Reactivity of Deoxy- and Oxyferrous Dehaloperoxidase B from Amphitrite ornata: Identification of Compound II and its Ferrous-Hydroperoxide Precursor†

PubMed Central

D’Antonio, Jennifer; Ghiladi, Reza A.

2011-01-01

Dehaloperoxidase (DHP) from the terebellid polychaete Amphitrite ornata is a bifunctional enzyme that possesses both hemoglobin and peroxidase activities. The bifunctional nature of DHP as a globin-peroxidase appears to be at odds with the traditional starting oxidation state for each individual activity. Namely, reversible oxygen-binding is only mediated via a ferrous heme in globins, and peroxidase activity is initiated from ferric centers and to the exclusion of the oxyferrous oxidation state from the peroxidase cycle. Thus, to address what appears to be a paradox, herein we report the details of our investigations into the DHP catalytic cycle when initiated from the deoxy- and oxyferrous states using biochemical assays, stopped-flow UV-visible and rapid-freeze-quench electron paramagnetic resonance spectroscopies, and anaerobic methods. We demonstrate the formation of Compound II directly from deoxyferrous DHP B upon its reaction with hydrogen peroxide, and show that this occurs both in the presence and absence of trihalophenol. Prior to Compound II formation, we have identified a new species which we have preliminarily attributed to a ferrous-hydroperoxide precursor that undergoes heterolysis to generate the aforementioned ferryl intermediate. Taken together, the results demonstrate that the oxyferrous state in DHP is a peroxidase competent starting species, and an updated catalytic cycle for DHP is proposed in which the ferric oxidation state is not an obligatory starting point for the peroxidase catalytic cycle of dehaloperoxidase. The data presented herein provide a link between the peroxidase and oxygen transport activities which furthers our understanding of how this bifunctional enzyme is able to unite its two inherent functions in one system. PMID:21619067

Study on the interaction between typical phthalic acid esters (PAEs) and human haemoglobin (hHb) by molecular docking.

PubMed

Tan, Songwen; Wang, Donglin; Chi, Zhenxing; Li, Weiguo; Shan, Ye

2017-07-01

This work has evaluated the binding force between hHb and typcial PAEs (DMP, DEP, DPRP, DBP, DIBP, DHP and DPHP) using molecule docking technique. The DPHP with 3 aromatic rings has the strongest binding (-ΔG binding : 6.0kcalmol -1 ) than other PAEs (-ΔG binding : 2.91∼4.48kcalmol -1 ). The DMP with the lowest molecular weight has a high binding force (-ΔG binding : 4.48kcalmol -1 ), while the DHP with the highest molecular weight has the lowest binding force (-ΔG binding : 2.91kcalmol -1 ). When the length of side chain increases, the binding force trend to decrease, regarding the VDW forces and H-bonding. The lgK ow -ΔG binding plotting figure shows that a higher K ow value is accompanied by a lower binding force. The aromatic ring existed in PAEs largely increases the binding force between the hHb and the PAEs. On the other hand, the PAEs with higher number of carbon, meaning a higher hydrophobicity, can enter into the hydrophobic space of hHb centre deeper and bond to different position. The aromatic ring decreases the depth of binding position in the hydrophobic space. This work provides basic data and a theoretical method to assess the transport and accumulation of PAEs in human body, and the cytotoxicity of PAEs to hBRCs. Copyright © 2017 Elsevier B.V. All rights reserved.

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

PubMed Central

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

PubMed

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

2016-01-12

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

Progestin withdrawal at parturition in the mare.

PubMed

Legacki, Erin L; Corbin, C J; Ball, B A; Wynn, M; Loux, S; Stanley, S D; Conley, A J

2016-10-01

Mammalian pregnancies need progestogenic support and birth requires progestin withdrawal. The absence of progesterone in pregnant mares, and the progestogenic bioactivity of 5α-dihydroprogesterone (DHP), led us to reexamine progestin withdrawal at foaling. Systemic pregnane concentrations (DHP, allopregnanolone, pregnenolone, 5α-pregnane-3β, 20α-diol (3β,20αDHP), 20α-hydroxy-5α-dihydroprogesterone (20αDHP)) and progesterone) were monitored in mares for 10days before foaling (n=7) by liquid chromatography-mass spectrometry. The biopotency of dominant metabolites was assessed using luciferase reporter assays. Stable transfected Chinese hamster ovarian cells expressing the equine progesterone receptor (ePGR) were transfected with an MMTV-luciferase expression plasmid responsive to steroid agonists. Cells were incubated with increasing concentrations (0-100nM) of progesterone, 20αDHP and 3α,20βDHP. The concentrations of circulating pregnanes in periparturient mares were (highest to lowest) 3α,20βDHP and 20αDHP (800-400ng/mL respectively), DHP and allopregnanolone (90 and 30ng/mL respectively), and pregnenolone and progesterone (4-2ng/mL). Concentrations of all measured pregnanes declined on average by 50% from prepartum peaks to the day before foaling. Maximum activation of the ePGR by progesterone occurred at 30nM; 20αDHP and 3α,20βDHP were significantly less biopotent. At prepartum concentrations, both 20αDHP and 3α,20βDHP exhibited significant ePGR activation. Progestogenic support of pregnancy declines from 3 to 5days before foaling. Prepartum peak concentrations indicate that DHP is the major progestin, but other pregnanes like 20αDHP are present in sufficient concentrations to play a physiological role in the absence of DHP. The authors conclude that progestin withdrawal associated with parturition in mares involves cessation of pregnane synthesis by the placenta. © 2016 Society for Reproduction and Fertility.

Relocalization of the calcium gradient and a dihydropyridine receptor is involved in upward bending by bulging of Chara protonemata, but not in downward bending by bowing of Chara rhizoids.

PubMed

Braun, M; Richter, P

1999-10-01

The localization of cytoplasmic free calcium and a dihydropyridine (DHP) receptor, a putative calcium channel, was recorded during the opposite graviresponses of tip-growing Chara rhizoids and Chara protonemata by using the calcium indicator Calcium Crimson and a fluorescently labeled dihydropyridine (FL-DHP). In upward (negatively gravitropically) growing protonemata and downward (positively gravitropically) growing rhizoids, a steep Ca2+ gradient and DHP receptors were found to be symmetrically localized in the tip. However, the localization of the Ca2+ gradient and DHP receptors differed considerably during the gravitropic responses upon horizontal positioning of the two cell types. During the graviresponse of rhizoids, a continuous bowing downward by differential flank growth, the Ca2+ gradient and DHP receptors remained symmetrically localized in the tip at the centre of growth. However, after tilting protonemata into a horizontal position, there was a drastic displacement of the Ca2+ gradient and FL-DHP to the upper flank of the apical dome. This displacement occurred after the apical intrusion and sedimentation of the statoliths but clearly before the change in the growth direction became evident. In protonemata, the reorientation of the growth direction started with the appearance of a bulge on that site of the upper flank which was predicted by the asymmetrically displaced Ca2+ gradient. With the upward shift of the cell tip, which is suggested to result from a statolith-induced displacement of the growth centre, the Ca2+ gradient and DHP receptors became symmetrically relocalized in the apical dome. No major asymmetrical rearrangement was observed during the following phase of gravitropic curvature which is characterized by slower rates of bending. Labeling with FL-DHP was completely inhibited by a non-fluorescently labeled dihydropyridine. From these results it is suggested that FL-DHP labels calcium channels in rhizoids and protonemata. In rhizoids, positive gravitropic curvature is caused by differential growth limited to the opposite subapical flanks of the apical dome, a process which does not involve displacement of the growth centre, the calcium gradient or calcium channels. In protonemata, however, it is proposed that a statolith-induced asymmetrical relocalization of calcium channels and the Ca2+ gradient precedes, and might mediate, the rearrangement of the centre of growth, most likely by the displacement of the Spitzenkorper, to the upper flank, which results in the negative gravitropic reorientation of the growth direction.

Receptor model for the molecular basis of tissue selectivity of 1,4-dihydropyridine calcium channel drugs

NASA Astrophysics Data System (ADS)

Langs, David A.; Strong, Phyllis D.; Triggle, David J.

1990-09-01

Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.

The effects of formulation on the immunostimulatory activity of dihydroheptaprenol.

PubMed

Roth, James A; Hibbard, Beth; Frank, Dagmar E; Kesl, Lyle; Robb, Edward J

2002-01-01

Holstein steer calves received a single injection of Miglyol (Sasol Chemical Industries, Ltd.) subcutaneously as a placebo, dihydroheptaprenol (DHP) (4 mg/kg) emulsified with lecithin subcutaneously, DHP in solution in Miglyol (4 mg/kg) subcutaneously, or DHP in solution in Miglyol (4 mg/kg) intranasally. The DHP emulsified in lecithin emulsion administered subcutaneously caused a substantial increase in body temperature, total leukocyte count, total neutrophil count, neutrophil cytochrome-c reduction, and neutrophil iodination 24 hours after administration and, for some of the parameters, at 48 hours. The DHP formulation in Miglyol did not have any of these effects when administered subcutaneously or intranasally. The carrier and formulation of DHP apparently have major effects on the biologic activity of DHP.

The role of T56 in controlling the flexibility of the distal histidine in dehaloperoxidase-hemoglobin from Amphitrite ornata.

PubMed

Jiang, Shu; Wright, Iain; Swartz, Paul; Franzen, Stefan

2013-10-01

The activation of dehaloperoxidase-hemoglobin (DHP) to form a ferryl intermediate requires the distal histidine, H55, to act as an acid base catalyst. The lack of ancillary amino acids in the distal pocket to assist in this process makes H55 even more important to the formation of active intermediates than in conventional peroxidases. Therefore, one can infer that the precise conformation H55 may greatly affect the enzymatic activity. Using site-direct mutagenesis at position T56, immediately adjacent to H55, we have confirmed that subtle changes in the conformation of H55 affect the catalytic efficiency of DHP. Mutating T56 to a smaller amino acid appears to permit H55 to rotate with relatively low barriers between conformations in the distal pocket, which may lead to an increase in catalytic activity. On the other hand, larger amino acids in the neighboring site appear to restrict the rotation of H55 due to the steric hindrance. In the case of T56V, which is an isosteric mutation, H55 appears less mobile, but forced to be closer to the heme iron than in wild type. Both proximity to the heme iron and flexibility of motion in some of the mutants can result in an increased catalytic rate, but can also lead to protein inactivation due to ligation of H55 to the heme iron, which is known as hemichrome formation. A balance of enzymatic rate and protein stability with respect to hemichrome formation appears to be optimum in wild type DHP (WT-DHP). Copyright © 2013 Elsevier B.V. All rights reserved.

Prevention of leucaena toxicosis of cattle in Florida by ruminal inoculation with 3-hydroxy-4-(1H)-pyridone-degrading bacteria.

PubMed

Hammond, A C; Allison, M J; Williams, M J; Prine, G M; Bates, D B

1989-12-01

Ruminal microorganisms in cattle at a Florida agriculture research station did not have the ability to detoxify leucaena by degradation of 3-hydroxy-4(1H)-pyridone (3,4,-DHP), but a DHP isomer (2,3-DHP) was degraded in some cattle. Cattle with microorganisms that degraded 2,3-DHP were mostly Senepol cattle imported from St. Croix, US Virgin Islands, where leucaena is an indigenous species. Hereford cattle at the research station in Florida generally did not degrade 3,4-DHP or 2,3-DHP. An experiment was conducted in which a pure culture of 3,4-DHP-degrading bacteria was inoculated into Hereford cattle (with ruminal fistula) grazing leucaena. The bacteria successfully colonized the rumen of recipient cattle and persisted through the following winter when there was no leucaena in the diet.

GrDHP: a general utility function representation for dual heuristic dynamic programming.

PubMed

Ni, Zhen; He, Haibo; Zhao, Dongbin; Xu, Xin; Prokhorov, Danil V

2015-03-01

A general utility function representation is proposed to provide the required derivable and adjustable utility function for the dual heuristic dynamic programming (DHP) design. Goal representation DHP (GrDHP) is presented with a goal network being on top of the traditional DHP design. This goal network provides a general mapping between the system states and the derivatives of the utility function. With this proposed architecture, we can obtain the required derivatives of the utility function directly from the goal network. In addition, instead of a fixed predefined utility function in literature, we conduct an online learning process for the goal network so that the derivatives of the utility function can be adaptively tuned over time. We provide the control performance of both the proposed GrDHP and the traditional DHP approaches under the same environment and parameter settings. The statistical simulation results and the snapshot of the system variables are presented to demonstrate the improved learning and controlling performance. We also apply both approaches to a power system example to further demonstrate the control capabilities of the GrDHP approach.

Absorption mechanism of DHP107, an oral paclitaxel formulation that forms a hydrated lipidic sponge phase

PubMed Central

Jang, Yura; Chung, Hye Jin; Hong, Jung Wan; Yun, Cheol-Won; Chung, Hesson

2017-01-01

Paclitaxel is a most widely used anticancer drug with low oral bioavailability, thus it is currently administered via intravenous infusion. DHP107 is a lipid-based paclitaxel formulation that can be administered as an oral solution. In this study, we investigated the mechanism of paclitaxel absorption after oral administration of DHP107 in mice and rats by changing the dosing interval, and evaluated the influence of bile excretion. DHP107 was orally administered to mice at various dosing intervals (2, 4, 8, 12, 24 h) to examine how residual DHP107 affected paclitaxel absorption during subsequent administration. Studies with small-angle X-ray diffraction (SAXS) and cryo-transmission electron microscopy (cryo-TEM) showed that DHP107 formed a lipidic sponge phase after hydration. The AUC values after the second dose were smaller than those after the first dose, which was correlated to the induction of expression of P-gp and CYP in the livers and small intestines from 2 h to 7 d after the first dose. The smaller AUC value observed after the second dose was also attributed to the intestinal adhesion of residual formulation. The adhered DHP107 may have been removed by ingested food, thus resulting in a higher AUC. In ex vivo and in vivo mucoadhesion studies, the formulation adhered to the villi for up to 24 h, and the amount of DHP107 that adhered was approximately half that of monoolein. The paclitaxel absorption after administration of DHP107 was not affected by bile in the cholecystectomy mice. The dosing interval and food intake affect the oral absorption of paclitaxel from DHP107, which forms a mucoadhesive sponge phase after hydration. Bile excretion does not affect the absorption of paclitaxel from DHP107 in vivo. PMID:27867185

Absorption mechanism of DHP107, an oral paclitaxel formulation that forms a hydrated lipidic sponge phase.

PubMed

Jang, Yura; Chung, Hye Jin; Hong, Jung Wan; Yun, Cheol-Won; Chung, Hesson

2017-01-01

Paclitaxel is a most widely used anticancer drug with low oral bioavailability, thus it is currently administered via intravenous infusion. DHP107 is a lipid-based paclitaxel formulation that can be administered as an oral solution. In this study, we investigated the mechanism of paclitaxel absorption after oral administration of DHP107 in mice and rats by changing the dosing interval, and evaluated the influence of bile excretion. DHP107 was orally administered to mice at various dosing intervals (2, 4, 8, 12, 24 h) to examine how residual DHP107 affected paclitaxel absorption during subsequent administration. Studies with small-angle X-ray diffraction (SAXS) and cryo-transmission electron microscopy (cryo-TEM) showed that DHP107 formed a lipidic sponge phase after hydration. The AUC values after the second dose were smaller than those after the first dose, which was correlated to the induction of expression of P-gp and CYP in the livers and small intestines from 2 h to 7 d after the first dose. The smaller AUC value observed after the second dose was also attributed to the intestinal adhesion of residual formulation. The adhered DHP107 may have been removed by ingested food, thus resulting in a higher AUC. In ex vivo and in vivo mucoadhesion studies, the formulation adhered to the villi for up to 24 h, and the amount of DHP107 that adhered was approximately half that of monoolein. The paclitaxel absorption after administration of DHP107 was not affected by bile in the cholecystectomy mice. The dosing interval and food intake affect the oral absorption of paclitaxel from DHP107, which forms a mucoadhesive sponge phase after hydration. Bile excretion does not affect the absorption of paclitaxel from DHP107 in vivo.

Isolation and pharmacological characterization of fatty acids from saw palmetto extract.

PubMed

Abe, Masayuki; Ito, Yoshihiko; Suzuki, Asahi; Onoue, Satomi; Noguchi, Hiroshi; Yamada, Shizuo

2009-04-01

Saw palmetto extract (SPE) has been widely used for the treatment of lower urinary-tract symptoms secondary to benign prostatic hyperplasia. The mechanisms of pharmacological effects of SPE include the inhibition of 5alpha-reductase, anti-androgenic effects, anti-proliferative effects, and anti-inflammatory effects. Previously, we showed that SPE bound actively to alpha(1)-adrenergic, muscarinic and 1,4-dihydropyridine calcium channel (1,4-DHP) receptors in the prostate and bladder of rats, whereas its active constituents have not been fully clarified. The present investigation is aimed to identify the main active components contained in hexane and diethyl ether extracts of SPE with the use of column chromatography and preparative HPLC. Based on the binding activity with alpha(1)-adrenergic, muscarinic, and 1,4-DHP receptors, both isolated oleic and lauric acids were deduced to be active components. Authentic samples of oleic and lauric acids also exhibited similar binding activities to these receptors as the fatty acids isolated from SPE, consistent with our findings. In addition, oleic and lauric acids inhibited 5alpha-reductase, possibly leading to therapeutic effects against benign prostatic hyperplasia and related lower urinary-tract symptoms.

Protective Effect of 4-(3,4-Dihydroxyphenyl)-3-Buten-2-One from Phellinus linteus on Naproxen-Induced Gastric Antral Ulcers in Rats.

PubMed

Kim, Jeong-Hwan; Kwon, Hyun Ju; Kim, Byung Woo

2016-05-28

The present study investigated the protective effect of naturally purified 4-(3,4- dihydroxyphenyl)-3-buten-2-one (DHP) from Phellinus linteus against naproxen-induced gastric antral ulcers in rats. To verify the protective effect of DHP on naproxen-induced gastric antral ulcers, various doses (1, 5, and 10 μg/kg) of DHP were pretreated for 3 days, and then gastric damage was caused by 80 mg/kg naproxen applied for 3 days. DHP prevented naproxen-induced gastric antral ulcers in a dose-dependent manner. In particular, 10 μg/kg DHP showed the best protective effect against naproxen-induced gastric antral ulcers. Moreover, DHP significantly attenuated the naproxen-induced lipid peroxide level in gastric mucosa and increased the activities of radical scavenging enzymes, such as superoxide dismutase, catalase, and glutathione peroxidase, in a dose-dependent manner. A histological examination clearly demonstrated that the gastric antral ulcer induced by naproxen nearly disappeared after the pretreatment of DHP. These results suggest that DHP can inhibit naproxen-induced gastric antral ulcers through prevention of lipid peroxidation and activation of radical scavenging enzymes.

Osteocyte viability and regulation of osteoblast function in a 3D trabecular bone explant under dynamic hydrostatic pressure.

PubMed

Takai, Erica; Mauck, Robert L; Hung, Clark T; Guo, X Edward

2004-09-01

A new trabecular bone explant model was used to examine osteocyte-osteoblast interactions under DHP loading. DHP loading enhanced osteocyte viability as well as osteoblast function measured by osteoid formation. However, live osteocytes were necessary for osteoblasts to form osteoids in response to DHP, which directly show osteoblast-osteocyte interactions in this in vitro culture. A trabecular bone explant model was characterized and used to examine the effect of osteocyte and osteoblast interactions and dynamic hydrostatic pressure (DHP) loading on osteocyte viability and osteoblast function in long-term culture. Trabecular bone cores obtained from metacarpals of calves were cleaned of bone marrow and trabecular surface cells and divided into six groups, (1) live cores + dynamic hydrostatic pressure (DHP), (2) live cores + sham, (3) live cores + osteoblast + DHP, (4) live cores + osteoblast + sham, (5) devitalized cores + osteoblast + DHP, and (6) devitalized cores + osteoblast + sham, with four culture durations (2, 8, 15, and 22 days; n = 4/group). Cores from groups 3-6 were seeded with osteoblasts, and cores from groups 5 and 6 were devitalized before seeding. Groups 1, 3, and 5 were subjected to daily DHP loading. Bone histomorphometry was performed to quantify osteocyte viability based on morphology and to assess osteoblast function based on osteoid surface per bone surface (Os/Bs). TUNEL staining was performed to evaluate the mode of osteocyte death under various conditions. A portion of osteocytes remained viable for the duration of culture. DHP loading significantly enhanced osteocyte viability up to day 8, whereas the presence of seeded osteoblasts significantly decreased osteocyte viability. Cores with live osteocytes showed higher Os/Bs compared with devitalized cores, which reached significant levels over a greater range of time-points when combined with DHP loading. DHP loading did not increase Os/Bs in the absence of live osteocytes. The percentage of apoptotic cells remained the same regardless of treatment or culture duration. Enhanced osteocyte viability with DHP suggests the necessity of mechanical stimulation for osteocyte survival in vitro. Furthermore, osteocytes play a critical role in the transmission of signals from DHP loading to modulate osteoblast function. This explant culture model may be used for mechanotransduction studies in long-term cultures.

Effect of dihydroxyacetone and pyruvate on plasma glucose concentration and turnover in noninsulin-dependent diabetes mellitus.

PubMed

Stanko, R T; Mitrakou, A; Greenawalt, K; Gerich, J

1990-01-01

Consumption of dihydroxyacetone and pyruvate (DHP) increases muscle extraction of glucose in normal men. To test the hypothesis that these three-carbon compounds would improve glycemic control in diabetes, we evaluated the effect of DHP on plasma glucose concentration, turnover, recycling, and tolerance in 7 women with noninsulin-dependent diabetes. The subjects consumed a 1,500-calorie diet (55% carbohydrate, 30% fat, 15% protein), randomly containing 13% of the calories as DHP (1/1) or Polycose (placebo; PL), as a drink three times daily for 7 days. On the 8th day, primed continuous infusions of [6-3H]-glucose and [U-14C]-glucose were begun at 05.00 h, and at 09.00 h a 3-hour glucose tolerance test (75 g glucola) was performed. Two weeks later the subjects repeated the study with the other diet. The fasting plasma glucose level decreased by 14% with DHP (DHP = 8.0 +/- 0.9 mmol/l; PL = 9.3 +/- 1.0 mmol/l, p less than 0.05) which accounted for lower postoral glucose glycemia (DHP = 13.1 +/- 0.8 mmol/l, PL = 14.7 +/- 0.8 mmol/l, p less than 0.05). [6-3H]-glucose turnover (DHP = 1.50 +/- 0.19 mg.kg-1.min-1, PL = 1.77 +/- 0.21 mg.kg-1.min-1, p less than 0.05) and glucose recycling, the difference in [6-3H]-glucose and [U-14C]-glucose turnover rates, decreased with DHP (DHP = 0.25 +/- 0.07 mg.kg-1.min-1, PL = 0.54 +/- 0.10 mg.kg-1.min-1, p less than 0.05). Fasting and postoral glucose, plasma insulin, glucagon, and C peptide levels were unaffected by DHP.(ABSTRACT TRUNCATED AT 250 WORDS)

Cav1.2, but not Cav1.3, L-type calcium channel subtype mediates nicotine-induced conditioned place preference in miceo.

PubMed

Liu, Yudan; Harding, Meghan; Dore, Jules; Chen, Xihua

2017-04-03

Nicotine use is one of the most common forms of drug addiction. Although L-type calcium channels (LTCCs) are involved in nicotine addiction, the contribution of the two primary LTCC subtypes (Ca v 1.2 and 1.3) is unknown. This study aims to determine the contribution of these two LTCC subtypes to nicotine-induced conditioned place preference (CPP) responses by using transgenic mouse models that do not express Ca v 1.3 (Ca v 1.3 -/- ) or contain a mutation in the dihydropyridine (DHP) site of the Ca v 1.2 (Ca v 1.2DHP -/- ). We found a hyperbolic dose dependent nicotine (0.1-1mg/kg; 0.5mg/kg optimum) effect on place preference in wild type (WT) mice, that could be prevented by the DHP LTCC blocker nifedipine pretreatment. Similarly, Ca v 1.3 -/- mice showed nicotine-induced place preference which was antagonized by nifedipine. In contrast, nifedipine pretreatment of Ca v 1.2DHP -/- mice had no effect on nicotine-induced CPP responses, suggesting an involvement of Ca v 1.2 subtype in the nicotine-induced CPP response. Nifedipine alone failed to produce either conditioned place aversion or CPP in WT mice. These results collectively indicate Ca v 1.2, but not Ca v 1.3 LTCC subtype regulates, at least in part, the reinforcing effects of nicotine use. Copyright © 2017 Elsevier Inc. All rights reserved.

Light-induced yellowing of selectively 13C-enriched dehydrogenation polymers (DHPs). Part 1, Side-chain 13C-enriched DHP ([alpha], [beta], and [gamma]-13C)

Treesearch

Jim Parkas; Magnus Paulsson; Terashima Noritsugu; Ulla Westermark; Sally Ralph

2004-01-01

Light-induced yellowing has been studied using side-chain ([alpha], [beta], and [gamma]) 13C-enriched DHP (dehydrogenation polymer) and quantitative solution state 13C NMR spectroscopy. The DHP was formed from 13C-enriched coniferin using an enzymatic system consisting of [beta]-glucosidase, glucose oxidase, and peroxidase in a pH 6 buffer solution. The DHP was applied...

Adherence to Metformin, Statins, and ACE/ARBs Within the Diabetes Health Plan (DHP).

PubMed

Duru, O Kenrik; Turk, Norman; Ettner, Susan L; Neugebauer, Romain; Moin, Tannaz; Li, Jinnan; Kimbro, Lindsay; Chan, Charles; Luchs, Robert H; Keckhafer, Abigail M; Kirvan, Anya; Ho, Sam; Mangione, Carol M

2015-11-01

Reducing patient cost-sharing and engaging patients in disease management activities have been shown to increase uptake of evidence-based care. To evaluate the effect of employer purchase of a disease-specific plan with reduced cost-sharing and disease management (the Diabetes Health Plan/DHP) on medication adherence among eligible employees and dependents. Employer-level "intent to treat" cohort study, including data from eligible employees and their dependents with diabetes, regardless of whether they were enrolled in the DHP. Employers that contracted with a large national health plan administrator in 2009, 2010, and/or 2011. Ten employers that purchased the DHP and 191 employers that did not (controls). Inverse probability weighting (IPW) estimation was used to adjust for inter-group differences. The DHP includes free or low-cost medications and physician visits. Enrollment strategies and specific benefit designs are determined by the employer and vary in practice. DHP participants are notified up front that they must engage in their own health care (e.g., receiving diabetes-related screening) in order to remain enrolled. Mean employee adherence to metformin, statins, and ACE/ARBs at the employer level at one year post-DHP implementation, as measured by the proportion of days covered (PDC). Baseline adherence to the three medications was similar across DHP and control employers, ranging from 64 to 69 %. In the first year after DHP implementation, predicted employer-level adherence for metformin (+4.9 percentage points, p = 0.017), statins (+4.8, p = 0.019), and ACE/ARBs (+4.4, p = 0.02) was higher with DHP purchase. Non-randomized, observational study. The Diabetes Health Plan, an innovative health plan that combines reduced cost-sharing and disease management with an up-front requirement of enrollee participation in his or her own health care, is associated with a modest improvement in medication adherence at 12 months.

Effect of dynamic high pressure on emulsifying and encapsulant properties of cashew tree gum.

PubMed

Porto, Bruna Castro; Cristianini, Marcelo

2018-04-15

Dynamic high pressure (DHP) has been applied in the physical modification of biopolymers as polysaccharides, proteins and gums. It is known that DHP is able to promote degradation of polysaccharides (e.g. molecular weight reduction). However, few studies have assessed the effect of DHP on the emulsifying and encapsulating properties of polysaccharides. Thus, this study aimed to investigate the effect of DHP on the emulsifying (average droplet size and particle size distribution, optical and confocal scanning laser microscopy, rheology, zeta potential and electric conductivity, creaming index, and turbidity) and encapsulating (scanning electronic microscopy, flavor retention, average droplet size, and particle size distribution) properties of cashew tree gum (CG). The application of DHP process improved the emulsifying capacity of cashew tree gum (CG) by reducing the medium droplet size (D3,2 and D4,3), increasing the turbidity and improving the emulsion stability. However, no effect of DHP was observed on the encapsulating capacity of CG. Copyright © 2018 Elsevier Ltd. All rights reserved.

Dehaloperoxidase-Hemoglobin from Amphitrite ornata Is Primarily a Monomer in Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

M Thompson; S Franzen; M Davis

2011-12-31

The crystal structures of the dehaloperoxidase-hemoglobin from A. ornata (DHP A) each report a crystallographic dimer in the unit cell. Yet, the largest dimer interface observed is 450 {angstrom}{sup 2}, an area significantly smaller than the typical value of 1200-2000 {angstrom}{sup 2} and in contrast to the extensive interface region of other known dimeric hemoglobins. To examine the oligomerization state of DHP A in solution, we used gel permeation by fast protein liquid chromatography and small-angle X-ray scattering (SAXS). Gel permeation experiments demonstrate that DHP A elutes as a monomer (15.5 kDa) and can be separated from green fluorescent protein,more » which has a molar mass of 27 kDa, near the 31 kDa expected for the DHP A dimer. By SAXS, we found that DHP A is primarily monomeric in solution, but with a detectable level of dimer (10%), under all conditions studied up to a protein concentration of 3.0 mM. These concentrations are likely 10-100-fold lower than the K{sub d} for dimer formation. Additionally, there was no significant effect either on the overall conformation of DHP A or its monomer-dimer equilibrium upon addition of the DHP A inhibitor, 4-iodophenol.« less

Role of L-type Ca2+ channel isoforms in the extinction of conditioned fear.

PubMed

Busquet, Perrine; Hetzenauer, Alfred; Sinnegger-Brauns, Martina J; Striessnig, Jörg; Singewald, Nicolas

2008-05-01

Dihydropyridine (DHP) L-type Ca(2+) channel (LTCC) antagonists, such as nifedipine, have been reported to impair the extinction of conditioned fear without interfering with its acquisition. Identification of the LTCC isoforms mediating this DHP effect is an essential basis to reveal their role as potential drug targets for the treatment of specific anxiety disorders. Ca(V)1.2 and Ca(V)1.3 are the predominant LTCCs in the mammalian brain. However, since no isoform-selective DHP blockers are available, their individual contribution to fear memory extinction is unknown. We used a novel mouse model expressing DHP-insensitive Ca(V)1.2 LTCCs (Ca(V)1.2DHP(-/-) mice) to address this question. In line with previous studies, wild-type (WT) mice treated with systemic nifedipine displayed markedly impaired fear extinction. This DHP effect was completely abolished in Ca(V)1.2DHP(-/-) mice, indicating that it is mediated by Ca(V)1.2, but not by Ca(V)1.3 LTCCs. Supporting this conclusion, Ca(V)1.3-deficient mice (Ca(V)1.3(-/-)) showed extinction identical to the respective WT mice. The inhibition of fear extinction was not observed after intracerebroventricular (i.c.v.) application of different doses of nifedipine, suggesting that this effect is secondary to inhibition of peripheral Ca(V)1.2 channels. The LTCC activator BayK, which lacks neurotoxic effects in Ca(V)1.2DHP(-/-) mice, did not influence the extinction time course. In summary, we demonstrate that LTCC signaling through the Ca(V)1.2 isoform of LTCCs interferes with fear memory extinction, presumably via a peripherally mediated mechanism. Activation of other LTCC isoforms (predominantly Ca(V)1.3) is not sufficient to accelerate extinction of conditioned fear in mice.

Polymyxin-B immobilized column-direct hemoperfusion for adolescent toxic shock syndrome.

PubMed

Nanishi, Etsuro; Hirata, Yuichirou; Lee, Sooyoung; Kaku, Noriyuki; Momii, Kenta; Kubota, Kensuke; Nishio, Hisanori; Maehara, Yoshihiko; Hara, Toshiro

2016-10-01

Toxic shock syndrome (TSS) is a critical illness associated with toxin from Staphylococcus aureus. Despite recent advances in critical care, mortality remains high and additional effective therapy is required. We report an adolescent case of TSS successfully treated with direct hemoperfusion using polymyxin-B immobilized fiber (PMX-DHP). The patient with spina bifida also had ischial pressure ulcer, and developed TSS associated with methicillin-resistant S. aureus. Despite conventional treatment, the patient developed refractory shock, which was immediately improved with PMX-DHP. PMX-DHP has been widely used for the treatment of sepsis to remove circulating endotoxins produced by Gram-negative bacteria, but beneficial effects have also been reported for Gram-positive bacterial infection. To our knowledge, this is the first report on PMX-DHP for TSS in an adolescent patient, and we propose that PMX-DHP could be a new treatment strategy for severe TSS in children as well. © 2016 Japan Pediatric Society.

Detection of ruminal bacteria that degrade toxic dihydroxypyridine compounds produced from mimosine.

PubMed Central

Allison, M J; Hammond, A C; Jones, R J

1990-01-01

Leucaena leucocephala, a tropical leguminous shrub, contains a toxic amino acid, mimosine. Successful utilization of leucaena as a ruminant forage depends on colonization of the rumen by bacteria that degrade dihydroxypyridines (DHP), which are toxic intermediates in the metabolism of mimosine. Populations in the rumina of animals in some parts of the world, however, do not include bacteria that are able to carry out this degradation. We thus describe tests for the presence of DHP degraders in ruminal populations that are based on degradation (loss) of DHP compounds from culture media. Results obtained with the tests indicate that DHP degraders were not part of microbial populations in the rumina of cattle, sheep, and goats in Iowa, while most rumen samples examined from animals from the Virgin Islands and Haiti contained DHP degraders. These results confirm and extend the findings of others about geographic limits to the distribution of these important ruminal bacteria. PMID:2317038

Diffusional dynamics of an active rhodamine-labeled 1,4-dihydropyridine in sarcolemmal lipid multibilayers.

PubMed Central

Mason, R P; Chester, D W

1989-01-01

A "membrane bilayer pathway" model, involving ligand partition into the bilayer, lateral diffusion, and receptor binding has been invoked to describe the 1,4-dihydropyridine (DHP) calcium channel antagonist receptor binding mechanism. In an earlier study (Chester et al. 1987. Biophys. J. 52:1021-1030), the diffusional component of this model was examined using an active fluorescence labeled DHP calcium channel antagonist, nisoldipine-lissamine rhodamine B (Ns-R), in purified cardiac sarcolemmal (CSL) lipid multibilayers. Diffusion coefficient measurements on membrane-bound drug and phospholipid at maximum bilayer hydration yielded similar values (3.8 x 10(-8) cm2/s). However, decreases in bilayer hydration resulted in dramatically reduced diffusion coefficient values for both probes with substantially greater impact on Ns-R diffusion. These data suggested that hydration dependent diffusional differences could be a function of relative probe location along the bilayer normal. In this communication, we have addressed the relative effect of the rhodamine substituent on Ns-R diffusion complex by examining the diffusional dynamics of free rhodamine B under the same conditions used to evaluate Ns-R complex and phospholipid diffusion. X-ray diffraction studies were performed to determine the Ns-R location in the membrane and model the CSL lipid bilayer profile structure to give a rationale for the differences in probe diffusional dynamics as a function of interbilayer water space. PMID:2611332

Influence of heme environment structure on dioxygen affinity for the dual function Amphitrite ornata hemoglobin/dehaloperoxidase. Insights into the evolutional structure-function adaptations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Shengfang; Sono, Masanori; Wang, Chunxue

Sea worm, Amphitrite ornata, has evolved its globin (an O 2 carrier) also to serves as a dehaloperoxidase (DHP) to detoxify haloaromatic pollutants generated by competing species. A previous mutagenesis study by our groups on both DHP and sperm whale myoglobin (SW Mb) revealed some structural factors that influence the dehaloperoxidase activities (significantly lower for Mb) of both proteins. Using an isocyanide/O 2 partition constant measurement method in this study, we have examined the effects of these structural factors on the O 2 equilibrium constants (K O2) of DHP, SW Mb, and their mutants. A clear trend of decreasing Omore » 2 affinity and increasing catalytic activity along with the increase in the distal His N ε–heme iron distance is observed. An H93K/T95H Mb double mutant mimicking the DHP proximal His positioning exhibited markedly enhanced O 2 affinity, confirming the essential effect of proximal His rotation on the globin function of DHP. For DHP, the L100F, T56G and M86E variants showed the effects of distal volume, distal His flexibility and proximal electronic push, respectively, on the O 2 affinity. This study provides insights into how DHP has evolved its heme environment to gain significantly enhanced peroxidase capability without compromising its primary function as an O 2 carrier.« less

A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe

PubMed Central

Tucker, James Franklin; Ohle, Corina; Schermann, Géza; Bendrin, Katja; Zhang, Wei; Fischer, Tamás; Zhang, Ke

2016-01-01

Epigenetic gene silencing plays a critical role in regulating gene expression and contributes to organismal development and cell fate acquisition in eukaryotes. In fission yeast, Schizosaccharomyces pombe, heterochromatin-associated gene silencing is known to be mediated by RNA processing pathways including RNA interference (RNAi) and a 3’-5’ exoribonuclease complex, the exosome. Here, we report a new RNA-processing pathway that contributes to epigenetic gene silencing and assembly of heterochromatin mediated by 5’-3’ exoribonuclease Dhp1/Rat1/Xrn2. Dhp1 mutation causes defective gene silencing both at peri-centromeric regions and at the silent mating type locus. Intriguingly, mutation in either of the two well-characterized Dhp1-interacting proteins, the Din1 pyrophosphohydrolase or the Rhn1 transcription termination factor, does not result in silencing defects at the main heterochromatic regions. We demonstrate that Dhp1 interacts with heterochromatic factors and is essential in the sequential steps of establishing silencing in a manner independent of both RNAi and the exosome. Genomic and genetic analyses suggest that Dhp1 is involved in post-transcriptional silencing of repetitive regions through its RNA processing activity. The results describe the unexpected role of Dhp1/Rat1/Xrn2 in chromatin-based silencing and elucidate how various RNA-processing pathways, acting together or independently, contribute to epigenetic regulation of the eukaryotic genome. PMID:26889830

Isolation and characterization of mimosine, 3, 4 DHP and 2, 3 DHP degrading bacteria from a commercial rumen inoculum.

PubMed

Derakhshani, Hooman; Corley, Sean W; Al Jassim, Rafat

2016-05-01

The presence of the toxic amino acid mimosine in Leucaena leucocephala restricts its use as a protein source for ruminants. Rumen bacteria degrade mimosine to 3,4- and 2,3-dihydroxypyridine (DHP), which remain toxic. Synergistes jonesii is believed to be the main bacterium responsible for degradation of these toxic compounds but other bacteria may also be involved. In this study, a commercial inoculum provided by the Queensland's Department of Agriculture, Fisheries, and Forestry was screened for isolation and characterization of mimosine, 3,4- and 2,3-DHP degrading bacterial strains. A new medium for screening of 2,3-DHP degrading bacteria was developed. Molecular and biochemical approaches used in this study revealed four bacterial isolates - Streptococcus lutetiensis, Clostridium butyricum, Lactobacillus vitulinus, and Butyrivibrio fibrisolvens - to be able to completely degrade mimosine within 7 days of incubation. It was also observed that C. butyricum and L. vitulinus were able to partially degrade 2,3-DHP within 12 days of incubation, while S. lutetiensis, was able to fully degrade both 3,4 and 2,3 DHP. Collectively, we concluded that S. jonesii is not the sole bacterium responsible for detoxification of Leucaena. Comprehensive screening of rumen fluid of cattle grazing on Leucaena pastures is needed to identify additional mimosine-detoxifying bacteria and contribute to development of more effective inoculums to be used by farmers against Leucaena toxicity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficacy and Safety of Rivaroxaban Versus Warfarin in Patients Taking Nondihydropyridine Calcium Channel Blockers for Atrial Fibrillation (from the ROCKET AF Trial).

PubMed

Washam, Jeffrey B; Hellkamp, Anne S; Lokhnygina, Yuliya; Piccini, Jonathan P; Berkowitz, Scott D; Nessel, Christopher C; Becker, Richard C; Breithardt, Günter; Fox, Keith A A; Halperin, Jonathan L; Hankey, Graeme J; Mahaffey, Kenneth W; Singer, Daniel E; Patel, Manesh R

2017-08-15

Non-dihydropyridine calcium channel blockers (non-DHP CCBs) possess combined P-glycoprotein and moderate CYP3A4 inhibition, which may lead to increased exposure of medications that are substrates for these metabolic pathways, such as rivaroxaban. We evaluated the use and outcomes of non-DHP CCBs in patients with atrial fibrillation (AF) in Rivaroxaban Once Daily Oral Direct Factor Xa Inhibition Compared with Vitamin K Antagonism for Prevention of Stroke and Embolism Trial in Atrial Fibrillation (ROCKET AF). We assessed clinical outcomes in patients who received non-DHP CCBs and the impact on the efficacy and safety of rivaroxaban compared with warfarin. Stroke or noncentral nervous system (CNS) systemic embolism (SE), major or nonmajor clinically relevant (NMCR) bleeding, all-cause death, and major bleeding were compared according to non-DHP CCB use. At randomization, 1,308 patients (9.2%) were taking a non-DHP CCB. They were more likely to be women, have diabetes and COPD, and less likely to have heart failure and had a lower mean CHADS 2 score (3.3 vs 3.5). Non-DHP CCB use was not associated with an increased risk of stroke/non-CNS SE (p = 0.11) or the composite outcome of NMCR or major bleeding (p = 0.087). Non-DHP CCB use was associated with an increased risk of major bleeding (adjusted hazard ratio 1.50, 95% CI 1.11 to 2.04) and intracranial hemorrhage (adjusted hazard ratio 2.84, 95% CI 1.53 to 5.29). No significant difference was observed in the primary efficacy (stroke or non-CNS SE; adjusted interaction p value = 0.38) or safety outcome (NMCR or major bleeding; adjusted interaction p value = 0.14) between rivaroxaban and warfarin with non-DHP CCB use. In conclusion, although the overall use of non-DHP CCBs was associated with an increased risk of major bleeding and intracranial hemorrhage, the use was not associated with a significant change in the safety or efficacy of rivaroxaban compared with warfarin observed in ROCKET AF. Copyright © 2017 Elsevier Inc. All rights reserved.

Efficacy and safety findings from DREAM: a phase III study of DHP107 (oral paclitaxel) versus i.v. paclitaxel in patients with advanced gastric cancer after failure of first-line chemotherapy.

PubMed

Kang, Y-K; Ryu, M-H; Park, S H; Kim, J G; Kim, J W; Cho, S-H; Park, Y-I; Park, S R; Rha, S Y; Kang, M J; Cho, J Y; Kang, S Y; Roh, S Y; Ryoo, B-Y; Nam, B-H; Jo, Y-W; Yoon, K-E; Oh, S C

2018-05-01

Paclitaxel is currently only available as an intravenous (i.v.) formulation. DHP107 is a novel oral formulation of lipid ingredients and paclitaxel. DHP107 demonstrated comparable efficacy, safety, and pharmacokinetics to i.v. paclitaxel as a second-line therapy in patients with advanced gastric cancer (AGC). DREAM is a multicenter, open-label, prospective, randomized phase III study of patients with histologically/cytologically confirmed, unresectable/recurrent AGC after first-line therapy failure. Patients were randomized 1 : 1 to DHP107 (200 mg/m2 orally twice daily days 1, 8, 15 every 4 weeks) or i.v. paclitaxel (175 mg/m2 day 1 every 3 weeks). Patients were stratified by Eastern Cooperative Oncology Group performance status, disease status, and prior treatment; response was assessed (Response Evaluation Criteria in Solid Tumors) every 6 weeks. Primary end point: non-inferiority of progression-free survival (PFS); secondary end points: overall response rate (ORR), overall survival (OS), and safety. For the efficacy analysis, sequential tests for non-inferiority were carried out, first with a non-inferiority margin of 1.48, then with a margin of 1.25. Baseline characteristics were balanced in the 236 randomized patients (n = 118 per arm). Median PFS (per-protocol) was 3.0 (95% CI 1.7-4.0) months for DHP107 and 2.6 (95% CI 1.8-2.8) months for paclitaxel (hazard ratio [HR] = 0.85; 95% CI 0.64-1.13). A sensitivity analysis on PFS using independent central review showed similar results (HR = 0.93; 95% CI 0.70-1.24). Median OS (full analysis set) was 9.7 (95% CI 7.1 - 11.5) months for DHP107 versus 8.9 (95% CI 7.1-12.2) months for paclitaxel (HR = 1.04; 95% CI 0.76-1.41). ORR was 17.8% for DHP107 (CR 4.2%; PR 13.6%) versus 25.4% for paclitaxel (CR 3.4%; PR 22.0%). Nausea, vomiting, diarrhea, and mucositis were more common with DHP107; peripheral neuropathy was more common with paclitaxel. There were only few Grade≥3 adverse events, most commonly neutropenia (42% versus 53%); febrile neutropenia was reported infrequently (5.9% versus 2.5%). No hypersensitivity reactions occurred with DHP107 (paclitaxel 2.5%). DHP107 as a second-line treatment of AGC was non-inferior to paclitaxel for PFS; other efficacy and safety parameters were comparable. DHP107 is the first oral paclitaxel with proven efficacy/safety for the treatment of AGC. NCT01839773.

Dendrobium huoshanense polysaccharide prevents ethanol-induced liver injury in mice by metabolomic analysis.

PubMed

Wang, Xiao-Yu; Luo, Jian-Ping; Chen, Rui; Zha, Xue-Qiang; Pan, Li-Hua

2015-01-01

The prevalence of alcohol consumption has increased in modern dietary life and alcoholic liver injury can follow. Dendrobium huoshanense polysaccharide (DHP) is a homogeneous polysaccharide isolated from Dendrobium huoshanense, which possesses hepatoprotection function. In this study, we investigated the metabolic profiles of serum and liver tissues extracts from control, ethanol-treated and DHP\\ethanol-treated mice using a UHPLC/LTQ Orbitrap XL MS-based metabolomics approach. Our results indicated that DHP alleviated early steatosis and inflammation in liver histology and the metabolomic analysis of serum and hepatic tissue revealed that first, ethanol treatment mainly altered phosphatidylcholines (PCs) including PC (13:0) and phosphocholine, arachidonic acid metabolites including 20-ethyl PGF2α and amino acids including L-Proline; Second, DHP supplementation ameliorated the altered metabolic levels particularly involved in phosphocholine and L-Proline. These data suggested that DHP might restore the perturbed metabolism pathways by ethanol exposure to prevent the progression of alcoholic liver injury. Copyright © 2015 Elsevier B.V. All rights reserved.

Human Cell Line Activation Test of the Novel Energetics Methyl Trinitropryrazol (MTNP) and 1,3-Dimethylhexahydropyrimidine (DHP)

DTIC Science & Technology

2017-11-01

costs, conserve physical resources, and sustain the health of those potentially exposed. The U.S. Army RDECOM, ETAP has been dedicated to finding...trinitropryrazol (MTNP) and 1,3-dimethylhexahydropyrimidine (DHP) Prepared by: Emily Reinke, Ph.D. Health Effects Division Toxicology...the Novel Energetics methyl trinitropyrazol (MTNP) and 1,3-dimethylhexahydropyrimidine (DHP) Emily N. Reinke, Ph.D. Army Public Health Center

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Serrano, Vesna; D; Antonio, Jennifer

2012-04-18

As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHP B refined to 1.58 {angstrom} resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distalmore » and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure-function relationships.« less

Cytochrome P450scc-dependent metabolism of 7-dehydrocholesterol in placenta and epidermal keratinocytes

PubMed Central

Slominski, Andrzej T.; Kim, Tae-Kang; Chen, Jianjun; Nguyen, Minh N.; Li, Wei; Yates, Charles R.; Sweatman, Trevor; Janjetovic, Zorica; Tuckey, Robert C.

2012-01-01

The discovery that 7-dehydrocholesterol (7DHC) is an excellent substrate for cytochrome P450scc (CYP11A1) opens up new possibilities in biochemistry. To elucidate its biological significance we tested ex-vivo P450scc-dependent metabolism of 7DHC by tissues expressing high and low levels of P450scc activity, placenta and epidermal keratinocytes, respectively. Incubation of human placenta fragments with 7DHC led to its conversion to 7-dehydropregnenolone (7DHP), which was inhibited by DL-aminoglutethimide, and stimulated by forskolin. Final proof for P450scc involvement was provided in isolated placental mitochondria where production of 7DHP was almost completely inhibited by 22R-hydroxycholesterol. 7DHC was metabolized by placental mitochondria at a faster rate than exogenous cholesterol, under both limiting and saturating conditions of substrate transport, consistent with higher catalytic efficiency (kcat/Km) with 7DHC as substrate than with cholesterol. Ex-vivo experiments showed five 5,7-dienal intermediates with MS spectra of dihydroxy and mono-hydroxy-7DHC and retention time corresponding to 20,22(OH)27DHC and 22(OH)7DHC. The chemical structure of 20,22(OH)27DHC was defined by NMR. 7DHP was further metabolized by either placental fragments or placental microsomes to 7-dehydroprogesterone as defined by UV, MS and NMR, and to an additional product with a 5,7-dienal structure and MS corresponding to hydroxy-7DHP. Furthermore, epidermal keratinocytes transformed either exogenous or endogenous 7DHC to 7DHP. 7DHP inhibited keratinocytes proliferation, while the product of its pholytic transformation, pregcalciferol, lost this capability. In conclusion, tissues expressing P450scc can metabolize 7DHC to biologically active 7DHP with 22(OH)7DHC and 20,22(OH)27DHC serving as intermediates, and with further metabolism to 7-dehydroprogesterone and (OH)7DHP. PMID:22877869

Solubilization, partial purification, and properties of omega-conotoxin receptors associated with voltage-dependent calcium channels from rat brain synaptosomes.

PubMed

Rosenberg, R L; Isaacson, J S; Tsien, R W

1989-01-01

These experiments provide a starting point for biochemical characterization of Ca channels from neuronal membranes, using omega-CgTX as a specific marker. The purification of the omega-CgTX receptors is far from complete. Each of the purification steps described results in only a two- to fivefold enrichment of the receptor proteins, and is accompanied by a loss of receptor concentration and stability, so the maximal specific activity achieved by a combination of these steps falls several orders of magnitude short of that of a large, homogeneous, active protein. Nevertheless, these studies have yielded important information about the omega-CgTX receptor. The Stokes' radius, determined from gel exclusion chromatography, is approximately 87 A, and the sedimentation coefficient, determined from sucrose gradient sedimentation, is approximately 19 S. These values are similar to those found for the DHP receptors solubilized in digitonin. We have also found that at least some of the omega-CgTX receptors have complex carbohydrate moieties that are recognized by WGA, together with evidence of heterogeneity of receptor glycosylation. Additionally, we have been able to use the solubilized, partially purified receptors in cross-linking experiments to tentatively identify the molecular weights of the omega-CgTX targets from rat brain. A large peptide of approximately 300 kDa, similar to that identified in photoaffinity studies, is very clearly labeled by the chemical incorporation of [125I]omega-CgTX into partially purified receptor preparations, but some ambiguity remains because of the faint labeling of peptides in the 120-170-kDa range. The approximately 300-kDa peptide is much larger than any single peptide component of DHP receptors from skeletal muscle, and it may be related to a molecular combination of the 170-kDa and 135-kDa subunits of the DHP receptor. Because [125I]omega-CgTX presumably labels both N- and L-type neuronal Ca channels, both channel types will probably be found in the purified preparations. Thus, at some time, it will be necessary to separate DHP-sensitive L-type channels from preparations of L- and N-type channels identified by omega-CgTX binding.

Cost-effectiveness of dihydroartemisinin-piperaquine compared with artemether-lumefantrine for treating uncomplicated malaria in children at a district hospital in Tanzania.

PubMed

Mori, Amani T; Ngalesoni, Frida; Norheim, Ole F; Robberstad, Bjarne

2014-09-15

Dihydroartemisinin-piperaquine (DhP) is highly recommended for the treatment of uncomplicated malaria. This study aims to compare the costs, health benefits and cost-effectiveness of DhP and artemether-lumefantrine (AL) alongside "do-nothing" as a baseline comparator in order to consider the appropriateness of DhP as a first-line anti-malarial drug for children in Tanzania. A cost-effectiveness analysis was performed using a Markov decision model, from a provider's perspective. The study used cost data from Tanzania and secondary effectiveness data from a review of articles from sub-Saharan Africa. Probabilistic sensitivity analysis was used to incorporate uncertainties in the model parameters. In addition, sensitivity analyses were used to test plausible variations of key parameters and the key assumptions were tested in scenario analyses. The model predicts that DhP is more cost-effective than AL, with an incremental cost-effectiveness ratio (ICER) of US$ 12.40 per DALY averted. This result relies on the assumption that compliance to treatment with DhP is higher than that with AL due to its relatively simple once-a-day dosage regimen. When compliance was assumed to be identical for the two drugs, AL was more cost-effective than DhP with an ICER of US$ 12.54 per DALY averted. DhP is, however, slightly more likely to be cost-effective compared to a willingness-to-pay threshold of US$ 150 per DALY averted. Dihydroartemisinin-piperaquine is a very cost-effective anti-malarial drug. The findings support its use as an alternative first-line drug for treatment of uncomplicated malaria in children in Tanzania and other sub-Saharan African countries with similar healthcare infrastructures and epidemiology of malaria.

A New Glutathione Conjugate of the Pyrrolizidine Alkaloids Produced by Human Cytosolic Enzyme Dependent Reactions in vitro.

PubMed

Muluneh, Fashe; Häkkinen, Merja R; El-Dairi, Rami; Pasanen, Markku; Juvonen, Risto O

2018-05-22

The toxic metabolites of pyrrolizidine alkaloids (PAs) are initially formed by cytochrome P450 mediated oxidation reactions and primarily eliminated as glutathione (GSH) conjugates. Although the reaction between the reactive metabolites and GSH can occur spontaneously, the role of the cytosolic enzymes in the process has not been studied. The toxic metabolites of selected PAs (retrorsine, monocrotaline, senecionine, lasiocarpine, heliotrine or senkirkine) were generated by incubating them in 100 mM phosphate buffer pH 7.4 containing liver microsomes of human, pig, rat or sheep, NADPH and reduced GSH in the absence or presence of human, pig, rat or sheep liver cytosolic fraction. The supernatants were analyzed by using liquid chromatography connected to Finnigan LTQ ion-trap, Agilent QTOF or Thermo Scientific Q Exactive Focus quadrupole-orbitrap mass spectrometers. Retrorsine, senecionine and lasiocarpine yielded three GSH conjugates producing [M-H] - ions at m/z 439 (7-GSH-DHP(CHO)), m/z 441 (7-GSH-DHP(OH)) and m/z 730 (7,9-diGSH-DHP) in the presence of human liver cytosolic fraction. 7-GSH-DHP(CHO) was a novel metabolite. Monocrotaline, heliotrine and senkirkine did not produce this novel 7-GSH-DHP(CHO) conjugate. 7-GSH-DHP(CHO) disappeared when incubated with hydroxylamine, and a new oxime derivative was formed. This metabolite was formed only by the human liver cytosolic enzymes but not in the presence of rat or sheep liver cytosolic fractions under otherwise identical reaction conditions. 7-GSH-DHP(CHO) has not been reported before and thus, it was considered as a novel metabolite of PAs. This may clarify the mechanisms involved in PA detoxification and widely observed but less understood species differences in response to PA exposure. This article is protected by copyright. All rights reserved.

A novel positive allosteric modulator of the GABAA receptor: the action of (+)-ROD188

PubMed Central

Thomet, Urs; Baur, Roland; Razet, Rodolphe; Dodd, Robert H; Furtmüller, Roman; Sieghart, Werner; Sigel, Erwin

2000-01-01

(+)-ROD188 was synthesized in the search for novel ligands of the GABA binding site. It shares some structural similarity with bicuculline. (+)-ROD188 failed to displace [3H]-muscimol in binding studies and failed to induce channel opening in recombinant rat α1β2γ2 GABAA receptors functionally expressed in Xenopus oocytes. (+)-ROD188 allosterically stimulated GABA induced currents. Displacement of [3H]-Ro15-1788 indicated a low affinity action at the benzodiazepine binding site. In functional studies, stimulation by (+)-ROD188 was little sensitive to the presence of 1 μM of the benzodiazepine antagonist Ro 15-1788, and (+)-ROD188 also stimulated currents mediated by α1β2, indicating a major mechanism of action different from that of benzodiazepines. Allosteric stimulation by (+)-ROD188 was similar in α1β2N265S as in unmutated α1β2, while that by loreclezole was strongly reduced. (+)-ROD188 also strongly stimulated currents elicited by either pentobarbital or 5α-pregnan-3α-ol-20-one (3α-OH-DHP), in line with a mode of action different from that of barbiturates or neurosteroids as channel agonists. Stimulation by (+)-ROD188 was largest in α6β2γ2 (α6β2γ2>>α1β2γ2=α5β2γ2>α2β2γ2= α3β2γ2), indicating a unique subunit isoform specificity. Miniature inhibitory postsynaptic currents (mIPSC) in cultures of rat hippocampal neurons, caused by spontaneous release of GABA showed a prolonged decay time in the presence of 30 μM (+)-ROD188, indicating an enhanced synaptic inhibitory transmission. PMID:11030736

Evaluation of the diabetes health plan to improve diabetes care and prevention.

PubMed

Duru, O Kenrik; Mangione, Carol M; Chan, Charles; Keckhafer, Abigail; Kimbro, Lindsay; Kirvan, K Anya; Turk, Norman; Luchs, Robert; Li, Jinnan; Ettner, Susan

2013-01-01

Investigators from the University of California, Los Angeles (UCLA), and members of the leadership and data analysis teams at UnitedHealthcare (UHC) are partnering to evaluate the Diabetes Health Plan (DHP), an innovative disease-specific insurance product designed by UHC specifically for patients with prediabetes or diabetes. The DHP provides improved access to care management, telephone coaching, and enhanced Internet-based communication with enrollees. The evaluation will use a quasi-experimental design, comparing patients from employer groups that offer the DHP with patients from groups that do not, to determine the effect of the DHP on incidence of diabetes, adherence to metformin, and costs of care among patients with prediabetes. Other factors studied will be cardiovascular risk factor control, adherence to preventive services, health care use, and costs of care among patients with existing diabetes.

[Protective effects of polysaccharides from Dendrobium huoshanense on CCl4-induced acute liver injury in mice].

PubMed

Huang, Jing; Li, Sheng-Li; Zhao, Hong-Wei; Pan, Li-Hua; Sun, Hao-Qiao; Luo, Jian-Ping

2013-02-01

To study the protective effects of polysaccharides from Dendrobium huoshanense (DHP) against CCl4-induced liver injury in mice. Eighty male Kunming mice were randomly divided into normal control group, model control group, dextran control group, starch control group, hydrolyzate control group, three different dose of DPH groups consisting of high-dosage group, middle-dosage group and low-dosage group (200, 100, 50 mg x kg(-1)). Each group contained ten mice. The mice were treated with DHP via intragastric administration for 15 days before treatment of 50% CCl4 in olive oil for consecutive two days. Both alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in serum and superoxide dismutase (SOD) activities and malondialdehyde (MDA) contents in liver tissues were determined in all groups. Immunohistochemistry was used to detect the expression of TNF-alpha in hepatic tissue. Hepatic histopathological examination was observed. DHP effectively decreased the activities of ALT and AST in serum and the contents of hepatic MDA, and restored hepatic SOD activities in acute liver injury mice. Liver tissue damage induced by CCl4 was ameliorated in mice with DHP administration through histopathology examination. Furthermore, the expression of TNF-alpha was greatly decreased in groups treated with polysaccharides. DHP has a significantly hepatoprotective effect on CCl4-induced acute liver injury in mice. Protective effect of DHP on the liver may be related to its function of scavenging free radicals and inhibiting lipid peroxidation and TNF-alpha expression.

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serrano, Vesna de; D’Antonio, Jennifer; Franzen, Stefan

2010-05-01

The crystal structure of dehaloperoxidase (DHP) isoenzyme B from the terebellid polychaete A. ornata, which exhibits both hemoglobin and peroxidase functions, has been determined at 1.58 Å resolution. As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHPmore » B refined to 1.58 Å resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distal and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure–function relationships.« less

New Whole-House Solutions Case Study: Testing Ductless Heat Pumps in High-Performance Affordable Housing, the Woods at Golden Given - Tacoma, Washington

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2015-06-01

The Woods is a 30-home, high- performance, energy efficient sustainable community built by Habitat for Humanity (HFH). With Support from Tacoma Public Utilities, Washington State University (part of the Building America Partnership for Improved Residential Construction) is researching the energy performance of these homes and the ductless heat pumps (DHP) they employ. This project provides Building America with an opportunity to: field test HVAC equipment, ventilation system air flows, building envelope tightness, lighting, appliance, and other input data that are required for preliminary Building Energy Optimization (BEopt™) modeling and ENERGY STAR® field verification; analyze cost data from HFH and othermore » sources related to building-efficiency measures that focus on the DHP/hybrid heating system and heat recovery ventilation system; evaluate the thermal performance and cost benefit of DHP/hybrid heating systems in these homes from the perspective of homeowners; compare the space heating energy consumption of a DHP/electric resistance (ER) hybrid heating system to that of a traditional zonal ER heating system; conduct weekly "flip-flop tests" to compare space heating, temperature, and relative humidity in ER zonal heating mode to DHP/ER mode.« less

Effect of dynamic high pressure on technological properties of cashew tree gum (Anacardium occidentale L.).

PubMed

Porto, Bruna Castro; Augusto, Pedro E D; Terekhov, Anton; Hamaker, Bruce R; Cristianini, Marcelo

2015-09-20

Dynamic high pressure (DHP) appears to be an alternative approach to physical modification of polysaccharides aimed improving their technological properties. Therefore, its effect on the functional properties of polysaccharides (i.e., oil absorption capacity, emulsifier, and rheology) needs to be investigated. Cashew tree gum (CG) is a biological macromolecule that has been proposed to be used as an emulsifier in beverage emulsions. To the best of our knowledge, none of the articles in the literature investigates the effect of DHP on the CG properties. This work presents a study on the evaluation of the effects of DHP on functional characteristics of CG, including rheological properties, molecular weight, glycosyl-linkage analysis, solubility, swelling and oil absorption capacity (OAC). The results suggest that DHP is able to modify the technological properties of cashew tree gum (increasing solubility and decreasing apparent viscosity). Copyright © 2015 Elsevier Ltd. All rights reserved.

Blockage of progestin physiology disrupts ovarian differentiation in XX Nile tilapia (Oreochromis niloticus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Linyan; Luo, Feng; Fang, Xuelian

Previous studies indicated that maturation inducing hormone, 17α, 20β-Dihydroxy-4-pregnen-3-one (DHP), probably through nuclear progestin receptor (Pgr), might be involved in spermatogenesis and oogenesis in fish. To further elucidate DHP actions in teleostean ovarian differentiation, we analyzed the expression of pgr in the ovary of Nile tilapia (Oreochromis niloticus), and performed RU486 (a synthetic Pgr antagonist) treatment in XX fish from 5 days after hatching (dah) to 120dah. Tilapia Pgr was abundantly expressed in the follicular cells surrounding oocytes at 30 and 90dah. Continuous RU486 treatment led to the blockage of oogenesis and masculinization of somatic cells in XX fish. Terminationmore » of RU486 treatment and maintenance in normal condition resulted in testicular differentiation, and estrogen compensation in RU486-treated XX fish successfully restored oogenesis. In RU486-treated XX fish, transcript levels of female dominant genes were significantly reduced, while male-biased genes were evidently augmented. Meanwhile, both germ cell mitotic and meiotic markers were substantially reduced. Consistently, estrogen production levels were significantly declined in RU486-treated XX fish. Taken together, our data further proved that DHP, possibly through Pgr, might be essential in the ovarian differentiation and estrogen production in fish. - Highlights: • DHP plays a critical role in early stage oogenesis of XX tilapia. • Blockage of DHP actions by RU486 treatment led to masculinization and/or sex reversal in XX tilapia. • Both DHP and estrogen are indispensable for ovarian differentiation.« less

Efficacy and safety of artemisinin-naphthoquine versus dihydroartemisinin-piperaquine in adult patients with uncomplicated malaria: a multi-centre study in Indonesia

PubMed Central

2012-01-01

Background A practical and simple regimen for all malaria species is needed towards malaria elimination in Indonesia. It is worth to compare the efficacy and safety of a single dose of artemisinin-naphthoquine (AN) with a three-day regimen of dihydroartemisinin-piperaquine (DHP), the existing programme drug, in adults with uncomplicated symptomatic malaria. Methods This is a phase III, randomized, open label using sealed envelopes, multi-centre, comparative study between a single dose of AN and a three-day dose of DHP in Jayapura and Maumere. The modified WHO inclusion and exclusion criteria for efficacy study were used in this trial. A total of 401 eligible adult malaria subjects were hospitalized for three days and randomly treated with AN four tablets single dose on day 0 or DHP three to four tablets single daily dose for three days, and followed for 42 days for physical examination, thick and thin smears microscopy, and other necessary tests. The efficacy of drug was assessed by polymerase chain reaction (PCR) uncorrected and corrected. Results There were 153 Plasmodium falciparum, 158 Plasmodium vivax and 90 P. falciparum/P. vivax malaria. Mean of fever clearance times were similar, 13.0 ± 10.3 hours in AN and 11.3 ± 7.3 hours in DHP groups. The mean of parasite clearance times were longer in AN compared with DHP (28.0 ± 11.7 hours vs 25.5 ± 12.2 hours, p = 0.04). There were only 12 PCR-corrected P. falciparum late treatment failures: seven in AN and five in DHP groups. The PCR uncorrected and corrected on day −42 of adequate clinical and parasitological responses for treatment of any malaria were 93.7% (95% Cl: 90.3–97.2) and 96.3% (95% Cl: 93.6–99.0) in AN, 96.3% (95% Cl: 93.5–99.0) and 97.3% (95% Cl: 95.0–99.6) in DHP groups. Few and mild adverse events were reported. All the abnormal haematology and blood chemistry values had no clinical abnormality. Conclusion AN and DHP are confirmed very effective, safe and tolerate for treatment of any malaria. Both drugs are promising for multiple first-line therapy policies in Indonesia. PMID:22554203

Hydrogen Bonding: Between Strengthening the Crystal Packing and Improving Solubility of Three Haloperidol Derivatives.

PubMed

Saluja, Hardeep; Mehanna, Ahmed; Panicucci, Riccardo; Atef, Eman

2016-06-01

The purpose of this study is to confirm the impact of polar functional groups on inter and intra-molecular hydrogen bonding in haloperidol (HP) and droperidol (DP) and, hence, their effects on dissolution using a new approach. To confirm our theory, a new molecule: deshydroxy-haloperidol (DHP) was designed and its synthesis was requested from a contract laboratory. The molecule was then studied and compared to DP and HP. Unlike DHP, both the HP and DP molecules have hydrogen donor groups, therefore, DHP was used to confirm the relative effects of the hydrogen donor group on solubility and crystal packing. The solid dispersions of the three structurally related molecules: HP, DP, and DHP were prepared using PVPK30, and characterized using XRPD and IR. A comparative dissolution study was carried out in aqueous medium. The absence of a hydrogen bonding donor group in DHP resulted in an unexpected increase in its aqueous solubility and dissolution rate from solid dispersion, which is attributed to weaker crystal pack. The increased dissolution rate of HP and DP from solid dispersions is attributed to drug-polymer hydrogen bonding that interferes with the drug-drug intermolecular hydrogen bonding and provides thermodynamic stability of the dispersed drug molecules. The drug-drug intermolecular hydrogen bond is the driving force for precipitation and crystal packing.

Enhanced metal loading in SBA-15-type catalysts facilitated by salt addition. Synthesis, characterization and catalytic epoxide alcoholysis activity of molybdenum incorporated porous silica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Budhi, Sridhar; Peeraphatdit, Chorthip; Pylypenko, Svitlana

2014-02-07

We report a novel method to increase the metal loading in SBA-15 silica matrix via direct synthesis. It was demonstrated through the synthesis and characterization of a series of molybdenum containing SBA-15 mesoporous silica catalysts prepared with and without diammonium hydrogen phosphate (DHP) as an additive. Catalysts prepared with DHP show a 2–3 times increase in incorporation of molybdenum in the silica matrix and pore size enlargement. The synthesized catalysts were characterized using nitrogen sorption, X-ray diffraction (XRD), Raman spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and inductively coupled plasma–optical emission spectroscopy (ICP–OES). Themore » catalytic activity of catalysts prepared with DHP for alcoholysis of epoxides was superior than the catalyst prepared without DHP. Alcoholysis of epoxides was demonstrated for a range of alcohols and epoxides under ambient conditions in as little as 30 min with high selectivity.« less

Effect of lignin content on a GH11 endoxylanase acting on glucuronoarabinoxylan-lignin nanocomposites.

PubMed

Boukari, Imen; Rémond, Caroline; O'Donohue, Michael; Chabbert, Brigitte

2012-06-20

The effects of lignin content on the activity and action pattern of GH11 endoxylanase from Thermobacillus xylanilyticus were investigated using in vitro reconstituted non-covalent glucuronoarabinoxylan-model lignin (GAX-DHP) nanocomposites. Four types of nanocomposites were prepared, each displaying different lignin contents. Variations in the DHP (model lignin) polymerization process were induced by increasing the coniferyl alcohol concentration. Examination of the morphology of the nanocomposites revealed globular particles enrobed in a matrix. The size of these particles increased in line with the lignin concentration. Physicochemical characterization of the in vitro reconstituted GAX-DHPs strongly suggested that increased particle size is directly related to the solubility and reactivity of coniferyl alcohol, as reflected by changes in the amount of β-O-4 linkages. Evaluation of the impact of the GH11 endoxylanase on the GAX-DHP nanocomposites revealed a negative correlation between the proportion and organization patterns of DHP in the nanocomposites and enzyme activity. Copyright © 2012 Elsevier Ltd. All rights reserved.

A pilot study: a combined therapy using polymyxin-B hemoperfusion and extracorporeal membrane oxygenation for acute exacerbation of interstitial pneumonia.

PubMed

Itai, Junji; Ohshimo, Shinichiro; Kida, Yoshiko; Ota, Kohei; Iwasaki, Yasumasa; Hirohashi, Nobuyuki; Bonella, Francesco; Guzman, Josune; Costabel, Ulrich; Kohno, Nobuoki; Tanigawa, Koichi

2015-01-05

Direct hemoperfusion with polymyxin B-immobilized fiber (PMX-DHP) might be beneficial for treating acute exacerbation (AE) of interstitial pneumonia (IP). Venovenous extracorporeal membranous oxygenation (VV-ECMO) is an emerging tool to avoid ventilator-induced lung injury. This is a report presenting the first three patients with AE of IP treated with a combined therapy of PMX-DHP and VV-ECMO. Patient 1 was a 68-year-old male with acute interstitial pneumonia, patient 2 a 67-year-old male with AE of idiopathic pulmonary fibrosis, and patient 3 a 61-year-old female with AE of collagen vascular disease-associated interstitial pneumonia. All patients were severely hypoxemic and required mechanical ventilation. A combined therapy using PMX-DHP and VV-ECMO was initiated with support of intravenous corticosteroids and antibiotics. Radiological findings, oxygenation and laboratory findings markedly improved and all patients survived without severe complications. A combined therapy of PMX-DHP and VV-ECMO might be a therapeutic option for AE of IP.

Application of Dilute Hydrogen Peroxide Gas Technology for Continuous Room Decontamination of Multidrug-Resistant Organisms: Negative Results from A Preliminary Experimental Study

PubMed Central

Rutala, William A; Kanamori, Hajime; Gergen, Maria; Sickbert-Bennett, Emily; Anderson, Deverick; Sexton, Daniel; Weber, David J

2017-01-01

Abstract Background Healthcare room environmental surfaces can be frequently and continuously contaminated with multidrug-resistant organisms (MDROs) that can persist in the environment for a prolonged time. Here, we used a dilute hydrogen peroxide (DHP) gas system for continuous room decontamination and experimentally examined the germicidal efficacy of the new technology against MDROs. Methods DHP units were installed in ceilings of a model room and the hallway in front of the room. We tested three test organisms; methicillin-resistant staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus (VRE), and MDR-Acinetobacter baumannii. An estimated 100–500 CFU for each test organism was inoculated and spread separately on each Formica sheet then exposed to DHP gas released into the room air. Triplicate samples were collected at times 0, 1, 3, 5, 6, 7, 24, and 48 hours. Following incubation, the colony forming units (CFU) of the test organisms on each Rodac plate were counted. Two separate experimental trials were performed for all time points. Statistical significance between intervention and control groups at each time point was determined by the Wilcoxon test, and P < 0.05 was considered significant. Results There were no statistical differences in survival between DHP intervention and control groups except data at very few time points for each organism (i.e., for MRSA in Figure 1, P = 0.0063 at 24 hours; for VRE in Figure 2, P = 0.0163 at 1 hour, P = 0.0163 at 3 hours; for MDR-Acinetobacter in in Figure 3, P = 0.0369 at 24 hours). The survival curves between both groups for each organism intersected at around 24 hours. The DHP units maintained a germicidal concentration (<0.3ppm for all runs) that was inadequate, despite attempts to control factors that could interfere with the hydrogen peroxide gas concentration. Conclusion Our preliminary study using DHP demonstrated inactivity against MDROs on room surfaces, likely because we were unable to generate a sufficient germicidal level under our test conditions with the particular DHP units. Additional technologic modifications would be required to maintain stable and effective DHP level for continuous room decontamination in patient rooms. Disclosures D. Sexton, Centers for Disease Control and Prevention: Grant Investigator, Grant recipient. Centers for Disease Control and Prevention Foundation: Grant Investigator, Grant recipient. UpToDate: Collaborator, Royalty Recipient. D. J. Weber, PDI: Consultant, Consulting fee.

Lunar synchronization of in vitro steroidogenesis in ovaries of the golden rabbitfish, Siganus guttatus (Bloch).

PubMed

Rahman, Md Saydur; Takemura, Akihiro; Takano, Kazunori

2002-01-01

To assess the relationship between lunar cycle and steroidogenesis in the ovaries of the golden rabbitfish, Siganus guttatus, the intact follicles of oocytes were incubated in vitro with human chorionic gonadotropin (hCG) and seven steroid hormones, 17alpha,20beta-dihydroxy-4-pregnen-3-one (DHP), 17alpha,20beta,21-trihydroxy-4-pregnen-3-one (20beta-S), 17alpha-hydroxyprogesterone (17alpha-OHP), progesterone (P), cortisol, estradiol-17beta (E2) and testosterone, during the two lunar phases, the new moon (1 week before spawning) and the first lunar quarter (just before spawning). Around the new moon, germinal vesicle breakdown (GVBD) could not be induced by addition of hCG or any steroid hormones. Around the first lunar quarter, GVBD was induced by addition of hCG, DHP, 20beta-S, 17alpha-OHP, P, and cortisol. DHP was the most potent steroid hormone. When the intact follicles of oocytes were incubated with hCG in both lunar phases, the production of E2 and DHP measured by enzyme immunoassay decreased and increased significantly from the new moon to the first lunar quarter, respectively. These results suggest that the ovarian follicles produce E2 around the new moon and DHP around the first lunar quarter and that the production/conversion of the steroid hormones is under the influence of gonadotropin(s). The synchronous increase in ovarian activity supports the hypothesis that lunar periodicity is a major factor for the ovarian development of S. guttatus.

A biologically inspired neural network model to transformation invariant object recognition

NASA Astrophysics Data System (ADS)

Iftekharuddin, Khan M.; Li, Yaqin; Siddiqui, Faraz

2007-09-01

Transformation invariant image recognition has been an active research area due to its widespread applications in a variety of fields such as military operations, robotics, medical practices, geographic scene analysis, and many others. The primary goal for this research is detection of objects in the presence of image transformations such as changes in resolution, rotation, translation, scale and occlusion. We investigate a biologically-inspired neural network (NN) model for such transformation-invariant object recognition. In a classical training-testing setup for NN, the performance is largely dependent on the range of transformation or orientation involved in training. However, an even more serious dilemma is that there may not be enough training data available for successful learning or even no training data at all. To alleviate this problem, a biologically inspired reinforcement learning (RL) approach is proposed. In this paper, the RL approach is explored for object recognition with different types of transformations such as changes in scale, size, resolution and rotation. The RL is implemented in an adaptive critic design (ACD) framework, which approximates the neuro-dynamic programming of an action network and a critic network, respectively. Two ACD algorithms such as Heuristic Dynamic Programming (HDP) and Dual Heuristic dynamic Programming (DHP) are investigated to obtain transformation invariant object recognition. The two learning algorithms are evaluated statistically using simulated transformations in images as well as with a large-scale UMIST face database with pose variations. In the face database authentication case, the 90° out-of-plane rotation of faces from 20 different subjects in the UMIST database is used. Our simulations show promising results for both designs for transformation-invariant object recognition and authentication of faces. Comparing the two algorithms, DHP outperforms HDP in learning capability, as DHP takes fewer steps to perform a successful recognition task in general. Further, the residual critic error in DHP is generally smaller than that of HDP, and DHP achieves a 100% success rate more frequently than HDP for individual objects/subjects. On the other hand, HDP is more robust than the DHP as far as success rate across the database is concerned when applied in a stochastic and uncertain environment, and the computational time involved in DHP is more.

Role of L-Type Ca[superscript 2+] Channel Isoforms in the Extinction of Conditioned Fear

ERIC Educational Resources Information Center

Busquet, Perrine; Hetzenauer, Alfred; Sinnegger-Brauns, Martina J.; Striessnig, Jorg; Singewald, Nicolas

2008-01-01

Dihydropyridine (DHP) L-type Ca[superscript 2+] channel (LTCC) antagonists, such as nifedipine, have been reported to impair the extinction of conditioned fear without interfering with its acquisition. Identification of the LTCC isoforms mediating this DHP effect is an essential basis to reveal their role as potential drug targets for the…

Reaction of [rho]-hydroxycinnamyl alcohols with transition metal salts. 3, Preparation and NMR characterization of improved DHPS

Treesearch

Lawrence L. Landucci

2000-01-01

Dehydropolymerization of [rho]-hydroxycinnamyl alcohols with manganese(III) acetate in either aqueous acetic acid or pyridine resulted in dehydropolymers (DHPs) that more closely approximate the structure of natural lignins than do DHPs produced by enzymic techniques. The 13C NMR spectrum of a "biomimetic" guaiacyl-DHP (G-DHP) from coniferyl alcohol was very...

Metabolic changes in serum steroids induced by total-body irradiation of female C57B/6 mice.

PubMed

Moon, Ju-Yeon; Shin, Hee-June; Son, Hyun-Hwa; Lee, Jeongae; Jung, Uhee; Jo, Sung-Kee; Kim, Hyun Sik; Kwon, Kyung-Hoon; Park, Kyu Hwan; Chung, Bong Chul; Choi, Man Ho

2014-05-01

The short- and long-term effects of a single exposure to gamma radiation on steroid metabolism were investigated in mice. Gas chromatography-mass spectrometry was used to generate quantitative profiles of serum steroid levels in mice that had undergone total-body irradiation (TBI) at doses of 0Gy, 1Gy, and 4Gy. Following TBI, serum samples were collected at the pre-dose time point and 1, 3, 6, and 9 months after TBI. Serum levels of progestins, progesterone, 5β-DHP, 5α-DHP, and 20α-DHP showed a significant down-regulation following short-term exposure to 4Gy, with the exception of 20α-DHP, which was significantly decreased at each of the time points measured. The corticosteroids 5α-THDOC and 5α-DHB were significantly elevated at each of the time points measured after exposure to either 1 or 4Gy. Among the sterols, 24S-OH-cholestoerol showed a dose-related elevation after irradiation that reached significance in the high dose group at the 6- and 9-month time points. Copyright © 2014 Elsevier Ltd. All rights reserved.

Diffusion of dihydropyridine calcium channel antagonists in cardiac sarcolemmal lipid multibilayers.

PubMed Central

Chester, D W; Herbette, L G; Mason, R P; Joslyn, A F; Triggle, D J; Koppel, D E

1987-01-01

A membrane bilayer pathway model has been proposed for the interaction of dihydropyridine (DHP) calcium channel antagonists with receptors in cardiac sarcolemma (Rhodes, D.G., J.G. Sarmiento, and L.G. Herbette. 1985. Mol. Pharmacol. 27:612-623) involving drug partition into the bilayer with subsequent receptor binding mediated (though probably not rate-limited) by diffusion within the bilayer. Recently, we have characterized the partition step, demonstrating that DHPs reside, on a time-average basis, near the bilayer hydrocarbon core/water interface. Drug distribution about this interface may define a plane of local concentration for lateral diffusion within the membrane. The studies presented herein examine the diffusional dynamics of an active rhodamine-labeled DHP and a fluorescent phospholipid analogue (DiIC16) in pure cardiac sarcolemmal lipid multibilayer preparations as a function of bilayer hydration. At maximal bilayer hydration, the drug diffuses over macroscopic distances within the bilayer at a rate identical to that of DiI (D = 3.8 X 10(-8) cm2/s), demonstrating the overall feasibility of the membrane diffusion model. The diffusion coefficients for both drug and lipid decreased substantially as the bilayers were dehydrated. While identical at maximal hydration, drug diffusion was significantly slower than that of DiIC16 in partially dehydrated bilayers, probably reflecting differences in mass distribution of these probes in the bilayer. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 PMID:2447967

Role of L-type Ca2+ channel isoforms in the extinction of conditioned fear

PubMed Central

Busquet, Perrine; Hetzenauer, Alfred; Sinnegger-Brauns, Martina J.; Striessnig, Jörg; Singewald, Nicolas

2008-01-01

Dihydropyridine (DHP) L-type Ca2+ channel (LTCC) antagonists, such as nifedipine, have been reported to impair the extinction of conditioned fear without interfering with its acquisition. Identification of the LTCC isoforms mediating this DHP effect is an essential basis to reveal their role as potential drug targets for the treatment of specific anxiety disorders. CaV1.2 and CaV1.3 are the predominant LTCCs in the mammalian brain. However, since no isoform-selective DHP blockers are available, their individual contribution to fear memory extinction is unknown. We used a novel mouse model expressing DHP-insensitive CaV1.2 LTCCs (CaV1.2DHP−/− mice) to address this question. In line with previous studies, wild-type (WT) mice treated with systemic nifedipine displayed markedly impaired fear extinction. This DHP effect was completely abolished in CaV1.2DHP−/− mice, indicating that it is mediated by CaV1.2, but not by CaV1.3 LTCCs. Supporting this conclusion, CaV1.3-deficient mice (CaV1.3−/−) showed extinction identical to the respective WT mice. The inhibition of fear extinction was not observed after intracerebroventricular (i.c.v.) application of different doses of nifedipine, suggesting that this effect is secondary to inhibition of peripheral CaV1.2 channels. The LTCC activator BayK, which lacks neurotoxic effects in CaV1.2DHP−/− mice, did not influence the extinction time course. In summary, we demonstrate that LTCC signaling through the CaV1.2 isoform of LTCCs interferes with fear memory extinction, presumably via a peripherally mediated mechanism. Activation of other LTCC isoforms (predominantly CaV1.3) is not sufficient to accelerate extinction of conditioned fear in mice. PMID:18441296

Therapeutic Response to Dihydroartemisinin-Piperaquine for P. falciparum and P. vivax Nine Years after Its Introduction in Southern Papua, Indonesia.

PubMed

Poespoprodjo, Jeanne Rini; Kenangalem, Enny; Wafom, Johny; Chandrawati, Freis; Puspitasari, Agatha M; Ley, Benedikt; Trianty, Leily; Korten, Zoé; Surya, Asik; Syafruddin, Din; Anstey, Nicholas M; Marfurt, Jutta; Noviyanti, Rintis; Price, Ric N

2018-03-01

Dihydroartemisinin-piperaquine (DHP) has been the first-line treatment of uncomplicated malaria due to both Plasmodium falciparum and Plasmodium vivax infections in Papua, Indonesia, since March 2006. The efficacy of DHP was reassessed to determine whether there had been any decline following almost a decade of its extensive use. An open-label drug efficacy study of DHP for uncomplicated P. falciparum and P. vivax malaria was carried out between March 2015 and April 2016 in Timika, Papua, Indonesia. Patients with uncomplicated malaria were administered supervised DHP tablets once daily for 3 days. Clinical and laboratory data were collected daily until parasite clearance and then weekly for 6 weeks. Molecular analysis was undertaken for all patients with recurrent parasitemia. A total of 129 study patients were enrolled in the study. At day 42, the polymerase chain reaction-adjusted efficacy was 97.7% (95% confidence intervals [CI]: 87.4-99.9) in the 61 patients with P. falciparum malaria, and 98.2% [95% CI: 90.3-100] in the 56 patients with P. vivax malaria. By day 2, 98% (56/57) of patients with P. falciparum and 96.9% (63/65) of those with P. vivax had cleared their peripheral parasitemia; none of the patients were still parasitaemic on day 3. Molecular analysis of P. falciparum parasites showed that none (0/61) had K13 mutations associated previously with artemisinin resistance or increased copy number of plasmepsin 2-3 (0/61). In the absence of artemisinin resistance, DHP has retained high efficacy for the treatment of uncomplicated malaria despite extensive drug pressure over a 9-year period.

Assembling metal oxide nanocrystals into dense, hollow, porous nanoparticles for lithium-ion and lithium-oxygen battery application.

PubMed

Ming, Jun; Wu, Yingqiang; Park, Jin-Bum; Lee, Joong Kee; Zhao, Fengyu; Sun, Yang-Kook

2013-11-07

New dense hollow porous (DHP) metal oxide nanoparticles that are smaller than 100 nm and composed of Co3O4, FeOx, NiO and MnOx were prepared by densely assembling metal oxide nanocrystals based on the hard-template method using a carbon colloid as a sacrificial core. These nanoparticles are quite different from the traditional particles as their hollow interior originates from the stacking of nanocrystals rather than a spherical shell. The DHP nanoparticles preserve the intriguing properties of nanocrystals and possess desirable surface area and pore volume that enhance the active surface, which ultimately benefits applications such as lithium-ion batteries. The DHP Co3O4 nanoparticles demonstrated an enhanced capacity of 1168 mA h g(-1) at 100 mA g(-1)vs. 590 mA h g(-1) of powders and stable cycling performance greater than 250 cycles when used as an anode material. Most importantly, the electrochemical performance of DHP Co3O4 nanoparticles in a lithium-O2 battery was also investigated for the first time. A low charge potential of ∼4.0 V, a high discharge voltage near 2.74 V and a long cycle ability greater than 100 cycles at a delivered capacity of 2000 mA h g(-1) (current density, 200 mA g(-1)) were observed. The performances were considerably improved compared to recent results of mesoporous Co3O4, Co3O4 nanoparticles and a composite of Co3O4/RGO and Co3O4/Pd. Therefore, it would be promising to investigate such properties of DHP nanoparticles or other hollow metal (oxide) particles for the popular lithium-air battery.

1,4-Dihydropyridine scaffold in medicinal chemistry, the story so far and perspectives (part 1): action in ion channels and GPCRs.

PubMed

Ioan, P; Carosati, E; Micucci, M; Cruciani, G; Broccatelli, F; Zhorov, B S; Chiarini, A; Budriesi, R

2011-01-01

Since the pioneering studies of Fleckenstein and co-workers, L-Type Calcium Channel (LTCC) blockers have attracted large interest due to their effectiveness in treating several cardiovascular diseases. Medicinal chemists achieved high potency and tissue selectivity by decorating the 1-4-DHP nucleus, the most studied scaffold among LTCC blockers. Nowadays it is clear that the 1,4-DHP nucleus is a privileged scaffold since, when appropriately substituted, it can selectively modulate diverse receptors, channels and enzymes. Therefore, the 1,4-DHP scaffold could be used to treat various diseases by a single-ligand multi-target approach. In this review, we describe the structure-activity relationships of 1,4-DHPs at ion channels, G-protein coupled receptors, and outline the potential for future therapeutic applications.

Salt-induced aggregation and fusion of dioctadecyldimethylammonium chloride and sodium dihexadecylphosphate vesicles.

PubMed Central

Carmona-Ribeiro, A M; Chaimovich, H

1986-01-01

Small dioctadecyldimethylammonium chloride (DODAC) vesicles prepared by sonication fuse upon addition of NaCl as detected by several methods (electron microscopy, trapped volume determinations, temperature-dependent phase transition curves, and osmometer behavior. In contrast, small sodium dihexadecyl phosphate (DHP) vesicles mainly aggregate upon NaCl addition as shown by electron microscopy and the lack of osmometer behavior. Scatter-derived absorbance changes of small and large DODAC or DHP vesicles as a function of time after salt addition were obtained for a range of NaCl or amphiphile concentration. These changes were interpreted in accordance with a phenomenological model based upon fundamental light-scattering laws and simple geometrical considerations. Short-range hydration repulsion between DODAC (or DHP) vesicles is possibly the main energy barrier for the fusion process. Images FIGURE 2 FIGURE 9 PMID:3779002

Image Quality and Radiation Exposure Comparison of a Double High-Pitch Acquisition for Coronary Computed Tomography Angiography Versus Standard Retrospective Spiral Acquisition in Patients With Atrial Fibrillation.

PubMed

Prazeres, Carlos Eduardo Elias Dos; Magalhães, Tiago Augusto; de Castro Carneiro, Adriano Camargo; Cury, Roberto Caldeira; de Melo Moreira, Valéria; Bello, Juliana Hiromi Silva Matsumoto; Rochitte, Carlos Eduardo

The aim of this study was to compare image quality and radiation dose of coronary computed tomography (CT) angiography performed with dual-source CT scanner using 2 different protocols in patients with atrial fibrillation. Forty-seven patients with AF underwent 2 different acquisition protocols: double high-pitch (DHP) spiral acquisition and retrospective spiral acquisition. The image quality was ranked according to a qualitative score by 2 experts: 1, no evident motion; 2, minimal motion not influencing coronary artery luminal evaluation; and 3, motion with impaired luminal evaluation. A third expert solved any disagreement. A total of 732 segments were evaluated. The DHP group (24 patients, 374 segments) showed more segments classified as score 1 than the retrospective spiral acquisition group (71.3% vs 37.4%). Image quality evaluation agreement was high between observers (κ = 0.8). There was significantly lower radiation exposure for the DHP group (3.65 [1.29] vs 23.57 [10.32] mSv). In this original direct comparison, a DHP spiral protocol for coronary CT angiography acquisition in patients with atrial fibrillation resulted in lower radiation exposure and superior image quality compared with conventional spiral retrospective acquisition.

The effects of daily supplementation of Dendrobium huoshanense polysaccharide on ethanol-induced subacute liver injury in mice by proteomic analysis.

PubMed

Wang, Xiao-Yu; Luo, Jian-Ping; Chen, Rui; Zha, Xue-Qiang; Wang, He

2014-09-01

Polysaccharides isolated from edible Dendrobium huoshanense have been shown to possess a hepatoprotection function for selenium- and carbon tetrachloride-induced liver injury. In this study, we investigated the preventive effects of daily supplementation with an homogeneous polysaccharide (DHP) purified from D. huoshanense on ethanol-induced subacute liver injury in mice and its potential mechanisms in liver protection by a proteomic approach. DHP was found to effectively depress the increased ratio of liver weight to body weight, reduce the elevated levels of serum aspartate aminotransferase, total cholesterol, total bilirubin and low density lipoprotein, and alleviate hepatic steatosis in mice with ethanol-induced subacute liver injury. Hepatic proteomics analysis performed by two-dimensional difference gel electrophoresis (2D-DIGE) coupled with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF/TOF-MS) revealed that cystathionine beta-synthase (Cbs) and D-lactate dehydrogenase (Ldhd) were two key proteins regulated by daily DHP intervention, which may assist in correcting the abnormal hepatic methionine metabolism pathway and decreasing the level of hepatic methylglyoxal generated from disordered metabolic pathways caused by ethanol. Our data suggest that DHP can protect liver function from alcoholic injury with complicated molecular mechanisms involving regulation of Cbs and Ldhd.

Structure, stability and behaviour of nucleic acids in ionic liquids

PubMed Central

Tateishi-Karimata, Hisae; Sugimoto, Naoki

2014-01-01

Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

Comparison of Chain Conformation of Poly(vinyl alcohol) in Solutions and Melts from Quantum Chemistry Based Molecular Dynamics Simulations

NASA Technical Reports Server (NTRS)

Jaffe, Richard; Han, Jie; Matsuda, Tsunetoshi; Yoon, Do; Langhoff, Stephen R. (Technical Monitor)

1997-01-01

Confirmations of 2,4-dihydroxypentane (DHP), a model molecule for poly(vinyl alcohol), have been studied by quantum chemistry (QC) calculations and molecular dynamics (MD) simulations. QC calculations at the 6-311G MP2 level show the meso tt conformer to be lowest in energy followed by the racemic tg, due to intramolecular hydrogen bond between the hydroxy groups. The Dreiding force field has been modified to reproduce the QC conformer energies for DHP. MD simulations using this force field have been carried out for DHP molecules in the gas phase, melt, and CHCl3 and water solutions. Extensive intramolecular hydrogen bonding is observed for the gas phase and CHCl3 solution, but not for the melt or aqueous solution, Such a condensed phase effect due to intermolecular interactions results in a drastic change in chain conformations, in agreement with experiments.

Influence of pectins on the solubility and the molar mass distribution of dehydrogenative polymers (DHPs, lignin model compounds).

PubMed

Cathala, B; Monties, B

2001-07-19

Dehydrogenation polymers (DHPs, lignin model compounds) were synthesized in the presence of increasing pectin concentrations using two different methods. The first method ('Zutropfverfahren', ZT) consists in the slow adding of monomers whereas in the second method ('Zulaufverfahren', ZL) all the reactants are added simultaneously. DHPs solubility increases with the pectin concentration in the ZT experiments and remains stable in the ZL experiments. Covalent bonds between pectin and DHP are formed during ZT polymerization resulting in lignin carbohydrate complex (LCC) which keeps the unbound DHPs in solution by the formation of aggregate or micelle-like structures. In contrast LCC are not formed during the ZL process which behave like the DHP reference. The ZT DHP molar masses increase observed is attributed to the reactivity of the high molar mass polymer solubilized by the LCC whereas ZL higher molar mass polymers are precipitated out of the solution and cannot react further.

Light-induced yellowing of selectively 13C-enriched dehydrogenation polymers (DHPs). Part 2, NMR assignments and photoyellowing of aromatic ring 1-, 3-, 4-, and 5-13C DHPs

Treesearch

Jim Parkas; Magnus Paulsson; Terashima Noritsugu; Ulla Westermark; Sally Ralph

2004-01-01

Light-induced yellowing of lignocellulosicmaterials has been studied using 13C-enriched DHP (dehydrogenation polymer), selectively 13C-enriched at positions 1, 3, 4, and 5 in the aromatic ring, and quantitative solution state 13C NMR spectroscopy. The NMR study confirmed the results of previous studies using side-chain labeled DHP, mainly that coniferyl alcohol end...

Urban-Rural Disparity of Generics Prescription in Taiwan: The Example of Dihydropyridine Derivatives

PubMed Central

Chiang, Shu-Chiung; Chou, Li-Fang

2014-01-01

The aim of the current study was to investigate the urban-rural disparity of prescribing generics, which were usually cheaper than branded drugs, within the universal health insurance system in Taiwan. Data sources were the cohort datasets of National Health Insurance Research Database with claims data in 2010. The generic prescribing ratios of dihydropyridine (DHP) derivatives (the proportion of DHP prescribed as generics to all prescribed DHP) of medical facilities were examined against the urbanization levels of the clinic location. Among the total 21,606,914 defined daily doses of DHP, 35.7% belonged to generics. The aggregate generic prescribing ratio rose from 6.7% at academic medical centers to 15.3% at regional hospitals, 29.4% at community hospital, and 66.1% at physician clinics. Among physician clinics, the generic prescribing ratio in urban areas was 63.9 ± 41.0% (mean ± standard deviation), lower than that in suburban (69.6 ± 38.7%) and in rural (74.1% ± 35.3%). After adjusting the related factors in the linear regression model, generic prescribing ratios of suburban and rural clinics were significantly higher than those of urban clinics (β = 0.043 and 0.077; P = 0.024 and 0.008, resp.). The generic prescribing ratio of the most popular antihypertensive agents at a clinic was reversely associated with the urbanization level. PMID:24683364

Large-scale Estimates of Leaf Area Index from Active Remote Sensing Laser Altimetry

NASA Astrophysics Data System (ADS)

Hopkinson, C.; Mahoney, C.

2016-12-01

Leaf area index (LAI) is a key parameter that describes the spatial distribution of foliage within forest canopies which in turn control numerous relationships between the ground, canopy, and atmosphere. The retrieval of LAI has demonstrated success by in-situ (digital) hemispherical photography (DHP) and airborne laser scanning (ALS) data; however, field and ALS acquisitions are often spatially limited (100's km2) and costly. Large-scale (>1000's km2) retrievals have been demonstrated by optical sensors, however, accuracies remain uncertain due to the sensor's inability to penetrate the canopy. The spaceborne Geoscience Laser Altimeter System (GLAS) provides a possible solution in retrieving large-scale derivations whilst simultaneously penetrating the canopy. LAI retrieved by multiple DHP from 6 Australian sites, representing a cross-section of Australian ecosystems, were employed to model ALS LAI, which in turn were used to infer LAI from GLAS data at 5 other sites. An optimally filtered GLAS dataset was then employed in conjunction with a host of supplementary data to build a Random Forest (RF) model to infer predictions (and uncertainties) of LAI at a 250 m resolution across the forested regions of Australia. Predictions were validated against ALS-based LAI from 20 sites (R2=0.64, RMSE=1.1 m2m-2); MODIS-based LAI were also assessed against these sites (R2=0.30, RMSE=1.78 m2m-2) to demonstrate the strength of GLAS-based predictions. The large-scale nature of current predictions was also leveraged to demonstrate large-scale relationships of LAI with other environmental characteristics, such as: canopy height, elevation, and slope. The need for such wide-scale quantification of LAI is key in the assessment and modification of forest management strategies across Australia. Such work also assists Australia's Terrestrial Ecosystem Research Network, in fulfilling their government issued mandates.

Study of interaction of antimutagenic 1,4-dihydropyridine AV-153-Na with DNA-damaging molecules and its impact on DNA repair activity.

PubMed

Leonova, Elina; Rostoka, Evita; Sauvaigo, Sylvie; Baumane, Larisa; Selga, Turs; Sjakste, Nikolajs

2018-01-01

1,4-dihydropyridines (1,4-DHP) possesses important biochemical and pharmacological properties, including antioxidant and antimutagenic activities. It was shown that the antimutagenic 1,4-dihydropyridine AV-153-Na interacts with DNA. The aim of the current study was to test the capability of the compound to scavenge peroxynitrite and hydroxyl radical, to test intracellular distribution of the compound, and to assess the ability of the compound to modify the activity of DNA repair enzymes and to protect the DNA in living cells against peroxynitrite-induced damage. Peroxynitrite decomposition was assayed by UV spectroscopy, hydroxyl radical scavenging-by EPR spectroscopy. DNA breakage was determined by the "comet method", activity of DNA repair enzymes-using Glyco-SPOT and ExSy-SPOT assays. Intracellular distribution of the compound was studied by laser confocal scanning fluorescence microscopy. Fluorescence spectroscopy titration and circular dichroism spectroscopy were used to study interactions of the compound with human serum albumin. Some ability to scavenge hydroxyl radical by AV-153-Na was detected by the EPR method, but it turned out to be incapable of reacting chemically with peroxynitrite. However, AV-153-Na effectively decreased DNA damage produced by peroxynitrite in cultured HeLa cells. The Glyco-SPOT test essentially revealed an inhibition by AV-153-Na of the enzymes involved thymine glycol repair. Results with ExSy-SPOT chip indicate that AV-153-Na significantly stimulates excision/synthesis repair of 8-oxoguanine (8-oxoG), abasic sites (AP sites) and alkylated bases. Laser confocal scanning fluorescence microscopy demonstrated that within the cells AV-153-Na was found mostly in the cytoplasm; however, a stain in nucleolus was also detected. Binding to cytoplasmic structures might occur due to high affinity of the compound to proteins revealed by spectroscopical methods. Activation of DNA repair enzymes after binding to DNA appears to be the basis for the antimutagenic effects of AV-153-Na.

A novel dihydropyridine with 3-aryl meta-hydroxyl substitution blocks L-type calcium channels in rat cardiomyocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galvis-Pareja, David; Centro Estudios Moleculares de la Célula; Zapata-Torres, Gerald

2014-08-15

Rationale: Dihydropyridines are widely used for the treatment of several cardiac diseases due to their blocking activity on L-type Ca{sup 2+} channels and their renowned antioxidant properties. Methods: We synthesized six novel dihydropyridine molecules and performed docking studies on the binding site of the L-type Ca{sup 2+} channel. We used biochemical techniques on isolated adult rat cardiomyocytes to assess the efficacy of these molecules on their Ca{sup 2+} channel-blocking activity and antioxidant properties. The Ca{sup 2+} channel-blocking activity was evaluated by confocal microscopy on fluo-3AM loaded cardiomyocytes, as well as using patch clamp experiments. Antioxidant properties were evaluated by flowmore » cytometry using the ROS sensitive dye 1,2,3 DHR. Results: Our docking studies show that a novel compound with 3-OH substitution inserts into the active binding site of the L-type Ca{sup 2+} channel previously described for nitrendipine. In biochemical assays, the novel meta-OH group in the aryl in C4 showed a high blocking effect on L-type Ca{sup 2+} channel as opposed to para-substituted compounds. In the tests we performed, none of the molecules showed antioxidant properties. Conclusions: Only substitutions in C2, C3 and C5 of the aryl ring render dihydropyridine compounds with the capacity of blocking LTCC. Based on our docking studies, we postulate that the antioxidant activity requires a larger group than the meta-OH substitution in C2, C3 or C5 of the dihydropyridine ring. - Highlights: • Dihydropyridine (DHP) molecules are widely used in cardiovascular disease. • DHPs block Ca{sup 2+} entry through LTCC—some DHPs have antioxidant activity as well. • We synthesized 6 new DHPs and tested their Ca{sup 2+} blocking and antioxidant activities. • 3-Aryl meta-hydroxyl substitution strongly increases their Ca{sup 2+} blocking activity. • 3-Aryl meta-hydroxyl substitution did not affect the antioxidant properties.« less

Phoma herbarum, a soil fungus able to grow on natural lignin and synthetic lignin (DHP) as sole carbon source and cause lignin degradation.

PubMed

Bi, Ran; Lawoko, Martin; Henriksson, Gunnar

2016-08-01

The fungus Phoma herbarum isolated from soil showed growth on highly pure lignin extracted from spruce wood and on synthetic lignin (DHP). The lignin remaining after cultivation was shown to have a lower molecular weight. The reduction in the numbers of ether linkages of the extracted lignins was also observed by derivatization followed by reductive cleavage (DFRC) in combination with (31)P NMR studies. The fungal strain showed an ability to degrade synthetic lignin by extracellular catalysts. GC-MS was applied to study the evolution of low molar mass adducts, e.g., monolignols and it was shown that a reduced coniferyl alcohol product was produced from DHP in a cell-free environment. The work has demonstrated the ability of soil microbes to grow on lignin as sole carbon source. The potential impact is in the production of low molar mass renewable phenols for material application.

Complete inhibition of anisomycin and UV radiation but not cytokine induced JNK and p38 activation by an aryl-substituted dihydropyrrolopyrazole quinoline and mixed lineage kinase 7 small interfering RNA.

PubMed

Wang, Xushan; Mader, Mary M; Toth, John E; Yu, Xiaohong; Jin, Najia; Campbell, Robert M; Smallwood, Jeffrey K; Christe, Michael E; Chatterjee, Arindam; Goodson, Theodore; Vlahos, Chris J; Matter, William F; Bloem, Laura J

2005-05-13

Mixed lineage kinase 7 (MLK7) is a mitogen-activated protein kinase kinase kinase (MAPKKK) that activates the pro-apoptotic signaling pathways p38 and JNK. A library of potential kinase inhibitors was screened, and a series of dihydropyrrolopyrazole quinolines was identified as highly potent inhibitors of MLK7 in vitro catalytic activity. Of this series, an aryl-substituted dihydropyrrolopyrazole quinoline (DHP-2) demonstrated an IC50 of 70 nM for inhibition of pJNK formation in COS-7 cell MLK7/JNK co-transfection assays. In stimulated cells, DHP-2 at 200 nM or MLK7 small interfering RNA completely blocked anisomycin and UV induced but had no effect on interleukin-1beta or tumor necrosis factor-alpha-induced p38 and JNK activation. Additionally, the compound blocked anisomycin and UV-induced apoptosis in COS-7 cells. Heart tissue homogenates from MLK7 transgenic mice treated with DHP-2 at 30 mg/kg had reduced JNK and p38 activation with no apparent effect on ERK activation, demonstrating that this compound can be used to block MLK7-driven MAPK pathway activation in vivo. Taken together, these data demonstrate that MLK7 is the MAPKKK required for modulation of the stress-activated MAPKs downstream of anisomycin and UV stimulation and that DHP-2 can be used to block MLK7 pathway activation in cells as well as in vivo.

Malondialdehyde-Derived Epitopes In Human Skin Result From Acute Exposure To Solar UV And Occur In Nonmelanoma Skin Cancer Tissue

PubMed Central

Williams, Joshua D.; Bermudez, Yira; Park, Sophia L.; Stratton, Steven P.; Uchida, Koji; Hurst, Craig A.; Wondrak, Georg T.

2014-01-01

Cutaneous exposure to solar ultraviolet radiation (UVR) is a causative factor in photoaging and photocarcinogenesis. In human skin, oxidative stress is widely considered a key mechanism underlying the detrimental effects of acute and chronic UVR exposure. The lipid peroxidation product malondialdehyde (MDA) accumulates in tissue under conditions of increased oxidative stress, and the occurrence of MDA-derived protein epitopes, including dihydropyridine-lysine (DHP), has recently been substantiated in human skin. Here we demonstrate for the first time that acute exposure to sub-apoptogenic doses of solar simulated UV light (SSL) causes the formation of free MDA and protein-bound MDA-derived epitopes in cultured human HaCaT keratinocytes and healthy human skin. Immunohistochemical staining revealed that acute exposure to SSL is sufficient to cause an almost twenty-fold increase in general MDA- and specific DHP-epitope content in human skin. When compared to dose-matched solar simulated UVA, complete SSL was more efficient generating both free MDA and MDA-derived epitopes. Subsequent tissue microarray (TMA) analysis revealed the prevalence of MDA- and DHP-epitopes in nonmelanoma skin cancer (NMSC). In squamous cell carcinoma tissue, both MDA- and DHP-epitopes were increased more than three-fold as compared to adjacent normal tissue. Taken together, these date demonstrate the occurrence of MDA-derived epitopes in both solar UVR-exposed healthy human skin and NMSC TMA tissue; however, the potential utility of these epitopes as novel biomarkers of cutaneous photodamage and a functional role in the process of skin photocarcinogenesis remain to be explored. PMID:24584085

The γ-Aminobutyrate Permease GabP Serves as the Third Proline Transporter of Bacillus subtilis

PubMed Central

Zaprasis, Adrienne; Hoffmann, Tamara; Stannek, Lorena; Gunka, Katrin; Commichau, Fabian M.

2014-01-01

PutP and OpuE serve as proline transporters when this imino acid is used by Bacillus subtilis as a nutrient or as an osmostress protectant, respectively. The simultaneous inactivation of the PutP and OpuE systems still allows the utilization of proline as a nutrient. This growth phenotype pointed to the presence of a third proline transport system in B. subtilis. We took advantage of the sensitivity of a putP opuE double mutant to the toxic proline analog 3,4-dehydro-dl-proline (DHP) to identify this additional proline uptake system. DHP-resistant mutants were selected and found to be defective in the use of proline as a nutrient. Whole-genome resequencing of one of these strains provided the lead that the inactivation of the γ-aminobutyrate (GABA) transporter GabP was responsible for these phenotypes. DNA sequencing of the gabP gene in 14 additionally analyzed DHP-resistant strains confirmed this finding. Consistently, each of the DHP-resistant mutants was defective not only in the use of proline as a nutrient but also in the use of GABA as a nitrogen source. The same phenotype resulted from the targeted deletion of the gabP gene in a putP opuE mutant strain. Hence, the GabP carrier not only serves as an uptake system for GABA but also functions as the third proline transporter of B. subtilis. Uptake studies with radiolabeled GABA and proline confirmed this conclusion and provided information on the kinetic parameters of the GabP carrier for both of these substrates. PMID:24142252

A randomized comparison of dihydroartemisinin-piperaquine and artesunate-amodiaquine combined with primaquine for radical treatment of vivax malaria in Sumatera, Indonesia.

PubMed

Pasaribu, Ayodhia Pitaloka; Chokejindachai, Watcharee; Sirivichayakul, Chukiat; Tanomsing, Naowarat; Chavez, Irwin; Tjitra, Emiliana; Pasaribu, Syahril; Imwong, Mallika; White, Nicholas J; Dondorp, Arjen M

2013-12-01

A high prevalence of chloroquine-resistant Plasmodium vivax in Indonesia has shifted first-line treatment to artemisinin-based combination therapies, combined with primaquine (PQ) for radical cure. Which combination is most effective and safe remains to be established. We conducted a prospective open-label randomized comparison of 14 days of PQ (0.25 mg base/kg) plus either artesunate-amodiaquine (AAQ + PQ) or dihydroartemisinin-piperaquine (DHP + PQ) for the treatment of uncomplicated monoinfection P. vivax malaria in North Sumatera, Indonesia. Patients were randomized and treatments were given without prior testing for G6PD status. The primary outcome was parasitological failure at day 42. Patients were followed up to 1 year. Between December 2010 and April 2012, 331 patients were included. After treatment with AAQ + PQ, recurrent infection occurred in 0 of 167 patients within 42 days and in 15 of 130 (11.5%; 95% confidence interval [CI], 6.6%-18.3%) within a year. With DHP + PQ, this was 1 of 164 (0.6%; 95% CI, 0.01%-3.4%) and 13 of 143 (9.1%; 95% CI, 4.9%-15.0%), respectively (P > .2). Intravascular hemolysis occurred in 5 patients, of which 3 males were hemizygous for the G6PD-Mahidol mutation. Minor adverse events were more frequent with AAQ + PQ. In North Sumatera, Indonesia, AAQ and DHP, both combined with PQ, were effective for blood-stage parasite clearance of uncomplicated P. vivax malaria. Both treatments were safe, but DHP + PQ was better tolerated. NCT01288820.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nabavi, Sadeq; Nazar, Ross N., E-mail: rnnazar@uoguelph.ca

The maturation of many small nuclear RNAs is dependent on RNase III-like endonuclease mediated cleavage, which generates a loading site for the exosome complex that trims the precursor at its 3' end. Using a temperature sensitive Pac1 nuclease, here we show that the endonuclease cleavage is equally important in terminating the transcription of the U2 snRNA in Schizosaccharomyces pombe. Using a temperature sensitive Dhp1p 5' {yields} 3' exonuclease, we demonstrate that it also is an essential component of the termination pathway. Taken together the results support a 'reversed torpedoes' model for the termination and maturation of the U2 snRNA; themore » Pac1 endonuclease cleavage provides entry sites for the 3' and 5' exonuclease activities, leading to RNA maturation in one direction and transcript termination in the other.« less

Using variance components to estimate power in a hierarchically nested sampling design improving monitoring of larval Devils Hole pupfish

USGS Publications Warehouse

Dzul, Maria C.; Dixon, Philip M.; Quist, Michael C.; Dinsomore, Stephen J.; Bower, Michael R.; Wilson, Kevin P.; Gaines, D. Bailey

2013-01-01

We used variance components to assess allocation of sampling effort in a hierarchically nested sampling design for ongoing monitoring of early life history stages of the federally endangered Devils Hole pupfish (DHP) (Cyprinodon diabolis). Sampling design for larval DHP included surveys (5 days each spring 2007–2009), events, and plots. Each survey was comprised of three counting events, where DHP larvae on nine plots were counted plot by plot. Statistical analysis of larval abundance included three components: (1) evaluation of power from various sample size combinations, (2) comparison of power in fixed and random plot designs, and (3) assessment of yearly differences in the power of the survey. Results indicated that increasing the sample size at the lowest level of sampling represented the most realistic option to increase the survey's power, fixed plot designs had greater power than random plot designs, and the power of the larval survey varied by year. This study provides an example of how monitoring efforts may benefit from coupling variance components estimation with power analysis to assess sampling design.

Novel multipotent tacrine-dihydropyridine hybrids with improved acetylcholinesterase inhibitory and neuroprotective activities as potential drugs for the treatment of Alzheimer's disease.

PubMed

Marco-Contelles, José; León, Rafael; de Los Ríos, Cristóbal; Guglietta, Antonio; Terencio, José; López, Manuela G; García, Antonio G; Villarroya, Mercedes

2006-12-28

In this work we describe the synthesis and biological evaluation of the tacrine-1,4-dihydropyridine (DHP) hybrids (3-11). These multipotent molecules are the result of the juxtaposition of an acetylcholinesterase inhibitor (AChEI) such as tacrine (1) and a 1,4-DHP such as nimodipine (2). Compounds 3-11 are very selective and potent AChEIs and show an excellent neuroprotective profile and a moderate Ca2+ channel blockade effect. Consequently, these molecules are new potential drugs for the treatment of Alzheimer's disease.

Estimation of leaf area index and foliage clumping in deciduous forests using digital photography

NASA Astrophysics Data System (ADS)

Chianucci, Francesco; Cutini, Andrea

2013-04-01

Rapid, reliable and meaningful estimates of leaf area index (LAI) are essential to the characterization of forest ecosystems. In this contribution the accuracy of both fisheye and non-fisheye digital photography for the estimation of forest leaf area in deciduous stands was evaluated. We compared digital hemispherical photography (DHP), the most widely used technique that measures the gap fraction at multiple zenith angles, with methods that measure the gap fraction at a single zenith angle, namely 57.5 degree photography and cover photography (DCP). Comparison with other different gap fraction methods used to calculate LAI such as canopy transmittance measurements from AccuPAR ceptometer and LAI- 2000 Plant Canopy Analyzer (PCA) were also performed. LAI estimated from all these indirect methods were compared with direct measurements obtained by litter traps (LAILT). We applied these methods in 10 deciduous stands of Quercus cerris, Castanea sativa and Fagus sylvatica, the most common deciduous species in Italy, where LAILT ranged from 3.9 to 7.3. DHP and DCP provided good indirect estimates of LAILT, and outperformed the other indirect methods. The DCP method provided estimates of crown porosity, crown cover, foliage cover and the clumping index at the zenith, but required assumptions about the light extinction coefficient at the zenith (k), to accurately estimate LAI. Cover photography provided good indirect estimates of LAI assuming a spherical leaf angle distribution, even though k appeared to decrease as LAI increased, thus affecting the accuracy of LAI estimates in DCP. In contrast, the accuracy of LAI estimates in DHP appeared insensitive to LAILT values, but the method was sensitive to photographic exposure, gamma-correction and was more time-consuming than DCP. Foliage clumping was estimated from all the photographic methods by analyzing either gap size distribution (DCP) or gap fraction distribution (DHP). Foliage clumping was also calculated from PCA and compared with DHP. The studied stands were characterized by fairly homogeneous canopies with higher within-crown clumping than between-crowns clumping; only the segmented analysis of gap fraction for each ring of the fisheye images was found to provide useful clumping index in such homogeneous canopies. By contrast, the 1-azimuth segment method employed in PCA poorly detected clumping in dense canopies. We conclude both fisheye and non-fisheye photographic methods are suitable for dense deciduous forests. Cover photography holds great promise as a means to quickly obtain inexpensive estimates of LAI over large areas. However, in situations where no direct reference measurements of k are available, we recommend using both DHP and DCP, in order to cross-calibrate the two methods; DCP could then be used for more routinely indirect measurement and monitoring of LAI. Keywords: digital hemispherical photography, cover photography, litter trap, AccuPAR ceptometer, LAI-2000.

Effects of subclinical inflammation on C-reactive protein and haptoglobin levels as well as specific humoral immunity in dogs vaccinated against canine distemper and parvovirus.

PubMed

Romiszewski, Przemysław; Kostro, Krzysztof; Lisiecka, Urszula

2018-03-05

The aim of the present study was to assess the effects of subclinical inflammation on specific humoral immunity in dogs vaccinated with Nobivac® DHP based on serum levels of CRP and Hp. Dogs from the group I were administered Nobivac® DHP, the vaccine against distemper, infectious hepatitis and parvovirus whereas group II animals received subcutaneous turpentine oil to induce subclinical inflammation, followed by Nobivac® DHP after 24 h. Animals in group III received only turpentine oil in the way and amount identical to that as in group II. Nobivac DHP relatively poorly induced the immune inflammatory response showing good immunogenic properties, which was evidenced by only a double increase in mean CRP and Hp levels associated with antigenic stimulation in group I. In group II, serum neutralization (SN) and haemagglutination inhibition (HI) results were quite closely correlated with serum levels of CPR and Hp. Our findings suggest that the efficacy of vaccinations in dogs can be significantly affected by subclinical inflammations, which is indicated by a correlation between serum CRP and Hp levels versus antibody titres for canine distemper and parvovirus in both experimental groups of dogs (group I and II). The correlation of mean CRP and Hp values in dogs with subclinical inflammation and after vaccination with the kinetics of increasing antibody titres against distemper and parvovirus in group II dogs reflects the severity of inflammatory response and the extent of specific humoral immunity. Routine determinations of serum CRP and Hp levels as the indices of inflammation severity can be the essential biochemical markers for assessment of dogs' health in the period preceding specific immunoprophylaxis and efficacy of the vaccine.

Characterization and longitudinal monitoring of serum progestagens and estrogens during normal pregnancy in the killer whale (Orcinus orca).

PubMed

Robeck, Todd R; Steinman, Karen J; O'Brien, Justine K

2016-09-15

The secretory patterns of progestagens and estrogens were characterized throughout 28 normal pregnancies until two month post-partum in eleven killer whales. HPLC analysis of serum from different reproductive stages (luteal phase, EARLY, MID, and LATE pregnancy) identified three major immunoreactive progestagen peaks; progesterone (P4), 5α-pregnane-3,20-dione (5α-DHP) and pregnanediol, with 5α-DHP approximately half of that for P4 in the luteal phase, and EARLY, but approximately 2/3 of P4 during MID and LATE pregnancy. At birth, 5α-DHP was the only significant (>10% immunoreactivity) immunoreactive progestagen detected in placental (umbilical cord) serum. Maternal recognition of pregnancy appears to occur between day 21 and 28 post-ovulation when a significant deviation in progestagen concentrations between conceptive and non-conceptive cycles was detected. Progestagen concentrations during pregnancy displayed a bimodal pattern with significant peaks (P<0.05) in EARLY (indexed month post-conception [IMPC] 2, 3, 4) and MID (IMPC 9, 10) before decreasing (P<0.05) over an 11day interval to luteal phase concentrations on the day of parturition. Among estrogens, estriol was secreted in the highest concentrations but only estrone (free and conjugated) and estradiol increased (P<0.001) during pregnancy, with peaks observed during the final month of gestation, and an influence (P<0.05) of fetal sex on estradiol production was detected. Collective findings indicate that P4 derived from the corpus luteum is the major biologically active progestagen during the luteal phase and pregnancy, and that 5α-DHP production, possibly from both luteal and placental sources, increases during the second half of pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Quantifying the Accuracy of Digital Hemispherical Photography for Leaf Area Index Estimates on Broad-Leaved Tree Species.

PubMed

Gilardelli, Carlo; Orlando, Francesca; Movedi, Ermes; Confalonieri, Roberto

2018-03-29

Digital hemispherical photography (DHP) has been widely used to estimate leaf area index (LAI) in forestry. Despite the advancement in the processing of hemispherical images with dedicated tools, several steps are still manual and thus easily affected by user's experience and sensibility. The purpose of this study was to quantify the impact of user's subjectivity on DHP LAI estimates for broad-leaved woody canopies using the software Can-Eye. Following the ISO 5725 protocol, we quantified the repeatability and reproducibility of the method, thus defining its precision for a wide range of broad-leaved canopies markedly differing for their structure. To get a complete evaluation of the method accuracy, we also quantified its trueness using artificial canopy images with known canopy cover. Moreover, the effect of the segmentation method was analysed. The best results for precision (restrained limits of repeatability and reproducibility) were obtained for high LAI values (>5) with limits corresponding to a variation of 22% in the estimated LAI values. Poorer results were obtained for medium and low LAI values, with a variation of the estimated LAI values that exceeded the 40%. Regardless of the LAI range explored, satisfactory results were achieved for trees in row-structured plantations (limits almost equal to the 30% of the estimated LAI). Satisfactory results were achieved for trueness, regardless of the canopy structure. The paired t -test revealed that the effect of the segmentation method on LAI estimates was significant. Despite a non-negligible user effect, the accuracy metrics for DHP are consistent with those determined for other indirect methods for LAI estimates, confirming the overall reliability of DHP in broad-leaved woody canopies.

The strategic significance of wastewater sources to pollutant phosphorus levels in English rivers and to environmental management for rural, agricultural and urban catchments.

PubMed

Neal, Colin; Jarvie, Helen P; Withers, Paul J A; Whitton, Brian A; Neal, Margaret

2010-03-01

The relationship between soluble and particulate phosphorus was examined for 9 major UK rivers including 26 major tributaries and 68 monitoring points, covering wide-ranging rural and agricultural/urban impacted systems with catchment areas varying from 1 to 6000km(2) scales. Phosphorus concentrations in Soluble Reactive (SRP), Total Dissolved (TDP), Total (TP), Dissolved Hydrolysable (DHP) and Particulate (PP) forms correlated with effluent markers (sodium and boron) and SRP was generally dominant signifying the importance of sewage sources. Low flows were particularly enriched in SRP, TDP and TP for average SRP>100microg/l indicating low effluent dilution. At particularly low average concentrations, SRP increased with flow but effluent sources were still implicated as the effluent markers (boron in particular) increased likewise. For rural areas, DHP had proportionately high concentrations and SRP+DHP concentrations could exceed environmental thresholds currently set for SRP. Given DHP has a high bioavailability the environmental implications need further consideration. PP concentrations were generally highest at high flows but PP in the suspended solids was generally at its lowest and in general PP correlated with particulate organic carbon and more so than the suspended sediment in total. Separation of pollutant inputs solely between effluent and diffuse (agriculture) components is misleading, as part of the "diffuse" term comprises effluents flushed from the catchments during high flow. Effluent sources of phosphorus supplied directly or indirectly to the river coupled with within-river interactions between water/sediment/biota largely determine pollutant levels. The study flags the fundamental need of placing direct and indirect effluent sources and contaminated storage with interchange to/from the river at the focus for remediation strategies for UK rivers in relation to eutrophication and the WFD.

Quantifying the Accuracy of Digital Hemispherical Photography for Leaf Area Index Estimates on Broad-Leaved Tree Species

PubMed Central

Gilardelli, Carlo; Orlando, Francesca; Movedi, Ermes; Confalonieri, Roberto

2018-01-01

Digital hemispherical photography (DHP) has been widely used to estimate leaf area index (LAI) in forestry. Despite the advancement in the processing of hemispherical images with dedicated tools, several steps are still manual and thus easily affected by user’s experience and sensibility. The purpose of this study was to quantify the impact of user’s subjectivity on DHP LAI estimates for broad-leaved woody canopies using the software Can-Eye. Following the ISO 5725 protocol, we quantified the repeatability and reproducibility of the method, thus defining its precision for a wide range of broad-leaved canopies markedly differing for their structure. To get a complete evaluation of the method accuracy, we also quantified its trueness using artificial canopy images with known canopy cover. Moreover, the effect of the segmentation method was analysed. The best results for precision (restrained limits of repeatability and reproducibility) were obtained for high LAI values (>5) with limits corresponding to a variation of 22% in the estimated LAI values. Poorer results were obtained for medium and low LAI values, with a variation of the estimated LAI values that exceeded the 40%. Regardless of the LAI range explored, satisfactory results were achieved for trees in row-structured plantations (limits almost equal to the 30% of the estimated LAI). Satisfactory results were achieved for trueness, regardless of the canopy structure. The paired t-test revealed that the effect of the segmentation method on LAI estimates was significant. Despite a non-negligible user effect, the accuracy metrics for DHP are consistent with those determined for other indirect methods for LAI estimates, confirming the overall reliability of DHP in broad-leaved woody canopies. PMID:29596376

Malondialdehyde-derived epitopes in human skin result from acute exposure to solar UV and occur in nonmelanoma skin cancer tissue.

PubMed

Williams, Joshua D; Bermudez, Yira; Park, Sophia L; Stratton, Steven P; Uchida, Koji; Hurst, Craig A; Wondrak, Georg T

2014-03-05

Cutaneous exposure to solar ultraviolet radiation (UVR) is a causative factor in photoaging and photocarcinogenesis. In human skin, oxidative stress is widely considered a key mechanism underlying the detrimental effects of acute and chronic UVR exposure. The lipid peroxidation product malondialdehyde (MDA) accumulates in tissue under conditions of increased oxidative stress, and the occurrence of MDA-derived protein epitopes, including dihydropyridine-lysine (DHP), has recently been substantiated in human skin. Here we demonstrate for the first time that acute exposure to sub-apoptogenic doses of solar simulated UV light (SSL) causes the formation of free MDA and protein-bound MDA-derived epitopes in cultured human HaCaT keratinocytes and healthy human skin. Immunohistochemical staining revealed that acute exposure to SSL is sufficient to cause an almost twenty-fold increase in general MDA- and specific DHP-epitope content in human skin. When compared to dose-matched solar simulated UVA, complete SSL was more efficient generating both free MDA and MDA-derived epitopes. Subsequent tissue microarray (TMA) analysis revealed the prevalence of MDA- and DHP-epitopes in nonmelanoma skin cancer (NMSC). In squamous cell carcinoma tissue, both MDA- and DHP-epitopes were increased more than threefold as compared to adjacent normal tissue. Taken together, these date demonstrate the occurrence of MDA-derived epitopes in both solar UVR-exposed healthy human skin and NMSC TMA tissue; however, the potential utility of these epitopes as novel biomarkers of cutaneous photodamage and a functional role in the process of skin photocarcinogenesis remain to be explored. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and expression of melatonin receptors in the mudskipper Boleophthalmus pectinirostris: their role in synchronizing its semilunar spawning rhythm.

PubMed

Hong, Lu Yan; Hong, Wan Shu; Zhu, Wen Bo; Shi, Qiong; You, Xin Xin; Chen, Shi Xi

2014-01-01

The mudskipper Boleophthalmus pectinirostris, a burrow-dwelling fish inhabiting intertidal mudflats, spawns only once during the spawning season around either the first or last lunar quarters. To understand the molecular mechanisms regulating this semilunar spawning rhythm, we cloned all melatonin receptor subtypes (mtnr1a1.4, mtnr1a1.7, mtnr1b, and mtnr1c). Expression of three melatonin receptor subtypes (except mtnr1c) was found in the ovaries. In contrast, the expression of all receptor subtypes was found in the diencephalon and the pituitary. In the fully-grown follicles, only mtnr1a1.7 mRNA was detected in both the isolated follicle layers and denuded oocytes. Interestingly, the transcript levels of both mtnr1a1.4 in the diencephalon and mtnr1a1.7 in the ovary displayed two cycles within one lunar month, and peaked around the first and last lunar quarters. We used 17α,20β-dihydroxy-4-pregnen-3-one (DHP), a maturation-inducing hormone, as a biomarker to examine the involvement of melatonin receptors in the control of the spawning cycle. Melatonin significantly increased the plasma DHP level 1h post intraperitoneal injection. Melatonin also directly stimulated ovarian fragments in vitro to produce a significantly higher amount of DHP. Taken together, these results provided the first evidence that melatonin receptors were involved in the synchronization of the semilunar spawning rhythm in the female mudskipper by acting through the HPG axis and/or directly on ovarian tissues to stimulate the production of DHP. Copyright © 2013 Elsevier Inc. All rights reserved.

Effects of chronic delta-9-tetrahydrocannabinol (THC) administration on neurotransmitter concentrations and receptor binding in the rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, S.F.; Newport, G.D.; Scallet, A.C.

THC is the major psychoactive constituent of marijuana and is also known as an hallucinogenic compound. Numerous reports have shown that large doses of THC produce significant alterations in various neurotransmitter systems. The present study was designed to determine whether chronic exposure to THC produces significant alterations in selected neurotransmitter systems (dopamine, serotonin, acetylcholine, GABAergic, benzodiazepine, and opiate) in the rat brain. In Experiment 1, male Sprague-Dawley rats were gavaged with vehicle, 10 or 20 mg THC/kg body weight daily, 5 days/week for 90 days. Animals were killed either 24 hours or two months after the last dose. Brains weremore » dissected into different regions for neurochemical analyses. Two months after the cessation of chronic administration, there was a significant decrease in GABA receptor binding in the hippocampus of animals in the high dose group. However, no other significant changes were found in neurotransmitter receptor binding characteristics in the hippocampus or in neurotransmitter concentrations in the caudate nucleus, hypothalamus or septum after chronic THC administration. In an attempt to replicate the GABA receptor binding changes and also to determine the (35S)TBPS binding in hippocampus, we designed Experiment 2. In this experiment, we dosed the animals by gavage with 0, 5, 10 or 20 mg THC/kg daily, 5 days/week or with 20 mg THC/kg Monday through Thursday and 60 mg/kg on Friday for 90 days. Results from this experiment failed to replicate the dose-dependent effect of THC on GABA receptor binding in hippocampus. Modulation of (35S)TBPS binding by GABA or 3 alpha-OH-DHP or inhibition by cold TBPS in frontal cortex did not show any significant dose-related effects.« less

Atypical 1,4-dihydropyridine derivatives, an approach to neuroprotection and memory enhancement.

PubMed

Klusa, Vija

2016-11-01

This mini review is devoted to the design and pharmacological studies of novel atypical 1,4-dihydropyridine (DHP) derivatives which differ to a great extent from the traditional DHPs either by lack of neuronal calcium channel blocking activity and/or inability to protect mitochondrial processes. About 100 new DHP derivatives were screened and the mostly active were selected for detailed studies. The compounds of the series of the amino acid ("free" plus "crypto")-containing DHPs and lipophilic di-cyclic DHPs demonstrated long-lasting neuroprotective and/or memory-enhancing action, particularly at low doses (0.005-0.05mg/kg) in different neurodeficiency rat or mice models, and exerted neurotransmitter-modulating effects. The studies have shown an ability of these atypical DHPs to normalize the expression of neuronal proteins, which participate in the regulation of neurotransmission (particularly of the GABAergic system) and synaptic plasticity that has been impaired in animal models, including Alzheimer's disease transgenic mice. The obtained results indicate that the tested DHP compounds can be considered as candidate molecules either for their further chemical modifications or for the more detailed studies to identify cell targets essential for neuroprotection and memory enhancing. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fatty acid DSF binds and allosterically activates histidine kinase RpfC of phytopathogenic bacterium Xanthomonas campestris pv. campestris to regulate quorum-sensing and virulence

PubMed Central

Zhang, Huan; Pan, Yue; Wu, Yao; Tian, Xiu-Qi; Wang, Fang-Fang; Wang, Li

2017-01-01

As well as their importance to nutrition, fatty acids (FA) represent a unique group of quorum sensing chemicals that modulate the behavior of bacterial population in virulence. However, the way in which full-length, membrane-bound receptors biochemically detect FA remains unclear. Here, we provide genetic, enzymological and biophysical evidences to demonstrate that in the phytopathogenic bacterium Xanthomonas campestris pv. campestris, a medium-chain FA diffusible signal factor (DSF) binds directly to the N-terminal, 22 amino acid-length sensor region of a receptor histidine kinase (HK), RpfC. The binding event remarkably activates RpfC autokinase activity by causing an allosteric change associated with the dimerization and histidine phosphotransfer (DHp) and catalytic ATP-binding (CA) domains. Six residues were found essential for sensing DSF, especially those located in the region adjoining to the inner membrane of cells. Disrupting direct DSF-RpfC interaction caused deficiency in bacterial virulence and biofilm development. In addition, two amino acids within the juxtamembrane domain of RpfC, Leu172 and Ala178, are involved in the autoinhibition of the RpfC kinase activity. Replacements of them caused constitutive activation of RpfC-mediated signaling regardless of DSF stimulation. Therefore, our results revealed a biochemical mechanism whereby FA activates bacterial HK in an allosteric manner, which will assist in future studies on the specificity of FA-HK recognition during bacterial virulence regulation and cell-cell communication. PMID:28369120

Blockage of progestin physiology disrupts ovarian differentiation in XX Nile tilapia (Oreochromis niloticus).

PubMed

Zhou, Linyan; Luo, Feng; Fang, Xuelian; Charkraborty, Tapas; Wu, Limin; Wei, Jing; Wang, Deshou

2016-04-22

Previous studies indicated that maturation inducing hormone, 17α, 20β-Dihydroxy-4-pregnen-3-one (DHP), probably through nuclear progestin receptor (Pgr), might be involved in spermatogenesis and oogenesis in fish. To further elucidate DHP actions in teleostean ovarian differentiation, we analyzed the expression of pgr in the ovary of Nile tilapia (Oreochromis niloticus), and performed RU486 (a synthetic Pgr antagonist) treatment in XX fish from 5 days after hatching (dah) to 120 dah. Tilapia Pgr was abundantly expressed in the follicular cells surrounding oocytes at 30 and 90 dah. Continuous RU486 treatment led to the blockage of oogenesis and masculinization of somatic cells in XX fish. Termination of RU486 treatment and maintenance in normal condition resulted in testicular differentiation, and estrogen compensation in RU486-treated XX fish successfully restored oogenesis. In RU486-treated XX fish, transcript levels of female dominant genes were significantly reduced, while male-biased genes were evidently augmented. Meanwhile, both germ cell mitotic and meiotic markers were substantially reduced. Consistently, estrogen production levels were significantly declined in RU486-treated XX fish. Taken together, our data further proved that DHP, possibly through Pgr, might be essential in the ovarian differentiation and estrogen production in fish. Copyright © 2016 Elsevier Inc. All rights reserved.

Online learning control using adaptive critic designs with sparse kernel machines.

PubMed

Xu, Xin; Hou, Zhongsheng; Lian, Chuanqiang; He, Haibo

2013-05-01

In the past decade, adaptive critic designs (ACDs), including heuristic dynamic programming (HDP), dual heuristic programming (DHP), and their action-dependent ones, have been widely studied to realize online learning control of dynamical systems. However, because neural networks with manually designed features are commonly used to deal with continuous state and action spaces, the generalization capability and learning efficiency of previous ACDs still need to be improved. In this paper, a novel framework of ACDs with sparse kernel machines is presented by integrating kernel methods into the critic of ACDs. To improve the generalization capability as well as the computational efficiency of kernel machines, a sparsification method based on the approximately linear dependence analysis is used. Using the sparse kernel machines, two kernel-based ACD algorithms, that is, kernel HDP (KHDP) and kernel DHP (KDHP), are proposed and their performance is analyzed both theoretically and empirically. Because of the representation learning and generalization capability of sparse kernel machines, KHDP and KDHP can obtain much better performance than previous HDP and DHP with manually designed neural networks. Simulation and experimental results of two nonlinear control problems, that is, a continuous-action inverted pendulum problem and a ball and plate control problem, demonstrate the effectiveness of the proposed kernel ACD methods.

Tumor microenvironment dual-responsive core-shell nanoparticles with hyaluronic acid-shield for efficient co-delivery of doxorubicin and plasmid DNA.

PubMed

Wang, Tianqi; Yu, Xiaoyue; Han, Leiqiang; Liu, Tingxian; Liu, Yongjun; Zhang, Na

2017-01-01

As the tumor microenvironment (TME) develops, it is critical to take the alterations of pH value, reduction and various enzymes of the TME into consideration when constructing the desirable co-delivery systems. Herein, TME pH and enzyme dual-responsive core-shell nanoparticles were prepared for the efficient co-delivery of chemotherapy drug and plasmid DNA (pDNA). A novel pH-responsive, positively charged drug loading material, doxorubicin (DOX)-4-hydrazinobenzoic acid (HBA)-polyethyleneimine (PEI) conjugate (DOX-HBA-PEI, DHP), was synthesized to fabricate positively charged polyion complex inner core DHP/DNA nanoparticles (DDN). Hyaluronic acid (HA) was an enzyme-responsive shell which could protect the core and enhance the co-delivery efficiency through CD44-mediated endocytosis. The HA-shielded pH and enzyme dual-responsive nanoparticles (HDDN) were spherical with narrow distribution. The particle size of HDDN was 148.3±3.88 nm and the zeta potential was changed to negative (-18.1±2.03 mV), which led to decreased cytotoxicity. The cumulative release of DOX from DHP at pH 5.0 (66.4%) was higher than that at pH 7.4 (30.1%), which indicated the pH sensitivity of DHP. The transfection efficiency of HDDN in 10% serum was equal to that in the absence of serum, while the transfection of DDN was significantly decreased in the presence of 10% serum. Furthermore, cellular uptake studies and co-localization assay showed that HDDN were internalized effectively through CD44-mediated endocytosis in the tumor cells. The efficient co-delivery of DOX and pEGFP was confirmed by fluorescent image taken by laser confocal microscope. It can be concluded that TME dual-responsive HA-shielded core-shell nanoparticles could be considered as a promising platform for the co-delivery of chemotherapy drug and pDNA.

Sex steroid levels in XY males and sex-reversed XX males, of rainbow trout (Oncorhynchus mykiss), during the reproductive cycle.

PubMed

Espinosa, E; Josa, A; Gil, L; González, N

2011-02-01

In this study, the annual cycle of the gonadal steroids testosterone (T), 11-ketotestosterone (11-KT), 17β-oestradiol (E2) and 17α, 20β-dihydroxy-4-pregnen-3-one (DHP) was determined using radioimmunoassay and then compared, for XY males (n=35) and sex-reversed XX males (n=27) rainbow trout, to establish possible endocrinology differences. Both in XY males and sex-reversed XX males, significant correlation was shown between body weight and T (r=0.5046 and 0.34078, respectively; p<0.0001) or KT (r=0.52494 and 0.43545, respectively; p<0.0001) concentrations. Plasma androgen levels in XY and sex-reversed XX males were similar and showed an intense seasonal variation. The highest levels for T and 11-KT were detected from December to April with a peak in January (51.67 ± 5.11 and 61.95 ± 4.25 ng/ml, for XY males and 57.1 ± 5.82 and 59.27 ± 4.84 ng/ml, respectively, for XX males). In addition, there was a positive correlation (p<0.0001) between T and 11-KT levels for XY males (r=0.7533) and sex-reversed XX males (r=0.6019). Concentrations of DHP in XY males also showed seasonal variation with a peak in February (25.18 ± 12.99 ng/ml). However, DHP levels in sex-reversed XX males were undetectable (<0.1 ng/ml) over the year. Levels of E2 were undetectable through the year in both groups of trout. In conclusion, the androgenic and oestrogenic profiles of sex-reversed XX males were similar to those observed in XY males. The only difference in the annual gonadal steroid cycle between XY and sex-reversed XX males was in the DHP profile. © 2009 Blackwell Verlag GmbH.

Doxycycline reduces the expression and activity of matrix metalloproteinase-2 in the periodontal ligament of the rat incisor without altering the eruption process.

PubMed

Gomes, J R; Omar, N F; Neves, J D S; Novaes, P D

2017-06-01

Doxycycline is an antibiotic agent that inhibits the activity of matrix metalloproteinases (MMPs) present in the extracellular matrix. In this study, the rat incisor was submitted to a hypofunctional condition, and the effects of doxycycline (80 mg/kg/d) on the expression and activity of MMP-2, as well as on eruption rate, were determined in the odontogenic region and in the periodontal ligament for 14 d. Rats were distributed into four groups: normofunctional (NF); doxycyline normofunctional (DNF); hypofunctional (HP); and doxycyline hypofunctional (DHP). The left lower incisors of 10 rats were shortened every 2 d, using a high-rotation drill, to produce the HP and DHP groups, after starting doxycycline treatment (80 mg/kg) by gavage. Eruption was measured using a millimeter ocular, from the gingival margin to the top of the tooth in the HP and DHP groups, and also by a mark made in the tooth previously, in the NF and DNF groups. The hemimandibles were removed and the teeth were extracted to collect the periodontal and odontogenic tissues for immunohistochemical analyses and zymography. The eruption rates were higher in the HP and the DHP groups than in the NF and DNF groups, respectively (p < 0.05). In the odontogenic region, neither of the treatments changed the expression and activity of MMP-2. In the HP group, the shortening treatment decreased the expression, but not the activity, of MMP-2, while doxycycline was able to inhibit the increase of expression and activity of MMP-2. We conclude that the inhibition of MMP-2 by doxycycline, during incisor shortening, was not enough to alter the eruption rate, which suggests that MMP-2 may have an important role in the turnover of extracellular matrix of the periodontal ligament during the tooth-eruption process. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Progestin Concentrations Are Increased following Paced Mating in Midbrain, Hippocampus, Diencephalon, and Cortex of Rats in Behavioral Estrus, but Only in Midbrain of Diestrous Rats

PubMed Central

Frye, Cheryl A.; Rhodes, Madeline E.

2013-01-01

Background The progesterone (P4 ) metabolite, 5α-pregnan-3α-ol-20-one (3α,5α-THP), acts in the midbrain ventral tegmental area (VTA) to modulate the intensity and duration of lordosis. 3α,5α-THP can also have anti-anxiety and anti-stress effects in part through actions in the hippocampus. Separate reports indicate that manipulating 3α,5α-THP levels in the VTA or hippocampus respectively can influence lordosis and affective behavior. 3α,5α-THP levels can also be altered by behavioral experiences, such as mating or swim stress. Whether endogenous levels of 3α,5α-THP modulate and/or are increased in response to affective and/or reproductively-relevant behaviors was investigated. Methods In Experiment 1, rats in behavioral estrus or diestrus were individually tested sequentially in the open field, elevated plus maze, partner preference, social interaction, and paced mating tasks and levels of 17 β-estradiol (E2), P4, dihydroprogesterone (DHP), and 3α,5α-THP in serum, midbrain, hippocampus, diencephalon, and cortex were examined. In Experiments 2 and 3, rats in behavioral estrus or diestrus, were individually tested in the battery indicated above, with, or without, paced mating and tissues were collected immediately after testing for later assessment of endocrine measures. Results In Experiment 1, behavioral estrous, compared to diestrous, rats demonstrated more exploratory, anti-anxiety, social, and reproductive behaviors, and had higher levels of E2 and progestins in serum, midbrain, hippocampus, diencephalon, and cortex. In Experiment 2, in midbrain and hippocampus, levels of 3α,5α-THP and its precursor DHP were increased among rats in behavioral estrus that were mated. In diencephalon, and cortex, DHP levels were increased by mating. In Experiment 3, in midbrain, levels of 3α,5α-THP and its precursor DHP were increased among diestrous rats that were tested in the behavioral battery with mating as compared to those tested in the behavioral battery without mating. Conclusions Increased levels of 3α,5α-THP in behavioral estrus versus diestrous rats are associated with enhanced exploratory, anti-anxiety, social, and reproductive behaviors. Rats in behavioral estrus that are mated have further increases in 3α,5α-THP and/or DHP levels in midbrain, hippocampus, diencephalon, and cortex than do non-mated rats in behavioral estrus, whereas diestrous rats only show 3α,5α-THP increases in midbrain in response to behavioral testing that included mating. PMID:17028418

A Role of Endogenous Progesterone in Stroke Cerebroprotection Revealed by the Neural-Specific Deletion of Its Intracellular Receptors.

PubMed

Zhu, Xiaoyan; Fréchou, Magalie; Liere, Philippe; Zhang, Shaodong; Pianos, Antoine; Fernandez, Neïké; Denier, Christian; Mattern, Claudia; Schumacher, Michael; Guennoun, Rachida

2017-11-08

Treatment with progesterone protects the male and female brain against damage after middle cerebral artery occlusion (MCAO). However, in both sexes, the brain contains significant amounts of endogenous progesterone. It is not known whether endogenously produced progesterone enhances the resistance of the brain to ischemic insult. Here, we used steroid profiling by gas chromatography-tandem mass spectrometry (GC-MS/MS) for exploring adaptive and sex-specific changes in brain levels of progesterone and its metabolites after MCAO. We show that, in the male mouse brain, progesterone is mainly metabolized via 5α-reduction leading to 5α-dihydroprogesterone (5α-DHP), also a progesterone receptor (PR) agonist ligand in neural cells, then to 3α,5α-tetrahydroprogesterone (3α,5α-THP). In the female mouse brain, levels of 5α-DHP and 3α,5α-THP are lower and levels of 20α-DHP are higher than in males. After MCAO, levels of progesterone and 5α-DHP are upregulated rapidly to pregnancy-like levels in the male but not in the female brain. To assess whether endogenous progesterone and 5α-DHP contribute to the resistance of neural cells to ischemic damage, we inactivated PR selectively in the CNS. Deletion of PR in the brain reduced its resistance to MCAO, resulting in increased infarct volumes and neurological deficits in both sexes. Importantly, endogenous PR ligands continue to protect the brain of aging mice. These results uncover the unexpected importance of endogenous progesterone and its metabolites in cerebroprotection. They also reveal that the female reproductive hormone progesterone is an endogenous cerebroprotective neurosteroid in both sexes. SIGNIFICANCE STATEMENT The brain responds to injury with protective signaling and has a remarkable capacity to protect itself. We show here that, in response to ischemic stroke, levels of progesterone and its neuroactive metabolite 5α-dihydroprogesterone are upregulated rapidly in the male mouse brain but not in the female brain. An important role of endogenous progesterone in cerebroprotection was demonstrated by the conditional inactivation of its receptor in neural cells. These results show the importance of endogenous progesterone, its metabolites, and neural progesterone receptors in acute cerebroprotection after stroke. This new concept could be exploited therapeutically by taking into account the progesterone status of patients and by supplementing and reinforcing endogenous progesterone signaling for attaining its full cerebroprotective potential. Copyright © 2017 the authors 0270-6474/17/3710998-23$15.00/0.

Synthesis, characterization, and evaluation of poly(aminoethyl) modified chitosan and its hydrogel used as antibacterial wound dressing.

PubMed

Zhang, Yubei; Dang, Qifeng; Liu, Chengsheng; Yan, Jingquan; Cha, Dongsu; Liang, Shengnan; Li, Xiaoli; Fan, Bing

2017-09-01

This study aims to develop new antibacterial hydrogel wound dressings composed of poly(aminoethyl) modified chitosan (PAEMCS). FTIR, 1 H NMR, and elemental analysis demonstrated that PAEMCS was successfully synthesized via grafting poly(aminoethyl) groups onto hydroxyl groups on chitin first, and removing acetyl groups from the grafted polymer afterward. XRD and TGA implied its well-defined crystallinity and thermostability. Furthermore, a series of hydrogels were fabricated under the participation of dipotassium hydrogen phosphate (DHP). The gelation tests suggested that the higher concentration of PAEMCS or DHP was beneficial to the formation of hydrogels. The pH values of hydrogels at 37°C were all in the range of 7.12-7.50. The rheological tests indicated that PAEMCS-based hydrogels were of lower DHP addition and higher elasticity than CS-based hydrogels to achieve the same gelation temperature under the same polymer's concentration. Additionally, the swelling, anti-bacteria, and cytotoxicity experiments showed that PAEMCS-based hydrogels possessed excellent hygroscopicity, high antibacterial activity against E. coli, S. aureus, or S. epidermidis, and good cytocompatibility toward L929 cells or HUVECs, respectively. All the results implied that PAEMCS-based hydrogels not only maintained inherent multiple properties of chitosan but also possessed excellent antibacterial activity, and might be promising antibacterial hydrogel dressings used in wound therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis, structural characterization and density functional studies of ethyl 4-(biphenyl-4-yl)-2,6,6-trimethyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate A non-merohedral twinned structure

NASA Astrophysics Data System (ADS)

Yıdırım, Sema Öztürk; Büyükmumcu, Zeki; Butcher, Ray J.; Çetin, Gökalp; Şimşek, Rahime; Şafak, Cihat

2018-07-01

1,4-Dihydropyridine (1,4-DHP) derivatives have the reducing effect of extracellular Ca2+ ions influx on the L-type calcium channel. Because of this effect many 1,4-DHP derivatives are potent calcium channel blockers and antihypertensive agents. The biphenyl group is present in the structures of the most biologically active compounds and thus is an important group. By introducing this moiety into the structure of various compounds, active compounds are obtained. Thus, pharmacologically active structures can be condensed with the biphenyl structure to achieve novel biologically active compounds or compounds with increased activity. In this study, to achieve an active calcium channel blocker compound, the biphenyl group was introduced into the 1,4-DHP structure. The structure of the compound is proved by IR, 1H NMR, Mass spectroscopy, X-ray crystallography and elemental analysis. The cytotoxic activity assays have continued and positive results have been obtained. The phenyl rings [C16-C21 and C22-C27] make dihedral angles of 84.4 (1) and 87.5 (1)°, respectively, with the 1,4-dihydropyridine ring [N1/C1/C4-C9]. In the crystal, adjacent molecules are linked by Nsbnd H … O and Csbnd H … O hydrogen bonds into chains parallel to [010].

The effect of different extraction techniques on property and bioactivity of polysaccharides from Dioscorea hemsleyi.

PubMed

Zhao, Chengcheng; Li, Xia; Miao, Jing; Jing, Songsong; Li, Xuejiao; Huang, Luqi; Gao, Wenyuan

2017-09-01

The rhizoma of Dioscorea hemsleyi (DH) has been used as a treatment of diabetes in China for hundreds of years. Polysaccharides in DH were extracted by using ultrasonic-assisted extraction (UAE), cold water extraction (CWE), warm water extraction (WWE) and hot water extraction (HWE), separately. Then the different characterizations of four DH polysaccharide (DHP) samples were analyzed by high-performance liquid chromatography (HPLC), high-performance Gel permeation chromatography (HGPC), ultraviolet-visible spectroscopy(UV), fourier transform-infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). Their activities in vitro of DHP were compared. Experimental results showed that HWE had the highest yield and large molecular weight. CWE had the highest uronic acid yield and little molecular weight, and its DPPH, AGI and AAI activity were the best. The molecular weight of UAE was small, and its RP and FRAP activity were the best. Four DHP samples had differences in the surface topography, while they all had the typical IR spectra characteristic of polysaccharides. According the correlation analysis, it showed that the more uronic acid and the lower molecular weight was, the higher the antioxidant activity was. The high content of monosaccharide composition of Xyl, Ara, GlcA and GalA, and little molecular weight have good effect on antidiabetic activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Integrated readout electronics for Belle II pixel detector

NASA Astrophysics Data System (ADS)

Blanco, R.; Leys, R.; Perić, I.

2018-03-01

This paper describes the readout components for Belle II that have been designed as integrated circuits. The ICs are connected to DEPFET sensor by bump bonding. Three types of ICs have been developed: SWITCHER for pixel matrix control, DCD for readout and digitizing of sensor signals and DHP for digital data processing. The ICs are radiation tolerant and use several novel features, such as the multiple-input differential amplifiers and the fast and radiation hard high-voltage drivers. SWITCHER and DCD have been developed at University of Heidelberg, Karlsruhe Institute of Technology (KIT) and DHP at Bonn University. The IC-development started in 2009 and was accomplished in 2016 with the submissions of final designs. The final ICs for Belle II pixel detector and the related measurement results will be presented in this contribution.

Fast activation of dihydropyridine-sensitive calcium channels of skeletal muscle. Multiple pathways of channel gating

PubMed Central

1996-01-01

Dihydropyridine (DHP) receptors of the transverse tubule membrane play two roles in excitation-contraction coupling in skeletal muscle: (a) they function as the voltage sensor which undergoes fast transition to control release of calcium from sarcoplasmic reticulum, and (b) they provide the conducting unit of a slowly activating L-type calcium channel. To understand this dual function of the DHP receptor, we studied the effect of depolarizing conditioning pulse on the activation kinetics of the skeletal muscle DHP-sensitive calcium channels reconstituted into lipid bilayer membranes. Activation of the incorporated calcium channel was imposed by depolarizing test pulses from a holding potential of -80 mV. The gating kinetics of the channel was studied with ensemble averages of repeated episodes. Based on a first latency analysis, two distinct classes of channel openings occurred after depolarization: most had delayed latencies, distributed with a mode of 70 ms (slow gating); a small number of openings had short first latencies, < 12 ms (fast gating). A depolarizing conditioning pulse to +20 mV placed 200 ms before the test pulse (-10 mV), led to a significant increase in the activation rate of the ensemble averaged-current; the time constant of activation went from tau m = 110 ms (reference) to tau m = 45 ms after conditioning. This enhanced activation by the conditioning pulse was due to the increase in frequency of fast open events, which was a steep function of the intermediate voltage and the interval between the conditioning pulse and the test pulse. Additional analysis demonstrated that fast gating is the property of the same individual channels that normally gate slowly and that the channels adopt this property after a sojourn in the open state. The rapid secondary activation seen after depolarizing prepulses is not compatible with a linear activation model for the calcium channel, but is highly consistent with a cyclical model. A six- state cyclical model is proposed for the DHP-sensitive Ca channel, which pictures the normal pathway of activation of the calcium channel as two voltage-dependent steps in sequence, plus a voltage-independent step which is rate limiting. The model reproduced well the fast and slow gating models of the calcium channel, and the effects of conditioning pulses. It is possible that the voltage-sensitive gating transitions of the DHP receptor, which occur early in the calcium channel activation sequence, could underlie the role of the voltage sensor and yield the rapid excitation-contraction coupling in skeletal muscle, through either electrostatic or allosteric linkage to the ryanodine receptors/calcium release channels. PMID:8882865

Projected impacts of climate change on hydropower potential in China

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xingcai; Tang, Qiuhong; Voisin, Nathalie

Hydropower is an important renewable energy source in China, but it is sensitive to climate change, because the changing climate may alter hydrological conditions (e.g., river flow and reservoir storage). Future changes and associated uncertainties in China's gross hydropower potential (GHP) and developed hydropower potential (DHP) are projected using simulations from eight global hydrological models (GHMs), including a large-scale reservoir regulation model, forced by five general circulation models (GCMs) with climate data under two representative concentration pathways (RCP2.6 and RCP8.5). Results show that the estimation of the present GHP of China is comparable to other studies; overall, the annual GHP is projectedmore » to change by −1.7 to 2 % in the near future (2020–2050) and increase by 3 to 6 % in the late 21st century (2070–2099). The annual DHP is projected to change by −2.2 to −5.4 % (0.7–1.7 % of the total installed hydropower capacity (IHC)) and −1.3 to −4 % (0.4–1.3 % of total IHC) for 2020–2050 and 2070–2099, respectively. Regional variations emerge: GHP will increase in northern China but decrease in southern China – mostly in south central China and eastern China – where numerous reservoirs and large IHCs currently are located. The area with the highest GHP in southwest China will have more GHP, while DHP will reduce in the regions with high IHC (e.g., Sichuan and Hubei) in the future. The largest decrease in DHP (in %) will occur in autumn or winter, when streamflow is relatively low and water use is competitive. Large ranges in hydropower estimates across GHMs and GCMs highlight the necessity of using multimodel assessments under climate change conditions. This study prompts the consideration of climate change in planning for hydropower development and operations in China, to be further combined with a socioeconomic analysis for strategic expansion.« less

Comparing sex steroid levels during the annual cycles of rainbow trout (Oncorhynchus mykiss) diploid female (XX) and triploid female (XXX) genotypic sex.

PubMed

Espinosa, E; Josa, A; Gil, L; Malo, C; Mitjana, O

2013-02-01

In this study, the annual cycle of the gonadal steroids testosterone (T), 11-ketotestosterone (11-KT), 17β-estradiol (E2) and 17α, 20β-dihydroxy-4-pregnen-3-one (DHP) was determined using radioimmunoassay and then compared for two populations of rainbow trout, XX diploid females (n = 40) and XXX triploid females (n = 15). In females, E2 and DHP levels were found to be significantly related to body weight (r = 0.22513; p < 0.0001 and r = 0.15831; p > 0.001, respectively). In this group, E2 concentrations peaked in November (25.05 ng/ml), while maximum DHP levels, only measurable from October to April, were attained in February (64.14 ng/ml). No significant differences in hormone ranges related to egg output ability were observed. Finally, sex steroid concentrations were low in the triploid female XXX fish compared to the female XX population. Nevertheless, maximum T (33.85 ng/ml) and 11-KT (32.35 ng/ml) levels were recorded in January, for XXX. The levels for these two hormones are relatively high and are also significantly associated (r = 0.8430; p < 0.0001). Diploid females showed significantly higher levels of E2 than triploids over the 12-month study period. The female triploid fish produced the lowest steroid hormone levels, such that these would be the most suitable for human consumption. © 2012 Blackwell Verlag GmbH.

Trial-unique, delayed nonmatching-to-location (TUNL) touchscreen testing for mice: sensitivity to dorsal hippocampal dysfunction.

PubMed

Kim, Chi Hun; Romberg, Carola; Hvoslef-Eide, Martha; Oomen, Charlotte A; Mar, Adam C; Heath, Christopher J; Berthiaume, Andrée-Anne; Bussey, Timothy J; Saksida, Lisa M

2015-11-01

The hippocampus is implicated in many of the cognitive impairments observed in conditions such as Alzheimer's disease (AD) and schizophrenia (SCZ). Often, mice are the species of choice for models of these diseases and the study of the relationship between brain and behaviour more generally. Thus, automated and efficient hippocampal-sensitive cognitive tests for the mouse are important for developing therapeutic targets for these diseases, and understanding brain-behaviour relationships. One promising option is to adapt the touchscreen-based trial-unique nonmatching-to-location (TUNL) task that has been shown to be sensitive to hippocampal dysfunction in the rat. This study aims to adapt the TUNL task for use in mice and to test for hippocampus-dependency of the task. TUNL training protocols were altered such that C57BL/6 mice were able to acquire the task. Following acquisition, dysfunction of the dorsal hippocampus (dHp) was induced using a fibre-sparing excitotoxin, and the effects of manipulation of several task parameters were examined. Mice could acquire the TUNL task using training optimised for the mouse (experiments 1). TUNL was found to be sensitive to dHp dysfunction in the mouse (experiments 2, 3 and 4). In addition, we observed that performance of dHp dysfunction group was somewhat consistently lower when sample locations were presented in the centre of the screen. This study opens up the possibility of testing both mouse and rat models on this flexible and hippocampus-sensitive touchscreen task.

Manganese Catalysts for C–H activation: An Experimental/Theoretical Study Identifies the Stereoelectronic Factor that Controls the Switch between Hydroxylation and Desaturation Pathways

PubMed Central

Hull, Jonathan F.; Balcells, David; Sauer, Effiette L. O.; Raynaud, Christophe; Brudvig, Gary W.; Crabtree, Robert H.; Eisenstein, Odile

2010-01-01

We describe competitive C–H activation chemistry of two types, desaturation and hydroxylation, using synthetic manganese catalysts with several substrates. 9,10-dihydrophenanthrene (DHP) gives the highest desaturation activity, the final products being phenanthrene (P1) and phenanthrene-9,10-oxide (P3), the latter being thought to arise from epoxidation of some of the phenanthrene. The hydroxylase pathway also occurs as suggested by the presence of the dione product, phenanthrene-9,10-dione (P2), thought to arise from further oxidation of hydroxylation intermediate 9-hydroxy-9,10-dihydrophenanthrene. The experimental work together with the DFT calculations shows that the postulated Mn oxo active species, [Mn(O)(tpp)(Cl)] (tpp = tetraphenyl porphyrin), can promote the oxidation of dihydrophenanthrene by either desaturation or hydroxylation pathways. The calculations show that these two competing reactions have a common initial step – radical H abstraction from one of the DHP sp3 C–H bonds. The resulting Mn hydroxo intermediate is capable of promoting not only OH rebound (hydroxylation) but also a second H abstraction adjacent to the first (desaturation). Like the active MnV=O species, this MnIV-OH species also has radical character on oxygen and can thus give H abstraction. Both steps have very low and therefore very similar energy barriers, leading to a product mixture. Since the radical character of the catalyst is located on the oxygen p orbital perpendicular to the MnIV-OH plane, the orientation of the organic radical with respect to this plane determines which reaction, desaturation or hydroxylation, will occur. Stereoelectronic factors such as the rotational orientation of the OH in the enzyme active site is thus likely to constitute the switch between hydroxylation and desaturation behavior. PMID:20481432

Probabilistic DHP adaptive critic for nonlinear stochastic control systems.

PubMed

Herzallah, Randa

2013-06-01

Following the recently developed algorithms for fully probabilistic control design for general dynamic stochastic systems (Herzallah & Káarnáy, 2011; Kárný, 1996), this paper presents the solution to the probabilistic dual heuristic programming (DHP) adaptive critic method (Herzallah & Káarnáy, 2011) and randomized control algorithm for stochastic nonlinear dynamical systems. The purpose of the randomized control input design is to make the joint probability density function of the closed loop system as close as possible to a predetermined ideal joint probability density function. This paper completes the previous work (Herzallah & Káarnáy, 2011; Kárný, 1996) by formulating and solving the fully probabilistic control design problem on the more general case of nonlinear stochastic discrete time systems. A simulated example is used to demonstrate the use of the algorithm and encouraging results have been obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

Even apparently insignificant chemical deviations among bioequivalent generic antibiotics can lead to therapeutic nonequivalence: the case of meropenem.

PubMed

Agudelo, M; Rodriguez, C A; Pelaez, C A; Vesga, O

2014-01-01

Several studies with animal models have demonstrated that bioequivalence of generic products of antibiotics like vancomycin, as currently defined, do not guarantee therapeutic equivalence. However, the amounts and characteristics of impurities and degradation products in these formulations do not violate the requirements of the U.S. Pharmacopeia (USP). Here, we provide experimental data with three generic products of meropenem that help in understanding how these apparently insignificant chemical differences affect the in vivo efficacy. Meropenem generics were compared with the innovator in vitro by microbiological assay, susceptibility testing, and liquid chromatography/mass spectrometry (LC/MS) analysis and in vivo with the neutropenic guinea pig soleus infection model (Pseudomonas aeruginosa) and the neutropenic mouse thigh (P. aeruginosa), brain (P. aeruginosa), and lung (Klebisella pneumoniae) infection models, adding the dihydropeptidase I (DHP-I) inhibitor cilastatin in different proportions to the carbapenem. We found that the concentration and potency of the active pharmaceutical ingredient, in vitro susceptibility testing, and mouse pharmacokinetics were identical for all products; however, two generics differed significantly from the innovator in the guinea pig and mouse models, while the third generic was therapeutically equivalent under all conditions. Trisodium adducts in a bioequivalent generic made it more susceptible to DHP-I hydrolysis and less stable at room temperature, explaining its therapeutic nonequivalence. We conclude that the therapeutic nonequivalence of generic products of meropenem is due to greater susceptibility to DHP-I hydrolysis. These failing generics are compliant with USP requirements and would remain undetectable under current regulations.

Identification of 17,20beta,21-trihydroxy-4-pregnen-3-one as an oocyte maturation-inducing steroid in black porgy, Acanthopagrus schlegeli.

PubMed

Yueh, Wen-Shiun; Thomas, Peter; Chang, Ching-Fong

2005-02-01

The identity of the maturation-inducing steroid (MIS) in black porgy, Acanthopagrus schlegeli, a marine protandrous teleost, is unknown. Previous studies demonstrated that two teleost MISs, the progestins 17,20beta,21-trihydroxy-4-pregnen-3-one (20beta-S) and 17,20beta-dihydroxy-4-pregnen-3-one (DHP) can induce maturation of black porgy oocytes in vitro. The purpose of the present study was to identify the major progestin produced during oocyte maturation (OM) in black porgy and investigate whether its secretion increases during this process. Females were injected twice with a LHRH analog to induce OM. Ovarian follicles undergoing OM were incubated in vitro with tritiated [3H]pregnenolone precursor and the tritiated products were extracted, purified, and identified by HPLC, TLC, acetylation, and recrystallization. Significant amounts of tritiated products were biosynthesized from [3H]pregnenolone that co-migrated with 20beta-S but not with DHP on HPLC and TLC. Similar TLC profiles were obtained with the tritiated products isolated from the HPLC/TLC 20beta-S fraction and standard 20beta-S after the acetylation reaction. The identity of the tritiated products as 20beta-S was confirmed by recrystallization. 20beta-S had a slightly higher potency than DHP in the inducing in vitro final oocyte maturation. Plasma 20beta-S concentrations increased significantly during the oocyte maturation after injection with a LHRH analog. The present data suggest that 20beta-S is the MIS in black porgy.

Development of a Double Hemispherical Probe for Improved Space Plasma Measurements

NASA Astrophysics Data System (ADS)

Wang, X.; Samaniego, J. I.; Hsu, H.-W.; Horányi, M.; Wahlund, J.-E.; Ergun, R. E.; Bering, E. A.

2018-04-01

Langmuir probes have been widely used for space plasma measurements for decades. However, there are still challenges in the interpretation of their measurements. Due to the interaction of the ambient plasma with a spacecraft and an onboard probe itself, the local plasma conditions around the probe could be very different from the true ambient plasma of interest. These local plasma conditions are often anisotropic and/or inhomogeneous. Most of the Langmuir probes that are made of a single electrode have difficulties to remove these local plasma effects, introducing errors in the derived plasma characteristics. Directional probes are able to characterize anisotropic and inhomogeneous plasmas. The split Langmuir probe and the Segmented Langmuir Probe have been developed to characterize the plasma flow in the Earth's ionosphere. Here we introduce a new type of a directional Langmuir probe, the Double Hemispherical Probe (DHP), to improve the space plasma measurements in a broad range of scenarios: (a) low-density plasmas, (b) high surface-emission (photo and/or secondary electron emission) environments, (c) flowing plasmas, and (d) dust-rich plasma environments. The DHP consists of two identical hemispheres that are electrically insulated and swept with the same voltages simultaneously. The difference currents between the two hemispheres are used to characterize the anisotropic/inhomogeneous plasma conditions created around the probe, which will be then removed or minimized on the interpretation of their current-voltage curves. This paper describes the basic concept and design of the DHP sensor, as well as its initial results tested in the laboratory plasma environments.

Experimental and molecular modeling investigation of isopropyl 4-(biphenyl-4-Yl)-2,6,6-trimethyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate

NASA Astrophysics Data System (ADS)

Yıldırım, Sema Öztürk; ćetin, Gökalp; Büyükmumcu, Zeki; Şimşek, Rahime; Şafak, Cihat; Butcher, Ray J.; Pekdur, Özlem Savaş

2018-02-01

The most important effect of 1,4-dihydropyridine (1,4-DHP) derivatives with various biological activities is to reduce the influx of extracellular Ca2+ ions. Because of this feature, many 1,4-DHP derivatives have been identified as potent calcium channel blockers and have been included in the treatment as antihypertensive agents. On the other hand, the biphenyl group is an important group in the molecule of biologically active compounds. The active compounds are obtained by introducing the biphenyl group into the structure of various compounds. In this study, the biphenyl group was introduced into the 1,4-DHP ring to reach to hexahydroquinoline (HHQ) derivative as an active calcium channel blocker compound. The structure of the compound was proved by IR, 1H-NMR, Mass spectroscopy, X-ray crystallography and elemental analysis. The cytotoxic properties of the compound has been determined, and biological activity assays continue. The crystal structure of C28H31NO3 was determined by single crystal X-ray diffraction: monoclinic, space group C c, a = 11.9713(3) Å, b = 18.7893(5) Å, c = 10.7358(3) Å, β = 102.411(4)°, Z = 4. The title molecule is twisted with the dihedral angle between two phenyl rings being 50.86(10)°. The optimized geometries of the title compound have been obtained employing DFT method. The calculated geometrical parameters were found to be in agreement with the experimental data.

Impact of a decision-support tool on decision making at the district level in Kenya

PubMed Central

2013-01-01

Background In many countries, the responsibility for planning and delivery of health services is devolved to the subnational level. Health programs, however, often fall short of efficient use of data to inform decisions. As a result, programs are not as effective as they can be at meeting the health needs of the populations they serve. In Kenya, a decision-support tool, the District Health Profile (DHP) tool was developed to integrate data from health programs, primarily HIV, at the district level and to enable district health management teams to review and monitor program progress for specific health issues to make informed service delivery decisions. Methods Thirteen in-depth interviews were conducted with ten tool users and three non-users in six districts to qualitatively assess the process of implementing the tool and its effect on data-informed decision making at the district level. The factors that affected use or non-use of the tool were also investigated. Respondents were selected via convenience sample from among those that had been trained to use the DHP tool except for one user who was self-taught to use the tool. Selection criteria also included respondents from urban districts with significant resources as well as respondents from more remote, under-resourced districts. Results Findings from the in-depth interviews suggest that among those who used it, the DHP tool had a positive effect on data analysis, review, interpretation, and sharing at the district level. The automated function of the tool allowed for faster data sharing and immediate observation of trends that facilitated data-informed decision making. All respondents stated that the DHP tool assisted them to better target existing services in need of improvement and to plan future services, thus positively influencing program improvement. Conclusions This paper stresses the central role that a targeted decision-support tool can play in making data aggregation, analysis, and presentation easier and faster. The visual synthesis of data facilitates the use of information in health decision making at the district level of a health system and promotes program improvement. The experience in Kenya can be applied to other countries that face challenges making district-level, data-informed decisions with data from fragmented information systems. PMID:24011028

Mainstreaming the Teacher.

ERIC Educational Resources Information Center

Barnsley, Roger; And Others

1989-01-01

Describes the practice teaching experience of a profoundly deaf woman in a mainstream junior high science classroom. Although problems had to be solved in communication, classroom management, and teaching methods, students and teachers described the outcome as educationally positive with additional benefits in students' non-academic learning. (DHP)

Detection of Pyrrolizidine Alkaloid DNA Adducts in Livers of Cattle Poisoned with Heliotropium europaeum.

PubMed

Fu, Peter P; Xia, Qingsu; He, Xiaobo; Barel, Shimon; Edery, Nir; Beland, Frederick A; Shimshoni, Jakob A

2017-03-20

Pyrrolizidine alkaloids are among the most common poisonous plants affecting livestock, wildlife, and humans. Exposure of humans and livestock to toxic pyrrolizidine alkaloids through the intake of contaminated food and feed may result in poisoning, leading to devastating epidemics. During February 2014, 73 mixed breed female beef cows from the Galilee region of Israel were accidently fed pyrrolizidine alkaloid contaminated hay for 42 days, resulting in the sudden death of 24 cows over a period of 63 days. The remaining cows were slaughtered 2.5 months after the last ingestion of the contaminated hay. In this study, we report the histopathological analysis of the livers from five of the slaughtered cows and quantitation of pyrrolizidine alkaloid-derived DNA adducts from their livers and three livers of control cows fed with feed free of weeds producing pyrrolizidine alkaloids. Histopathological examination revealed that the five cows suffered from varying degrees of bile duct proliferation, fibrosis, and megalocytosis. Selected reaction monitoring HPLC-ES-MS/MS analysis indicated that (±)-6,7-dihydro-7-hydroxy-1-hydroxymethyl-5H-pyrrolizine (DHP)-derived DNA adducts were formed in all five livers. The livers from the three control cows did not have any liver damage nor any indication of DHP-DNA adduct formed. These results confirm that the toxicity observed in these cattle was caused by pyrrolizidine alkaloid poisoning and that pyrrolizidine alkaloid-derived DNA adducts could still be detected and quantified in the livers of the chronically poisoned cows 2.5 months after their last exposure to the contaminated feed, suggesting that DHP-derived DNA adducts can serve as biomarkers for pyrrolizidine alkaloid exposure and poisoning.

A new, precise measurement of the primordial abundance of deuterium

NASA Astrophysics Data System (ADS)

Pettini, Max; Cooke, Ryan

2012-10-01

The metal-poor (Z ≃ 1/100 Z⊙) damped Lyman α system (DLA) at redshift zabs = 3.049 84 in the zem ≃ 3.030 QSO SDSS J1419+0829 has near-ideal properties for an accurate determination of the primordial abundance of deuterium (D/H)p. We have analysed a high-quality spectrum of this object with software specifically designed to deduce the best-fitting value of D/H and to assess comprehensively the random and systematic errors affecting this determination. We find (D/H)DLA = (2.535 ± 0.05) × 10-5, which in turn implies Ωb, 0h2 = 0.0223 ± 0.0009, in very good agreement with Ωb, 0h2(CMB) = 0.0222 ± 0.0004 deduced from the angular power spectrum of the cosmic microwave background (CMB). If the value in this DLA is indeed the true (D/H)p produced by big bang nucleosynthesis (BBN), there may be no need to invoke non-standard physics nor early astration of D to bring together Ωb, 0 h2(BBN) and Ωb, 0 h2(CMB). The scatter between most of the reported values of (D/H)p in the literature may be due largely to unaccounted systematic errors and biases. Further progress in this area will require a homogeneous set of data comparable to those reported here and analysed in a self-consistent manner. Such an endeavour, while observationally demanding, has the potential of improving our understanding of BBN physics, including the relevant nuclear reactions, and the subsequent processing of light nuclides through stars. Based on observations collected at the European Organisation for Astronomical Research in the Southern hemisphere, Chile [Very Large Telescope programme ID 085.A-0109(A)].

GABAergic miniature postsynaptic currents in septal neurons show differential allosteric sensitivity after binge-like ethanol exposure.

PubMed

DuBois, Dustin W; Trzeciakowski, Jerome P; Parrish, Alan R; Frye, Gerald D

2006-05-17

Binge-like ethanol treatment of septal neurons blunts GABAAR-mediated miniature postsynaptic currents (mPSCs), suggesting it arrests synaptic development. Ethanol may disrupt postsynaptic maturation by blunting feedback signaling through immature GABAARs. Here, the impact of ethanol on the sensitivity of mPSCs to zolpidem, zinc and 3alpha-hydroxy-5alpha-pregnan-20-one (3alpha-OH-DHP) was tested. The decay phase of mPSCs showed concentration-dependent potentiation by zolpidem (0.03-100 microM), which was substantially blunted after ethanol exposure. Since zolpidem potentiation exhibited a substantial age-dependent increase in untreated neurons, this finding supported the idea that ethanol arrests synaptic development. GABAAR alpha1 subunit protein also increased with age in untreated neurons, paralleling enhanced sensitivity to zolpidem. Surprisingly, alpha1 levels were not reduced by binge ethanol even though mPSCs were relatively zolpidem-insensitive. Zinc (3-30 microM) decreased mPSC parameters in a concentration- and age-related manner with older untreated cells showing less inhibition. However, there was no increase in mPSC zinc sensitivity after binge ethanol as would be expected if a general arrest of synaptic maturation had occurred. 3alpha-OH-DHP (3-1000 nM) induced concentration-dependent potentiation of mPSC decay. Although potentiation was age-independent, binge ethanol treatment exaggerated sensitivity to this neurosteroid. Finally, chronic picrotoxin pretreatment (100 microM) intended to mimic GABAAR inhibition from ethanol pretreatment did not significantly change mPSC modulation by zolpidem, zinc or 3alpha-OH-DHP. These results suggest that binge ethanol treatment selectively arrests a subset of processes important for maturation of postsynaptic GABAA Rs. However, it is unlikely that ethanol causes a broad arrest of postsynaptic development through a direct inhibition of GABAAR signaling.

Coiled-Coil Antagonism Regulates Activity of Venus Flytrap-Domain-Containing Sensor Kinases of the BvgS Family

PubMed Central

Lesne, Elodie; Dupré, Elian; Lensink, Marc F.; Locht, Camille

2018-01-01

ABSTRACT Bordetella pertussis controls the expression of its virulence regulon through the two-component system BvgAS. BvgS is a prototype for a family of multidomain sensor kinases. In BvgS, helical linkers connect periplasmic Venus flytrap (VFT) perception domains to a cytoplasmic Per-Arnt-Sim (PAS) domain and the PAS domain to the dimerization/histidine phosphotransfer (DHp) domain of the kinase. The two linkers can adopt coiled-coil structures but cannot do so simultaneously. The first linker forms a coiled coil in the kinase mode and the second in the phosphatase mode, with the other linker in both cases showing an increase in dynamic behavior. The intervening PAS domain changes its quaternary structure between the two modes. In BvgS homologues without a PAS domain, a helical “X” linker directly connects the VFT and DHp domains. Here, we used BvgS as a platform to characterize regulation in members of the PAS-less subfamily. BvgS chimeras of homologues with natural X linkers displayed various regulation phenotypes. We identified two distinct coiled-coil registers in the N- and C-terminal portions of the X linkers. Stable coil formation in the C-terminal moiety determines the phosphatase mode, similarly to BvgS; in contrast, coil formation in the N-terminal moiety along the other register leads to the kinase mode. Thus, antagonism between two registers in the VFT-DHp linker forms the basis for activity regulation in the absence of the PAS domain. The N and C moieties of the X linker play roles similar to those played by the two independent linkers in sensor kinases with a PAS domain, providing a unified mechanism of regulation for the entire family. PMID:29487240

Cigarette smoking and alveolar bone in young adults: a study using digitized radiographs.

PubMed

Rosa, Guillermo M; Lucas, Gabriela Q; Lucas, Oscar N

2008-02-01

Evidence indicates that cigarette smoking is one of the most significant risk factors for periodontal diseases; however, there have been few radiographic prospective studies of alveolar bone in young populations. The purpose of this study was to evaluate the effect of smoking on alveolar bone in young adults. Eighty-one dental students (mean age: 20.5 years), considered not to have periodontitis according to clinical criteria, participated in this study. Forty-two subjects were smokers (mean consumption was 14.1 cigarettes/day for > or =2 years), and 39 subjects had never smoked. A parallel-arm prospective design was used. All subjects took part in a dental hygiene program (DHP) that included oral hygiene instructions, mechanical debridement, and polishing. The following clinical variables were measured before and after the DHP: plaque index (PI), gingival crevicular fluid (GCF) flow rate, gingival index (GI), probing depth, and clinical attachment level (CAL). Standardized posterior vertical bitewing radiographs were taken and digitized preexperimentally and on days 180, 365, and 545. The following analyses were performed: bone height measurement (BHM), computer-assisted densitometric image analysis (CADIA), and qualitative analysis of digital subtraction radiography (DSR). Repeated-measures multiple-way analysis of variance (ANOVA) was performed between the groups, and one-way ANOVA was performed within the groups. The mean PI and GI were significantly greater in the smokers (P <0.01). The mean GCF flow rate was significantly lower in the smokers (P <0.01). CAL and the number of sites with recession were significantly greater in the smokers (P <0.001). The BHM indicated a significantly lower mean alveolar bone height in the smokers (P <0.01). The smokers showed significantly lower CADIA values, which indicated a lower bone density on days 0 (P <0.05), 180, 365, and 545 (P <0.01). CADIA values decreased during the study in the smokers, with significant differences on day 545 (P <0.05). The smokers had a significantly higher mean percentage of sites that had decreased density, as assessed by DSR (P <0.001). In the smokers, the mean percentage of sites with decreased density, as assessed by DSR, had increased significantly by days 365 (P <0.05) and 545 (P <0.01). Smoking produces an adverse effect on clinical periodontal variables and alveolar bone height and density, acting as a potential risk factor for alveolar bone loss, even at an early age with low tobacco consumption. It is very important to inform young smokers about the risk of this habit in relation to periodontal health.

Lyme Disease Comes to Camp.

ERIC Educational Resources Information Center

Peterson, Michael

1989-01-01

Describes one summer camp's plan for dealing with Lyme disease. Describes the disease and the deer tick. Recommends avoiding tick exposure through clothing, frequent examination, showers, and avoiding high grass and brushy areas, and using chemical insect repellents and chemicals to kill ticks in deer mouse nests. (DHP)

A novel series of 1, 4-Dihydropyridine (DHP) derivatives bearing thiazolidin-4-one: From synthesis to structure

NASA Astrophysics Data System (ADS)

Bade, Tahseen S.; Ebrahimi, Hossein Pasha; Alsalim, Tahseen A.; Titinchi, Salam J. J.; Abbo, Hanna S.; Bolandnazar, Zeinab; Ebrahimi, Amirpasha

2017-06-01

A novel series of 1, 4-Dihydropyridine (DHP) thiazolidin-4-one compounds derived from dihydropyridine hydrazones Schiff bases with thioglycolic acid were synthesized through an efficient Hantzsch reaction and experimentally characterized by spectral methods using IR, 1H NMR, 13C NMR, and mass spectroscopic methods. Herein, DHPs were synthesized by an improved Hantzsch procedure in the excellent yields by three different conditions including reflux condensation, fusion, and the microwave irradiation. An additional comparison of applied methodology routes was used to confirm the advantages including short reaction time, good yields, and operational simplicity. Furthermore, the structural and electronic properties of the studied molecules were theoretically investigated by performing density functional theory (DFT) to access reliable results to the experimental values. The molecular geometry, HOMO, and LUMO of the studied compounds were calculated. The theoretical 13C chemical shift results were also calculated using the gauge independent atomic orbital (GIAO) approach and their respective linear correlations were obtained.

Probabilistic dual heuristic programming-based adaptive critic

NASA Astrophysics Data System (ADS)

Herzallah, Randa

2010-02-01

Adaptive critic (AC) methods have common roots as generalisations of dynamic programming for neural reinforcement learning approaches. Since they approximate the dynamic programming solutions, they are potentially suitable for learning in noisy, non-linear and non-stationary environments. In this study, a novel probabilistic dual heuristic programming (DHP)-based AC controller is proposed. Distinct to current approaches, the proposed probabilistic (DHP) AC method takes uncertainties of forward model and inverse controller into consideration. Therefore, it is suitable for deterministic and stochastic control problems characterised by functional uncertainty. Theoretical development of the proposed method is validated by analytically evaluating the correct value of the cost function which satisfies the Bellman equation in a linear quadratic control problem. The target value of the probabilistic critic network is then calculated and shown to be equal to the analytically derived correct value. Full derivation of the Riccati solution for this non-standard stochastic linear quadratic control problem is also provided. Moreover, the performance of the proposed probabilistic controller is demonstrated on linear and non-linear control examples.

Polymyxin-B-immobilized-fiber column hemoperfusion with oseltamivir treatment for ARDS due to influenza H1N1/09.

PubMed

Binh, Nguyen Gia; Manabe, Toshie; Co, Dao Xuan; Tuan, Nguyen Dang; Thach, Pham The; Kudo, Koichiro

2015-06-01

Acute respiratory distress syndrome (ARDS) is one of the severe complications of influenza H1N1/09 infection, resulting in high mortality. Effective treatment strategies for ARDS are needed. This report presents two cases of ARDS due to influenza in Vietnam. Both cases were similar in terms of starting symptoms, the rapid progression to ARDS, and the treatment strategy, direct hemoperfusion with a polymyxin-B-immobilized fiber column (PMX-DHP) and oseltamivir. However, the clinical course of disease and the outcomes were different. For case 1, treatment was initiated on day 4 following the onset of hypoxemia due to ARDS. Symptoms improved rapidly after treatment and the patient was discharged on day 12. For case 2, treatment was initiated on day 9 after the onset of symptoms. Despite intensive therapy, the patient died on day 18. In conclusion, treatment with PMX-DHP and oseltamivir is effective on ARDS due to influenza but only if initiated early.

Pomelo peels-derived porous activated carbon microsheets dual-doped with nitrogen and phosphorus for high performance electrochemical capacitors

NASA Astrophysics Data System (ADS)

Wang, Zhen; Tan, Yongtao; Yang, Yunlong; Zhao, Xiaoning; Liu, Ying; Niu, Lengyuan; Tichnell, Brandon; Kong, Lingbin; Kang, Long; Liu, Zhen; Ran, Fen

2018-02-01

In this work, biomass pomelo peel is used to fabricate the porous activated carbon microsheets, and diammonium hydrogen phosphate (DHP) is employed to dual-dope carbon with nitrogen and phosphorus elements. With the benefit of DHP inducement and dual-doping of nitrogen and phosphorus, the prepared carbon material has a higher carbon yield, and exhibits higher specific surface area (about 807.7 m2/g), and larger pore volume (about 0.4378 cm3/g) with hierarchically structure of interconnected thin microsheets compared to the pristine carbon. The material exhibits not only high specific capacitance (240 F/g at 0.5 A/g), but also superior cycling performance (approximately 100% of capacitance retention after 10,000 cycles at 2 A/g) in 2 M KOH aqueous electrolyte. Furthermore, the assembled symmetric electrochemical capacitor in 1 M Na2SO4 aqueous electrolyte exhibits a high energy density of 11.7 Wh/kg at a power density of 160 W/kg.

Students and the Conflicts of the Sixties.

ERIC Educational Resources Information Center

Altbach, Philip G.

1989-01-01

Reviews four books about the student protest movements of the 1960s. Two books, by Todd Gitlin and Tom Hayden, focus on the United States, while the others consider international events; all four examine student political activism, but none considers the resultant conservative political and social reactions. (DHP)

AN ASSESSMENT OF PHTHALATE ESTER TOXICITY TO FRESHWATER BENTHOS: 2. SEDIMENT EXPOSURES

EPA Science Inventory

Seven phthalate esters were evaluated for their stability and 10-d acute toxicity to the freshwater invertebrates Hyalella azteca and Chironomus tentans following incorporation into sediment. The chemicals were diethyl (DEP), di-n-butyl (DBP), di-n-hyxyl (DHP), di-[2-ethylhexyl] ...

Implications of Land Policy and Rural Development in Botswana.

ERIC Educational Resources Information Center

Milazi, Dominic

1988-01-01

Examines land tenure alteration in relation to rural development programs in Botswana. Development efforts have had a class differentiated effect, aiding the relatively well-off cattle owners, but ignoring the small crop producers. A rural development strategy that benefits all rural groups must contain measures specifically tailored to each. (DHP)

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

FT-Raman study of dehydrogenation polymer (DHP) lignins

Treesearch

Umesh P. Agarwal; Noritsugu Terashima

2003-01-01

Compared to conventional Raman spectroscopy where samples are excited using visible light lasers, 1064 nm-excited FT-Raman technique has the single most important advantage that the sample-fluorescence is significantly suppressed for samples that are strongly fluorescent. DHPs are difficult to analyze in conventional Raman because small amounts of chromophores present...

Effects of a dry hydrogen peroxide (DHP) air sanitation system used in an egg cooler on hatchability and chick quality

USDA-ARS?s Scientific Manuscript database

In commercial poultry production, hatcheries are a source of continual contamination. Sanitation in the hatchery is a constant process, where minimal beneficial results are seen if done correctly, but drastic negative impacts are felt when done improperly. A sanitation method that could continually ...

Using the Hands On Philosophy Daily in a Second Grade Classroom.

ERIC Educational Resources Information Center

Hammond, Pat

1988-01-01

Discusses student participation in many short-term projects related to regular study units in a second grade classroom. Describes projects of writing a class constitution, constructing a model colonial town, creating a mural of local colonial life, making corn shuck and apple-head dolls, and learning apple types grown locally. (DHP)

Observational tests of convective core overshooting in stars of intermediate to high mass in the Galaxy

NASA Technical Reports Server (NTRS)

Stothers, Richard B.

1991-01-01

This study presents the results of 14 tests for the presence of convective overshooting in large convecting stellar cores for stars with masses of 4-17 solar masses which are members of detached close binary systems and of open clusters in the Galaxy. A large body of theoretical and observational data is scrutinized and subjected to averaging in order to minimize accidental and systematic errors. A conservative upper limit of d/HP less than 0.4 is found from at least four tests, as well as a tighter upper limit of d/HP less than 0.2 from one good test that is subject to only mild restrictions and is based on the maximum observed effective temperature of evolved blue supergiants. It is concluded that any current uncertainty about the distance scale for these stars is unimportant in conducting the present tests for convective core overshooting. The correct effective temperature scale for the B0.5-B2 stars is almost certainly close to one of the proposed hot scales.

Adaptive dynamic programming for discrete-time linear quadratic regulation based on multirate generalised policy iteration

NASA Astrophysics Data System (ADS)

Chun, Tae Yoon; Lee, Jae Young; Park, Jin Bae; Choi, Yoon Ho

2018-06-01

In this paper, we propose two multirate generalised policy iteration (GPI) algorithms applied to discrete-time linear quadratic regulation problems. The proposed algorithms are extensions of the existing GPI algorithm that consists of the approximate policy evaluation and policy improvement steps. The two proposed schemes, named heuristic dynamic programming (HDP) and dual HDP (DHP), based on multirate GPI, use multi-step estimation (M-step Bellman equation) at the approximate policy evaluation step for estimating the value function and its gradient called costate, respectively. Then, we show that these two methods with the same update horizon can be considered equivalent in the iteration domain. Furthermore, monotonically increasing and decreasing convergences, so called value iteration (VI)-mode and policy iteration (PI)-mode convergences, are proved to hold for the proposed multirate GPIs. Further, general convergence properties in terms of eigenvalues are also studied. The data-driven online implementation methods for the proposed HDP and DHP are demonstrated and finally, we present the results of numerical simulations performed to verify the effectiveness of the proposed methods.

Column temperature programming in enantioseparation of dihydropyrimidinone compounds using derivatized cellulose and amylose chiral stationary phases.

PubMed

Wang, Fang; Yeung, David; Han, Jun; Semin, David; McElvain, James S; Cheetham, Janet

2008-03-01

We report the application of column temperature programs as a tool to examine unusual temperature-induced behaviors of polysaccharide chiral stationary phases (CSPs). Using dihydropyrimidinone (DHP) compounds as probes we observed the heating (10-50 degrees C) and cooling (50-10 degrees C) van't Hoff plots of retention factors and/or selectivities of DHP compounds were not superimposable on AD, IA, and AS-H columns solvated with ethanol (EtOH)/n-hexane (n-Hex) mobile phases. The plots were not superimposable on AD, IB, and AS-H columns solvated with 2-propanol (2-PrOH)/n-Hex mobile phases. The thermally induced path-dependant behaviors were caused by slow equilibration as evidenced by the disappearance of the hysteresis in the second heating to cooling cycle and in a cooling to heating cycle. From the step-temperature program (10-50-10 degrees C), only EtOH solvated AD and AS-H phases showed the change of retention factors and/or selectivities with time while only 2-PrOH solvated AS-H phase showed similar behaviors.

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Electrical double layer modulation of hybrid room temperature ionic liquid/aqueous buffer interface for enhanced sweat based biosensing.

PubMed

Jagannath, Badrinath; Muthukumar, Sriram; Prasad, Shalini

2018-08-03

We have investigated the role of kosmotropic anionic moieties and chaotropic cationic moieties of room temperature hydrophilic ionic liquids in enhancing the biosensing performance of affinity based immunochemical biosensors in human sweat. Two ionic liquids, 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM[BF 4 ]) and choline dihydrogen phosphate (Choline[DHP]) were investigated in this study with Choline[DHP] being more kosmotropic in nature having a more protein stabilizing effect based on the hofmeister series. Non-faradaic interfacial charge transfer has been employed as the mechanism for evaluating the formation and the biosensing of capture probe antibodies in room temperature ionic liquids (RTILs)/aqueous human sweat interface. The charge of the ionic moieties were utilized to form compact electrical double layers around the antibodies for enhancing the stability of the antibody capture probes, which was evaluated through zeta potential measurements. The zeta potential measurements indicated stability of antibodies due to electrostatic repulsion of the RTIL charged moieties encompassing the antibodies, thus preventing any aggregation. Here, we report for the first time of non-faradaic electrochemical impedance spectroscopy equivalent circuit model analysis for analyzing and interpreting affinity based biosensing at hybrid electrode/ionic liquid-aqueous sweat buffer interface guided by the choice of the ionic liquid. Interleukin-6 (IL-6) and cortisol two commonly occurring biomarkers in human sweat were evaluated using this method. The limit of detection (LOD) obtained using both ionic liquids for IL-6 was 0.2 pg mL -1 with cross-reactivity studies indicating better performance of IL-6 detection using Choline[DHP] and no response to cross-reactive molecule. The LOD of 0.1 ng/mL was achieved for cortisol and the cross-reactivity studies indicated that cortisol antibody in BMIM[BF 4 ] did not show any signal response to cross-reactive molecules. Furthermore, improved sensitivity and LOD was achieved using ionic liquids as compared to capture probes in aqueous buffer. Copyright © 2018 Elsevier B.V. All rights reserved.

An isotope-dilution UPLC-MS/MS technique for the human biomonitoring of the internal exposure to glycidol via a valine adduct at the N-terminus of hemoglobin.

PubMed

Hielscher, Jan; Monien, Bernhard H; Abraham, Klaus; Jessel, Sönke; Seidel, Albrecht; Lampen, Alfonso

2017-08-01

Fatty acid esters of glycidol (glycidyl esters) are processing contaminants generated as a byproduct of the industrial deodorization of vegetable oils and fats. Oral intake of glycidyl esters leads to the release of glycidol in the gastrointestinal tract. Glycidol is carcinogenic, genotoxic and teratogenic in rodents. It is rated as probably carcinogenic to humans (IARC group 2A). The determination of internal exposure of glycidol may support the assessment of the possible human health risks related to glycidyl ester intake. For this purpose, hemoglobin adducts of glycidol may be suitable biomarkers reflecting the cumulative exposure of up to four months. We applied a modified Edman degradation to assess the glycidol adduct at the N-terminal valine, N-(2,3-dihydroxypropyl)-valine (2,3-diHOPr-Val), of hemoglobin. The modified valine was cleaved with fluorescein-5-isothiocyanate (FITC), resulting in the formation of N-(2,3-dihydroxypropyl)-valine fluorescein thiohydantoin (DHP-Val-FTH). An isotope-dilution technique was developed for the quantification of the thiohydantoin analyte by ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) and DHP-Val-d 7 -FTH as reference standard. The limit of detection was 4 fmol DHP-Val-FTH per injection corresponding to 0.7pmol 2,3-diHOPr-Val/g hemoglobin. The adduct levels in blood samples of 12 non-smoking participants were in the range of 2.2-4.9pmol 2,3-diHOPr-Val/g hemoglobin. The current work presents the first isotope-dilution technique using UPLC-MS/MS for the quantification of 2,3-diHOPr-Val at the N-terminus of hemoglobin as a sensitive and convenient alternative to earlier GC-MS methods. Copyright © 2017 Elsevier B.V. All rights reserved.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Racial and Residential Differences in U.S. Infant Death Rates: A Temporal Analysis.

ERIC Educational Resources Information Center

Johnson, Nan E.; Zaki, Khalida P.

1988-01-01

Compares annual rates of neonatal, postneonatal mortality to annual rates of low birth weight, 1963-1982. Shows that same level of decline in incidence of low birth weight is associated with greater decline in mortality rates of non-White than White infants and for nonmetro than metro infants. Contains 15 references. (Author/DHP)

Environmental gestagens activate fathead minnow (Pimephales promelas) nuclear progesterone and androgen receptors in vitro

EPA Science Inventory

Gestagen is a collective term for endogenous and synthetic progesterone receptor (PR) ligands. In teleost fishes, 17á,20â-dihydroxy-4-pregnen-3-one (DHP) and17á,20â,21- trihydroxy-4-pregnen-3-one (20â-S) are the predominant progestogens, whereas in other vertebrates the major pro...

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Purification and Characterization of the FeII- and α-Ketoglutarate-Dependent Xanthine Hydroxylase from Aspergillus nidulans†

PubMed Central

Montero-Morán, Gabriela M.; Li, Meng; Rendòn-Huerta, Erika; Jourdan, Fabrice; Lowe, David J.; Stumpff-Kane, Andrew W.; Feig, Michael; Scazzocchio, Claudio; Hausinger, Robert P.

2008-01-01

His6-tagged xanthine/α-ketoglutarate (αKG) dioxygenase (XanA) of Aspergillus nidulans was purified from both the fungal mycelium and recombinant Escherichia coli cells, and the properties of the two forms of the protein were compared. Evidence was obtained for both N- and O-linked glycosylation on the fungus-derived XanA, which aggregates into an apparent dodecamer, while bacteria-derived XanA is free of glycosylation and behaves as a monomer. Immunological methods identify phosphothreonine in both forms of XanA, with phosphoserine also detected in the bacteria-derived protein. Mass spectrometric analysis confirms glycosylation and phosphorylation of the fungus-derived sample, which also undergoes extensive truncation at its amino terminus. Despite the major differences in properties of these proteins, their kinetic parameters are similar (kcat 30-70 s-1, Km of αKG 31-50 μM, Km of xanthine ∼45 μM, and pH optima at 7.0 to 7.4). The enzyme exhibits no significant isotope effect when using 8-2H-xanthine; however, it demonstrates a two-fold solvent deuterium isotope effect. CuII and ZnII potently inhibit the FeII-specific enzyme, whereas CoII, MnII, and NiII are weaker inhibitors. NaCl decreases the kcat and increases the Km of both αKG and xanthine. The αKG cosubstrate can be substituted by α-ketoadipate (9-fold decrease in kcat and 5-fold increase in the Km compared to the normal α-keto acid), while the αKG analogue N-oxalylglycine is a competitive inhibitor (Ki 0.12 μM). No alternative purines effectively substitute for xanthine as a substrate, and only one purine analogue (6,8-dihydroxypurine) results in significant inhibition. Quenching of the endogenous fluorescence of the two enzyme forms by xanthine, αKG, and DHP was used to characterize their binding properties. A XanA homology model was generated on the basis of the structure of the related enzyme TauD (PDB code 1OS7) and provided insights into the sites of posttranslational modification and substrate binding. These studies represent the first biochemical characterization of purified xanthine/αKG dioxygenase. PMID:17429948

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

1987-11-01

Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez-Rodríguez, Sergio; González-Ramírez, Luis Antonio; Clemente-Jiménez, Josefa María

The dihydropyrimidinase from S. meliloti CECT4114, with activity towards both hydantoin and dihydrouracil substrates, was crystallized, and diffraction data were collected to 1.85 Å resolution. Dihydropyrimidinases are involved in the reductive pathway of pyrimidine degradation, catalysing the hydrolysis of 5,6-dihydrouracil and 5,6-dihydrothymine to the corresponding N-carbamoyl β-amino acids. This enzyme has often been referred to as hydantoinase owing to its industrial application in the production of optically pure amino acids starting from racemic mixtures of 5-monosubstituted hydantoins. Recombinant dihydropyrimidinase from Sinorhizobium meliloti CECT4114 (SmelDhp) has been expressed, purified and crystallized. Crystallization was performed using the counter-diffusion method with capillaries ofmore » 0.3 mm inner diameter. Crystals of SmelDhp suitable for data collection and structure determination were grown in the presence of agarose at 0.1%(w/v) in order to ensure mass transport controlled by diffusion. X-ray data were collected to a resolution of 1.85 Å. The crystal belongs to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 124.89, b = 126.28, c = 196.10 Å and two molecules in the asymmetric unit. A molecular-replacement solution has been determined and refinement is in progress.« less

Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

PubMed

Gehring, I; Geider, K

2012-07-01

Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

1,4-Dihydropyridine scaffold in medicinal chemistry, the story so far and perspectives (part 2): action in other targets and antitargets.

PubMed

Carosati, E; Ioan, P; Micucci, M; Broccatelli, F; Cruciani, G; Zhorov, B S; Chiarini, A; Budriesi, R

2012-01-01

1,4-Dihydropyridines were introduced in the last century for the treatment of coronary diseases. Then medicinal chemists decorated the 1,4-DHP nucleus, the most studied scaffold among L-type calcium channel blockers, achieving diverse activities at several receptors, channels and enzymes. We already described (Ioan et al. Curr. Med. Chem. 2011, 18, 4901-4922) the effects of 1,4-DHPs at ion channels and G-protein coupled receptors. In this paper we continue the analysis of the wide range of biological effects exerted by compounds belonging to this chemical class. In particular, focus is given to the ability of 1,4-DHPs to revert multi drug resistance that, after over 20 years of research, continues to be of great interest. We also describe activities on other targets and the action of 1,4-DHPs against several diseases. Finally, we report and review the interaction of 1,4-DHPs with the hERG channel, transporters and phase I metabolizing enzymes. This work is a starting point for further exploration of the 1,4-DHP core activities on targets, off-targets and antitargets.

A high deuterium abundance at redshift z = 0.7.

PubMed

Webb, J K; Carswell, R F; Lanzetta, K M; Ferlet, R; Lemoine, M; Vidal-Madjar, A; Bowen, D V

1997-07-17

Of the light elements, the primordial abundance of deuterium relative to hydrogen, (D/H)p, provides the most sensitive diagnostic for the cosmological mass density parameter, omegaB. Recent high-redshift D/H measurements are highly discrepant, although this may reflect observational uncertainties. The larger primordial D/H values imply a low omegaB (requiring the Universe to be dominated by non-baryonic matter), and cause problems for galactic chemical evolution models, which have difficulty in reproducing the steep decline in D/H to the present-day values. Conversely, the lower D/H values measured at high redshift imply an omegaB greater than that derived from 7Li and 4He abundance measurements, and may require a deuterium-abundance evolution that is too low to easily explain. Here we report the first measurement of D/H at intermediate redshift (z = 0.7010), in a gas cloud selected to minimize observational uncertainties. Our analysis yields a value of D/H ((2.0 +/- 0.5) x 10[-4]) which is at the upper end of the range of values measured at high redshifts. This finding, together with other independent observations, suggests that there may be inhomogeneity in (D/H)p of at least a factor of ten.

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

NASA Astrophysics Data System (ADS)

Schwartz, Rochelle D.; Kellar, Kenneth J.

1983-04-01

Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

Substance P binding sites in the nucleus tractus solitarius of the cat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, B.E.; Sasek, C.A.; Seybold, V.S.

1988-11-01

Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

PubMed

Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

2018-06-16

Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

PubMed Central

Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

2008-01-01

Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

[The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

PubMed

Kawasaki, Kazuyoshi; Ogawa, Seturou

2003-01-01

NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poat, J.A.; Cripps, H.E.; Iversen, L.L.

1988-05-01

Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCann, D.J.; Su, T.P.

1991-05-01

The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

PubMed

Suzuki, N; Mihashi, K

1991-01-01

The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luthin, G.R.; Wolfe, B.B.

The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

In situ quantitation of ring-conjugated ethylenic lignin-units in spruce thermomechanical pulps by FT-Raman spectroscopy

Treesearch

Umesh Agarwal; Sally A. Ralph

2003-01-01

With the objective of using FT-Raman to quantitatively analyze ethylenic units in lignin in thermomechanical pulps (TMPs), coniferyl alcohol, coniferin, coniferaldehyde, and G-DHP lignin models were used to first demonstrate that the technique was fully capable of quantifying ring conjugated ethylenic units. Based on this result, the amount of ethylenic units in TMP...

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Ethylene binding site affinity in ripening apples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, S.M.; Sisler, E.C.

1993-09-01

Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

Autoradiographic localization of endothelin-1 binding sites in porcine skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Y.D.; Springall, D.R.; Wharton, J.

Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

PubMed

Jiang, Peng; Singh, Mona; Coller, Hilary A

2013-01-01

Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Location of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

Locations of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

Discovering amino acid patterns on binding sites in protein complexes

PubMed Central

Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

2011-01-01

Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegon, A.; Rainbow, T.C.

1983-05-01

The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Study of the interaction of 1,4-dihydropyridine derivatives with glucocorticoid hormone receptors from the rat liver.

PubMed

Vaitkuviene, Aida; Ulinskaite, Audrone; Meskys, Rolandas; Duburs, Gunars; Klusa, Vija; Liutkevicius, Evaldas

2006-01-01

Seventeen derivatives of 1,4-dihydropyridine (DHP) series were tested in vitro for their ability to inhibit [1,2,4-(3)H]-dexamethasone binding to glucocorticoid receptor from the rat liver cytosol. Depending on structural features and inhibiting activities, the compounds can be divided into three groups. The first group (nifedipine, foridone, J-6-163, OSI-4164 and OSI-7724) had the highest activity: they inhibited specific ligand-receptor binding by 70-80% at concentrations of 10(-5) M and 10(-4) M, with apparent IC(50)values of 1.5-6.0 muM. The second group (cerebrocrast, diethone, OSI-1211 and OSI-7265) was active at concentration of 10(-4) M, and their IC(50) values were 23-45 muM; compound OSI-5003 was almost inactive. Both groups are compounds with scarce water solubility, more or less lipophilic. The third group of compounds comprises ionogenic compounds (organic cations or anions with corresponding inorganic counterions): most of them are water-soluble (glutapyrone, carbatone, gammapyrone, OSI-2780, OSI-1580, OSI-2140) or liposome-forming (A-74). They lack the above-mentioned activity. Among the first two groups, compounds possessing more bulky substituents in positions 3 and 5 are less active. The aromatic ring in the position 4 is essential for the optimal activity. It seems that there is a bell-shaped dependence of activity upon lipophilicity. In general, the compounds of the first group are strong Ca-antagonists, while the second group includes moderate Ca-antagonists, but each group comprises also compounds which lack Ca antagonistic activity. All compounds of the third group lack Ca antagonistic properties.

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palacios, J.M.; Chinaglia, G.; Rigo, M.

1991-02-01

Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

PubMed

Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

2014-01-01

We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

PubMed

Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

1996-10-11

In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

PubMed Central

2011-01-01

Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

PubMed

Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

2016-11-01

Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

Improving Defense Health Program Medical Research Processes

DTIC Science & Technology

2017-08-08

needed for DHP medical research , such as the Army’s Clinical and Translational Research Program Office, 38 the Navy’s Research Methods Training Program... research stated, “key infrastructure for a learning health system will encompass three core elements: data networks, methods , and workforce.” 221 A 2012... Research Methods Training Program, 132 which will be further discussed in Appendix D.2. AIR FORCE Air Force Instruction 40-402, Protection of

Sediment Management at the Watershed Level

DTIC Science & Technology

2012-08-01

al. 2005). Trimble examined ten river basins (1,000 to 7,500 mi2 ) and found that the sediment yield averaged about six percent. He attributed the...importance of storage and remobilization in controlling sediment yield from the 139 mi2 Coon Creek watershed in Wisconsin. Trimble prepared sediment...Federal government in 1984, DHP activities targeted sixteen watersheds comprising 2,625 mi2 within the Yazoo River Basin in the Lower Mississippi

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Near-Optimal Tracking Control of Mobile Robots Via Receding-Horizon Dual Heuristic Programming.

PubMed

Lian, Chuanqiang; Xu, Xin; Chen, Hong; He, Haibo

2016-11-01

Trajectory tracking control of wheeled mobile robots (WMRs) has been an important research topic in control theory and robotics. Although various tracking control methods with stability have been developed for WMRs, it is still difficult to design optimal or near-optimal tracking controller under uncertainties and disturbances. In this paper, a near-optimal tracking control method is presented for WMRs based on receding-horizon dual heuristic programming (RHDHP). In the proposed method, a backstepping kinematic controller is designed to generate desired velocity profiles and the receding horizon strategy is used to decompose the infinite-horizon optimal control problem into a series of finite-horizon optimal control problems. In each horizon, a closed-loop tracking control policy is successively updated using a class of approximate dynamic programming algorithms called finite-horizon dual heuristic programming (DHP). The convergence property of the proposed method is analyzed and it is shown that the tracking control system based on RHDHP is asymptotically stable by using the Lyapunov approach. Simulation results on three tracking control problems demonstrate that the proposed method has improved control performance when compared with conventional model predictive control (MPC) and DHP. It is also illustrated that the proposed method has lower computational burden than conventional MPC, which is very beneficial for real-time tracking control.

Correlation between plasma steroid hormones and vitellogenin profiles and lunar periodicity in the female golden rabbitfish, Siganus guttatus (Bloch).

PubMed

Rahman, M D; Takemura, A; Takano, K

2000-09-01

Characteristics of the lunar reproductive cycle in the golden rabbitfish, Siganus guttatus, were determined by histological observations of ovarian development, and immunological measurements of plasma steroid hormones, estradiol-17beta (E2), testosterone (T), 17alpha,20beta-dihydroxy-4-pregnen-3-one (DHP) and 17alpha,20beta,21-trihydroxy-4-pregnen-3-one (20beta-S), and vitellogenin (VTG). Ovarian and plasma samples were collected every week according to the lunar phases from May to July. Weekly change of gonadosomatic index (GSI) showed two peaks at the first lunar quarter in June and July. Yolky oocytes were also observed around this time. Histological observations revealed that the vitellogenic oocytes appeared again 1 week after spawning and developed synchronously. These results suggest that this species is a multiple spawner and the oocyte development is in a group-synchronous manner. Plasma steroid hormones (E2, T, DHP and 20beta-S) and VTG levels changed in parallel with changes in GSI. The peak of plasma VTG level occurred prior to spawning. These cyclic changes of plasma steroid hormones and VTG support the hypothesis that lunar periodicity is the major factor in stimulating reproductive activity of S. guttatus.

Reduced density gradient as a novel approach for estimating QSAR descriptors, and its application to 1, 4-dihydropyridine derivatives with potential antihypertensive effects.

PubMed

Jardínez, Christiaan; Vela, Alberto; Cruz-Borbolla, Julián; Alvarez-Mendez, Rodrigo J; Alvarado-Rodríguez, José G

2016-12-01

The relationship between the chemical structure and biological activity (log IC 50 ) of 40 derivatives of 1,4-dihydropyridines (DHPs) was studied using density functional theory (DFT) and multiple linear regression analysis methods. With the aim of improving the quantitative structure-activity relationship (QSAR) model, the reduced density gradient s( r) of the optimized equilibrium geometries was used as a descriptor to include weak non-covalent interactions. The QSAR model highlights the correlation between the log IC 50 with highest molecular orbital energy (E HOMO ), molecular volume (V), partition coefficient (log P), non-covalent interactions NCI(H4-G) and the dual descriptor [Δf(r)]. The model yielded values of R 2 =79.57 and Q 2 =69.67 that were validated with the next four internal analytical validations DK=0.076, DQ=-0.006, R P =0.056, and R N =0.000, and the external validation Q 2 boot =64.26. The QSAR model found can be used to estimate biological activity with high reliability in new compounds based on a DHP series. Graphical abstract The good correlation between the log IC 50 with the NCI (H4-G) estimated by the reduced density gradient approach of the DHP derivatives.

Quantitative analysis of detailed lignin monomer composition by pyrolysis-gas chromatography combined with preliminary acetylation of the samples.

PubMed

Sonoda, T; Ona, T; Yokoi, H; Ishida, Y; Ohtani, H; Tsuge, S

2001-11-15

Detailed quantitative analysis of lignin monomer composition comprising p-coumaryl, coniferyl, and sinapyl alcohol and p-coumaraldehyde, coniferaldehyde, and sinapaldehyde in plant has not been studied from every point mainly because of artifact formation during the lignin isolation procedure, partial loss of the lignin components inherent in the chemical degradative methods, and difficulty in the explanation of the complex spectra generally observed for the lignin components. Here we propose a new method to quantify lignin monomer composition in detail by pyrolysis-gas chromatography (Py-GC) using acetylated lignin samples. The lignin acetylation procedure would contribute to prevent secondary formation of cinnamaldehydes from the corresponding alcohol forms during pyrolysis, which are otherwise unavoidable in conventional Py-GC process to some extent. On the basis of the characteristic peaks on the pyrograms of the acetylated sample, lignin monomer compositions in various dehydrogenative polymers (DHP) as lignin model compounds were determined, taking even minor components such as cinnamaldehydes into consideration. The observed compositions by Py-GC were in good agreement with the supplied lignin monomer contents on DHP synthesis. The new Py-GC method combined with sample preacetylation allowed us an accurate quantitative analysis of detailed lignin monomer composition using a microgram order of extractive-free plant samples.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

PubMed

Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

1986-08-15

The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

PubMed

Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

2017-04-01

BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

PubMed

Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

1996-01-04

In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, K.A.; LaBarbera, A.R.

1988-11-01

The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

PubMed Central

Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

2013-01-01

Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Computational Optimization and Characterization of Molecularly Imprinted Polymers

NASA Astrophysics Data System (ADS)

Terracina, Jacob J.

Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

PubMed

Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

2011-05-01

The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Acceleration of Binding Site Comparisons by Graph Partitioning.

PubMed

Krotzky, Timo; Klebe, Gerhard

2015-08-01

The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

sc-PDB: a 3D-database of ligandable binding sites--10 years on.

PubMed

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

PubMed

Ahmed, Ahmed H; Oswald, Robert E

2010-03-11

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

PubMed Central

Ahmed, Ahmed H.; Oswald, Robert E.

2010-01-01

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

PubMed

Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

2013-07-01

Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

PubMed

Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

2017-09-14

U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauch, Eva-Maria; Bernard, Steffen M.; La, David

Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

PubMed

Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

2015-11-01

Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

Oligomycin frames a common drug-binding site in the ATP synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

PubMed

Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

2013-01-01

Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

[3H]MK-801 binding sites in post-mortem human frontal cortex.

PubMed

Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

1989-03-29

The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Study of Factors Related to Army Delayed-Entry Program Attrition

DTIC Science & Technology

1985-11-01

level, gender , and tenure in DEP. Military classification and assignment are determined almost solely on cognitive factors, physical examinations...Between Gender and Responses to Question 13 for Voluntary DEP Losses . . . . . , . . . , . . . . o , o . ° . 99 P-2. Chi-square Tests for Independence...Between Gender and Responses to Question 13 for DHP Aooession/ Voluntary Active Duty Losses . . 9 0 4 . 0 0 0 0 a a 0 106 B-9. Chi-square Tests for

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-03-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed Central

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-01-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

sc-PDB: a 3D-database of ligandable binding sites—10 years on

PubMed Central

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

PubMed

Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

2018-05-29

Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

PubMed Central

Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

2012-01-01

Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

PubMed

Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

2014-01-01

We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

PubMed

Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

2018-03-23

The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

PubMed

Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

2006-07-01

High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannopoulos, G.; Jackson, K.; Kredentser, J.

The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

PubMed

Konc, Janez; Janežič, Dušanka

2014-07-01

The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

2005-08-22

Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

PubMed

Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

1994-10-27

Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Cav 1.3 channels play a crucial role in the formation of paroxysmal depolarization shifts in cultured hippocampal neurons.

PubMed

Stiglbauer, Victoria; Hotka, Matej; Ruiß, Manuel; Hilber, Karlheinz; Boehm, Stefan; Kubista, Helmut

2017-05-01

An increase of neuronal Ca v 1.3 L-type calcium channels (LTCCs) has been observed in various animal models of epilepsy. However, LTCC inhibitors failed in clinical trials of epileptic treatment. There is compelling evidence that paroxysmal depolarization shifts (PDSs) involve Ca 2+ influx through LTCCs. PDSs represent a hallmark of epileptiform activity. In recent years, a probable epileptogenic role for PDSs has been proposed. However, the implication of the two neuronal LTCC isoforms, Ca v 1.2 and Ca v 1.3, in PDSs remained unknown. Moreover, Ca 2+ -dependent nonspecific cation (CAN) channels have also been suspected to contribute to PDSs. Nevertheless, direct experimental support of an important role of CAN channel activation in PDS formation is still lacking. Primary neuronal networks derived from dissociated hippocampal neurons were generated from mice expressing a dihydropyridine-insensitive Ca v 1.2 mutant (Ca v 1.2DHP -/- mice) or from Ca v 1.3 -/- knockout mice. To investigate the role of Ca v 1.2 and Ca v 1.3, perforated patch-clamp recordings were made of epileptiform activity, which was elicited using either bicuculline or caffeine. LTCC activity was modulated using the dihydropyridines Bay K 8644 (agonist) and isradipine (antagonist). Distinct PDS could be elicited upon LTCC potentiation in Ca v 1.2DHP -/- neurons but not in Ca v 1.3 -/- neurons. In contrast, when bicuculline led to long-lasting, seizure-like discharge events rather than PDS, these were prolonged in Ca v 1.3 -/- neurons but not in Ca v 1.2DHP -/- neurons. Because only the Ca v 1.2 isoform is functionally coupled to CAN channels in primary hippocampal networks, PDS formation does not require CAN channel activity. Our data suggest that the LTCC requirement of PDS relates primarily to Ca v 1.3 channels rather than to Ca v 1.2 channels and CAN channels in hippocampal neurons. Hence, Ca v 1.3 may represent a new therapeutic target for suppression of PDS development. The proposed epileptogenic role of PDSs may allow for a prophylactic rather than the unsuccessful seizure suppressing application of LTCC inhibitors. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

NASA Astrophysics Data System (ADS)

Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

PubMed Central

Jalak, Jürgen; Väljamäe, Priit

2014-01-01

Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

PubMed Central

Gibbons, R. J.; Moreno, E. C.; Etherden, I.

1983-01-01

The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

1990-01-01

Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

The Structural Basis of ATP as an Allosteric Modulator

PubMed Central

Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

2014-01-01

Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

PubMed Central

Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

2014-01-01

A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

PubMed Central

Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

1999-01-01

Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romm, E.; Marks, M.J.; Collins, A.C.

1990-01-01

Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

Immunolocalization and Changes of Hydroxyproline-Rich Glycoproteins During Symbiotic Germination of Dendrobium officinale.

PubMed

Li, Yuan-Yuan; Chen, Xiao-Mei; Zhang, Ying; Cho, Yu-Hsiu; Wang, Ai-Rong; Yeung, Edward C; Zeng, Xu; Guo, Shun-Xing; Lee, Yung-I

2018-01-01

Hydroxyproline-rich glycoproteins (HRGPs) are abundant cell wall components involved in mycorrhizal symbiosis, but little is known about their function in orchid mycorrhizal association. To gain further insight into the role of HRGPs in orchid symbiosis, the location and function of HRGPs were investigated during symbiotic germination of Dendrobium officinale . The presence of JIM11 epitope in developing protocorms was determined using immunodot blots and immunohistochemical staining procedures. Real-time PCR was also employed to verify the expression patterns of genes coding for extensin-like genes selected from the transcriptomic database. The importance of HRGPs in symbiotic germination was further investigated using 3,4-dehydro-L-proline (3,4-DHP), an inhibitor of HRGP biosynthesis. In symbiotic cultures, immunodot blots of JIM11 signals were moderate in mature seeds, and the signals became stronger in swollen embryos. After germination, signal intensities decreased in developing protocorms. In contrast, in asymbiotic cultures, JIM11 signals were much lower as compared with those stages in symbiotic cultures. Immunofluorescence staining enabled the visualization of JIM11 epitope in mature embryo and protocorm cells. Positive signals were initially localized in the larger cells near the basal (suspensor) end of uninfected embryos, marking the future colonization site of fungal hyphae. After 1 week of inoculation, the basal end of embryos had been colonized, and a strong signal was detected mostly at the mid- and basal regions of the enlarging protocorm. As protocorm development progressed, the signal was concentrated in the colonized cells at the basal end. In colonized cells, signals were present in the walls and intracellularly associated with hyphae and the pelotons. The precise localization of JIM11 epitope is further examined by immunogold labeling. In the colonized cells, gold particles were found mainly in the cell wall and the interfacial matrix near the fungal cell wall. Four extensin-like genes were verified to be highly up-regulated in symbiotically germinated protocorms as compared to asymbiotically germinated ones. The 3,4-DHP treatment inhibited the accumulation of HRGPs and symbiotic seed germination. In these protocorms, fungal hyphae could be found throughout the protocorms. Our results indicate that HRGPs play an important role in symbiotic germination. They can serve as markers for fungal colonization, establishing a symbiotic compartment and constraining fungal colonization inside the basal cells of protocorms.

Immunolocalization and Changes of Hydroxyproline-Rich Glycoproteins During Symbiotic Germination of Dendrobium officinale

PubMed Central

Li, Yuan-Yuan; Chen, Xiao-Mei; Zhang, Ying; Cho, Yu-Hsiu; Wang, Ai-Rong; Yeung, Edward C.; Zeng, Xu; Guo, Shun-Xing; Lee, Yung-I

2018-01-01

Hydroxyproline-rich glycoproteins (HRGPs) are abundant cell wall components involved in mycorrhizal symbiosis, but little is known about their function in orchid mycorrhizal association. To gain further insight into the role of HRGPs in orchid symbiosis, the location and function of HRGPs were investigated during symbiotic germination of Dendrobium officinale. The presence of JIM11 epitope in developing protocorms was determined using immunodot blots and immunohistochemical staining procedures. Real-time PCR was also employed to verify the expression patterns of genes coding for extensin-like genes selected from the transcriptomic database. The importance of HRGPs in symbiotic germination was further investigated using 3,4-dehydro-L-proline (3,4-DHP), an inhibitor of HRGP biosynthesis. In symbiotic cultures, immunodot blots of JIM11 signals were moderate in mature seeds, and the signals became stronger in swollen embryos. After germination, signal intensities decreased in developing protocorms. In contrast, in asymbiotic cultures, JIM11 signals were much lower as compared with those stages in symbiotic cultures. Immunofluorescence staining enabled the visualization of JIM11 epitope in mature embryo and protocorm cells. Positive signals were initially localized in the larger cells near the basal (suspensor) end of uninfected embryos, marking the future colonization site of fungal hyphae. After 1 week of inoculation, the basal end of embryos had been colonized, and a strong signal was detected mostly at the mid- and basal regions of the enlarging protocorm. As protocorm development progressed, the signal was concentrated in the colonized cells at the basal end. In colonized cells, signals were present in the walls and intracellularly associated with hyphae and the pelotons. The precise localization of JIM11 epitope is further examined by immunogold labeling. In the colonized cells, gold particles were found mainly in the cell wall and the interfacial matrix near the fungal cell wall. Four extensin-like genes were verified to be highly up-regulated in symbiotically germinated protocorms as compared to asymbiotically germinated ones. The 3,4-DHP treatment inhibited the accumulation of HRGPs and symbiotic seed germination. In these protocorms, fungal hyphae could be found throughout the protocorms. Our results indicate that HRGPs play an important role in symbiotic germination. They can serve as markers for fungal colonization, establishing a symbiotic compartment and constraining fungal colonization inside the basal cells of protocorms. PMID:29922306

Nucleotide-dependent bisANS binding to tubulin.

PubMed

Chakraborty, S; Sarkar, N; Bhattacharyya, B

1999-07-13

Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

1988-01-01

(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

DTIC Science & Technology

positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

PubMed

Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

2017-03-16

Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

1986-06-01

(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

PubMed Central

Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

1998-01-01

The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

PubMed

Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

2015-12-01

CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

NASA Astrophysics Data System (ADS)

Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2018-03-01

To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

PubMed Central

Keck, P C; Huston, J S

1996-01-01

Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Catalytic site interactions in yeast OMP synthase.

PubMed

Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

2014-01-15

The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

PubMed

Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

2006-01-01

Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muccioli, G.; Guardabassi, A.; Pattono, P.

1990-03-01

The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

Study of DNA binding sites using the Rényi parametric entropy measure.

PubMed

Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

2004-04-07

Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Binding site and affinity prediction of general anesthetics to protein targets using docking.

PubMed

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

2012-05-01

The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

PubMed Central

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

2012-01-01

Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

PubMed Central

Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

2008-01-01

Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

PubMed

Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

2006-04-15

We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

PubMed Central

Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

2015-01-01

Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

PubMed

Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

2013-02-21

Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Souza, E.B.; Kuyatt, B.L.

1987-01-01

Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

USGS Publications Warehouse

Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

2002-01-01

The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Selection of the simplest RNA that binds isoleucine

PubMed Central

LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

2003-01-01

We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shima, K.; Kitayama, S.; Nakano, R.

Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

NASA Astrophysics Data System (ADS)

Aalberts, Daniel P.; Garland, Jeffrey A.

2004-03-01

When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Reid, A.; Mahboubi, A.

1991-02-01

Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

PubMed

Brierley, I; Hoggett, J G

1992-07-01

The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

NASA Astrophysics Data System (ADS)

Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

2010-01-01

The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

Cooperative interplay of let-7 mimic and HuR with MYC RNA

PubMed Central

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

Two classes of binding sites for [3H]substance P in rat cerebral cortex.

PubMed

Geraghty, D P; Burcher, E

1993-01-22

The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

A web server for analysis, comparison and prediction of protein ligand binding sites.

PubMed

Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

2016-03-25

One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

PubMed Central

Meng, Xiangzhi; Leman, Michael; Xiang, Yan

2007-01-01

Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

PubMed

Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

2018-05-16

Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

NASA Astrophysics Data System (ADS)

Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

1986-07-01

The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

PubMed

Marsh, Lorraine

2015-01-01

Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

PubMed

Fehr, Marcus; Wolf, Antje; Stammler, Gerd

2016-03-01

Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

NASA Astrophysics Data System (ADS)

Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

1985-05-01

The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

PubMed

DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

2003-07-08

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

PubMed

Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

1997-10-28

Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

PubMed Central

Jayasena, S D; Johnston, B H

1992-01-01

tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

PubMed

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-04-01

Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

PubMed Central

Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

PubMed

Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

PubMed Central

Joiner, C H; Lauf, P K

1978-01-01

1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

PubMed Central

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-01-01

Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.

Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

PubMed

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

The D-galactose specific lectin of field bean (Dolichos lablab) seed binds sugars with extreme negative cooperativity and half-of-the-sites binding.

PubMed

Rao, Devavratha H; Gowda, Lalitha R

2012-08-15

The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.

Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

PubMed Central

Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

2011-01-01

Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

PubMed Central

Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

2007-01-01

The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

PubMed

Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

2018-05-01

The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.