than that of LBM-CK and LBM-A. Additionally, LBM-M-H and LBM-H had better accuracy and precision. The prognostic values of LBM in all-cause mortality risk based on LBM-M-H, LBM-H, LBM-CK, and LBM-A were similar. ♦ Conclusions: Lean body mass estimated by the new equations based on MAMC and HGS was correlated with LBM obtained by DEXA and may serve as practical surrogate markers of LBM in PD patients. PMID:26293839
Novel Equations for Estimating Lean Body Mass in Peritoneal Dialysis Patients.
Dong, Jie; Li, Yan-Jun; Xu, Rong; Yang, Zhi-Kai; Zheng, Ying-Dong
2015-12-01
♦ To develop and validate equations for estimating lean body mass (LBM) in peritoneal dialysis (PD) patients. ♦ Two equations for estimating LBM, one based on mid-arm muscle circumference (MAMC) and hand grip strength (HGS), i.e., LBM-M-H, and the other based on HGS, i.e., LBM-H, were developed and validated with LBM obtained by dual-energy X-ray absorptiometry (DEXA). The developed equations were compared to LBM estimated from creatinine kinetics (LBM-CK) and anthropometry (LBM-A) in terms of bias, precision, and accuracy. The prognostic values of LBM estimated from the equations in all-cause mortality risk were assessed. ♦ The developed equations incorporated gender, height, weight, and dialysis duration. Compared to LBM-DEXA, the bias of the developed equations was lower than that of LBM-CK and LBM-A. Additionally, LBM-M-H and LBM-H had better accuracy and precision. The prognostic values of LBM in all-cause mortality risk based on LBM-M-H, LBM-H, LBM-CK, and LBM-A were similar. ♦ Lean body mass estimated by the new equations based on MAMC and HGS was correlated with LBM obtained by DEXA and may serve as practical surrogate markers of LBM in PD patients. Copyright © 2015 International Society for Peritoneal Dialysis.
Premature greying of the hair is not associated with low bone mineral density.
Beardsworth, S A; Kearney, C E; Steel, S A; Newman, J; Purdie, D W
1999-01-01
In two recent case-control studies premature greying of the hair was associated with a lowering of bone mineral density (BMD) and osteopenia, suggesting that this might be a clinically useful risk marker for osteoporosis. We report a further re-examination of this proposal in 52 prematurely grey-haired women from East Yorkshire who responded to an advertisement inviting them for bone densitometry. Thirty-five had no clinical or drug history that could influence bone density. All were Caucasian with a mean age of 52.8 years. In the group as a whole the mean BMD values at the lumbar spine and femoral neck were no different from those of a young adult, but there was a trend toward a greater than average BMD than that of the local age-matched population (p = 0.097 and 0.218, respectively). Twenty women were premenopausal, with an average age of 45.3 years. Mean BMD values at the lumbar spine and femoral neck in this group were no different from those of young adults. There was, however, a trend toward a BMD greater than that of the local age-matched population at the femoral neck (p = 0.117). Fifteen women were postmenopausal with an average age of 62.9 years and an average age at menopause of 51.1 years. Mean BMD values at both the lumbar spine and femoral neck in this group were lower than those of young adults, but no different from those of the local age-matched population. In conclusion, our group of prematurely grey-haired women had average BMD for their age, and we are therefore unable to support the proposed clinical usefulness of premature greying as a risk marker for osteoporosis.
Chávez-Valencia, Venice; Arce-Salinas, César Alejandro; Espinosa-Ortega, Fabricio
2014-01-01
Cost-minimization study to assess the annual direct costs of 2 antiresorptive strategies in postmenopausal women with low bone mineral densities (BMDs). Patients were randomly assigned to receive 70 mg of oral weekly alendronate or a 1-time 5mg of intravenous zoledronic acid. All medical and nonmedical direct costs were recorded for 1 yr. Student's t-test or the Chi-squared test was used. A total of 101 postmenopausal women were enrolled with a mean age of 58.3 ± 7.6 yr and a postmenopausal period of 13.5 ± 8.3 yr. A total of 50 patients completed 1 yr of alendronate and 51 patients received zoledronic acid. At baseline, no differences were seen between the 2 groups in anthropometric measures, comorbidities, and bone mineral density. The costs for medical attention for low bone mass were $81,532 (US Dollars) for the alendronate group and $69,251 for the zoledronic acid group; the cost per patient was $1631 in the alendronate group vs $1358 in the zoledronic acid group (p<0.0001). Therefore, zoledronic acid treatment provided an annual savings of 15% of the direct costs compared with oral alendronate treatment. Moreover, there was a significant increase in lumbar spine T-scores in the zoledronic acid group when compared with the alendronate group. Annual zoledronic acid infusion as an antiresorptive treatment in women with low BMD provides significant monetary savings when compared with weekly alendronate therapy for 1 yr. Zoledronic acid infusion is also linked to higher increase in BMD and compliance. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
High prevalence of morphometric vertebral deformities in patients with inflammatory bowel disease.
Heijckmann, Anna Caroline; Huijberts, Maya S P; Schoon, Erik J; Geusens, Piet; de Vries, Jolanda; Menheere, Paul P C A; van der Veer, Eveline; Wolffenbuttel, Bruce H R; Stockbrugger, Reinhold W; Dumitrescu, Bianca; Nieuwenhuijzen Kruseman, Arie C
2008-08-01
Earlier studies have documented that the prevalence of decreased bone mineral density (BMD) is elevated in patients with inflammatory bowel disease. The objective of this study was to investigate the prevalence of vertebral deformities in inflammatory bowel disease patients and their relation with BMD and bone turnover. One hundred and nine patients with Crohn's disease (CD) and 72 with ulcerative colitis (UC) (age 44.5+/-14.2 years) were studied. BMD of the hip (by dual X-ray absorptiometry) was measured and a lateral single energy densitometry of the spine for assessment of vertebral deformities was performed. Serum markers of bone resorption (carboxy-terminal cross-linked telopeptide of type I collagen) and formation (procollagen type I amino-terminal propeptide) were measured, and determinants of prevalent vertebral deformities were assessed using logistic regression analysis. Vertebral deformities were found in 25% of both CD and UC patients. Comparing patients with and without vertebral deformities, no significant difference was found between Z-scores and T-scores of BMD, or levels of serum carboxy-terminal cross-linked telopeptide of type I collagen and serum procollagen type I amino-terminal propeptide. Using logistic regression analysis the only determinant of any morphometric vertebral deformity was sex. The presence of multiple vertebral deformities was associated with older age and glucocorticoid use. The prevalence of morphometric vertebral deformities is high in CD and UC. Male sex, but neither disease activity, bone turnover markers, clinical risk factors, nor BMD predicted their presence. The determinants for having more than one vertebral deformity were age and glucocorticoid use. This implies that in addition to screening for low BMD, morphometric assessment of vertebral deformities is warranted in CD and UC.
Risk factors for stress fracture among young female cross-country runners.
Kelsey, Jennifer L; Bachrach, Laura K; Procter-Gray, Elizabeth; Nieves, Jeri; Greendale, Gail A; Sowers, Maryfran; Brown, Byron W; Matheson, Kim A; Crawford, Sybil L; Cobb, Kristin L
2007-09-01
To identify risk factors for stress fracture among young female distance runners. Participants were 127 competitive female distance runners, aged 18-26, who provided at least some follow-up data in a randomized trial among 150 runners of the effects of oral contraceptives on bone health. After completing a baseline questionnaire and undergoing bone densitometry, they were followed an average of 1.85 yr. Eighteen participants had at least one stress fracture during follow-up. Baseline characteristics associated (P<0.10) in multivariate analysis with stress fracture occurrence were one or more previous stress fractures (rate ratio [RR] [95% confidence interval]=6.42 (1.80-22.87), lower whole-body bone mineral content (RR=2.70 [1.26-5.88] per 1-SD [293.2 g] decrease), younger chronologic age (RR=1.42 [1.05-1.92] per 1-yr decrease), lower dietary calcium intake (RR=1.11 [0.98-1.25] per 100-mg decrease), and younger age at menarche (RR=1.92 [1.15-3.23] per 1-yr decrease). Although not statistically significant, a history of irregular menstrual periods was also associated with increased risk (RR=3.41 [0.69-16.91]). Training-related factors did not affect risk. The results of this and other studies indicate that risk factors for stress fracture among young female runners include previous stress fractures, lower bone mass, and, although not statistically significant in this study, menstrual irregularity. More study is needed of the associations between stress fracture and age, calcium intake, and age at menarche. Given the importance of stress fractures to runners, identifying preventive measures is of high priority.
Bone health status of postmenopausal Chinese women.
Lo, Sue S T
2015-12-01
To evaluate the prevalence of osteoporosis in treatment-naïve postmenopausal women, their treatment adherence, and the risk factors for osteoporosis. Cross-sectional study of bone density reports, a self-administered health checklist, and computerised consultation records. Primary care sexual and reproductive health service in Hong Kong. Postmenopausal Chinese women who had never received osteoporosis treatment or hormone replacement therapy. Each woman completed a checklist of risk factors for osteoporosis, menopause age, history of hormone replacement therapy, and osteoporosis treatment prior to undergoing bone mineral density measurement at the postero-anterior lumbar spine and left femur. The consultation records of those with osteoporosis were reviewed to determine their treatment adherence. T-score at the spine and hip, presence or absence of risk factors for osteoporosis, and treatment adherence. Between January 2008 and December 2011, 1507 densitometries were performed for eligible women; 51.6% of whom were diagnosed with osteopenia and 25.7% with osteoporosis. The mean age of women with normal bone mineral density, osteopenia, and osteoporosis was 57.0, 58.0, and 59.7 years, respectively. Approximately half of them had an inadequate dietary calcium intake, performed insufficient weight-bearing exercise, or had too little sun exposure. Logistic regression analysis revealed that age, body mass index of <18.5 kg/m(2), parental history of osteoporosis or hip fracture, and duration of menopause were significant risk factors for osteoporosis. Among those with osteoporosis, 42.9% refused treatment, 30.7% complied with treatment, and 26.3% discontinued treatment or defaulted from follow-up. Those who refused treatment were significantly older. Osteoporosis is prevalent in postmenopausal women. Only 50% adopted primary prevention strategies. Almost 70% refused treatment or stopped prematurely.
Augoulea, A; Tsakonas, E; Triantafyllopoulos, I; Rizos, D; Armeni, E; Tsoltos, N; Tournis, S; Deligeoroglou, E; Antoniou, A; Lambrinoudaki, I
2017-03-01
To clarify potential differences between denosumab (DNS) and bisphosphonates (BIS) in terms of bone density and bone metabolism, in a sample of postmenopausal women. A total of 113 postmenopausal women aged 53-66 years were treated with either DNS or BIS for 12 months. Bone densitometry and laboratory tests were compared between baseline and follow-up. Femoral neck BMD increased in both treatment-arms (FN-BMD, DNS: 0.69±0.07 g/cm 2 to 0.75±0.09 g/cm 2 ; BIS: 0.69±0.06 g/cm 2 to 0.71±0.07 g/cm 2 ; p≤0.001 in both cases). Lumbar spine BMD (LS-BMD) increased significantly only in the DNS-group (0.83±0.14 g/cm 2 to 0.89±0.14 g/cm 2 , p=0.0001). Only women under treatment with DNS had a significant increase in serum parathyroid hormone (PTH: 44.87±17.54 pg/mL to 53.27±15.77 pg/mL, p=0.04), independently of baseline vitamin D levels. DNS-administration resulted in higher increase from baseline in FN-BMD compared to BIS (DNS vs BIS: 8.7%±8.5 vs 3.8%±7.3, p=0.004). Finally, baseline 25OH vitamin D levels did not determine the extent of PTH-increase following administration of DNS- or BIS-treatment. Both treatments increased BMD, however, the effect of DNS on FN-BMD was superior compared to that of BIS. DNS-treatment increased serum PTH. Baseline 25OH vitamin D levels did not predict the extent of PTH increase at follow-up.
Measurement of Body Composition: is there a Gold Standard?
Branski, Ludwik K; Norbury, William B; Herndon, David N; Chinkes, David L; Cochran, Amalia; Suman, Oscar; Benjamin, Deb; Jeschke, Marc G
2015-01-01
Background Maintaining lean body mass (LBM) after a severe burn is an essential goal of modern burn treatment. An accurate determination of LBM is necessary for short- and longterm therapeutic decisions. The aim of this study was to compare 2 measurement methods for body composition, wholebody potassium counting (K count) and dual x-ray absorptiometry (DEXA), in a large prospective clinical trial in severely burned pediatric patients. Methods Two-hundred seventy-nine patients admitted with burns covering 40% of total body surface area (TBSA) were enrolled in the study. Patients enrolled were controls or received long-term treatment with recombinant human growth hormone (rhGH). Near-simultaneous measurements of LBM with DEXA and fat-free mass (FFM) with K count were performed at hospital discharge and at 6, 9, 12, 18, and 24 months post injury. Results were correlated using Pearson’s regression analysis. Agreement between the 2 methods was analyzed with the Bland-Altman method. Results Age, gender distribution, weight, burn size, and admission time from injury were not significantly different between control and treatment groups. rhGH and control patients at all time points postburn showed a good correlation between LBM and FFM measurements (R2 between 0.9 and 0.95). Bland-Altman revealed that the mean bias and 95% limits of agreement depended only on patient weight and not on treatment or time postburn. The 95% limits ranged from 0.1 ± 2.9 kg for LBM or FFM in 7- to 18-kg patients to 16.3 ± 17.8 kg for LBM or FFM in patients >60 kg. Conclusions DEXA can provide a sufficiently accurate determination of LBM and changes in body composition, but a correction factor must be included for older children and adolescents with more LBM. DEXA scans are easier, cheaper, and less stressful for the patient, and this method should be used rather than the K count. PMID:19884353
Otsuka, Makoto; Oshinbe, Ayako; Legeros, Racquel Z; Tokudome, Yoshihiro; Ito, Atsuo; Otsuka, Kuniko; Higuchi, William I
2008-01-01
The purpose of this study was to evaluate the therapeutic efficacy of a new calcium phosphate (CaP)-based formulation in improving the bone mineral deficiency in ovariectomized (OVX) rats. The ions release experiments for CaP preparations (G2: 0.46% Mg, 5.78% Zn, and 2.5% F; G3:3.1% Mg, 0.03% Zn, and 3.01% F; G4: 1.25% Mg, 1.77% Zn, 1.35% F) and of a Zn-TCP (G1: 6.17% Zn) powders, the initial Mg and Zn ion release rates of MZF-CaPs were performed in acetate buffer at pH 4.5 (37 degrees C). Wistar rats were divided into six groups including a normal (not OVX) group (GN) and a control, OVX group (GC). Rats in groups GC, G1, G2, G3, G4 were OVX. Suspensions consisting of CaP preparations (G2, G3, G4) and of a Zn-TCP (G1) powders were injected in the right thighs of OVX rats in all groups except for GN and GC, once a week for 4 weeks. GN and GC rats were injected with saline solutions. Plasma was analyzed for Zn land alkaline phosphatase levels. The bone mineral density (BMD) was measured using DEXA and the bone (femur) strength determined using three-point-bending analysis. G1 and G2 groups showed high plasma Zn levels. The area under the curve of plasma Zn was significantly greater in the G1, G2, and GN groups than in the G3, G4, and GC groups (p < 0.05). The BMD and bone mechanical strength of the right femur were significantly higher in the G1, G2, G3, and G4 groups than GC group on day 28. The right femur had significantly greater BMD and bone mechanical strength than the left femur in G1, G2, G3, and G4 groups. However, there was no significant difference in the BMD of the right femur between the G1, G2, G3, and G4 groups. Results indicate that the new injectable CaP formulations are effective in improving bone properties of OVX rats and may be useful in osteoporosis therapy. (c) 2007 Wiley-Liss, Inc.
Barger-Lux, M Janet; Davies, K Michael; Heaney, Robert P
2005-10-01
In earlier observational work, the dietary calcium:protein ratio was directly related to bone accrual in healthy postadolescent women. In this study, we sought to test the hypothesis that augmented calcium intake would increase postadolescent skeletal consolidation, using a double-blind, randomized, placebo-controlled design. We recruited 152 healthy young women (age 23.1 +/- 2.7 y, BMI 22.5 +/- 3.0 kg/m2); their usual diets, as assessed by 7-d food diaries, were low in calcium (605 +/- 181 mg/d; 15.1 +/- 4.5 mmol/d) and in the calcium:protein ratio (10.1 +/- 2.0 mg/g). The subjects were randomly assigned to supplemental calcium [500 mg calcium (12.5 mmol) as the carbonate, 3 times/d, with meals] or placebo capsules identical in appearance; all participants also took a daily multivitamin, and they were followed for up to 36 mo with bone densitometry (dual energy X-ray absorptiometry; DXA) at 6-mo intervals. A total of 121 subjects remained in the study for at least 12 mo (median time in the study, 35 mo), with a mean compliance level (observed/expected tablet consumption) of 87.7%. DXA data for these 121 subjects indicated modest but significant mean rates of increase (i.e., 0.24 to 1.10%/y) in bone mineral content (BMC; total body, total hip, and lumbar spine) and in lumbar spine bone mineral density (BMD) but no change in total hip BMD. None of these rates of change differed by group, i.e., calcium supplementation did not have any measurable effect on bone mass accrual. By midstudy, the calcium content of the subjects' usual diets for both groups had risen by approximately 15%. The combined effect of improved intakes of dietary calcium and the small amount of calcium added by the multivitamin tablets resulted in a mean calcium intake for the control group > 800 mg (20 mmol)/d, possibly at or near the threshold beyond which additional calcium has no further effect on bone accrual.
Krueger, Diane; Libber, Jessie; Sanfilippo, Jennifer; Yu, Hui Jing; Horvath, Blaine; Miller, Colin G; Binkley, Neil
2016-01-01
New densitometer installation requires cross-calibration for accurate longitudinal assessment. When replacing a unit with the same model, the International Society for Clinical Densitometry recommends cross-calibrating by scanning phantoms 10 times on each instrument and states that spine bone mineral density (BMD) should be within 1%, whereas total body lean, fat, and %fat mass should be within 2% of the prior instrument. However, there is limited validation that these recommendations provide adequate total body cross-calibration. Here, we report a total body cross-calibration experience with phantoms and humans. Cross-calibration between an existing and new Lunar iDXA was performed using 3 encapsulated spine phantoms (GE [GE Lunar, Madison, WI], BioClinica [BioClinica Inc, Princeton, NJ], and Hologic [Hologic Inc, Bedford, MA]), 1 total body composition phantom (BioClinica), and 30 human volunteers. Thirty scans of each phantom and a total body scan of human volunteers were obtained on each instrument. All spine phantom BMD means were similar (within 1%; <-0.010 g/cm2 bias) between the existing and new dual-energy X-ray absorptiometry unit. The BioClinica body composition phantom (BBCP) BMD and bone mineral content (BMC) values were within 2% with biases of 0.005 g/cm2 and -3.4 g. However, lean and fat mass and %fat differed by 4.6%-7.7% with biases of +463 g, -496 g, and -2.8%, respectively. In vivo comparison supported BBCP data; BMD and BMC were within ∼2%, but lean and fat mass and %fat differed from 1.6% to 4.9% with biases of +833 g, -860 g, and -1.1%. As all body composition comparisons exceeded the recommended 2%, the new densitometer was recalibrated. After recalibration, in vivo bias was lower (<0.05%) for lean and fat; -23 and -5 g, respectively. Similarly, BBCP lean and fat agreement improved. In conclusion, the BBCP behaves similarly, but not identical, to human in vivo measurements for densitometer cross-calibration. Spine phantoms, despite good BMD and BMC agreement, did not detect substantial lean and fat differences observed using BBCP and in vivo assessments. Consequently, spine phantoms are inadequate for dual-energy X-ray absorptiometry whole body composition cross-calibration. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Relation of parity and homocysteine to bone mineral density of postmenopausal women.
Yilmaz, Necat; Kepkep, Necip; Ciçek, Hülya Kanbur; Celik, Ahmet; Meram, Iclal
2006-01-01
Osteoporosis is a major problem in contemporary society. However, there is not enough data on multiparity and osteoporosis from developing and/or undeveloped countries on a large scale. Selection of participants in this study was aimed at the detection of bone status in healthy (normal bone mineral density) postmenopausal (n = 46, 55.3 +/- 6.7 years) and osteoporotic postmenopausal women (n: 33) of similar age. Bone mineral density (BMD) was evaluated using dual energy X-ray absorptiometry. At the DEXA evaluation, 33 women had osteoporotic (T score below -2.5) and 46 had normal BMD values. The number of pregnancies was found to range from 3 to 12 (with an overall mean of 6.7 +/- 2.5), while 2.6 +/- 1.9 (range, 1-7) were miscarriages in all of the 33 postmenopausal osteoporotic women. Serum homocysteine (t-Hcy) and urinary deoxypyridinoline (DPD) levels were significantly higher in osteoporotic postmenopausal women (11.96 +/- 3.84 micromol/L, 15.4 +/- 7.0 nM/mM cr) than in non-osteoporotic postmenopausal women (10.93 +/- 3.6 micromol/L, 10.6 +/- 9.1 nM/mM cr), p < 0.05, p < 0.01, respectively. Surprisingly, in postmenopausal osteoporotic women the homocysteine (t-Hcy) levels were positively associated with the number of deliveries (multiparity; 6.7 +/- 2.5), and positively associated with the number of curettages (2.6 +/- 1.9), r = 0.401, p < 0.038 and r = 0.520, p < 0.029, respectively. The mechanism linking serum t-Hcy to the number of pregnancies is unclear, and the relationship may only be by chance. In conclusion, the present study firstly suggests that the number of pregnancies has an effect on the t-Hcy levels. In addition, our study indicates that there is a significant negative correlation between the number of pregnancies and the lumbar spine BMD.
Rexhepi, Sylejman; Rexhepi, Mjellma; Sahatçiu-Meka, Vjollca; Mahmutaj, Vigan; Boshnjaku, Shkumbin
2016-04-01
Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by symmetrical polyarthritis and multisystemic involvement. The aim of this study was to assess the impact of low dose of methotrexate on bone mineral density (BMD) in patients with early rheumatoid arthritis (RA). This paper follows a retrospective study, which involves 60 female patients with early onset RA diagnosed according to the American Rheumatism Association Criteria (ACR/EULAR 2010). The patients were divided into two groups group I was composed of thirty patients treated with dose of 7.5 mg/weekly methotrexate (MTX), while group II included thirty patients treated with dose of 2 g/daily sulfasalazine (SSZ). The Disease Activity was measured by a combination of Erythrocyte Sedimentation Rate (ESR) and Disease Activity Score (DAS-28). Bone mineral density of the lumbar spine (L2-4), and femoral neck, was measured by dual energy X-ray absorptiometry (DEXA) (Stratos 800). Laboratory findings included: In this study, we found no negative effect on BMD in RA patients treated with low dose MTX in comparison to patients treated with SSZ. There was not observed significant difference in BMD of the lumbar spine, femur neck or trochanter, of MTX and SSZ patients in the pretreatment phase, nor after 12 months of treatment. No significant change in the biochemical parameters of the both groups. Based on the results of our study, low dose of methotrexate has no negative effect on BMD in premenopausal RA patients. We believe that these results might provide new insights and that further longitudinal studies with larger groups of premenopausal RA patients are required.
Rexhepi, Sylejman; Rexhepi, Mjellma; Sahatçiu-Meka, Vjollca; Mahmutaj, Vigan; Boshnjaku, Shkumbin
2016-01-01
Introduction: Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by symmetrical polyarthritis and multisystemic involvement. Objective: The aim of this study was to assess the impact of low dose of methotrexate on bone mineral density (BMD) in patients with early rheumatoid arthritis (RA). Materials and methods: This paper follows a retrospective study, which involves 60 female patients with early onset RA diagnosed according to the American Rheumatism Association Criteria (ACR/EULAR 2010). The patients were divided into two groups group I was composed of thirty patients treated with dose of 7.5 mg/weekly methotrexate (MTX), while group II included thirty patients treated with dose of 2 g/daily sulfasalazine (SSZ). The Disease Activity was measured by a combination of Erythrocyte Sedimentation Rate (ESR) and Disease Activity Score (DAS-28). Bone mineral density of the lumbar spine (L2–4), and femoral neck, was measured by dual energy X-ray absorptiometry (DEXA) (Stratos 800). Laboratory findings included: In this study, we found no negative effect on BMD in RA patients treated with low dose MTX in comparison to patients treated with SSZ. There was not observed significant difference in BMD of the lumbar spine, femur neck or trochanter, of MTX and SSZ patients in the pretreatment phase, nor after 12 months of treatment. No significant change in the biochemical parameters of the both groups. Conclusion: Based on the results of our study, low dose of methotrexate has no negative effect on BMD in premenopausal RA patients. We believe that these results might provide new insights and that further longitudinal studies with larger groups of premenopausal RA patients are required. PMID:27147781
Miniature X-Ray Bone Densitometer
NASA Technical Reports Server (NTRS)
Charles, Harry K., Jr.
1999-01-01
The purpose of the Dual Energy X-ray Absorptiometry (DEXA) project is to design, build, and test an advanced X-ray absorptiometry scanner capable of being used to monitor the deleterious effects of weightlessness on the human musculoskeletal system during prolonged spaceflight. The instrument is based on the principles of dual energy x-ray absorptiometry and is designed not only to measure bone, muscle, and fat masses but also to generate structural information about these tissues so that the effects on mechanical integrity may be assessed using biomechanical principles. A skeletal strength assessment could be particularly important for an astronaut embarking on a remote planet where the consequences of a fragility fracture may be catastrophic. The scanner will employ multiple projection images about the long axis of the scanned subject to provide geometric properties in three dimensions, suitable for a three-dimensional structural analysis of the scanned region. The instrument will employ advanced fabrication techniques to minimize volume and mass (100 kg current target with a long-term goal of 60 kg) of the scanner as appropriate for the space environment, while maintaining the required mechanical stability for high precision measurement. The unit will have the precision required to detect changes in bone mass and geometry as small as 1% and changes in muscle mass as small as 5%. As the system evolves, advanced electronic fabrication technologies such as chip-on-board and multichip modules will be combined with commercial (off-the-shelf) parts to produce a reliable, integrated system which not only minimizes size and weight, but, because of its simplicity, is also cost effective to build and maintain. Additionally, the system is being designed to minimize power consumption. Methods of heat dissipation and mechanical stowage (for the unit when not in use) are being optimized for the space environment.
Prevention of nutritional rickets in Nigerian children with dietary calcium supplementation.
Thacher, Tom D; Fischer, Philip R; Isichei, Christian O; Zoakah, Ayuba I; Pettifor, John M
2012-05-01
Nutritional rickets in Nigerian children usually results from dietary calcium insufficiency. Typical dietary calcium intakes in African children are about 200mg daily (approximately 20-28% of US RDAs for age). We sought to determine if rickets could be prevented with supplemental calcium or with an indigenous food rich in calcium. We enrolled Nigerian children aged 12 to 18months from three urban communities. Two communities were assigned calcium, either as calcium carbonate (400mg) or ground fish (529±109mg) daily, while children in all three communities received vitamin A (2500IU) daily as placebo. Serum markers of mineral homeostasis and forearm bone density (pDEXA) were measured and radiographs were obtained at enrollment and after 18months of supplementation. The overall prevalence of radiographic rickets at baseline was 1.2% and of vitamin D deficiency [serum 25(OH)D<12ng/ml] 5.4%. Of 647 children enrolled, 390 completed the 18-month follow-up. Rickets developed in 1, 1, and 2 children assigned to the calcium tablet, ground fish, and control groups, respectively (approximate incidence 6.4/1000 children/year between 1 and 3years of age). Children who developed rickets in the calcium-supplemented groups had less than 50% adherence. Compared with the group that received no calcium supplementation, the groups that received calcium had a greater increase in areal bone density of the distal and proximal 1/3 radius and ulna over time (P<0.04). We conclude that calcium supplementation increased areal bone density at the radius and ulna, but a larger sample size would be required to determine its effect on the incidence of rickets. Copyright © 2012 Elsevier Inc. All rights reserved.
Bisphosphonates for prevention of postmenopausal osteoporosis.
Ravn, Pernille
2002-02-01
Our studies showed that 5 mg alendronate per day was the lowest, most effective dose that persistently prevented bone loss in recently postmenopausal women with normal bone mass. The effect on bone mass and biochemical markers was found comparable to that of commonly recommended regimens of postmenopausal HRT, and 5 mg alendronate per day is suggested as a new option for prevention of postmenopausal osteoporosis. HRT must, however, still be considered the first choice for this indication because of additional beneficial effects on other organ systems. The effect of alendronate was unaffected by bone or fat mass status, but increased with increasing postmenopausal age. The implications were that alendronate stabilized bone mass to a comparable extent in women at particular risk of osteoporosis because of thin body habitus or low bone mass and in healthy postmenopausal women with normal bone mass. Calcium supplementation was insufficient to prevent bone loss and did not add an effect on bone metabolism when combined with alendronate treatment in recently postmenopausal women. The gastrointestinal risk and adverse event profile of 5 mg alendronate per day was comparable to that of placebo, and this dose of alendronate appeared safe for long-term use. Bone loss resumed at a normal postmenopausal rate promptly after withdrawal of alendronate in early postmenopausal women consistent with a substantial underlying natural bone loss during early menopause. Oral ibandronate increased bone mass at all skeletal regions in elderly postmenopausal women with low bone mass, and 2.5 mg ibandronate per day was the lowest dose with this effect. The results are indicative of ibandronate as an option for secondary prevention of postmenopausal osteoporosis, but longer-term phase III trials should be performed before ibandronate can be recommended for this indication. The study showed that 2.5 mg ibandronate per day was efficient for prevention of bone loss and increment in bone mass in a population of women at particular risk of osteoporosis because of low bone mass. There were no differences between 2.5 mg ibandronate per day and placebo in terms of side effects, including complaints from the gastrointestinal tract, and ibandronate appeared safe for longer-term use in this dosing. Bone loss resumed at a normal postmenopausal rate when treatment was withdrawn. The response in bone mass and biochemical markers indicated that 2.5 mg ibandronate per day is equivalent to 10 mg alendronate per day in postmenopausal women. Our studies of two recently developed biochemical markers, urine CTX and serum total OC, showed that bone turnover was lowest in the premenopausal period, where these biochemical markers furthermore revealed a negative association with bone mass. It indicated that increased bone turnover contributes to a small premenopausal bone loss and resulting lowered bone mass. In consistence, a small premenopausal bone loss was observed in some regions of the hip. The biochemical markers increased at the time of menopause, consistent with initiation of the postmenopausal bone loss, and became gradually more negatively associated with bone mass as time past the menopause increased. The biochemical markers were furthermore higher in postmenopausal women with low bone mass, consistent with the characterization of postmenopausal osteoporosis as a condition with increased bone turnover. Our results consistently indicated a central role of increased bone turnover for development of low bone mass and osteoporosis. It is, however, also important to stress that the associations between biochemical markers and bone mass were too weak to allow for a valid individual estimation of bone mass based on biochemical markers. In contrast, the biochemical markers were shown as valid tools for monitoring and prediction of treatment effect of bisphosphonates. CTX, NTX, and total OC revealed the best performance characteristics in this respect. Six months after start of treatment, the level of suppression of these biochemical markers of bone resorption and formation accurately reflected the size of the 1-2 year response in bone mass in groups of women treated with bisphosphonate. This was a clear advance over bone densitometry, which has a precision error in the area of the anticipated yearly bone mass response during bisphosphonate therapy. The relationship was consistent during treatment with alendronate or ibandronate and in younger or elderly postmenopausal women. In individual patients, cut-off values of an about 40% decrease in urine CTX or NTX and an about 20% decrease in total OC validly predicted long-term prevention of bone loss. The sensitivity of prediction was high, but the specificity low. This implicated that the biochemical markers could be used as an exact method to detect "responders" to therapy, whereas "non-responders" to bisphosphonate treatment should be detected with bone densitometry in patients who do not reveal a decrease below the cut-off value in the biochemical marker during treatment. However, before such approach can be generally recommended the cut-off values of the biochemical markers should be validated in future clinical trials of bisphosphonate. Postmenopausal osteoporosis develops slowly over many years and mainly becomes a significant individual and socio-economic health problem 1-3 decades after the menopause. Prevention of postmenopausal osteoporosis by bisphosphonates is therefore likely to imply a treatment regimen of at least a decade, as presently recommended for HRT (Consensus Development Statement 1997). However, future cost-effectiveness studies should reveal when bisphosphonate treatment should ideally be initiated. Our studies showed that the bisphosphonates were effective over the range from general recommendation (recently postmenopausal women with normal bone mass) to a reservation for women at particular risk of osteoporosis (elderly women, thin women, or women with osteopenia). Presently available biochemical markers could be used for groupwise and individual monitoring and prediction of treatment response. Most presently available biochemical markers, however, have the drawback of a low specificity. Recent studies of CTX measured in serum are promising, and indicate that this new biochemical marker might have overcome these drawbacks due to a pronounced response to treatment and a low long-term biological variation (Christgau et al. 1998b, Rosen et al. 1998, and 2000).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peña, Jaime A.; Damm, Timo; Bastgen, Jan
Purpose: Accurate noninvasive assessment of vertebral bone marrow fat fraction is important for diagnostic assessment of a variety of disorders and therapies known to affect marrow composition. Moreover, it provides a means to correct fat-induced bias of single energy quantitative computed tomography (QCT) based bone mineral density (BMD) measurements. The authors developed new segmentation and calibration methods to obtain quantitative surrogate measures of marrow-fat density in the axial skeleton. Methods: The authors developed and tested two high resolution-QCT (HR-QCT) based methods which permit segmentation of bone voids in between trabeculae hypothesizing that they are representative of bone marrow space. Themore » methods permit calculation of marrow content in units of mineral equivalent marrow density (MeMD). The first method is based on global thresholding and peeling (GTP) to define a volume of interest away from the transition between trabecular bone and marrow. The second method, morphological filtering (MF), uses spherical elements of different radii (0.1–1.2 mm) and automatically places them in between trabeculae to identify regions with large trabecular interspace, the bone-void space. To determine their performance, data were compared ex vivo to high-resolution peripheral CT (HR-pQCT) images as the gold-standard. The performance of the methods was tested on a set of excised human vertebrae with intact bone marrow tissue representative of an elderly population with low BMD. Results: 86% (GTP) and 87% (MF) of the voxels identified as true marrow space on HR-pQCT images were correctly identified on HR-QCT images and thus these volumes of interest can be considered to be representative of true marrow space. Within this volume, MeMD was estimated with residual errors of 4.8 mg/cm{sup 3} corresponding to accuracy errors in fat fraction on the order of 5% both for GTP and MF methods. Conclusions: The GTP and MF methods on HR-QCT images permit noninvasive localization and densitometric assessment of marrow fat with residual accuracy errors sufficient to study disorders and therapies known to affect bone marrow composition. Additionally, the methods can be used to correct BMD for fat induced bias. Application and testing in vivo and in longitudinal studies are warranted to determine the clinical performance and value of these methods.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuester, W.; Seidl, G.; Linkesch, W.
1981-10-01
For the diagnosis of primary osteoporosis, various semiquantitative radiologic methods were compared in 149 unselected patients, aged over 50 years. Crush fracture syndrome (CFS), lumbar spine index (LSI), and Singh Index (SI) were assessed by three radiologists and after reevaluation, the intra- and interobserver errors were calculated. The reliability of the subjective grading was improved by joint and repeated reading of the radiographs. Additionally, the peripheral trabecular bone content was measured by photon absorption densitometry (PAD). To test the value of the various semiquantitative methods. LSI, Si, and PAD have been compared with sex-matching before and after separation into agemore » in decades in CFS-positive and CFS-negative patients. In an attempt to differentiate osteoporotics and non-osteoporotics by CFS, our results indicate that CFS-positive and CFS-negative males cannot be separated by LSI, Si, and PAD, whereas in females these methods can discriminate irrespective of the age in decades. However, in age related groups, only SI can discriminate significantly between CFS-positive and CFS-negative females. Correlation of the semiquantitative methods, regardless of the diagnosis of a CFS, revealed a significant correlation-between SI and PAD, but no correlation between LSI and SI, and LSI and PAD, respectively.« less
Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol
2011-01-01
To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.
Effect of Clothing on Measurement of Bone Mineral Density.
McNamara, Elizabeth A; Feldman, Anna Z; Malabanan, Alan O; Abate, Ejigayehu G; Whittaker, LaTarsha G; Yano-Litwin, Amanda; Dorazio, Jolene; Rosen, Harold N
2016-01-01
It is unknown whether allowing patients to have BMD (bone mineral density) studies acquired while wearing radiolucent clothing adlib contributes appreciably to the measurement error seen. To examine this question, a spine phantom was scanned 30 times without any clothing, while draped with a gown, and while draped with heavy winter clothing. The effect on mean BMD and on SD (standard deviation) was assessed. The effect of clothing on mean or SD of the area was not significant. The effect of clothing on mean and SD for BMD was small but significant and was around 1.6% for the mean. However, the effect on BMD precision was much more clinically important. Without clothing the spine phantom had an least significant change of 0.0077 gm/cm(2), while when introducing variability of clothing the least significant change rose as high as 0.0305 gm/cm(2). We conclude that, adding clothing to the spine phantom had a small but statistically significant effect on the mean BMD and on variance of the measurement. It is unlikely that the effect on mean BMD has any clinical significance, but the effect on the reproducibility (precision) of the result is likely clinically significant. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Sun, Yubo; Scannell, Brian P; Honeycutt, Patrick R; Mauerhan, David R; H, James Norton; Hanley Jr, Edward N
2015-01-01
Osteoarthritis is a joint disease involved in articular cartilage, subchondral bone, meniscus and synovial membrane. This study sought to examine cartilage degeneration, subchondral bone mineral density (BMD) and meniscal mineral density (MD) in male Hartley, female Hartley and female strain 13 guinea pigs to determine the association of cartilage degeneration with subchondral BMD and meniscal MD. Cartilage degeneration, subchondral BMD and meniscal MD in 12 months old guinea pigs were examined with histochemistry, X-ray densitometry and calcium analysis. We found that male Hartley guinea pigs had more severe cartilage degeneration, subchondral BMD and meniscal MD than female Hartley guinea pigs, but not female strain 13 guinea pigs. Female strain 13 guinea pigs had more severe cartilage degeneration and higher subchondral BMD, but not meniscal MD, than female Hartley guinea pigs. These findings indicate that higher subchondral BMD, not meniscal MD, is associated with more severe cartilage degeneration in the guinea pigs and suggest that abnormal subchondral BMD may be a therapeutic target for OA treatment. These findings also indicate that the pathogenesis of OA in the male guinea pigs and female guinea pigs are different. Female strain 13 guinea pig may be used to study female gender-specific pathogenesis of OA. PMID:26401159
Agostinete, Ricardo R; Lynch, Kyle R; Gobbo, Luís A; Lima, Manoel Carlos Spiguel; Ito, Igor H; Luiz-de-Marco, Rafael; Rodrigues-Junior, Mario A; Fernandes, Romulo A
2016-01-01
The objective of this study was to analyze the effect of different sports on bone mineral density (BMD) accrual among male adolescents during a 9-mo follow-up. The sample was composed of 82 boys (control [n = 13], basketball [n = 14], karate [n = 9], soccer [n = 18], judo [n = 12], and swimming [n = 16]) who were followed up for 9 mo (from October 2013 to August 2014). BMD (gram per square centimeter) was assessed at baseline and follow-up using a dual-energy X-ray absorptiometry scanner, whereas somatic maturation was estimated through the use of the peak height velocity. Vitamin D consumption was assessed by questionnaire. After 9 mo of follow-up, all groups (including the control group) presented significant BMD accrual (overall sample: 4.5% in the whole body). On the other hand, the basketball group presented higher BMD accrual in the upper limbs (17.6%) than the control group (7.2%). A similar difference was observed in whole-body BMD (control group: 4.1% vs basketball group: 7.1%). The basketball group had significantly higher BMD gains than the control group and other sports groups. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Unilateral vs bilateral hip bone mineral density measurement for the diagnosis of osteoporosis.
Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Mukaiyama, Keijiro; Kato, Hiroyuki
2014-01-01
It has not been established whether unilateral or bilateral hip dual-energy X-ray absorptiometry (DXA) is preferable for the diagnosis of osteoporosis. We investigated the discordance in DXA measurements in bilateral hips to determine whether unilateral DXA is valid for osteoporosis diagnosis. The subjects were 2964 Japanese patients without a previous diagnosis of primary osteoporosis. We measured bilateral femoral bone mineral density (BMD) and calculated indices, related to the unilateral results, for predicting contralateral hip osteoporosis. A likelihood ratio (LR) of a negative test (LR [-]) of less than 0.2 was considered to exclude the diagnosis. In the normal spinal BMD group, the sensitivity of unilateral DXA for women was 27-73% and LR (-) was 0.28-0.73; the sensitivity for men was 0-50% and LR (-) was 0.51-1.00; the diagnosis of contralateral osteoporosis was not excluded. Sensitivity increased and LR (-) increased with worsening spinal BMD status; however, LR (-) did not meet the cutoff for exclusion. We could exclude unilateral hip osteoporosis, in women only, by performing contralateral femoral DXA; this necessitated lowering the T-score cutoff from -2.5 to -2.0. Unilateral femoral DXA is not useful for excluding the diagnosis of contralateral hip osteoporosis. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Tornow, R P; Stilling, R; Zrenner, E
1999-10-01
To test the feasibility of scanning laser densitometry with a modified Rodenstock scanning laser ophthalmoscope (SLO) to measure the rod and cone photopigment distribution in patients with retinal diseases. Scanning laser densitometry was performed using a modified Rodenstock scanning laser ophthalmoscope. The distribution of the photopigments was calculated from dark adapted and bleached images taken with the 514 nm laser of the SLO. This wavelength is absorbed by rod and cone photopigments. Discrimination is possible due to their different spatial distribution. Additionally, to measure retinal sensitivity profiles, dark adapted two color static perimetry with a Tübinger manual perimeter was performed along the horizontal meridian with 1 degree spacing. A patient with retinitis pigmentosa had slightly reduced photopigment density within the central +/- 5 degrees but no detectable photopigment for eccentricities beyond 5 degrees. A patient with cone dystrophy had nearly normal pigment density beyond +/- 5 degrees, but considerably reduced photopigment density within the central +/- 5 degrees. Within the central +/- 5 degrees, the patient with retinitis pigmentosa had normal sensitivity for the red stimulus and reduced sensitivity for the green stimulus. There was no measurable function beyond 7 degrees. The patient with cone dystrophy had normal sensitivity for the green stimulus outside the foveal center and reduced sensitivity for the red stimulus at the foveal center. The results of color perimetry for this patient with a central scotoma were probably influenced by eccentric fixation. Scanning laser densitometry with a modified Rodenstock SLO is a useful method to assess the human photopigment distribution. Densitometry results were confirmed by dark adapted two color static perimetry. Photopigment distribution and retinal sensitivity profiles can be measured with high spatial resolution. This may help to measure exactly the temporal development of retinal diseases and to test the success of different therapeutic treatments. Both methods have limitations at the present state of development. However, some of these limitations can be overcome by further improving the instruments.
Lung densitometry: why, how and when
Camiciottoli, Gianna; Diciotti, Stefano
2017-01-01
Lung densitometry assesses with computed tomography (CT) the X-ray attenuation of the pulmonary tissue which reflects both the degree of inflation and the structural lung abnormalities implying decreased attenuation, as in emphysema and cystic diseases, or increased attenuation, as in fibrosis. Five reasons justify replacement with lung densitometry of semi-quantitative visual scales used to measure extent and severity of diffuse lung diseases: (I) improved reproducibility; (II) complete vs. discrete assessment of the lung tissue; (III) shorter computation times; (IV) better correlation with pathology quantification of pulmonary emphysema; (V) better or equal correlation with pulmonary function tests (PFT). Commercially and open platform software are available for lung densitometry. It requires attention to technical and methodological issues including CT scanner calibration, radiation dose, and selection of thickness and filter to be applied to sections reconstructed from whole-lung CT acquisition. Critical is also the lung volume reached by the subject at scanning that can be measured in post-processing and represent valuable information per se. The measurements of lung density include mean and standard deviation, relative area (RA) at −970, −960 or −950 Hounsfield units (HU) and 1st and 15th percentile for emphysema in inspiratory scans, and RA at −856 HU for air trapping in expiratory scans. Kurtosis and skewness are used for evaluating pulmonary fibrosis in inspiratory scans. The main indication for lung densitometry is assessment of emphysema component in the single patient with chronic obstructive pulmonary diseases (COPD). Additional emerging applications include the evaluation of air trapping in COPD patients and in subjects at risk of emphysema and the staging in patients with lymphangioleiomyomatosis (LAM) and with pulmonary fibrosis. It has also been applied to assess prevalence of smoking-related emphysema and to monitor progression of smoking-related emphysema, alpha1 antitrypsin deficiency emphysema, and pulmonary fibrosis. Finally, it is recommended as end-point in pharmacological trials of emphysema and lung fibrosis. PMID:29221318
Passos, J S; Vianna, M I P; Gomes-Filho, I S; Cruz, S S; Barreto, M L; Adan, L; Rösing, C K; Cerqueira, E M M; Trindade, S C; Coelho, J M F
2013-04-01
This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women. The findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth, showing that osteoporosis/osteopenia has had an influence on the progression of periodontitis. This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women and explored the effects of use of osteoporosis medication and tooth loss on this association. This case-control study involved 521 postmenopausal women, with minimum age of 50 years, in Feira de Santana, Bahia, Brazil. Sociodemographic characteristics, health conditions/medications, and lifestyle habits were recorded. A complete periodontal examination was performed and periodontitis was diagnosed. Bone mineral density was evaluated through lumbar spine and femoral bone densitometry, obtained using dual-energy X-ray absorptiometry. Logistic regression was used to calculate the strength of association between the occurrences of osteoporosis/osteopenia and periodontitis. Women with osteoporosis/osteopenia were twice as likely to present periodontitis, as were those with normal bone mineral density, even after adjusting for smoking, age, family income, and last visit to dentist (odds ratios (OR)adjusted=2.24, 95% CI [1.24-4.06], p=0.008). Among nonusers of osteoporosis medication (ORadjusted=2.51, 95% CI [1.33-4.73], p=0.004) and women with at least 10 remaining teeth (ORadjusted=2.50 95% CI [1.18-5.27], p=0.02), the odds ratio was higher and statistically significant. These findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth.
Edwards, Mark H; Ward, Kate A; Ntani, Georgia; Parsons, Camille; Thompson, Jennifer; Sayer, Avan A; Dennison, Elaine M; Cooper, Cyrus
2015-12-01
Understanding the effects of muscle and fat on bone is increasingly important in the optimisation of bone health. We explored relationships between bone microarchitecture and body composition in older men and women from the Hertfordshire Cohort Study. 175 men and 167 women aged 72-81 years were studied. High resolution peripheral quantitative computed tomography (HRpQCT) images (voxel size 82 μm) were acquired from the non-dominant distal radius and tibia with a Scanco XtremeCT scanner. Standard morphological analysis was performed for assessment of macrostructure, densitometry, cortical porosity and trabecular microarchitecture. Body composition was assessed using dual energy X-ray absorptiometry (DXA) (Lunar Prodigy Advanced). Lean mass index (LMI) was calculated as lean mass divided by height squared and fat mass index (FMI) as fat mass divided by height squared. The mean (standard deviation) age in men and women was 76 (3) years. In univariate analyses, tibial cortical area (p<0.01), cortical thickness (p<0.05) and trabecular number (p<0.01) were positively associated with LMI and FMI in both men and women. After mutual adjustment, relationships between cortical area and thickness were only maintained with LMI [tibial cortical area, β (95% confidence interval (CI)): men 6.99 (3.97,10.01), women 3.59 (1.81,5.38)] whereas trabecular number and density were associated with FMI. Interactions by sex were found, including for the relationships of LMI with cortical area and FMI with trabecular area in both the radius and tibia (p<0.05). In conclusion, LMI and FMI appeared to show independent relationships with bone microarchitecture. Further studies are required to confirm the direction of causality and explore the mechanisms underlying these tissue-specific associations. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Sibonga, J. D.; Spector, E. R.; King, L. J.; Evans, H. J.; Smith, S. A.
2014-01-01
Dual-energy x-ray absorptiometry [DXA] is the widely-applied bone densitometry method used to diagnose osteoporosis in a terrestrial population known to be at risk for age-related bone loss. This medical test, which measures areal bone mineral density [aBMD] of clinically-relevant skeletal sites (e.g., hip and spine), helps the clinician to identify which persons, among postmenopausal women and men older than 50 years, are at high risk for low trauma or fragility fractures and might require an intervention. The most recognized osteoporotic fragility fracture is the vertebral compression fracture which can lead to kyphosis or hunched backs typically seen in the elderly. DXA measurement of BMD however is recognized to be insufficient as a sole index for assessing fracture risk. DXA's limitation may be related to its inability to monitor changes in structural parameters, such as trabecular vs. cortical bone volumes, bone geometry or trabecular microarchitecture. Hence, in order to understand risks to human health and performance due to space exposure, NASA needs to expand its measurements of bone to include other contributors to skeletal integrity. To this aim, the Bone and Mineral Lab conducted a pilot study for a novel measurement of bone microarchitecture that can be obtained by retrospective analysis of DXA scans. Trabecular Bone Score (TBS) assesses changes to trabecular microarchitecture by measuring the grey color "texture" information extracted from DXA images of the lumbar spine. An analysis of TBS in 51 ISS astronauts was conducted to assess if TBS could detect 1) an effect of spaceflight and 2) a response to countermeasures independent of DXA BMD. In addition, changes in trunk body lean tissue mass and in trunk body fat tissue mass were also evaluated to explore an association between body composition, as impacted by ARED exercise, and bone microarchitecture. The pilot analysis of 51 astronaut scans of the lumbar spine suggests that, following an ISS mission, DXA BMD and TBS are detecting different effects of ARED exercise and of ARED + Bisphosphonate on the lumbar spine of astronauts. There is emerging evidence associating reduced TBS with terrestrial metabolic bone disorders where a TBS <1.200 is associated with "degraded" while > 1.350 is associated with "normal." However, it is not possible to conclude how the spaceflight-induced changes in TBS increase risk for vertebral fractures in the astronaut or if changes in body composition of the trunk region could be an indirect method of assessing exercise effect on bone microarchitecture. More importantly, this pilot analysis demonstrates a new, minimal risk approach for monitoring changes to vertebral bone microarchitecture. This method could help assess the combined skeletal effects of spaceflight with the effects of aging in the astronaut after return to Earth.
Role of Growth Hormone, Exercise and Serum Phosphorus in Unloaded Bone of Young Rats
NASA Technical Reports Server (NTRS)
Arnnaud, Sara B.; Harper, J. S.; Gosselink, K. L.; Navidi, M.; Fung, P.; Grindeland, R. E.; Wade, Charles E. (Technical Monitor)
1994-01-01
Growth hormone, known to be stimulated by exercise, is suppressed in rats after space flight and in a ground-based model in which the hind-limbs are unloaded (S). To determine the role of GH in the osteopenia of unloaded bones of S rats, young males were treated with GH combined with insulin-like growth factor-1 (IGF-1), a peptide that mediates the local actions of the hormone. 200 g rats, hypophysectomized (hypox) 17 d earlier, were treated with 1 mg/kg/d GH/IGF-1 (H) or saline (C) in 3 divided daily doses x10 d. Hind-limb bones were unloaded (S), ambulated (A) or exercised (X) by climbing a ladder while carrying a weight. Growth was monitored daily. Tibial growth plate (Tepi) was measured with a micrometer, and femoral (F) area, length, and mineral content (BMC) by DEXA. Parameters of calcium metabolism were measured by autoanalyzer and calciotropic hormones by radioimmunoassay. F bone density, g/square cm, (BMD) or BW were not affected by S in Hypox. However, FBMD was lower in S+H than A+H (p is less than 0.002) and H stimulated whole body growth in S (5.2 g/d) and SX (5.6 g/d) to a lesser extent than in A (6.6 g/d) (p is less than 0.05). Adjusted for BW, Tepi showed the greatest increase in S+H+X (64%), the next highest increase in S+H (50%) and no change in S+X. F area, length and BMC/100 g BW were lower in all H groups than respective C's. By multiple regression analysis, serum phosphorus (Pi) which correlated with Tepi (r = 0.88, p is less than 0.001) and was inversely related to FBMC (r = -0.68, p is less than 0.001) proved to be the most significant determinant of BMC. This illustrates the dependence of osteopenia in S on GH, the maximizing effect of X for epiphyseal growth and the major role of Pi metabolism on BMC in weight bearing bone during growth.
Effects of Growth Hormone/IGF-I and Exercise on Unloaded Bones
NASA Technical Reports Server (NTRS)
Harper, J. S.; Arnaud, S. B.; Gosselink, K. L.; Grindeland, R. E.
1994-01-01
Growth hormone (GH) and insulin-like growth factor-I (IGF-I) in combination with exercise prevent muscle atrophy induced by unloading in the tail-suspension rat model for space flight (Gosselink et al, FASEB J 1994). This study evaluated the effects of these treatments on bone. Hypophysectomized rats were suspended (S) and treated with 1mg/kg/day CH plus IGF-I (H) or vehicle (Sal) daily by injection and exercised (Ex) by 3 climbs up a 1m ladder carrying a load equal to 30% the initial body weight (BW) 3x/day for 10 days. Tibial epiphysis (Epi) widths were measured by micrometry and femoral Bone Mineral Content (fBMC) in excised femurs by DEXA (Lunar DPX-L). Serum calcium (Ca) and phosphorus (Pi) were measured by COBAS Autoanalyzer (Roche Diag.). Ambulatory (Amb)-H treated rats showed growth rates of 6.6+-0.9 g/day, similar to S-H-Ex and higher than S-H (3.210.6, p less than 0.05) and S-Sal (-0.711.0, p less than 0.05). Epi widths were 10% lower in S-Sal, and S-Sal-Ex, and increased 100% in all H groups. fBMC was less in S than Amb, only when all S groups are compared to both Amb groups (p less than 0.03). H treatment increased fBMC (p less than 0.05) but reduced fBMC/100g BW in all H groups (p less than 0.001). The reduced density of H bone cannot be attributed to low circulating Ca. and Pi since they were higher in H than Sal (p less than 0.001). H treatment for 10 days in doses sufficient to support normal growth in BW failed to produce normal Epi widths or fBMC, even when combined with exercise. The suspension effect observed in Epi widths was not corrected by H or Ex alone, but was improved by H plus a This regimen. although effective in preventing muscle atrophy, failed to return bone measures, Epi widths and fBMC, to normal.
Relationship of Muscle Mass Determined by DEXA with Spirometric Results in Healthy Individuals.
Martín Holguera, Rafael; Turrión Nieves, Ana Isabel; Rodríguez Torres, Rosa; Alonso, María Concepción
2017-07-01
Muscle mass maybe a determining factor in the variability of spirometry results in individuals of the same sex and age who have similar anthropometric characteristics. The aim of this study was to determine the association between spirometric results from healthy individuals and their muscle mass assessed by dual energy X-ray absorptiometry (DEXA). A sample of 161 women and 144 men, all healthy non-smokers, was studied. Ages ranged from18 to77years. For each subject, spirometry results and total and regional lean mass values obtained by full body DEXA were recorded. A descriptive analysis of the variables and a regression analysis were performed to study the relationship between spirometric variables and lean body mass, correcting for age and body mass index (BMI). In both sexes all muscle mass variables correlated positively and significantly with spirometric variables, and to a greater extent in men. After partial adjustment of correlations by age and BMI, the factor which best explains the spirometric variables is the total lean body mass in men, and trunk lean body mass in women. In men, muscle mass in the lower extremities is most closely associated with spirometric results. In women, it is the muscle mass of the trunk. In both sexes muscle mass mainly affects FEV 1 . Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Body composition in untreated adult patients with Laron syndrome (primary GH insensitivity).
Laron, Zvi; Ginsberg, Shira; Lilos, Pearl; Arbiv, Mira; Vaisman, Nahum
2006-07-01
To quantify body adiposity and its distribution in untreated adult patients with Laron syndrome (LS; primary GH insensitivity) caused by molecular defects of the GH receptor gene or postreceptor pathways and characterized by dwarfism, obesity, insulin resistance and hyperlipidaemia. Eleven LS patients (seven females and four males) aged 28-53 years were studied. Seven healthy males and six healthy females served as controls. Body composition of the total body trunk, upper and lower extremities was determined using dual-energy X-ray absorptiometry (DEXA). Statistical analysis using an analysis of variance (anova) and Mann-Whitney nonparametric methods was performed separately in males and females. Percentage body fat in the LS patients was much higher (P < 0.01) than that in the control population and the female LS patients were significantly more obese (59% total body fat) than the male patients (39% total body fat) (P < 0.002). It was also evident that in these types of patients with markedly increased body fat and decreased muscle and bone mass, body mass index (BMI) does not accurately reflect the body composition. Lifelong congenital IGF-I deficiency leads to extreme adiposity.
Short, Charlotte-Eve S; Shaw, Simon G; Fisher, Martin J; Walker-Bone, Karen; Gilleece, Yvonne C
2014-02-01
Rates of osteoporosis and fracture may be increased in HIV but there are few UK data. Our aim was to examine the prevalence of and risk factors for osteoporosis and fractures among a homogeneous cohort of well-characterized HIV-infected men. In total, 168 men were recruited, median age 45 years, 37 combination antiretroviral therapy (cART) naïve, 46 with <3 years cART exposure and 85 cART-exposed longer term (median >10 years). All participants provided information on bone health and underwent DEXA scanning. Osteopenia was found in 58% of subjects and osteoporosis in 12%; 14% reported fractures since HIV diagnosis. Number of fractures since HIV diagnosis was significantly increased among those with osteoporosis (OR 3.5, 95% CI 1.2-10.4, p = 0.018). Duration of infection greater than 13 years was significantly associated with osteoporosis. Duration of cART was associated in univariate but not multivariate analyses. Strategies to prevent osteoporosis and fractures in HIV will require attention to viral and lifestyle factors and not just cART.
González-Arellano, J Andrés; Milla-Villeda, Reynaldo H; Hernández-Vera, Gloria E; Cisneros-Pérez, Vicente; Lazalde, Brissia; Reyes, Miguel R
2007-01-01
To estimate the prevalence of osteopenia and osteporosis using distal forearm dual-energy X-ray absorptiometry among a random sample of women of 50 years or older living in the city of Durango, Mexico. 258 women participated in a cross-sectional study fielded at the Osteoporosis Clinic of Durango. Bone mineral density was determined by dual-energy X-ray absorptiometry. Scanning was performed on the distal third of the dominant forearm. Diagnosis of osteopenia and osteoporosis was based on the WHO criteria. Osteoporosis was diagnosed in 13.65% (95%CI: 9.6-18.5) and osteopenia in 30.12% (95% CI: 24.5-36.2) of participants. Mean age, weight, height and body mass index were 65 years, 60.5 kg, 147.8 cm and 28.3 kg/m2 respectively. Osteoporosis and osteopenia were a common diagnosis given the mean age of our sample. These results can be extrapolated to the general population thereby suggesting the need for preventive measures to decrease disease prevalence, especially considering the increase in life expectancy.
Binkley, Neil
2006-08-01
Osteoporosis is defined as "a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue with a consequent increase in bone fragility and susceptibility to fracture". Approximately 40-50% of women sustain osteoporotic fractures in their lifetime; as such, it is appropriate that studies initially focused upon females. Despite an increased recognition of osteoporotic fractures in men, there continues to be neglect of this disease in males. This ongoing neglect is inappropriate as 25-33% of men in some populations will sustain osteoporotic fractures in their lifetime. Testosterone plays an important role in male skeletal health. However, recent data suggest that estrogen may in fact be the dominant hormone regulating skeletal status in both men and women. BMD measurement may be utilized for osteoporosis diagnosis and to assist with fracture risk prediction in men prior to their sustaining a fracture. Recognizing this need, the International Society for Clinical Densitometry (ISCD) recommended and recently reaffirmed use of a BMD T-score of -2.5 or below be utilized to diagnose osteoporosis in men. Androgen therapy of hypogonadal men may be considered with the caveat that data do not exist to document that this treatment reduces fracture risk. At this time, the data is inadequate to support use of androgen treatment in eugonadal men with osteoporosis. Parathyroid hormone treatment does increase BMD; existing studies have not been of adequate size or duration to document fracture reduction efficacy. Bisphosphonate therapy increases BMD, reduces vertebral fracture risk and is considered the standard of care for osteoporotic men at this point in time.
Approach to the Child with Fractures
Boyce, Alison M.
2011-01-01
Evaluation of the child with fractures is challenging, as no clear guidelines exist to distinguish traumatic from pathological fractures. Although most fractures in childhood are benign, recurrent fractures may be associated with a wide variety of primary skeletal diseases as well as secondary causes, necessitating a careful history and physical exam to guide the evaluation. There is no “gold standard” for the evaluation and treatment of children with fractures and low bone mineral density (BMD); therefore, the diagnosis of osteoporosis in a pediatric patient should be made using a combination of clinical and radiographic features. Interpretation of bone densitometry in growing patients presents a unique set of challenges because areal BMD measured by dual-energy x-ray absorptiometry depends on multiple dynamic variables. Interpretation of pediatric dual-energy x-ray absorptiometry should be based on Z-scores (sd scores compared to age, sex, and ethnicity-matched controls), using normative databases specific to the brand of densitometer and the patient population. Given the skeleton's ability to recover from low BMD through modeling and remodeling, optimizing management of underlying conditions leading to bone fragility is the initial step. Conservative measures including calcium and vitamin D supplementation and weight-bearing physical activity are important interventions that should not be overlooked. The use of bisphosphonates in children and adolescents is controversial due to lack of long-term efficacy and safety data and should be limited to clinical trials and compassionate therapy in children with significantly compromised quality of life. Close monitoring is required, and further study is necessary to assess their long-term safety and efficacy in children. PMID:21734001
Osteoporosis: the emperor has no clothes
Järvinen, T L N; Michaëlsson, K; Aspenberg, P; Sievänen, H
2015-01-01
Current prevention strategies for low-trauma fractures amongst older persons depend on the notions that fractures are mainly caused by osteoporosis (pathophysiology), that patients at high risk can be identified (screening) and that the risk is amenable to bone-targeted pharmacotherapy (treatment). However, all these three notions can be disputed. Pathophysiology Most fracture patients have fallen, but actually do not have osteoporosis. A high likelihood of falling, in turn, is attributable to an ageing-related decline in physical functioning and general frailty. Screening Currently available fracture risk prediction strategies including bone densitometry and multifactorial prediction tools are unable to identify a large proportion of patients who will sustain a fracture, whereas many of those with a high fracture risk score will not sustain a fracture. Treatment The evidence for the viability of bone-targeted pharmacotherapy in preventing hip fracture and other clinical fragility fractures is mainly limited to women aged 65–80 years with osteoporosis, whereas the proof of hip fracture-preventing efficacy in women over 80 years of age and in men at all ages is meagre or absent. Further, the antihip fracture efficacy shown in clinical trials is absent in real-life studies. Many drugs for the treatment of osteoporosis have also been associated with increased risks of serious adverse events. There are also considerable uncertainties related to the efficacy of drug therapy in preventing clinical vertebral fractures, whereas the efficacy for preventing other fractures (relative risk reductions of 20–25%) remains moderate, particularly in terms of the low absolute risk reduction in fractures with this treatment. PMID:25809279
Osteoporosis in haemophilia - an underestimated comorbidity?
Wallny, T A; Scholz, D T; Oldenburg, J; Nicolay, C; Ezziddin, S; Pennekamp, P H; Stoffel-Wagner, B; Kraft, C N
2007-01-01
A relationship between haemophilia and osteoporosis has been suggested, leading to the initiative for a larger study assessing this issue. Bone mineral density (BMD) was measured by osteodensitometry using dual energy X-ray absorptiometry (DEXA) in 62 male patients with severe haemophilia A; mean age 41 +/- 13.1 years, mean body mass index (BMI) 23.5 +/- 3.6 kg m(-2). Using the clinical score suggested by the World Federation of Hemophilia, all patients were assessed to determine the severity of their arthropathy. A reduced BMD defined as osteopenia and osteoporosis by World Health Organization criteria was detected in 27/62 (43.5%) and 16/62 (25.8%) patients, respectively. Fifty-five of sixty-two (88.7%) patients suffered from haemophilic arthropathy. An increased number of affected joints and/or an increased severity were associated with lower BMD in the neck of femur. Pronounced muscle atrophy and loss of joint movement were also associated with low BMD. Furthermore, hepatitis C, low BMI and age were found to be additional risk factors for reduced BMD in the haemophiliac. Our data shows that in haemophilic patients osteoporosis represents a frequent concomitant observation. The main cause for reduced bone mass in the haemophiliac is most probably the haemophilic arthropathy being typically associated with chronic pain and loss of joint function subsequently leading to inactivity. Further studies including control groups are necessary to elucidate the impact of comorbidities such as hepatitis C or HIV on the development of osteoporosis in the haemophiliac.
[Prevalence of low bone mineral density in postmenopausal breast cancer survivors].
Poloni, Priscila Ferreira; Omodei, Michelle Sako; Nahas-Neto, Jorge; Uemura, Gilberto; Véspoli, Heloisa De Luca; Nahas, Eliana Aguiar Petri
2015-01-01
To evaluate the prevalence of low bone mineral density (BMD) in postmenopausal breast cancer survivors. In this cross-sectional study, 115 breast cancer survivors, seeking healthcare at a University Hospital in Brazil, were evaluated. Eligibility criteria included women with amenorrhea ≥ 12 months and age ≥ 45 years, treated for breast cancer and metastasis-free for at least five years. BMD was measured by DEXA at the lumbar spine (L1-L4) and femoral neck. Low BMD was considered when total-spine and/or femoral-neck T-score values were <-1.0 Delphi Score (DP) (osteopenia and osteoporosis). The risk factors for low BMD were assessed by interview. Data were analyzed statistically by the χ(2) test and Fisher's exact test. The mean age of breast cancer survivors was 61.6 ± 10.1 years and time since menopause was 14.2 ± 5.6 years, with a mean follow-up of 10.1 ± 3.9 years. Considering spine and femoral neck, 60% of breast cancer survivors had low BMD. By evaluating the risk factors for low BMD, a significant difference was found in the percent distribution for age (higher % of women >50 years with low BMD), personal history of previous fracture (11.6% with low BMD versus 0% with normal BMD) and BMI. A higher frequency of obesity was observed among women with normal BMD (63%) compared to those with low BMD (26.1%) (p<0.05). Postmenopausal breast cancer survivors had a high prevalence of osteopenia and osteoporosis.
Lee, J H; Lee, J-H; Park, J W; Shin, Y H
2012-01-01
In patients with osteoporosis there is always a strong possibility that pedicle screws will loosen. This makes it difficult to select the appropriate osteoporotic patient for a spinal fusion. The purpose of this study was to determine the correlation between bone mineral density (BMD) and the magnitude of torque required to insert a pedicle screw. To accomplish this, 181 patients with degenerative disease of the lumbar spine were studied prospectively. Each underwent dual-energy x-ray absorptiometry (DEXA) and intra-operative measurement of the torque required to insert each pedicle screw. The levels of torque generated in patients with osteoporosis and osteopenia were significantly lower than those achieved in normal patients. Positive correlations were observed between BMD and T-value at the instrumented lumbar vertebrae, mean BMD and mean T-value of the lumbar vertebrae, and mean BMD and mean T-value of the proximal femur. The predictive torque (Nm) generated during pedicle screw insertion was [-0.127 + 1.62 × (BMD at the corresponding lumbar vertebrae)], as measured by linear regression analysis. The positive correlation between BMD and the maximum torque required to insert a pedicle screw suggests that pre-operative assessment of BMD may be useful in determining the ultimate strength of fixation of a device, as well as the number of levels that need to be fixed with pedicle screws in patients who are suspected of having osteoporosis.
Polat, Sefika Burcak; Evranos, Berna; Aydin, Cevdet; Cuhaci, Neslihan; Ersoy, Reyhan; Cakir, Bekir
2015-07-01
Pregnancy or lactation-related osteoporosis (PLO) is a very rare and debilitating condition which is usually diagnosed during the last trimester of the pregnancy or early postpartum period. Herein, we report a case with severe PLO and multiple vertebral compression fractures that were successfully treated with teriparatide. Twenty-three-year-old female patient was admitted to our clinic two months after her first spontaneous vaginal delivery with the complaint of severe back pain. Bone mineral density was measured using dual energy X-ray absorptiometry (DEXA), and low T- and Z-scores were observed in lumbar vertebrae. In vertebral MRI, severe height loss was detected in thoracic (T) 5,7,10,11,12 vertebrae. After exclusion of the other possible causes of OP, she was diagnosed to have PLO and the lactation was stopped. She was treated with calcium 1000 mg/day, cholecalciferol 800 mg/day and teriparatide 20 µg/day. At the 12th and 18th month of therapy, BMD was increased by 8% and 27%, respectively, at the lumbar spine and pain was completely relieved in few months. There are pharmacological therapy modalities that can be used in PLO. Bisphosphonates are effective, but there are some concerns that they accumulate in bone and may expose fetus in subsequent pregnancies. Teriparatide is a strong candidate to be the optimal medical therapy in severe cases since it is effective and safe.
Scrimgeour, Angus G; Marchitelli, Louis J; Whicker, Jered S; Song, Yang; Ho, Emily; Young, Andrew J
2010-07-01
Phytic acid forms insoluble complexes with nutritionally essential minerals, including zinc (Zn). Animal studies show that addition of microbial phytase (P) to low-Zn diets improves Zn status and bone strength. The present study determined the effects of phytase supplementation on bone mineral density (BMD), body composition and voluntary running activity of male rats fed a high phytic acid, low-Zn diet. In a factorial design, rats were assigned to ZnLO (5 mg/kg diet), ZnLO+P (ZnLO diet with 1500 U phytase/kg) or ZnAD (30 mg/kg diet) groups and were divided into voluntary exercise (EX) or sedentary (SED) groups, for 9 weeks. SED rats were significantly heavier from the second week, and no catch-up growth occurred in EX rats. Feed intakes were not different between groups throughout the study. ZnLO animals had decreased food efficiency ratios compared to both phytase-supplemented (ZnLO+P) and Zn-adequate (ZnAD) animals (P<.01 compared to ZnLO). The ZnLO+P and ZnAD rats ran 56-75 km more total distance than ZnLO rats (P<.05), with the ZnLO+P rats running more kilometers per week than the ZnLO rats by Week 6. In vivo DEXA analyses indicate that rats fed phytase-supplemented diets had higher lean body mass (LBM) than those fed ZnLO diets; and that rats fed the Zn-adequate diets had the highest LBM. Body fat (%) was significantly lower in EX rats and was both Zn- and phytase insensitive. Rats fed phytase-supplemented diets had higher bone mineral content (BMC), bone area (BA) and BMD than rats fed ZnLO diets; and in rats fed ZnAD diets these indices were the highest. The dietary effects on BMC, BA and BMD were independent of activity level. We conclude that consuming supplemental dietary phytase or dietary Zn additively enhances Zn status to increase BMD, LBM and voluntary physical activity in rats fed a low-Zn diet. While the findings confirm that bone health is vulnerable to disruption by moderate Zn deficiency in rats, this new data suggests that if dietary Zn is limiting, supplemental phytase may have beneficial effects on LBM and performance activity. (c) 2010 Elsevier Inc. All rights reserved.
Bone mineral measurement: Skylab experiment M-078.
Vogel, J M
1975-01-01
The observation that bone mineral is lost in patients who are either immobilized or remain in bed for extended periods of time formed the basis for the concern that large amounts of bone mineral may be lost during long periods of weightlessness. This concern was magnified when early X-ray densitometry studies suggested that rather large amounts of mineral could be lost during rather short periods of weightlessness (4-14 days). Even though these Gemini results have recently been modified, they still reflect substantial losses in the upper extremity. This led to a series of prolonged bed-rest studies (30-36 weeks) which, in addition to careful calcium balance, also employed a newer, more precise method of estimating bone mineral in the radius, ulna, and os calcis. It employed an essentially monoenergetic photon source (125I) and a scintillation detector operating in a rectilinear scanning mode to measure bone mineral by the absorptiometric technique. Bed-rest studies revealed variable mineral losses but suggested that little if any is lost during 4-6 weeks, with variable amounts being lost in 8 weeks. Losses up to 40% were noted in the os calcis after 9 months, with essentially none in the radius and ulna. When this technique was employed during the Apollo 14, 15, and 16 missions, only one crewman (CMP Apollo 15) showed significant losses in the os calcis and none in the radius or ulna. These results were, therefore, in concert with the bed-rest data but at variance with the earlier Gemini data. The variability observed during bed rest was reconciled when it was observed that the rate of loss could be correlated with the initial 24-hour urinary hydroxyproline excretion and the initial os calcis mineral content. Prediction terms were established. Measurements of the SL-II crew after 28 days of weightlessness revealed no significant bone mineral losses. The Skylab data lie within the predicted limits obtained from the bed-rest data. The relevance of the prediction terms to the Skylab and longer missions discussed.
Boyle, I T
1993-10-01
Osteoporosis with attendant increased fracture risk is a common complication of many other diseases. Indeed, almost all chronic diseases make some impact on life-style, usually by restricting physical activity and hence reducing the anabolic effect of exercise and gravitational strains on the skeleton. Restricted appetite and modified gastrointestinal tract function is another commonplace finding that has an impact on bone nutrition and synthesis, as on other systems. Sex hormone status is of particular importance for the maintenance of the normal skeleton, and the postmenopausal woman is at particular risk for most causes of secondary osteoporosis. In dealing with secondary osteoporosis in the hypo-oestrogenic woman, the question of giving hormone replacement therapy in addition to other disease-specific therapy should always be considered, as, for example, in a young amenorrhoeic woman with Crohn's disease. Similarly, in hypogonadal men the administration of testosterone is useful for bone conservation. The wider availability of bone densitometry ought to make us more aware of the presence of osteoporosis in the many disease states discussed above. This is particularly important as the life span of such patients is now increased by improved management of the underlying disease process in many instances. Even in steroid-induced osteoporosis--one of the commonest and most severe forms of osteoporosis--we now have some effective therapy in the form of the bisphosphonates and other anti-bone-resorbing drug classes. The possibility of prophylaxis against secondary osteoporosis has therefore become a possibility, although the very long-term effects of such drug regimens are still unknown. In some situations, such as thyrotoxicosis, Cushing's syndrome and immobilization, spontaneous resolution of at least part of the osteoporosis is possible after cure of the underlying problem. The shorter the existence of the basic problem, the more successful the restoration of the skeleton appears to be. A useful credo for clinicians with respect to secondary osteoporosis is: to think of it; to use specific therapy for the underlying disease; to reduce or remove completely any relevant drug or toxic material; to optimize physical activity and general nutrition; to treat hypogonadism if present and feasible; and to consider the use of specific anti-bone-resorbing or other bone active drugs.
Interest of a prescreening questionnaire to reduce the cost of bone densitometry.
Ben Sedrine, W; Broers, P; Devogelaer, J P; Depresseux, G; Kaufman, J M; Goemaere, S; Reginster, J Y
2002-05-01
Bone mineral density (BMD) measurement is widely recognized as the best single tool to identify patients with a high lifetime risk of developing an osteoporosis-related fracture. However, the cost/benefit value of screening the whole population has been repeatedly challenged and demonstrated to be rather poor. In many countries, BMD scan is not or no longer reimbursed because of lack of validated criteria to identify patients who should benefit from this procedure. Based on the proposals of a nationwide expert panel, a simple questionnaire identifying historical, clinical and behavioral risk factors for osteoporosis was developed. The aim of this study was to assess the diagnostic accuracy of the proposed criteria; to determine the extent to which this questionnaire could be useful for optimizing the use of densitometry tests; and, more specifically, to estimate the diagnostic costs per osteoporotic or osteopenic patient detected. For this purpose, we applied the questionnaire to 3998 consecutive individuals at least 20 years old, of both genders, either consulting spontaneously or referred for a BMD measurement to an outpatient osteoporosis center. BMD was measured by dual-energy X-ray absorptiometry (DXA) at the lumbar spine and at the hip (both total hip and femoral neck). Diagnostic accuracies were evaluated through measures of sensitivity, specificity, and positive and negative predictive values. After determining a benchmark value for age, different strategies were compared in order to identify the most cost-effective one in terms of cost per patient detected. According to the WHO operational definition of osteoporosis (T-score <-2.5), 31% of the subjects were classified as osteoporotic at one or more of the measured sites. If only patients with at least one of the proposed risk factors had been referred for scans, 33.3% of the BMD measurements would have been avoided. Among those, less than 5% were missclassified as they did have osteoporosis at the total hip and up to 23% at one or more of the considered sites. On the other hand, of the subjects who would be recommended for a densitometry test, only a small fraction were identified correctly (the positive predictive values varied from 11.3% at the total hip to 34.8% at any site). In this first setting, the suggested criteria seem useful chiefly for excluding subjects who do not need a DXA scan rather than selecting osteoporotic patients. When applied only to patients aged 61 years or more, the positive predictive values rose to 15.1% (total hip) and 42.9% (any site), whereas the corresponding negative predictive values were set at 93% and 68.6%. In comparison, with a mass screening scenario the estimated diagnostic costs (costs associated with the DXA procedure) per osteoporotic patient detected at any of the considered sites would be reduced by more than 9% (59.4 instead of 65.3 Euros) if the suggested indications are taken into account for prescreening patients. And when the questionnaire is applied only to women over the age of 60 years these costs would be further reduced to 50.6 Euros, representing a 23% decrease. Then, a prescreening strategy based on these indications concomitantly with an age-selective criterion could represent a promising way toward a more rational use of BMD measurement.
How should clinicians manage osteoporosis in ankylosing spondylitis?
Bessant, Rupa; Keat, Andrew
2002-07-01
Osteoporosis is a common complication of AS, with an incidence between 18.7% and 62%. The prevalence of osteoporosis is greater in males, and increases with increasing patient age and disease duration. Osteoporosis is also more common in patients with syndesmophytes, cervical fusion, and peripheral joint involvement. These variables are not all independent, as they may be indicators of disease duration. Osteoporosis in patients with AS is largely confined to the axial skeleton, in contrast to the pattern of osteoporosis seen in rheumatoid arthritis. BMD at the lumbar spine and femoral neck may be severely reduced, while most studies indicate that carpal and radial BMD remain within normal limits. The development of syndesmophytes in late AS can lead to difficulties in the use of DEXA scanning to determine lumbar BMD, as the extraspinal bone may obscure osteoporotic vertebrae. Under these circumstances more accurate assessment of lumbar BMD, and one that correlates better with femoral neck BMD, may be obtained by quantitative CT scanning or DEXA scanning of the lateral aspect of the L3 vertebra. Osteoporosis in AS significantly increases the risk of vertebral compression fractures within 5 years of the diagnosis of AS. The risk of a vertebral compression fracture occurring over a 30 year period following the diagnosis of AS is 14%, compared to 3.4% for population controls. In patients with vertebral osteoporosis relatively minor trauma, such as slipping, can lead to spinal fracture and dislocatior with subsequent damage to the spinal cord. There is a higher incidence of spinal cord injury following spinal fracture dislocations in patients with AS, and the resulting neurological deficit can range from mild sensory loss to complete paraplegia. Cytokines such as TNF-alpha and IL-6 may play an important part in the pathogenesis of osteoporosis in early AS, and IL-6 levels have been correlated with markers of disease activity and severity. In late AS, mechanical factors such as decreased mobility and the support provided by extraspinal bone may play a role in vertebral osteoporosis. Screening patients with AS for the presence of osteoporosis is an important, but contentious subject. This and subsequent monitoring needs to be considered in all patients, but longterm studies are needed to determine with confidence which patients should undergo screening, by which methods, and how often. The treatment of osteoporosis in AS is at present similar to that used for primary osteoporosis, except that due to the male predominance and a relatively young age of patients, there is a limited role for hormone replacement therapy. Exercise regimens and bisphosphonates are widely used, but a study of the relative efficacy of different bisphosphonate agents in patients with AS is required.
Bioindicators in the MIDUS National Study: Protocol, Measures, Sample, and Comparative Context
Love, Gayle Dienberg; Seeman, Teresa E.; Weinstein, Maxine; Ryff, Carol D.
2010-01-01
Objectives MIDUS is a national study of health and aging among individuals aged 25 to 74 at baseline(1995/96). Longitudinal survey assessments (2004/05), were followed by biological assessments on a subsample aged 35–85. To facilitate public use, we describe the protocol, measures, and sample. Methods Respondents traveled to clinics for a two-day data collection protocol that included fasting blood specimens, 12-hour urine specimen, medical history, physical exam, bone densitometry, a laboratory challenge (heart rate variability, blood pressure, respiration, salivary cortisol). Results Response rates for the biological protocol (N = 1,255) were 39.3%, or 43.1% (adjusting for those who could not be located or contacted). Reasons for non-participation were travel, family obligations, and being too busy. Respondents were comparable to the recruitment pool on most demographic characteristics and health assessments. Discussion Strengths of the protocol vis-à-vis other similar studies include opportunities to link biological factors with diverse content from other MIDUS projects. PMID:20876364
Bone and fall-related fracture risks in women and men with a recent clinical fracture.
van Helden, Svenhjalmar; van Geel, Antonia C M; Geusens, Piet P; Kessels, Alfons; Nieuwenhuijzen Kruseman, Arie C; Brink, Peter R G
2008-02-01
Worldwide fracture rates are increasing as a result of the aging population, and prevention, both primary and secondary, is an important public health goal. Therefore, we systematically analyzed risk factors in subjects with a recent clinical fracture. All men and women over fifty years of age who had been treated in the emergency department of, or hospitalized at, our institution because of a recent fracture during a one-year period were offered the opportunity to undergo an evidence-based bone and fall-related risk-factor assessment and bone densitometry. The women included in this study were also compared with a group of postmenopausal women without a fracture history who had been included in another cohort study. Of the 940 consecutive patients, 797 (85%) were eligible for this study and 568 (60%) agreed to participate. The prevalence of fall-related risk factors (75% [95% confidence interval = 71% to 78%]; n = 425) and the prevalence of bone-related risk factors (53% [95% confidence interval = 49% to 57%]; n = 299) at the time of fracture were higher than the prevalence of osteoporosis (35% [95% confidence interval = 31% to 39%]; n = 201) as defined by a dual x-ray absorptiometry T score of
Sklarew, R J
1983-10-01
A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.
Yonova, Diana H; Vazelov, Evgueniy S; Trendafilov, Ivan I; Stoinova, Veselka V; Nedevska, Mariya T; Antonov, Simeon A
2014-04-01
Cardiovascular calcification (CVC) in hemodialysis patients (HDP) causes cardiovascular pathology. Up until now very few drugs and therapeutic interventions have been able to reduce cardiovascular calcium deposits in hemodialysis patients and the process requires more than a year. Our idea in this study was to test 2 calcium binders--sodium thiosulfate (STS) and dinatrium ethylene diamine tetraacetic acid (DNEDTA)--for prevention and treatment of cardiovascular calcification of hemodialysis patients, using both substances not as an intravenous infusion but by adding them to the liquid bicarbonate part of the dialysis fluid. 6 HDPs were treated with sodium thiosulphate (STS), 6 with dinatrium ethylene diamine tetraacetic acid (DNEDTA), and 6 patients served as controls. Electrolytes, liver function, markers of inflammation, oxidative stress, bone metabolism, spiral computed tomography (SCT) of coronary CVC and bone densitometry were performed twice (start and end of the study). Starting blood parameters were similar to the end (STS group). No toxic or side effects from STS were observed. Initially in the DNEDTA group all the patients had vomiting so we excluded DNEDTA from the study. SCT found a significant reduction of calcification in 4 patients (STS group) and retardation in 2 patients comparatively to controls. The first results are hopeful, but the number of the patients was small, so we are enlarging the enrollment in the expectation of corroborating our results soon.
Nuclear medicine techniques in the assessment of alkaptonuria.
Vinjamuri, Sobhan; Ramesh, Chandakacharla N; Jarvis, Jonathan; Gallagher, Jim A; Ranganath, Lakshminarayana L
2011-10-01
Alkaptonuria is a rare autosomal recessive disorder due to a lack of the enzyme homogentisate dioxygenase, leading to ochronosis, a process of accumulation of a melanin-like polymer of homogentisic acid in cartilage and other collagenous structures. Patients develop severe osteoarthropathy that resembles osteoarthritis. Although the diagnosis of alkaptonuria is not particularly challenging in view of the blue-black discolouration of visible connective tissue and the presence of homogentisic acid in urine, the natural history of alkaptonuria remains poorly understood. Patients would benefit immensely from an objective assessment of their disease status and from a clearer understanding of the pathophysiology and associated physical changes. Isotope bone scans, which are commonly used to identify the extent of involvement of bones in cancerous processes, have also been increasingly used for characterizing the extent of arthropathy in conditions such as osteoarthritis and rheumatoid arthritis. Semiquantitative scores based on the extent of involvement of joints have been used to describe the involvement of large joints in the context of symptomatic treatment for osteoarthritis. A similar semiquantitative isotope bone scan score depending on the involvement of the number of large joints in patients with alkaptonuria can be formulated and validated in a suitable cohort of patients. Bone densitometry measurement using dual-energy X-ray absorptiometry scanning is an internationally accepted tool to assess the risk and extent of osteoporosis, and is increasingly used to assess the additional fracture risk in patients with arthropathy. We believe that, currently, nuclear medicine techniques can provide useful information, which can be incorporated into disease severity scores for alkaptonuria. Once the biological basis for alkaptonuria is better understood, it is feasible that nuclear medicine techniques of even greater sensitivity and specificity can be developed, thereby taking advantage of the vast advances in the fields of radiochemistry, radiopharmacy, positron emission tomography-computed tomography and positron emission tomography-magnetic resonance imaging scanning.
Muscular Maximal Strength Indices and Bone Variables in a Group of Elderly Women.
Nasr, Riad; Al Rassy, Nathalie; Watelain, Eric; Matta, Joseph; Frenn, Fabienne; Rizkallah, Maroun; Maalouf, Ghassan; El Khoury, César; Berro, Abdel-Jalil; El Hage, Rawad
2018-03-22
The aim of the present study was to explore the relations between muscular maximal strength indices and bone parameters (bone mineral density [BMD], hip geometry indices, and trabecular bone score [TBS]) in a group of elderly women. This study included 35 healthy elderly women whose ages range between 65 and 75 yr (68.1 ± 3.1 yr). BMD (in gram per square centimeter) was determined for each individual by dual-energy X-ray absorptiometry at the whole body, lumbar spine (L1-L4), total hip (TH), and femoral neck (FN). L1-L4 TBS and hip geometry indices were also evaluated by dual-energy X-ray absorptiometry. Maximal muscle strength of bench press (1-repetition maximum [RM] bench press), maximal muscle strength of leg press (1-RM leg press), and handgrip were measured using validated methods. 1-RM bench press was positively correlated to TH BMD (r = 0.40; p < 0.05), FN BMD (r = 0.41; p < 0.05), FN section modulus (r = 0.33; p < 0.05), and FN cross-sectional moment of inertia (r = 0.35; p < 0.05). 1-RM leg press was positively correlated to TH BMD (r = 0.50; p < 0.01), FN BMD (r = 0.35; p < 0.05), FN cross-sectional area (r = 0.38; p < 0.05), and TBS (r = 0.37; p < 0.05). Handgrip was correlated only to FN cross-sectional moment of inertia (r = 0.43; p < 0.01). This study suggests that 1-RM bench press and 1-RM leg press are positive determinants of BMD in elderly women. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Hochberg, Marc C; Silverman, Stuart L; Barr, Charles E; Miller, Paul D
2010-01-01
Bone turnover markers may provide a more rapid indication of patient response to osteoporosis treatment than bone mineral density (BMD) measurements. This post hoc analysis of data from the MOBILE (Monthly Oral iBandronate In LadiEs) study assessed the relationship between increases in BMD at 12 mo from baseline after starting ibandronate treatment and changes in bone resorption marker serum C-terminal telopeptide of type I collagen (sCTX) from baseline at 3 and 6 mo. MOBILE enrolled postmenopausal women aged 55-80 yr with mean lumbar spine (LS) BMD T-score of -2.5 to -5.0. This analysis included women who received 150-mg monthly oral ibandronate (n=323). A high proportion of women were classified as BMD responders after 1 yr (BMD increase was >/=0%, i.e., 74-91% depending on skeletal site; BMD increase was >/=3%, i.e., 34-67%). Women with larger decreases in sCTX were more likely to be BMD responders. The percent increase in LS BMD at 12 mo was significantly associated with the percent decrease in sCTX at 3 mo from baseline (Pearson correlation coefficient: -0.19, p=0.0016). In linear regression models, percent decrease in sCTX at 3 mo from baseline was a significant predictor of 1-yr LS BMD response (R(2)=0.61, p=0.0007). These data suggest that 3-mo changes in sCTX levels are associated with 1-yr LS BMD increases in postmenopausal women treated with once-monthly oral ibandronate. The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Minematsu, Akira; Hazaki, Kan; Harano, Akihiro; Iki, Masayuki; Fujita, Yuki; Okamoto, Nozomi; Kurumatani, Norio
2012-01-01
Screening for low bone mass is important to prevent fragility fractures in men as well as women, although men show a much lower prevalence of osteoporosis than women. The purpose of this study was to establish a screening model for low bone mineral density (BMD) using a quantitative ultrasound parameter and easily obtained objective indices for elderly Japanese men. We examined 1633 men (65-84 yr old) who were subjects of the Fujiwara-Kyo Study. Speed of sound (SOS) at the calcaneus was determined, and BMD was measured by dual-energy X-ray absorptiometry at the lumbar spine (LS), total hip (TH), and femoral neck (FN). Low BMD was defined as >1 standard deviation below the young adult mean, in accordance with World Health Organization criteria. We performed receiver operating characteristic (ROC) analysis to identify a better screening model incorporating SOS and determined the optimal cutoff value using Youden index. Prevalences of low BMD at the 3 skeletal sites were 27.8% (LS), 33.5% (TH), 48.6% (FN), and 43.3% at either LS or TH. The greatest area under the ROC curve (0.806, 95% confidence interval: 0.785-0.828) and smallest Akaike's information criterion were obtained in the multivariate model incorporating SOS, age, height, and weight for predicting low BMD at all skeletal sites. This model predicted low BMD at TH with the sensitivity of 0.726 and specificity of 0.739, whereas a similar model predicted low BMD at LS with much lower validity. We conclude that the multivariate model for TH could be used to screen for low BMD in elderly Japanese men. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Hind, Karen; Oldroyd, Brian; Truscott, John G
2010-01-01
Knowledge of precision is integral to the monitoring of bone mineral density (BMD) changes using dual-energy X-ray absorptiometry (DXA). We evaluated the precision for bone measurements acquired using a GE Lunar iDXA (GE Healthcare, Waukesha, WI) in self-selected men and women, with mean age of 34.8 yr (standard deviation [SD]: 8.4; range: 20.1-50.5), heterogeneous in terms of body mass index (mean: 25.8 kg/m(2); SD: 5.1; range: 16.7-42.7 kg/m(2)). Two consecutive iDXA scans (with repositioning) of the total body, lumbar spine, and femur were conducted within 1h, for each subject. The coefficient of variation (CV), the root-mean-square (RMS) averages of SDs of repeated measurements, and the corresponding 95% least significant change were calculated. Linear regression analyses were also undertaken. We found a high level of precision for BMD measurements, particularly for scans of the total body, lumbar spine, and total hip (RMS: 0.007, 0.004, and 0.007 g/cm(2); CV: 0.63%, 0.41%, and 0.53%, respectively). Precision error for the femoral neck was higher but still represented good reproducibility (RMS: 0.014 g/cm(2); CV: 1.36%). There were associations between body size and total-body BMD and total-hip BMD SD precisions (r=0.534-0.806, p<0.05) in male subjects. Regression parameters showed good association between consecutive measurements for all body sites (r(2)=0.98-0.99). The Lunar iDXA provided excellent precision for BMD measurements of the total body, lumbar spine, femoral neck, and total hip. Copyright © 2010 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Mydlárová Blaščáková, Marta; Blaščáková, Ľudmila; Poráčová, Janka; Mydlár, Jozef; Vašková, Janka; Bernasovská, Jarmila; Boroňová, Iveta; Petrejčíková, Eva; Bernasovský, Ivan
2017-09-01
The study was focused on evaluating the possible correlation between biochemical, anthropometric, and genetic indicators of osteoporosis in postmenopausal women. The frequency of genotypes and differences in measured parameters were evaluated within two ethnically different groups of women in Slovakia. The study included 310 postmenopausal women divided into non-Roma and Roma groups. Based on results of densitometry, they were divided into control groups and women with osteoporosis and osteopenia. In all women, a genetic analysis of polymorphism of osteoprotegerin gene promotor region (A163G) was provided along with measurement of indicators of bone tissue metabolism. There is a particularly low incidence of osteoporosis in Roma women. We found a correlation between bone mineral density (BMD), body mass index, and waist and hip circumference in women with osteoporosis and in Roma women with osteopenia. The frequency of the AG genotype was higher in non-Roma women with osteoporosis, but reached only 10.7% in Roma women with osteopenia. While the presence of the G allele in the non-Roma population was accompanied by higher BMD and markers of osteoformation, it was accompanied by significantly higher concentrations of parathyroid hormone in the Roma population. The presence of the AG genotype has a different effect on bone metabolism in two ethnically diverse populations of women in Slovakia. In the general population, the presence of the G allele exhibited protective effects consistent with other studies, but in Roma population this appears to be the allele A. However, this requires a further study for confirmation and more detailed characterization of the differences between populations that have this work indicated. © 2016 Wiley Periodicals, Inc.
Grip strength is a predictor of bone mineral density among adolescent combat sport athletes.
Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Fadhel Najjar, Mohamed; Neffeti, Fadoua; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair
2013-01-01
The aim of this study was firstly to investigate the correlation between bone parameters and grip strength (GS) in hands, explosive legs power (ELP), and hormonal parameters; second, to identify the most determinant variables of bone mineral density (BMD) among adolescent combat sport athletes. Fifty combat sport athletes aged 17.1 ± 0.2 year were compared with 30 sedentary subjects matched for age, height, and pubertal stage. For all subjects, the BMD in deferent sites associated with anthropometric parameters were measured by dual-energy X-ray absorptiometry. The growth hormone (GH) and testosterone (TESTO) concentrations were tested. The GS in dominant (GSDA) and nondominant arms (GSNDA) and ELP were evaluated. All BMD measured were greater in athletes than in sedentary group (p<0.01). The GS and ELP showed higher values in athletes than in sedentary group (p<0.01). The BMD in all sites were correlated with weight, but without correlation with height. The GSNDA and ELP were significantly correlated with BMD of both spine and legs. The GH was correlated with the BMD of whole body and spine (p<0.05). The TESTO was only correlated with BMD of the arms (p<0.01). The best predictor of BMD measurements is GSNDA. This study has proved the osteogenic effect of combat sports practice, especially judo and karate kyokushinkai. Therefore, children and adolescent should be encouraged to participate in combat sport. Moreover, it suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the GSNDA. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Peppler, W T; Kim, W J; Ethans, K; Cowley, K C
2017-05-01
Methodological validation of dual-energy x-ray absorptiometry (DXA)-based measures of leg bone mineral density (BMD) based on the guidelines of the International Society for Clinical Densitometry. The primary objective of this study was to determine the precision of BMD estimates at the knee and heel using the manufacturer provided DXA acquisition algorithm. The secondary objective was to determine the smallest change in DXA-based measurement of BMD that should be surpassed (least significant change (LSC)) before suggesting that a biological change has occurred in the distal femur, proximal tibia and calcaneus. Academic Research Centre, Canada. Ten people with motor-complete SCI of at least 2 years duration and 10 people from the general population volunteered to have four DXA-based measurements taken of their femur, tibia and calcaneus. BMDs for seven regions of interest (RIs) were calculated, as were short-term precision (root-mean-square (RMS) standard deviation (g cm -2 ), RMS-coefficient of variation (RMS-CV, %)) and LSC. Overall, RMS-CV values were similar between SCI (3.63-10.20%, mean=5.3%) and able-bodied (1.85-5.73%, mean=4%) cohorts, despite lower absolute BMD values at each RIs in those with SCI (35%, heel to 54%, knee; P<0.0001). Precision was highest at the calcaneus and lowest at the femur. Except at the femur, RMS-CV values were under 6%. For DXA-based estimates of BMD at the distal femur, proximal tibia and calcaneus, these precision values suggest that LSC values >10% are needed to detect differences between treated and untreated groups in studies aimed at reducing bone mineral loss after SCI.
Imbalanced expression of RANKL and osteoprotegerin mRNA in pannus tissue of rheumatoid arthritis.
Ainola, M; Mandelin, J; Liljeström, M; Konttinen, Y T; Salo, J
2008-01-01
To test if the pannus tissue is characterized by a high receptor activator of nuclear factor kappaB ligand to osteoprotegerin (RANKL:OPG) ratio, which could explain local osteoclastogenesis and formation of bony erosions. Messenger RNA and protein expressions of RANKL and OPG in rheumatoid and osteoarthritic tissue samples were measured using quantitative real-time RT-PCR and Western blot/densitometry. Pannus and synovitis fibroblasts explanted from tissue samples were cultured in vitro without and with TNF-alpha, IL-1Beta or IL-17 and analyzed quantitatively for RANKL expression. The ability of pannus fibroblasts to induce formation of multinuclear osteoclast-like cells from human monocytes, with macrophage-colony stimulating factor (M-CSF) but without RANKL added, was tested. Histochemical staining was used to assess the eventual presence of RANKL and tartrate resistant acid phosphatase positive osteoclast-like cells at the pannus-bone interface. RANKL:OPG ratios of messenger RNA (p<0.05) and protein level were high in pannus (2.06+/-0.73 and 2.2+/-0.65) compared to rheumatoid (0.62+/-0.13 and 1.31+/-0.69) and osteoarthritis (0.62+/-0.32 and 0.52+/-0.16) synovial membranes. Resting and stimulated (p dependent on the cytokine used) pannus fibroblasts produced RANKL in excess (p=0.0005) and unstimulated pannus fibroblasts also effectively induced osteoclast-like cell formation from monocytes in vitro without any exogenous RANKL added. Compatible with these findings, multinuclear osteoclasts-like cells were frequent in the fibroblast- and macrophage-rich pannus tissue at the soft tissue-to-bone interface. The high RANKL:OPG ratio, together with close fibroblast-to-monocyte contacts in pannus tissue, probably favor local generation of bone resorbing osteoclasts at the site of erosion in rheumatoid arthritis.
Breastfeeding as the sole source of milk for 6 months and adolescent bone mineral density.
Blanco, E; Burrows, R; Reyes, M; Lozoff, B; Gahagan, S; Albala, C
2017-10-01
Little is known regarding the relationship between early life factors and bone mineral density (BMD). We found a positive association between breastfeeding for at least 6 months, without formula supplementation, and whole body adolescent BMD z-score. The aim of the study is to assess the role of breastfeeding BF on adolescent bone mineral density (BMD) in a cohort prospectively followed since infancy. We studied 679 participants from an infancy iron deficiency anemia preventive trial in Santiago, Chile, followed to adolescence. Breast and bottle feeding were ascertained weekly from 4 to 12 months. At 16 years, whole body BMD was assessed by DEXA. Using linear regression, we evaluated associations between BF duration and BF as the sole source of milk and adolescent BMD z-score, adjusting for possible infancy, adolescent, and background confounders. Mean birth weight and length were 3.5 (0.3) kg and 50.7 (1.6) cm. For at least 6 months, BF was the sole source of milk for 26.3% and with supplementation for 36.7%. For 37%, BF was provided for less than 6 months. Mean 16-year BMD z-score was 0.25 (1.0). Covariates included male sex, birth length, and gestational age. BF as the sole source of milk ≥6 months, compared to BF < 6 months, was associated with higher adolescent BMD z-score adjusting for covariates (β = 0.29, p < 0.05). Mixed BF was not significantly related to adolescent BMD z-score (β = 0.06, p = 0.47). For every 30 days of BF as the sole source of milk, adolescent BMD z-score increased by 0.03 (p = 0.01). BF without formula supplementation for at least 6 months was associated with higher adolescent BMD z-score and a suggestive trend in the same direction for BMD suggests that exclusivity and duration of BF may play a role in adolescent bone health.
Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper
2017-01-01
To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.
The usefulness of densitometry in predicting the composition and fragility of urolithiasis.
Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael
2014-04-01
The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.
1996-01-01
OBJECTIVE: To recommend clinical practice guidelines for the assessment of people at risk for osteoporosis, and for effective diagnosis and management of the condition. OPTIONS: Screening and diagnostic methods: risk-factor assessment, clinical evaluation, measurement of bone mineral density, laboratory investigations. Prophylactic and corrective therapies: calcium and vitamin D nutritional supplementation, physical activity and fall-avoidance techniques, ovarian hormone therapy, bisphosphonate drugs, other drug therapies. Pain-management medications and techniques. OUTCOMES: Prevention of loss of bone mineral density and fracture; increased bone mass; and improved quality of life. EVIDENCE: Epidemiologic and clinical studies and reports were examined, with emphasis on recent randomized controlled trials. Clinical practice in Canada and elsewhere was surveyed. Availability of treatment products and diagnostic equipment in Canada was considered. VALUES: Cost-effective methods and products that can be adopted across Canada were considered. A high value was given to accurate assessment of fracture risk and osteoporosis, and to increasing bone mineral density, reducing fractures and fracture risk and minimizing side effects of diagnosis and treatment. BENEFITS, HARMS AND COSTS: Proper diagnosis and management of osteoporosis minimize injury and disability, improve quality of life for patients and reduce costs to society. Rationally targeted methods of screening and diagnosis are safe and cost effective. Harmful side effects and costs of recommended therapies are minimal compared with the harms and costs of untreated osteoporosis. Alternative therapies provide a range of choices for physicians and patients. RECOMMENDATIONS: Population sets at high risk should be identified and then the diagnosis confirmed through bone densitometry. Dual-energy x-ray absorptiometry is the preferred measurement technique. Radiography can be adjunct when indicated. Calcium and vitamin D nutritional supplementation should be at currently recommended levels. Patients should be counselled in fall-avoidance techniques and exercises. Immobilization should be avoided. Guidelines for management of acute pain are listed. Ovarian hormone therapy is the therapy of choice for osteoporosis prevention and treatment in postmenopausal women. Bisphosphonates are an alternative therapy for women with established osteoporosis who cannot or prefer not to take ovarian hormone therapy. PMID:8873639
Kronhed, A C; Möller, M
1998-10-01
Vadstena is a small community in the county of Ostergötland, Sweden, where a project began in 1989 to prevent osteoporosis and to lower the expected incidence of osteoporotic fractures. Persons aged 40-70 years who had a low bone mineral density (BMD) value at screening of the distal radius by single-photon absorptiometry (SPA) were invited to participate in a training study during one year. The definition of low BMD was a densitometry value below -1 SD (standard deviation) from a sex- and age-specific reference value (z-score). Fifteen persons wanted to exercise in a group and 15 persons wanted to become a control group. All participants answered a questionnaire about lifestyle, occupation, diseases, medication and heredity. Clinical tests were made regarding mobility of the joints and muscles, balance and physical fitness. BMD for the hip and the lumbar spine were assessed by dual-energy X-ray absorptiometry (DXA) before and after the investigation period. The training programme was carried out for 60 min twice a week during one year and had the intention to improve bone mass, muscle strength and flexibility, balance skill and aerobic capacity. After the training period there was a significant increase in BMD at the greater trochanter (P < 0.01), in balance skill (standing on one leg with closed eyes and "ski step"-test) (P < 0.05) and in oxygen uptake capacity (P < 0.05) in the exercise group. In the control group, there was a significant increase in BMD at the lumbar spine (P < 0.05). However, these results should be judged with caution because several participants were over the age of 60, and at that age degenerative changes in the lumbar spine may increase to a greater or lesser extent. Regular weight-bearing exercises during one year seem to influence BMD at the greater trochanter in a training group comprising both women and men. However, our study was small in number and further training studies are needed to assess the effect of weight-bearing training on bone mass in different sex- and age-specific groups.
Dytfeld, Joanna; Ignaszak-Szczepaniak, Magdalena; Gowin, Ewelina; Michalak, Michał; Horst-Sikorska, Wanda
2011-01-01
Despite known positive association between body mass and bone mineral density (BMD), relative contribution of fat and lean tissue to BMD remains under debate. We aimed at investigating the effect of selected anthropometric parameters, including fat content and lean body mass (LBM) on BMD in postmenopausal, osteoporotic women with body mass index (BMI) > 20 kg/m(2). The study involved 92 never-treated women (mean age 69.5 ± 7.3). L1-L4 and femoral neck (FN) BMD were measured by dual energy X-ray absorptiometry (DEXA). Absolute (kg) and relative (%) fat and LBM were assessed by means of electric bioimpedance method. We showed both FN and L1-L4 BMD were positively correlated with body mass, waist circumference (WC), hip circumference (HC) and LBM (kg). Fat content correlated with FN BMD (r = 0.36, p < 0.001). Regression analysis revealed the only predictor of L1-L4 BMD was LBM (R(2) = 0.18, p < 0.05), for FN--both LBM and fat (R(2) = 0.18, p < 0.05 and p < 0.001, respectively). Of the women, 44.5% were overweight, 18.4% obese. Obese women displayed the highest BMD. Both L1-L4 and FN BMD were higher in women with WC > 80 cm. In postmenopausal osteoporotic women with BMI > 20 kg/m(2) both fat and lean tissue might contribute to BMD. Positive association between body mass and BMD does not make obesity and osteoporosis mutually exclusive. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Kęska, Anna; Lutosławska, Grażyna; Bertrandt, Jerzy; Sobczak, Małgorzata
2018-03-14
Data concerning the relationship between body fat and BMD are equivocal since both positive and negative effects have been noted. Recently, the index of fat mass (IFM) representing subjects with different body fat and similar lean mass and index of lean mass (ILM) representing subjects with different lean body mass and similar body fat, have been used to evaluate body composition effect on BMD in middle-aged women. This study aimed at determination of ILM and IFM association with BMD in young men and women. A total of 212 university students of Public Health (125 women and 87 men) participated in the study. Body composition was determined by the bioelectrical impedance method (BIA) using BC 418 MA equipment (Tanita Co., Japan). Fat mass and fat free mass were used to calculate ILM and IFM. Bone mineral density was measured on the wrist of the non-dominant hand using the DEXA method and EXA 3000 equipment (HFS Ltd., Korea). BMD was evaluated using Z-score, with values lower than -2.0 indicating inadequate BMD for subject chronological age. Exclusively in women, IFM was markedly and positively correlated with Z-score (r=0.366, P<0.001). In both genders, a significant relationship was found between ILM and Z-scores (r=0.420; p<0.001 and r=0.220; p<0.02 in men and women, respectively). Women with lower than median IFM but similar ILM, were characterized by significantly lower Z-scores vs. women with higher IFM (-1.016 vs. -0.512; p<0.001). Irrespective of gender, participants with higher ILM but similar IFM, were characterized by markedly higher Z-score vs. their counterparts with low ILM. The use of IFM and ILM in the present study, allowed the observation that in young adults lean body mass was associated with BMD, regardless of gender, while fat mass is significant for bone mineral density only in women.
Ikeda, Keigo; Hayakawa, Kunihiro; Fujishiro, Maki; Kawasaki, Mikiko; Hirai, Takuya; Tsushima, Hiroshi; Miyashita, Tomoko; Suzuki, Satoshi; Morimoto, Shinji; Tamura, Naoto; Takamori, Kenji; Ogawa, Hideoki; Sekigawa, Iwao
2017-08-22
We previously reported that JAK-STAT-pathway mediated regulation of IFN-regulatory factor genes could play an important role in SLE pathogenesis. Here, we evaluated the efficacy of the JAK inhibitor tofacitinib (TOFA) for controlling IFN signalling via the JAK-STAT pathway and as a therapeutic for SLE. We treated NZB/NZW F1 mice with TOFA and assessed alterations in their disease, pathological, and immunological conditions. Gene-expression results obtained from CD4 + T cells (SLE mice) and CD3 + T cells (human SLE patients) were measured by DNA microarray and qRT-PCR. TOFA treatment resulted in reduced levels of anti-dsDNA antibodies, decreased proteinuria, and amelioration of nephritis as compared with those observed in control animals. Moreover, we observed the rebalance in the populations of naïve CD4 + T cells and effector/memory cells in TOFA-treated mice; however, treatment with a combination of TOFA and dexamethasone (DEXA) elicited a stronger inhibitory effect toward the effector/memory cells than did TOFA or DEXA monotherapy. We also detected decreased expression of several IFN-signature genes Ifit3 and Isg15 in CD4 + from SLE-prone mice following TOFA and DEXA treatment, and IFIT3 in CD3 + T cells from human patients following immunosuppressant therapy including steroid, respectively. Modulation of type I IFN signalling via JAK-STAT inhibition may exert a beneficial effect in SLE patients, and our results suggest that TOFA could be utilised for the development of new SLE-specific therapeutic strategies.
Influence of female and male sex steroids on body composition in the rabbit model.
Alexandersen, P; Hassager, C; Christiansen, C
2001-09-01
To study the influence on body composition of estrogen replacement therapy (ERT) in female rabbits and of replacement therapy with testosterone (TRT) in male rabbits using dual-energy X-ray absorptiometry (DEXA). Cholesterol-fed female and male rabbits receiving a weight-restricted diet (100 g/day) were used. Total lean tissue mass (LTM), total body fat tissue mass (FTM) and total tissue mass (TTM) were determined by DEXA at baseline, after which the animals were gonadectomized and treated with sex steroids. Soft body composition was then determined again after 30-31 weeks of treatment. Relative to controls, ERT with estradiol (E2) doses of 2 and 4 mg/day significantly increased LTM (p < 0.001), whereas E2 0.5 and 1 mg/day had a neutral effect on LTM. The change in fat mass, however, was not statistically significant between groups. In male rabbits, compared with castrated control rabbits, LTM decreased in testosterone-treated animals (by 7-12%; p < 0.001) but FTM decreased relatively more (by 66-79%; p < 0.0001). In both genders, body weight correlated with TTM as determined by DEXA (r = 0.89-0.91, p < 0.0001). In this in vivo model of growing rabbits, estrogen replacement significantly increased LTM in female animals, whereas testosterone replacement significantly decreased FTM in males, suggesting that soft body composition of both genders is significantly affected by replacement with sex steroids. Until comparable human data are available, it is speculated that similar changes in soft body composition may occur in humans treated with sex steroids.
Crosby, Vincent; D'Souza, Catherine; Bristow, Carina; Proffitt, Amy; Hussain, Asmah; Potter, Vanessa; Hennig, Ivo; O'Connor, Richard; Baracos, Vickie; Wilcock, Andrew
2017-04-01
Current methods of dosing platinum-based chemotherapy are suboptimal. Potentially, taking lean body mass into account may help. To inform the design of a future study, we first examined the feasibility and acceptability of such an approach using dual-energy X-ray absorptiometry (DEXA) and explored aspects suggestive of over- and under-dosing. Patients with lung cancer offered platinum-based chemotherapy over 1 year were identified and, if eligible, invited to take part in a prospective feasibility study. Questionnaires examined acceptability of the DEXA scan and of a future study that randomized between traditional dosing and one adjusted according to body composition. Dose-limiting toxicity (DLT) and a lack of neutropenia explored potential over- and under-dosing, respectively. Of the 173 patients offered chemotherapy, 123 (71%) were ineligible, mostly because of failing entry criteria (84, 49%). Of the 50 approached, 18 (36%) participated, most receiving carboplatin, with 17 providing data. All found a DEXA scan acceptable; other assessments were fully completed, except nadir and pre-chemotherapy blood counts. Most (94%) were prepared to take part in a future study, although the additional hospital visits for a nadir blood count were unpopular with some. Five (29%) patients experienced six episodes of DLT which resulted in discontinuation (3), dose reduction (2) or change to a less toxic regimen (1). Nine (60%) patients experienced either no (2) or inconsistent (7) neutropenia. A randomized trial appears acceptable and feasible in patients receiving carboplatin. Adjustment of our entry criteria and avoiding a hospital visit for a nadir blood count should aid recruitment.
Fairus, A; Ima Nirwana, S; Elvy Suhana, M R; Tan, M H; Santhana, R; Farihah, H S
2013-01-01
Visceral obesity may be due to the dysregulation of cortisol production or metabolism that lead to metabolic disease. In adipose tissue, the enzyme 11beta-hydroxysteroid dehydrogenase type 1 regulates cortisol metabolism (11beta-HSD1). A previous study showed an increase in the visceral fat deposition in adrenalectomised rats given intramuscular dexamethasone. Glycyrrhizic acid (GCA) has been shown to reduce fat deposition because it is a known potent inhibitor of the 11beta-HSD1 enzyme. Piper sarmentosum (PS) is an edible medicinal plant commonly used in Asia as traditional medicine for treating diabetes, hypertension and joint pains. In this study, we determined the effects of PS extract on the disposition and morphology of perirenal adipocytes of adrenalectomised rats given intramuscular dexamethasone. A total of 21 male Spraque Dawley rats were adrenalectomised and given intramuscular dexamethasone, 120 μg/kg/day. These rats were further divided into three groups: adrenalectomised control (ADR+Dexa; n=7), GCA-treated (ADR+Dexa+GCA; dose=240 mg/kg/day; n=7) and PS-treated (ADR+Dexa+PS; dose=125 mg/kg/day; n=7) groups. The various treatments were given via gastric gavage following 2 weeks of adrenalectomy. Treatment with PS extract for 8 weeks showed decreased deposition of perirenal adipocytes which was similar to the GCA-treated group. However, PS-treated rats had thinner adipocyte membrane compared with that of the GCA-treated group. In conclusion, PS extract decreased perirenal fat deposition and reduced the diameter of the adipocyte membrane. However, the mechanisms of action needed further study.
Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel
NASA Astrophysics Data System (ADS)
Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.
2014-04-01
Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.
Seasonal vegetation differences from ERTS imagery
NASA Technical Reports Server (NTRS)
Ashley, M. D.; Rea, J.
1975-01-01
Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.
Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri
2016-01-01
Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150
Pape, G; Raiss, P; Kleinschmidt, K; Schuld, C; Mohr, G; Loew, M; Rickert, M
2010-12-01
Loosening of the glenoid component is one of the major causes of failure in total shoulder arthroplasty. Possible risk factors for loosening of cemented components include an eccentric loading, poor bone quality, inadequate cementing technique and insufficient cement penetration. The application of a modern cementing technique has become an established procedure in total hip arthroplasty. The goal of modern cementing techniques in general is to improve the cement-penetration into the cancellous bone. Modern cementing techniques include the cement vacuum-mixing technique, retrograde filling of the cement under pressurisation and the use of a pulsatile lavage system. The main purpose of this study was to analyse cement penetration into the glenoid bone by using modern cement techniques and to investigate the relationship between the bone mineral density (BMD) and the cement penetration. Furthermore we measured the temperature at the glenoid surface before and after jet-lavage of different patients during total shoulder arthroplasty. It is known that the surrounding temperature of the bone has an effect on the polymerisation of the cement. Data from this experiment provide the temperature setting for the in-vitro study. The glenoid surface temperature was measured in 10 patients with a hand-held non-contact temperature measurement device. The bone mineral density was measured by DEXA. Eight paired cadaver scapulae were allocated (n = 16). Each pair comprised two scapulae from one donor (matched-pair design). Two different glenoid components were used, one with pegs and the other with a keel. The glenoids for the in-vitro study were prepared with the bone compaction technique by the same surgeon in all cases. Pulsatile lavage was used to clean the glenoid of blood and bone fragments. Low viscosity bone cement was applied retrogradely into the glenoid by using a syringe. A constant pressure was applied with a modified force sensor impactor. Micro-computed tomography scans were applied to analyse the cement penetration into the cancellous bone. The mean temperature during the in-vivo arthroplasty of the glenoid was 29.4 °C (27.2-31 °C) before and 26.2 °C (25-27.5 °C) after jet-lavage. The overall peak BMD was 0.59 (range 0.33-0.99) g/cm (2). Mean cement penetration was 107.9 (range 67.6-142.3) mm (2) in the peg group and 128.3 (range 102.6-170.8) mm (2) in the keel group. The thickness of the cement layer varied from 0 to 2.1 mm in the pegged group and from 0 to 2.4 mm in the keeled group. A strong negative correlation between BMD and mean cement penetration was found for the peg group (r (2) = -0.834; p < 0.01) and for the keel group (r (2) = -0.727; p < 0.041). Micro-CT shows an inhomogenous dispersion of the cement into the cancellous bone. Data from the in-vivo temperature measurement indicate that the temperature at the glenohumeral surface under operation differs from the body core temperature and should be considered in further in-vitro studies with human specimens. Bone mineral density is negatively correlated to cement penetration in the glenoid. The application of a modern cementing technique in the glenoid provides sufficient cementing penetration although there is an inhomogenous dispersion of the cement. The findings of this study should be considered in further discussions about cementing technique and cement penetration into the cancellous bone of the glenoid. © Georg Thieme Verlag KG Stuttgart · New York.
Müller-Gerbl, M
1998-01-01
Pauwels (1965) and subsequent workers in the same field have shown that the distribution of the subchondral density within a joint surface can serve as a parametric measurement which reflects the main stress acting on a joint. Our own investigations on anatomical specimens have demonstrated that this subchondral mineralization does indeed show regular distribution patterns from which conclusions about the mechanical situation within an individual joint may be drawn. Since radiographical densitometry and histological methods are only available for determining the adaptive reaction of the bone to the particular mechanical situation in a joint after death, the information obtained applies only to an end situation and tells us nothing about the development of the changes with time. Furthermore, investigations carried out on human specimens by radiographical densitometry mostly apply to samples of a particular age, since such specimens can be acquired only from departments of pathology, forensic medicine or anatomy. The functional reactions of the bone tissue to repeated long-term changes in the loading--lengthy immobilization and subsequent remobilization, for instance, or heavy loading over a considerable period of time--cannot be followed by any ordinary method in experimental animals, since the death of the animal is a prerequisite for the precise quantitative examination of the bone tissue. This applies also to attempts to follow the process by means of animal experiments. CT OAM has been developed as a method which, based on CT, can provide a surface representation of the 3-D density distribution in the joints of living subjects. Comparative studies were carried out to establish and confirm the validity of the procedure. These have shown (1) that the results obtained from anatomical specimens are identical with those obtained in the living; (2) that secondary CT sections are suitable for evaluation and that the spectrum of joint surfaces examined can be extended to include the whole joint (if this were not so, effects caused by the apparatus--particularly the partial-volume effect--would render the procedure impossible); and finally (3) that the distribution of the Hounsfield density within the subchondral bone represents the distribution of the mineralization. The mineralization patterns found by us in different joints of normal subjects have shown that these patterns can be brought into line with current models of joint mechanics. The radiocarpal joint, for instance, has revealed the various types of loading occurring within physiological limits. Information has also been obtained about the age-related changes taking place in the hip, wrist and ankle joints. The increase of the total mineralization in gymnasts can be related to the qualitative and quantitative adaptation to an increased peak loading, and reduced mineralization to a lengthy reduction in use during, for instance, postoperative immobilization. In groups of patients with various diseases of mechanical origin (shoulder instability, malalignment of the main axis, defective repositioning of healed fractures, rupture of the rotator cuff, meniscectomy or rupture of the anterior cruciate ligament), a pattern of mineralization is found which is different from the normal picture. These findings reflect the abnormal mechanical situation. The mineralization pattern of the femoropatellar joint has revealed the differing etiologies of medial and lateral cartilage damage and the examination of patients with lunatomalacia has made it possible to recognize a genetic disposition. The postoperative comparison of the mineralization patterns of patients with genu varum who have undergone a correction osteotomy and the results of animal experiments on various procedures for reconstructing the anterior cruciate ligament or a primary replacement of the meniscus, have produced results which make it possible to judge the success or failure of the operation. (ABSTRACT TRUNCATED)
WISE 2005: LBNP Exercise and Flywheel Resistive Exercise as an Effective Countermeasure Combination
NASA Technical Reports Server (NTRS)
Meuche, S.; Schneider, S. M.; Lee, S. M. C.; Macias, B. R.; Smith, S. M.; Watenpaugh, D. E.; Hargens, A. R.
2006-01-01
Long-term exposure to microgravity can cause a severe musculoskeletal loss and cardiovascular deconditioning in astronauts. In this report, the effectiveness of combined supine treadmill exercise in a lower body negative pressure chamber (LBNPex) and flywheel resistive exercise (Rex) countermeasures was determined to prevent bone loss, reduced aerobic upright exercise capacity and reduced muscle strength. We hypothesized that exercise subjects (EX) would show less decrease in bone mineral density (BMD), peak oxygen consumption (VO2pk) and knee extensor strength (KES) than control subjects (CON). Sixteen healthy female subjects (34 plus or minus 4yrs, 164 plus or minus 6.5cm, 58 plus or minus 5kg; mean plus or minus SD) participated in a 60-d 6 degree head-down tilt bed rest (BR) study after providing written informed consent. Subjects were assigned to one of two groups: a non- exercising CON group or an EX group performing LBNPex 2-4 d/wk and Rex every 3rd-d. VO2pk was measured with a maximal, graded, upright treadmill test performed pre-BR and on 3-d after BR. BMD was assessed pre-BR and 3-d after BR by dual energy x-ray absorptiometry total body DEXA scan (DEXA; HOLOGIC QDR 4500 Elite ). A Cybex dynamometer was employed to measure the isokinetic KES before and 5-d after BR. Two-way repeated measures ANOVA were performed with time as the repeated factor. Statistical significance was set at p less than 0.05. CON experienced a significant decrease in BMD in the trochanter (PRE: 0.670 0.045; POST: 0.646 0.352 g(raised dot) per square centimeter) and in the whole hip (PRE: 0.894 0.059; POST: 0.858 0.057 g(raised dot) per square centimeter). BMD also decreased significantly in EX in the trochanter (PRE: 0.753 plus or minus 0.0617; POST: 0.741 plus or minus 0.061 g(raised dot) per square centimeter) and whole hip (PRE: 0.954 plus or minus 0.067; POST: 0.935 plus or minus 0.069 g(raised dot) per square centimeter). BMD losses were significantly less in EX than in CON subjects. VO2pk was significantly decreased in the CON after BR (PRE: 38.0 plus or minus 4.8; POST: 29.9 plus or minus 4.2 ml(raised dot) per kilogram per minute), but not in the EX (PRE: 39.0 plus or minus 2.0; POST: 37.8 plus or minus 1.9 ml(raised dot) per kilogram per minute). KES was significantly reduced by 30% in CON (PRE: 113 plus or minus 12; POST: 78 plus or minus 8 N-m), but was not different in EX (PRE: 126 plus or minus 25; POST: 115 plus or minus 25 N-m). The combination LBNPex and Rex during 60-d BR protects against cardiovascular and musculoskeletal deconditioning and may be an efficacious countermeasure for prolonged space flight.
Kaya, Cafer; Tam, Abbas Ali; Dirikoç, Ahmet; Kılıçyazgan, Aylin; Kılıç, Mehmet; Türkölmez, Şeyda; Ersoy, Reyhan; Çakır, Bekir
2016-10-01
Primary hyperparathyroidism (PHP) is a common endocrine disease, and its most effective treatment is surgery. Postoperative hypocalcemia is a morbidity of parathyroid surgeries, and it may extend hospitalization durations. The purpose of this study is to determine the predictive factors related to the development of hypocalcemia and hungry bone syndrome (HBS) in patients who underwent parathyroidectomy for PHP. Laboratory data comprising parathyroid hormone (PTH), calcium, phosphate, 25-OHD, albumin, magnesium, alkaline phosphatase (ALP), blood urea nitrogen (BUN), and thyroid stimulating hormone (TSH) of the patients were recorded preoperatively, on the 1st and 4th days postoperatively, and in the 6th postoperative month, and their neck ultrasound (US) and bone densitometry data were also recorded. Hypocalcemia was seen in 63 patients (38.4%) on the 1st day after parathyroidectomy. Ten patients (6.1%) had permanent hypocalcemia in the 6th month after surgery. Out of the patients who underwent parathyroidectomy for PHP, 22 (13.4%) had HBS. The incidence of postoperative hypocalcemia was higher in patients who underwent parathyroidectomy for PHP, who had parathyroid hyperplasia, and who had osteoporosis. Preoperative PTH, ALP, and BUN values were higher in those patients who developed HBS. Furthermore, HBS was more common in patients who had osteoporosis, who had parathyroid hyperplasia, and who underwent thyroidectomy simultaneously with parathyroidectomy. As a result, patients who have the risk factors for development of hypocalcemia and HBS should be monitored more attentively during the perioperative period.
Park, Jin-Sung; Lee, Jaewon; Park, Ye-Soo
2016-01-01
The study aimed to investigate the effectiveness of the clinical use of the Fracture Risk Assessment Tool (FRAX(®)) developed by the World Health Organization identifying patients at risk of osteoporotic fracture and to evaluate changes in osteoporotic fracture risk prediction according to bone mineral density (BMD) values. We identified the occurrence of osteoporotic fracture among patients whose BMD was measured in our hospital between April 2003 and March 2013. We then analyzed FRAX(®) scores obtained with or without BMD on the day before the occurrence of an osteoporotic fracture in actual osteoporotic fracture patients. According to the National Osteoporosis Foundation high-risk criteria, we identified the percentage of high-risk patients before the actual fracture. Among 445 osteoporotic fracture patients, when FRAX(®)-BMD was used, 281 patients (63%) were identified as high-risk before an actual osteoporotic fracture, and when FRAX(®) without BMD was used, 258 patients (58%) were identified (p = 0.115). In the 84 osteopenia patients, 39 patients (46.4%) were identified as high-risk when FRAX(®) without BMD was used, and 19 patients (22.6%) were identified when FRAX(®)-BMD was used (p = 0.001). The use of BMD in FRAX(®) does not seem to increase the clinical effectiveness of predicting osteoporotic fracture in osteopenia patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Factors in daily physical activity related to calcaneal mineral density in men.
Hutchinson, T M; Whalen, R T; Cleek, T M; Vogel, J M; Arnaud, S B
1995-05-01
To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g.cm-2) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry (SXA, Osteon, Inc., Wahiawa, HI). Subjects walked a mean (+/- SD) of 7902 (+/- 2534) steps per day or approximately 3.9 (+/- 1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143 (2-772) (median and range) min.wk-1 exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRFz) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRFz less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g.cm-2 vs 0.597 +/- 0.062 g.cm-2, P < 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P < 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.
Factors in Daily Physical Activity Related to Calcaneal Mineral Density in Men
NASA Technical Reports Server (NTRS)
Hutchinson, Teresa M.; Whalen, Robert T.; Cleek, Tammy M.; Vogel, John M.; Arnaud, Sara B.
1995-01-01
To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g/sq cm) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry. Subjects walked a mean (+/- SD) of 7902(+/-2534) steps per day or approximately 3.9(+/-1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143(2-772) (median and range) min/wk exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRF(sub z)) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRF(sub z) less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g/sq cm vs 0.597 +/- 0.062 g/sq cm, P less than 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P less than 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.
Cortical Porosity Identifies Women with Osteopenia at Increased Risk for Forearm Fractures
Bala, Yohann; Zebaze, Roger; Ghasem-Zadeh, Ali; Atkinson, Elizabeth J.; Iuliano, Sandra; Peterson, James M.; Amin, Shreyasee; Bjørnerem, Åshild; Melton, L. Joseph; Johansson, Helena; Kanis, John A.; Khosla, Sundeep; Seeman, Ego
2014-01-01
Background Most fragility fractures arise among the many women with osteopenia, not the smaller number with osteoporosis at high risk for fracture. Thus, most women at risk for fracture assessed only by measuring areal bone mineral density (aBMD) will remain untreated. Methods We measured cortical porosity and trabecular bone volume/total volume (BV/TV) of the ultradistal radius (UDR) using high-resolution peripheral quantitative computed tomography, aBMD using densitometry, and 10-year fracture probability using the country-specific FRAX tool in 68 postmenopausal women with forearm fractures and 70 age-matched community controls in Olmsted County, Minnesota. Results Women with forearm fractures had 0.4 standard deviations (SD) higher cortical porosity and 0.6 SD lower trabecular BV/TV. Compact-appearing cortical porosity predicted fracture independent of aBMD; odds ratio [OR] 1.92 (95%CI, 1.10–3.33). In women with osteoporosis at the UDR, cortical porosity did not distinguish those with, from those without, fractures because high porosity was present in 92% and 86% of each group respectively. By contrast, in women with osteopenia at the UDR, high porosity of the compact-appearing cortex conferred an OR for fracture of 4.00 (95%CI, 1.15–13.90). Conclusion In women with osteoporosis, porosity is captured by aBMD and so measuring UDR cortical porosity does not improve diagnostic sensitivity. However, in women with osteopenia, cortical porosity was associated with forearm fractures. PMID:24519558
Phenotype of sarcopenic obesity in older individuals with a history of falling.
Huo, Ya Ruth; Suriyaarachchi, Pushpa; Gomez, Fernando; Curcio, Carmen L; Boersma, Derek; Gunawardene, Piumali; Demontiero, Oddom; Duque, Gustavo
2016-01-01
Although sarcopenic obesity is associated with disability in middle-aged community-dwelling individuals, the phenotype of sarcopenic obesity in people 65 and older, especially those with a history of falls, remain unknown. To fill this knowledge gap, the goal of this study was to obtain a comprehensive phenotype of sarcopenic obesity in this high-risk population. Cross-sectional study of 680 subjects (mean age=79±9, 65% female) assessed between 2009 and 2013 at the Falls and Fractures Clinic, Nepean Hospital (Penrith, Australia). The assessment included a comprehensive examination, posturography, gait velocity, grip strength, bone densitometry and body composition by DXA, and blood tests for biochemical status. Patients were divided into four groups based on DXA and clinical criteria: 1) sarcopenic obese; 2) non-sarcopenic obese; 3) sarcopenic and; 4) non-sarcopenic/non-obese. The difference between groups was assessed by one-way ANOVA, chi-square analysis, and multivariable linear regression. Sarcopenic obese subjects were older (81.1±7.3), mostly female and more likely to have lower bone mineral density, lower grip strength, slower gait velocity, and poor balance. Sarcopenic obese individuals also showed significantly higher parathyroid hormone and lower vitamin D. We identified a particular set of clinical and biochemical characteristics in our subgroup of sarcopenic obese older fallers. Identification of these particular characteristics in the clinical setting is essential in order to prevent poor outcomes in this high-risk population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Pinheiro, M M; Reis Neto, E T; Machado, F S; Omura, F; Szejnfeld, J; Szejnfeld, V L
2012-04-01
The performance of the São Paulo Osteoporosis Risk Index (SAPORI) was tested in 1,915 women from the original cohort, São Paulo Osteoporosis Study (SAPOS) (N = 4332). This new tool was able to identify women with low bone density (spine and hip) and low-impact fracture, with an area under the receiving operator curve (ROC) of 0.831, 0.724, and 0.689, respectively. A number of studies have demonstrated the clinical relevance of risk factors for identifying individuals at risk of fracture (Fx) and osteoporosis (OP). The SAPOS is an epidemiological study for the assessment of risk factors for Fx and low bone density in women from the community of the metropolitan area of São Paulo, Brazil. The aim of the present study was to develop and validate a tool for identifying women at higher risk for OP and low-impact Fx. A total of 4,332 pre-, peri-, and postmenopausal women were analyzed through a questionnaire addressing risk factors for OP and Fx. All of them performed bone densitometry at the lumbar spine and proximal femur (DPX NT, GE-Lunar). Following the identification of the main risk factors for OP and Fx through multivariate and logistic regression, respectively, the SAPORI was designed and subsequently validated on a second cohort of 1,915 women from the metropolitan community of São Paulo. The performance of this tool was assessed through ROC analysis. The main and significant risk factors associated with low bone density and low-impact Fx were low body weight, advanced age, Caucasian ethnicity, family history of hip Fx, current smoking, and chronic use of glucocorticosteroids. Hormonal replacement therapy and regular physical activity in the previous year played a protective role (p < 0.05). After the statistical adjustments, the SAPORI was able to identify women with low bone density (T-score ≤ -2 standard deviations) in the femur, with 91.4% sensitivity, 52% specificity, and an area under the ROC of 0.831 (p < 0.001). At the lumbar spine, the performance was similar (81.5% sensitivity, 50% specificity, and area under ROC of 0.724; p < 0.001). Regarding the identification of low-impact Fx, the sensitivity was 71%, the specificity was 52%, and the area under the ROC was 0.689 (p < 0.001). The SAPORI is a simple, useful, fast, practice, and valid tool for identifying women at higher risk for low bone density and osteoporotic fractures.
[Sufficiency with water-soluble vitamins and state of bone in pregnant women].
Vrzhesinskaya, O A; Pereverzeva, O G; Gmoshinskaya, M V; Kodentsova, V M; Safronova, A I; Korosteleva, M M; Aleshina, I V; Fandeeva, T A
2015-01-01
Vitamin status and bone strength have been estimated in 91 pregnant women (29.3 ± 4.6 years old) from Moscow by non-invasive methods. Sufficiency with vitamins C, B2, B6 has been evaluated by morning urinary excretion of ascorbic acid, riboflavin and 4-piridoxic acid determined by visual titration and fluorimetric methods. The rate of bone resorption has been measured by the ratio of urinary calcium and creatinine, determined by complexometric titration and spectrophotometrically. The study of the bone strength has been conducted using an ultrasonic densitometer (the speed of the ultrasonic waves along the cortical layer). The lack of vitamin C was found in 20.4% .of the women surveyed, vitamin B2--in 27.4%. Vitamin B6 deficiency was detected most frequently (90%). Excretion of vitamins B2 and B6 in women in the third trimester of pregnancy was lower as compared with the women in the first and second trimester. In 53.3% of the women surveyed an increase in urinary excretion of calcium per creatinine has been observed. Excretion of group B vitamins (especially vitamin B6, 1.75 fold, p < 0.05) in women taking vitamin supplements was higher compared to non-taking vitamins that indicates the better sufficiency of the organism with these vitamins. Among women who took vitamin complexes, inadequate supply with water-soluble vitamins C, B2 and B6 was detected less frequently (the difference was significant for vitamin B2) than among women who did not intake vitamin complexes (in 11.9, 27.7 and 42.4% vs 16.1, 54.8 and 48.8 %). The rate of bone resorption (Ca/creatinine) in women taking vitamins was smaller (0.19 ± 0.09 vs 0.24 ± 0.14, p > 0.05). Ca/creatinine ratio was within normal range in 40% of women who intake vitamins, while in women not taking vitamins--only in 22.2%; this value exceeded the upper limit of norm in the rest. The strength of bone was broken in women in the second and third trimester of pregnancy, having worse supply of vitamins. The percentage of agreement of the results of osteopenia diagnosis assessment (ultrasound densitometry and urinary Ca/creatinine) was 42.2%. Thus, the conclusion has been confirmed that the evaluation of the status of bone is possible only basing on the results of determination of several parameters.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Han Yen; Ng, Tuck Wah; Liew, Oi Wah
2010-03-20
Flatbed scanner densitometers can be operated under various illumination and recording exposure levels. In this work, we show that optical density measurement accuracy, sensitivity, and stability of stained polyacrylamide electrophoresis gel densitometry are crucially dependent on these two factors (brightness and exposure level), notwithstanding that the source is monochromatic, spatially uniform, and the measurements are made using an accurately calibrated step wedge in tandem. We further outline a method to accommodate the intensity deviations over a range of illumination and exposure levels in order to maintain sensitivity and repeatability in the computed optical densities. Comparisons were also made with resultsmore » from a commercial densitometer.« less
Cohen, Sophie; Innes, Steve; Geelen, Sibyl P. M.; Wells, Jonathan C. K.; Smit, Colette; Wolfs, Tom F. W.; van Eck-Smit, Berthe L. F.; Kuijpers, Taco W.; Reiss, Peter; Scherpbier, Henriette J.
2015-01-01
Objective Longitudinal studies objectively evaluating changes in regional fat distribution of HIV-infected children assessed by whole body dual energy X-ray absorptiometry (DEXA) are scarce, whilst this long-term effect of HIV and antiretroviral therapy (cART) is an important issue in infected children in need for lifelong treatment. Methods We assessed regional fat distribution over time, measured with sequential DEXA-scans in HIV-infected children on cART in cohorts from South Africa (SA) and the Netherlands (NL), and in healthy controls (SA). Limb and trunk fat Z-scores were calculated with the lambda-mu-sigma (LMS) method. Multivariable linear regression models with mixed effects were used to investigate the effect of cART compounds on body fat distribution over time. Results In total, 218 children underwent 445 DEXA assessments with a median follow-up of 3.5 years. Fat mass in all limbs was decreased in HIV-infected children compared to controls (arm fat Z-score: coefficient -0.4813; P = 0.006, leg fat Z-score: coefficient -0.4345; P = 0.013). In the HIV-infected group, stavudine treatment was associated with lower subcutaneous fat mass (arm fat Z-score: coefficient -0.5838; P = 0.001), with an additional cumulative exposure effect (arm fat Z-score: coefficient -0.0867; P = 0.003). Conclusions Our study shows that subcutaneous fat loss is still prevalent in HIV-infected children on cART, and is strongly associated with cumulative stavudine exposure. These results underline the need for early detection of subcutaneous fat loss and alternative treatment options for HIV-infected children globally. PMID:26148119
Cohen, Sophie; Innes, Steve; Geelen, Sibyl P M; Wells, Jonathan C K; Smit, Colette; Wolfs, Tom F W; van Eck-Smit, Berthe L F; Kuijpers, Taco W; Reiss, Peter; Scherpbier, Henriette J; Pajkrt, Dasja; Bunders, Madeleine J
2015-01-01
Longitudinal studies objectively evaluating changes in regional fat distribution of HIV-infected children assessed by whole body dual energy X-ray absorptiometry (DEXA) are scarce, whilst this long-term effect of HIV and antiretroviral therapy (cART) is an important issue in infected children in need for lifelong treatment. We assessed regional fat distribution over time, measured with sequential DEXA-scans in HIV-infected children on cART in cohorts from South Africa (SA) and the Netherlands (NL), and in healthy controls (SA). Limb and trunk fat Z-scores were calculated with the lambda-mu-sigma (LMS) method. Multivariable linear regression models with mixed effects were used to investigate the effect of cART compounds on body fat distribution over time. In total, 218 children underwent 445 DEXA assessments with a median follow-up of 3.5 years. Fat mass in all limbs was decreased in HIV-infected children compared to controls (arm fat Z-score: coefficient -0.4813; P = 0.006, leg fat Z-score: coefficient -0.4345; P = 0.013). In the HIV-infected group, stavudine treatment was associated with lower subcutaneous fat mass (arm fat Z-score: coefficient -0.5838; P = 0.001), with an additional cumulative exposure effect (arm fat Z-score: coefficient -0.0867; P = 0.003). Our study shows that subcutaneous fat loss is still prevalent in HIV-infected children on cART, and is strongly associated with cumulative stavudine exposure. These results underline the need for early detection of subcutaneous fat loss and alternative treatment options for HIV-infected children globally.
Lera, Lydia; Albala, Cecilia; Ángel, Bárbara; Sánchez, Hugo; Picrin, Yaisy; Hormazabal, María José; Quiero, Andrea
2014-03-01
To develop a predictive model of appendicular skeletal muscle mass (ASM) based on anthropometric measurements in elderly from Santiago, Chile. 616 community dwelling, non-disabled subjects ≥ 60 years (mean 69.9 ± 5.2 years) living in Santiago, 64.6% female, participating in ALEXANDROS study. Anthropometric measurements, handgrip strength, mobility tests and DEXA were performed. Step by step linear regression models were used to associate ASM from DEXA with anthropometric variables, age and sex. The sample was divided at random into two to obtain prediction equations for both subsamples, which were mutually validated by double cross-validation. The high correlation between the values of observed and predicted MMAE in both sub-samples and the low degree of shrinkage allowed developing the final prediction equation with the total sample. The cross-validity coefficient between prediction models from the subsamples (0.941 and 0.9409) and the shrinkage (0.004 and 0.006) were similar in both equations. The final prediction model obtained from the total sample was: ASM (kg) = 0.107(weight in kg) + 0.251( knee height in cm) + 0.197 (Calf Circumference in cm) +0.047 (dynamometry in kg) - 0.034 (Hip Circumference in cm) + 3.417 (Man) - 0.020 (age years) - 7.646 (R2 = 0.89). The mean ASM obtained by the prediction equation and the DEXA measurement were similar (16.8 ± 4.0 vs 16.9 ± 3.7) and highly concordant according Bland and Altman (95% CI: -2.6 -2.7) and Lin (concordance correlation coefficient = 0.94) methods. We obtained a low cost anthropometric equation to determine the appendicular skeletal muscle mass useful for the screening of sarcopenia in older adults. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Regulation of body temperature and nociception induced by non-noxious stress in rat.
Vidal, C; Suaudeau, C; Jacob, J
1984-04-09
The effects of 3 different non-noxious stressors on body temperature (Tb) were investigated in the rat: (1) loose restraint in cylinders, (2) removal of the rats from cylinders, exposure to a novel environment and replacement in cylinders, a stressor called here 'novelty', and (3) gentle holding of the rats by the nape of the neck. Loose restraint and 'novelty' produced hyperthermia. On the contrary, holding induced hypothermia. Hypophysectomy (HX) reduced basal Tb, abolished restraint hyperthermia and reduced both 'novelty' hyperthermia and holding hypothermia. Dexamethasone ( DEXA ) had no effect upon either restraint or novelty hyperthermia but reduced the hypothermia. Naloxone (Nx) produced a slight fall in basal Tb accounting for its reduction of restraint and 'novelty' hyperthermias ; it did not affect holding hypothermia. The inhibitory effects of HX suggest a participation of the pituitary in the hyperthermias ; the neurointermediate lobe would be involved as the hyperthermias were not affected by DEXA , which is known to block the stress-induced release of pituitary secretions from the anterior lobe but not from the neurointermediate lobe. In contrast, substances from the anterior lobe might participate in hypothermia due to holding since it is reduced by HX and DEXA . As to the effects of Nx, endogenous opioids would not be significantly involved in the thermic effects of the stressors used in this study; they might play, if any, only a minor role in the regulation of basal Tb. These results are compared with those previously obtained on nociception using the same non-noxious stressors. It emerges that, depending on the stressor, different types of association between thermoregulation and nociception may occur, i.e. hyperthermia with analgesia, hyperthermia with hyperalgesia and hypothermia with hyperalgesia.
A novel body circumferences-based estimation of percentage body fat.
Lahav, Yair; Epstein, Yoram; Kedem, Ron; Schermann, Haggai
2018-03-01
Anthropometric measures of body composition are often used for rapid and cost-effective estimation of percentage body fat (%BF) in field research, serial measurements and screening. Our aim was to develop a validated estimate of %BF for the general population, based on simple body circumferences measures. The study cohort consisted of two consecutive samples of health club members, designated as 'development' (n 476, 61 % men, 39 % women) and 'validation' (n 224, 50 % men, 50 % women) groups. All subjects underwent anthropometric measurements as part of their registration to a health club. Dual-energy X-ray absorptiometry (DEXA) scan was used as the 'gold standard' estimate of %BF. Linear regressions where used to construct the predictive equation (%BFcal). Bland-Altman statistics, Lin concordance coefficients and percentage of subjects falling within 5 % of %BF estimate by DEXA were used to evaluate accuracy and precision of the equation. The variance inflation factor was used to check multicollinearity. Two distinct equations were developed for men and women: %BFcal (men)=10·1-0·239H+0·8A-0·5N; %BFcal (women)=19·2-0·239H+0·8A-0·5N (H, height; A, abdomen; N, neck, all in cm). Bland-Altman differences were randomly distributed and showed no fixed bias. Lin concordance coefficients of %BFcal were 0·89 in men and 0·86 in women. About 79·5 % of %BF predictions in both sexes were within ±5 % of the DEXA value. The Durnin-Womersley skinfolds equation was less accurate in our study group for prediction of %BF than %BFcal. We conclude that %BFcal offers the advantage of obtaining a reliable estimate of %BF from simple measurements that require no sophisticated tools and only a minimal prior training and experience.
Aerenhouts, Dirk
2015-01-01
A recommended field method to assess body composition in adolescent sprint athletes is currently lacking. Existing methods developed for non-athletic adolescents were not longitudinally validated and do not take maturation status into account. This longitudinal study compared two field methods, i.e., a Bio Impedance Analysis (BIA) and a skinfold based equation, with underwater densitometry to track body fat percentage relative to years from age at peak height velocity in adolescent sprint athletes. In this study, adolescent sprint athletes (34 girls, 35 boys) were measured every 6 months during 3 years (age at start = 14.8 ± 1.5yrs in girls and 14.7 ± 1.9yrs in boys). Body fat percentage was estimated in 3 different ways: 1) using BIA with the TANITA TBF 410; 2) using a skinfold based equation; 3) using underwater densitometry which was considered as the reference method. Height for age since birth was used to estimate age at peak height velocity. Cross-sectional analyses were performed using repeated measures ANOVA and Pearson correlations between measurement methods at each occasion. Data were analyzed longitudinally using a multilevel cross-classified model with the PROC Mixed procedure. In boys, compared to underwater densitometry, the skinfold based formula revealed comparable values for body fatness during the study period whereas BIA showed a different pattern leading to an overestimation of body fatness starting from 4 years after age at peak height velocity. In girls, both the skinfold based formula and BIA overestimated body fatness across the whole range of years from peak height velocity. The skinfold based method appears to give an acceptable estimation of body composition during growth as compared to underwater densitometry in male adolescent sprinters. In girls, caution is warranted when interpreting estimations of body fatness by both BIA and a skinfold based formula since both methods tend to give an overestimation. PMID:26317426
Pekel, Gökhan; Cetin, Ebru Nevin; Acer, Semra; Yagci, Ramazan; Altintas, Seher; Ongun, Gülin Tugba
2014-06-01
To evaluate the effects of chronic tobacco smoking on lens nucleus by Pentacam HR lens densitometry (LD) in young adults. Prospective cross-sectional case series. Thirty subjects (23 M, 7 F) who were chronic cigarette smokers (≥10 cigarettes/day for at least 2 years) (group 1) and another 30 subjects (23 M, 7 F) who did not smoke (group 2), were included in this study. The patients were matched for age and sex between the groups. The exclusion criteria were any history of ocular surgery, any systemic disorders and any ocular diseases except for mild refractive disorders. Lens densitometry measurements were done with the Pentacam HR (Oculus, Wetzlar, Germany). The Schirmer test and pachymetry measurements were also performed. Mean age of the patients for both groups was 28.90 ± 8.20 years (range: 18-40 years). Mean lens densitometry (LD) measurements of Group 1 (chronic cigarette smoking group) were higher than those of Group 2 (control group) in all LD techniques; however only mean "peak" LD measurements showed a statistically significant difference between these two groups (Group 1: 8.67 ± 0.61, Group 2: 8.44 ± 0.70, p = 0.04). The mean Schirmer test value was 12.43 ± 5.60 mm in Group 1 and 13.00 ± 4.26 mm in Group 2 (p = 0.55). The mean central corneal thickness (CCT) value was 564.23 ± 34.61 µm in Group 1 and 550.47 ± 32.94 µm in Group 2 (p = 0.03). The Pentacam HR LD seems to be an important option for the evaluation of lens nucleus in young adults, because it gives objective and quantitative data. Although chronic smoking increases lens nucleus density in young adults, the effect is not statistically significant when compared with the control group.
Abraham, Bincy P; Prasad, Preethi; Malaty, Hoda M
2014-08-01
As several factors can contribute to low bone mineral density (BMD), we investigated the role of vitamin D in low BMD while controlling for other risk factors in inflammatory bowel diseases (IBD) patients. We conducted a prospective cross-sectional study between 2008 and 2012 in adult IBD patients. Demographic data including age, gender, ethnicity, BMI, along with disease type and location, vitamin D levels, prior corticosteroid use, and anti-TNF use were recorded and evaluated with DEXA results. A total of 166 patients [105 Crohn's disease (CD), 61 ulcerative colitis (UC)] qualified for the study. Low BMD was found in 40%, twice as frequently in CD than in UC (p = 0.048). Higher prevalence of low BMD was associated with those of male gender (p = 0.05), Asian ethnicity (p = 0.02), and history of corticosteroid use (p = 0.001). Age, body mass index, or disease location did not increase the risk of low BMD. The overall prevalence of low vitamin D was 60%, with insufficiency (25-hydroxy levels between 20 and 30 ng/mL) found in 37% and deficiency (levels <20 ng/mL) found in 23% of the patients. Vitamin D insufficient and deficient patients were two times (p = 0.049) and almost 3 times (p = 0.02) as likely to have low BMD, respectively. Low vitamin D, male gender, Asian ethnicity, CD, and corticosteroid use significantly increased the risk of having low BMD, while age and disease location did not affect BMD in our IBD population. It remains important to evaluate for vitamin D nutritional deficiency and limit corticosteroid use to help prevent low BMD in IBD patients.
[Postmenopausal osteoporosis].
László, Adám
2004-01-04
Due to its incidence and clinical consequences osteoporosis followed by vertebral, hip, and forearm fractures represents an outstanding problem of nowadays' health care. Because of its high mortality rate hip fractures are of special interest. The number of fractures caused by postmenopausal osteoporosis increases with age. Costs of examinations and treatment of women with postmenopausal osteoporosis and fractures are also increasing and represent a significant amount all over the world. Organization of Osteoporosis Centres in Hungary was founded in 1995 and has been since functioning, however, only the one-sixth of osteoporotic patients are treated. Several risk factors are known in the pathogenesis of osteoporosis, first of all the lack of sufficient calcium and vitamin D intake, age, genetic factors, and circumstances known to predispose falling. Estrogen deficiency is the most likely cause of postmenopausal osteoporosis. Osteodensitometry by DEXA is the most important method to evaluate osteoporosis, since decrease in bone mineral density strongly correlates with fracture incidence. Physical, radiologic, and laboratory examination are also required at the first visit and during follow-up. The quantity of bone can hardly be influenced after the 35th year of age, thus prevention of osteoporosis has special significance: appropriate calcium and vitamin D supplementation, weight-bearing sports and physical activity can prevent fractures. According to the results from studies fulfilling the criteria of evidence-based medicine, first choice treatment of osteoporosis involves hormone replacement therapy, bisphosphonates, the tissue specific tibolone, raloxifen and calcitonin. Calcium and vitamin D supplementation are always necessary to be added to any antiporotic treatment. Other combinations of different antiporotic drugs are useless and make the treatment more expensive. Other treatments like massage, physiotherapy, hip-protecting pants, etc. as well as rehabilitation have special clinical significance.
Sakurai-Iesato, Yoriko; Kawata, Naoko; Tada, Yuji; Iesato, Ken; Matsuura, Yukiko; Yahaba, Misuzu; Suzuki, Toshio; Ikari, Jun; Yanagawa, Noriyuki; Kasahara, Yasunori; West, James; Tatsumi, Koichiro
2017-01-01
Objective Osteoporosis, which is now recognized as a major comorbidity of chronic obstructive pulmonary disease (COPD), must be diagnosed by appropriate methods. The aims of this study were to clarify the relationships between bone mineral density (BMD) and COPD-related clinical variables and to explore the association of BMD with the updated Global Initiative for Chronic Obstructive Lung Disease (GOLD) classification in men. Methods We enrolled 50 Japanese men with clinically stable COPD who underwent dual-energy X-ray absorptiometry (DEXA), pulmonary function testing, and computerized tomography (CT) and who had completed a questionnaire (COPD assessment test [CAT]). We determined the association between the T-score and other tested parameters and compared the BMD of patients in each GOLD category. Results Twenty-three of the 50 patients (46.0%) were diagnosed with osteopenia, and 7 (14.0%) were diagnosed with osteoporosis. The BMD findings were significantly correlated with the CAT score, forced expiratory volume in 1 second percentage predicted (FEV 1 % predicted), low attenuation volume percentage (LAV%), and percentage of cross-sectional area of small pulmonary vessels (%CSA) on CT images. Notably, the median T-score of the GOLD category D participants was significantly lower than that of the participants in each of the other categories (A [-0.98], B [-1.06], C [-1.05], and D [-2.19], p<0.05). Conclusion Reduced BMD was associated with airflow limitation, extent of radiographic findings, and a poor quality of life (QOL) in patients with COPD. The BMD of GOLD category D patients was the lowest of all of the patients evaluated, and category D patients may benefit from active intervention for osteoporosis.
Sakurai-Iesato, Yoriko; Kawata, Naoko; Tada, Yuji; Iesato, Ken; Matsuura, Yukiko; Yahaba, Misuzu; Suzuki, Toshio; Ikari, Jun; Yanagawa, Noriyuki; Kasahara, Yasunori; West, James; Tatsumi, Koichiro
2017-01-01
Objective Osteoporosis, which is now recognized as a major comorbidity of chronic obstructive pulmonary disease (COPD), must be diagnosed by appropriate methods. The aims of this study were to clarify the relationships between bone mineral density (BMD) and COPD-related clinical variables and to explore the association of BMD with the updated Global Initiative for Chronic Obstructive Lung Disease (GOLD) classification in men. Methods We enrolled 50 Japanese men with clinically stable COPD who underwent dual-energy X-ray absorptiometry (DEXA), pulmonary function testing, and computerized tomography (CT) and who had completed a questionnaire (COPD assessment test [CAT]). We determined the association between the T-score and other tested parameters and compared the BMD of patients in each GOLD category. Results Twenty-three of the 50 patients (46.0%) were diagnosed with osteopenia, and 7 (14.0%) were diagnosed with osteoporosis. The BMD findings were significantly correlated with the CAT score, forced expiratory volume in 1 second percentage predicted (FEV1% predicted), low attenuation volume percentage (LAV%), and percentage of cross-sectional area of small pulmonary vessels (%CSA) on CT images. Notably, the median T-score of the GOLD category D participants was significantly lower than that of the participants in each of the other categories (A [-0.98], B [-1.06], C [-1.05], and D [-2.19], p<0.05). Conclusion Reduced BMD was associated with airflow limitation, extent of radiographic findings, and a poor quality of life (QOL) in patients with COPD. The BMD of GOLD category D patients was the lowest of all of the patients evaluated, and category D patients may benefit from active intervention for osteoporosis. PMID:28717072
25OH vitamin D levels in pediatric patients affected by Prader-Willi syndrome.
Fintini, D; Pedicelli, S; Bocchini, S; Bizzarri, C; Grugni, G; Cappa, M; Crinò, A
2018-06-01
Obesity, insulin resistance, and puberty seem to influence and been inversely associated with 25-hydroxy vitamin D (25OHD) levels. To our knowledge, a study on 25OHD in children and adolescents with Prader-Willi syndrome (PWS), a genetic form of obesity, is not yet available. To analyze the 25OHD values in pediatric PWS subjects in comparison with a control group (CNT), highlighting the possible correlations with IR, BMD, body composition, pubertal stage, and GH therapy (GHT). Auxological and laboratory parameters, HOMA-IR, Vitamin D status, and bone density and body composition by DEXA scan were analyzed in 52 PWS and 110 controls (CNT), gender-, age-, and BMI-SD matched. None of them was on calcium or vitamin D. 20 PWS were on growth hormone (GH) therapy and 32 were previously treated. Altogether, PWS had similar values of 25OHD compared to CNT.16 PWS (30.7%) and 27 CNT (24.5%) had low 25OHD levels (< 20 ng/ml) (p = NS). 25OHD of PWS on GHT were comparable to those previously treated. In both groups, univariate analysis showed a negative correlation between 25OHD and fat mass% (FM%). GH therapy and pubertal stage were positively correlated with bone parameters analyzed by DXA. Multivariate regression confirmed only FM% as negative predictor of 25HOD in PWS patients, as previously described. GHT does not seem to influence 25OHD in PWS. Our data showed that PWS had similar values of 25OHD compared to CNT. As already described, FM seems to be the only parameter influencing 25OHD levels. Finally, GHT does not seem to influence 25OHD metabolism in PWS.
Comparison of Some Secondary Body Composition Algorithms
ERIC Educational Resources Information Center
Sutton, Robert A.; Miller, Carolyn
2006-01-01
Body composition measurements vary greatly in degree of measurement difficulty and accuracy. Hydrostatic weighing, chemical dilution or their equivalents were the accepted "gold" standards for assessing fat mass. Dual Energy X-ray Absorptiometry (DEXA) is fast replacing these techniques as the preferred standard. However, these direct measurement…
Cheng, Xiao-Guang; Li, Kai; Ou, Shan-Xing; Tang, Guang-Yu; Wang, Qian-Qian; Wang, Chao; Wang, Ling; Tian, Wei
This study compares spinal volumetric bone mineral density (vBMD) with spinal areal bone mineral density (aBMD) among young adults from 3 eastern provincial capital cities in Mainland China. A total of 416 young adults (age range: 20-40 yr) from 3 eastern provincial capital cities (Beijing, Shanghai, and Guangzhou) in Mainland China were recruited in this study. From each subject, the vBMD of the lumbar spine was measured by the Mindways quantitative computed tomography system. Moreover, the aBMD of the lumbar spine, measured by the dual-energy X-ray absorptiometry, was extracted from a previous multicenter large-scale study, and the 420 participants were matched by age, gender, height, weight, as well as geographic territory. The vBMD and the aBMD values were further compared and analyzed. Generally, the bone mineral density (BMD) results were significantly different among participants from the 3 cities (p <0.05). Specifically, both vBMD and aBMD values of participants from Beijing were significantly different from those from Guangzhou (p <0.05). Additionally, a statistically significant difference in aBMD values was also found between participants from Beijing and Shanghai (p <0.05). However, no significant differences were found between participants from Shanghai and Guangzhou in terms of the aBMD and vBMD values (p 1 > 0.05 and p 2 > 0.05). Interestingly, the overall mean vBMD value was 5.9% greater in women than those in men for all the 3 cities (p <0.001). This study demonstrated an overall heterogeneity in spinal BMD among young adults from 3 eastern provincial capital cities in Mainland China. Specifically, the taller and heavier young adults from the northern part of China have smaller spinal vBMD but higher spinal aBMD values than those who were shorter and lighter from the southern part of China. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Mittal, Monica; Kreatsa, Maria; Narvekar, Nitish; Savvas, Michael; Hamoda, Haitham
2014-09-01
Premature ovarian insufficiency can have significant implications for the affected women. This review assesses the fertility desires, choice of hormone replacement, and the effect of time since menopause on the bone density of these women. This is a retrospective analysis of 223 consecutive new referrals. The average age (mean [± standard deviation]) of the women was 37.35 (± 5.88) years, with 24.1% (n = 19/79) presenting within 12 months of the onset of symptoms, most commonly, vasomotor type symptoms (n = 98/223; 43.9%). Of the women included, 58.7% (n = 131/223) took hormone replacement therapy (HRT), most commonly, an oral (n = 90/131; 68.7%) sequential preparation (n = 91/131; 69.5%), with a significant number of women >40 years of age preferring the transdermal route (n = 26/54; 48.1%; p<0.01). A total of 37.7% (n = 84/223) of the women expressed concerns regarding their future fertility, more notable in women ≤ 40 years (n = 72/142; 50.7%; p < 0.01). Of these, 41.7% (n = 35/84) took HRT, most commonly, a sequential regimen (n = 26/35; 74.3%) with oral estradiol (n = 30/35; 85.7%); 69.5% (n = 155/223) of the women had had a bone densitometry scan performed, with 66.5% (n = 103/155) showing normal bone mineral density (BMD), but a greater likelihood of having reduced BMD the greater the time delay in presentation. No difference was seen for the three broad categories of BMD when further analysed for the cause of premature ovarian insufficiency, but a significant difference was noted for the spinal Z-scores, whereby women who underwent a surgically induced menopause were noted to have lower BMD compared with the other causes (p < 0.01). These findings can be useful in counselling women and guiding clinicians in their management of women with premature ovarian insufficiency. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.
Zimering, Mark B; Caldarella, Felice A; White, Kenneth E; Econs, Michael J
2005-01-01
To describe a case of persistent tumor-induced osteomalacia, determine whether serum fibroblast growth factor-23 (FGF-23) levels postoperatively indicate incomplete tumor resection, and report lumbar spine and forearm bone mineral density (BMD) changes during 5 years of follow-up. We present clinical, radiologic, histologic, and bone densitometry data as well as serum FGF-23 levels (determined with use of a novel C-terminal enzyme-linked immunosorbent assay) from the study patient and discuss these findings in the context of previous literature. A 52-year-old man, who presented with muscle weakness and multiple fractures, was found to have low values for serum phosphorus, serum 1,25-dihydroxyvitamin D, and maximal tubular reabsorption of phosphate per glomerular filtration rate, a high level of serum alkaline phosphatase, and a normal serum concentration of parathyroid hormone, characteristic of tumor-induced osteomalacia. Magnetic resonance imaging to evaluate an abnormality of the left foot revealed a soft tissue mass, biopsy of which confirmed the presence of a benign, phosphaturic, mesenchymal tumor. The baseline serum FGF-23 level (2,050 RU/mL) was more than 17 times the upper limit of normal for adults (23 to 118 RU/mL) and decreased substantially within 1 day after partial resection of the tumor but remained above normal postoperatively. BMD changes indicated rapid substantial recovery of vertebral BMD but ongoing loss of forearm bone density. The serum FGF-23 level is high in a substantial proportion of patients with tumor-induced osteomalacia. The postoperative above normal levels of serum FGF-23 correlated with known persistence of tumor in our study patient. In a patient with normal renal function, such as our study patient, levels of serum FGF-23 studied with use of the C-terminal enzyme-linked immunosorbent assay reached their nadir within 24 hours postoperatively. This result suggests that this assay can provide clinicians with rapid prognostic information in patients with known or suspected residual tumor. BMD should be assessed at both appendicular and axial sites in patients with persistent tumor-induced osteomalacia.
NASA Technical Reports Server (NTRS)
Sibonga, Jean D.; Spector, Elizabeth R.; Ploutz-Snyder, R.; Evans, H. J.; King, L.; Watts, N. B.; Hans, D.; Smith, S. A.
2013-01-01
Spaceflight is a potential risk factor for secondary osteoporosis in astronauts. Although lumbar spine (LS) BMD declines rapidly, more than expected for age, there have been no fragility fractures in astronauts that can clearly be attributed to spaceflight. Recently, astronauts have been returning from 6-month spaceflights with absolute BMD still above young adult mean BMD. In spite of these BMD measurements, we project that the rapid loss in bone mass over long-duration spaceflight affects the bone microarchitecture of the LS which might predispose astronauts to premature vertebral fractures. Thus, we evaluated TBS, a novel texture index correlated with vertebral bone microarchitecture, as a means of monitoring changes to bone microarchitecture in astronauts as they age. We previously reported that TBS detects an effect of spaceflight (6-month duration), independent of BMD, in 51 astronauts (47+/-4 y) (Smith et al, J Clin Densitometry 2014). Hence, TBS was evaluated in serial DXA scans (Hologic Discovery W) conducted triennially in all active and retired astronauts and more frequently (before spaceflight, after spaceflight and until recovery) in the subset of astronauts flying 4-6- month missions. We used non-linear models to describe trends in observations (BMD or TBS) plotted as a function of astronaut age. We fitted 1175 observations of 311 astronauts, pre-flight and then postflight starting 3 years after landing or after astronaut's BMD for LS was restored to within 2% of preflight BMD. Observations were then grouped and defined as follows: 1) LD: after exposure to at least one long-duration spaceflight > 100 days and 2) SD: before LD and after exposure to at least one short-duration spaceflight < 30 days. Data from males and females were analyzed separately. Models of SD observations revealed that TBS and BMD had similar curvilinear declines with age for both male and female astronauts. However, models of LD observations showed TBS declining with age while BMD appeared stable or trending upward. For females (n=8) LD observations were too few to discern a trend. Notably, models describing trends in TBS appeared to be more sensitive to the effects of age than the models for BMD. We conclude that TBS may provide an additional index for the lumbar spine to monitor the combined changes due to spaceflight and due to aging. This increased knowledge may enhance the ability to identify an intervention trigger for premature vertebral fractures in astronauts.
Soccer increases bone mass in prepubescent boys during growth: a 3-yr longitudinal study.
Zouch, Mohamed; Zribi, Anis; Alexandre, Christian; Chaari, Hamada; Frere, Delphine; Tabka, Zouhair; Vico, Laurence
2015-01-01
The aim of this study was to examine the effect of 3-yr soccer practice on bone acquisition in prepubescent boys. We investigated 65 boys (aged 10-13 yr, Tanner stage I) at baseline, among which only 40 boys (Tanner stages II and III) have continued the 3-yr follow-up: 23 soccer players (F) completed 2-5 h of training plus 1 competition game per week and 17 controls (C). Bone mineral density (BMD, g/cm(2)) and bone mineral content (BMC, g) were measured by dual-energy X-ray absorptiometry at different sites. At baseline, BMD was higher in soccer players than in controls in the whole body and legs. In contrast, there was nonsignificant difference BMD in head, femoral neck, arms, and BMC in all measured sites between groups. At 3-yr follow-up, soccer players were found to have higher BMD and BMC at all sites than controls, except for head BMD and BMC and arms BMC in which the difference was nonsignificant between groups. During the 3-yr follow-up, the soccer players were found to gain significantly more in lumbar spine (31.2% ± 2.9% vs 23.9% ± 2.1%; p < 0.05), femoral neck (24.1% ± 1.8% vs 11.4% ± 1.9%; p < 0.001), whole body (16.5% ± 1.4% vs 11.8% ± 1.5%; p < 0.05), and nondominant arm BMD (18.2% ± 1.4% vs 13.6% ± 1.7%; p < 0.05) as well as lumbar spine (62.5% ± 20.1% vs 39.5% ± 20.1%; p < 0.001), femoral neck, (37.7% ± 14.2% vs 28.9% ± 12.8%; p < 0.05) and nondominant arm BMC (68.6% ± 22.9% vs 50.1% ± 22.4%; p < 0.05) than controls. In contrast, soccer players have less %BMD and %BMC changes in the head than controls. A nonsignificant difference was found in legs, dominant arm, head %BMD and %BMC changes, and whole-body %BMC changes between groups. In summary, we suggest that soccer has an osteogenic effect BMD and BMC in loaded sites in pubertal soccer players. The increased bone mass induced by soccer training in the stressed sites was associated to a decreased skull bone mass after 3 yr of follow-up. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Harel, Zeev; Riggs, Suzanne; Vaz, Rosalind; Flanagan, Patricia; Harel, Dalia; Machan, Jason T
2010-02-01
To date, there are no data regarding the effect of the transdermal combined estrogen and progestin contraceptive Ortho Evra on bone mineral content (BMC) and bone mineral density (BMD). We examined the effects of transdermally delivered ethinyl estradiol and norelgestromin on whole body (WB) BMC and BMD of the hip and lumbar spine (LS) of adolescent girls. In a matched case-control study, girls (n = 5) who applied Ortho Evra for days 1-21 followed by days 22-28 free of medication for 13 cycles (about 12 months) were compared with 5 age- and ethnicity-matched control girls. Evaluations of calcium intake; bone-protective physical activity; bone densitometry (DXA, QDR 4500A, Hologic); bone formation markers serum osteocalcin (OC) and bone-specific alkaline phosphatase (BAP); bone resorption marker urinary N-telopeptide (uNTX); insulin growth factor-1 (IGF-1); and sex hormone binding globulin (SHBG) were carried out at initiation, 6 months, and 12 months. Changes from baseline were compared using mixed models, adjusting for follow-up comparisons using the Holm Test (sequential Bonferroni). There were no significant differences (SD) between groups at baseline in age, gynecologic age, WBBMC, hip BMD, and LSBMD. Girls on Ortho Evra did not change significantly in WBBMC (12-month mean increase 0.2% +/- 0.8%), whereas controls did (3.9% +/- 1.8%, P < or = .001, adjusted P = .002), with SD between the 2 groups (P = .007, adjusted P = .036). Adolescents on Ortho Evra did not change significantly in hip BMD (12-month mean increase 0.5% +/- 0.6%), whereas controls did (2.7% +/- 0.6%, P < or = .001, adjusted P = .004), with SD between the 2 groups (P = .024) prior to adjustment for multiple comparisons, but no SD after adjustment (P = .096). Similarly, although the increase in LSBMD within the control group after 12 months (mean increase 2.8% +/- 1.0%) was statistically significant (P = .009, adjusted P = .044), the change within the treatment group (12-month mean increase 0.8% +/- 0.8%) was not. However, percent LSBMD changes after 12 months did not significantly differ between the 2 groups before or after adjustment for multiple comparisons. Calcium intake and bone-protective physical activity did not significantly predict BMC and BMD changes of study participants. There was a significantly greater increase in SHBG levels in the treatment group after 6 months (P = .003, adjusted P = .013) and 12 months (P < or = .001, adjusted P < or = .001) than in controls. Changes in levels of OC, BAP, uNTX, and IGF-1 were not significantly different between the 2 groups. Ortho Evra use attenuates bone mass acquisition in young women who are still undergoing skeletal maturation. This attenuation may be attributed in part to increased SHBG levels, which reduce the concentrations of free estradiol and free testosterone that are available to interact with receptors on the bone. Clinical implications remain to be determined in studies with a larger number of adolescents. Copyright 2010 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.
Gómez-de-Tejada Romero, María-Jesús; Navarro Rodríguez, María-del-Carmen; Saavedra Santana, Pedro; Quesada Gómez, José-Manuel; Jódar Gimeno, Esteban; Sosa Henríquez, Manuel
2014-03-01
First, to study the difference between two groups of postmenopausal women living in different population centres (rural vs urban) in the prevalence of osteoporosis, fragility fractures and factors which may influence them: hypovitaminosis D, bone mineral density, coexistence of other diseases which predispose to their appearance; secondly, to observe the influence of low socioeconomic status, categorised as poverty. 1229 postmenopausal women were studied, of whom 390 (31.7%), were living in rural areas and 839 (68.3%), in urban areas. Data regarding risk factors related to osteoporosis were obtained, and, among other biochemical measures, 25 hydroxyvitamin D and parathyroid hormone were determined. Bone densitometry was carried out in the lumbar spine and proximal femur, as well as lateral X-rays of the dorsal and lumbar spine. The women who lived in rural areas were older, shorter, heavier and had a higher body mass index than those from urban areas. Among the women from rural areas there was a higher prevalence of poverty, and higher levels of obesity, arterial hypertension and diabetes mellitus were observed, as well as a higher prevalence of densitometric osteoporosis. The rural women had lower values of bone mineral density in the lumbar spine and a higher prevalence of vertebral fractures and hypovitaminosis D. The variables which were associated independently with living in rural areas were poverty, obesity, vertebral fractures, BMD in the lumbar spine and levels of 25 hydroxyvitamin D. In our study, postmenopausal women who live in rural populations have more poverty, lower values of vitamin D, lower BMD in the lumbar spine and a higher prevalence of vertebral fractures and of osteoporosis. The higher prevalence of obesity, arterial hypertension and diabetes mellitus observed in these women may be adjuvant factors, all fostered by their socioeconomic state of poverty. Copyright © 2014. Published by Elsevier Ireland Ltd.
Buehring, Bjoern; Kirchner, Elizabeth; Sun, Zhiyuan; Calabrese, Leonard
2012-01-01
As a result of the advances in antiretroviral therapy, the life span of human immunodeficiency virus (HIV)-infected patients has increased dramatically. Attendant to these effects are signs of premature aging with notable changes in the musculoskeletal system. Although changes in bone and fat distribution have been studied extensively, far less is known about changes in muscle. This study examined the extent of low muscle mass (LMM) and its relationship with low bone mineral density (BMD) and lipodystrophy (LD) in HIV-positive males. As such, HIV-positive males on therapy or treatment naive underwent dual-energy X-ray absorptiometry total body composition measurements. Appendicular lean mass/(height)2 and lowest 20% of residuals from regression analysis were used to define LMM. BMD criteria defined osteopenia/osteoporosis, and the percent central fat/percent lower extremity ratio defined LD. Several potential risk factors were assessed through chart review. Sixty-six males (57 with treatment and 9 treatment naive) volunteered. Treated individuals were older than naive (44 vs 34 yr) and had HIV longer (108 vs 14 mo). When definitions for sarcopenia (SP) in elderly individuals were applied, the prevalence of LMM was 21.9% and 18.8% depending on the definition used. Low BMD was present in 68.2% of participants. LD with a cutoff of 1.5 and 1.961 was present in 54.7% and 42.2% of participants, respectively. LMM and LD were negatively associated. In conclusion, this study shows that LMM is common in males with HIV and that SP affecting muscle function could be present in a substantial number of individuals. Future research needs to examine what impact decreased muscle mass and function has on morbidity, physical function, and quality of life in individuals with HIV. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Sowers, M R; Finkelstein, J S; Ettinger, B; Bondarenko, I; Neer, R M; Cauley, J A; Sherman, S; Greendale, G A
2003-01-01
We evaluated bone mineral density (BMD), hormone concentrations and menstrual cycle status to test the hypothesis that greater variations in reproductive hormones and menstrual bleeding patterns in mid-aged women might engender an environment permissive for less bone. We studied 2336 women, aged 42-52 years, from the Study of Women's Health Across the Nation (SWAN) who self-identified as African-American (28.2%), Caucasian (49.9%), Japanese (10.5%) or Chinese (11.4%). Outcome measures were lumbar spine, femoral neck and total hip BMD by dual-energy X-ray densitometry (DXA). Explanatory variables were estradiol, testosterone, sex hormone binding globulin (SHBG) and follicle stimulating hormone (FSH) from serum collected in the early follicular phase of the menstrual cycle or menstrual status [premenopausal (menses in the 3 months prior to study entry without change in regularity) or early perimenopause (menstrual bleeding in the 3 months prior to study entry but some change in the regularity of cycles)]. Total testosterone and estradiol concentrations were indexed to SHBG for the Free Androgen Index (FAI) and the Free Estradiol Index (FEI). Serum logFSH concentrations were inversely correlated with BMD (r = -10 for lumbar spine [95% confidence interval (CI): -0.13, -0.06] and r = -0.08 for femoral neck (95% CI: -0.11, -0.05). Lumbar spine BMD values were approximately 0.5% lower for each successive FSH quartile. There were no significant associations of BMD with serum estradiol, total testosterone, FEI or FAI, respectively, after adjusting for covariates. BMD tended to be lower (p values = 0.009 to 0.06, depending upon the skeletal site) in women classified as perimenopausal versus premenopausal, after adjusting for covariates. Serum FSH but not serum estradiol, testosterone or SHBG were significantly associated with BMD in a multiethnic population of women classified as pre- versus perimenopausal, supporting the hypothesis that alterations in hormone environment are associated with BMD differences prior to the final menstrual period.
Sarcopenia is related to increased risk for low bone mineral density.
Wu, Chia-Hung; Yang, Kun-Cheh; Chang, Hao-Hsiang; Yen, Jo-Fang; Tsai, Ko-Sung; Huang, Kuo-Chin
2013-01-01
Lean body mass is positively correlated with bone mineral density (BMD). The association between sarcopenia and BMD is less studied. The aim of the study is to investigate the association between sarcopenia and abnormal BMD. A total of 600 community residents aged 40-85 years (mean=63.63 ± 10.12) from Taipei, Taiwan were included. Abnormal and normal BMD groups were categorized by T-score of femoral neck and lumbar spine (L2-L4) measured by dual-energy X-ray absorptiometry. Skeletal muscle mass (SM) index (SMI) was obtained from SM divided by height squared using bioelectrical impedance analysis (BIA) method. Sarcopenia was defined as SMI less than 8.87 kg/m² in men and 6.42 kg/m² in women according to previous Taiwanese sarcopenia study. The association between BMD groups and sarcopenia was examined using binary logistic regression analyses after controlling potential confounders. Subjects with sarcopenia were at higher risk for low BMD (odds ratio (OR) = 1.59, 95% confidence interval (CI)=1.06-2.39 for femoral neck BMD and OR=1.72, 95% CI=1.09-2.72 for lumbar BMD) compared with the nonsarcopenia group. Even in different gender groups with age categorized, sarcopenia was still an important independent factor in female group. The least square (LS) means of BMD of femoral neck and lumbar spine were significantly lower in sarcopenia group. The risk of low BMD increased significantly with sarcopenia. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Kaviani, Nargess; Bukberg, Phillip; Manessis, Anastasios; Yen, Vincent; Young, Iven
2011-01-01
To report the first case of severe osteoporosis associated with a vertebral pathologic fracture and osteonecrosis of femoral heads in an HIV-infected man receiving inhaled corticosteroids and ritonavir-boosted antiretroviral therapy. We describe an HIV-infected man with severe osteoporosis, bilateral hip osteonecrosis, and secondary adrenal suppression, including detailed clinical, laboratory, and radiographic data, and review the related literature. A 60-year-old man with a 15-year history of HIV infection and a medical history of long-standing bronchiectasis treated with inhaled corticosteroids and hypogonadism treated with testosterone was referred to the endocrinology clinic after experiencing an osteoporotic vertebral fracture. He was taking ritonavir-boosted antiretroviral therapy. Osteonecrosis of both hips was also diagnosed, which required total hip replacement therapy. Laboratory evaluation revealed adrenal insufficiency due to increased effect of exogenous inhaled steroids and no other secondary causes of osteoporosis. A bone densitometry study showed osteoporosis of both hips and the lumbar spine. He was treated with intravenous pamidronate. During treatment, he developed bilateral femoral fractures after minor trauma. Given the potential for increased serum levels of inhaled corticosteroids in patients taking ritonavir-boosted highly active antiretroviral therapy, attention must be paid to the risk of bone loss in HIV-infected patients taking inhaled corticosteroids. Prescribing calcium and vitamin D supplementation and considering early osteoporosis screening are reasonable measures for this patient population. Interaction between inhaled corticosteroids and ritonavir may increase risk of hypothalamus-pituitary-adrenal axis suppression.
Shetty, Rohit; Rajiv Kumar, Nimisha; Pahuja, Natasha; Deshmukh, Rashmi; Vunnava, KrishnaPoojita; Abilash, Valsala Gopalakrishnan; Sinha Roy, Abhijit; Ghosh, Arkasubhra
2018-03-01
To evaluate the correlation of visual and keratometry outcomes after corneal cross-linking (CXL) in patients with keratoconus with cone epithelium-specific gene expression levels. Corneal epithelium was obtained from 35 eyes that underwent accelerated CXL (KXLII, 9 mW/cm for 10 min). Using corneal topography, epithelium over the cone and periphery was obtained separately from each subject. The ratio of gene expression for lysyl oxidase (LOX), matrix metalloproteinase 9 (MMP9), bone morphogenic protein 7, tissue inhibitor of metalloproteinase 1, collagen, type I, alpha 1, and collagen, type IV, alpha 1 (COL IVA1) from the cone and peripheral cornea was correlated with the outcome of cross-linking surgery. Patients were assessed for visual acuity, keratometry, refraction, and corneal densitometry before and 6 months after surgery. Based on the change in corneal flattening indicated by ΔKmax, the outcomes were classified as a higher response or lower response. Reduction in keratometric indices correlated with improved spherical equivalent after CXL. Preoperative levels of cone-specific LOX expression in cases with a higher response were significant (P = 0.001). COL IVA1, bone morphogenic protein 7, and tissue inhibitor of metalloproteinase 1 gene expressions were reduced in the cones of the subjects with a lower response. MMP9 levels were relatively lower in cases with a higher response compared with those with a lower response. Our study demonstrates that preoperative levels of molecular factors such as LOX, MMP9, and COL IVA1 aid in understanding CXL outcomes at the tissue level.