Sample records for dictyostelium discoideum cenb

  1. Cellulose biogenesis in Dictyostelium discoideum

    SciTech Connect

    Blanton, R.L.


    Organisms that synthesize cellulose can be found amongst the bacteria, protistans, fungi, and animals, but it is in plants that the importance of cellulose in function (as the major structural constituent of plant cell walls) and economic use (as wood and fiber) can be best appreciated. The structure of cellulose and its biosynthesis have been the subjects of intense investigation. One of the most important insights gained from these studies is that the synthesis of cellulose by living organisms involves much more than simply the polymerization of glucose into a (1{r_arrow}4)-{beta}-linked polymer. The number of glucoses in a polymer (the degree of polymerization), the crystalline form assumed by the glucan chains when they crystallize to form a microfibril, and the dimensions and orientation of the microfibrils are all subject to cellular control. Instead of cellulose biosynthesis, a more appropriate term might be cellulose biogenesis, to emphasize the involvement of cellular structures and mechanisms in controlling polymerization and directing crystallization and deposition. Dictyostelium discoideum is uniquely suitable for the study of cellulose biogenesis because of its amenability to experimental study and manipulation and the extent of our knowledge of its basic cellular mechanisms (as will be evident from the rest of this volume). In this chapter, I will summarize what is known about cellulose biogenesis in D. discoideum, emphasizing its potential to illuminate our understanding both of D. discoideum development and plant cellulose biogenesis.

  2. The model organism Dictyostelium discoideum.


    Bozzaro, Salvatore


    Much of our knowledge of molecular cellular functions is based on studies with a few number of model organisms that were established during the last 50 years. The social amoeba Dictyostelium discoideum is one such model, and has been particularly useful for the study of cell motility, chemotaxis, phagocytosis, endocytic vesicle traffic, cell adhesion, pattern formation, caspase-independent cell death, and, more recently, autophagy and social evolution. As nonmammalian model of human diseases D. discoideum is a newcomer, yet it has proven to be a powerful genetic and cellular model for investigating host-pathogen interactions and microbial infections, for mitochondrial diseases, and for pharmacogenetic studies. The D. discoideum genome harbors several homologs of human genes responsible for a variety of diseases, -including Chediak-Higashi syndrome, lissencephaly, mucolipidosis, Huntington disease, IBMPFD, and Shwachman-Diamond syndrome. A few genes have already been studied, providing new insights on the mechanism of action of the encoded proteins and in some cases on the defect underlying the disease. The opportunities offered by the organism and its place among the nonmammalian models for human diseases will be discussed. PMID:23494300

  3. Centromere sequence and dynamics in Dictyostelium discoideum.


    Glöckner, Gernot; Heidel, Andrew J


    Centromeres play a pivotal role in the life of a eukaryote cell, perform an essential and conserved function, but this has not led to a standard centromere structure. It remains currently unclear, how the centromeric function is achieved by widely differing structures. Since centromeres are often large and consist mainly of repetitive sequences they have only been analyzed in great detail in a handful of organisms. The genome of Dictyostelium discoideum, a valuable model organism, was described a few years ago but its centromere organization remained largely unclear. Using available sequence information we reconstructed the putative centromere organization in three of the six chromosomes of D. discoideum. They mainly consist of one type of transposons that is confined to centromeric regions. Centromeres are dynamic due to transposon integration, but an optimal centromere size seems to exist in D. discoideum. One centromere probably has expanded recently, whereas another underwent major rearrangements. In addition to insights into the centromere organization and dynamics of a protist eukaryote, this work also provides a starting point for the analysis of the evolution of centromere structures in social amoebas by comparative genomics.

  4. Mutants of thermotaxis in Dictyostelium discoideum

    SciTech Connect

    Schneider, M.J.; Fontana, D.R.; Poff, K.L.


    Amoebae of Dictyostelium discoideum, strain HL50 were mutagenized with N-methyl-N'-nitro-N-nitrosoguanidine, cloned, allowed to form pseudoplasmodia and screened for aberrant positive and negative thermotaxis. Three types of mutants were found. Mutant HO428 exhibits only positive thermotaxis over the entire temperature range (no negative thermotaxis). HO596 and HO813 exhibit weakened positive thermotaxis and normal negative thermotaxis. The weakened positive thermotactic response results in a shift toward warmer temperatures in the transition temperature from negative to positive thermotaxis. Mutant HO209 exhibits weakened positive and negative thermotactic responses and has a transition temperature similar to the 'wild type' (HL50).The two types of mutants represented by HO428, HO596 and HO813 support the model that positive and negative thermotaxis have separate pathways for temperature sensing. The type of mutants which contains HO209 suggests that those two pathways converge at some point before the response.

  5. Scaling law for Dictyostelium Discoideum mounds

    NASA Astrophysics Data System (ADS)

    Voeltz, Camilla; Bodenschatz, Eberhard


    Little is known about how multicellular organisms regulate the size of their tissues during development. The eukaryote Dictyostelium Discoideum, may be studied as a model system. When starved, these amoebae aggregate and form cell mounds. These mounds develop into moving slugs and fruiting bodies consisting of a spore mass held atop a rigid stem of stalk cells. We report experiments on the development of mounds of Dicty-cells when confined to different heights. At the smallest height the amoebae are confined to a monolayer of cells in a 2d-plane. We found that the confinement inhibited the development of moving slugs and fruiting bodies. The cells aggregated and formed mounds whose size was found to be proportional to the height of the mounds. The precise mechanism is yet unknown. We will present the data and discuss possible mechanisms. This work is supported by the NSF through the Biocomplexity Program.

  6. Lack of 5-methylcytosine in Dictyostelium discoideum DNA.

    PubMed Central

    Smith, S S; Ratner, D I


    We find no evidence for the presence of 5-methylcytosine in the DNA of Dictyostelium discoideum. Methylation was absent from CCGG sites in repetitive DNA and in DNA from the actin multigene family. Nor was 5-methylcytosine detected in total DNA when base composition was determined by means of h.p.l.c. Images Fig. 1. Fig. 2. PMID:1713034

  7. Dictyostelium discoideum--a model for many reasons.


    Annesley, Sarah J; Fisher, Paul R


    The social amoeba or cellular slime mould Dictyostelium discoideum is a "professional" phagocyte that has long been recognized for its value as a biomedical model organism, particularly in studying the actomyosin cytoskeleton and chemotactic motility in non-muscle cells. The complete genome sequence of D. discoideum is known, it is genetically tractable, readily grown clonally as a eukaryotic microorganism and is highly accessible for biochemical, cell biological and physiological studies. These are the properties it shares with other microbial model organisms. However, Dictyostelium combines these with a unique life style, with motile unicellular and multicellular stages, and multiple cell types that offer for study an unparalleled variety of phenotypes and associated signalling pathways. These advantages have led to its recent emergence as a valuable model organism for studying the molecular pathogenesis and treatment of human disease, including a variety of infectious diseases caused by bacterial and fungal pathogens. Perhaps surprisingly, this organism, without neurons or brain, has begun to yield novel insights into the cytopathology of mitochondrial diseases as well as other genetic and idiopathic disorders affecting the central nervous system. Dictyostelium has also contributed significantly to our understanding of NDP kinase, as it was the Dictyostelium enzyme whose structure was first determined and related to enzymatic activity. The phenotypic richness and tractability of Dictyostelium should provide a fertile arena for future exploration of NDPK's cellular roles.

  8. Flow-driven instabilities during pattern formation of Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.


    The slime mold Dictyostelium discoideum is a well known model system for the study of biological pattern formation. In the natural environment, aggregating populations of starving Dictyostelium discoideum cells may experience fluid flows that can profoundly change the underlying wave generation process. Here we study the effect of advection on the pattern formation in a colony of homogeneously distributed Dictyostelium discoideum cells described by the standard Martiel-Goldbeter model. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. The evolution of small perturbations in cAMP concentrations is studied analytically in the linear regime and by corresponding numerical simulations. We show that flow can significantly influence the dynamics of the system and lead to a flow-driven instability that initiate downstream traveling cAMP waves. We also show that boundary conditions have a significant effect on the observed patterns and can lead to a new kind of instability.

  9. Dissection of Francisella-Host Cell Interactions in Dictyostelium discoideum.


    Lampe, Elisabeth O; Brenz, Yannick; Herrmann, Lydia; Repnik, Urska; Griffiths, Gareth; Zingmark, Carl; Sjöstedt, Anders; Winther-Larsen, Hanne C; Hagedorn, Monica


    Francisella bacteria cause severe disease in both vertebrates and invertebrates and include one of the most infectious human pathogens. Mammalian cell lines have mainly been used to study the mechanisms by which Francisella manipulates its host to replicate within a large variety of hosts and cell types, including macrophages. Here, we describe the establishment of a genetically and biochemically tractable infection model: the amoeba Dictyostelium discoideum combined with the fish pathogen Francisella noatunensis subsp. noatunensis. Phagocytosed F. noatunensis subsp. noatunensis interacts with the endosomal pathway and escapes further phagosomal maturation by translocating into the host cell cytosol. F. noatunensis subsp. noatunensis lacking IglC, a known virulence determinant required for Francisella intracellular replication, follows the normal phagosomal maturation and does not grow in Dictyostelium. The attenuation of the F. noatunensis subsp. noatunensis ΔiglC mutant was confirmed in a zebrafish embryo model, where growth of F. noatunensis subsp. noatunensis ΔiglC was restricted. In Dictyostelium, F. noatunensis subsp. noatunensis interacts with the autophagic machinery. The intracellular bacteria colocalize with autophagic markers, and when autophagy is impaired (Dictyostelium Δatg1), F. noatunensis subsp. noatunensis accumulates within Dictyostelium cells. Altogether, the Dictyostelium-F. noatunensis subsp. noatunensis infection model recapitulates the course of infection described in other host systems. The genetic and biochemical tractability of the system allows new approaches to elucidate the dynamic interactions between pathogenic Francisella and its host organism. PMID:26712555

  10. Dissection of Francisella-Host Cell Interactions in Dictyostelium discoideum

    PubMed Central

    Lampe, Elisabeth O.; Brenz, Yannick; Herrmann, Lydia; Repnik, Urska; Griffiths, Gareth; Zingmark, Carl; Sjöstedt, Anders; Winther-Larsen, Hanne C.


    Francisella bacteria cause severe disease in both vertebrates and invertebrates and include one of the most infectious human pathogens. Mammalian cell lines have mainly been used to study the mechanisms by which Francisella manipulates its host to replicate within a large variety of hosts and cell types, including macrophages. Here, we describe the establishment of a genetically and biochemically tractable infection model: the amoeba Dictyostelium discoideum combined with the fish pathogen Francisella noatunensis subsp. noatunensis. Phagocytosed F. noatunensis subsp. noatunensis interacts with the endosomal pathway and escapes further phagosomal maturation by translocating into the host cell cytosol. F. noatunensis subsp. noatunensis lacking IglC, a known virulence determinant required for Francisella intracellular replication, follows the normal phagosomal maturation and does not grow in Dictyostelium. The attenuation of the F. noatunensis subsp. noatunensis ΔiglC mutant was confirmed in a zebrafish embryo model, where growth of F. noatunensis subsp. noatunensis ΔiglC was restricted. In Dictyostelium, F. noatunensis subsp. noatunensis interacts with the autophagic machinery. The intracellular bacteria colocalize with autophagic markers, and when autophagy is impaired (Dictyostelium Δatg1), F. noatunensis subsp. noatunensis accumulates within Dictyostelium cells. Altogether, the Dictyostelium-F. noatunensis subsp. noatunensis infection model recapitulates the course of infection described in other host systems. The genetic and biochemical tractability of the system allows new approaches to elucidate the dynamic interactions between pathogenic Francisella and its host organism. PMID:26712555

  11. Chemotaxis to Excitable Waves in Dictyostelium Discoideum

    NASA Astrophysics Data System (ADS)

    Bhowmik, Arpan; Rappel, Wouter-Jan; Levine, Herbert

    In recent years, there have been significant advances in our understanding of the mechanisms underlying chemically directed motility by eukaryotic cells such as Dictyostelium. In particular, the LEGI model has proven capable of providing a framework for quantitatively explaining many experiments that present Dictyostelium cells with tailored chemical stimuli and monitor their subsequent polarization. Here, we couple the LEGI approach to an excitable medium model of the cAMP wave-field that is self-generated by the cells and investigate the extent to which this class of models enables accurate chemotaxis to the cAMP waveforms expected in vivo. Our results indicate that the ultra-sensitive version of the model does an excellent job in providing natural wave rectification, thereby providing a compelling solution to the ``back-of-the-wave paradox'' during cellular aggregation. This work was supported by National Institutes of Health Grant P01 GM078586.

  12. Excitable signal relay in Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Mestler, Troy; Schwab, David; Mehta, Pankaj; Gregor, Thomas


    The social amoeba D. discoideum transitions when starved from a collection of individual cells into a multicellular spore-complex. During this process, amoebae display several interesting phenomena including intercellular signaling, pattern formation, and cell differentiation. At the heart of these phenomena is the exchange of the signaling molecule cyclic-AMP, which has previously been extensively studied using a variety of indirect methods. Here we employ a sensor that uses a compound fluorescent protein whose emission spectrum changes in the presence of bound cyclic AMP to directly monitor, in real time and in vivo, intracellular cAMP concentrations. We use cells expressing this sensor in microchemostats to study intracellular cAMP concentrations at the single-cell level in response to precise, dynamically-controlled external cAMP stimulation. Specifically, we show that these cells display excitability much like that found in neurons and agree experimentally quite well with a modified FitzHugh-Nagumo dynamical systems model. This single-cell model sets groundwork for a comprehensive multicellular model that promises to explain emergent behavior in D. discoideum.

  13. Choice of partners: sexual cell interactions in Dictyostelium discoideum.


    Urushihara, H


    Recognition of mating partners is of central importance in the sexual processes. In consideration that the most important function of sexuality is to shuffle genetic materials to generate wider variation of characters, mating among different genetic backgrounds is preferable. Wild isolates of cellular slime mold Dictyostelium discoideum are predominantly heterothallic, but homothallic ones also exist. In addition, there are bi-sexual strains which are compatible with either mating type of heterothallic strains but are self-incompatible. How cells of these organisms choose proper mating partners may include the essential mechanisms for sexual cell recognition in general. This minireview addresses studies on sexual cell interactions of D. discoideum with special attention to cell recognition and evolution of the mating system. PMID:8906358

  14. Production and secretion of recombinant proteins in Dictyostelium discoideum.


    Dittrich, W; Williams, K L; Slade, M B


    We have expressed useful amounts of three recombinant proteins in a new eukaryotic host/vector system. The cellular slime mold Dictyostelium discoideum efficiently secreted two recombinant products, a soluble form of the normally cell surface associated D. discoideum glycoprotein (PsA) and the heterologous protein glutathione-S-transferase (GST) from Schistosoma japonicum, while the enzyme beta-glucuronidase (GUS) from Escherichia coli was cell associated. Up to 20mg/l of recombinant PsA and 1mg/l of GST were obtained after purification from a standard, peptone based growth medium. The secretion signal peptide was correctly cleaved from the recombinant GST- and PsA-proteins and the expression of recombinant PsA was shown to be stable for at least one hundred generations in the absence of selection. PMID:7764951

  15. Altruism and social cheating in the social amoeba Dictyostelium discoideum.


    Strassmann, J E; Zhu, Y; Queller, D C

    The social amoeba, Dictyostelium discoideum, is widely used as a simple model organism for multicellular development, but its multicellular fruiting stage is really a society. Most of the time, D. discoideum lives as haploid, free-living, amoeboid cells that divide asexually. When starved, 10(4)-10(5) of these cells aggregate into a slug. The anterior 20% of the slug altruistically differentiates into a non-viable stalk, supporting the remaining cells, most of which become viable spores. If aggregating cells come from multiple clones, there should be selection for clones to exploit other clones by contributing less than their proportional share to the sterile stalk. Here we use microsatellite markers to show that different clones collected from a field population readily mix to form chimaeras. Half of the chimaeric mixtures show a clear cheater and victim. Thus, unlike the clonal and highly cooperative development of most multicellular organisms, the development of D. discoideum is partly competitive, with conflicts of interests among cells. These conflicts complicate the use of D. discoideum as a model for some aspects of development, but they make it highly attractive as a model system for social evolution.

  16. Theoretical model for morphogenesis and cell sorting in Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Umeda, T.; Inouye, K.


    The morphogenetic movement and cell sorting in cell aggregates from the mound stage to the migrating slug stage of the cellular slime mold Dictyostelium discoideum were studied using a mathematical model. The model postulates that the motive force generated by the cells is in equilibrium with the internal pressure and mechanical resistance. The moving boundary problem derived from the force balance equation and the continuity equation has stationary solutions in which the aggregate takes the shape of a spheroid (or an ellipse in two-dimensional space) with the pacemaker at one of its foci, moving at a constant speed. Numerical calculations in two-dimensional space showed that an irregularly shaped aggregate changes its shape to become an ellipse as it moves. Cell aggregates consisting of two cell types differing in motive force exhibit cell sorting and become elongated, suggesting the importance of prestalk/prespore differentiation in the morphogenesis of Dictyostelium.

  17. Ordered yeast artificial chromosome clones representing the Dictyostelium discoideum genome.

    PubMed Central

    Kuspa, A; Loomis, W F


    High resolution gene maps of the six chromosomes of Dictyostelium discoideum have been generated by a combination of physical mapping techniques. A set of yeast artificial chromosome clones has been ordered into overlapping arrays that cover >98% of the 34-magabase pair genome. Clones were grouped and ordered according to the genes they carried, as determined by hybridization analyses with DNA fragments from several hundred genes. Congruence of the gene order within each arrangement of clones with the gene order determined from whole genome restriction site mapping indicates that a high degree of confidence can be placed on the clone map. This clone-based description of the Dictyostelium chromosomes should be useful for the physical mapping and subcloning of new genes and should facilitate more detailed analyses of this genome. cost of silicon-based construction and in the efficient sample handling afforded by component integration. PMID:8643615

  18. Signaling pathways mediating chemotaxis in the social amoeba, Dictyostelium discoideum.


    Willard, Stacey S; Devreotes, Peter N


    Chemotaxis, or cell migration guided by chemical cues, is critical for a multitude of biological processes in a diverse array of organisms. Dictyostelium discoideum amoebae rely on chemotaxis to find food and to survive starvation conditions, and we have taken advantage of this system to study the molecular regulation of this vital cell behavior. Previous work has identified phosphoinositide signaling as one mechanism which may contribute to directional sensing and actin polymerization during chemotaxis; a mechanism which is conserved in mammalian neutrophils. In this review, we will discuss recent data on genes and pathways governing directional sensing and actin polymerization, with a particular emphasis on contributions from our laboratory. PMID:16962888

  19. Analysis of Dictyostelium discoideum inositol pyrophosphate metabolism by gel electrophoresis.


    Pisani, Francesca; Livermore, Thomas; Rose, Giuseppina; Chubb, Jonathan Robert; Gaspari, Marco; Saiardi, Adolfo


    The social amoeba Dictyostelium discoideum was instrumental in the discovery and early characterization of inositol pyrophosphates, a class of molecules possessing highly-energetic pyrophosphate bonds. Inositol pyrophosphates regulate diverse biological processes and are attracting attention due to their ability to control energy metabolism and insulin signalling. However, inositol pyrophosphate research has been hampered by the lack of simple experimental procedures to study them. The recent development of polyacrylamide gel electrophoresis (PAGE) and simple staining to resolve and detect inositol pyrophosphate species has opened new investigative possibilities. This technology is now commonly applied to study in vitro enzymatic reactions. Here we employ PAGE technology to characterize the D. discoideum inositol pyrophosphate metabolism. Surprisingly, only three major bands are detectable after resolving acidic extract on PAGE. We have demonstrated that these three bands correspond to inositol hexakisphosphate (IP₆ or Phytic acid) and its derivative inositol pyrophosphates, IP₇ and IP₈. Biochemical analyses and genetic evidence were used to establish the genuine inositol phosphate nature of these bands. We also identified IP₉ in D. discoideum cells, a molecule so far detected only from in vitro biochemical reactions. Furthermore, we discovered that this amoeba possesses three different inositol pentakisphosphates (IP₅) isomers, which are largely metabolised to inositol pyrophosphates. Comparison of PAGE with traditional Sax-HPLC revealed an underestimation of the cellular abundance of inositol pyrophosphates by traditional methods. In fact our study revealed much higher levels of inositol pyrophosphates in D. discoideum in the vegetative state than previously detected. A three-fold increase in IP₈ was observed during development of D. discoideum a value lower that previously reported. Analysis of inositol pyrophosphate metabolism using ip6k null amoeba

  20. Characterization of the Roco protein family in Dictyostelium discoideum.


    van Egmond, Wouter N; van Haastert, Peter J M


    The Roco family consists of multidomain Ras-GTPases that include LRRK2, a protein mutated in familial Parkinson's disease. The genome of the cellular slime mold Dictyostelium discoideum encodes 11 Roco proteins. To study the functions of these proteins, we systematically knocked out the roco genes. Previously described functions for GbpC, Pats1, and QkgA (Roco1 to Roco3) were confirmed, while novel developmental defects were identified in roco4- and roco11-null cells. Cells lacking Roco11 form larger fruiting bodies than wild-type cells, while roco4-null cells show strong developmental defects during the transition from mound to fruiting body; prestalk cells produce reduced levels of cellulose, leading to unstable stalks that are unable to properly lift the spore head. Detailed phylogenetic analysis of four slime mold species reveals that QkgA and Roco11 evolved relatively late by duplication of an ancestor roco4 gene (later than approximately 300 million years ago), contrary to the situation with other roco genes, which were already present before the split of the common ancestor of D. discoideum and Polysphondylium pallidum (before approximately 600 million years ago). Together, our data show that the Dictyostelium Roco proteins serve a surprisingly diverse set of functions and highlight Roco4 as a key protein for proper stalk cell formation. PMID:20348387

  1. Cell Assisted Cell Growth Experiments with Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Bae, Albert; Ip, Wui; Franck, Carl


    In eukaryotic cell culture, it is routinely recommended to keep the cells above a minimum cell density to maintain vigorous growth. We are investigating the basis for this prescription by viewing cell growth as a social behavior facilitated by cell-cell communication. Employing Dictyostelium discoideum, we find good evidence for a slow-fast transition in the cell growth rate vs. density in well mixed, 25 ml, cell cultures. We also use low height microfluidic chambers (four orders of magnitude smaller in volume) to find similar behavior even though the system is not well mixed and the cells are confined to substrates. A preliminary measurement at a flow rate that should strongly perturb cell-cell communication by means of diffusing signal molecules suggests that cell communication essential for growth is not accomplished by such means but possibly via direct contacts.

  2. Genetics of phototaxis in a model eukaryote, Dictyostelium discoideum.


    Fisher, P R


    The life cycle of Dictyostelium discoideum offers a unique opportunity to study signal transduction in eukaryotic cells at both the unicellular and multicellular levels of organization. Adding to the already extensive knowledge of the unicellular stages, classical and molecular genetics have begun to unravel transduction of signals controlling morphogenesis and behaviour (phototaxis and thermotaxis) in the multicellular 'slug' stage of the life cycle. Distributed over all seven genetic linkage groups are probably about 20, but possibly as many as 55, genes of importance for slug behaviour. The encoded proteins appear from pharmacological studies and mutant phenotypes to govern transduction pathways involving the intracellular second messengers cyclic AMP, cyclic GMP, IP3 and Ca2+. Pathways from the photo- and thermoreceptors converge first with each other and thence, at the level of the second messengers, with those from extracellular tip activation (cyclic AMP) and inhibition (Slug Turning Factor and/or ammonia and/or adenosine) signals that control slug movement and morphogenesis.

  3. Secondary Ion Mass Spectrometry Imaging of Dictyostelium discoideum Aggregation Streams

    PubMed Central

    DeBord, John Daniel; Smith, Donald F.; Anderton, Christopher R.; Heeren, Ron M. A.; Paša-Tolić, Ljiljana; Gomer, Richard H.; Fernandez-Lima, Francisco A.


    High resolution imaging mass spectrometry could become a valuable tool for cell and developmental biology, but both, high spatial and mass spectral resolution are needed to enable this. In this report, we employed Bi3 bombardment time-of-flight (Bi3 ToF-SIMS) and C60 bombardment Fourier transform ion cyclotron resonance secondary ion mass spectrometry (C60 FTICR-SIMS) to image Dictyostelium discoideum aggregation streams. Nearly 300 lipid species were identified from the aggregation streams. High resolution mass spectrometry imaging (FTICR-SIMS) enabled the generation of multiple molecular ion maps at the nominal mass level and provided good coverage for fatty acyls, prenol lipids, and sterol lipids. The comparison of Bi3 ToF-SIMS and C60 FTICR-SIMS suggested that while the first provides fast, high spatial resolution molecular ion images, the chemical complexity of biological samples warrants the use of high resolution analyzers for accurate ion identification. PMID:24911189

  4. Secondary ion mass spectrometry imaging of Dictyostelium discoideum aggregation streams.


    DeBord, John Daniel; Smith, Donald F; Anderton, Christopher R; Heeren, Ron M A; Paša-Tolić, Ljiljana; Gomer, Richard H; Fernandez-Lima, Francisco A


    High resolution imaging mass spectrometry could become a valuable tool for cell and developmental biology, but both, high spatial and mass spectral resolution are needed to enable this. In this report, we employed Bi3 bombardment time-of-flight (Bi3 ToF-SIMS) and C60 bombardment Fourier transform ion cyclotron resonance secondary ion mass spectrometry (C60 FTICR-SIMS) to image Dictyostelium discoideum aggregation streams. Nearly 300 lipid species were identified from the aggregation streams. High resolution mass spectrometry imaging (FTICR-SIMS) enabled the generation of multiple molecular ion maps at the nominal mass level and provided good coverage for fatty acyls, prenol lipids, and sterol lipids. The comparison of Bi3 ToF-SIMS and C60 FTICR-SIMS suggested that while the first provides fast, high spatial resolution molecular ion images, the chemical complexity of biological samples warrants the use of high resolution analyzers for accurate ion identification.

  5. Secondary Ion Mass Spectrometry Imaging of Dictyostelium discoideum Aggregation Streams

    SciTech Connect

    Debord, J. Daniel; Smith, Donald F.; Anderton, Christopher R.; Heeren, Ronald M.; Pasa-Tolic, Ljiljana; Gomer, Richard H.; Fernandez-Lima, Francisco A.


    High resolution imaging mass spectrometry could become a valuable tool for cell and developmental biology, but both, high spatial and mass spectral resolution are needed to enable this. In this report, we employed Bi3 bombardment time-of-flight (Bi3 ToF-SIMS) and C60 bombardment Fourier transform ion cyclotron resonance secondary ion mass spectrometry (C60 FTICR-SIMS) to image Dictyostelium discoideum aggregation streams. Nearly 300 lipid species were identified from the aggregation streams. High resolution mass spectrometry imaging (FTICR-SIMS) enabled the generation of multiple molecular ion maps at the nominal mass level and provided good coverage for fatty acyls, prenol lipids, and sterol lipids. The comparison of Bi3 ToF-SIMS and C60 FTICR-SIMS suggested that while the first provides fast, high spatial resolution molecular ion images, the chemical complexity of biological samples warrants the use of high resolution analyzers for accurate ion identification.

  6. Measuring cheating, fitness, and segregation in Dictyostelium discoideum.


    Buttery, Neil J; Smith, Jeff; Queller, David C; Strassmann, Joan E


    Dictyostelium has become a model organism for the study of social evolution because of the stage in its life cycle where thousands of independent amoebae together form a fruiting body. Some individuals die to form a stalk that holds aloft the remaining cells for dispersal to new environments as spores. Different genotypes can aggregate together, creating opportunities for exploitation by cheaters that contribute a smaller proportion of cells to the stalk. Clustering of genotypes into separate fruiting bodies reduces the opportunities for cheating. Some genotypes achieve this by segregating after aggregation. Here we describe techniques for assaying cheating and segregation in D. discoideum. We cover how to grow and maintain cells, fluorescently label genotypes, design experiments for accuracy and precision, calculate fitness and segregation, and interpret the results.

  7. Sketch the migration of Dictyostelium discoideum using phase field model

    NASA Astrophysics Data System (ADS)

    Zhang, Yunsong; Camley, Brian; Rappel, Wouter-Jan; Levine, Herbert

    Cell migration plays an important role in a lot of biological processes, like chemotaxis, wound healing, and cancer metastasis. The fact it is highly integrated has brought great challenges, physical and mathematical, to the modeling efforts. Recently, a phase field model, which couples cellular reaction dynamics, intra-cellular hydrodynamics, cell-substrate adhesions and deformable cell boundaries, has successfully captured some characteristics of moving cells, including morphological change, cytosolic actin flow pattern, periodic migration and so on. Here we apply the phase field model to sketch the migration of Dictyostelium discoideum, which shows a completely different moving pattern from the cells (like fish keratocyte) in our previous attempts. And we will also compare our results with some experimental observations, not only on the cell morphology, but also on the traction force patterns on the substrate.

  8. Multi-scale interactions in Dictyostelium discoideum aggregation

    NASA Astrophysics Data System (ADS)

    Dixon, James A.; Kelty-Stephen, Damian G.


    Cellular aggregation is essential for a wide range of phenomena in developmental biology, and a crucial event in the life-cycle of Dictyostelium discoideum. The current manuscript presents an analysis of multi-scale interactions involved in D. discoideum aggregation and non-aggregation events. The multi-scale fractal dimensions of a sequence of microscope images were used to estimate changing structure at different spatial scales. Three regions showing aggregation and three showing non-aggregation were considered. The results showed that both aggregation and non-aggregation regions were strongly multi-fractal. Analyses of the over-time relationships among nine scales of the generalized dimension, D(q), were conducted using vector autoregression and vector error-correction models. Both types of regions showed evidence that across-scale interactions serve to maintain the equilibrium of the system. Aggregation and non-aggregation regions also showed different patterns of effects of individual scales on other scales. Specifically, aggregation regions showed greater effects of both the smallest and largest scales on the smaller scale structures. The results suggest that multi-scale interactions are responsible for maintaining and altering the cellular structures during aggregation.

  9. Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.


    Khare, Anupama; Shaulsky, Gad


    The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510

  10. The genome of the social amoeba Dictyostelium discoideum.


    Eichinger, L; Pachebat, J A; Glöckner, G; Rajandream, M-A; Sucgang, R; Berriman, M; Song, J; Olsen, R; Szafranski, K; Xu, Q; Tunggal, B; Kummerfeld, S; Madera, M; Konfortov, B A; Rivero, F; Bankier, A T; Lehmann, R; Hamlin, N; Davies, R; Gaudet, P; Fey, P; Pilcher, K; Chen, G; Saunders, D; Sodergren, E; Davis, P; Kerhornou, A; Nie, X; Hall, N; Anjard, C; Hemphill, L; Bason, N; Farbrother, P; Desany, B; Just, E; Morio, T; Rost, R; Churcher, C; Cooper, J; Haydock, S; van Driessche, N; Cronin, A; Goodhead, I; Muzny, D; Mourier, T; Pain, A; Lu, M; Harper, D; Lindsay, R; Hauser, H; James, K; Quiles, M; Madan Babu, M; Saito, T; Buchrieser, C; Wardroper, A; Felder, M; Thangavelu, M; Johnson, D; Knights, A; Loulseged, H; Mungall, K; Oliver, K; Price, C; Quail, M A; Urushihara, H; Hernandez, J; Rabbinowitsch, E; Steffen, D; Sanders, M; Ma, J; Kohara, Y; Sharp, S; Simmonds, M; Spiegler, S; Tivey, A; Sugano, S; White, B; Walker, D; Woodward, J; Winckler, T; Tanaka, Y; Shaulsky, G; Schleicher, M; Weinstock, G; Rosenthal, A; Cox, E C; Chisholm, R L; Gibbs, R; Loomis, W F; Platzer, M; Kay, R R; Williams, J; Dear, P H; Noegel, A A; Barrell, B; Kuspa, A


    The social amoebae are exceptional in their ability to alternate between unicellular and multicellular forms. Here we describe the genome of the best-studied member of this group, Dictyostelium discoideum. The gene-dense chromosomes of this organism encode approximately 12,500 predicted proteins, a high proportion of which have long, repetitive amino acid tracts. There are many genes for polyketide synthases and ABC transporters, suggesting an extensive secondary metabolism for producing and exporting small molecules. The genome is rich in complex repeats, one class of which is clustered and may serve as centromeres. Partial copies of the extrachromosomal ribosomal DNA (rDNA) element are found at the ends of each chromosome, suggesting a novel telomere structure and the use of a common mechanism to maintain both the rDNA and chromosomal termini. A proteome-based phylogeny shows that the amoebozoa diverged from the animal-fungal lineage after the plant-animal split, but Dictyostelium seems to have retained more of the diversity of the ancestral genome than have plants, animals or fungi.

  11. Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.


    Khare, Anupama; Shaulsky, Gad


    The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.

  12. Subcellular localization of ammonium transporters in Dictyostelium discoideum

    PubMed Central

    Kirsten, Janet H; Xiong, Yanhua; Davis, Carter T; Singleton, Charles K


    Background With the exception of vertebrates, most organisms have plasma membrane associated ammonium transporters which primarily serve to import a source of nitrogen for nutritional purposes. Dictyostelium discoideum has three ammonium transporters, Amts A, B and C. Our present work used fluorescent fusion proteins to determine the cellular localization of the Amts and tested the hypothesis that the transporters mediate removal of ammonia generated endogenously from the elevated protein catabolism common to many protists. Results Using RFP and YFP fusion constructs driven by the actin 15 promoter, we found that the three ammonium transporters were localized on the plasma membrane and on the membranes of subcellular organelles. AmtA and AmtB were localized on the membranes of endolysosomes and phagosomes, with AmtB further localized on the membranes of contractile vacuoles. AmtC also was localized on subcellular organelles when it was stabilized by coexpression with either the AmtA or AmtB fusion transporter. The three ammonium transporters exported ammonia linearly with regard to time during the first 18 hours of the developmental program as revealed by reduced export in the null strains. The fluorescently tagged transporters rescued export when expressed in the null strains, and thus they were functional transporters. Conclusion Unlike ammonium transporters in most organisms, which import NH3/NH4+ as a nitrogen source, those of Dictyostelium export ammonia/ammonium as a waste product from extensive catabolism of exogenously derived and endogenous proteins. Localization on proteolytic organelles and on the neutral contractile vacuole suggests that Dictyostelium ammonium transporters may have unique subcellular functions and play a role in the maintenance of intracellular ammonium distribution. A lack of correlation between the null strain phenotypes and ammonia excretion properties of the ammonium transporters suggests that it is not the excretion function that

  13. Scanning X-Ray Nanodiffraction on Dictyostelium discoideum

    PubMed Central

    Priebe, Marius; Bernhardt, Marten; Blum, Christoph; Tarantola, Marco; Bodenschatz, Eberhard; Salditt, Tim


    We have performed scanning x-ray nanobeam diffraction experiments on single cells of the amoeba Dictyostelium discoideum. Cells have been investigated in 1), freeze-dried, 2), frozen-hydrated (vitrified), and 3), initially alive states. The spatially resolved small-angle x-ray scattering signal shows characteristic streaklike patterns in reciprocal space, which we attribute to fiber bundles of the actomyosin network. From the intensity distributions, an anisotropy parameter can be derived that indicates pronounced local variations within the cell. In addition to nanobeam small-angle x-ray scattering, we have evaluated the x-ray differential phase contrast in view of the projected electron density. Different experimental aspects of the x-ray experiment, sample preparation, and data analysis are discussed. Finally, the x-ray results are correlated with optical microscopy (differential phase contrast and confocal microscopy of mutant strains with fluorescently labeled actin and myosin II), which have been carried out in live and fixed states, including optical microscopy under cryogenic conditions. PMID:25468345

  14. Pattern formation in Dictyostelium discoideum aggregates in confined microenvironments

    NASA Astrophysics Data System (ADS)

    Hallou, Adrien; Hersen, Pascal; di Meglio, Jean-Marc; Kabla, Alexandre

    Dictyostelium Discoideum (Dd) is often viewed as a model system to study the complex collective cell behaviours which shape an embryo. Under starvation, Dd cells form multicellular aggregates which soon elongate, starting to display an anterior-posterior axis by differentiating into two distinct cell populations; prestalk (front) and prespore (rear) cells zones. Different models, either based on positional information or on differentiation followed up by cell sorting, have been proposed to explain the origin and the regulation of this spatial pattern.To decipher between the proposed hypotheses, we have developed am experimental platform where aggregates, made of genetically engineered Dd cells to express fluorescent reporters of cell differentiation in either prestalk or prespore cells, are allowed to develop in 20 to 400 μm wide hydrogel channels. Such a setup allows us to both mimic Dd confined natural soil environment and to follow the patterning dynamics using time-lapse microscopy. Tracking cell lineage commitments and positions in space and time, we demonstrate that Dd cells differentiate first into prestalk and prespore cells prior to sorting into an organized spatial pattern on the basis of collective motions based on differential motility and adhesion mechanisms. A. Hallou would like to thank the University of Cambridge for the Award of an ``Oliver Gatty Studentship in Biophysical and Colloid Science''.

  15. Sensory adaptation of Dictyostelium discoideum cells to chemotactic signals

    PubMed Central


    Postvegetative Dictyostelium discoideum cells react chemotactically to gradients of cAMP, folic acid, and pterin. In the presence of a constant concentration of 10(-5) M cAMP cells move at random. They still are able to respond to superimposed gradients of cAMP, although the response is less efficient than without the high background level of cAMP. Cells which are accommodated to 10(-5) M cAMP do not react to a gradient of cAMP if the mean cAMP concentration is decreasing with time. This indicates the involvement of adaptation in the detection of chemotactic gradients: cells adapt to the mean concentration of chemoattractant and respond to positive deviations from the mean concentration. Cells adapted to high cAMP concentrations react normally to gradients of folic acid or pterin. Adaptation to one of these compounds does not affect the response to the other attractants. This suggests that cAMP, folic acid, and pterin are detected by different receptors, and that adaptation is localized at a step in the transduction process before the signals from these receptors coincide into one pathway. I discuss the implications of adaptation for chemotaxis and cell aggregation. PMID:6304109

  16. Glycoproteins That Exhibit Extensive Size Polymorphisms in Dictyostelium Discoideum

    PubMed Central

    Smith, E.; Gooley, A. A.; Hudson, G. C.; Williams, K. L.


    Electrophoretic variants which arise from amino acid substitutions, leading to charge differences between proteins are ubiquitous and have been used extensively for genetic analysis. Less well documented are polymorphisms in the size of proteins. Here we report that a group of glycoproteins, which share a common carbohydrate epitope, vary in size in different isolates of the cellular slime mould, Dictyostelium discoideum. One of these proteins, PsA, a developmentally regulated prespore-specific surface glycoprotein, has previously been shown to exist in three size forms due to allelic variation at the pspA locus on linkage group I. In this report, a second glycoprotein, PsB, which is also prespore specific but found inside prespore cells, is studied. PsB maps to linkage group II and exhibits at least four different sizes in the isolates examined. We propose that the size polymorphisms are the product of allelic variation at the pspB locus, due to differences in the number of repeat units. PMID:2731733

  17. Cellulases released during the germination of Dictyostelium discoideum spores.

    PubMed Central

    Jones, T H; de Renobales, M; Pon, N


    Dormant spores of Dictyostelium discoideum contained cellulase at a specific activity of 130 to 140 U/mg of protein; when heat activated, the spores germinated, progressively releasing the cellulase activity into the extracellular medium. The cellulase release was a selective process and resulted in recovery of the cellulase activity at a specific activity of 2,000 U/mg of protein; beta-glucosidase in the spores remained completely associated with the emerging amoebae. Release of the cellulase required heat activation of the spores and occurred during the swelling stage of germination; inhibition of the emergence stage with cycloheximide had no effect on the release of the cellulase. The cellulase activity released consisted of two enzymes whose molecular weights were 136,000 and 69,000. Studies of their pH optima, heat lability, and of their sensitivity to inhibition revealed no distinctive differences between these two proteins. Analysis on diethylaminoethyl-Sephadex columns showed that the higher-molecular-weight protein could be converted into the lower-molecular-weight component in vitro. PMID:33962

  18. Genetic diversity in the social amoeba Dictyostelium discoideum: population differentiation and cryptic species.


    Douglas, Tracy E; Kronforst, Marcus R; Queller, David C; Strassmann, Joan E


    The social amoeba Dictyostelium discoideum is a commonly used model organism for the study of social evolution, multicellularity, and cell biology. But the boundaries and structure of the species have not been explored. The lack of morphological traits to distinguish D. discoideum makes even knowing whether a given clone is D. discoideum a challenge. We address this with a phylogeny of a widespread collection of clones from a range of locations and including clones identified previously as potential cryptic species. We sequenced portions of nuclear ribosomal DNA and mitochondrial DNA, analyzing approximately 5500 and 2500 base pairs from the two regions respectively. We compared these sequences to known reference sequences for both D. discoideum and other closely related Dictyostelium species to create Bayesian and neighbor-joining phylogenetic trees representing the evolutionary relationships among the clones. We identified 51 unique D. discoideum concatenated sequences based on the combined mitochondrial and ribosomal sequence data. We also identified four unique D. citrinum concatenated sequences, three of which were previously classified as D. discoideum clones. Our analysis of the data revealed that all D. discoideum clones form a monophyletic group, but there are several well-supported subclades and pronounced genetic differentiation among locations (F(ST)=0.242, P=0.011), suggesting the presence of geographic or other barriers between populations. Our results reveal the need for further investigation into potential tropical cryptic species. PMID:21601638

  19. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  20. Cryptococcus neoformans Virulence Is Enhanced after Growth in the Genetically Malleable Host Dictyostelium discoideum

    PubMed Central

    Steenbergen, Judith N.; Nosanchuk, Joshua D.; Malliaris, Stephanie D.; Casadevall, Arturo


    Cryptococcus neoformans is an encapsulated, environmental fungus that can cause life-threatening meningitis. Pathogenicity of C. neoformans for macrophages and vertebrate hosts may be a mechanism selected in evolution for protection against environmental predators. In this study, we investigated whether Dictyostelium discoideum could serve as an alternate host for C. neoformans. D. discoideum has a defined genetic system which provides significant advantages for the study of fungus-amoeba interactions. Our results show that D. discoideum is susceptible to infection with C. neoformans and that the interactions are similar to those described previously for this fungus with macrophages and Acanthamoeba castellanii. Acapsular C. neoformans cells did not replicate when coincubated with D. discoideum. However, incubation of acapsular C. neoformans with D. discoideum mutants defective in myosin VII synthesis resulted in infection, validating the concept that avirulent organisms can be virulent in impaired hosts even at the unicellular level. Phagocytosis of C. neoformans by D. discoideum could be inhibited with capsule-specific antibodies and various sugars. Passage of an encapsulated C. neoformans strain through D. discoideum cultures increased virulence and was accompanied by larger capsules and faster time to melanization. These results add to the evidence implicating soil ameboid predators as important factors for the maintenance of C. neoformans virulence in the environment and suggest that D. discoideum promises to be an extremely useful system for studying the interaction of C. neoformans with phagocytic cells. PMID:12933827

  1. Amino acid repeats cause extraordinary coding sequence variation in the social amoeba Dictyostelium discoideum.


    Scala, Clea; Tian, Xiangjun; Mehdiabadi, Natasha J; Smith, Margaret H; Saxer, Gerda; Stephens, Katie; Buzombo, Prince; Strassmann, Joan E; Queller, David C


    Protein sequences are normally the most conserved elements of genomes owing to purifying selection to maintain their functions. We document an extraordinary amount of within-species protein sequence variation in the model eukaryote Dictyostelium discoideum stemming from triplet DNA repeats coding for long strings of single amino acids. D. discoideum has a very large number of such strings, many of which are polyglutamine repeats, the same sequence that causes various human neurological disorders in humans, like Huntington's disease. We show here that D. discoideum coding repeat loci are highly variable among individuals, making D. discoideum a candidate for the most variable proteome. The coding repeat loci are not significantly less variable than similar non-coding triplet repeats. This pattern is consistent with these amino-acid repeats being largely non-functional sequences evolving primarily by mutation and drift. PMID:23029418

  2. Detection and characterisation of NAD(P)H-diaphorase activity in Dictyostelium discoideum cells (Protozoa)

    PubMed Central

    Amaroli, A.; Chessa, M.G.


    In Dictyostelium discoideum (D. discoideum), compounds generating nitric oxide (NO) inhibit its aggregation and differentiation without altering cyclic guanosine monophosphate (cGMP) production. They do it by preventing initiation of cyclic adenosine monophosphate (cAMP) pulses. Furthermore, these compounds stimulate adenosine diphosphate (ADP)-ribosylation of a 41 kDa cytosolic protein and regulate the glyceraldehyde-3-phospate dehydrogenase activity. Yet, although D. discoideum cells produce NO at a relatively constant rate at the onset of their developmental cycle, there is still no evidence of the presence of nitric oxide synthase (NOS) enzymes. In this work, we detect the nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) activity in D. discoideum and we characterise it by specific inhibitors and physical-chemical conditions that allegedly distinguish between NOS-related and -unrelated NADPH-d activity. PMID:23361243

  3. Dictyostelium discoideum as a Novel Host System to Study the Interaction between Phagocytes and Yeasts

    PubMed Central

    Koller, Barbara; Schramm, Christin; Siebert, Susann; Triebel, János; Deland, Eric; Pfefferkorn, Anna M.; Rickerts, Volker; Thewes, Sascha


    The social amoeba Dictyostelium discoideum is a well-established model organism to study the interaction between bacteria and phagocytes. In contrast, research using D. discoideum as a host model for fungi is rare. We describe a comprehensive study, which uses D. discoideum as a host model system to investigate the interaction with apathogenic (Saccharomyces cerevisiae) and pathogenic (Candida sp.) yeast. We show that Dictyostelium can be co-cultivated with yeasts on solid media, offering a convenient test to study the interaction between fungi and phagocytes. We demonstrate that a number of D. discoideum mutants increase (atg1−, kil1−, kil2−) or decrease (atg6−) the ability of the amoebae to predate yeast cells. On the yeast side, growth characteristics, reduced phagocytosis rate, as well as known virulence factors of C. albicans (EFG1, CPH1, HGC1, ICL1) contribute to the resistance of yeast cells against predation by the amoebae. Investigating haploid C. albicans strains, we suggest using the amoebae plate test for screening purposes after random mutagenesis. Finally, we discuss the potential of our adapted amoebae plate test to use D. discoideum for risk assessment of yeast strains.

  4. Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Cellular Slime Mold, Dictyostelium Discoideum

    NASA Technical Reports Server (NTRS)

    Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.


    The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of

  5. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.


    Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta


    Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

  6. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.


    Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta


    Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway. PMID:24499792

  7. Protein and phospholipid methylation during chemotaxis in Dictyostelium discoideum and its relationship to calcium movements.

    PubMed Central

    Mato, J M; Marín-Cao, D


    Suspensions of cyclic AMP sensitive cells of Dictyostelium discoideum responded to a cyclic AMP pulse with increased methylation of a protein of molecular weight about 120,000 and increased phospholipid demethylation. Protein methylation reached its peak 15-30 sec after cyclic AMP addition. Phospholipid demethylation reached its maximum within 2 min and basal levels were recovered in 3 min. S-Adenosyl-L-methionine is probably the methyl donor. In vitro addition of 0.25 mM and 25 microM S-adenosyl-L-methionine to sonicated D. discoideum cells inhibited ATP-dependent 45Ca2+ uptake by 70% and 25%, respectively. Based on these lines of evidence we propose that protein and phospholipid methylation are involved in D. discoideum chemotaxis probably by regulation of intracellular Ca2+ movements. PMID:230497

  8. Identification of the homolog of cell-counting factor in the cellular slime mold Dictyostelium discoideum.


    Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo


    Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.

  9. A second functional delta5 fatty acid desaturase in the cellular slime mould Dictyostelium discoideum.


    Saito, T; Morio, T; Ochiai, H


    A cDNA with homology to fatty acid desaturases was selected by searching the cDNA data bank of Dictyostelium discoideum (http://www. with conserved histidine box motifs. Using this sequence, genomic DNA encoding the Delta5 desaturase was amplified from the genomic DNA of D. discoideum, and its desaturase activity was confirmed by the overexpression mutation in D. discoideum and the gain-of-function mutation in yeast. The cloned cDNA is 1565 nucleotides in length, and the deduced amino-acid sequence comprised 467 amino-acid residues containing an N-terminal cytochrome b5 domain that shared 43% identity with cytochrome b5 of Oryza sativa. The whole sequence was 42% identical to the Delta5 desaturase of Mortierella alpina. This desaturase is a novel member of the cytochrome b5-containing Delta5 fatty acid desaturase. As we have already reported one other Delta5 desaturase in Dictyostelium, this organism is the first to be confirmed as having two functional Delta5 fatty acid desaturase genes. The substrate specificities of the two functional Delta5 desaturases of D. discoideum were also examined.

  10. Anchoring of an immunogenic Plasmodium falciparum circumsporozoite protein on the surface of Dictyostelium discoideum.


    Reymond, C D; Beghdadi-Rais, C; Roggero, M; Duarte, E A; Desponds, C; Bernard, M; Groux, D; Matile, H; Bron, C; Corradin, G


    The circumsporozoite protein (CSP), a major antigen of Plasmodium falciparum, was expressed in the slime mold Dictyostelium discoideum. Fusion of the parasite protein to a leader peptide derived from Dictyostelium contact site A was essential for expression. The natural parasite surface antigen, however, was not detected at the slime mold cell surface as expected but retained intracellularly. Removal of the last 23 amino acids resulted in secretion of CSP, suggesting that the C-terminal segment of the CSP, rather than an ectoplasmic domain, was responsible for retention. Cell surface expression was obtained when the CSP C-terminal segment was replaced by the D. discoideum contact site A glycosyl phosphatidylinositol anchor signal sequence. Mice were immunized with Dictyostelium cells harboring CSP at their surface. The raised antibodies recognized two different regions of the CSP. Anti-sporozoite titers of these sera were equivalent to anti-peptide titers detected by enzyme-linked immunosorbent assay. Thus, cell surface targeting of antigens can be obtained in Dictyostelium, generating sporozoite-like cells having potentials for vaccination, diagnostic tests, or basic studies involving parasite cell surface proteins. PMID:7759554

  11. Phosphorylation of proteins in Dictyostelium discoideum during development

    SciTech Connect

    Coffman, D.S.


    The phosphoproteins in D. discoideum were studied with respect to their formation, metabolic stability, cellular and subcellular distribution. Special emphasis was on the role of cAMP on the pattern of phosphorylation. Amoebae were metabolically labeled with /sup 32/P/sub i/; subsequently proteins of the total lysate, nuclei and membranes were resolved by SDS-polyacrylamide gel electrophoresis and subjected to autoradiography. Numerous changes in the profile of phosphoproteins were observed during development. Functions were assigned to four membranal phosphoproteins; only one protein, the heavy chain of myosin, was susceptible to phosphorylation in vitro when purified membranes and /sup 32/P-ATP were used. A comparison between the time of protein synthesis and phosphorylation, as examined in vivo using /sup 35/S-methionine and /sup 32/P/sub i/ labeling of amoebae and two-dimensional gel electrophoresis, indicated that phosphorylation is concurrent with synthesis. It appears then that there are two classes of membranal phosphoproteins in D. discoideum which differ with respect to the stability of the phosphate moiety. It is evident that the turnover of the phosphate moiety in myosin heavy chain plays a crucial role in the function of myosin; a role for the metabolically inert phosphate of other membranal proteins remains to be established. The G protein which couples occupancy of hormone receptor to stimulation of adenylate cyclase in higher multicellular eukaryotes was detected in D. discoideum. The G protein is present in approximately equal amounts in vegetative and in developing amoebae.

  12. The use of streptavidin conjugates as immunoblot loading controls and mitochondrial markers for use with Dictyostelium discoideum.


    Davidson, Andrew J; King, Jason S; Insall, Robert H


    The loading controls used for quantitative immunoblotting of mammalian proteins are not appropriate for use with Dictyostelium discoideum. Actin levels, for example, change greatly during Dictyostelium development. In addition, Dictyostelium-specific antibodies for other potential control proteins are not commercially available. Here we demonstrate the use of labeled streptavidin to detect biotinylated mitochondrial 3-methylcrotonyl-CoA carboxylase α (MCCC1), providing a robust and convenient tool for quantitative normalization of Dictyostelium Western blots, as well as fluorescently labeling mitochondria for microscopy of fixed cells.

  13. Migration in the social stage of Dictyostelium discoideum amoebae impacts competition

    PubMed Central

    Buttery, Neil; Adu-Oppong, Boahemaa; Powers, Michael; Thompson, Christopher R.L.; Queller, David C.; Strassmann, Joan E.


    Interaction conditions can change the balance of cooperation and conflict in multicellular groups. After aggregating together, cells of the social amoeba Dictyostelium discoideum may migrate as a group (known as a slug) to a new location. We consider this migration stage as an arena for social competition and conflict because the cells in the slug may not be from a genetically homogeneous population. In this study, we examined the interplay of two seemingly diametric actions, the solitary action of kin recognition and the collective action of slug migration in D. discoideum, to more fully understand the effects of social competition on fitness over the entire lifecycle. We compare slugs composed of either genetically homogenous or heterogeneous cells that have migrated or remained stationary in the social stage of the social amoeba Dictyostelium discoideum. After migration of chimeric slugs, we found that facultative cheating is reduced, where facultative cheating is defined as greater contribution to spore relative to stalk than found for that clone in the clonal state. In addition our results support previous findings that competitive interactions in chimeras diminish slug migration distance. Furthermore, fruiting bodies have shorter stalks after migration, even accounting for cell numbers at that time. Taken together, these results show that migration can alleviate the conflict of interests in heterogeneous slugs. It aligns their interest in finding a more advantageous place for dispersal, where shorter stalks suffice, which leads to a decrease in cheating behavior. PMID:26528414

  14. Migration in the social stage of Dictyostelium discoideum amoebae impacts competition.


    Jack, Chandra N; Buttery, Neil; Adu-Oppong, Boahemaa; Powers, Michael; Thompson, Christopher R L; Queller, David C; Strassmann, Joan E


    Interaction conditions can change the balance of cooperation and conflict in multicellular groups. After aggregating together, cells of the social amoeba Dictyostelium discoideum may migrate as a group (known as a slug) to a new location. We consider this migration stage as an arena for social competition and conflict because the cells in the slug may not be from a genetically homogeneous population. In this study, we examined the interplay of two seemingly diametric actions, the solitary action of kin recognition and the collective action of slug migration in D. discoideum, to more fully understand the effects of social competition on fitness over the entire lifecycle. We compare slugs composed of either genetically homogenous or heterogeneous cells that have migrated or remained stationary in the social stage of the social amoeba Dictyostelium discoideum. After migration of chimeric slugs, we found that facultative cheating is reduced, where facultative cheating is defined as greater contribution to spore relative to stalk than found for that clone in the clonal state. In addition our results support previous findings that competitive interactions in chimeras diminish slug migration distance. Furthermore, fruiting bodies have shorter stalks after migration, even accounting for cell numbers at that time. Taken together, these results show that migration can alleviate the conflict of interests in heterogeneous slugs. It aligns their interest in finding a more advantageous place for dispersal, where shorter stalks suffice, which leads to a decrease in cheating behavior.

  15. Functional Characterization of a Novel Aquaporin from Dictyostelium discoideum Amoebae Implies a Unique Gating Mechanism*

    PubMed Central

    von Bülow, Julia; Müller-Lucks, Annika; Kai, Lei; Bernhard, Frank; Beitz, Eric


    The social amoeba Dictyostelium discoideum is a widely used model organism for studying basic functions of protozoan and metazoan cells, such as osmoregulation and cell motility. There is evidence from other species that cellular water channels, aquaporins (AQP), are central to both processes. Yet, data on D. discoideum AQPs is almost absent. Despite cloning of two putative D. discoideum AQPs, WacA, and AqpA, water permeability has not been shown. Further, WacA and AqpA are expressed at the late multicellular stage and in spores but not in amoebae. We cloned a novel AQP, AqpB, from amoeboidal D. discoideum cells. Wild-type AqpB was impermeable to water, glycerol, and urea when expressed in Xenopus laevis oocytes. Neither stepwise truncation of the N terminus nor selected point mutations activated the water channel. However, mutational truncation by 12 amino acids of an extraordinary long intracellular loop induced water permeability of AqpB, hinting at a novel gating mechanism. This AqpB mutant was inhibited by mercuric chloride, confirming the presence of a cysteine residue in the selectivity filter as predicted by our structure model. We detected AqpB by Western blot analysis in a glycosylated and a non-glycosylated form throughout all developmental stages. When expressed in D. discoideum amoebae, AqpB-GFP fusion constructs localized to vacuolar structures, to the plasma membrane, and to lamellipodia-like membrane protrusions. We conclude that the localization pattern in conjunction with channel gating may be indicative of AqpB functions in osmoregulation as well as cell motility of D. discoideum. PMID:22262860

  16. Variation, sex, and social cooperation: molecular population genetics of the social amoeba Dictyostelium discoideum.


    Flowers, Jonathan M; Li, Si I; Stathos, Angela; Saxer, Gerda; Ostrowski, Elizabeth A; Queller, David C; Strassmann, Joan E; Purugganan, Michael D


    Dictyostelium discoideum is a eukaryotic microbial model system for multicellular development, cell-cell signaling, and social behavior. Key models of social evolution require an understanding of genetic relationships between individuals across the genome or possibly at specific genes, but the nature of variation within D. discoideum is largely unknown. We re-sequenced 137 gene fragments in wild North American strains of D. discoideum and examined the levels and patterns of nucleotide variation in this social microbial species. We observe surprisingly low levels of nucleotide variation in D. discoideum across these strains, with a mean nucleotide diversity (pi) of 0.08%, and no strong population stratification among North American strains. We also do not find any clear relationship between nucleotide divergence between strains and levels of social dominance and kin discrimination. Kin discrimination experiments, however, show that strains collected from the same location show greater ability to distinguish self from non-self than do strains from different geographic areas. This suggests that a greater ability to recognize self versus non-self may arise among strains that are more likely to encounter each other in nature, which would lead to preferential formation of fruiting bodies with clonemates and may prevent the evolution of cheating behaviors within D. discoideum populations. Finally, despite the fact that sex has rarely been observed in this species, we document a rapid decay of linkage disequilibrium between SNPs, the presence of recombinant genotypes among natural strains, and high estimates of the population recombination parameter rho. The SNP data indicate that recombination is widespread within D. discoideum and that sex as a form of social interaction is likely to be an important aspect of the life cycle.

  17. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.


    Saito, T; Ochiai, H


    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  18. Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.


    Katayama, Takahiro; Yasukawa, Hiro


    The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

  19. Purification, crystallization and X-ray diffraction analysis of dihydropyrimidinase from Dictyostelium discoideum

    SciTech Connect

    Lohkamp, Bernhard; Andersen, Birgit; Piškur, Jure; Dobritzsch, Doreen


    Dihydropyrimidinase from the slime mould D. discoideum was crystallized. A single crystal was shown to belong to space group I222 and diffracted anisotropically to better than 1.8 Å. Dihydropyrimidinase (EC is the second enzyme in the reductive pyrimidine-degradation pathway and catalyses the hydrolysis of 5,6-dihydrouracil and 5,6-dihydrothymine to the corresponding N-carbamylated β-amino acids. The recombinant enzyme from the slime mould Dictyostelium discoideum was overexpressed, purified and crystallized by the vapour-diffusion method. One crystal diffracted to better than 1.8 Å resolution on a synchrotron source and was shown to belong to space group I222, with unit-cell parameters a = 84.6, b = 89.6, c = 134.9 Å and one molecule in the asymmetric unit.

  20. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.


    Saito, T; Ochiai, H


    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds. PMID:10504413

  1. Functional complementation of yeast phosphofructokinase mutants by the non-allosteric enzyme from Dictyostelium discoideum.


    Estévez, A M; Heinisch, J J; Aragón, J J


    Phosphofructokinase (PFK) from yeast has been replaced by the non-allosteric isozyme from the slime mold Dictyostelium discoideum. This has been achieved by overexpression of the latter in a PFK-deficient strain of Saccharomyces cerevisiae under the control of the PFK2 promoter. Transformants complemented the glucose-negative growth phenotype exhibiting generation times on glucose-containing media similar to those of an untransformed strain being wild-type for yeast PFK genes. The PFK produced reacted with an antibody against D. discoideum PFK. It exhibited the same subunit size, quaternary structure and kinetic parameters than those of the wild-type enzyme, and was also devoid of specific regulatory properties. PMID:7589492

  2. Systematic evaluation of buffer influences on the development of Dictyostelium discoideum.


    Márquez López, Johanna; Sulzmann, Anja; Thewes, Sascha


    Development and cell differentiation are key features of the social amoeba Dictyostelium discoideum. Already at early developmental stages, the gene expression profile changes in the amoebae to make the cells aggregation competent. In the laboratory, development starts when the cells are washed free of nutrients. For this purpose, various non-nutrient buffers are used in different laboratories. However, to date, it is not clear if different buffers have different influences on the development of D. discoideum. Therefore, we investigated systematically the influence of six widely used buffers on the development of D. discoideum. Investigation was done at the phenotypical, biochemical, and molecular level. The results show that some of the investigated buffers show clear differences in the phenotypical outcome of the developmental cycle, at a biochemical level as measured in the response to cAMP, and/or at a molecular level as measured in the expression of early developmental marker genes. According to our results buffer compositions should be considered carefully for all developmental experiments with D. discoideum, especially when gene expression will be investigated. PMID:26791868

  3. Intracellular Replication of Mycobacterium marinum within Dictyostelium discoideum: Efficient Replication in the Absence of Host Coronin

    PubMed Central

    Solomon, Jonathan M.; Leung, Grace S.; Isberg, Ralph R.


    Mycobacterium marinum causes tuberculosis-like disease in fish and amphibians and has been used as a model mycobacterial species because of its rapid growth and less stringent containment requirements relative to other mycobacterial species. We demonstrate here that M. marinum grows within Dictyostelium discoideum cells, allowing the genetic analysis of host factors that may modulate the replication of mycobacterial species. Intracellular growth of M. marinum was shown to mimic the properties previously observed for growth within cultured phagocytes. A defined bacterial mutant defective for growth within phagocytic cells was shown to be similarly defective for growth within D. discoideum. To test the role of host coronin, which was previously hypothesized to positively modulate mycobacterial growth within mouse macrophages, a defined D. discoideum coronin mutant was analyzed. Surprisingly, the absence of coronin resulted in enhanced intracellular replication of M. marinum relative to the control wild-type strain. Consistent with previous observations, some phagosomes showed persistence of coronin about the surface of the compartment, but colocalization of the protein was far from uniform. We conclude that in D. discoideum factors other than coronin support intracellular replication of M. marinum. PMID:12761143

  4. Ribosomal proteins are encoded by single copy genes in Dictyostelium discoideum.


    Steel, L F; Jacobson, A


    Five recombinant plasmids which encode ribosomal proteins (r-proteins) from Dictyostelium discoideum have been isolated. Poly(A) + RNA was size-fractionated by preparative agarose gel electrophoresis and a fraction encoding proteins of less than 35 kDa was used to construct a cDNA library in the plasmid vector pBR322. Individual clones from the library were screened by hybrid-selected translation and those encoding r-proteins were identified by co-migration of the translation products in two-dimensional gel electrophoresis with marker proteins purified from Dictyostelium ribosomes. Initial characterization using the five cDNA plasmids indicates that these r-proteins are encoded by single copy genes and that they are not tightly clustered in the genome.

  5. Secreted Cyclic Di-GMP Induces Stalk Cell Differentiation in the Eukaryote Dictyostelium discoideum

    PubMed Central

    Chen, Zhi-hui


    Cyclic di-GMP (c-di-GMP) is currently recognized as the most widely used intracellular signal molecule in prokaryotes, but roles in eukaryotes were only recently discovered. In the social amoeba Dictyostelium discoideum, c-di-GMP, produced by a prokaryote-type diguanylate cyclase, induces the differentiation of stalk cells, thereby enabling the formation of spore-bearing fruiting bodies. In this review, we summarize the currently known mechanisms that control the major life cycle transitions of Dictyostelium and focus particularly on the role of c-di-GMP in stalk formation. Stalk cell differentiation has characteristics of autophagic cell death, a process that also occurs in higher eukaryotes. We discuss the respective roles of c-di-GMP and of another signal molecule, differentiation-inducing factor 1, in autophagic cell death in vitro and in stalk formation in vivo. PMID:26013485

  6. The Dictyostelium discoideum cellulose synthase: Structure/function analysis and identification of interacting proteins

    SciTech Connect

    Richard L. Blanton


    OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.

  7. Secreted Cyclic Di-GMP Induces Stalk Cell Differentiation in the Eukaryote Dictyostelium discoideum.


    Chen, Zhi-hui; Schaap, Pauline


    Cyclic di-GMP (c-di-GMP) is currently recognized as the most widely used intracellular signal molecule in prokaryotes, but roles in eukaryotes were only recently discovered. In the social amoeba Dictyostelium discoideum, c-di-GMP, produced by a prokaryote-type diguanylate cyclase, induces the differentiation of stalk cells, thereby enabling the formation of spore-bearing fruiting bodies. In this review, we summarize the currently known mechanisms that control the major life cycle transitions of Dictyostelium and focus particularly on the role of c-di-GMP in stalk formation. Stalk cell differentiation has characteristics of autophagic cell death, a process that also occurs in higher eukaryotes. We discuss the respective roles of c-di-GMP and of another signal molecule, differentiation-inducing factor 1, in autophagic cell death in vitro and in stalk formation in vivo. PMID:26013485

  8. Secreted Cyclic Di-GMP Induces Stalk Cell Differentiation in the Eukaryote Dictyostelium discoideum.


    Chen, Zhi-hui; Schaap, Pauline


    Cyclic di-GMP (c-di-GMP) is currently recognized as the most widely used intracellular signal molecule in prokaryotes, but roles in eukaryotes were only recently discovered. In the social amoeba Dictyostelium discoideum, c-di-GMP, produced by a prokaryote-type diguanylate cyclase, induces the differentiation of stalk cells, thereby enabling the formation of spore-bearing fruiting bodies. In this review, we summarize the currently known mechanisms that control the major life cycle transitions of Dictyostelium and focus particularly on the role of c-di-GMP in stalk formation. Stalk cell differentiation has characteristics of autophagic cell death, a process that also occurs in higher eukaryotes. We discuss the respective roles of c-di-GMP and of another signal molecule, differentiation-inducing factor 1, in autophagic cell death in vitro and in stalk formation in vivo.

  9. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.


    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  10. Expression of the human muscarinic receptor gene m2 in Dictyostelium discoideum

    SciTech Connect

    Voith, G.; Dingermann, T.


    We have expressed a functional human muscarinic M2 receptor, under the control of the homologous discoidin I{gamma} promoter, in the cellular slime mold Dictyostelium discoideum. The use of a contact site A leader peptide ensured insertion of the newly synthesized receptor protein into the plasma membrane. Due to the characteristics of the discoidin I{gamma} promoter, the M2 receptor is expressed during late growth and early development. The heterologously expressed M2 receptors show binding characteristics similar to authentic receptors. Membranes as well as whole cells can be used in ligand binding assays. 36 refs., 4 figs.

  11. Cloning, expression and characterization of the ornithine decarboxylase gene from Dictyostelium discoideum.


    Kumar, Rishikesh; Rafia, Sheikh; Saran, Shweta


    Ornithine decarboxylase (ODC) is a rate limiting enzyme in polyamine synthesis that decarboxylates ornithine to form the diamine putrescine. We report here the isolation, expression and characterization of a homolog of ODC from Dictyostelium discoideum. DdODC is conserved and shows sequence and structural homology with that from human. Both ODC transcript and protein are expressed at all stages of development and show high expression in prestalk/stalk cells. It is cytosolic and predominantly perinuclear in localization. Both overexpression of DdODC and putrescine treatment resulted in inhibition of cell proliferation. PMID:25896203

  12. Identification of Pentatricopeptide Repeat Proteins in the Model Organism Dictyostelium discoideum.


    Manna, Sam; Brewster, Jessica; Barth, Christian


    Pentatricopeptide repeat (PPR) proteins are RNA binding proteins with functions in organelle RNA metabolism. They are found in all eukaryotes but have been most extensively studied in plants. We report on the identification of 12 PPR-encoding genes in the genome of the protist Dictyostelium discoideum, with potential homologs in other members of the same lineage and some predicted novel functions for the encoded gene products in protists. For one of the gene products, we show that it localizes to the mitochondria, and we also demonstrate that antisense inhibition of its expression leads to slower growth, a phenotype associated with mitochondrial dysfunction.

  13. Expression of the human muscarinic receptor gene m2 in Dictyostelium discoideum.


    Voith, G; Dingermann, T


    We have expressed a functional human muscarinic M2 receptor, under the control of the homologous discoidin I gamma promoter, in the cellular slime mold Dictyostelium discoideum. The use of a contact site A leader peptide ensured insertion of the newly synthesized receptor protein into the plasma membrane. Due to the characteristics of the discoidin I gamma promoter, the M2 receptor is expressed during late growth and early development. The heterologously expressed M2 receptors show binding characteristics similar to authentic receptors. Membranes as well as whole cells can be used in ligand binding assays. PMID:9636297

  14. Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum

    SciTech Connect

    Blanton, R.L.


    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  15. Functional expression of rat GLUT 1 glucose transporter in Dictyostelium discoideum.

    PubMed Central

    Cohen, N R; Knecht, D A; Lodish, H F


    To facilitate expression of the rat GLUT 1 glucose transporter cDNA in Dictyostelium discoideum, we mutated the 5' end of the coding sequence such that the codons for the first ten amino acids conformed to preferred Dictyostelium codon usage. As determined by Western-blot analysis, a population of Dictyostelium transformed with the mutated cDNA expressed nonglycosylated GLUT 1 protein. Cell lines expressing GLUT 1 transport radiolabelled 2-deoxy-D-glucose at a rate 6-10 times that of cell lines transformed with vector alone. The initial rate of inward transport of 2-deoxy-D-glucose was stimulated several-fold by the presence of unlabelled glucose in the Dictyostelium cytoplasm, exemplifying the trans-activation of GLUT 1 transport characteristic of GLUT 1 present in erythrocyte membranes. The K(m) and Ki values for 2-deoxy-D-glucose, D-glucose, D-mannose and D-galactose were 3.7 mM, 2.6 mM, 11 mM and 30 mM respectively, similar to the values for GLUT 1 expressed in mammalian cells. L-Glucose and L-galactose, which are not transported by GLUT 1, do not inhibit uptake of 2-deoxy-D-glucose in Dictyostelium expressing GLUT 1. Thus, even though GLUT 1 expressed in Dictyostelium is not N-glycosylated, it transports hexoses normally; this is the first example of functional expression of a mammalian transport protein in this lower eukaryote. PMID:8645185

  16. Guanylate cyclase in Dictyostelium discoideum with the topology of mammalian adenylate cyclase.

    PubMed Central

    Roelofs, J; Snippe, H; Kleineidam, R G; Van Haastert, P J


    The core of adenylate and guanylate cyclases is formed by an intramolecular or intermolecular dimer of two cyclase domains arranged in an antiparallel fashion. Metazoan membrane-bound adenylate cyclases are composed of 12 transmembrane spanning regions, and two cyclase domains which function as a heterodimer and are activated by G-proteins. In contrast, membrane-bound guanylate cyclases have only one transmembrane spanning region and one cyclase domain, and are activated by extracellular ligands to form a homodimer. In the cellular slime mould, Dictyostelium discoideum, membrane-bound guanylate cyclase activity is induced after cAMP stimulation; a G-protein-coupled cAMP receptor and G-proteins are essential for this activation. We have cloned a Dictyostelium gene, DdGCA, encoding a protein with 12 transmembrane spanning regions and two cyclase domains. Sequence alignment demonstrates that the two cyclase domains are transposed, relative to these domains in adenylate cyclases. DdGCA expressed in Dictyostelium exhibits high guanylate cyclase activity and no detectable adenylate cyclase activity. Deletion of the gene indicates that DdGCA is not essential for chemotaxis or osmo-regulation. The knock-out strain still exhibits substantial guanylate cyclase activity, demonstrating that Dictyostelium contains at least one other guanylate cyclase. PMID:11237875

  17. Dictyostelium discoideum myosin: Isolation and characterization of cDNAs encoding the essential light chain

    SciTech Connect

    Chisholm, R.L.; Rushforth, A.M.; Pollenz, R.S.; Kuczmarski, E.R.; Tafuri, S.R.


    The authors used an antibody specific for Dictyostelium discoideum myosin to screen a lambdagt11 cDNA expression library to obtain cDNA clones which encode the Dictyostelium essential myosin light chain (EMLC). The amino acid sequence predicted from the sequence of the cDNA clone showed 31.5% identity with the amino acid sequence of the chicken EMLC. Comparisons of the Dictyostelium EMLC, a nonmuscle cell type, with EMLC sequences from similar MLCs of skeletal- and smooth-muscle origin, showed distinct regions of homology. Much of the observed homology was localized to regions corresponding to consensus Ca/sup 2 +/-binding of E-F hand domains. Southern blot analysis suggested that the Dictyostelium genome contains a single gene encoding the EMLC. Examination of the pattern of EMLC mRNA expression showed that a significant increase in EMLC message levels occurred during the first few hours of development, coinciding with increased actin expression and immediately preceding the period of maximal chemotactic activity.

  18. Characterization of the Roco Protein Family in Dictyostelium discoideum ▿ †

    PubMed Central

    van Egmond, Wouter N.; van Haastert, Peter J. M.


    The Roco family consists of multidomain Ras-GTPases that include LRRK2, a protein mutated in familial Parkinson's disease. The genome of the cellular slime mold Dictyostelium discoideum encodes 11 Roco proteins. To study the functions of these proteins, we systematically knocked out the roco genes. Previously described functions for GbpC, Pats1, and QkgA (Roco1 to Roco3) were confirmed, while novel developmental defects were identified in roco4- and roco11-null cells. Cells lacking Roco11 form larger fruiting bodies than wild-type cells, while roco4-null cells show strong developmental defects during the transition from mound to fruiting body; prestalk cells produce reduced levels of cellulose, leading to unstable stalks that are unable to properly lift the spore head. Detailed phylogenetic analysis of four slime mold species reveals that QkgA and Roco11 evolved relatively late by duplication of an ancestor roco4 gene (later than ∼300 million years ago), contrary to the situation with other roco genes, which were already present before the split of the common ancestor of D. discoideum and Polysphondylium pallidum (before ∼600 million years ago). Together, our data show that the Dictyostelium Roco proteins serve a surprisingly diverse set of functions and highlight Roco4 as a key protein for proper stalk cell formation. PMID:20348387

  19. Expression of the rat muscarinic receptor gene m3 in Dictyostelium discoideum.


    Voith, G; Kramm, H; Zündorf, I; Winkler, T; Dingermann, T


    We functionally expressed the rat muscarinic m3 receptor (rm3) in the cellular slime mold Dictyostelium discoideum under the control of the homologous discoidin I gamma promoter. Cells transfected with the authentic rm3 receptor gene expressed about 100 functional receptor molecules per cell, corresponding to a Bmax for [3H]-NMS of 36 +/- 9 fmol/mg of protein in isolated membranes. Genetic fusion of the Dictyostelium contact site A (csA) leader peptide to the amino terminus of rm3 increased the receptor expression by about 17-fold. Remarkable, in [3H]-NMS ligand binding experiments performed with whole cells no characteristic saturable binding was observed and there was no significant difference in [3H]-NMS binding to whole cells of rm3 and csA/rm3 transformants. The recombinant rm3 receptor showed an about 10-fold higher affinity to the M3-selective antagonist p-F-HHSiD compared to the M2-selective antagonist AQ-RA 741, suggesting that membranes derived from transgenic D. discoideum cells may be useful for the search of new subtype-specific muscarinic receptor ligands. PMID:9812338

  20. Deficiency of huntingtin has pleiotropic effects in the social amoeba Dictyostelium discoideum.


    Myre, Michael A; Lumsden, Amanda L; Thompson, Morgan N; Wasco, Wilma; MacDonald, Marcy E; Gusella, James F


    Huntingtin is a large HEAT repeat protein first identified in humans, where a polyglutamine tract expansion near the amino terminus causes a gain-of-function mechanism that leads to selective neuronal loss in Huntington's disease (HD). Genetic evidence in humans and knock-in mouse models suggests that this gain-of-function involves an increase or deregulation of some aspect of huntingtin's normal function(s), which remains poorly understood. As huntingtin shows evolutionary conservation, a powerful approach to discovering its normal biochemical role(s) is to study the effects caused by its deficiency in a model organism with a short life-cycle that comprises both cellular and multicellular developmental stages. To facilitate studies aimed at detailed knowledge of huntingtin's normal function(s), we generated a null mutant of hd, the HD ortholog in Dictyostelium discoideum. Dictyostelium cells lacking endogenous huntingtin were viable but during development did not exhibit the typical polarized morphology of Dictyostelium cells, streamed poorly to form aggregates by accretion rather than chemotaxis, showed disorganized F-actin staining, exhibited extreme sensitivity to hypoosmotic stress, and failed to form EDTA-resistant cell-cell contacts. Surprisingly, chemotactic streaming could be rescued in the presence of the bivalent cations Ca(2+) or Mg(2+) but not pulses of cAMP. Although hd(-) cells completed development, it was delayed and proceeded asynchronously, producing small fruiting bodies with round, defective spores that germinated spontaneously within a glassy sorus. When developed as chimeras with wild-type cells, hd(-) cells failed to populate the pre-spore region of the slug. In Dictyostelium, huntingtin deficiency is compatible with survival of the organism but renders cells sensitive to low osmolarity, which produces pleiotropic cell autonomous defects that affect cAMP signaling and as a consequence development. Thus, Dictyostelium provides a novel haploid

  1. Deficiency of Huntingtin Has Pleiotropic Effects in the Social Amoeba Dictyostelium discoideum

    PubMed Central

    Myre, Michael A.; Lumsden, Amanda L.; Thompson, Morgan N.; Wasco, Wilma; MacDonald, Marcy E.; Gusella, James F.


    Huntingtin is a large HEAT repeat protein first identified in humans, where a polyglutamine tract expansion near the amino terminus causes a gain-of-function mechanism that leads to selective neuronal loss in Huntington's disease (HD). Genetic evidence in humans and knock-in mouse models suggests that this gain-of-function involves an increase or deregulation of some aspect of huntingtin's normal function(s), which remains poorly understood. As huntingtin shows evolutionary conservation, a powerful approach to discovering its normal biochemical role(s) is to study the effects caused by its deficiency in a model organism with a short life-cycle that comprises both cellular and multicellular developmental stages. To facilitate studies aimed at detailed knowledge of huntingtin's normal function(s), we generated a null mutant of hd, the HD ortholog in Dictyostelium discoideum. Dictyostelium cells lacking endogenous huntingtin were viable but during development did not exhibit the typical polarized morphology of Dictyostelium cells, streamed poorly to form aggregates by accretion rather than chemotaxis, showed disorganized F-actin staining, exhibited extreme sensitivity to hypoosmotic stress, and failed to form EDTA-resistant cell–cell contacts. Surprisingly, chemotactic streaming could be rescued in the presence of the bivalent cations Ca2+ or Mg2+ but not pulses of cAMP. Although hd− cells completed development, it was delayed and proceeded asynchronously, producing small fruiting bodies with round, defective spores that germinated spontaneously within a glassy sorus. When developed as chimeras with wild-type cells, hd− cells failed to populate the pre-spore region of the slug. In Dictyostelium, huntingtin deficiency is compatible with survival of the organism but renders cells sensitive to low osmolarity, which produces pleiotropic cell autonomous defects that affect cAMP signaling and as a consequence development. Thus, Dictyostelium provides a novel haploid

  2. Lipid composition of multilamellar bodies secreted by Dictyostelium discoideum reveals their amoebal origin.


    Paquet, Valérie E; Lessire, René; Domergue, Frédéric; Fouillen, Laetitia; Filion, Geneviève; Sedighi, Ahmadreza; Charette, Steve J


    When they are fed with bacteria, Dictyostelium discoideum amoebae produce and secrete multilamellar bodies (MLBs), which are composed of membranous material. It has been proposed that MLBs are a waste disposal system that allows D. discoideum to eliminate undigested bacterial remains. However, the real function of MLBs remains unknown. Determination of the biochemical composition of MLBs, especially lipids, represents a way to gain information about the role of these structures. To allow these analyses, a protocol involving various centrifugation procedures has been developed to purify secreted MLBs from amoeba-bacterium cocultures. The purity of the MLB preparation was confirmed by transmission electron microscopy and by immunofluorescence using H36, an antibody that binds to MLBs. The lipid and fatty acid compositions of pure MLBs were then analyzed by high-performance thin-layer chromatography (HPTLC) and gas chromatography (GC), respectively, and compared to those of amoebae as well as bacteria used as a food source. While the bacteria were devoid of phosphatidylcholine (PC) and phosphatidylinositol (PI), these two polar lipid species were major classes of lipids in MLBs and amoebae. Similarly, the fatty acid composition of MLBs and amoebae was characterized by the presence of polyunsaturated fatty acids, while cyclic fatty acids were found only in bacteria. These results strongly suggest that the lipids constituting the MLBs originate from the amoebal metabolism rather than from undigested bacterial membranes. This opens the possibility that MLBs, instead of being a waste disposal system, have unsuspected roles in D. discoideum physiology.

  3. Lipid Composition of Multilamellar Bodies Secreted by Dictyostelium discoideum Reveals Their Amoebal Origin

    PubMed Central

    Paquet, Valérie E.; Lessire, René; Domergue, Frédéric; Fouillen, Laetitia; Filion, Geneviève; Sedighi, Ahmadreza


    When they are fed with bacteria, Dictyostelium discoideum amoebae produce and secrete multilamellar bodies (MLBs), which are composed of membranous material. It has been proposed that MLBs are a waste disposal system that allows D. discoideum to eliminate undigested bacterial remains. However, the real function of MLBs remains unknown. Determination of the biochemical composition of MLBs, especially lipids, represents a way to gain information about the role of these structures. To allow these analyses, a protocol involving various centrifugation procedures has been developed to purify secreted MLBs from amoeba-bacterium cocultures. The purity of the MLB preparation was confirmed by transmission electron microscopy and by immunofluorescence using H36, an antibody that binds to MLBs. The lipid and fatty acid compositions of pure MLBs were then analyzed by high-performance thin-layer chromatography (HPTLC) and gas chromatography (GC), respectively, and compared to those of amoebae as well as bacteria used as a food source. While the bacteria were devoid of phosphatidylcholine (PC) and phosphatidylinositol (PI), these two polar lipid species were major classes of lipids in MLBs and amoebae. Similarly, the fatty acid composition of MLBs and amoebae was characterized by the presence of polyunsaturated fatty acids, while cyclic fatty acids were found only in bacteria. These results strongly suggest that the lipids constituting the MLBs originate from the amoebal metabolism rather than from undigested bacterial membranes. This opens the possibility that MLBs, instead of being a waste disposal system, have unsuspected roles in D. discoideum physiology. PMID:23748431

  4. Actin on disease--studying the pathobiology of cell motility using Dictyostelium discoideum.


    Carnell, Michael J; Insall, Robert H


    The actin cytoskeleton in eukaryotic cells provides cell structure and organisation, and allows cells to generate forces against membranes. As such it is a central component of a variety of cellular structures involved in cell motility, cytokinesis and vesicle trafficking. In multicellular organisms these processes contribute towards embryonic development and effective functioning of cells of all types, most obviously rapidly moving cells like lymphocytes. Actin also defines and maintains the architecture of complex structures such as neuronal synapses and stereocillia, and is required for basic housekeeping tasks within the cell. It is therefore not surprising that misregulation of the actin cytoskeleton can cause a variety of disease pathologies, including compromised immunity, neurodegeneration, and cancer spread. Dictyostelium discoideum has long been used as a tool for dissecting the mechanisms by which eukaryotic cells migrate and chemotax, and recently it has gained precedence as a model organism for studying the roles of conserved pathways in disease processes. Dictyostelium's unusual lifestyle, positioned between unicellular and multicellular organisms, combined with ease of handling and strong conservation of actin regulatory machinery with higher animals, make it ideally suited for studying actin-related diseases. Here we address how research in Dictyostelium has contributed to our understanding of immune deficiencies and neurological defects in humans, and briefly discuss its future prospects for furthering our understanding of neurodegenerative disorders.

  5. The Social Amoeba Dictyostelium discoideum Is Highly Resistant to Polyglutamine Aggregation.


    Santarriaga, Stephanie; Petersen, Amber; Ndukwe, Kelechi; Brandt, Anthony; Gerges, Nashaat; Bruns Scaglione, Jamie; Scaglione, Kenneth Matthew


    The expression, misfolding, and aggregation of long repetitive amino acid tracts are a major contributing factor in a number of neurodegenerative diseases, including C9ORF72 amyotrophic lateral sclerosis/frontotemporal dementia, fragile X tremor ataxia syndrome, myotonic dystrophy type 1, spinocerebellar ataxia type 8, and the nine polyglutamine diseases. Protein aggregation is a hallmark of each of these diseases. In model organisms, including yeast, worms, flies, mice, rats, and human cells, expression of proteins with the long repetitive amino acid tracts associated with these diseases recapitulates the protein aggregation that occurs in human disease. Here we show that the model organism Dictyostelium discoideum has evolved to normally encode long polyglutamine tracts and express these proteins in a soluble form. We also show that Dictyostelium has the capacity to suppress aggregation of a polyglutamine-expanded Huntingtin construct that aggregates in other model organisms tested. Together, these data identify Dictyostelium as a novel model organism with the capacity to suppress aggregation of proteins with long polyglutamine tracts.

  6. A non-mitotic CENP-E homolog in Dictyostelium discoideum with slow motor activity.


    Kösem, Süleyman; Ökten, Zeynep; Ho, Thi-Hieu; Trommler, Gudrun; Koonce, Michael P; Samereier, Matthias; Müller-Taubenberger, Annette


    Kinesins are ATP-dependent molecular motors that mediate unidirectional intracellular transport along microtubules. Dictyostelium discoideum has 13 different kinesin isoforms including two members of the kinesin-7 family, Kif4 and Kif11. While Kif4 is structurally and functionally related to centromere-associated CENP-E proteins involved in the transport of chromosomes to the poles during mitosis, the function of the unusually short CENP-E variant Kif11 is unclear. Here we show that orthologs of short CENP-E variants are present in plants and fungi, and analyze functional properties of the Dictyostelium CENP-E version, Kif11. Gene knockout mutants reveal that Kif11 is not required for mitosis or development. Imaging of GFP-labeled Kif11 expressing Dictyostelium cells indicates that Kif11 is a plus-end directed motor that accumulates at microtubule plus ends. By multiple motor gliding assays, we show that Kif11 moves with an average velocity of 38nm/s, thus defining Kif11 as a very slow motor. The activity of the Kif11 motor appears to be modulated via interactions with the non-catalytic tail region. Our work highlights a subclass of kinesin-7-like motors that function outside of a role in mitosis.

  7. Mitochondrial tRNA 5'-editing in Dictyostelium discoideum and Polysphondylium pallidum.


    Abad, Maria G; Long, Yicheng; Kinchen, R Dimitri; Schindel, Elinor T; Gray, Michael W; Jackman, Jane E


    Mitochondrial tRNA (mt-tRNA) 5'-editing was first described more than 20 years ago; however, the first candidates for 5'-editing enzymes were only recently identified in a eukaryotic microbe (protist), the slime mold Dictyostelium discoideum. In this organism, eight of 18 mt-tRNAs are predicted to be edited based on the presence of genomically encoded mismatched nucleotides in their aminoacyl-acceptor stem sequences. Here, we demonstrate that mt-tRNA 5'-editing occurs at all predicted sites in D. discoideum as evidenced by changes in the sequences of isolated mt-tRNAs compared with the expected sequences encoded by the mitochondrial genome. We also identify two previously unpredicted editing events in which G-U base pairs are edited in the absence of any other genomically encoded mismatches. A comparison of 5'-editing in D. discoideum with 5'-editing in another slime mold, Polysphondylium pallidum, suggests organism-specific idiosyncrasies in the treatment of U-G/G-U pairs. In vitro activities of putative D. discoideum editing enzymes are consistent with the observed editing reactions and suggest an overall lack of tRNA substrate specificity exhibited by the repair component of the editing enzyme. Although the presence of terminal mismatches in mt-tRNA sequences is highly predictive of the occurrence of mt-tRNA 5'-editing, the variability in treatment of U-G/G-U base pairs observed here indicates that direct experimental evidence of 5'-editing must be obtained to understand the complete spectrum of mt-tRNA editing events in any species. PMID:24737330

  8. Mitochondrial tRNA 5′-Editing in Dictyostelium discoideum and Polysphondylium pallidum*

    PubMed Central

    Abad, Maria G.; Long, Yicheng; Kinchen, R. Dimitri; Schindel, Elinor T.; Gray, Michael W.; Jackman, Jane E.


    Mitochondrial tRNA (mt-tRNA) 5′-editing was first described more than 20 years ago; however, the first candidates for 5′-editing enzymes were only recently identified in a eukaryotic microbe (protist), the slime mold Dictyostelium discoideum. In this organism, eight of 18 mt-tRNAs are predicted to be edited based on the presence of genomically encoded mismatched nucleotides in their aminoacyl-acceptor stem sequences. Here, we demonstrate that mt-tRNA 5′-editing occurs at all predicted sites in D. discoideum as evidenced by changes in the sequences of isolated mt-tRNAs compared with the expected sequences encoded by the mitochondrial genome. We also identify two previously unpredicted editing events in which G-U base pairs are edited in the absence of any other genomically encoded mismatches. A comparison of 5′-editing in D. discoideum with 5′-editing in another slime mold, Polysphondylium pallidum, suggests organism-specific idiosyncrasies in the treatment of U-G/G-U pairs. In vitro activities of putative D. discoideum editing enzymes are consistent with the observed editing reactions and suggest an overall lack of tRNA substrate specificity exhibited by the repair component of the editing enzyme. Although the presence of terminal mismatches in mt-tRNA sequences is highly predictive of the occurrence of mt-tRNA 5′-editing, the variability in treatment of U-G/G-U base pairs observed here indicates that direct experimental evidence of 5′-editing must be obtained to understand the complete spectrum of mt-tRNA editing events in any species. PMID:24737330

  9. NaCS-PDMDAAC immobilized cultivation of recombinant Dictyostelium discoideum for soluble human Fas ligand production.


    Zheng, Chao; Zeng, Xianhai; Danquah, Michael K; Lu, Yinghua


    Dictyostelium discoideum is a promising eukaryotic host for the expression of heterologous proteins requiring post-translational modifications. However, the dilute nature of D. discoideum cell culture limits applications for high value proteins production. D. discoideum cells, entrapped in sodium cellulose sulfate/poly-dimethyl-diallyl-ammonium chloride (NaCS-PDMDAAC) capsules were used for biosynthesis of the heterologous protein, soluble human Fas ligand (hFasL). Semi-continuous cultivations with capsules recycling were carried out in shake flasks. Also, a scaled-up cultivation of immobilized D. discoideum for hFasL production in a customized vitreous airlift bioreactor was conducted. The results show that NaCS-PDMDAAC capsules have desirable biophysical properties including biocompatibility with the D. discoideum cells and good mechanical stability throughout the duration of cultivation. A maximum cell density of 2.02 × 10(7) cells mL(-1) (equivalent to a maximum cell density of 2.22 × 10(8) cells mL(-1) in capsules) and a hFasL concentration of 130.40 μg L(-1) (equivalent to a hFasL concentration of 1434.40 μg L(-1) in capsules) were obtained in shake flask cultivation with capsules recycling. Also, a maximum cell density of 1.72 × 10(7) cells mL(-1) (equivalent to a maximum cell density of 1.89 × 10(8) cells mL(-1) in capsules) and a hFasL concentration of 106.10 μg L(-1) (equivalent to a hFasL concentration of 1167.10 μg L(-1) in capsules) were obtained after ∼170 h cultivation in the airlift bioreactor (with a working volume of 200 mL in a 315 mL bioreactor). As the article presents a premier work in the application of NaCS-PDMDAAC immobilized D. discoideum cells for the production of hFasL, more work is required to further optimize the system to generate higher cell densities and hFasL titers for large-scale applications. PMID:25504805

  10. The orientation of nucleus, nucleus-associated body and protruding nucleolus in aggregating Dictyostelium discoideum.


    Sameshima, M


    Dictyostelium discoideum growing or developing on cellulose dialysis membranes were fixed with acrolein vapour for electron microscopy. In interphase amoebae, nucleoli began to protrude from the nuclei. The percentage of cells with protruding nucleoli increased during aggregation by a value approximately twice as high in aggregation streams as in centers. Cells in pseudoplasmodia showed only a low percentage and protrusions disappeared at early culmination stage. The protrusions did not reappear when cells from dissociated pseudoplasmodia migrated toward cAMP. Thus the formation of the protrusions did not depend solely on chemotaxis; rather, it was specific to the aggregation stage. In aggregation streams, the nucleus was anterior in the cell, with the protrusion at its anterior periphery. In contrast, the nucleus associated body (NAB) was evident at the cell's mid-point. This orientation of nucleus and NAB in the aggregating slime mould amoeba is contrary to that seen in human neutrophils or cultured mouse 3T3 cells. PMID:2981691

  11. Mitochondrial Stress Tests Using Seahorse Respirometry on Intact Dictyostelium discoideum Cells.


    Lay, Sui; Sanislav, Oana; Annesley, Sarah J; Fisher, Paul R


    Mitochondria not only play a critical and central role in providing metabolic energy to the cell but are also integral to the other cellular processes such as modulation of various signaling pathways. These pathways affect many aspects of cell physiology, including cell movement, growth, division, differentiation, and death. Mitochondrial dysfunction which affects mitochondrial bioenergetics and causes oxidative phosphorylation defects can thus lead to altered cellular physiology and manifest in disease. The assessment of the mitochondrial bioenergetics can thus provide valuable insights into the physiological state, and the alterations to the state of the cells. Here, we describe a method to successfully use the Seahorse XF(e)24 Extracellular Flux Analyzer to assess the mitochondrial respirometry of the cellular slime mold Dictyostelium discoideum.

  12. Structured growth and genetic drift raise relatedness in the social amoeba Dictyostelium discoideum.


    Buttery, Neil J; Jack, Chandra N; Adu-Oppong, Boahemaa; Snyder, Kate T; Thompson, Christopher R L; Queller, David C; Strassmann, Joan E


    One condition for the evolution of altruism is genetic relatedness between altruist and beneficiary, often achieved through active kin recognition. Here, we investigate the power of a passive process resulting from genetic drift during population growth in the social amoeba Dictyostelium discoideum. We put labelled and unlabelled cells of the same clone in the centre of a plate, and allowed them to proliferate outward. Zones formed by genetic drift owing to the small population of actively growing cells at the colony edge. We also found that single cells could form zones of high relatedness. Relatedness increased at a significantly higher rate when food was in short supply. This study shows that relatedness can be significantly elevated before the social stage without a small founding population size or recognition mechanism.

  13. Cloning and characterization of the Dictyostelium discoideum cycloartenol synthase cDNA.


    Godzina, S M; Lovato, M A; Meyer, M M; Foster, K A; Wilson, W K; Gu, W; de Hostos, E L; Matsuda, S P


    Cycloartenol synthase converts oxidosqualene to cycloartenol, the first carbocyclic intermediate en route to sterols in plants and many protists. Presented here is the first cycloartenol synthase gene identified from a protist, the cellular slime mold Dictyostelium discoideum. The cDNA encodes an 81-kDa predicted protein 50-52% identical to known higher plant cycloartenol synthases and 40-49% identical to known lanosterol synthases from fungi and mammals. The encoded protein expressed in transgenic Saccharomyces cerevisiae converted synthetic oxidosqualene to cycloartenol in vitro. This product was characterized by 1H and 13C nuclear magnetic resonance and gas chromatography-mass spectrometry. The predicted protein sequence diverges sufficiently from the known cycloartenol synthase sequences to dramatically reduce the number of residues that are candidates for the catalytic difference between cycloartenol and lanosterol formation.

  14. Mitochondrial Stress Tests Using Seahorse Respirometry on Intact Dictyostelium discoideum Cells.


    Lay, Sui; Sanislav, Oana; Annesley, Sarah J; Fisher, Paul R


    Mitochondria not only play a critical and central role in providing metabolic energy to the cell but are also integral to the other cellular processes such as modulation of various signaling pathways. These pathways affect many aspects of cell physiology, including cell movement, growth, division, differentiation, and death. Mitochondrial dysfunction which affects mitochondrial bioenergetics and causes oxidative phosphorylation defects can thus lead to altered cellular physiology and manifest in disease. The assessment of the mitochondrial bioenergetics can thus provide valuable insights into the physiological state, and the alterations to the state of the cells. Here, we describe a method to successfully use the Seahorse XF(e)24 Extracellular Flux Analyzer to assess the mitochondrial respirometry of the cellular slime mold Dictyostelium discoideum. PMID:27271893

  15. Myb-binding site regulates the expression of glucosamine-6-phosphate isomerase in Dictyostelium discoideum.


    Tabata, K; Matsuda, Y; Viller, E; Masamune, Y; Katayama, T; Yasukawa, H


    A homolog of the glucosamine-6-phosphate isomerase in the cellular slime mold Dictyostelium discoideum has been analyzed. The gene disruption mutant was arrested at the mound stage, demonstrating that the gene is important for development. The gene was expressed in vegetatively growing cells, silenced on starvation and expressed again in prestalk cells during the multicellular stages. The upstream region of the gene (1376 bp relative to ATG) was cloned and sequenced to study the transcription control mechanisms. Analysis of deletion mutants and a site-directed mutant indicated that the Myb-binding sequence (5'-AACTG-3') localized in the upstream region is important for gene expression. The results of gel-shift assays showed the presence of an Myb-related protein binding to the sequence at the growing phase and another protein binding to the sequence at developmental stages. PMID:11576175

  16. The possible role of ammonia in phototaxis of migrating slugs of Dictyostelium discoideum

    PubMed Central

    Bonner, J. T.; Chiang, A.; Lee, J.; Suthers, H. B.


    Previously we showed that the rising cell masses of cellular slime molds orient away from high concentrations of ammonia gas, presumably by speeding up the cells on one side. Here we show that in the same way NH3 could also be involved in the highly sensitive phototaxis found in the migrating slugs of Dictyostelium discoideum. We have evidence that light increases their speed of migration and their production of NH3. Since unilateral light is concentrated on the distal side of a cell mass by the “lens effect,” this leads to the obvious hypothesis that the light stimulates the local production of NH3, which, in turn, stimulates the cells in the illuminated region to move faster. PMID:16593935

  17. The Dictyostelium discoideum RACK1 orthologue has roles in growth and development

    PubMed Central


    Background The receptor for activated C-kinase 1 (RACK1) is a conserved protein belonging to the WD40 repeat family of proteins. It folds into a beta propeller with seven blades which allow interactions with many proteins. Thus it can serve as a scaffolding protein and have roles in several cellular processes. Results We identified the product of the Dictyostelium discoideum gpbB gene as the Dictyostelium RACK1 homolog. The protein is mainly cytosolic but can also associate with cellular membranes. DdRACK1 binds to phosphoinositides (PIPs) in protein-lipid overlay and liposome-binding assays. The basis of this activity resides in a basic region located in the extended loop between blades 6 and 7 as revealed by mutational analysis. Similar to RACK1 proteins from other organisms DdRACK1 interacts with G protein subunits alpha, beta and gamma as shown by yeast two-hybrid, pulldown, and immunoprecipitation assays. Unlike the Saccharomyces cerevisiae and Cryptococcus neoformans RACK1 proteins it does not appear to take over Gβ function in D. discoideum as developmental and other defects were not rescued in Gβ null mutants overexpressing GFP-DdRACK1. Overexpression of GFP-tagged DdRACK1 and a mutant version (DdRACK1mut) which carried a charge-reversal mutation in the basic region in wild type cells led to changes during growth and development. Conclusion DdRACK1 interacts with heterotrimeric G proteins and can through these interactions impact on processes specifically regulated by these proteins. PMID:24930026

  18. Sentinel cells, symbiotic bacteria and toxin resistance in the social amoeba Dictyostelium discoideum.


    Brock, Debra A; Callison, W Éamon; Strassmann, Joan E; Queller, David C


    The social amoeba Dictyostelium discoideum is unusual among eukaryotes in having both unicellular and multicellular stages. In the multicellular stage, some cells, called sentinels, ingest toxins, waste and bacteria. The sentinel cells ultimately fall away from the back of the migrating slug, thus removing these substances from the slug. However, some D. discoideum clones (called farmers) carry commensal bacteria through the multicellular stage, while others (called non-farmers) do not. Farmers profit from their beneficial bacteria. To prevent the loss of these bacteria, we hypothesize that sentinel cell numbers may be reduced in farmers, and thus farmers may have a diminished capacity to respond to pathogenic bacteria or toxins. In support, we found that farmers have fewer sentinel cells compared with non-farmers. However, farmers produced no fewer viable spores when challenged with a toxin. These results are consistent with the beneficial bacteria Burkholderia providing protection against toxins. The farmers did not vary in spore production with and without a toxin challenge the way the non-farmers did, which suggests the costs of Burkholderia may be fixed while sentinel cells may be inducible. Therefore, the costs for non-farmers are only paid in the presence of the toxin. When the farmers were cured of their symbiotic bacteria with antibiotics, they behaved just like non-farmers in response to a toxin challenge. Thus, the advantages farmers gain from carrying bacteria include not just food and protection against competitors, but also protection against toxins.

  19. Sentinel cells, symbiotic bacteria and toxin resistance in the social amoeba Dictyostelium discoideum.


    Brock, Debra A; Callison, W Éamon; Strassmann, Joan E; Queller, David C


    The social amoeba Dictyostelium discoideum is unusual among eukaryotes in having both unicellular and multicellular stages. In the multicellular stage, some cells, called sentinels, ingest toxins, waste and bacteria. The sentinel cells ultimately fall away from the back of the migrating slug, thus removing these substances from the slug. However, some D. discoideum clones (called farmers) carry commensal bacteria through the multicellular stage, while others (called non-farmers) do not. Farmers profit from their beneficial bacteria. To prevent the loss of these bacteria, we hypothesize that sentinel cell numbers may be reduced in farmers, and thus farmers may have a diminished capacity to respond to pathogenic bacteria or toxins. In support, we found that farmers have fewer sentinel cells compared with non-farmers. However, farmers produced no fewer viable spores when challenged with a toxin. These results are consistent with the beneficial bacteria Burkholderia providing protection against toxins. The farmers did not vary in spore production with and without a toxin challenge the way the non-farmers did, which suggests the costs of Burkholderia may be fixed while sentinel cells may be inducible. Therefore, the costs for non-farmers are only paid in the presence of the toxin. When the farmers were cured of their symbiotic bacteria with antibiotics, they behaved just like non-farmers in response to a toxin challenge. Thus, the advantages farmers gain from carrying bacteria include not just food and protection against competitors, but also protection against toxins. PMID:27097923

  20. The Dictyostelium discoideum GPHR Ortholog Is an Endoplasmic Reticulum and Golgi Protein with Roles during Development

    PubMed Central

    Deckstein, Jaqueline; van Appeldorn, Jennifer; Tsangarides, Marios; Yiannakou, Kyriacos; Müller, Rolf; Stumpf, Maria; Sukumaran, Salil K.; Eichinger, Ludwig


    Dictyostelium discoideum GPHR (Golgi pH regulator)/Gpr89 is a developmentally regulated transmembrane protein present on the endoplasmic reticulum (ER) and the Golgi apparatus. Transcript levels are low during growth and vary during development, reaching high levels during the aggregation and late developmental stages. The Arabidopsis ortholog was described as a G protein-coupled receptor (GPCR) for abscisic acid present at the plasma membrane, whereas the mammalian ortholog is a Golgi apparatus-associated anion channel functioning as a Golgi apparatus pH regulator. To probe its role in D. discoideum, we generated a strain lacking GPHR. The mutant had different growth characteristics than the AX2 parent strain, exhibited changes during late development, and formed abnormally shaped small slugs and fruiting bodies. An analysis of development-specific markers revealed that their expression was disturbed. The distributions of the endoplasmic reticulum and the Golgi apparatus were unaltered at the immunofluorescence level. Likewise, their functions did not appear to be impaired, since membrane proteins were properly processed and glycosylated. Also, changes in the external pH were sensed by the ER, as indicated by a pH-sensitive ER probe, as in the wild type. PMID:25380752

  1. Fruiting bodies of the social amoeba Dictyostelium discoideum increase spore transport by Drosophila

    PubMed Central


    Background Many microbial phenotypes are the product of cooperative interactions among cells, but their putative fitness benefits are often not well understood. In the cellular slime mold Dictyostelium discoideum, unicellular amoebae aggregate when starved and form multicellular fruiting bodies in which stress-resistant spores are held aloft by dead stalk cells. Fruiting bodies are thought to be adaptations for dispersing spores to new feeding sites, but this has not been directly tested. Here we experimentally test whether fruiting bodies increase the rate at which spores are acquired by passing invertebrates. Results Drosophila melanogaster accumulate spores on their surfaces more quickly when exposed to intact fruiting bodies than when exposed to fruiting bodies physically disrupted to dislodge spore masses from stalks. Flies also ingest and excrete spores that still express a red fluorescent protein marker. Conclusions Multicellular fruiting bodies created by D. discoideum increase the likelihood that invertebrates acquire spores that can then be transported to new feeding sites. These results thus support the long-hypothesized dispersal benefits of altruism in a model system for microbial cooperation. PMID:24884856

  2. Rapid antagonistic coevolution between strains of the social amoeba Dictyostelium discoideum.


    Hollis, Brian


    Social groups face a fundamental problem of overcoming selfish individuals capable of destroying cooperation. In the social amoeba Dictyostelium discoideum, there is evidence that some clones ('cheaters') contribute disproportionately to the viable spores in a fruiting body while avoiding the dead stalk cell fate. It remains unclear, however, whether this cheating is actually the product of selection. Here, I report the results of an experimental evolution study designed to test whether clones of D. discoideum will evolve resistance to cheating in the laboratory with genetic variation created only through spontaneous mutation. Two strains, one green fluorescent protein (GFP)-labelled and one wild-type, were allowed to grow and develop together before the wild-type strain was removed and replaced with a naïve strain evolving in parallel. Over the course of 10 social generations, the GFP-labelled strain reliably increased its representation in the spores relative to control populations that had never experienced the competitor. This competitive advantage extended to the non-social, vegetative growth portion of the life cycle, but not to pairwise competition with two other strains. These results indicate strong antagonism between strains, mediated by ample mutational variation for cheating and also suggest that arms races between strains in the wild may be common. PMID:22719037

  3. Regulation by guanosine 3':5'-cyclic monophosphate of phospholipid methylation during chemotaxis in Dictyostelium discoideum.

    PubMed Central

    Alemany, S; García Gil, M; Mato, J M


    In Dictyostelium discoideum, the chemoattractant cyclic AMP activates the enzyme guanylate cyclase, giving a brief up to 10-fold increase in the intracellular cyclic GMP content. The addition of physiological cyclic GMP concentrations to a homogenate of D. discoideum cells markedly increased the incorporation of the 3H-labeled methyl group from S-adenosyl-L-[methyl-3H]methionine into mono- and dimethylated phosphatidylethanolamine and phosphatidylcholine. Lipid methylation was inhibited by S-adenosyl-L-homocysteine, which inhibits transmethylation. When whole cells prelabeled with L-[methyl-3H]methionine were exposed to cyclic AMP, a rapid transient increase in the amount of [methyl-3H]phosphatidylcholine was observed. The time course of [methyl-3H]phosphatidylcholine formation agrees with its being mediated by the intracellular increase in cyclic GMP originating during chemotactic stimulation. Addition of the 8-Br derivative of cyclic GMP to whole cells also increased the levels of labeled phosphatidylcholine. It is therefore likely that cyclic GMP contributes to chemotaxis by regulating membrane function via phospholipid methylation. PMID:6261233

  4. Covalent modifications of ribosomal proteins in growing and aggregation-competent dictyostelium discoideum: phosphorylation and methylation.


    Ramagopal, S


    Phosphorylated and methylated ribosomal proteins were identified in vegetatively growing amoebae and in the starvation-induced, aggregation-competent cells of Dictyostelium discoideum. Of the 15 developmentally regulated cell-specific ribosomal proteins reported earlier, protein A and the acidic proteins A1, A2, and A3 were identified as phosphoproteins, and S5, S6, S10, and D were identified as methylated proteins. Three other ribosomal proteins were phosphorylated and 19 others methylated. S19, L13, A1, A2, and A3 were the predominant phosphoproteins in growing amoebae, whereas S20 and A were the predominant ones in the aggregation-competent cells. Among the methylated proteins, eight (S6, S10, S13, S30, D, L1, L2, and L31) were modified only during growth phase, six (S5, S7, S8, S24, S31, and L36) were altered only during aggregation-competent phase, and nine (S9, S27, S28, S29, S34, L7, L35, L41, and L42) were modified under both phases. Five proteins (S6, S24, L7, L41, and L42) were heavily methylated and of these, the large subunit proteins were present in both growing amoebae and aggregation-competent cells. These findings demonstrate that covalent modification of specific ribosomal proteins is regulated during cell differentiation in D. discoideum.

  5. Effects of a 50 Hz magnetic field on Dictyostelium discoideum (Protista).


    Amaroli, Andrea; Trielli, Francesca; Bianco, Bruno; Giordano, Stefano; Moggia, Elsa; Corrado, Maria Umberta Delmonte


    Some studies have demonstrated that a few biological systems are affected by weak, extremely low frequency (ELF) electromagnetic fields (EMFs), lower than 10 mT. However, to date there is scanty evidence of this effect on Protists in the literature. Due to their peculiarity as single-cell eukaryotic organisms, Protists respond directly to environmental stimuli, thus appearing as very suitable experimental systems. Recently, we showed the presence of propionylcholinesterase (PrChE) activity in single-cell amoebae of Dictyostelium discoideum. This enzyme activity was assumed to be involved in cell-cell and cell-environment interactions, as its inhibition affects cell aggregation and differentiation. In this work, we have exposed single-cell amoebae of D. discoideum to an ELF-EMF of about 200 microT, 50 Hz, for 3 h or 24 h at 21 degrees C. A delay in the early phase of the differentiation was observed in 3 h exposed cells, and a significant decrease in the fission rate appeared in 24 h exposed cells. The PrChE activity was significantly lower in 3 h exposed cells than in the controls, whereas 24 h exposed cells exhibited an increase in this enzyme activity. However, such effects appeared to be transient, as the fission rate and PrChE activity values returned to the respective control values after a 24 h stay under standard conditions.

  6. Self-organized, near-critical behavior during aggregation in Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    de Palo, Giovanna; Yi, Darvin; Gregor, Thomas; Endres, Robert

    During starvation, the social amoeba Dictyostelium discoideum aggregates artfully via pattern formation into a multicellular slug and finally spores. The aggregation process is mediated by the secretion and sensing of cyclic adenosine monophosphate, leading to the synchronized movement of cells. The whole process is a remarkable example of collective behavior, spontaneously emerging from single-cell chemotaxis. Despite this phenomenon being broadly studied, a precise characterization of the transition from single cells to multicellularity has been elusive. Here, using fluorescence imaging data of thousands of cells, we investigate the role of cell shape in aggregation, demonstrating remarkable transitions in cell behavior. To better understand their functional role, we analyze cell-cell correlations and provide evidence for self-organization at the onset of aggregation (as opposed to leader cells), with features of criticality in this finite system. To capture the mechanism of self-organization, we extend a detailed single-cell model of D.discoideum chemotaxis by adding cell-cell communication. We then use these results to extract a minimal set of rules leading to aggregation in the population model. If universal, similar rules may explain other types of collective cell behavior.

  7. Chromosome Fragments in DICTYOSTELIUM DISCOIDEUM Obtained from Parasexual Crosses between Strains of Different Genetic Background

    PubMed Central

    Williams, Keith L.; Robson, Gillian E.; Welker, Dennis L.


    The first aneuploid strains of Dictyostelium discoideum have been unambiguously characterized, using cytological and genetic analysis. Three independently isolated, but genetically similar, fragment chromosomes have been observed in segregants from diploids formed between haploid strains derived from the NC4 and V12 isolates of D. discoideum. Once generated, the fragment chromosomes, all of which have V12-derived centromeres, can be maintained in a NC4 genetic background. Genetic evidence is consistent with the view that all three fragment chromosomes studied encompass the region from the centromere to the whiA locus of linkage group II and terminate in the interval between whiA and acrA. From cytological studies, one of the fragment chromosomes consists of approximately half of linkage group II.—We observed no deleterious effect on viability or asexual fruiting-body formation in either haploid or diploid strains carrying an additional incomplete chromosome and hence are disomic or trisomic, respectively, for part of linkage group II. The incomplete chromosome is lost at a frequency of 2 to 3% from disomic and trisomic strains, but surprisingly this loss is not increased in the presence of the haploidizing agent, benlate. A new locus (clyA), whose phenotype is altered colony morphology, is assigned to the region of linkage group II encompassed by the fragment chromosome. PMID:17249037

  8. Analysis of the disruption mutant of the oscillin homolog gene of Dictyostelium discoideum.


    Matsuda, Y; Masamune, Y; Kodaira, K; Yasukawa, H


    A homolog of oscillin, the Ca2+ oscillation-inducing factor of the hamster, was identified from the cellular slime mold Dictyostelium discoideum and designated Dd-oscillin. In the developmental stages of D. discoideum, the gene is expressed at the prestalk region which contains a higher concentration of cytosolic Ca2+ than the prespore region. The Dd-oscillin null strain aggregated but did not develop further when the cells were plated on non-nutrient agar at a density of 1.5x10(6) cells/cm2, showing that the Dd-oscillin gene is important for development. Since the null cells carrying the hamster oscillin gene formed fruiting body, the hamster oscillin was the homolog of Dd-oscillin as far as function is concerned. In addition, the null cells formed fruiting body in the presence of 2,5-di(tert-butyl)-1,4-hydroquinone (BHQ: a specific inhibitor of Ca2+-ATPase activity in the endoplasmic reticulum). These results suggest that Dd-oscillin will increase cytosolic Ca2+ in the cells and promote further development. PMID:10513612

  9. Dictyostelium discoideum to human cells: pharmacogenetic studies demonstrate a role for sphingolipids in chemoresistance.


    Alexander, Stephen; Min, Junxia; Alexander, Hannah


    Resistance to chemotherapy is a major obstacle for the treatment of cancer and a subject of extensive research. Numerous mechanisms of drug resistance have been proposed, and they differ for different drugs. Nevertheless, it is clear that our understanding of this important problem is still incomplete, and that new targets for modulating therapy still await discovery. The attractive biology and the availability of powerful molecular techniques have made the cellular slime mold Dictyostelium discoideum, a powerful non-mammalian model for drug target discovery, and the problem of drug resistance. To understand the molecular basis of chemoresistance to the widely used drug cisplatin, both genetic and pharmacological approaches have been applied to this versatile experimental system. These studies have resulted in the identification of novel molecular pathways which can be used to increase the efficacy of cisplatin, and brought attention to the role of sphingolipids in mediating the cellular response to chemotherapeutic drugs. In the following review, we will describe the history and utility of D. discoideum in pharmacogenetics, and discuss recent studies which focus attention on the role of sphingolipids in chemotherapy and chemoresistance. PMID:16403600

  10. Rapid antagonistic coevolution between strains of the social amoeba Dictyostelium discoideum.


    Hollis, Brian


    Social groups face a fundamental problem of overcoming selfish individuals capable of destroying cooperation. In the social amoeba Dictyostelium discoideum, there is evidence that some clones ('cheaters') contribute disproportionately to the viable spores in a fruiting body while avoiding the dead stalk cell fate. It remains unclear, however, whether this cheating is actually the product of selection. Here, I report the results of an experimental evolution study designed to test whether clones of D. discoideum will evolve resistance to cheating in the laboratory with genetic variation created only through spontaneous mutation. Two strains, one green fluorescent protein (GFP)-labelled and one wild-type, were allowed to grow and develop together before the wild-type strain was removed and replaced with a naïve strain evolving in parallel. Over the course of 10 social generations, the GFP-labelled strain reliably increased its representation in the spores relative to control populations that had never experienced the competitor. This competitive advantage extended to the non-social, vegetative growth portion of the life cycle, but not to pairwise competition with two other strains. These results indicate strong antagonism between strains, mediated by ample mutational variation for cheating and also suggest that arms races between strains in the wild may be common.

  11. Expression of CSA-hm2 fusion in Dictyostelium discoideum under the control of the Dictyostelium ras promoter reveals functional muscarinic receptors.


    Voith, G; Dingermann, T


    We have expressed the human m2 muscarinic receptor gene in the cellular slime mold Dictyostelium discoideum. Expression under the control of the constitutive actin 6 promoter without a D. discoideum leader peptide results in cells which seem to respond to muscarinic agonists initially, but which quickly revert to non responding cells only after a few generations. However, when expressing the hm2 gene as a fusion gene together with the CSA leader peptide under the control of the regulated D. discoideum ras promoter cells are obtained which express functional muscarinic M2 receptors in a stable manner. As expected from the typical regulation of the ras promoter, M2 receptors are expressed only during development. In ligand binding assays these heterologously expressed receptors show binding characteristics similar to authentic M2 receptors. PMID:8570674

  12. Thirteen is enough: the myosins of Dictyostelium discoideum and their light chains

    PubMed Central

    Kollmar, Martin


    Background Dictyostelium discoideum is one of the most famous model organisms for studying motile processes like cell movement, organelle transport, cytokinesis, and endocytosis. Members of the myosin superfamily, that move on actin filaments and power many of these tasks, are tripartite proteins consisting of a conserved catalytic domain followed by the neck region consisting of a different number of so-called IQ motifs for binding of light chains. The tails contain functional motifs that are responsible for the accomplishment of the different tasks in the cell. Unicellular organisms like yeasts contain three to five myosins while vertebrates express over 40 different myosin genes. Recently, the question has been raised how many myosins a simple multicellular organism like Dictyostelium would need to accomplish all the different motility-related tasks. Results The analysis of the Dictyostelium genome revealed thirteen myosins of which three have not been described before. The phylogenetic analysis of the motor domains of the new myosins placed Myo1F to the class-I myosins and Myo5A to the class-V myosins. The third new myosin, an orphan myosin, has been named MyoG. It contains an N-terminal extension of over 400 residues, and a tail consisting of four IQ motifs and two MyTH4/FERM (myosin tail homology 4/band 4.1, ezrin, radixin, and moesin) tandem domains that are separated by a long region containing an SH3 (src homology 3) domain. In contrast to previous analyses, an extensive comparison with 126 class-VII, class-X, class-XV, and class-XXII myosins now showed that MyoI does not group into any of these classes and should not be used as a model for class-VII myosins. The search for calmodulin related proteins revealed two further potential myosin light chains. One is a close homolog of the two EF-hand motifs containing MlcB, and the other, CBP14, phylogenetically groups to the ELC/RLC/calmodulin (essential light chain/regulatory light chain) branch of the tree

  13. Isolation of an actin-binding protein from membranes of Dictyostelium discoideum

    PubMed Central


    We prepared a probe of radiolabeled, glutaraldehyde cross-linked filamentous actin (F-actin) to study binding of actin to membranes of Dictyostelium discoideum. The probe bound to membranes or detergent extracts of membranes with a high affinity and in a saturable manner. The binding could be reduced by boiling of either the actin probe or the membranes, or by addition of excess native F-actin, but not by addition of an equivalent amount of bovine serum albumin, to the assay. The probe labeled several proteins when used to overlay sodium dodecyl sulfate gels of Dictyostelium membranes. One of these labeled proteins was a 24,000-mol-wt protein (p24), which was soluble only in the presence of a high concentration of sodium deoxycholate (5%, wt/vol) at room temperature or above. The p24 was purified by selective detergent extraction and column chromatography. When tested in a novel two-phase binding assay, p24 bound both native monomeric actin (G-actin) and F- actin in a specific manner. In this assay, G-actin bound p24 with a submicromolar affinity. PMID:3972891

  14. Isolation and initial characterization of the bipartite contractile vacuole complex from Dictyostelium discoideum.


    Nolta, K V; Steck, T L


    The contractile vacuole complex serves to excrete excess cytosolic water from protists. In the amoeba, Dictyostelium discoideum, the organelle had a bipartite morphology: a large main vacuole (bladder) marked by lumenal alkaline phosphatase was surrounded by numerous satellite vacuoles (spongiomes). Bladders and spongiomes have now been purified for the first time. The spongiome membranes had a high density of surface projections identified as catalytically-active vacuolar proton pumps (V-H(+)-ATPase). Spongiomes were resolved from the pump-poor bladders by immunogold buoyant density shift with antibodies to the V-H(+)-ATPase; they contained little protein other than this pump. It appears that, following homogenization, most of the spongiome dissociated from bladders and populated the proton pump-rich membrane fraction called acidosomes. Isolated bladders were enriched > 40-fold in alkaline phosphatase and phosphodiesterase, the activities of which were > 85% latent. Bladders depleted of spongiomes bore several distinctive polypeptides; they also had an excess of the basepieces of the proton pump over the catalytic heads. Bladder membranes were also lipid-rich and had a distinctive lipid composition. We conclude that the contractile vacuole system in Dictyostelium is a complex of discrete, separable bladder and spongiome membranes. The V-H(+)-ATPase in the spongiome may catalyze the primary energy transduction step for pumping water out of the cytoplasm.

  15. Dictyostelium discoideum--a promising expression system for the production of eukaryotic proteins.


    Arya, Ranjana; Bhattacharya, Alok; Saini, Kulvinder Singh


    In general, four different expression systems, namely, bacterial, yeast, baculovirus, and mammalian, are widely used for the overproduction of biochemical enzymes and therapeutic proteins. Clearly, bacterial expression systems offer ease of maneuverability with respect to large-scale production of recombinant proteins, while, a baculovirus expression system ensures proper protein modifications, processing, and refolding of complex proteins. Despite these advantages, mammalian cells remain the preferred host for many eukaryotic proteins of pharmaceutical importance, particularly, those requiring post-translational modifications. Recently, the single-celled slime mold, Dictyostelium discoideum (Dd), has emerged as a promising eukaryotic host for the expression of a variety of heterologous recombinant eukaryotic proteins. This organism possesses the complex cellular machinery required for orchestrating post-translational modifications similar to the one observed in higher eukaryotes. This review summarizes the advantages and disadvantages of Dictyostelium as an alternate system compared to other well-established expression systems. The key lessons learned from the expression of human recombinant proteins in this system are reviewed. Also, the strengths, weaknesses, and challenges associated with industrial-scale production of proteins in Dd expression system are discussed. PMID:18714070

  16. EppA, a Putative Substrate of DdERK2, Regulates Cyclic AMP Relay and Chemotaxis in Dictyostelium discoideum

    PubMed Central

    Chen, Songyang; Segall, Jeffrey E.


    The mitogen-activated protein kinase DdERK2 is critical for cyclic AMP (cAMP) relay and chemotaxis to cAMP and folate, but the details downstream of DdERK2 are unclear. To search for targets of DdERK2 in Dictyostelium discoideum,32PO43−-labeled protein samples from wild-type and Dderk2− cells were resolved by 2-dimensional electrophoresis. Mass spectrometry was used to identify a novel 45-kDa protein, named EppA (ERK2-dependent phosphoprotein A), as a substrate of DdERK2 in Dictyostelium. Mutation of potential DdERK2 phosphorylation sites demonstrated that phosphorylation on serine 250 of EppA is DdERK2 dependent. Changing serine 250 to alanine delayed development of Dictyostelium and reduced Dictyostelium chemotaxis to cAMP. Although overexpression of EppA had no significant effect on the development or chemotaxis of Dictyostelium, disruption of the eppA gene led to delayed development and reduced chemotactic responses to both cAMP and folate. Both eppA gene disruption and overexpression of EppA carrying the serine 250-to-alanine mutation led to inhibition of intracellular cAMP accumulation in response to chemoattractant cAMP, a pivotal process in Dictyostelium chemotaxis and development. Our studies indicate that EppA regulates extracellular cAMP-induced signal relay and chemotaxis of Dictyostelium. PMID:16835457

  17. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F


    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  18. The Discoidin I Gene Family of Dictyostelium Discoideum Is Linked to Genes Regulating Its Expression

    PubMed Central

    Welker, D. L.


    The discoidin I protein has been studied extensively as a marker of early development in the cellular slime mold Dictyostelium discoideum. However, like most other developmentally regulated proteins in this system, no reliable information was available on the linkage of the discoidin genes to other known genes. Analysis of the linkage of the discoidin I genes by use of restriction fragment length polymorphisms revealed that all three discoidin I genes as well as a pseudogene are located on linkage group II. This evidence is consistent with the discoidin I genes forming a gene cluster that may be under the control of a single regulatory element. The discoidin I genes are linked to three genetic loci (disA, motA, daxA) that affect the expression of the discoidin I protein. Linkage of the gene family members to regulatory loci may be important in the coordinate maintenance of the gene family and regulatory loci. A duplication affecting the entire discoidin gene family is also linked to group II; this appears to be a small tandem duplication. This duplication was mapped using a DNA polymorphism generated by insertion of the Tdd-3 mobile genetic element into a Tdd-2 element flanking the γ gene. A probe for Tdd-2 identified a restriction fragment length polymorphism in strain AX3K that was consistent with generation by a previously proposed Tdd-3 insertion event. A putative duplication or rearrangement of a second Tdd-2 element on linkage group IV of strain AX3K was also identified. This is the first linkage information available for mobile genetic elements in D. discoideum. PMID:3402731

  19. A new member of the GP138 multigene family implicated in cell interactions in Dictyostelium discoideum.


    Hata, T; Yamaguchi, N; Tanaka, Y; Urushihara, H


    The cellular slime mold Dictyostelium discoideum reproduces sexually under submerged and dark conditions. Its mating system is polymorphic and particularly interesting with respect to mechanisms of cell recognition. The cell-surface glycoprotein gp138 has been implicated in sexual cell interactions, as it was identified as a target molecule for the antibodies that block sexual cell fusion in D. discoideum. Two mutually homologous genes, GP138A and GP138B, have been cloned, but gene disruption experiments to clarify their functional relationships suggested that there is at least one more gene for gp138. Further protein analysis including peptide mapping also revealed that gp138 exists as three isoforms, DdFRP1, DdFRP2, and DdFRP3. GP138A encodes DdFRP2 and GP138B, DdFRP3, and the presence of a third gp138 gene encoding DdFRP1 was suggested. Here, we isolated and characterized a third GP138 gene, GP138C. Although the deduced amino acid sequences of GP138C matched completely with those of peptide fragments of DdFRP1 in the N-terminal half, the rest did not give complete matches. Overexpression of GP138C caused an increase in the intensity of DdFRP1, but disruption of this gene did not diminish DdFRP1. Our results indicate that GP138C encodes a protein very similar to but distinct from DdFRP1. The GP138 multigene family is thus composed of more members than previously expected, and their functional relationships are of special interest. PMID:10462174

  20. CyrA, a matricellular protein that modulates cell motility in Dictyostelium discoideum.


    Huber, Robert J; Suarez, Andres; O'Day, Danton H


    CyrA, an extracellular matrix (slime sheath), calmodulin (CaM)-binding protein in Dictyostelium discoideum, possesses four tandem EGF-like repeats in its C-terminus and is proteolytically cleaved during asexual development. A previous study reported the expression and localization of CyrA cleavage products CyrA-C45 and CyrA-C40. In this study, an N-terminal antibody was produced that detected the full-length 63kDa protein (CyrA-C63). Western blot analyses showed that the intracellular expression of CyrA-C63 peaked between 12 and 16h of development, consistent with the time that cells are developing into a motile, multicellular slug. CyrA immunolocalization and CyrA-GFP showed that the protein localized to the endoplasmic reticulum, particularly its perinuclear component. CyrA-C63 secretion began shortly after the onset of starvation peaking between 8 and 16h of development. A pharmacological analysis showed that CyrA-C63 secretion was dependent on intracellular Ca(2+) release and active CaM, PI3K, and PLA2. CyrA-C63 bound to CaM both intra- and extracellularly and both proteins were detected in the slime sheath deposited by migrating slugs. In keeping with its purported function, CyrA-GFP over-expression enhanced cAMP-mediated chemotaxis and CyrA-C45 was detected in vinculin B (VinB)-GFP immunoprecipitates, thus providing a link between the increase in chemotaxis and a specific cytoskeletal component. Finally, DdEGFL1-FITC was detected on the membranes of cells capped with concanavalin A suggesting that a receptor exists for this peptide sequence. Together with previous studies, the data presented here suggests that CyrA is a bona fide matricellular protein in D. discoideum.

  1. Dictyostelium discoideum contains three inositol monophosphatase activities with different substrate specificities and sensitivities to lithium.

    PubMed Central

    Van Dijken, P; Bergsma, J C; Hiemstra, H S; De Vries, B; Van Der Kaay, J; Van Haastert, P J


    The small ion lithium, a very effective agent in the treatment of manic depressive patients, inhibits the mammalian enzyme inositol monophosphatase, which is proposed as the biological target for the effects of lithium. In this study we investigated Dictyostelium discoideum inositol monophosphatase activity. Partial purification of the proteins in the soluble cell fraction using anion-exchange chromatography revealed the presence of at least three enzyme activities capable of degrading inositol monophosphate isomers. The first activity was similar to the monophosphatase found in mammalian cells, as it degraded Ins(4)P, Ins(1)P and to a lesser extent Ins(3)P, was dependent on MgCl2 and inhibited by LiCl in a uncompetitive [corrected] manner. The second enzyme activity was specific for Ins(4)P; the enzyme activity was not dependent on MgCl2 and not inhibited by LiCl. The third monophosphatase activity degraded especially Ins(3)P, but also Ins(4)P and Ins(1)P; increasing concentrations of MgCl2 inhibited this enzyme activity, whereas LiCl had no effect. In vivo, LiCl induces a reduction of inositol levels by about 20%. In [3H]inositol-labelled cells LiCl causes a 6-fold increase in the radioactivity of [3H]Ins(1)P, a doubling of [3H]Ins(4)P and a slight decrease in the radioactivity in [3H]Ins(3)P. These data indicate that the biological effects of lithium in Dictyostelium are not due to depletion of the inositol pool by inhibition of inositol monophosphatase activity. PMID:8670062

  2. Identification and characterization of two penta-EF-hand Ca(2+)-binding proteins in Dictyostelium discoideum.


    Ohkouchi, S; Nishio, K; Maeda, M; Hitomi, K; Adachi, H; Maki, M


    Penta-EF-hand (PEF) proteins such as ALG-2 (apoptosis-linked gene 2 product) and the calpain small subunit are a newly classified family of Ca(2+)-binding proteins that possess five EF-hand-like motifs. We identified two mutually homologous PEF proteins, designated DdPEF-1 and DdPEF-2 (64% amino acid residue identities), in the cellular slime mold Dictyostelium discoideum. Both PEF proteins showed a higher similarity to mammalian ALG-2 and peflin (Group I PEF proteins) than to calpain and sorcin subfamily (Group II PEF proteins) in the first EF-hand (EF-1) regions. Northern blot analyses revealed that DdPEF-1 and DdPEF-2 were constitutively expressed throughout development of Dictyostelium, but their levels of expression were developmentally regulated. In situ hybridization analyses demonstrated that DdPEF-1 was expressed in both the anterior prestalk and the posterior prespore regions of the tipped aggregate, slugs and early culminants. On the other hand, DdPEF-2 was dominantly expressed in the anterior tip region of these multicellular structures. Both PEF proteins were detected as 22-23-kDa proteins in soluble fractions in the presence of EGTA but in particulate fractions in the presence of Ca(2+) by Western blotting using specific monoclonal antibodies. Together with the finding of PEF-like sequences in DNA databases of plants, fungi and protists, our results strongly suggest that Group I PEF proteins are ubiquitously present in all eukaryotes and play important roles in basic cellular functions.

  3. A RabGAP Regulates Life-Cycle Duration via Trimeric G-protein Cascades in Dictyostelium discoideum

    PubMed Central

    Kuwayama, Hidekazu; Miyanaga, Yukihiro; Urushihara, Hideko; Ueda, Masahiro


    Background The life-cycle of cellular slime molds comprises chronobiologically regulated processes. During the growth phase, the amoeboid cells proliferate at a definite rate. Upon starvation, they synthesize cAMP as both first and second messengers in signalling pathways and form aggregates, migrating slugs, and fruiting bodies, consisting of spores and stalk cells, within 24 h. In Dictyostelium discoideum, because most growth-specific events cease during development, proliferative and heterochronic mutations are not considered to be interrelated and no genetic factor governing the entire life-cycle duration has ever been identified. Methodology/Principal Findings Using yeast 2-hybrid library screening, we isolated a Dictyostelium discoideum RabGAP, Dd Rbg-3, as a candidate molecule by which the Dictyostelium Gα2 subunit directs its effects. Rab GTPase-activating protein, RabGAP, acts as a negative regulator of Rab small GTPases, which orchestrate the intracellular membrane trafficking involved in cell proliferation. Deletion mutants of Dd rbg-3 exhibited an increased growth rate and a shortened developmental period, while an overexpression mutant demonstrated the opposite effects. We also show that Dd Rbg-3 interacts with 2 Gα subunits in an activity-dependent manner in vitro. Furthermore, both human and Caenorhabditis elegans rbg-3 homologs complemented the Dd rbg-3–deletion phenotype in D. discoideum, indicating that similar pathways may be generally conserved in multicellular organisms. Conclusions/Significance Our findings suggest that Dd Rbg-3 acts as a key element regulating the duration of D. discoideum life-span potentially via trimeric G-protein cascades. PMID:24349132

  4. Investigating the Function of Coronin A in the Early Starvation Response of Dictyostelium discoideum by Aggregation Assays.


    Drexler, Stefan K; Brogna, Francesco; Vinet, Adrien; Pieters, Jean


    Dictyostelium discoideum amoeba are found in soil, feeding on bacteria. When food sources become scarce, they secrete factors to initiate a multicellular development program, during which single cells chemotax towards aggregation centers(1-4). This process is dependent on the release of cyclic adenosine monophosphate (cAMP)(5). cAMP is produced in waves through the concerted action of adenylate cyclase and phosphodiesterases, and binds to G protein-coupled cAMP receptors(6,7). A widely used assay to analyze the mechanisms involved in the developmental cycle of the lower eukaryote Dictyostelium discoideum is based on the observation of cell aggregation in submerged conditions(8,9). This protocol describes the analysis of the role of coronin A in the developmental cycle by starvation in tissue-culture plates submerged in balanced salt solution (BSS)(10). Coronin A is a member of the widely conserved protein family of coronins that have been implicated in a wide variety of activities(11,12). Dictyostelium cells lacking coronin A are unable to form multicellular aggregates, and this defect can be rescued by supplying pulses of cAMP, suggesting that coronin A acts upstream of the cAMP cascade(10). The techniques described in these studies provide robust tools to investigate functions of proteins during the initial stages of the developmental cycle of Dictyostelium discoideum upstream of the cAMP cascade. Therefore, utilizing this aggregation assay may allow the further study of coronin A function and advance our understanding of coronin biology. PMID:27403805

  5. A Quorum-Sensing Factor in Vegetative Dictyostelium Discoideum Cells Revealed by Quantitative Migration Analysis

    PubMed Central

    Golé, Laurent; Rivière, Charlotte; Hayakawa, Yoshinori; Rieu, Jean-Paul


    Background Many cells communicate through the production of diffusible signaling molecules that accumulate and once a critical concentration has been reached, can activate or repress a number of target genes in a process termed quorum sensing (QS). In the social amoeba Dictyostelium discoideum, QS plays an important role during development. However little is known about its effect on cell migration especially in the growth phase. Methods and Findings To investigate the role of cell density on cell migration in the growth phase, we use multisite timelapse microscopy and automated cell tracking. This analysis reveals a high heterogeneity within a given cell population, and the necessity to use large data sets to draw reliable conclusions on cell motion. In average, motion is persistent for short periods of time (), but normal diffusive behavior is recovered over longer time periods. The persistence times are positively correlated with the migrated distances. Interestingly, the migrated distance decreases as well with cell density. The adaptation of cell migration to cell density highlights the role of a secreted quorum sensing factor (QSF) on cell migration. Using a simple model describing the balance between the rate of QSF generation and the rate of QSF dilution, we were able to gather all experimental results into a single master curve, showing a sharp cell transition between high and low motile behaviors with increasing QSF. Conclusion This study unambiguously demonstrates the central role played by QSF on amoeboid motion in the growth phase. PMID:22073217

  6. Emerging models for DNA repair: Dictyostelium discoideum as a model for nonhomologous end-joining.


    Pears, Catherine J; Lakin, Nicholas D


    DNA double strand breaks (DSBs) are a particularly cytotoxic variety of DNA lesion that can be repaired by homologous recombination (HR) or nonhomologous end-joining (NHEJ). HR utilises sequences homologous to the damage DNA template to facilitate repair. In contrast, NHEJ does not require homologous sequences for repair but instead functions by directly re-joining DNA ends. These pathways are critical to resolve DSBs generated intentionally during processes such as meiotic and site-specific recombination. However, they are also utilised to resolve potentially pathological DSBs generated by mutagens and errors during DNA replication. The importance of DSB repair is underscored by the findings that defects in these pathways results in chromosome instability that contributes to a variety of disease states including malignancy. The general principles of NHEJ are conserved in eukaryotes. As such, relatively simple model organisms have been instrumental in identifying components of these pathways and providing a mechanistic understanding of repair that has subsequently been applied to vertebrates. However, certain components of the NHEJ pathway are absent or show limited conservation in the most commonly used invertebrate models exploited to study DNA repair. Recently, however, it has become apparent that vertebrate DNA repair pathway components, including those involved in NHEJ, are unusually conserved in the amoeba Dictyostelium discoideum. Traditionally, this genetically tractable organism has been exploited to study the molecular basis of cell type specification, cell motility and chemotaxis. Here we discuss the use of this organism as an additional model to study DNA repair, with specific reference to NHEJ.

  7. Identification of Proteins Associated with Multilamellar Bodies Produced by Dictyostelium discoideum

    PubMed Central

    Denoncourt, Alix M.; Paquet, Valérie E.; Sedighi, Ahmadreza; Charette, Steve J.


    Dictyostelium discoideum amoebae produce and secrete multilamellar bodies (MLBs) when fed digestible bacteria. The aim of the present study was to elucidate the proteic content of MLBs. The lipid composition of MLBs is mainly amoebal in origin, suggesting that MLB formation is a protozoa-driven process that could play a significant role in amoebal physiology. We identified four major proteins on purified MLBs using mass spectrometry in order to better understand the molecular mechanisms governing MLB formation and, eventually, to elucidate the true function of MLBs. These proteins were SctA, PhoPQ, PonC and a protein containing a cytidine/deoxycytidylate deaminase (CDD) zinc-binding region. SctA is a component of pycnosomes, which are membranous materials that are continuously secreted by amoebae. The presence of SctA on MLBs was confirmed by immunofluorescence and Western blotting using a specific anti-SctA antibody. The CDD protein may be one of the proteins recognized by the H36 antibody, which was used as a MLB marker in a previous study. The function of the CDD protein is unknown. Immunofluorescence and flow cytometric analyses confirmed that the H36 antibody is a better marker of MLBs than the anti-SctA antibody. This study is an additional step to elucidate the potential role of MLBs and revealed that only a small set of proteins appeared to be present on MLBs. PMID:27340834

  8. Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum

    SciTech Connect

    Benichou, J.C.; Quiviger, B.; Ryter, A.


    The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest of the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.

  9. Microtubule-nucleus interactions in Dictyostelium discoideum mediated by central motor kinesins.


    Tikhonenko, Irina; Nag, Dilip K; Robinson, Douglas N; Koonce, Michael P


    Kinesins are a diverse superfamily of motor proteins that drive organelles and other microtubule-based movements in eukaryotic cells. These motors play important roles in multiple events during both interphase and cell division. Dictyostelium discoideum contains 13 kinesin motors, 12 of which are grouped into nine families, plus one orphan. Functions for 11 of the 13 motors have been previously investigated; we address here the activities of the two remaining kinesins, both isoforms with central motor domains. Kif6 (of the kinesin-13 family) appears to be essential for cell viability. The partial knockdown of Kif6 with RNA interference generates mitotic defects (lagging chromosomes and aberrant spindle assemblies) that are consistent with kinesin-13 disruptions in other organisms. However, the orphan motor Kif9 participates in a completely novel kinesin activity, one that maintains a connection between the microtubule-organizing center (MTOC) and nucleus during interphase. kif9 null cell growth is impaired, and the MTOC appears to disconnect from its normally tight nuclear linkage. Mitotic spindles elongate in a normal fashion in kif9(-) cells, but we hypothesize that this kinesin is important for positioning the MTOC into the nuclear envelope during prophase. This function would be significant for the early steps of cell division and also may play a role in regulating centrosome replication.

  10. Developmental accumulation of inorganic polyphosphate affects germination and energetic metabolism in Dictyostelium discoideum

    PubMed Central

    Livermore, Thomas Miles; Chubb, Jonathan Robert; Saiardi, Adolfo


    Inorganic polyphosphate (polyP) is composed of linear chains of phosphate groups linked by high-energy phosphoanhydride bonds. However, this simple, ubiquitous molecule remains poorly understood. The use of nonstandardized analytical methods has contributed to this lack of clarity. By using improved polyacrylamide gel electrophoresis we were able to visualize polyP extracted from Dictyostelium discoideum. We established that polyP is undetectable in cells lacking the polyphosphate kinase (DdPpk1). Generation of this ppk1 null strain revealed that polyP is important for the general fitness of the amoebae with the mutant strain displaying a substantial growth defect. We discovered an unprecedented accumulation of polyP during the developmental program, with polyP increasing more than 100-fold. The failure of ppk1 spores to accumulate polyP results in a germination defect. These phenotypes are underpinned by the ability of polyP to regulate basic energetic metabolism, demonstrated by a 2.5-fold decrease in the level of ATP in vegetative ppk1. Finally, the lack of polyP during the development of ppk1 mutant cells is partially offset by an increase of both ATP and inositol pyrophosphates, evidence for a model in which there is a functional interplay between inositol pyrophosphates, ATP, and polyP. PMID:26755590

  11. Flow-driven waves and sink-driven oscillations during aggregation of Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Gholami, Azam; Zykov, Vladimir; Steinbock, Oliver; Bodenschatz, Eberhard

    The slime mold Dictyostelium discoideum (D.d) is a well-known model system for the study of biological pattern formation. Under starvation, D.d. cells aggregate chemotactically towards cAMP signals emitted periodically from an aggregation center. In the natural environment, D.d cells may experience fluid flows that can profoundly change the underlying wave generation process. We investigate spatial-temporal dynamics of a uniformly distributed population of D.d. cells in a flow-through narrow microfluidic channel with a cell-free inlet area. We show that flow can significantly influence the dynamics of the system and lead to a flow- driven instability that initiate downstream traveling cAMP waves. We also show that cell-free boundary regions have a significant effect on the observed patterns and can lead to a new kind of instability. Since there are no cells in the inlet to produce cAMP, the points in the vicinity of the inlet lose cAMP due to advection or diffusion and gain only a little from the upstream of the channel (inlet). In other words, there is a large negative flux of cAMP in the neighborhood close to the inlet, which can be considered as a sink. This negative flux close to the inlet drives a new kind of instability called sink-driven oscillations. Financial support of the MaxSynBio Consortium is acknowledged.

  12. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.


    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano


    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype. PMID:19893578

  13. A large scale screen reveals genes that mediate electrotaxis in Dictyostelium discoideum**

    PubMed Central

    Gao, Runchi; Zhao, Siwei; Jiang, Xupin; Sun, Yaohui; Zhao, Sanjun; Gao, Jing; Borleis, Jane; Willard, Stacey; Tang, Ming; Cai, Huaqing; Kamimura, Yoichiro; Huang, Yuesheng; Jiang, Jianxin; Huang, Zunxi; Mogilner, Alex; Pan, Tingrui; Devreotes, Peter N; Zhao, Min


    Directional cell migration in an electric field, a phenomenon called galvanotaxis or electrotaxis, occurs in many types of cells, and may play an important role in wound healing and development. Small extracellular electric fields can guide the migration of amoeboid cells, and here, we established a large-scale screening approach to search for mutants with electrotaxis phenotypes from a collection of 563 Dictyostelium discoideum strains with morphological defects. We identified 28 strains that were defective in electrotaxis and 10 strains with a slightly higher directional response. Using plasmid rescue followed by gene disruption, we identified some of the mutated genes, including some previously implicated in chemotaxis. Amongst these we studied PiaA, which encodes a critical component of TORC2, a kinase protein complex that transduces changes in motility by activating the kinase PKB (also known as Akt). Furthermore, we found that electrotaxis was decreased in mutants lacking gefA, rasC, rip3, lst8 or pkbR1, genes that encode other components of the TORC2-PKB pathway. Thus, we have developed a high-throughput screening technique that will be a useful tool to elucidate the molecular mechanisms of electrotaxis. PMID:26012633

  14. Overexpression of TOR (target of rapamycin) inhibits cell proliferation in Dictyostelium discoideum.


    Swer, Pynskhem Bok; Mishra, Himanshu; Lohia, Rakhee; Saran, Shweta


    TOR (target of rapamycin) protein kinase acts as a central controller of cell growth and development of an organism. Present study was undertaken to find the expression pattern and role of TOR during growth and development of Dictyostelium discoideum. Failures to generate either knockout and/or knockdown mutants indicate that interference with its levels led to cellular defects. Thus, the effects of TOR (DDB_G0281569) overexpression specifically, cells expressing Dd(Δ211-TOR)-Eyfp mutant was analyzed. Elevated expression of (Δ211-TOR)-Eyfp reduced both cell size and cell proliferation. DdTOR was found to be closer to fungus. mRNA level of TOR was found maximally in the freshly starved/aggregate cells that gradually declined. This was also strengthened by the expression patterns observed by in situ and the analysis of β-galactosidase reporter driven by the putative TOR promoter. The TOR protein was found to be highest at the aggregate stage. The fusion protein, (Δ211-TOR)-Eyfp was localized to the cell membrane, cytosol, and the nucleus. We suggest, DdTOR to be an essential protein and high TOR expression inhibits cell proliferation.

  15. Microtubules Are Essential for Mitochondrial Dynamics–Fission, Fusion, and Motility–in Dictyostelium discoideum

    PubMed Central

    Woods, Laken C.; Berbusse, Gregory W.; Naylor, Kari


    Mitochondrial function is dependent upon mitochondrial structure which is in turn dependent upon mitochondrial dynamics, including fission, fusion, and motility. Here we examined the relationship between mitochondrial dynamics and the cytoskeleton in Dictyostelium discoideum. Using time-lapse analysis, we quantified mitochondrial fission, fusion, and motility in the presence of cytoskeleton disrupting pharmaceuticals and the absence of the potential mitochondria-cytoskeleton linker protein, CluA. Our results indicate that microtubules are essential for mitochondrial movement, as well as fission and fusion; actin plays a less significant role, perhaps selecting the mitochondria for transport. We also suggest that CluA is not a linker protein but plays an unidentified role in mitochondrial fission and fusion. The significance of our work is to gain further insight into the role the cytoskeleton plays in mitochondrial dynamics and function. By better understanding these processes we can better appreciate the underlying mitochondrial contributions to many neurological disorders characterized by altered mitochondrial dynamics, structure, and/or function. PMID:27047941

  16. Proteomic profiling of the extracellular matrix (slime sheath) of Dictyostelium discoideum.


    Huber, Robert J; O'Day, Danton H


    Dictyostelium discoideum has historically served as a model system for cell and developmental biology, but recently it has gained increasing attention as a model for the study of human diseases. The extracellular matrix (ECM) of this eukaryotic microbe serves multiple essential functions during development. It not only provides structural integrity to the moving multicellular pseudoplasmodium, or slug, it also provides components that regulate cell motility and differentiation. An LC/MS/MS analysis of slug ECM revealed the presence of a large number of proteins in two wild-type strains, NC4 and WS380B. GO annotation identified a large number of proteins involved in some form of binding (e.g. protein, polysaccharide, cellulose, carbohydrate, ATP, cAMP, ion, lipid, vitamin), as well as proteins that modulate metabolic processes, cell movement, and multicellular development. In addition, this proteomic analysis identified numerous expected (e.g. EcmA, EcmD, discoidin I, discoidin II), as well as unexpected (e.g. ribosomal and nuclear proteins) components. These topics are discussed in terms of the structure and function of the ECM during the development of this model amoebozoan and their relevance to ongoing biomedical research.

  17. Role of SP65 in assembly of the Dictyostelium discoideum spore coat.


    Metcalf, Talibah; van der Wel, Hanke; Escalante, Ricardo; Sastre, Leandro; West, Christopher M


    Like the cyst walls of other protists, the spore coat of Dictyostelium discoideum is formed de novo to protect the enclosed dormant cell from stress. Spore coat assembly is initiated by exocytosis of protein and polysaccharide precursors at the cell surface, followed by the infusion of nascent cellulose fibrils, resulting in an asymmetrical trilaminar sandwich with cellulose filling the middle layer. A molecular complex consisting of cellulose and two proteins, SP85 and SP65, is associated with the inner and middle layers and is required for proper organization of distinct proteins in the outer layer. Here we show that, unlike SP85 and other protein precursors, which are stored in prespore vesicles, SP65 is, like cellulose, synthesized just in time. By tagging the SP65 locus with green fluorescent protein, we find that SP65 is delivered to the cell surface via largely distinct vesicles, suggesting that separate delivery of components of the cellulose-SP85-SP65 complex regulates its formation at the cell surface. In support of previous in vivo studies, recombinant SP65 and SP85 are shown to interact directly. In addition, truncation of SP65 causes a defect of the outer layer permeability barrier as seen previously for SP85 mutants. These observations suggest that assembly of the cellulose-SP85-SP65 triad at the cell surface is biosynthetically regulated both temporally and spatially and that the complex contributes an essential function to outer layer architecture and function.

  18. Proteomic profiling of the extracellular matrix (slime sheath) of Dictyostelium discoideum.


    Huber, Robert J; O'Day, Danton H


    Dictyostelium discoideum has historically served as a model system for cell and developmental biology, but recently it has gained increasing attention as a model for the study of human diseases. The extracellular matrix (ECM) of this eukaryotic microbe serves multiple essential functions during development. It not only provides structural integrity to the moving multicellular pseudoplasmodium, or slug, it also provides components that regulate cell motility and differentiation. An LC/MS/MS analysis of slug ECM revealed the presence of a large number of proteins in two wild-type strains, NC4 and WS380B. GO annotation identified a large number of proteins involved in some form of binding (e.g. protein, polysaccharide, cellulose, carbohydrate, ATP, cAMP, ion, lipid, vitamin), as well as proteins that modulate metabolic processes, cell movement, and multicellular development. In addition, this proteomic analysis identified numerous expected (e.g. EcmA, EcmD, discoidin I, discoidin II), as well as unexpected (e.g. ribosomal and nuclear proteins) components. These topics are discussed in terms of the structure and function of the ECM during the development of this model amoebozoan and their relevance to ongoing biomedical research. PMID:26152465

  19. Ribosomal protein gene expression is cell type specific during development in Dictyostelium discoideum.


    Agarwal, A K; Parrish, S N; Blumberg, D D


    Starvation for amino acids initiates the developmental cycle in the cellular slime mold, Dictyostelium discoideum. Upon starvation one of the earliest developmental events is the selective loss of the ribosomal protein mRNAs from polysomes. This loss depends upon sequences in the 5' non-translated leader of the ribosomal protein (r-protein) mRNAs. Here evidence is presented which indicates that those cells which will become prestalk cells express the ribosomal protein genes during development under starvation conditions. Cells which enter the prespore pathway shut off r-protein synthesis. The promoter and 5' non-translated leader sequences from two ribosomal protein genes, the rp-L11 and the rp-S9 genes, are fused to the Escherichia coli beta-galactosidase reporter gene. While beta-galactosidase enzyme activity is detected in situ in most growing cells, by 15 h of development beta-galactosidase enzyme activity is largely lost from the prespore cells although strong beta-galactosidase enzyme activity is present in the prestalk cells. These observations suggest the possibility that the ribosomal protein mRNAs are excluded from polysomes in a cell-type-specific manner. PMID:10550541

  20. Induction of phosphodiesterase by cyclic adenosine 3':5'-monophosphate in differentiating Dictyostelium discoideum amoebae.


    Klein, C


    Cyclic adenosine 3':5'-monophosphate added to the starvation media of Dictyostelium discoideum amoebae induces both intracellular and extracellular phosphodiesterase activities of these cells. The induced enzyme activity appears several hours earlier than that in starved cells which have not been induced with cyclic nucleotide. In both cases, the appearance of enzyme is inhibited by cycloheximide, and actinomycin D, and daunomycin. The KmS for the extracellular enzyme(s) of nucleotide-induced and uninduced control cells are identical. The induction of enzyme activity seems specific for cyclic adenosine 3':5'-monophosphate since cyclic guanosine 3':5'-monophosphate, as well as other nucleotides, have no effect. No differences in the activity or excretion of either N-acetylglucosaminidase or the inhibitory of the extracellular phosphodiesterase are observed between cyclic adenosine 3':5'-monophosphate-induced and control cells. A direct activation of phosphodiesterase by cyclic adenosine 3':5'-monophosphate can be excluded, since the addition of this nucleotide to cell lysates has no effect on the enzyme activity. PMID:170256

  1. Identification of Proteins Associated with Multilamellar Bodies Produced by Dictyostelium discoideum.


    Denoncourt, Alix M; Paquet, Valérie E; Sedighi, Ahmadreza; Charette, Steve J


    Dictyostelium discoideum amoebae produce and secrete multilamellar bodies (MLBs) when fed digestible bacteria. The aim of the present study was to elucidate the proteic content of MLBs. The lipid composition of MLBs is mainly amoebal in origin, suggesting that MLB formation is a protozoa-driven process that could play a significant role in amoebal physiology. We identified four major proteins on purified MLBs using mass spectrometry in order to better understand the molecular mechanisms governing MLB formation and, eventually, to elucidate the true function of MLBs. These proteins were SctA, PhoPQ, PonC and a protein containing a cytidine/deoxycytidylate deaminase (CDD) zinc-binding region. SctA is a component of pycnosomes, which are membranous materials that are continuously secreted by amoebae. The presence of SctA on MLBs was confirmed by immunofluorescence and Western blotting using a specific anti-SctA antibody. The CDD protein may be one of the proteins recognized by the H36 antibody, which was used as a MLB marker in a previous study. The function of the CDD protein is unknown. Immunofluorescence and flow cytometric analyses confirmed that the H36 antibody is a better marker of MLBs than the anti-SctA antibody. This study is an additional step to elucidate the potential role of MLBs and revealed that only a small set of proteins appeared to be present on MLBs.

  2. Genetic Diversity in Cellular Slime Molds: Allozyme Electrophoresis and a Monoclonal Antibody Reveal Cryptic Species among Dictyostelium discoideum Strains

    PubMed Central

    Briscoe, David A.; Gooley, Andrew A.; Bernstein, R. L.; McKay, George M.; Williams, Keith L.


    Cellular slime molds have been classified on the basis of a small number of descriptive criteria such as fruiting body color and morphology, and, in heterothallic species, by assignment to compatible mating groups. However, some isolates which are morphologically classified as conspecific do not fall into a simple mating-type classification; for example some are asexual or homothallic. An increasing interest in inter-strain genetic variation in studies of development and simple behavior has led us to reassess genetic relationships among a number of frequently used isolates. Allozyme electrophoresis of 16 soluble enzymes and use of a monoclonal antibody show that there is relatively little genetic diversity among sexually competent Dictyostelium discoideum isolates, despite considerable variation in geographic origin and time since isolation in the laboratory. In contrast a pair of asexual strains and each of two homothallic strains are genetically quite distinct and differ sufficiently from each other, and from sexually competent isolates, to warrant their recognition as separate species. There are probably four biological species represented in the supposedly D. discoideum isolates studied. This heterogeneity extends to other cellular slime mold species. Each of three isolates of Dictyostelium purpureum is genetically distinct from the others. Limited analysis of other cellular slime molds indicates that the generic distinction of Dictyostelium and Polysphondylium must be questioned. This study emphasizes that caution should be applied in classifying simple organisms on morphological criteria. PMID:17246401

  3. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.


    Zhang, Chenyu; Kuspa, Adam


    Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA) is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial protein synthesis in D

  4. Dictyostelium discoideum strains lacking the RtoA protein are defective for maturation of the Legionella pneumophila replication vacuole.


    Li, Zhiru; Solomon, Jonathan M; Isberg, Ralph R


    To identify host proteins involved in Legionella pneumophila intracellular replication, the soil amoeba Dictyostelium discoideum was analysed. The absence of the amoebal RtoA protein is demonstrated here to depress L. pneumophila intracellular growth. Uptake of L. pneumophila into a D. discoideum rtoA(-) strain was marginally defective, but this effect was not sufficient to account for the defective intracellular growth of L. pneumophila. The rtoA mutant was also more resistant to high-multiplicity killing by the bacterium. A targeting assay testing the colocalization of L. pneumophila-containing vacuole with an endoplasmic reticulum/pre-Golgi intermediate compartment marker protein, GFP-HDEL, was used to analyse these defects. In parental D. discoideum, the L. pneumophila vacuole showed recruitment of GFP-HDEL within 40 min after introduction of bacteria to the amoebae. By 6 h after infection it was clear that the rtoA mutant acquired and retained the GFP-HDEL less efficiently than the parental strain, and that the mutant was defective for promoting the physical expansion of the membranous compartment surrounding the bacteria. Depressed intracellular growth of L. pneumophila in a D. discoideum rtoA(-) mutant therefore appeared to result from a lowered efficiency of vesicle trafficking events that are essential for the modification and expansion of the L. pneumophila-containing compartment. PMID:15679845

  5. A membrane cytoskeleton from Dictyostelium discoideum. I. Identification and partial characterization of an actin-binding activity

    PubMed Central


    Dictyostelium discoideum plasma membranes isolated by each of three procedures bind F-actin. The interactions between these membranes and actin are examined by a novel application of falling ball viscometry. Treating the membranes as multivalent actin-binding particles analogous to divalent actin-gelation factors, we observe large increases in viscosity (actin cross-linking) when membranes of depleted actin and myosin are incubated with rabbit skeletal muscle F-actin. Pre- extraction of peripheral membrane proteins with chaotropes or the inclusion of Triton X-100 during the assay does not appreciably diminish this actin cross-linking activity. Lipid vesicles, heat- denatured membranes, proteolyzed membranes, or membranes containing endogenous actin show minimal actin cross-linking activity. Heat- denatured, but not proteolyzed, membranes regain activity when assayed in the presence of Triton X-100. Thus, integral membrane proteins appear to be responsible for some or all of the actin cross-linking activity of D. discoideum membranes. In the absence of MgATP, Triton X- 100 extraction of isolated D. discoideum membranes results in a Triton- insoluble residue composed of actin, myosin, and associated membrane proteins. The inclusion of MgATP before and during Triton extraction greatly diminishes the amount of protein in the Triton-insoluble residue without appreciably altering its composition. Our results suggest the existence of a protein complex stabilized by actin and/or myosin (membrane cytoskeleton) associated with the D. discoideum plasma membrane. PMID:6894148

  6. Characterization of a 1,4-{beta}-D-glucan synthase from Dictyostelium discoideum. Progress report, May 1990--January 1992

    SciTech Connect

    Blanton, R.L.


    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  7. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central


    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  8. Regulation of Spatiotemporal Patterns by Biological Variability: General Principles and Applications to Dictyostelium discoideum

    PubMed Central

    Grace, Miriam; Hütt, Marc-Thorsten


    Spatiotemporal patterns often emerge from local interactions in a self-organizing fashion. In biology, the resulting patterns are also subject to the influence of the systematic differences between the system’s constituents (biological variability). This regulation of spatiotemporal patterns by biological variability is the topic of our review. We discuss several examples of correlations between cell properties and the self-organized spatiotemporal patterns, together with their relevance for biology. Our guiding, illustrative example will be spiral waves of cAMP in a colony of Dictyostelium discoideum cells. Analogous processes take place in diverse situations (such as cardiac tissue, where spiral waves occur in potentially fatal ventricular fibrillation) so a deeper understanding of this additional layer of self-organized pattern formation would be beneficial to a wide range of applications. One of the most striking differences between pattern-forming systems in physics or chemistry and those in biology is the potential importance of variability. In the former, system components are essentially identical with random fluctuations determining the details of the self-organization process and the resulting patterns. In biology, due to variability, the properties of potentially very few cells can have a driving influence on the resulting asymptotic collective state of the colony. Variability is one means of implementing a few-element control on the collective mode. Regulatory architectures, parameters of signaling cascades, and properties of structure formation processes can be "reverse-engineered" from observed spatiotemporal patterns, as different types of regulation and forms of interactions between the constituents can lead to markedly different correlations. The power of this biology-inspired view of pattern formation lies in building a bridge between two scales: the patterns as a collective state of a very large number of cells on the one hand, and the internal

  9. Purification by reflux electrophoresis of whey proteins and of a recombinant protein expressed in Dictyostelium discoideum.


    Corthals, G L; Collins, B M; Mabbutt, B C; Williams, K L; Gooley, A A


    Protein purification that combines the use of molecular mass exclusion membranes with electrophoresis is particularly powerful as it uses properties inherent to both techniques. The use of membranes allows efficient processing and is easily scaled up, while electrophoresis permits high resolution separation under mild conditions. The Gradiflow apparatus combines these two technologies as it uses polyacrylamide membranes to influence electrokinetic separations. The reflux electrophoresis process consists of a series of cycles incorporating a forward phase and a reverse phase. The forward phase involves collection of a target protein that passes through a separation membrane before trailing proteins in the same solution. The forward phase is repeated following clearance of the membrane in the reverse phase by reversing the current. We have devised a strategy to establish optimal reflux separation parameters, where membranes are chosen for a particular operating range and protein transfer is monitored at different pH values. In addition, forward and reverse phase times are determined during this process. Two examples of the reflux method are described. In the first case, we described the purification strategy for proteins from a complex mixture which contains proteins of higher electrophoretic mobility than the target protein. This is a two-step procedure, where first proteins of higher mobility than the target protein are removed from the solution by a series of reflux cycles, so that the target protein remains as the leading fraction. In the second step the target protein is collected, as it has become the leading fraction of the remaining proteins. In the second example we report the development of a reflux strategy which allowed a rapid one-step preparative purification of a recombinant protein, expressed in Dictyostelium discoideum. These strategies demonstrate that the Gradiflow is amenable to a wide range of applications, as the protein of interest is not

  10. Association of the cyclic AMP chemotaxis receptor with the detergent- insoluble cytoskeleton of Dictyostelium discoideum

    PubMed Central


    Treatment of 6-h differentiated Dictyostelium discoideum cells with the nonionic detergent Triton X-100 dissolves away membranes and soluble components, as judged by marker enzyme distributions, leaving intact a cytoskeletal residue that contains approximately 10% of the cell protein and 50% of the actin. Nitrobenzooxadiazo-phallacidin staining for F-actin and electron microscopy of detergent-extracted whole-mounts indicate that the cytoskeletons retain the size and shape of intact cells and contain F-actin in cortical meshworks. The cytoskeletons contain little if any remaining membrane material by morphological criteria, and the plasma membrane enzymes cyclic nucleotide phosphodiesterase and alkaline phosphatase are absent from the insoluble residue, which retains only 15% of the membrane concanavalin A-binding glycoproteins. This detergent-insoluble residue retains a specific [3H]cAMP-binding site with the nucleotide specificity, rapid kinetics and approximate affinity of the cAMP receptor on intact cells. Upon detergent extraction of cells, the number of cAMP-binding sites increases 20-70%. The binding site is attached to the insoluble residue whether or not the cAMP receptor is occupied at the time of detergent addition. The pH dependence for recovery of the insoluble cAMP-binding site is much sharper than that on intact cells or membranes with an optimum at pH 6.1. Conditions of pH and ionic composition that lead to disruption of the cytoskeleton upon detergent treatment also result in the loss of cAMP binding. During differentiation, the detergent- insoluble cAMP binding increases in parallel with cell surface cAMP receptors and chemotaxis to cAMP. PMID:6693497

  11. The cytohesin paralog Sec7 of Dictyostelium discoideum is required for phagocytosis and cell motility

    PubMed Central


    Background Dictyostelium harbors several paralogous Sec7 genes that encode members of three subfamilies of the Sec7 superfamily of guanine nucleotide exchange factors. One of them is the cytohesin family represented by three members in D. discoideum, SecG, Sec7 and a further protein distinguished by several transmembrane domains. Cytohesins are characterized by a Sec7-PH tandem domain and have roles in cell adhesion and migration. Results We study here Sec7. In vitro its PH domain bound preferentially to phosphatidylinositol 3,4-bisphosphate (PI(3,4)P2), phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) and phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3). When following the distribution of GFP-Sec7 in vivo we observed the protein in the cytosol and at the plasma membrane. Strikingly, when cells formed pseudopods, macropinosomes or phagosomes, GFP-Sec7 was conspicuously absent from areas of the plasma membrane which were involved in these processes. Mutant cells lacking Sec7 exhibited an impaired phagocytosis and showed significantly reduced speed and less persistence during migration. Cellular properties associated with mammalian cytohesins like cell-cell and cell-substratum adhesion were not altered. Proteins with roles in membrane trafficking and signal transduction have been identified as putative interaction partners consistent with the data obtained from mutant analysis. Conclusions Sec7 is a cytosolic component and is associated with the plasma membrane in a pattern distinctly different from the accumulation of PI(3,4,5)P3. Mutant analysis reveals that loss of the protein affects cellular processes that involve membrane flow and the actin cytoskeleton. PMID:23915312

  12. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene

    PubMed Central

    Rodriguez-Centeno, Javier; Sastre, Leandro


    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation. PMID:26840347

  13. Cell behavior in Dictyostelium discoideum: preaggregation response to localized cyclic AMP pulses

    PubMed Central


    The motion of cells in the aggregation phase of Dictyostelium discoideum development is complex. To probe its mechanisms we applied precisely timed (+/- 1 s) and positioned (+/-2 micrometers) pulses of cyclic AMP to fields of cells of moderate density using a micropipette. We recorded cell behavior by time lapse microcinematography and extracted cell motion data from the film with our Galatea computer system. Analysis of these data reveals: (a) Chemotaxis lasts only about as long as the cyclic AMP signal; in particular, brief pulses (approximately 5 s) do not induce chemotaxis. (b) Chemotactic competence increases gradually from within an hour after the initiation of development (starvation) to full competence at approximately 15 h when aggregation begins under our conditions. (c) Cell motion reverses rapidly (within 20 s) when the external gradient is reversed. There is no refractory period for motion. We present a new description of the process of aggregation consistent with our result and other recent findings. (d) The behavioral response to cyclic AMP includes a phenomenon we call "cringing." In a prototypical cringe the cell speed drops within 3 s after a brief cyclic AMP stimulus, and the cell stops and rounds and then resumes motion after 25 s. (e) The development of the speed response in cringing as the cells age closely parallels the development of the cyclic AMP-induced light-scattering response of cells in suspension. (f) Cringing occurs in natural populations during weak oriented movement. The computerized analysis of cell behavior proves to be a powerful technique which can reveal significant phenomena that are not apparent to the eye even after repeated examination of the film. PMID:6282894

  14. Relevant Genes Linked to Virulence Are Required for Salmonella Typhimurium to Survive Intracellularly in the Social Amoeba Dictyostelium discoideum.


    Riquelme, Sebastián; Varas, Macarena; Valenzuela, Camila; Velozo, Paula; Chahin, Nicolás; Aguilera, Paulina; Sabag, Andrea; Labra, Bayron; Álvarez, Sergio A; Chávez, Francisco P; Santiviago, Carlos A


    The social amoeba Dictyostelium discoideum has proven to be a useful model for studying relevant aspects of the host-pathogen interaction. In this work, D. discoideum was used as a model to study the ability of Salmonella Typhimurium to survive in amoebae and to evaluate the contribution of selected genes in this process. To do this, we performed infection assays using axenic cultures of D. discoideum co-cultured with wild-type S. Typhimurium and/or defined mutant strains. Our results confirmed that wild-type S. Typhimurium is able to survive intracellularly in D. discoideum. In contrast, mutants ΔaroA and ΔwaaL are defective in intracellular survival in this amoeba. Next, we included in our study a group of mutants in genes directly linked to Salmonella virulence. Of note, mutants ΔinvA, ΔssaD, ΔclpV, and ΔphoPQ also showed an impaired ability to survive intracellularly in D. discoideum. This indicates that S. Typhimurium requires a functional biosynthetic pathway of aromatic compounds, a lipopolysaccharide containing a complete O-antigen, the type III secretion systems (T3SS) encoded in SPI-1 and SPI-2, the type VI secretion system (T6SS) encoded in SPI-6 and PhoP/PhoQ two-component system to survive in D. discoideum. To our knowledge, this is the first report on the requirement of O-antigen and T6SS in the survival of Salmonella within amoebae. In addition, mutants ΔinvA and ΔssaD were internalized in higher numbers than the wild-type strain during competitive infections, suggesting that S. Typhimurium requires the T3SS encoded in SPI-1 and SPI-2 to evade phagocytosis by D. discoideum. Altogether, these results indicate that S. Typhimurium exploits a common set of genes and molecular mechanisms to survive within amoeba and animal host cells. The use of D. discoideum as a model for host-pathogen interactions will allow us to discover the gene repertoire used by Salmonella to survive inside the amoeba and to study the cellular processes that are affected

  15. Relevant Genes Linked to Virulence Are Required for Salmonella Typhimurium to Survive Intracellularly in the Social Amoeba Dictyostelium discoideum

    PubMed Central

    Riquelme, Sebastián; Varas, Macarena; Valenzuela, Camila; Velozo, Paula; Chahin, Nicolás; Aguilera, Paulina; Sabag, Andrea; Labra, Bayron; Álvarez, Sergio A.; Chávez, Francisco P.; Santiviago, Carlos A.


    The social amoeba Dictyostelium discoideum has proven to be a useful model for studying relevant aspects of the host-pathogen interaction. In this work, D. discoideum was used as a model to study the ability of Salmonella Typhimurium to survive in amoebae and to evaluate the contribution of selected genes in this process. To do this, we performed infection assays using axenic cultures of D. discoideum co-cultured with wild-type S. Typhimurium and/or defined mutant strains. Our results confirmed that wild-type S. Typhimurium is able to survive intracellularly in D. discoideum. In contrast, mutants ΔaroA and ΔwaaL are defective in intracellular survival in this amoeba. Next, we included in our study a group of mutants in genes directly linked to Salmonella virulence. Of note, mutants ΔinvA, ΔssaD, ΔclpV, and ΔphoPQ also showed an impaired ability to survive intracellularly in D. discoideum. This indicates that S. Typhimurium requires a functional biosynthetic pathway of aromatic compounds, a lipopolysaccharide containing a complete O-antigen, the type III secretion systems (T3SS) encoded in SPI-1 and SPI-2, the type VI secretion system (T6SS) encoded in SPI-6 and PhoP/PhoQ two-component system to survive in D. discoideum. To our knowledge, this is the first report on the requirement of O-antigen and T6SS in the survival of Salmonella within amoebae. In addition, mutants ΔinvA and ΔssaD were internalized in higher numbers than the wild-type strain during competitive infections, suggesting that S. Typhimurium requires the T3SS encoded in SPI-1 and SPI-2 to evade phagocytosis by D. discoideum. Altogether, these results indicate that S. Typhimurium exploits a common set of genes and molecular mechanisms to survive within amoeba and animal host cells. The use of D. discoideum as a model for host–pathogen interactions will allow us to discover the gene repertoire used by Salmonella to survive inside the amoeba and to study the cellular processes that are affected

  16. Relevant Genes Linked to Virulence Are Required for Salmonella Typhimurium to Survive Intracellularly in the Social Amoeba Dictyostelium discoideum.


    Riquelme, Sebastián; Varas, Macarena; Valenzuela, Camila; Velozo, Paula; Chahin, Nicolás; Aguilera, Paulina; Sabag, Andrea; Labra, Bayron; Álvarez, Sergio A; Chávez, Francisco P; Santiviago, Carlos A


    The social amoeba Dictyostelium discoideum has proven to be a useful model for studying relevant aspects of the host-pathogen interaction. In this work, D. discoideum was used as a model to study the ability of Salmonella Typhimurium to survive in amoebae and to evaluate the contribution of selected genes in this process. To do this, we performed infection assays using axenic cultures of D. discoideum co-cultured with wild-type S. Typhimurium and/or defined mutant strains. Our results confirmed that wild-type S. Typhimurium is able to survive intracellularly in D. discoideum. In contrast, mutants ΔaroA and ΔwaaL are defective in intracellular survival in this amoeba. Next, we included in our study a group of mutants in genes directly linked to Salmonella virulence. Of note, mutants ΔinvA, ΔssaD, ΔclpV, and ΔphoPQ also showed an impaired ability to survive intracellularly in D. discoideum. This indicates that S. Typhimurium requires a functional biosynthetic pathway of aromatic compounds, a lipopolysaccharide containing a complete O-antigen, the type III secretion systems (T3SS) encoded in SPI-1 and SPI-2, the type VI secretion system (T6SS) encoded in SPI-6 and PhoP/PhoQ two-component system to survive in D. discoideum. To our knowledge, this is the first report on the requirement of O-antigen and T6SS in the survival of Salmonella within amoebae. In addition, mutants ΔinvA and ΔssaD were internalized in higher numbers than the wild-type strain during competitive infections, suggesting that S. Typhimurium requires the T3SS encoded in SPI-1 and SPI-2 to evade phagocytosis by D. discoideum. Altogether, these results indicate that S. Typhimurium exploits a common set of genes and molecular mechanisms to survive within amoeba and animal host cells. The use of D. discoideum as a model for host-pathogen interactions will allow us to discover the gene repertoire used by Salmonella to survive inside the amoeba and to study the cellular processes that are affected

  17. Relevant Genes Linked to Virulence Are Required for Salmonella Typhimurium to Survive Intracellularly in the Social Amoeba Dictyostelium discoideum

    PubMed Central

    Riquelme, Sebastián; Varas, Macarena; Valenzuela, Camila; Velozo, Paula; Chahin, Nicolás; Aguilera, Paulina; Sabag, Andrea; Labra, Bayron; Álvarez, Sergio A.; Chávez, Francisco P.; Santiviago, Carlos A.


    The social amoeba Dictyostelium discoideum has proven to be a useful model for studying relevant aspects of the host-pathogen interaction. In this work, D. discoideum was used as a model to study the ability of Salmonella Typhimurium to survive in amoebae and to evaluate the contribution of selected genes in this process. To do this, we performed infection assays using axenic cultures of D. discoideum co-cultured with wild-type S. Typhimurium and/or defined mutant strains. Our results confirmed that wild-type S. Typhimurium is able to survive intracellularly in D. discoideum. In contrast, mutants ΔaroA and ΔwaaL are defective in intracellular survival in this amoeba. Next, we included in our study a group of mutants in genes directly linked to Salmonella virulence. Of note, mutants ΔinvA, ΔssaD, ΔclpV, and ΔphoPQ also showed an impaired ability to survive intracellularly in D. discoideum. This indicates that S. Typhimurium requires a functional biosynthetic pathway of aromatic compounds, a lipopolysaccharide containing a complete O-antigen, the type III secretion systems (T3SS) encoded in SPI-1 and SPI-2, the type VI secretion system (T6SS) encoded in SPI-6 and PhoP/PhoQ two-component system to survive in D. discoideum. To our knowledge, this is the first report on the requirement of O-antigen and T6SS in the survival of Salmonella within amoebae. In addition, mutants ΔinvA and ΔssaD were internalized in higher numbers than the wild-type strain during competitive infections, suggesting that S. Typhimurium requires the T3SS encoded in SPI-1 and SPI-2 to evade phagocytosis by D. discoideum. Altogether, these results indicate that S. Typhimurium exploits a common set of genes and molecular mechanisms to survive within amoeba and animal host cells. The use of D. discoideum as a model for host–pathogen interactions will allow us to discover the gene repertoire used by Salmonella to survive inside the amoeba and to study the cellular processes that are affected

  18. Whole genome sequencing of mutation accumulation lines reveals a low mutation rate in the social amoeba Dictyostelium discoideum.


    Saxer, Gerda; Havlak, Paul; Fox, Sara A; Quance, Michael A; Gupta, Sharu; Fofanov, Yuriy; Strassmann, Joan E; Queller, David C


    Spontaneous mutations play a central role in evolution. Despite their importance, mutation rates are some of the most elusive parameters to measure in evolutionary biology. The combination of mutation accumulation (MA) experiments and whole-genome sequencing now makes it possible to estimate mutation rates by directly observing new mutations at the molecular level across the whole genome. We performed an MA experiment with the social amoeba Dictyostelium discoideum and sequenced the genomes of three randomly chosen lines using high-throughput sequencing to estimate the spontaneous mutation rate in this model organism. The mitochondrial mutation rate of 6.76×10(-9), with a Poisson confidence interval of 4.1×10(-9) - 9.5×10(-9), per nucleotide per generation is slightly lower than estimates for other taxa. The mutation rate estimate for the nuclear DNA of 2.9×10(-11), with a Poisson confidence interval ranging from 7.4×10(-13) to 1.6×10(-10), is the lowest reported for any eukaryote. These results are consistent with low microsatellite mutation rates previously observed in D. discoideum and low levels of genetic variation observed in wild D. discoideum populations. In addition, D. discoideum has been shown to be quite resistant to DNA damage, which suggests an efficient DNA-repair mechanism that could be an adaptation to life in soil and frequent exposure to intracellular and extracellular mutagenic compounds. The social aspect of the life cycle of D. discoideum and a large portion of the genome under relaxed selection during vegetative growth could also select for a low mutation rate. This hypothesis is supported by a significantly lower mutation rate per cell division in multicellular eukaryotes compared with unicellular eukaryotes. PMID:23056439

  19. A Novel Glycolipid Biosurfactant Confers Grazing Resistance upon Pantoea ananatis BRT175 against the Social Amoeba Dictyostelium discoideum.


    Smith, Derek D N; Nickzad, Arvin; Déziel, Eric; Stavrinides, John


    Pantoea is a versatile genus of bacteria with both plant- and animal-pathogenic strains, some of which have been suggested to cause human infections. There is, however, limited knowledge on the potential determinants used for host association and pathogenesis in animal systems. In this study, we used the model host Dictyostelium discoideum to show that isolates of Pantoea ananatis exhibit differential grazing susceptibility, with some being resistant to grazing by the amoebae. We carried out a high-throughput genetic screen of one grazing-resistant isolate, P. ananatis BRT175, using the D. discoideum pathosystem to identify genes responsible for the resistance phenotype. Among the 26 candidate genes involved in grazing resistance, we identified rhlA and rhlB, which we show are involved in the biosynthesis of a biosurfactant that enables swarming motility in P. ananatis BRT175. Using liquid chromatography-mass spectrometry (LC-MS), the biosurfactant was shown to be a glycolipid with monohexose-C10-C10 as the primary congener. We show that this novel glycolipid biosurfactant is cytotoxic to the amoebae and is capable of compromising cellular integrity, leading to cell lysis. The production of this biosurfactant may be important for bacterial survival in the environment and could contribute to the establishment of opportunistic infections. IMPORTANCE The genetic factors used for host interaction by the opportunistic human pathogen Pantoea ananatis are largely unknown. We identified two genes that are important for the production of a biosurfactant that confers grazing resistance against the social amoeba Dictyostelium discoideum. We show that the biosurfactant, which exhibits cytotoxicity toward the amoebae, is a glycolipid that incorporates a hexose rather than rhamnose. The production of this biosurfactant may confer a competitive advantage in the environment and could potentially contribute to the establishment of opportunistic infections. PMID:27303689

  20. A Novel Glycolipid Biosurfactant Confers Grazing Resistance upon Pantoea ananatis BRT175 against the Social Amoeba Dictyostelium discoideum.


    Smith, Derek D N; Nickzad, Arvin; Déziel, Eric; Stavrinides, John


    Pantoea is a versatile genus of bacteria with both plant- and animal-pathogenic strains, some of which have been suggested to cause human infections. There is, however, limited knowledge on the potential determinants used for host association and pathogenesis in animal systems. In this study, we used the model host Dictyostelium discoideum to show that isolates of Pantoea ananatis exhibit differential grazing susceptibility, with some being resistant to grazing by the amoebae. We carried out a high-throughput genetic screen of one grazing-resistant isolate, P. ananatis BRT175, using the D. discoideum pathosystem to identify genes responsible for the resistance phenotype. Among the 26 candidate genes involved in grazing resistance, we identified rhlA and rhlB, which we show are involved in the biosynthesis of a biosurfactant that enables swarming motility in P. ananatis BRT175. Using liquid chromatography-mass spectrometry (LC-MS), the biosurfactant was shown to be a glycolipid with monohexose-C10-C10 as the primary congener. We show that this novel glycolipid biosurfactant is cytotoxic to the amoebae and is capable of compromising cellular integrity, leading to cell lysis. The production of this biosurfactant may be important for bacterial survival in the environment and could contribute to the establishment of opportunistic infections. IMPORTANCE The genetic factors used for host interaction by the opportunistic human pathogen Pantoea ananatis are largely unknown. We identified two genes that are important for the production of a biosurfactant that confers grazing resistance against the social amoeba Dictyostelium discoideum. We show that the biosurfactant, which exhibits cytotoxicity toward the amoebae, is a glycolipid that incorporates a hexose rather than rhamnose. The production of this biosurfactant may confer a competitive advantage in the environment and could potentially contribute to the establishment of opportunistic infections.

  1. A Novel Glycolipid Biosurfactant Confers Grazing Resistance upon Pantoea ananatis BRT175 against the Social Amoeba Dictyostelium discoideum

    PubMed Central

    Smith, Derek D. N.; Nickzad, Arvin


    ABSTRACT Pantoea is a versatile genus of bacteria with both plant- and animal-pathogenic strains, some of which have been suggested to cause human infections. There is, however, limited knowledge on the potential determinants used for host association and pathogenesis in animal systems. In this study, we used the model host Dictyostelium discoideum to show that isolates of Pantoea ananatis exhibit differential grazing susceptibility, with some being resistant to grazing by the amoebae. We carried out a high-throughput genetic screen of one grazing-resistant isolate, P. ananatis BRT175, using the D. discoideum pathosystem to identify genes responsible for the resistance phenotype. Among the 26 candidate genes involved in grazing resistance, we identified rhlA and rhlB, which we show are involved in the biosynthesis of a biosurfactant that enables swarming motility in P. ananatis BRT175. Using liquid chromatography-mass spectrometry (LC-MS), the biosurfactant was shown to be a glycolipid with monohexose-C10-C10 as the primary congener. We show that this novel glycolipid biosurfactant is cytotoxic to the amoebae and is capable of compromising cellular integrity, leading to cell lysis. The production of this biosurfactant may be important for bacterial survival in the environment and could contribute to the establishment of opportunistic infections. IMPORTANCE The genetic factors used for host interaction by the opportunistic human pathogen Pantoea ananatis are largely unknown. We identified two genes that are important for the production of a biosurfactant that confers grazing resistance against the social amoeba Dictyostelium discoideum. We show that the biosurfactant, which exhibits cytotoxicity toward the amoebae, is a glycolipid that incorporates a hexose rather than rhamnose. The production of this biosurfactant may confer a competitive advantage in the environment and could potentially contribute to the establishment of opportunistic infections. PMID

  2. Identification of a high-affinity Ca sup 2+ pump associated with endocytotic vesicles in Dictyostelium discoideum

    SciTech Connect

    Milne, J.L.; Coukell, M.B. )


    In the cellular slime mold Dictyostelium discoideum, changes in free cytosolic Ca{sup 2+} are thought to regulate certain processes during cell aggregation and differentiation. To understand the mechanisms controlling free Ca{sup 2+} levels in this organism, the authors previously isolated and characterized an ATP/Mg{sup 2+}-dependent, high-affinity Ca{sup 2+} pump which appeared to be a component of inside-out plasma membrane vesicles. In this report, they demonstrate that a high-affinity Ca{sup 2+} pump, with properties virtually identical to the isolated pump, can be detected in filipin- or digitonin-permeabilized cells of Dictyostelium. Moreover, Ca{sup 2+}-pumping vesicles, which migrate on Percoll/KCl gradients like the vesicles identified earlier, can be isolated from the permeabilized cells. Results of additional experiments suggest that this intracellular Ca{sup 2+} transporter is associated with a high-capacity non-IP{sub 3}-releasable Ca{sup 2+} store which is generated by endocytosis. A possible role for this store in maintaining Ca{sup 2+} homeostasis in Dictyostelium is discussed.

  3. The actinome of Dictyostelium discoideum in comparison to actins and actin-related proteins from other organisms.


    Joseph, Jayabalan M; Fey, Petra; Ramalingam, Nagendran; Liu, Xiao I; Rohlfs, Meino; Noegel, Angelika A; Müller-Taubenberger, Annette; Glöckner, Gernot; Schleicher, Michael


    Actin belongs to the most abundant proteins in eukaryotic cells which harbor usually many conventional actin isoforms as well as actin-related proteins (Arps). To get an overview over the sometimes confusing multitude of actins and Arps, we analyzed the Dictyostelium discoideum actinome in detail and compared it with the genomes from other model organisms. The D. discoideum actinome comprises 41 actins and actin-related proteins. The genome contains 17 actin genes which most likely arose from consecutive gene duplications, are all active, in some cases developmentally regulated and coding for identical proteins (Act8-group). According to published data, the actin fraction in a D. discoideum cell consists of more than 95% of these Act8-type proteins. The other 16 actin isoforms contain a conventional actin motif profile as well but differ in their protein sequences. Seven actin genes are potential pseudogenes. A homology search of the human genome using the most typical D. discoideum actin (Act8) as query sequence finds the major actin isoforms such as cytoplasmic beta-actin as best hit. This suggests that the Act8-group represents a nearly perfect actin throughout evolution. Interestingly, limited data from D. fasciculatum, a more ancient member among the social amoebae, show different relationships between conventional actins. The Act8-type isoform is most conserved throughout evolution. Modeling of the putative structures suggests that the majority of the actin-related proteins is functionally unrelated to canonical actin. The data suggest that the other actin variants are not necessary for the cytoskeleton itself but rather regulators of its dynamical features or subunits in larger protein complexes.

  4. Flow-Driven Waves and Phase-Locked Self-Organization in Quasi-One-Dimensional Colonies of Dictyostelium discoideum

    NASA Astrophysics Data System (ADS)

    Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.


    We report experiments on flow-driven waves in a microfluidic channel containing the signaling slime mold Dictyostelium discoideum. The observed cyclic adenosine monophosphate (cAMP) wave trains developed spontaneously in the presence of flow and propagated with the velocity proportional to the imposed flow velocity. The period of the wave trains was independent of the flow velocity. Perturbations of flow-driven waves via external periodic pulses of the signaling agent cAMP induced 1 ∶1 , 2 ∶1 , 3 ∶1 , and 1 ∶2 frequency responses, reminiscent of Arnold tongues in forced oscillatory systems. We expect our observations to be generic to active media governed by reaction-diffusion-advection dynamics, where spatially bound autocatalytic processes occur under flow conditions.

  5. Cyclophilins of a novel subfamily interact with SNW/SKIP coregulator in Dictyostelium discoideum and Schizosaccharomyces pombe.


    Skruzný, M; Ambrozková, M; Fuková, I; Martínková, K; Blahůsková, A; Hamplová, L; Půta, F; Folk, P


    We screened the Dictyostelium discoideum two-hybrid cDNA library with the SNW/SKIP transcription coregulator SnwA and identified a novel cyclophilin CypE. Independently, the Schizosaccharomyces pombe cDNA library was screened with the SnwA ortholog Snw1 and the ortholog of CypE (named Cyp2) was found. Both cyclophilins bind the respective SNW protein in their autologous systems. The interaction was localized to the N-terminal part of SnwA as well as of Snw1. CypE was confirmed in vitro to be a cyclosporin A-sensitive peptidyl-prolyl cis-trans isomerase. Remarkably, both SNW proteins bind the cyclophilins in a cyclosporin A independent manner, possibly serving as adaptors for these novel isomerases. These results are the first characterization of the members of a novel cyclophilin subfamily, which includes the human CGI-124/PPIL1 protein. PMID:11690648

  6. Flow-driven waves and phase-locked self-organization in quasi-one-dimensional colonies of Dictyostelium discoideum.


    Gholami, A; Steinbock, O; Zykov, V; Bodenschatz, E


    We report experiments on flow-driven waves in a microfluidic channel containing the signaling slime mold Dictyostelium discoideum. The observed cyclic adenosine monophosphate (cAMP) wave trains developed spontaneously in the presence of flow and propagated with the velocity proportional to the imposed flow velocity. The period of the wave trains was independent of the flow velocity. Perturbations of flow-driven waves via external periodic pulses of the signaling agent cAMP induced 1∶1, 2∶1, 3∶1, and 1∶2 frequency responses, reminiscent of Arnold tongues in forced oscillatory systems. We expect our observations to be generic to active media governed by reaction-diffusion-advection dynamics, where spatially bound autocatalytic processes occur under flow conditions. PMID:25615506

  7. Fluorographic detection of tritiated glycopeptides and oligosaccharides separated on polyacrylamide gels: analysis of glycans from Dictyostelium discoideum glycoproteins

    SciTech Connect

    Prem Das, O.; Henderson, E.J.


    Previous workers have shown that oligosaccharides and glycopeptides can be separated by electrophoresis in buffers containing borate ions. However, normal fluorography of tritium-labeled structures cannot be performed because the glycans are soluble and can diffuse during equilibration with scintillants. This problem has been circumvented by equilibration of the gel with 2,5-diphenyloxazole (PPO) prior to electrophoresis. The presence of PPO in the gel during electrophoresis does not alter mobility of the glycopeptides and oligosaccharides. After electrophoresis, the gel is simply dried and fluorography performed. This allows sensitive and precise comparisons of labeled samples in parallel lanes of a slab gel and, since mobilities are highly reproducible, between different gels. The procedure is preparative in that after fluorography the gel bands can be quantitatively eluted for further study, without any apparent modification by the procedure. In this report, the procedure is illustrated by fractionation of both neutral and anionic glycopeptides produced by the cellular slime mold Dictyostelium discoideum.

  8. The helC gene encodes a putative DEAD-box RNA helicase required for development in Dictyostelium discoideum.


    Machesky, L M; Insall, R H; Kay, R R


    DEAD-box RNA helicases, defined by the sequence Asp-Glu-Ala-Asp (DEAD, in single-letter amino-acid code), regulate RNA unwinding and secondary structure in an ATP-dependent manner in vitro [1] and control mRNA stability and protein translation. Both yeast and mammals have large families of DEAD-box proteins, many of unknown function. We have disrupted a Dictyostelium discoideum gene, helC, which encodes helicase C, a member of the DEAD-box family of RNA helicases that shows strong homology to the product of the essential Saccharomyces cerevisiae gene dbp5 [2] and to related helicases in mouse and Schizosaccharomyces pombe. The HelC protein also shows weaker homology to the translation initiation factor elF-4a. Other DEAD-box-containing proteins, which are less closely related to HelC, have been implicated in developmental roles in Drosophila [3] and Xenopus laevis; one example is the Xenopus Vasa-like protein (XVLP) [4-6]. In Drosophila and Xenopus, Vasa and XVLP, respectively, are required for the establishment of tissue polarity during development. In yeast, DEAD-box helicases such as Prp8 [7] are components of the spliceosome and connect pre-mRNA splicing with the cell cycle. Disruption of the helC gene in D. discoideum led to developmental asynchrony, failure to differentiate and aberrant morphogenesis. We postulate that one reason for the existence of large families of homologous DEAD-box proteins in yeast, mammals and Dictyostelium could be that some DEAD-box proteins have developmentally specific roles regulating protein translation or mRNA stability. PMID:9601648

  9. Imaging G-protein coupled receptor (GPCR)-mediated signaling events that control chemotaxis of Dictyostelium discoideum.


    Xu, Xuehua; Jin, Tian


    Many eukaryotic cells can detect gradients of chemical signals in their environments and migrate accordingly (1). This guided cell migration is referred as chemotaxis, which is essential for various cells to carry out their functions such as trafficking of immune cells and patterning of neuronal cells (2, 3). A large family of G-protein coupled receptors (GPCRs) detects variable small peptides, known as chemokines, to direct cell migration in vivo (4). The final goal of chemotaxis research is to understand how a GPCR machinery senses chemokine gradients and controls signaling events leading to chemotaxis. To this end, we use imaging techniques to monitor, in real time, spatiotemporal concentrations of chemoattractants, cell movement in a gradient of chemoattractant, GPCR mediated activation of heterotrimeric G-protein, and intracellular signaling events involved in chemotaxis of eukaryotic cells (5-8). The simple eukaryotic organism, Dictyostelium discoideum, displays chemotaxic behaviors that are similar to those of leukocytes, and D. discoideum is a key model system for studying eukaryotic chemotaxis. As free-living amoebae, D. discoideum cells divide in rich medium. Upon starvation, cells enter a developmental program in which they aggregate through cAMP-mediated chemotaxis to form multicullular structures. Many components involved in chemotaxis to cAMP have been identified in D. discoideum. The binding of cAMP to a GPCR (cAR1) induces dissociation of heterotrimeric G-proteins into Gγ and Gβγ subunits (7, 9, 10). Gβγ subunits activate Ras, which in turn activates PI3K, converting PIP(2;) into PIP(3;) on the cell membrane (11-13). PIP(3;) serve as binding sites for proteins with pleckstrin Homology (PH) domains, thus recruiting these proteins to the membrane (14, 15). Activation of cAR1 receptors also controls the membrane associations of PTEN, which dephosphorylates PIP(3;) to PIP(2;)(16, 17). The molecular mechanisms are evolutionarily conserved in

  10. Sex ratio and gamete size across eastern North America in Dictyostelium discoideum, a social amoeba with three sexes.


    Douglas, T E; Strassmann, J E; Queller, D C


    Theory indicates that numbers of mating types should tend towards infinity or remain at two. The social amoeba, Dictyostelium discoideum, however, has three mating types. It is therefore a mystery how this species has broken the threshold of two mating types, but has not increased towards a much higher number. Frequency-dependent selection on rare types in combination with isogamy, a form of reproduction involving gametes similar in size, could explain the evolution of multiple mating types in this system. Other factors, such as drift, may be preventing the evolution of more than three. We first looked for evidence of isogamy by measuring gamete size associated with each type. We found no evidence of size dissimilarities between gametes. We then looked for evidence of balancing selection, by examining mating type distributions in natural populations and comparing genetic differentiation at the mating type locus to that at more neutral loci. We found that mating type frequency varied among the three populations we examined, with only one of the three showing an even sex ratio, which does not support balancing selection. However, we found more population structure at neutral loci than the mating type locus, suggesting that the three mating types are indeed maintained at intermediate frequencies by balancing selection. Overall, the data are consistent with balancing selection acting on D. discoideum mating types, but with a sufficiently weak rare sex advantage to allow for drift, a potential explanation for why these amoebae have only three mating types.

  11. Sex ratio and gamete size across eastern North America in Dictyostelium discoideum, a social amoeba with three sexes.


    Douglas, T E; Strassmann, J E; Queller, D C


    Theory indicates that numbers of mating types should tend towards infinity or remain at two. The social amoeba, Dictyostelium discoideum, however, has three mating types. It is therefore a mystery how this species has broken the threshold of two mating types, but has not increased towards a much higher number. Frequency-dependent selection on rare types in combination with isogamy, a form of reproduction involving gametes similar in size, could explain the evolution of multiple mating types in this system. Other factors, such as drift, may be preventing the evolution of more than three. We first looked for evidence of isogamy by measuring gamete size associated with each type. We found no evidence of size dissimilarities between gametes. We then looked for evidence of balancing selection, by examining mating type distributions in natural populations and comparing genetic differentiation at the mating type locus to that at more neutral loci. We found that mating type frequency varied among the three populations we examined, with only one of the three showing an even sex ratio, which does not support balancing selection. However, we found more population structure at neutral loci than the mating type locus, suggesting that the three mating types are indeed maintained at intermediate frequencies by balancing selection. Overall, the data are consistent with balancing selection acting on D. discoideum mating types, but with a sufficiently weak rare sex advantage to allow for drift, a potential explanation for why these amoebae have only three mating types. PMID:27018644

  12. Dictyostelium discoideum as a surrogate host-microbe model for antivirulence screening in Pseudomonas aeruginosa PAO1.


    Bravo-Toncio, Catalina; Álvarez, Javiera A; Campos, Francisca; Ortíz-Severín, Javiera; Varas, Macarena; Cabrera, Ricardo; Lagos, Carlos F; Chávez, Francisco P


    The interest of the pharmaceutical industry in developing new antibiotics is decreasing, as established screening systems which identify compounds that kill or inhibit the growth of bacteria can no longer be used. Consequently, antimicrobial screening using classical minimum inhibitory concentration (MIC) measurements is becoming obsolete. The discovery of antimicrobial agents that specifically target a bacterial pathogen without affecting the host and its beneficial bacteria is a promising strategy. However, few host-microbe models are available for in vivo screening of novel antivirulence molecules. Here we designed high-throughput developmental assays in the social amoeba Dictyostelium discoideum to measure Pseudomonas aeruginosa virulence and to screen for novel antivirulence molecules without side effects to the host and its beneficial bacteria Klebsiella aerogenes. Thirty compounds were evaluated that had been previously selected by virtual screening for inhibitors of P. aeruginosa PAO1 polyphosphate kinase 1 (PaPPK1) and diverse compounds with combined PPK1 inhibitory and antivirulence activities were identified. This approach demonstrates that D. discoideum is a suitable surrogate host for preliminary high-throughput screening of antivirulence agents and that PPK1 is a suitable target for developing novel antivirulence compounds that can be further validated in mammalian models. PMID:27066943

  13. Amoeba-resisting bacteria found in multilamellar bodies secreted by Dictyostelium discoideum: social amoebae can also package bacteria.


    Paquet, Valérie E; Charette, Steve J


    Many bacteria can resist phagocytic digestion by various protozoa. Some of these bacteria (all human pathogens) are known to be packaged in multilamellar bodies produced in the phagocytic pathway of the protozoa and that are secreted into the extracellular milieu. Packaged bacteria are protected from harsh conditions, and the packaging process is suspected to promote bacterial persistence in the environment. To date, only a limited number of protozoa, belonging to free-living amoebae and ciliates, have been shown to perform bacteria packaging. It is still unknown if social amoebae can do bacteria packaging. The link between the capacity of 136 bacterial isolates to resist the grazing of the social amoeba Dictyostelium discoideum and to be packaged by this amoeba was investigated in the present study. The 45 bacterial isolates displaying a resisting phenotype were tested for their capacity to be packaged. A total of seven isolates from Cupriavidus, Micrococcus, Microbacterium and Rathayibacter genera seemed to be packaged and secreted by D. discoideum based on immunofluorescence results. Electron microscopy confirmed that the Cupriavidus and Rathayibacter isolates were formally packaged. These results show that social amoebae can package some bacteria from the environment revealing a new aspect of microbial ecology. PMID:26862140

  14. The TOM Complex of Amoebozoans: the Cases of the Amoeba Acanthamoeba castellanii and the Slime Mold Dictyostelium discoideum.


    Wojtkowska, Małgorzata; Buczek, Dorota; Stobienia, Olgierd; Karachitos, Andonis; Antoniewicz, Monika; Slocinska, Małgorzata; Makałowski, Wojciech; Kmita, Hanna


    Protein import into mitochondria requires a wide variety of proteins, forming complexes in both mitochondrial membranes. The TOM complex (translocase of the outer membrane) is responsible for decoding of targeting signals, translocation of imported proteins across or into the outer membrane, and their subsequent sorting. Thus the TOM complex is regarded as the main gate into mitochondria for imported proteins. Available data indicate that mitochondria of representative organisms from across the major phylogenetic lineages of eukaryotes differ in subunit organization of the TOM complex. The subunit organization of the TOM complex in the Amoebozoa is still elusive, so we decided to investigate its organization in the soil amoeba Acanthamoeba castellanii and the slime mold Dictyostelium discoideum. They represent two major subclades of the Amoebozoa: the Lobosa and Conosa, respectively. Our results confirm the presence of Tom70, Tom40 and Tom7 in the A. castellanii and D. discoideum TOM complex, while the presence of Tom22 and Tom20 is less supported. Interestingly, the Tom proteins display the highest similarity to Opisthokonta cognate proteins, with the exception of Tom40. Thus representatives of two major subclades of the Amoebozoa appear to be similar in organization of the TOM complex, despite differences in their lifestyle. PMID:26074248

  15. Dictyostelium discoideum as a surrogate host-microbe model for antivirulence screening in Pseudomonas aeruginosa PAO1.


    Bravo-Toncio, Catalina; Álvarez, Javiera A; Campos, Francisca; Ortíz-Severín, Javiera; Varas, Macarena; Cabrera, Ricardo; Lagos, Carlos F; Chávez, Francisco P


    The interest of the pharmaceutical industry in developing new antibiotics is decreasing, as established screening systems which identify compounds that kill or inhibit the growth of bacteria can no longer be used. Consequently, antimicrobial screening using classical minimum inhibitory concentration (MIC) measurements is becoming obsolete. The discovery of antimicrobial agents that specifically target a bacterial pathogen without affecting the host and its beneficial bacteria is a promising strategy. However, few host-microbe models are available for in vivo screening of novel antivirulence molecules. Here we designed high-throughput developmental assays in the social amoeba Dictyostelium discoideum to measure Pseudomonas aeruginosa virulence and to screen for novel antivirulence molecules without side effects to the host and its beneficial bacteria Klebsiella aerogenes. Thirty compounds were evaluated that had been previously selected by virtual screening for inhibitors of P. aeruginosa PAO1 polyphosphate kinase 1 (PaPPK1) and diverse compounds with combined PPK1 inhibitory and antivirulence activities were identified. This approach demonstrates that D. discoideum is a suitable surrogate host for preliminary high-throughput screening of antivirulence agents and that PPK1 is a suitable target for developing novel antivirulence compounds that can be further validated in mammalian models.

  16. The TOM Complex of Amoebozoans: the Cases of the Amoeba Acanthamoeba castellanii and the Slime Mold Dictyostelium discoideum.


    Wojtkowska, Małgorzata; Buczek, Dorota; Stobienia, Olgierd; Karachitos, Andonis; Antoniewicz, Monika; Slocinska, Małgorzata; Makałowski, Wojciech; Kmita, Hanna


    Protein import into mitochondria requires a wide variety of proteins, forming complexes in both mitochondrial membranes. The TOM complex (translocase of the outer membrane) is responsible for decoding of targeting signals, translocation of imported proteins across or into the outer membrane, and their subsequent sorting. Thus the TOM complex is regarded as the main gate into mitochondria for imported proteins. Available data indicate that mitochondria of representative organisms from across the major phylogenetic lineages of eukaryotes differ in subunit organization of the TOM complex. The subunit organization of the TOM complex in the Amoebozoa is still elusive, so we decided to investigate its organization in the soil amoeba Acanthamoeba castellanii and the slime mold Dictyostelium discoideum. They represent two major subclades of the Amoebozoa: the Lobosa and Conosa, respectively. Our results confirm the presence of Tom70, Tom40 and Tom7 in the A. castellanii and D. discoideum TOM complex, while the presence of Tom22 and Tom20 is less supported. Interestingly, the Tom proteins display the highest similarity to Opisthokonta cognate proteins, with the exception of Tom40. Thus representatives of two major subclades of the Amoebozoa appear to be similar in organization of the TOM complex, despite differences in their lifestyle.

  17. Biosynthesis of Dictyostelium discoideum differentiation-inducing factor by a hybrid type I fatty acid-type III polyketide synthase.


    Austin, Michael B; Saito, Tamao; Bowman, Marianne E; Haydock, Stephen; Kato, Atsushi; Moore, Bradley S; Kay, Robert R; Noel, Joseph P


    Differentiation-inducing factors (DIFs) are well known to modulate formation of distinct communal cell types from identical Dictyostelium discoideum amoebas, but DIF biosynthesis remains obscure. We report complimentary in vivo and in vitro experiments identifying one of two approximately 3,000-residue D. discoideum proteins, termed 'steely', as responsible for biosynthesis of the DIF acylphloroglucinol scaffold. Steely proteins possess six catalytic domains homologous to metazoan type I fatty acid synthases (FASs) but feature an iterative type III polyketide synthase (PKS) in place of the expected FAS C-terminal thioesterase used to off load fatty acid products. This new domain arrangement likely facilitates covalent transfer of steely N-terminal acyl products directly to the C-terminal type III PKS active sites, which catalyze both iterative polyketide extension and cyclization. The crystal structure of a steely C-terminal domain confirms conservation of the homodimeric type III PKS fold. These findings suggest new bioengineering strategies for expanding the scope of fatty acid and polyketide biosynthesis. PMID:16906151

  18. Amoeba-resisting bacteria found in multilamellar bodies secreted by Dictyostelium discoideum: social amoebae can also package bacteria.


    Paquet, Valérie E; Charette, Steve J


    Many bacteria can resist phagocytic digestion by various protozoa. Some of these bacteria (all human pathogens) are known to be packaged in multilamellar bodies produced in the phagocytic pathway of the protozoa and that are secreted into the extracellular milieu. Packaged bacteria are protected from harsh conditions, and the packaging process is suspected to promote bacterial persistence in the environment. To date, only a limited number of protozoa, belonging to free-living amoebae and ciliates, have been shown to perform bacteria packaging. It is still unknown if social amoebae can do bacteria packaging. The link between the capacity of 136 bacterial isolates to resist the grazing of the social amoeba Dictyostelium discoideum and to be packaged by this amoeba was investigated in the present study. The 45 bacterial isolates displaying a resisting phenotype were tested for their capacity to be packaged. A total of seven isolates from Cupriavidus, Micrococcus, Microbacterium and Rathayibacter genera seemed to be packaged and secreted by D. discoideum based on immunofluorescence results. Electron microscopy confirmed that the Cupriavidus and Rathayibacter isolates were formally packaged. These results show that social amoebae can package some bacteria from the environment revealing a new aspect of microbial ecology.

  19. The Ste20-like kinase SvkA of Dictyostelium discoideum is essential for late stages of cytokinesis.


    Rohlfs, Meino; Arasada, Rajesh; Batsios, Petros; Janzen, Julia; Schleicher, Michael


    The genome of the social amoeba Dictyostelium discoideum encodes approximately 285 kinases, which represents approximately 2.6% of the total genome and suggests a signaling complexity similar to that of yeasts and humans. The behavior of D. discoideum as an amoeba and during development relies heavily on fast rearrangements of the actin cytoskeleton. Here, we describe the knockout phenotype of the svkA gene encoding severin kinase, a homolog of the human MST3, MST4 and YSK1 kinases. SvkA-knockout cells show drastic defects in cytokinesis, development and directed slug movement. The defect in cytokinesis is most prominent, leading to multinucleated cells sometimes with >30 nuclei. The defect arises from the frequent inability of svkA-knockout cells to maintain symmetry during formation of the cleavage furrow and to sever the last cytosolic connection. We demonstrate that GFP-SvkA is enriched at the centrosome and localizes to the midzone during the final stage of cell division. This distribution is mediated by the C-terminal half of the kinase, whereas a rescue of the phenotypic changes requires the active N-terminal kinase domain as well. The data suggest that SvkA is part of a regulatory pathway from the centrosome to the midzone, thus regulating the completion of cell division. PMID:18042625

  20. Codon usage, genetic code and phylogeny of Dictyostelium discoideum mitochondrial DNA as deduced from a 7.3-kb region.


    Angata, K; Kuroe, K; Yanagisawa, K; Tanaka, Y


    We have sequenced a region (7,376-bp) of the mitochondrial (mt) DNA (54 kb) of the cellular slime mold, Dictyostelium discoideum. From the DNA and amino-acid sequence comparisons with known sequences, genes for ATPase subunit 9 (ATP9), cytochrome b (CYTB), NADH dehydrogenase subunits 1, 3 and 6 (ND1, ND3 and ND6), small subunit rRNA (SSU rRNA) and seven tRNAs (Arg, Asn, Cys, Lys, f-Met, Met and Pro) have been identified. The sequenced region of the mtDNA has a high average A + T-content (70.8%). The A + T-content of protein-genes (73.6%) is considerably higher than that of RNA genes (61.3%). Even with the strong AT-bias, the genetic code employed is most probably the universal one. All seven tRNAs are able to form typical clover leaf structures. The molecular phylogenetic trees of CYTB and SSU rRNA suggest that D. discoideum is closer to green plants than to animals and fungi. PMID:7736610

  1. The Ste20-like kinase SvkA of Dictyostelium discoideum is essential for late stages of cytokinesis.


    Rohlfs, Meino; Arasada, Rajesh; Batsios, Petros; Janzen, Julia; Schleicher, Michael


    The genome of the social amoeba Dictyostelium discoideum encodes approximately 285 kinases, which represents approximately 2.6% of the total genome and suggests a signaling complexity similar to that of yeasts and humans. The behavior of D. discoideum as an amoeba and during development relies heavily on fast rearrangements of the actin cytoskeleton. Here, we describe the knockout phenotype of the svkA gene encoding severin kinase, a homolog of the human MST3, MST4 and YSK1 kinases. SvkA-knockout cells show drastic defects in cytokinesis, development and directed slug movement. The defect in cytokinesis is most prominent, leading to multinucleated cells sometimes with >30 nuclei. The defect arises from the frequent inability of svkA-knockout cells to maintain symmetry during formation of the cleavage furrow and to sever the last cytosolic connection. We demonstrate that GFP-SvkA is enriched at the centrosome and localizes to the midzone during the final stage of cell division. This distribution is mediated by the C-terminal half of the kinase, whereas a rescue of the phenotypic changes requires the active N-terminal kinase domain as well. The data suggest that SvkA is part of a regulatory pathway from the centrosome to the midzone, thus regulating the completion of cell division.

  2. Clues to γ-secretase, huntingtin and Hirano body normal function using the model organism Dictyostelium discoideum.


    Myre, Michael A


    Many neurodegenerative disorders, although related by their destruction of brain function, display remarkable cellular and/or regional pathogenic specificity likely due to a deregulated functionality of the mutant protein. However, neurodegenerative disease genes, for example huntingtin (HTT), the ataxins, the presenilins (PSEN1/PSEN2) are not simply localized to neurons but are ubiquitously expressed throughout peripheral tissues; it is therefore paramount to properly understand the earliest precipitating events leading to neuronal pathogenesis to develop effective long-term therapies. This means, in no unequivocal terms, it is crucial to understand the gene's normal function. Unfortunately, many genes are often essential for embryogenesis which precludes their study in whole organisms. This is true for HTT, the β-amyloid precursor protein (APP) and presenilins, responsible for early onset Alzheimer's disease (AD). To better understand neurological disease in humans, many lower and higher eukaryotic models have been established. So the question arises: how reasonable is the use of organisms to study neurological disorders when the model of choice does not contain neurons? Here we will review the surprising, and novel emerging use of the model organism Dictyostelium discoideum, a species of soil-living amoeba, as a valuable biomedical tool to study the normal function of neurodegenerative genes. Historically, the evidence on the usefulness of simple organisms to understand the etiology of cellular pathology cannot be denied. But using an organism without a central nervous system to understand diseases of the brain? We will first introduce the life cycle of Dictyostelium, the presence of many disease genes in the genome and how it has provided unique opportunities to identify mechanisms of disease involving actin pathologies, mitochondrial disease, human lysosomal and trafficking disorders and host-pathogen interactions. Secondly, I will highlight recent studies on

  3. Clues to γ-secretase, huntingtin and Hirano body normal function using the model organism Dictyostelium discoideum

    PubMed Central


    Many neurodegenerative disorders, although related by their destruction of brain function, display remarkable cellular and/or regional pathogenic specificity likely due to a deregulated functionality of the mutant protein. However, neurodegenerative disease genes, for example huntingtin (HTT), the ataxins, the presenilins (PSEN1/PSEN2) are not simply localized to neurons but are ubiquitously expressed throughout peripheral tissues; it is therefore paramount to properly understand the earliest precipitating events leading to neuronal pathogenesis to develop effective long-term therapies. This means, in no unequivocal terms, it is crucial to understand the gene's normal function. Unfortunately, many genes are often essential for embryogenesis which precludes their study in whole organisms. This is true for HTT, the β-amyloid precursor protein (APP) and presenilins, responsible for early onset Alzheimer's disease (AD). To better understand neurological disease in humans, many lower and higher eukaryotic models have been established. So the question arises: how reasonable is the use of organisms to study neurological disorders when the model of choice does not contain neurons? Here we will review the surprising, and novel emerging use of the model organism Dictyostelium discoideum, a species of soil-living amoeba, as a valuable biomedical tool to study the normal function of neurodegenerative genes. Historically, the evidence on the usefulness of simple organisms to understand the etiology of cellular pathology cannot be denied. But using an organism without a central nervous system to understand diseases of the brain? We will first introduce the life cycle of Dictyostelium, the presence of many disease genes in the genome and how it has provided unique opportunities to identify mechanisms of disease involving actin pathologies, mitochondrial disease, human lysosomal and trafficking disorders and host-pathogen interactions. Secondly, I will highlight recent studies on

  4. Clues to γ-secretase, huntingtin and Hirano body normal function using the model organism Dictyostelium discoideum.


    Myre, Michael A


    Many neurodegenerative disorders, although related by their destruction of brain function, display remarkable cellular and/or regional pathogenic specificity likely due to a deregulated functionality of the mutant protein. However, neurodegenerative disease genes, for example huntingtin (HTT), the ataxins, the presenilins (PSEN1/PSEN2) are not simply localized to neurons but are ubiquitously expressed throughout peripheral tissues; it is therefore paramount to properly understand the earliest precipitating events leading to neuronal pathogenesis to develop effective long-term therapies. This means, in no unequivocal terms, it is crucial to understand the gene's normal function. Unfortunately, many genes are often essential for embryogenesis which precludes their study in whole organisms. This is true for HTT, the β-amyloid precursor protein (APP) and presenilins, responsible for early onset Alzheimer's disease (AD). To better understand neurological disease in humans, many lower and higher eukaryotic models have been established. So the question arises: how reasonable is the use of organisms to study neurological disorders when the model of choice does not contain neurons? Here we will review the surprising, and novel emerging use of the model organism Dictyostelium discoideum, a species of soil-living amoeba, as a valuable biomedical tool to study the normal function of neurodegenerative genes. Historically, the evidence on the usefulness of simple organisms to understand the etiology of cellular pathology cannot be denied. But using an organism without a central nervous system to understand diseases of the brain? We will first introduce the life cycle of Dictyostelium, the presence of many disease genes in the genome and how it has provided unique opportunities to identify mechanisms of disease involving actin pathologies, mitochondrial disease, human lysosomal and trafficking disorders and host-pathogen interactions. Secondly, I will highlight recent studies on

  5. Iron metabolism and resistance to infection by invasive bacteria in the social amoeba Dictyostelium discoideum.


    Bozzaro, Salvatore; Buracco, Simona; Peracino, Barbara


    Dictyostelium cells are forest soil amoebae, which feed on bacteria and proliferate as solitary cells until bacteria are consumed. Starvation triggers a change in life style, forcing cells to gather into aggregates to form multicellular organisms capable of cell differentiation and morphogenesis. As a soil amoeba and a phagocyte that grazes on bacteria as the obligate source of food, Dictyostelium could be a natural host of pathogenic bacteria. Indeed, many pathogens that occasionally infect humans are hosted for most of their time in protozoa or free-living amoebae, where evolution of their virulence traits occurs. Due to these features and its amenability to genetic manipulation, Dictyostelium has become a valuable model organism for studying strategies of both the host to resist infection and the pathogen to escape the defense mechanisms. Similarly to higher eukaryotes, iron homeostasis is crucial for Dictyostelium resistance to invasive bacteria. Iron is essential for Dictyostelium, as both iron deficiency or overload inhibit cell growth. The Dictyostelium genome shares with mammals many genes regulating iron homeostasis. Iron transporters of the Nramp (Slc11A) family are represented with two genes, encoding Nramp1 and Nramp2. Like the mammalian ortholog, Nramp1 is recruited to phagosomes and macropinosomes, whereas Nramp2 is a membrane protein of the contractile vacuole network, which regulates osmolarity. Nramp1 and Nramp2 localization in distinct compartments suggests that both proteins synergistically regulate iron homeostasis. Rather than by absorption via membrane transporters, iron is likely gained by degradation of ingested bacteria and efflux via Nramp1 from phagosomes to the cytosol. Nramp gene disruption increases Dictyostelium sensitivity to infection, enhancing intracellular growth of Legionella or Mycobacteria. Generation of mutants in other "iron genes" will help identify genes essential for iron homeostasis and resistance to pathogens.

  6. Iron metabolism and resistance to infection by invasive bacteria in the social amoeba Dictyostelium discoideum

    PubMed Central

    Bozzaro, Salvatore; Buracco, Simona; Peracino, Barbara


    Dictyostelium cells are forest soil amoebae, which feed on bacteria and proliferate as solitary cells until bacteria are consumed. Starvation triggers a change in life style, forcing cells to gather into aggregates to form multicellular organisms capable of cell differentiation and morphogenesis. As a soil amoeba and a phagocyte that grazes on bacteria as the obligate source of food, Dictyostelium could be a natural host of pathogenic bacteria. Indeed, many pathogens that occasionally infect humans are hosted for most of their time in protozoa or free-living amoebae, where evolution of their virulence traits occurs. Due to these features and its amenability to genetic manipulation, Dictyostelium has become a valuable model organism for studying strategies of both the host to resist infection and the pathogen to escape the defense mechanisms. Similarly to higher eukaryotes, iron homeostasis is crucial for Dictyostelium resistance to invasive bacteria. Iron is essential for Dictyostelium, as both iron deficiency or overload inhibit cell growth. The Dictyostelium genome shares with mammals many genes regulating iron homeostasis. Iron transporters of the Nramp (Slc11A) family are represented with two genes, encoding Nramp1 and Nramp2. Like the mammalian ortholog, Nramp1 is recruited to phagosomes and macropinosomes, whereas Nramp2 is a membrane protein of the contractile vacuole network, which regulates osmolarity. Nramp1 and Nramp2 localization in distinct compartments suggests that both proteins synergistically regulate iron homeostasis. Rather than by absorption via membrane transporters, iron is likely gained by degradation of ingested bacteria and efflux via Nramp1 from phagosomes to the cytosol. Nramp gene disruption increases Dictyostelium sensitivity to infection, enhancing intracellular growth of Legionella or Mycobacteria. Generation of mutants in other “iron genes” will help identify genes essential for iron homeostasis and resistance to pathogens. PMID

  7. Effects of Listeria monocytogenes EGD-e and Salmonella enterica ser. Typhimurium LT2 chitinases on intracellular survival in Dictyostelium discoideum and mammalian cell lines.


    Frederiksen, Rikki F; Leisner, Jørgen J


    Some bacterial pathogens produce chitinases as virulence factors during host infection. The molecular target of such enzymes in non-chitinous hosts remains uncertain. We studied the importance of Listeria monocytogenes EGD-e and Salmonella enterica ser. Typhimurium LT2 chitinases for intracellular survival in Dictyostelium discoideum, and for Salmonella, also infection of mammalian cell lines, and a mouse model. The Salmonella chitinase did not contribute significantly to infection of D. discoideum, mammalian cell lines or mice. However, survival in D. discoideum was clearly reduced for Listeria mutants deficient of ChiB (8-fold) or deficient of both ChiA and ChiB (22-fold). Our findings suggest that chitinases from the two species play different roles in virulence.

  8. Loss of Cln3 Function in the Social Amoeba Dictyostelium discoideum Causes Pleiotropic Effects That Are Rescued by Human CLN3

    PubMed Central

    Huber, Robert J.


    The neuronal ceroid lipofuscinoses (NCL) are a group of inherited, severe neurodegenerative disorders also known as Batten disease. Juvenile NCL (JNCL) is caused by recessive loss-of-function mutations in CLN3, which encodes a transmembrane protein that regulates endocytic pathway trafficking, though its primary function is not yet known. The social amoeba Dictyostelium discoideum is increasingly utilized for neurological disease research and is particularly suited for investigation of protein function in trafficking. Therefore, here we establish new overexpression and knockout Dictyostelium cell lines for JNCL research. Dictyostelium Cln3 fused to GFP localized to the contractile vacuole system and to compartments of the endocytic pathway. cln3− cells displayed increased rates of proliferation and an associated reduction in the extracellular levels and cleavage of the autocrine proliferation repressor, AprA. Mid- and late development of cln3− cells was precocious and cln3− slugs displayed increased migration. Expression of either Dictyostelium Cln3 or human CLN3 in cln3− cells suppressed the precocious development and aberrant slug migration, which were also suppressed by calcium chelation. Taken together, our results show that Cln3 is a pleiotropic protein that negatively regulates proliferation and development in Dictyostelium. This new model system, which allows for the study of Cln3 function in both single cells and a multicellular organism, together with the observation that expression of human CLN3 restores abnormalities in Dictyostelium cln3− cells, strongly supports the use of this new model for JNCL research. PMID:25330233

  9. Loss of Cln3 function in the social amoeba Dictyostelium discoideum causes pleiotropic effects that are rescued by human CLN3.


    Huber, Robert J; Myre, Michael A; Cotman, Susan L


    The neuronal ceroid lipofuscinoses (NCL) are a group of inherited, severe neurodegenerative disorders also known as Batten disease. Juvenile NCL (JNCL) is caused by recessive loss-of-function mutations in CLN3, which encodes a transmembrane protein that regulates endocytic pathway trafficking, though its primary function is not yet known. The social amoeba Dictyostelium discoideum is increasingly utilized for neurological disease research and is particularly suited for investigation of protein function in trafficking. Therefore, here we establish new overexpression and knockout Dictyostelium cell lines for JNCL research. Dictyostelium Cln3 fused to GFP localized to the contractile vacuole system and to compartments of the endocytic pathway. cln3- cells displayed increased rates of proliferation and an associated reduction in the extracellular levels and cleavage of the autocrine proliferation repressor, AprA. Mid- and late development of cln3- cells was precocious and cln3- slugs displayed increased migration. Expression of either Dictyostelium Cln3 or human CLN3 in cln3- cells suppressed the precocious development and aberrant slug migration, which were also suppressed by calcium chelation. Taken together, our results show that Cln3 is a pleiotropic protein that negatively regulates proliferation and development in Dictyostelium. This new model system, which allows for the study of Cln3 function in both single cells and a multicellular organism, together with the observation that expression of human CLN3 restores abnormalities in Dictyostelium cln3- cells, strongly supports the use of this new model for JNCL research. PMID:25330233

  10. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A


    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  11. Adenosine 3',5'-monophosphate waves in dictyostelium discoideum: a demonstration by isotope dilution-fluorography

    SciTech Connect

    Tomchik, K.J.; Devreotes, P.N.


    The distribution of adenosine 3',5'-monophosphate (cyclic AMP) in fields of aggregating amoebae of Dictyostelium discoidenum was examined by a novel isotope dilution-fluorographic technique. Cellular cyclic AMP was visualized by its competition with exogenous /sup 3/H-labeled cyclic AMP for high-affinity binding sites on protein kinase immobilized on a Millipore filter used to blot the monolayer. The cyclic AMP was distributed in spiral or concentric circular wave patterns which centered on the foci of the aggregations. These patterns were correlated with those of cell shape change that propagate through the monolayers. These observations support the hypothesis that the aggregation process in Dictyostelium is mediated by the periodic relay of cyclic AMP signals and suggest a simple scheme for the dynamics of the aggregation process.

  12. A matricellular protein and EGF-like repeat signalling in the social amoebozoan Dictyostelium discoideum.


    Huber, Robert J; O'Day, Danton H


    Matricellular proteins interact with the extracellular matrix (ECM) and modulate cellular processes by binding to cell surface receptors and initiating intracellular signal transduction. Their association with the ECM and the ability of some members of this protein family to regulate cell motility have opened up new avenues of research to investigate their functions in normal and diseased cells. In this review, we summarize the research on CyrA, an ECM calmodulin-binding protein in Dictyostelium. CyrA is proteolytically cleaved into smaller EGF-like (EGFL) repeat containing cleavage products during development. The first EGFL repeat of CyrA binds to the cell surface and activates a novel signalling pathway that modulates cell motility in this model organism. The similarity of CyrA to the most well-characterized matricellular proteins in mammals allows it to be designated as the first matricellular protein identified in Dictyostelium. PMID:22782112

  13. A matricellular protein and EGF-like repeat signalling in the social amoebozoan Dictyostelium discoideum.


    Huber, Robert J; O'Day, Danton H


    Matricellular proteins interact with the extracellular matrix (ECM) and modulate cellular processes by binding to cell surface receptors and initiating intracellular signal transduction. Their association with the ECM and the ability of some members of this protein family to regulate cell motility have opened up new avenues of research to investigate their functions in normal and diseased cells. In this review, we summarize the research on CyrA, an ECM calmodulin-binding protein in Dictyostelium. CyrA is proteolytically cleaved into smaller EGF-like (EGFL) repeat containing cleavage products during development. The first EGFL repeat of CyrA binds to the cell surface and activates a novel signalling pathway that modulates cell motility in this model organism. The similarity of CyrA to the most well-characterized matricellular proteins in mammals allows it to be designated as the first matricellular protein identified in Dictyostelium.

  14. Analyses of cDNAs from growth and slug stages of Dictyostelium discoideum.


    Urushihara, Hideko; Morio, Takahiro; Saito, Tamao; Kohara, Yuji; Koriki, Eiko; Ochiai, Hiroshi; Maeda, Mineko; Williams, Jeffrey G; Takeuchi, Ikuo; Tanaka, Yoshimasa


    Dictyostelium is a favored model for studying problems in cell and developmental biology. To comprehend the genetic potential and networks that direct growth and multicellular development, we are performing a large-scale analysis of Dictyostelium cDNAs. Here, we newly determine 7720 nucleotide sequences of cDNAs from the multicellular, slug stage (S) and 10 439 from the unicellular, vegetative stage (V). The combined 26 954 redundant ESTs were computer assembled using the PHRAP program to yield 5381 independent sequences. These 5381 predicted genes represent about half of the estimated coding potential of the organism. One-third of them were classified into 12 functional categories. Although the overall classification patterns of the V and S libraries were very similar, stage-specific genes exist in every category. The majority of V-specific genes function in some aspect of protein translation, while such genes are in a minority in the S-specific and common populations. Instead, genes for signal transduction and multicellular organization are enriched in the population of S-specific genes. Genes encoding the enzymes of basic metabolism are mainly found in the common gene population. These results therefore suggest major differences between growing and developing Dictyostelium cells in the nature of the genes transcribed. PMID:15010511

  15. Analyses of cDNAs from growth and slug stages of Dictyostelium discoideum

    PubMed Central

    Urushihara, Hideko; Morio, Takahiro; Saito, Tamao; Kohara, Yuji; Koriki, Eiko; Ochiai, Hiroshi; Maeda, Mineko; Williams, Jeffrey G.; Takeuchi, Ikuo; Tanaka, Yoshimasa


    Dictyostelium is a favored model for studying problems in cell and developmental biology. To comprehend the genetic potential and networks that direct growth and multicellular development, we are performing a large-scale analysis of Dictyostelium cDNAs. Here, we newly determine 7720 nucleotide sequences of cDNAs from the multicellular, slug stage (S) and 10 439 from the unicellular, vegetative stage (V). The combined 26 954 redundant ESTs were computer assembled using the PHRAP program to yield 5381 independent sequences. These 5381 predicted genes represent about half of the estimated coding potential of the organism. One-third of them were classified into 12 functional categories. Although the overall classification patterns of the V and S libraries were very similar, stage-specific genes exist in every category. The majority of V-specific genes function in some aspect of protein translation, while such genes are in a minority in the S-specific and common populations. Instead, genes for signal transduction and multicellular organization are enriched in the population of S-specific genes. Genes encoding the enzymes of basic metabolism are mainly found in the common gene population. These results therefore suggest major differences between growing and developing Dictyostelium cells in the nature of the genes transcribed. PMID:15010511

  16. Differentiation-inducing factor 2 modulates chemotaxis via the histidine kinase DhkC-dependent pathway in Dictyostelium discoideum.


    Kuwayama, Hidekazu; Kubohara, Yuzuru


    Differentiation-inducing factor 1(DIF-1) and DIF-2 are signaling molecules that control chemotaxis in Dictyostelium discoideum. Whereas DIF-1 suppresses chemotaxis in shallow cAMP gradients, DIF-2 enhances chemotaxis under the same conditions via a phosphodiesterase, response regulator A (RegA), which is a part of the DhkC-RdeA-RegA two-component signaling system. In this study, to investigate the mechanism of the chemotaxis regulation by DIF-2, we examined the effects of DIF-2 (and DIF-1) on chemotaxis in rdeA(-) and dhkC(-) mutant strains. In the parental wild-type strains, chemotactic cell movement was suppressed with DIF-1 and enhanced with DIF-2 in shallow cAMP gradients. In contrast, in both rdeA(-) and dhkC(-) strains, chemotaxis was suppressed with DIF-1 but unaffected by DIF-2. The results suggest that DIF-2 modulates chemotaxis via the DhkC-RdeA-RegA signaling system.

  17. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.


    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  18. Interaction of Dictyostelium discoideum lysosomal enzymes with the mammalian phosphomannosyl receptor. The importance of oligosaccharides which contain phosphodiesters

    SciTech Connect

    Freeze, H.H.


    Mammalian cell lysosomal enzymes or phosphorylated oligosaccharides derived from them are endocytosed by a phosphomannosyl receptor (PMR) found on the surface of fibroblasts. Various studies suggest that 2 residues of Man-6-P in phosphomonoester linkage but not diester linkage (PDE) are essential for a high rate of uptake. The lysosomal enzymes of the slime mold Dictyostelium discoideum are also recognized by the PMR on these cells; however, none of the oligosaccharides from these enzymes contain 2 phosphomonoesters. Instead, most contain multiple sulfate esters and 2 residues of Man-6-P in an unusual PDE linkage. In this study the authors have tried to account for the unexpected highly efficient uptake of the slime mold enzymes. The results show that nearly all of the alpha-mannosidase molecules contain the oligosaccharides required for uptake. Competition of SVI-beta-glucosidase uptake by various carbohydrate-containing fractions indicates that the best inhibitors are those with 2 PDE, either with or without sulfate esters. Complete denaturation of SVI-labeled wild-type beta-glucosidase in sodium dodecyl sulfate/dithiothreitol also reduces its uptake by about 10-fold. Taken together, these results suggest that the interactions of multiple, weakly binding oligosaccharides, especially those with 2 PDE, are important for the high rate of uptake of the slime mold enzymes.

  19. Systematic analysis of γ-aminobutyric acid (GABA) metabolism and function in the social amoeba Dictyostelium discoideum.


    Wu, Yuantai; Janetopoulos, Chris


    While GABA has been suggested to regulate spore encapsulation in the social amoeba Dictyostelium discoideum, the metabolic profile and other potential functions of GABA during development remain unclear. In this study, we investigated the homeostasis of GABA metabolism by disrupting genes related to GABA metabolism and signaling. Extracellular levels of GABA are tightly regulated during early development, and GABA is generated by the glutamate decarboxylase, GadB, during growth and in early development. However, overexpression of the prespore-specific homologue, GadA, in the presence of GadB reduces production of extracellular GABA. Perturbation of extracellular GABA levels delays the process of aggregation. Cytosolic GABA is degraded by the GABA transaminase, GabT, in the mitochondria. Disruption of a putative vesicular GABA transporter (vGAT) homologue DdvGAT reduces secreted GABA. We identified the GABAB receptor-like family member GrlB as the major GABA receptor during early development, and either disruption or overexpression of GrlB delays aggregation. This delay is likely the result of an abolished pre-starvation response and late expression of several "early" developmental genes. Distinct genes are employed for GABA generation during sporulation. During sporulation, GadA alone is required for generating GABA and DdvGAT is likely responsible for GABA secretion. GrlE but not GrlB is the GABA receptor during late development.

  20. Expression and function of pvcrt-o, a Plasmodium vivax ortholog of pfcrt, in Plasmodium falciparum and Dictyostelium discoideum.


    Sá, Juliana Martha; Yamamoto, Marcio M; Fernandez-Becerra, Carmen; de Azevedo, Mauro Ferreira; Papakrivos, Janni; Naudé, Bronwen; Wellems, Thomas E; Del Portillo, Hernando A


    Chloroquine resistance in Plasmodium vivax threatens the use of this drug as first-line treatment for millions of people infected each year worldwide. Unlike Plasmodium falciparum, in which chloroquine resistance is associated with mutations in the pfcrt gene encoding a digestive vacuole transmembrane protein, no point mutations have been associated with chloroquine resistance in the P. vivax ortholog gene, pvcrt-o (also called pvcg10). However, the question remains whether pvcrt-o can affect chloroquine response independent of mutations. Since P. vivax cannot be cultured in vitro, we used two heterologous expression systems to address this question. Results from the first system, in which chloroquine sensitive P. falciparum parasites were transformed with pvcrt-o, showed a 2.2-fold increase in chloroquine tolerance with pvcrt-o expression under a strong promoter; this effect was reversed by verapamil. In the second system, wild type pvcrt-o or a mutated form of the gene was expressed in Dictyostelium discoideum. Forms of PvCRT-o engineered to express either lysine or threonine at position 76 produced a verapamil-reversible reduction of chloroquine accumulation in this system to approximately 60% of that in control cells. Our data support an effect of PvCRT-o on chloroquine transport and/or accumulation by P. vivax, independent of the K76T amino acid substitution.

  1. Polyphosphate kinase 1, a conserved bacterial enzyme, in a eukaryote, Dictyostelium discoideum, with a role in cytokinesis.


    Zhang, Haiyu; Gómez-García, María R; Shi, Xiaobing; Rao, Narayana N; Kornberg, Arthur


    Polyphosphate kinase 1 (PPK1), the principal enzyme responsible for reversible synthesis of polyphosphate (poly P) from the terminal phosphate of ATP, is highly conserved in bacteria and archaea. Dictyostelium discoideum, a social slime mold, is one of a few eukaryotes known to possess a PPK1 homolog (DdPPK1). Compared with PPK1 of Escherichia coli, DdPPK1 contains the conserved residues for ATP binding and autophosphorylation, but has an N-terminal extension of 370 aa, lacking homology with any known protein. Polyphosphate or ATP promote oligomerization of the enzyme in vitro. The DdPPK1 products are heterogeneous in chain length and shorter than those of E. coli. The unique DdPPK1 N-terminal domain was shown to be necessary for its enzymatic activity, cellular localization, and physiological functions. Mutants of DdPPK1, as previously reported, are defective in development, sporulation, and predation, and as shown here, in late stages of cytokinesis and cell division. PMID:17940044

  2. Evidence that noncoding RNA dutA is a multicopy suppressor of Dictyostelium discoideum STAT protein Dd-STATa.


    Shimada, Nao; Kawata, Takefumi


    Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.

  3. Different CHD chromatin remodelers are required for expression of distinct gene sets and specific stages during development of Dictyostelium discoideum

    PubMed Central

    Platt, James L.; Rogers, Benjamin J.; Rogers, Kelley C.; Harwood, Adrian J.; Kimmel, Alan R.


    Control of chromatin structure is crucial for multicellular development and regulation of cell differentiation. The CHD (chromodomain-helicase-DNA binding) protein family is one of the major ATP-dependent, chromatin remodeling factors that regulate nucleosome positioning and access of transcription factors and RNA polymerase to the eukaryotic genome. There are three mammalian CHD subfamilies and their impaired functions are associated with several human diseases. Here, we identify three CHD orthologs (ChdA, ChdB and ChdC) in Dictyostelium discoideum. These CHDs are expressed throughout development, but with unique patterns. Null mutants lacking each CHD have distinct phenotypes that reflect their expression patterns and suggest functional specificity. Accordingly, using genome-wide (RNA-seq) transcriptome profiling for each null strain, we show that the different CHDs regulate distinct gene sets during both growth and development. ChdC is an apparent ortholog of the mammalian Class III CHD group that is associated with the human CHARGE syndrome, and GO analyses of aberrant gene expression in chdC nulls suggest defects in both cell-autonomous and non-autonomous signaling, which have been confirmed through analyses of chdC nulls developed in pure populations or with low levels of wild-type cells. This study provides novel insight into the broad function of CHDs in the regulation development and disease, through chromatin-mediated changes in directed gene expression. PMID:24301467

  4. Absence of catalytic domain in a putative protein kinase C (PkcA) suppresses tip dominance in Dictyostelium discoideum.


    Mohamed, Wasima; Ray, Sibnath; Brazill, Derrick; Baskar, Ramamurthy


    A number of organisms possess several isoforms of protein kinase C but little is known about the significance of any specific isoform during embryogenesis and development. To address this we characterized a PKC ortholog (PkcA; DDB_G0288147) in Dictyostelium discoideum. pkcA expression switches from prestalk in mound to prespore in slug, indicating a dynamic expression pattern. Mutants lacking the catalytic domain of PkcA (pkcA(-)) did not exhibit tip dominance. A striking phenotype of pkcA- was the formation of an aggregate with a central hollow, and aggregates later fragmented to form small mounds, each becoming a fruiting body. Optical density wave patterns of cAMP in the late aggregates showed several cAMP wave generation centers. We attribute these defects in pkcA(-) to impaired cAMP signaling, altered cell motility and decreased expression of the cell adhesion molecules - CadA and CsaA. pkcA(-) slugs showed ectopic expression of ecmA in the prespore region. Further, the use of a PKC-specific inhibitor, GF109203X that inhibits the activity of catalytic domain phenocopied pkcA(-). PMID:26183108

  5. Extracellular calmodulin regulates growth and cAMP-mediated chemotaxis in Dictyostelium discoideum

    SciTech Connect

    O'Day, Danton H.; Huber, Robert J.; Suarez, Andres


    Highlights: Black-Right-Pointing-Pointer Extracellular calmodulin is present throughout growth and development in Dictyostelium. Black-Right-Pointing-Pointer Extracellular calmodulin localizes within the ECM during development. Black-Right-Pointing-Pointer Extracellular calmodulin inhibits cell proliferation and increases chemotaxis. Black-Right-Pointing-Pointer Extracellular calmodulin exists in eukaryotic microbes. Black-Right-Pointing-Pointer Extracellular calmodulin may be functionally as important as intracellular calmodulin. -- Abstract: The existence of extracellular calmodulin (CaM) has had a long and controversial history. CaM is a ubiquitous calcium-binding protein that has been found in every eukaryotic cell system. Calcium-free apo-CaM and Ca{sup 2+}/CaM exert their effects by binding to and regulating the activity of CaM-binding proteins (CaMBPs). Most of the research done to date on CaM and its CaMBPs has focused on their intracellular functions. The presence of extracellular CaM is well established in a number of plants where it functions in proliferation, cell wall regeneration, gene regulation and germination. While CaM has been detected extracellularly in several animal species, including frog, rat, rabbit and human, its extracellular localization and functions are less well established. In contrast the study of extracellular CaM in eukaryotic microbes remains to be done. Here we show that CaM is constitutively expressed and secreted throughout asexual development in Dictyostelium where the presence of extracellular CaM dose-dependently inhibits cell proliferation but increases cAMP mediated chemotaxis. During development, extracellular CaM localizes within the slime sheath where it coexists with at least one CaMBP, the matricellular CaM-binding protein CyrA. Coupled with previous research, this work provides direct evidence for the existence of extracellular CaM in the Dictyostelium and provides insight into its functions in this model amoebozoan.

  6. Mutations affecting sensitivity of the cellular slime mold Dictyostelium discoideum to DNA-damaging agents.


    Bronner, C E; Welker, D L; Deering, R A


    We describe 22 new mutants of D. discoideum that are sensitive to DNA damage. These mutants were isolated on the basis of sensitivity to either temperature, gamma-rays, or 4-nitroquinolone-1-oxide (4NQO). The doses of gamma-rays, ultraviolet light (UV), and 4NQO required to reduce the survival of colony-forming ability of these mutants to 10% (D10) range from 2% to 100% of the D10s for the nonmutant, parent strains. For most of the mutants, those which are very sensitive to one agent are very sensitive to all agents tested and those which are moderately sensitive to one agent, are moderately sensitive to all agents tested. One mutant is sensitive only to 4NQO. Linkage relationships have been examined for 13 of these mutants. This linkage information was used to design complementation tests to determine allelism with previously characterized complementation groups affecting sensitivity to radiation. 4 of the new mutants fall within previously identified complementation groups and 3 new complementation groups have been identified (radJ, radK and radL). Other new loci probably also exist among these new mutants. This brings the number of characterized mutants of D. discoideum which are sensitive to DNA-damaging agents to 33 and the number of assigned complementation groups to 11. PMID:1380652

  7. Biochemical and morphological effects of sodium butyrate on Dictyostelium discoideum development.


    Boto, L; Cano, A; Pestaña, A


    Pretreatment of proliferating D. discoideum amoebae with 10 mM butyrate for at least 8 h (one duplicating time) induced a reversible and dose dependent premature expression of several developmental parameters when the cells were starved in the absence of the fatty acid. The aggregative phase of the morphogenetic cycle was reduced in 2 h and the appearance of mature fruiting bodies and spores took place 4 h earlier as a result of butyrate pretreatment. Some developmentally regulated proteins, such as contact-sites A, cell surface lectins and cyclic AMP phosphodiesterase were also expressed 2 h earlier in butyrate pretreated cells than in controls. The level of extracellular cyclic AMP was reduced in butyrate pretreated cells, while other parameters of cyclic AMP metabolism were not affected. Butyrate also caused a partial inhibition of growth and the hyperacetylation of histone H4 in growing amoeba. These results suggest that butyrate acts as an inducer of differentiation in D. discoideum and can therefore be used as an experimental tool in order to explore regulatory mechanisms operating in slime mold differentiation. PMID:3037305

  8. Excitable waves and direction-sensing in Dictyostelium discoideum: steps towards a chemotaxis model

    NASA Astrophysics Data System (ADS)

    Bhowmik, Arpan; Rappel, Wouter-Jan; Levine, Herbert


    In recent years, there have been significant advances in our understanding of the mechanisms underlying chemically directed motility by eukaryotic cells such as Dictyostelium. In particular, the local excitation and global inhibition (LEGI) model has proven capable of providing a framework for quantitatively explaining many experiments that present Dictyostelium cells with tailored chemical stimuli and monitor their subsequent polarization. In their natural setting, cells generate their own directional signals via the detection and secretion of cyclic adenosine monophosphate (cAMP). Here, we couple the LEGI approach to an excitable medium model of the cAMP wave-field that is propagated by the cells and investigate the possibility for this class of models to enable accurate chemotaxis to the cAMP waveforms expected in vivo. Our results indicate that the ultra-sensitive version of the model does an excellent job in providing natural wave rectification, thereby providing a compelling solution to the ‘back-of-the-wave paradox’ during cellular aggregation.

  9. Extracellular matrix family proteins that are potential targets of Dd-STATa in Dictyostelium discoideum.


    Shimada, Nao; Nishio, Keiko; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi


    Dd-STATa is a functional Dictyostelium homologue of metazoan STAT (signal transducers and activators of transcription) proteins, which is activated by cAMP and is thereby translocated into the nuclei of anterior tip cells of the prestalk region of the slug. By using in situ hybridization analyses, we found that the SLF308 cDNA clone, which contains the ecmF gene that encodes a putative extracellular matrix protein and is expressed in the anterior tip cells, was greatly down-regulated in the Dd-STATa-null mutant. Disruption of the ecmF gene, however, resulted in almost no phenotypic change. The absence of any obvious mutant phenotype in the ecmF-null mutant could be due to a redundancy of similar genes. In fact, a search of the Dictyostelium whole genome database demonstrates the existence of an additional 16 homologues, all of which contain a cellulose-binding module. Among these homologues, four genes show Dd-STATa-dependent expression, while the others are Dd-STATa-independent. We discuss the potential role of Dd-STATa in morphogenesis via its effect on the interaction between cellulose and these extracellular matrix family proteins.

  10. Excision of pyrimidine dimers from nuclear deoxyribonucleic acid in ultraviolet-irradiated Dictyostelium discoideum

    SciTech Connect

    Clark, J.M.; Deering, R.A.


    A sensitive endonuclease assay was used to study the fate of pyrimidine dimers introduced by ultraviolet irradiation into the nuclear deoxyribonucleic acid of the cellular slime mold Dictyostellium discoideum. Analysis of the frequency of T4 endonuclease V-induced single-strand breaks by alkaline sucrose gradient sedimentation showed that strain NC4 (rad/sup +/) removed >98% of the dimers induced by irradiation at 40 J/m/sup 2/ (254 nm) within 215 min after irradiation. HPS104 (radC44), a mutant sensitive to ultraviolet irradiation, removed 91% under these conditions, although at a significantly slower rate than NC4: only 8% were removed during the 10- to 15- min period immediately after irradiation, whereas NC4 excised 64% during this interval. HPS104 thus appears to be deficient in the activity(ies) responsible for rapidly incising ultraviolet-irradiated nuclear deoxyribonucleic acid at the sites of pyrimidine dimers.

  11. A ribosomal protein gene cluster is encoded in the mitochondrial DNA of Dictyostelium discoideum: UGA termination codons and similarity of gene order to Acanthamoeba castellanii.


    Iwamoto, M; Pi, M; Kurihara, M; Morio, T; Tanaka, Y


    We sequenced a region of about 14.5 kb downstream from the ribosomal protein L11 gene (rpl11) in the mitochondrial DNA (54+/-2 kb) of the cellular slime mold Dictyostelium discoideum. Sequence analysis revealed that eleven ribosomal protein genes and six open reading frames (ORFs) formed a cluster arranged in the order: rpl11-orf189-rps12-rps7-rpl2-rps19-+ ++orf425-orf1740-rpl16-rpl14-orf188- rps14-rps8-rpl6-rps13-orf127-orf796. This order was very similar to that of homologous genes in Acanthamoeba castellanii mitochondrial DNA. The N-terminal region of ORF425 and the C-terminal region of ORF1740 had partial similarities to the S3 ribosomal protein of other organisms. The termination codons of rpl16 and orf188 were UGA, which has not hitherto been found in genes encoded in D. discoideum mitochondrial DNA. PMID:9560439

  12. Parasexual recombination in Dictyostelium discoideum: selection of stable diploid heterozygotes and stable haploid segregants (clones-temperature sensitive-ploidy-fruiting bodies-spore-slime mold).


    Katz, E R; Sussman, M


    Haploid strains of Dictyostelium discoideum bearing temperature-sensitive mutations have been used to select stable diploid, heterozygotic clones, which arise at low frequency (about 10(-5)). Segregants arise from such diploids at low frequency (about 10(-3)). The diploids were heterozygous for resistance to cycloheximide and were phenotypically sensitive to the drug. Growth of the diploid cells in the presence of cycloheximide automatically selected those segregants bearing the resistant allele, and facilitated examination of the assortment of unselected markers. The combination of the two selective methods provides a workable system of genetic analysis in this species. We have used this method to locate six markers on three different linkage groups.

  13. Differentiation of Dictyostelium discoideum vegetative cells into spores during earth orbit in space

    NASA Astrophysics Data System (ADS)

    Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.; Ohnishi, T.


    We reported previously that emerged amoebae of Dictyosterium ( D.) discoideum grew, aggregated and differentiated to fruiting bodies with normal morphology in space. Here, we investigated the effects of space radiation and/or microgravity on the number, viability, kinetics of germination, growth rate and mutation frequency of spores formed in space in a radiation-sensitive strain, γs13, and the parental strain, NC4. In γs13, there were hardly spores in the fruiting bodies formed in space. In NC4, we found a decrease in the number of spores, a delay in germination of the spores and delayed start of cell growth of the spores formed in space when compared to the ground control. However, the mutation frequency of the NC4 spores formed in space was similar to that of the ground control. We conclude that the depression of spore formation might be induced by microgravity and/or space radiation through the depression of some stage(s) of DNA repair during cell differentiation in the slime mold.

  14. Changes of the cell surface and of the digestive apparatus of dictyostelium discoideum during the starvation period triggering aggregation

    PubMed Central

    De Chastellier, C; Ryter, A


    The effects of starvation on the cell morphology of Dictyostelium discoideum were studied with different cytochemical techniques, and with a morphometric method by which the surface areas of the cell membrane and of the digestive system can be determined. During the first 2 h, the cell membrane becomes very wrinkled and many phagocytic cups and filopods are formed. These changes are in accord with the 40 percent increase in the cell surface area to cytoplasmic volume ratio observed, which is mainly due to a strong decrease in the cytoplasmic volume. At this time of starvation, cells are able to ingest twice as many yeast as during growth. Afterwards, while the phagocytic ability decreases, the phagocytic cups disappear, and all the cells become bristled with many thin filopods. In spite of these morphological changes, no quantitative or topological differences have been observed concerning the polysaccharide content of the plasma membrane, whether it was stained with phosphotungstic acid, silver proteinate, or ruthenium red. During this time, the digestive vacuoles imbricate one into the other. Part of the vacuoles are degraded by this process, thus leading to an atrophy of the digestive apparatus. The digestive apparatus is progressively replaced by an autophagic system. Polysaccharide stainings and morphological observations show that the cytosegresomes seem to originate from the food vacuoles which flatten and sequester portions of cytoplasm. After 5 h of starvation, the digestive system is entirely transformed into an autophagic apparatus. The cell population appears to be homogeneous with respect to these changes. Therefore, potential precursors of prestalk and prespore cells were not observed. PMID:144140

  15. The Effects of Temperature Variation on the Sensitivity to Pesticides: a Study on the Slime Mould Dictyostelium discoideum (Protozoa).


    Amaroli, Andrea


    Slime moulds live in agricultural ecosystems, where they play an important role in the soil fertilization and in the battle against crop pathogens. In an agricultural soil, the amoebae are exposed to different stress factors such as pesticides and weather conditions. The use of pesticides increased up from 0.49 kg per hectare in 1961 to 2 kg in 2004, and the global greenhouse gas emission has grown 70% between 1970 and 2004 leading to a global fluctuation of average surface temperature. Therefore, the European Directive 2009/128/EC has led to a new approach to agriculture, with the transition from an old concept based on high use of pesticides and fossil fuels to an agriculture aware of biodiversity and health issues. We studied the effects of temperature variations and pesticides on Dictyostelium discoideum. We measured the fission rate, the ability to differentiate and the markers of stress such as the activity and presence of pseudocholinesterase and the presence of heat shock protein 70. Our results highlight how the sensitivity to zinc, aluminium, silver, copper, cadmium, mercury, diazinon and dicofol changes for a 2 °C variation from nothing/low to critical. Our work suggests considering, in future regulations, about the use of pesticides as their toxic effect on non-target organisms is strongly influenced by climate temperatures. In addition, there is a need for a new consideration of the protozoa, which takes into account recent researches about the presence in this microorganism of classical neurotransmitters that, similar to those in animals, make protozoa an innocent target of neurotoxic pesticides in the battle against the pest crops.

  16. Derivatives of Dictyostelium discoideum differentiation-inducing factor-3 suppress the activities of Trypanosoma cruzi in vitro and in vivo.


    Nakajima-Shimada, Junko; Hatabu, Toshimitsu; Hosoi, Yukari; Onizuka, Yoko; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru


    Chagas disease (human American trypanosomiasis), which is caused by the protozoan parasite Trypanosoma cruzi, is responsible for numerous deaths each year; however, established treatments for the disease are limited. Differentiation-inducing factor-1 (DIF-1) and DIF-3 are chlorinated alkylphenones originally found in the cellular slime mold Dictyostelium discoideum that have been shown to possess pharmacological activities. Here, we investigated the effects of DIF-3 derivatives on the infection rate and growth of T. cruzi by using an in vitro assay system utilizing host human fibrosarcoma HT1080 cells. Certain DIF-3 derivatives, such as butoxy-DIF-3 (Bu-DIF-3), at micro-molar levels strongly suppressed both the infection rate and growth of T. cruzi in HT1080 cells and exhibited little toxicity for HT1080 cells. For example, the IC50 of DIF-3 and Bu-DIF-3 versus the growth of T. cruzi in HT1080 cells were 3.95 and 0.72μM, respectively, and the LD50 of the two compounds versus HT1080 cells were both greater than 100μM. We also examined the effects of DIF-3 and Bu-DIF-3 on T. cruzi activity in C57BL/6 mice. Intraperitoneally administered Bu-DIF-3 (50mg/kg) significantly suppressed the number of trypomastigotes in blood with no apparent adverse effects. These results strongly suggest that DIF-3 derivatives could be new lead compounds in the development of anti-trypanosomiasis drugs. PMID:23511088

  17. The Effects of Temperature Variation on the Sensitivity to Pesticides: a Study on the Slime Mould Dictyostelium discoideum (Protozoa).


    Amaroli, Andrea


    Slime moulds live in agricultural ecosystems, where they play an important role in the soil fertilization and in the battle against crop pathogens. In an agricultural soil, the amoebae are exposed to different stress factors such as pesticides and weather conditions. The use of pesticides increased up from 0.49 kg per hectare in 1961 to 2 kg in 2004, and the global greenhouse gas emission has grown 70% between 1970 and 2004 leading to a global fluctuation of average surface temperature. Therefore, the European Directive 2009/128/EC has led to a new approach to agriculture, with the transition from an old concept based on high use of pesticides and fossil fuels to an agriculture aware of biodiversity and health issues. We studied the effects of temperature variations and pesticides on Dictyostelium discoideum. We measured the fission rate, the ability to differentiate and the markers of stress such as the activity and presence of pseudocholinesterase and the presence of heat shock protein 70. Our results highlight how the sensitivity to zinc, aluminium, silver, copper, cadmium, mercury, diazinon and dicofol changes for a 2 °C variation from nothing/low to critical. Our work suggests considering, in future regulations, about the use of pesticides as their toxic effect on non-target organisms is strongly influenced by climate temperatures. In addition, there is a need for a new consideration of the protozoa, which takes into account recent researches about the presence in this microorganism of classical neurotransmitters that, similar to those in animals, make protozoa an innocent target of neurotoxic pesticides in the battle against the pest crops. PMID:25515424

  18. Structure of the 34 kDa F-actin-bundling protein ABP34 from Dictyostelium discoideum.


    Kim, Min-Kyu; Kim, Ji-Hye; Kim, Ji-Sun; Kang, Sa-Ouk


    The crystal structure of the 34 kDa F-actin-bundling protein ABP34 from Dictyostelium discoideum was solved by Ca(2+)/S-SAD phasing and refined at 1.89 Å resolution. ABP34 is a calcium-regulated actin-binding protein that cross-links actin filaments into bundles. Its in vitro F-actin-binding and F-actin-bundling activities were confirmed by a co-sedimentation assay and transmission electron microscopy. The co-localization of ABP34 with actin in cells was also verified. ABP34 adopts a two-domain structure with an EF-hand-containing N-domain and an actin-binding C-domain, but has no reported overall structural homologues. The EF-hand is occupied by a calcium ion with a pentagonal bipyramidal coordination as in the canonical EF-hand. The C-domain structure resembles a three-helical bundle and superposes well onto the rod-shaped helical structures of some cytoskeletal proteins. Residues 216-244 in the C-domain form part of the strongest actin-binding sites (193-254) and exhibit a conserved sequence with the actin-binding region of α-actinin and ABP120. Furthermore, the second helical region of the C-domain is kinked by a proline break, offering a convex surface towards the solvent area which is implicated in actin binding. The F-actin-binding model suggests that ABP34 binds to the side of the actin filament and residues 216-244 fit into a pocket between actin subdomains -1 and -2 through hydrophobic interactions. These studies provide insights into the calcium coordination in the EF-hand and F-actin-binding site in the C-domain of ABP34, which are associated through interdomain interactions. PMID:26327373

  19. The intracellular location of lysosomal enzymes in developing Dictyostelium discoideum cells

    SciTech Connect

    Lenhard, J.M.


    The author has found that developing Dictyostelium cells contain two distinct acid hydrolase-containing organelles. Vesicles from cells at different stages of development were separated using Percoll density gradients. The lower density vesicles (LDVs or lysosomes) were present in nourished and starved cells. The higher density vesicles (HDVs) arose during starvation-induced differentiation. HDVs lacked two prestalk cell-specific lysosomal enzymes which were contained in LDVs. Prespore cell-specific spore coat proteins were detected in HDVs by ELISA. ({sup 35}S)sulfate labeling revealed that HDVs contained newly made glycoproteins as well as glycoproteins found in preexisting LDVs. Pulse-chase experiments using ({sup 35}S)methionine revealed that {alpha}-mannosidase from pre-existing LDVs an newly made {alpha}-mannosidase had entered HDVs. These data suggest that prespore LDVs mature to become HDVs. He has obtained evidence that HDVs are identical to prespore vesicles. Prespore vesicles are specialized secretory organelles which arise during prespore cell differentiation and which secrete their contents during terminal differentiation. As prespore vesicles secreted their contents, there was a co-incidental increase in extracellular acid hydrolase activity and a decrease in HDV-associated enzyme activity. Electron micrographs revealed that prespore cells contained two acid phosphatase-staining organelles, one of which appeared to be identical to lysosomes from nourished cells and a second which had features similar to prespore vesicles. Ricin-gold affinity electron microscopy was used to label the mucopolysaccharide component of prespore vesicles and the spore coat. Immunoelectron microscopy revealed co-localization of {alpha}-mannosidase with ricin-gold in prespore vesicles and the spore coat.

  20. Comparison of experimental to MELTSIM calculated DNA melting of the (A+T) rich Dictyostelium discoideum genome: denaturation maps distinguish exons from introns.


    Marx, K A; Assil, I Q; Bizzaro, J W; Blake, R D


    The slime mold, Dictyostelium discoideum, possesses an (A+T) rich eukaryotic genome that is being sequenced in the Human Genome Project. High resolution melting curves of isolated total and fractionated nuclear D. discoideum DNA(AX3 strain) were determined experimentally and are compared to melting curves calculated from GENBANK sequences (1.59% of genome) by the statistical thermodynamics program MELTSIM (1), parameterized for long DNA sequences (2,3). The lower and upper temperature limits of calculated melting agree well with the observed melting of total DNA. The experimental curve is unusual in that it contains a number of sharp peaks. MELTSIM allowed us to calculate positional denaturation maps of D. discoideum GENBANK sequence documents containing the 26S, 5.8S and 17S rDNA gene sequences, a major satellite DNA and repetitive sequence family present in 100-200 copies/nucleus. These denaturation maps contain subtransitions that correspond with a number of the experimentally observed peaks, some of which we show to correspond with rDNA gene enriched CsCl gradient fractions of D. discoideum DNA. MELTSIM calculated curves of coding, intron and flanking sequences indicate that both intron and flanking sequences are extremely (A+T) rich and account for most of the low temperature melting. There is no temperature overlap between thermal stabilities of these sequence domains and those of coding DNA. The latter must satisfy triplet codon constraints of higher (G+C) content. These large stability property differences enable a denaturation mapping feature of MELTSIM to clearly distinguish exon positions from those of introns and flanking DNA in long D. discoideum gene containing sequences.

  1. Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.


    Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu


    In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms.

  2. Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.


    Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu


    In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. PMID:22330805

  3. Virulence of the Pseudomonas fluorescens clinical strain MFN1032 towards Dictyostelium discoideum and macrophages in relation with type III secretion system

    PubMed Central


    Background Pseudomonas fluorescens biovar I MFN1032 is a clinical isolate able to grow at 37°C. This strain displays secretion-mediated hemolytic activity involving phospholipase C and cyclolipopeptides, and a cell-associated hemolytic activity distinct from the secreted hemolytic activity. Cell-associated hemolysis is independent of biosurfactant production and remains in a gacA mutant. Disruption of the hrpU-like operon (the basal part of type III secretion system from rhizospheric strains) suppresses this activity. We hypothesized that this phenotype could reflect evolution of an ancestral mechanism involved in the survival of this species in its natural niche. In this study, we evaluated the hrpU-like operon’s contribution to other virulence mechanisms using a panel of Pseudomonas strains from various sources. Results We found that MFN1032 inhibited the growth of the amoebae Dictyostelium discoideum and that this inhibition involved the hrpU-like operon and was absent in a gacA mutant. MFN1032 was capable of causing macrophage lysis, if the hrpU-like operon was intact, and this cytotoxicity remained in a gacA mutant. Cell-associated hemolytic activity and macrophage necrosis were found in other P. fluorescens clinical isolates, but not in biocontrol P. fluorescens strains harbouring hrpU-like operon. The growth of Dictyostelium discoideum was inhibited to a different extent by P. fluorescens strains without correlation between this inhibition and hrpU-like operon sequences. Conclusions In P. fluorescens MFN1032, the basal part of type III secretion system plays a role in D. discoideum growth inhibition and macrophage necrosis. The inhibition of D. discoideum growth is dependent on the GacS/GacA system, while cell-associated hemolytic activity and macrophage lysis are not. Virulence against eukaryotic cells based on the hrpU-like operon may be more than just a stochastic evolution of a conserved system dedicated to survival in competition with natural

  4. Growth and developmental functions of a human immunodeficiency virus Tat-binding protein/26S protease subunit homolog from Dictyostelium discoideum.

    PubMed Central

    Cao, J G; Firtel, R A


    We have characterized a newly identified gene from Dictyostelium discoideum, DdTBP alpha, that encodes a member of the family of eukaryotic proteins. These proteins contain a conserved ATPase domain, include subunits of the 26S protease subunit, and are homologous to the mammalian human immunodeficiency virus Tat-binding protein TBP1. While information indicates that some family members are involved in the regulation of transcription in mammalian and yeast cells during growth, these proteins are also involved in other cellular functions, and nothing is known about their possible function in multicellular development. The Dictyostelium DdTBP alpha gene is developmentally regulated, with its expression at the highest levels occurring during growth and early development. The gene is present in two copies in the genome. Disruption of one copy by homologous recombination leads to aberrant morphogenesis, which lasts from the formation of the first finger until the onset of culmination. The gene appears to be essential for growth since we were unable to obtain a complete null phenotype and since expression of an inducible antisense construct in the partial null background resulted in cell death. Expression of the antisense construct during development accentuated the partial null phenotype and also resulted in very abnormal fruiting bodies. Overexpression of DdTBP alpha from its own promoter leads to very large multinucleated vegetative cells when the cells are grown in suspension culture. When the cells are plated onto petri dishes in growth medium, they rapidly split into multiple cells containing one to two nuclei, in a manner similar to that of wild-type cells. Overexpressing cells are significantly delayed in forming a multicellular aggregate, but development proceeds normally once the first finger stage is reached. The results indicate that DdTBP alpha plays an important role in regulating both growth and morphogenesis in D. discoideum. PMID:7862164

  5. Allorecognition, via TgrB1 and TgrC1, mediates the transition from unicellularity to multicellularity in the social amoeba Dictyostelium discoideum.


    Hirose, Shigenori; Santhanam, Balaji; Katoh-Kurosawa, Mariko; Shaulsky, Gad; Kuspa, Adam


    The social amoeba Dictyostelium discoideum integrates into a multicellular organism when individual starving cells aggregate and form a mound. The cells then integrate into defined tissues and develop into a fruiting body that consists of a stalk and spores. Aggregation is initially orchestrated by waves of extracellular cyclic adenosine monophosphate (cAMP), and previous theory suggested that cAMP and other field-wide diffusible signals mediate tissue integration and terminal differentiation as well. Cooperation between cells depends on an allorecognition system comprising the polymorphic adhesion proteins TgrB1 and TgrC1. Binding between compatible TgrB1 and TgrC1 variants ensures that non-matching cells segregate into distinct aggregates prior to terminal development. Here, we have embedded a small number of cells with incompatible allotypes within fields of developing cells with compatible allotypes. We found that compatibility of the allotype encoded by the tgrB1 and tgrC1 genes is required for tissue integration, as manifested in cell polarization, coordinated movement and differentiation into prestalk and prespore cells. Our results show that the molecules that mediate allorecognition in D. discoideum also control the integration of individual cells into a unified developing organism, and this acts as a gating step for multicellularity. PMID:26395484

  6. Allorecognition, via TgrB1 and TgrC1, mediates the transition from unicellularity to multicellularity in the social amoeba Dictyostelium discoideum.


    Hirose, Shigenori; Santhanam, Balaji; Katoh-Kurosawa, Mariko; Shaulsky, Gad; Kuspa, Adam


    The social amoeba Dictyostelium discoideum integrates into a multicellular organism when individual starving cells aggregate and form a mound. The cells then integrate into defined tissues and develop into a fruiting body that consists of a stalk and spores. Aggregation is initially orchestrated by waves of extracellular cyclic adenosine monophosphate (cAMP), and previous theory suggested that cAMP and other field-wide diffusible signals mediate tissue integration and terminal differentiation as well. Cooperation between cells depends on an allorecognition system comprising the polymorphic adhesion proteins TgrB1 and TgrC1. Binding between compatible TgrB1 and TgrC1 variants ensures that non-matching cells segregate into distinct aggregates prior to terminal development. Here, we have embedded a small number of cells with incompatible allotypes within fields of developing cells with compatible allotypes. We found that compatibility of the allotype encoded by the tgrB1 and tgrC1 genes is required for tissue integration, as manifested in cell polarization, coordinated movement and differentiation into prestalk and prespore cells. Our results show that the molecules that mediate allorecognition in D. discoideum also control the integration of individual cells into a unified developing organism, and this acts as a gating step for multicellularity.

  7. Characterization and genetic mapping of modA. A mutation in the post-translational modification of the glycosidases of Dictyostelium discoideum.


    Free, S J; Schimke, R T; Freeze, H; Loomis, W F


    We have isolated a mutant of Dictyostelium discoideum, M31, which produces a reduced number of alpha-mannosidase-1 molecules per cell during the developmental program of the organism. We find that several of the glycosidases, a group of lysosomal proteins produced by D. discoideum, are altered in strain M31 and that this strain produces a reduced level of at least three of these activities. These enzymes do not share a common protein subunit but are known to share a common antigenic determinant which is, in part, carbohydrate in nature. In the wild type parent of M31, alpha-mannosidase-1 is modified by the addition of mannose and glucosamine (probably as N-acetylglucosamine) in the molar ratio of 5:2. alpha-Mannosidase-1 was also found to contain phosphoserine/phosphothreonine residues. alpha-Mannosidase-1 and other glycosidases are electrophoretically less negative when isolated from strain M31 than when isolated from wild type cells. The mutation present in M31, modA, appears to affect posttranslational modification, modA is a recessive mutation which we map onto linkage group I.

  8. Use of the myosin motor domain as large-affinity tag for the expression and purification of proteins in Dictyostelium discoideum.


    Kollmar, Martin


    The cellular slime mold Dictyostelium discoideum is increasingly be used for the overexpression of proteins. Dictyostelium is amenable to classical and molecular genetic approaches and can easily be grown in large quantities. It contains a variety of chaperones and folding enzymes, and is able to perform all kinds of post-translational protein modifications. Here, new expression vectors are presented that have been designed for the production of proteins in large quantities for biochemical and structural studies. The expression cassettes of the most successful vectors are based on a tandem affinity purification tag consisting of an octahistidine tag followed by the myosin motor domain tag. The myosin motor domain not only strongly enhances the production of fused proteins but is also used for a fast affinity purification step through its ATP-dependent binding to actin. The applicability of the new system has been demonstrated for the expression and purification of subunits of the dynein-dynactin motor protein complex from different species. PMID:16516959

  9. Relevance of the bioavailable fraction of DDT and its metabolites in freshwater sediment toxicity: New insight into the mode of action of these chemicals on Dictyostelium discoideum.


    Sforzini, Susanna; Governa, Daniela; Boeri, Marta; Oliveri, Laura; Oldani, Alessandro; Vago, Fabio; Viarengo, Aldo; Borrelli, Raffaella


    In this work, the toxicity of lake sediments contaminated with DDT and its metabolites DDD and DDE (collectively, DDX) was evaluated with widely used toxicity tests (i.e., Vibrio fischeri, Daphnia magna, Pseudokirchneriella subcapitata, and Lumbriculus variegatus) and with the social amoeba Dictyostelium discoideum, a model organism that is also suitable for studying pollutant-induced alterations at the molecular and cellular levels. Although the DDX concentration in the sediments was high (732.5 ppb), the results suggested a minimal environmental risk; in fact, no evidence of harmful effects was found using the different bioassays or when we considered the results of more sensitive sublethal biomarkers in D. discoideum amoebae. In line with the biological results, the chemical data showed that the concentration of DDX in the pore water (in general a highly bioavailable phase) showed a minimal value (0.0071ppb). To confirm the importance of the bioavailability of the toxic chemicals in determining their biological effects and to investigate the mechanisms of DDX toxicity, we exposed D. discoideum amoebae to 732.5ppb DDX in water solution. DDX had no effect on cell viability; however, a strong reduction in amoebae replication rate was observed, which depended mainly on a reduction in endocytosis rate and on lysosomal and mitochondrial alterations. In the presence of a moderate and transient increase in reactive oxygen species, the glutathione level in DDX-exposed amoebae drastically decreased. These results highlight that studies of the bioavailability of pollutants in environmental matrices and their biological effects are essential for site-specific ecological risk assessment. Moreover, glutathione depletion in DDX-exposed organisms is a new finding that could open the possibility of developing new pesticide mixtures that are more effective against DDT-resistant malaria vectors. PMID:27340883

  10. Partial genetic suppression of a loss-of-function mutant of the neuronal ceroid lipofuscinosis-associated protease TPP1 in Dictyostelium discoideum.


    Phillips, Jonathan E; Gomer, Richard H


    Neuronal ceroid lipofuscinosis (NCL) is the most common childhood-onset neurodegenerative disease. NCL is inevitably fatal, and there is currently no treatment available. Children with NCL show a progressive decline in movement, vision and mental abilities, and an accumulation of autofluorescent deposits in neurons and other cell types. Late-infantile NCL is caused by mutations in the lysosomal protease tripeptidyl peptidase 1 (TPP1). TPP1 cleaves tripeptides from the N-terminus of proteins in vitro, but little is known about the physiological function of TPP1. TPP1 shows wide conservation in vertebrates but it is not found in Drosophila, Caenorhabditis elegans or Saccharomyces cerevisiae. Here, we characterize ddTpp1, a TPP1 ortholog present in the social amoeba Dictyostelium discoideum. Lysates from cells lacking ddTpp1 show a reduced but not abolished ability to cleave a TPP1 substrate, suggesting that other Dictyostelium enzymes can perform this cleavage. ddTpp1 and human TPP1 localize to the lysosome in Dictyostelium, indicating conserved function and trafficking. Cells that lack ddTpp1 show precocious multicellular development and a reduced ability to form spores during development. When cultured in autophagy-stimulating conditions, cells lacking ddTpp1 rapidly decrease in size and are less viable than wild-type cells, suggesting that one function of ddTpp1 could be to limit autophagy. Cells that lack ddTpp1 exhibit strongly impaired development in the presence of the lysosome-perturbing drug chloroquine, and this phenotype can be suppressed through a secondary mutation in the gene that we name suppressor of tpp1(-) A (stpA), which encodes a protein with some similarity to mammalian oxysterol-binding proteins (OSBPs). Taken together, these results suggest that targeting specific proteins could be a viable way to suppress the effects of loss of TPP1 function. PMID:25540127

  11. N-glycomic profiling of a glucosidase II mutant of Dictyostelium discoideum by ‘off-line’ liquid chromatography and mass spectrometry

    PubMed Central

    Hykollari, Alba; Dragosits, Martin; Rendić, Dubravko; Wilson, Iain B. H.; Paschinger, Katharina


    In this study, we have performed the first mass spectrometric analysis of N-glycans of the M31 mutant strain of the cellular slime mould Dictyostelium discoideum, previously shown to have a defect in glucosidase II. Together with glucosidase I, this enzyme mediates part of the initial processing of N-glycans; defects in either glucosidase are associated with human diseases and result in an accumulation of incorrectly-processed oligosaccharides which are not, or only poor, substrates for a range of downstream enzymes. To examine the effect of the glucosidase II mutation in Dictyostelium, we employed off-line LC-MALDI-TOF-MS in combination with chemical and enzymatic treatments and MS/MS to analyse the neutral and anionic N-glycans of the mutant as compared to the wild-type. The major neutral species were, as expected, of the composition Hex10-11HexNAc2-3 with one or two terminal glucose residues. Consistent with the block in processing of neutral N-glycans caused by the absence of glucosidase II, fucose was apparently absent from the N-glycans and bisecting N-acetylglucosamine was rare. The major anionic oligosaccharides were sulphated and/or methylphosphorylated forms of Hex8-11HexNAc2-3, many of which surprisingly lacked glucose residues entirely. As anionic N-glycans are considered to be mostly associated with lysosomal enzymes in Dictyostelium, we hypothesise that glycosidases present in the acidic compartments may act on the oligosaccharides attached to such slime mould proteins. Furthermore, our chosen analytical approach enabled us, via observation of diagnostic negative-mode MS/MS fragments, to determine the fine structure of the methylphosphorylated and sulphated N-glycans of the M31 glucosidase mutant in their native state. PMID:24574058

  12. UDP-GlcNAc:Glycoprotein N-acetylglucosamine-1-phosphotransferase mediates the initial step in the formation of the methylphosphomannosyl residues on the high mannose oligosaccharides of Dictyostelium discoideum glycoproteins.


    Qian, Yi; West, Christopher M; Kornfeld, Stuart


    The Dictyostelium discoideum gene gpt1 encodes a protein XP_638036 with sequence similarity to the alpha/beta subunits of mammalian UDP-GlcNAc:Glycoprotein N-acetylglucosamine-1-phosphotransferase. We now demonstrate that extracts of D. discoideum clones with mutations in this gene transfer GlcNAc-P from UDP-GlcNAc to mannose residues at less than 5% the wild type value. Further, the lysosomal hydrolases of these mutant clones fail to bind to a cation-independent mannose 6-phosphate receptor affinity column, indicating a lack of methylphosphomannosyl residues on the high mannose oligosaccharides of these proteins. We conclude that the gpt1 gene product catalyzes the initial step in the formation of methylphosphomannosyl residues on D. discoideum lysosomal hydrolases.

  13. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L


    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  14. Nucleotide sequence of a Dictyostelium discoideum gene encoding a protein homologous to the yeast ribosomal protein S31.


    Hoja, U; Hofmann, J; Marschalek, R; Dingermann, T


    A cDNA clone has been isolated whose coding potential is significantly homologous to the yeast ribosomal protein S31. The single copy genomic gene contains a 271 bp intron immediately downstream from the ATG translation initiation codon and is flanked by cannonical exon/intron junctions. The intron carries a CAATCAAT motif which has been described as inducer element for discoidin I gamma expression and which has also been found within the intron of the rp29 gene form D. discoideum. The deduced protein contains 110 amino acids and is slightly basic. PMID:7916591

  15. Toxicity assessment of diesel- and metal-contaminated soils through elutriate and solid phase assays with the slime mold Dictyostelium discoideum.


    Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan


    A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC.

  16. Delineation of the Roles Played by RasG and RasC in cAMP-dependent Signal Transduction during the Early Development of Dictyostelium discoideum

    PubMed Central

    Bolourani, Parvin; Spiegelman, George B.


    On starvation, the cellular slime mold Dictyostelium discoideum initiates a program of development leading to formation of multicellular structures. The initial cell aggregation requires chemotaxis to cyclic AMP (cAMP) and relay of the cAMP signal by the activation of adenylyl cyclase (ACA), and it has been shown previously that the Ras protein RasC is involved in both processes. Insertional inactivation of the rasG gene resulted in delayed aggregation and a partial inhibition of early gene expression, suggesting that RasG also has a role in early development. Both chemotaxis and ACA activation were reduced in the rasG− cells, but the effect on chemotaxis was more pronounced. When the responses of rasG− cells to cAMP were compared with the responses of rasC− and rasC−rasG− strains, generated in otherwise isogenic backgrounds, these studies revealed that signal transduction through RasG is more important in chemotaxis and early gene expression, but that signal transduction through RasC is more important in ACA activation. Because the loss of either of the two Ras proteins alone did not result in a total loss of signal output down either of the branches of the cAMP signal-response pathway, there appears to be some overlap of function. PMID:16885420

  17. Mass spectrometric analysis of neutral and anionic N-glycans from a Dictyostelium discoideum model for human congenital disorder of glycosylation CDG IL.


    Hykollari, Alba; Balog, Crina I A; Rendić, Dubravko; Braulke, Thomas; Wilson, Iain B H; Paschinger, Katharina


    The HL241 mutant strain of the cellular slime mold Dictyostelium discoideum is a potential model for human congenital disorder of glycosylation type IL (ALG9-CDG) and has been previously predicted to possess a lower degree of modification of its N-glycans with anionic moieties than the parental wild-type. In this study, we first showed that this strain has a premature stop codon in its alg9 mannosyltransferase gene compatible with the occurrence of truncated N-glycans. These were subject to an optimized analytical workflow, considering that the mass spectrometry of acidic glycans often presents challenges due to neutral loss and suppression effects. Therefore, the protein-bound N-glycans were first fractionated, after serial enzymatic release, by solid phase extraction. Then primarily single glycan species were isolated by mixed hydrophilic-interaction/anion-exchange or reversed-phase HPLC and analyzed using chemical and enzymatic treatments and MS/MS. We show that protein-linked N-glycans of the mutant are of reduced size as compared to those of wild-type AX3, but still contain core α1,3-fucose, intersecting N-acetylglucosamine, bisecting N-acetylglucosamine, methylphosphate, phosphate, and sulfate residues. We observe that a single N-glycan can carry up to four of these six possible modifications. Due to the improved analytical procedures, we reveal fuller details regarding the N-glycomic potential of this fascinating model organism. PMID:23320427

  18. Studies on ribosomal proteins in the cellular slime mold Dictyostelium discoideum. Resolution, nomenclature and molecular weights of proteins in the 40-S and 60-S ribosomal subunits.


    Ramagopal, S; Ennis, H L


    This study is concerned with the identification and subunit localization of ribosomal proteins in Dictyostelium discoideum. The characterization is based on the resolution of ribosomal proteins by various methods of electrophoresis. 34 and 42 unique proteins were identified in the 40-S and 60-S ribosomal subunits respectively. The total mass of proteins in the 40-S subunit was 746,100 daltons and 981,900 daltons in the 60-S subunit. The molecular weights of individual proteins in the 40-S subunit ranged from 13,200 to 40,900 with a number-average molecular weight of 21,900. The molecular weight range for the 60-S subunit was 13,800--51,100 with a number-average molecular weight of 23,400. The 80-S ribosome contained 78 proteins, two of which were lost upon its dissociation into subunits. All the proteins of the 40-S and 60-S subunits could be identified individually in a 80-S map as well as in unfractionated proteins from whole cells. Purification of ribosomes in high-ionic-strength buffers resulted in non-specific loss of the various proteins from the 40-S and 60-S subunits. In addition, the undissociated ribosomes contained about 10 acidic proteins in the molecular weight range 50,000--100,000, which were retained after washing the ribosomes in high-salt buffers. They were found in polysomes, run-off ribosomes and could also be identified in the 40-S subunit after dissociation.

  19. The Effects of Extracellular Calcium on Motility, Pseudopod and Uropod Formation, Chemotaxis and the Cortical Localization of Myosin II in Dictyostelium discoideum

    PubMed Central

    Lusche, Daniel F.; Wessels, Deborah; Soll, David R.


    Extracellular Ca++, a ubiquitous cation in the soluble environment of cells both free living and within the human body, regulates most aspects of amoeboid cell motility, including shape, uropod formation, pseudopod formation, velocity and turning in Dictyostelium discoideum. Hence it affects the efficiency of both basic motile behavior and chemotaxis. Extracellular Ca++ is optimal at 10 mM. A gradient of the chemoattractant cAMP generated in the absence of added Ca++ only affects turning, but in combination with extracellular Ca++, enhances the effects of extracellular Ca++. Potassium, at 40 mM, can substitute for Ca++. Mg++, Mn++, Zn++ and Na+ cannot. Extracellular Ca++, or K+, also induce the cortical localization of myosin II in a polar fashion. The effects of Ca++, K+ or a cAMP gradient do not appear to be similarly mediated by an increase in the general pool of free cytosolic Ca++. These results suggest a model, in which each agent functioning through different signaling systems, converge to affect the cortical localization of myosin II, which in turn effects the behavioral changes leading to efficient cell motility and chemotaxis. PMID:19363786

  20. Toxicity assessment of diesel- and metal-contaminated soils through elutriate and solid phase assays with the slime mold Dictyostelium discoideum.


    Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan


    A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC. PMID:26450765

  1. DdAlix, an Alix/AIP1 homolog in Dictyostelium discoideum, is required for multicellular development under low Ca2+ conditions.


    Ohkouchi, Susumu; El-Halawany, Medhat S; Aruga, Fumika; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi


    Apoptosis-linked gene 2 (ALG-2) interacting protein X (Alix), also called AIP1, is a widely conserved protein in eukaryotes. Alix and its homologs are involved in various phenomena such as apoptosis, regulation of cell adhesion, protein sorting, adaptation to stress conditions, and budding of human immunodeficiency virus (HIV). To investigate the role of Alix in development, we identified an Alix homolog in the cellular slime mold Dictyostelium discoideum and disrupted the gene by homologous recombination. The growth of DdAlix deletion mutant (alx-) cells was significantly impaired in the presence of 5 mM Li+. On an agar plate, alx- cells underwent normal development and formed fruiting bodies indistinguishable from those formed by wild-type cells. However, alx- cells could not form fruiting bodies in the presence of 5 mM Li+. Similar results were obtained when cells were developed in the presence of 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester (TMB-8), which is an antagonist of intracellular Ca2+ store. Furthermore, when the extracellular free Ca2+ was reduced to 10 nM, the ability of alx- cells, but not that of wild-type cells, to form fruiting bodies was impaired. The results indicate that DdAlix is essential for development under low Ca2+ conditions and suggest that DdAlix is involved in Ca2+ signaling during development. PMID:15276209

  2. Alterations of nuclear DNA synthesis after irradiation of the cellular slime mold Dictyostelium discoideum: studies performed in a mutant strain displaying enhanced thymidine uptake

    SciTech Connect

    Hurley, D.L.


    The auxotrophic Dictyostelium discoideum strain HPS 401 was studied. Thymidine at 8 or thymidylate at 50 supported growth to maximal cell densities. Thin layer chromatography of cell extracts showed rapid intracellular accumulation of thymidine in HPS 401 vs slightly detectable accumulation in wild-type cells. Measurements showed that methionine and thymidylate were taken into all strains at a low rate, but HPS 401 had enhanced uptake of thymidine and uridine compared to wild-type. The HPS 401 phenotype is due to the efficient utilization of thymidine as a result of increased nucleoside uptake. Rapid nuclear purification removed mitochondrial DNA without decreasing the single-strand molecular weight of the nuclear DNA. The nuclear DNA peaks on alkaline sucrose gradients were identified using filter hybridization to cloned probes. As measured by pulse-chase labelling, production of full-sized main band DNA required 45-50 minutes. Pulse labelling of the cells immediately after ultraviolet irradiation caused the single-strand molecular weight of the DNA synthesized to decrease from 8 x 10/sup 6/ daltons at O J/m/sup 2/ to 3.9 x 10/sup 6/ daltons at 50 J/m/sup 2/ to 2.6 x 10/sup 6/ daltons at 200 J/m/sup 2/. The time required for maturation into full-sized DNA increased from 1 hour at O J/m/sup 2/ to 4 hours at 20 J/m/sup 2/ and to 21 hours at 200 J/m/sup 2/. Measured amounts of DNA synthesis at times after ultraviolet irradiation showed a period of reduced incorporation, followed by the resumption of control levels. The lag period ended at the same time as the production of full-sized DNA resumed.

  3. Mitochondria are the target organelle of differentiation-inducing factor-3, an anti-tumor agent isolated from Dictyostelium discoideum [corrected].


    Kubohara, Yuzuru; Kikuchi, Haruhisa; Matsuo, Yusuke; Oshima, Yoshiteru; Homma, Yoshimi


    Differentiation-inducing factor-3 (DIF-3), found in the cellular slime mold Dictyostelium discoideum, and its derivatives such as butoxy-DIF-3 (Bu-DIF-3) are potent anti-tumor agents. However, the precise mechanisms underlying the actions of DIF-3 remain to be elucidated. In this study, we synthesized a green fluorescent derivative of DIF-3, BODIPY-DIF-3, and a control fluorescent compound, Bu-BODIPY (butyl-BODIPY), and investigated how DIF-like molecules behave in human cervical cancer HeLa cells by using both fluorescence and electron microscopy. BODIPY-DIF-3 at 5-20 µ M suppressed cell growth in a dose-dependent manner, whereas Bu-BODIPY had minimal effect on cell growth. When cells were incubated with BODIPY-DIF-3 at 20 µM, it penetrated cell membranes within 0.5 h and localized mainly in mitochondria, while Bu-BODIPY did not stain the cells. Exposure of cells for 1-3 days to DIF-3, Bu-DIF-3, BODIPY-DIF-3, or CCCP (a mitochondrial uncoupler) induced substantial mitochondrial swelling, suppressing cell growth. When added to isolated mitochondria, DIF-3, Bu-DIF-3, and BOIDPY-DIF-3, like CCCP, dose-dependently promoted the rate of oxygen consumption, but Bu-BODIPY did not. Our results suggest that these bioactive DIF-like molecules suppress cell growth, at least in part, by disturbing mitochondrial activity. This is the first report showing the cellular localization and behavior of DIF-like molecules in mammalian tumor cells. PMID:23977224

  4. Properties of a non-bioactive fluorescent derivative of differentiation-inducing factor-3, an anti-tumor agent found in Dictyostelium discoideum.


    Kubohara, Yuzuru; Kikuchi, Haruhisa; Matsuo, Yusuke; Oshima, Yoshiteru; Homma, Yoshimi


    Differentiation-inducing factor-3 (DIF-3), found in the cellular slime mold Dictyostelium discoideum, and its derivatives, such as butoxy-DIF-3 (Bu-DIF-3), are potent anti-tumor agents. To investigate the activity of DIF-like molecules in tumor cells, we recently synthesized a green fluorescent DIF-3 derivative, BODIPY-DIF-3G, and analyzed its bioactivity and cellular localization. In this study, we synthesized a red (orange) fluorescent DIF-3 derivative, BODIPY-DIF-3R, and compared the cellular localization and bioactivities of the two BODIPY-DIF-3s in HeLa human cervical cancer cells. Both fluorescent compounds penetrated the extracellular membrane within 0.5 h and localized mainly to the mitochondria. In formalin-fixed cells, the two BODIPY-DIF-3s also localized to the mitochondria, indicating that the BODIPY-DIF-3s were incorporated into mitochondria independently of the mitochondrial membrane potential. After treatment for 3 days, BODIPY-DIF-3G, but not BODIPY-DIF-3R, induced mitochondrial swelling and suppressed cell proliferation. Interestingly, the swollen mitochondria were stainable with BODIPY-DIF-3G but not with BODIPY-DIF-3R. When added to isolated mitochondria in vitro, BODIPY-DIF-3G increased dose-dependently the rate of O2 consumption, but BODIPY-DIF-3R did not. These results suggest that the bioactive BODIPY-DIF-3G suppresses cell proliferation, at least in part, by altering mitochondrial activity, whereas the non-bioactive BODIPY-DIF-3R localizes to the mitochondria but does not affect mitochondrial activity or cell proliferation. PMID:24682009

  5. A Model for Direction Sensing in Dictyostelium discoideum: Ras Activity and Symmetry Breaking Driven by a Gβγ-Mediated, Gα2-Ric8 -- Dependent Signal Transduction Network

    PubMed Central

    Cheng, Yougan; Othmer, Hans


    Chemotaxis is a dynamic cellular process, comprised of direction sensing, polarization and locomotion, that leads to the directed movement of eukaryotic cells along extracellular gradients. As a primary step in the response of an individual cell to a spatial stimulus, direction sensing has attracted numerous theoretical treatments aimed at explaining experimental observations in a variety of cell types. Here we propose a new model of direction sensing based on experiments using Dictyostelium discoideum (Dicty). The model is built around a reaction-diffusion-translocation system that involves three main component processes: a signal detection step based on G-protein-coupled receptors (GPCR) for cyclic AMP (cAMP), a transduction step based on a heterotrimetic G protein Gα2βγ, and an activation step of a monomeric G-protein Ras. The model can predict the experimentally-observed response of cells treated with latrunculin A, which removes feedback from downstream processes, under a variety of stimulus protocols. We show that Gα2βγ cycling modulated by Ric8, a nonreceptor guanine exchange factor for Gα2 in Dicty, drives multiple phases of Ras activation and leads to direction sensing and signal amplification in cAMP gradients. The model predicts that both Gα2 and Gβγ are essential for direction sensing, in that membrane-localized Gα2*, the activated GTP-bearing form of Gα2, leads to asymmetrical recruitment of RasGEF and Ric8, while globally-diffusing Gβγ mediates their activation. We show that the predicted response at the level of Ras activation encodes sufficient ‘memory’ to eliminate the ‘back-of-the wave’ problem, and the effects of diffusion and cell shape on direction sensing are also investigated. In contrast with existing LEGI models of chemotaxis, the results do not require a disparity between the diffusion coefficients of the Ras activator GEF and the Ras inhibitor GAP. Since the signal pathways we study are highly conserved between Dicty

  6. A Model for Direction Sensing in Dictyostelium discoideum: Ras Activity and Symmetry Breaking Driven by a Gβγ-Mediated, Gα2-Ric8 -- Dependent Signal Transduction Network.


    Cheng, Yougan; Othmer, Hans


    Chemotaxis is a dynamic cellular process, comprised of direction sensing, polarization and locomotion, that leads to the directed movement of eukaryotic cells along extracellular gradients. As a primary step in the response of an individual cell to a spatial stimulus, direction sensing has attracted numerous theoretical treatments aimed at explaining experimental observations in a variety of cell types. Here we propose a new model of direction sensing based on experiments using Dictyostelium discoideum (Dicty). The model is built around a reaction-diffusion-translocation system that involves three main component processes: a signal detection step based on G-protein-coupled receptors (GPCR) for cyclic AMP (cAMP), a transduction step based on a heterotrimetic G protein Gα2βγ, and an activation step of a monomeric G-protein Ras. The model can predict the experimentally-observed response of cells treated with latrunculin A, which removes feedback from downstream processes, under a variety of stimulus protocols. We show that [Formula: see text] cycling modulated by Ric8, a nonreceptor guanine exchange factor for [Formula: see text] in Dicty, drives multiple phases of Ras activation and leads to direction sensing and signal amplification in cAMP gradients. The model predicts that both [Formula: see text] and Gβγ are essential for direction sensing, in that membrane-localized [Formula: see text], the activated GTP-bearing form of [Formula: see text], leads to asymmetrical recruitment of RasGEF and Ric8, while globally-diffusing Gβγ mediates their activation. We show that the predicted response at the level of Ras activation encodes sufficient 'memory' to eliminate the 'back-of-the wave' problem, and the effects of diffusion and cell shape on direction sensing are also investigated. In contrast with existing LEGI models of chemotaxis, the results do not require a disparity between the diffusion coefficients of the Ras activator GEF and the Ras inhibitor GAP. Since

  7. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.


    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D


    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  8. Unusual sequence organization in CenB, an inverting endoglucanase from Cellulomonas fimi.

    PubMed Central

    Meinke, A; Braun, C; Gilkes, N R; Kilburn, D G; Miller, R C; Warren, R A


    The nucleotide sequence of the cenB gene was determined and used to deduce the amino acid sequence of endoglucanase B (CenB) of Cellulomonas fimi. CenB comprises 1,012 amino acids and has a molecular weight of 105,905. The polypeptide is divided by so-called linker sequences rich in proline and hydroxyamino acids into five domains: a catalytic domain of 607 amino acids at the N terminus, followed by three repeats of 98 amino acids each which are greater than 60% identical, and a C-terminal domain of 101 amino acids which is 50% identical to the cellulose-binding domains of C. fimi cellulases Cex and CenA. A deletion mutant of the cenB gene encodes a polypeptide lacking the C-terminal 333 amino acids of CenB. The truncated polypeptide is catalytically active and, like intact CenB, binds to cellulose, suggesting that CenB has a second cellulose-binding site. The sequence of amino acids 1 to 461 of CenB is 35% identical, with a further 15% similarity, to that of a cellulase from avocado, which places CenB in cellulase family E. CenB releases mostly cellobiose and cellotetraose from cellohexaose. Like CenA, CenB hydrolyzes the beta-1,4-glucosidic bond with inversion of the anomeric configuration. The pH optimum for CenB is 8.5, and that for CenA is 7.5. PMID:1987122

  9. Bacterial discrimination: Dictyostelium's discerning taste.


    Snyder, Michelle L D


    New research indicates that the social amoeba Dictyostelium discoideum recognizes distinctions between Gram(-) and Gram(+) bacterial prey and responds discriminately to these two groups of bacteria. These findings may lend insight to the origins of microbial pattern recognition in innate immunity.

  10. Dictyostelium discoideum, a lower eukaryote model for the study of DNA repair: Implications for the role of DNA-damaging chemicals in the evolution of repair proficient cells

    NASA Astrophysics Data System (ADS)

    Deering, R. A.


    The evolution of the ability of living cells to cope with stress is crucial for the maintenance of their genetic integrity. Yet low levels of mutation must remain to allow adaptation to environmental changes. The cellular slime mold D. discoideum is a good system for studying molecular aspects of the repair of lethal and mutagenic damage to DNA by radiation and chemicals. The wild-type strains of this soil microorganism are extremely resistant to DNA damaging agents. In nature the amoeboid cells in their replicative stage feed on soil bacteria and are exposed to numerous DNA-damaging chemicals produced by various soil microorganisms. It is probable that the evolution of repair systems in this organism and perhaps in others is a consequence of the necessity to cope with chemical damage which also confers resistance to radiation.

  11. Dictyostelium discoideum, a lower eukaryote model for the study of DNA repair: implications for the role of DNA-damaging chemicals in the evolution of repair proficient cells.


    Deering, R A


    The evolution of the ability of living cells to cope with stress is crucial for the maintenance of their genetic integrity. Yet low levels of mutation must remain to allow adaptation to environmental changes. The cellular slime mold D. discoideum is a good system for studying molecular aspects of the repair of lethal and mutagenic damage to DNA by radiation and chemicals. The wild-type strains of this soil microorganism are extremely resistant to DNA damaging agents. In nature the amoeboid cells in their replicative stage feed on soil bacteria and are exposed to numerous DNA-damaging chemicals produced by various soil microorganisms. It is probable that the evolution of repair systems in this organism and perhaps in others is a consequence of the necessity to cope with chemical damage which also confers resistance to radiation. PMID:11539974

  12. Genetic control of morphogenesis in Dictyostelium

    PubMed Central

    Loomis, William F.


    Cells grow, move, expand, shrink and die in the process of generating the characteristic shapes of organisms. Although the structures generated during development of the social amoeba Dictyostelium discoideum look nothing like the structures seen in metazoan embryogenesis, some of the morphogenetic processes used in their making are surprisingly similar. Recent advances in understanding the molecular basis for directed cell migration, cell type specific sorting, differential adhesion, secretion of matrix components, pattern formation, regulation and terminal differentiation are reviewed. Genes involved in Dictyostelium aggregation, slug formation, and culmination of fruiting bodies are discussed. PMID:25872182

  13. Chemotactic Blebbing in Dictyostelium Cells.


    Zatulovskiy, Evgeny; Kay, Robert R


    Many researchers use the social amoeba Dictyostelium discoideum as a model organism to study various aspects of the eukaryotic cell chemotaxis. Traditionally, Dictyostelium chemotaxis is considered to be driven mainly by branched F-actin polymerization. However, recently it has become evident that Dictyostelium, as well as many other eukaryotic cells, can also employ intracellular hydrostatic pressure to generate force for migration. This process results in the projection of hemispherical plasma membrane protrusions, called blebs, that can be controlled by chemotactic signaling.Here we describe two methods to study chemotactic blebbing in Dictyostelium cells and to analyze the intensity of the blebbing response in various strains and under different conditions. The first of these methods-the cyclic-AMP shock assay-allows one to quantify the global blebbing response of cells to a uniform chemoattractant stimulation. The second one-the under-agarose migration assay-induces directional blebbing in cells moving in a gradient of chemoattractant. In this assay, the cells can be switched from a predominantly F-actin-driven mode of motility to a bleb-driven chemotaxis, allowing one to compare the efficiency of both modes and explore the molecular machinery controlling chemotactic blebbing. PMID:27271896

  14. Biogenesis of lysosomal enzymes in the alpha-glucosidase II-deficient modA mutant of Dictyostelium discoideum: retention of alpha-1,3-linked glucose on N-linked oligosaccharides delays intracellular transport but does not alter sorting of alpha-mannosidase or beta-glucosidase.


    Ebert, D L; Bush, J M; Dimond, R L; Cardelli, J A


    The endoplasmic reticulum-localized enzyme alpha-glucosidase II is responsible for removing the two alpha-1,3-linked glucose residues from N-linked oligosaccharides of glycoproteins. This activity is missing in the modA mutant strain, M31, of Dictyostelium discoideum. Results from both radiolabeled pulse-chase and subcellular fractionation experiments indicate that this deficiency did not prevent intracellular transport and proteolytic processing of the lysosomal enzymes, alpha-mannosidase and beta-glucosidase. However, the rate at which the glucosylated precursors left the rough endoplasmic reticulum was several-fold slower than the rate at which the wild-type precursors left this compartment. Retention of glucose residues did not disrupt the binding of the precursor forms of the enzymes with intracellular membranes, indicating that the delay in movement of proteins from the ER did not result from lack of association with membranes. However, the mutant alpha-mannosidase precursor contained more trypsin-sensitive sites than did the wild-type precursor, suggesting that improper folding of precursor molecules might account for the slow rate of transport to the Golgi complex. Percoll density gradient fractionation of extracts prepared from M31 cells indicated that the proteolytically processed mature forms of alpha-mannosidase and beta-glucosidase were localized to lysosomes. Finally, the mutation in M31 may have other, more dramatic, effects on the lysosomal system since two enzymes, N-acetylglucosaminidase and acid phosphatase, were secreted much less efficiently from lysosomal compartments by the mutant strain.

  15. Dictyostelium discoideum cells lacking the 34,000-dalton actin-binding protein can grow, locomote, and develop, but exhibit defects in regulation of cell structure and movement: a case of partial redundancy

    PubMed Central


    Cells lacking the Dictyostelium 34,000-D actin-bundling protein, a calcium-regulated actin cross-linking protein, were created to probe the function of this polypeptide in living cells. Gene replacement vectors were constructed by inserting either the UMP synthase or hygromycin resistance cassette into cloned 4-kb genomic DNA containing sequences encoding the 34-kD protein. After transformation and growth under appropriate selection, cells lacking the protein were analyzed by PCR analyses on genomic DNA, Northern blotting, and Western blotting. Cells lacking the 34-kD protein were obtained in strains derived from AX2 and AX3. Growth, pinocytosis, morphogenesis, and expression of developmentally regulated genes is normal in cells lacking the 34-kD protein. In chemotaxis studies, 34-kD- cells were able to locomote and orient normally, but showed an increased persistence of motility. The 34-kD- cells also lost bits of cytoplasm during locomotion. The 34-kD- cells exhibited either an excessive number of long and branched filopodia, or a decrease in filopodial length and an increase in the total number of filopodia per cell depending on the strain. Reexpression of the 34-kD protein in the AX2-derived strain led to a "rescue" of the defect in the persistence of motility and of the excess numbers of long and branched filopodia, demonstrating that these defects result from the absence of the 34-kD protein. We explain the results through a model of partial functional redundancy. Numerous other actin cross-linking proteins in Dictyostelium may be able to substitute for some functions of the 34-kD protein in the 34-kD cells. The observed phenotype is presumed to result from functions that cannot be adequately supplanted by a substitution of another actin cross- linking protein. We conclude that the 34-kD actin-bundling protein is not essential for growth, but plays an important role in dynamic control of cell shape and cytoplasmic structure. PMID:8922380

  16. Extracellular chemical signal controlling phototactic behavior by D. discoideum slugs

    SciTech Connect

    Fisher, P.R.; Smith, E.; Williams, K.L.


    Developing cells of the cellular slime mold Dictyostelium discoideum release a low molecular weight metabolite (Slug Turning Factor, STF) which, at high uniform concentrations, interferes with phototaxis and thermotaxis by D. discoideum slugs. D. discoideum slugs migrating in darkness are repelled by (exhibit negative chemotaxis to) crude STF exudates. Dose-response curves relating the accuracies of phototaxis and negative chemotaxis to STF concentration indicate that, in both phototaxis and chemotaxis, slugs measure the ratios of STF concentrations on their opposite sides. Net STF release is enhanced by light. Researchers propose that light, focused onto the slug's distal side by its convex surface, generates a lateral STF gradient in response to which the slug turns toward the light source.

  17. Studying Chemoattractant Signal Transduction Dynamics in Dictyostelium by BRET.


    Islam, A F M Tariqul; Stepanski, Branden M; Charest, Pascale G


    Understanding the dynamics of chemoattractant signaling is key to our understanding of the mechanisms underlying the directed migration of cells, including that of neutrophils to sites of infections and of cancer cells during metastasis. A model frequently used for deciphering chemoattractant signal transduction is the social amoeba Dictyostelium discoideum. However, the methods available to quantitatively measure chemotactic signaling are limited. Here, we describe a protocol to quantitatively study chemoattractant signal transduction in Dictyostelium by monitoring protein-protein interactions and conformational changes using Bioluminescence Resonance Energy Transfer (BRET). PMID:27271894

  18. Learning physics of living systems from Dictyostelium.


    Levine, Herbert


    Unlike a new generation of scientists that are being trained directly to work on the physics of living systems, most of us more senior members of the community had to find our way from other research areas. We all have our own stories as to how we made this transition. Here, I describe how a chance encounter with the eukaryotic microorganism Dictyostelium discoideum led to a decades-long research project and taught me valuable lessons about how physics and biology can be mutually supportive disciplines.

  19. Crawling into a new era-the Dictyostelium genome project.


    Eichinger, Ludwig; Noegel, Angelika A


    The social amoeba Dictyostelium discoideum is a well-established model organism for the study of basic aspects of differentiation, signal transduction, phagocytosis, cytokinesis and cell motility. Its genome is being sequenced by an international consortium using a whole chromosome shotgun approach. The pacemaker of the D.discoideum genome project has been chromosome 2, the largest chromosome, which at 8 Mb represents approximately 25% of the genome and whose sequence and analysis have been published recently. Chromosomes 1 and 6 are close to being finished. To accelerate completion of the genome sequence, the next step in the project will be a whole-genome assembly followed by the analysis of the complete gene content. The completed genome sequence and its analysis provide the basis for genome-wide functional studies. It will position Dictyostelium at the same level as other model organisms and further enhance its experimental attractiveness. PMID:12727861

  20. Multiple domains in endoglucanase B (CenB) from Cellulomonas fimi: functions and relatedness to domains in other polypeptides.

    PubMed Central

    Meinke, A; Gilkes, N R; Kilburn, D G; Miller, R C; Warren, R A


    Endoglucanase B (CenB) from the bacterium Cellulomonas fimi is divided into five discrete domains by linker sequences rich in proline and hydroxyamino acids (A. Meinke, C. Braun, N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and R. A. J. Warren, J. Bacteriol. 173:308-314, 1991). The catalytic domain of 608 amino acids is at the N terminus. The sequence of the first 477 amino acids in the catalytic domain is related to the sequences of cellulases in family E, which includes procaryotic and eucaryotic enzymes. The sequence of the last 131 amino acids of the catalytic domain is related to sequences present in a number of cellulases from different families. The catalytic domain alone can bind to cellulose, and this binding is mediated at least in part by the C-terminal 131 amino acids. Deletion of these 131 amino acids reduces but does not eliminate activity. The catalytic domain is followed by three domains which are repeats of a 98-amino-acid sequence. The repeats are approximately 50% identical to two repeats of 95 amino acids in a chitinase from Bacillus circulans which are related to fibronectin type III repeats (T. Watanabe, K. Suzuki, K. Oyanagi, K. Ohnishi, and H. Tanaka, J. Biol. Chem. 265:15659-15665, 1990). The C-terminal domain of 101 amino acids is related to sequences, present in a number of bacterial cellulases and xylanases from different families, which form cellulose-binding domains (CBDs). It functions as a CBD when fused to a heterologous polypeptide. Cells of Escherichia coli expressing the wild-type cenB gene accumulate both native CenB and a stable proteolytic fragment of 41 kDa comprising the three repeats and the C-terminal CBD. The 41-kDa polypeptide binds to cellulose but lacks enzymatic activity. Images FIG. 7 FIG. 8 PMID:1938913

  1. Dictyostelium Cultivation, Transfection, Microscopy and Fractionation

    PubMed Central

    Hirst, Jennifer; Kay, Robert R; Traynor, David


    The real time visualisation of fluorescently tagged proteins in live cells using ever more sophisticated microscopes has greatly increased our understanding of the dynamics of key proteins during fundamental physiological processes such as cell locomotion, chemotaxis, cell division and membrane trafficking. In addition the fractionation of cells and isolation of organelles or known compartments can often verify any subcellular localisation and the use of tagged proteins as bait for the immunoprecipitation of material from cell fractions can identify specific binding partners and multiprotein complexes thereby helping assign a function to the tagged protein. We have successfully applied these techniques to the Dictyostelium discoideum protein TSPOON that is part of an ancient heterohexamer membrane trafficking complex (Hirst et al., 2013). TSPOON is the product of the tstD gene in Dictyostelium and is not required for growth or the developmental cycle in this organism. Dictyostelium amoebae will exist in a vegetative phase where growth is sustained by the phagocytosis of bacteria. When this food source is spent they enter a developmental phase where the amoebae aggregate, via chemotaxis to extracellular waves of cAMP, into multicellular structures that subsequently form a fruiting body containing viable spores (Muller-Taubenberger et al., 2013). In the laboratory this cycle takes less than 24 h to complete and as a further aid to manipulation the requirement for a bacterial food source has been circumvented by the derivatisation of the wild type and isolation of axenic strains that can also grow in a nutrient rich broth. Axenic strains like Ax2 are the mainstay of laboratory research using Dictyostelium (Muller-Taubenberger et al., 2013). A description of Dictyostelium cell cultivation, the generation of cell lines that overexpress TSPOON-GFP and TSPOON null cells, and subsequent analysis (Muller-Taubenberger and Ishikawa-Ankerhold, 2013) is detailed below. PMID

  2. Dictyostelium host response to legionella infection: strategies and assays.


    Bozzaro, Salvatore; Peracino, Barbara; Eichinger, Ludwig


    The professional phagocyte Dictyostelium discoideum is a simple eukaryotic microorganism, whose natural habitat is deciduous forest soil and decaying leaves, where the amoebae feed on bacteria and grow as separate, independent, single cells. In the last decade, the organism has been successfully used as a host for several human pathogens, including Legionella pneumophila, Mycobacterium avium and Mycobacterium marinum,Pseudomonas aeruginosa, Klebsiella pneumoniae, Cryptococcus neoformans, and Salmonella typhimurium. To dissect the complex cross-talk between host and pathogen Dictyostelium offers easy cultivation, a high quality genome sequence and excellent molecular genetic and biochemical tools. Dictyostelium cells are also extremely suitable for cell biological studies, which in combination with in vivo expression of fluorescence-tagged proteins allow investigating the dynamics of bacterial uptake and infection. Inactivation of genes by homologous recombination as well as gene rescue and overexpression are well established and a large mutant collection is available at the Dictyostelium stock center, favoring identification of host resistance or susceptibility genes. Here, we briefly introduce the organism, address the value of Dictyostelium as model host, describe strategies to identify host cell factors important for infection followed by protocols for cell culture and storage, uptake and infection, and confocal microscopy of infected cells. PMID:23150412

  3. Dictyostelium host response to legionella infection: strategies and assays.


    Bozzaro, Salvatore; Peracino, Barbara; Eichinger, Ludwig


    The professional phagocyte Dictyostelium discoideum is a simple eukaryotic microorganism, whose natural habitat is deciduous forest soil and decaying leaves, where the amoebae feed on bacteria and grow as separate, independent, single cells. In the last decade, the organism has been successfully used as a host for several human pathogens, including Legionella pneumophila, Mycobacterium avium and Mycobacterium marinum,Pseudomonas aeruginosa, Klebsiella pneumoniae, Cryptococcus neoformans, and Salmonella typhimurium. To dissect the complex cross-talk between host and pathogen Dictyostelium offers easy cultivation, a high quality genome sequence and excellent molecular genetic and biochemical tools. Dictyostelium cells are also extremely suitable for cell biological studies, which in combination with in vivo expression of fluorescence-tagged proteins allow investigating the dynamics of bacterial uptake and infection. Inactivation of genes by homologous recombination as well as gene rescue and overexpression are well established and a large mutant collection is available at the Dictyostelium stock center, favoring identification of host resistance or susceptibility genes. Here, we briefly introduce the organism, address the value of Dictyostelium as model host, describe strategies to identify host cell factors important for infection followed by protocols for cell culture and storage, uptake and infection, and confocal microscopy of infected cells.

  4. Mound-Interface Kinetics in Dictyostelium Aggregation

    NASA Astrophysics Data System (ADS)

    Tutu, Hiroki


    The mound development of the cellular slime mold amoebae Dictyostelium discoideum is studied with an interface kinetic model for the height of cell layers. As a competitive role for the chemotaxis, we compare two types of curvature relaxations; the surface relaxation induced by cell-substrate affinity (model A), and that comes from a cell-cell adhesive effect (model B). It is found that both models are characterized by the growth law for the maximum mound height. Based on a self-similarity scaling hypothesis for the spatial structure of streaming pattern, we suggest a scaling law for the growth of mound-height hmax ˜ t1-1/α+β/α with α = 2 (4) for the model A (B) and a number 0 ≤ β < 1.

  5. The cooperative amoeba: Dictyostelium as a model for social evolution.


    Li, Si I; Purugganan, Michael D


    Social interactions, including cooperation and altruism, are characteristic of numerous species, but many aspects of the evolution, ecology and genetics of social behavior remain unclear. The microbial soil amoeba Dictyostelium discoideum is a model system for the study of social evolution and provides insights into the nature of social cooperation and its genetic basis. This species exhibits altruism during both asexual and sexual cycles of its life history, and recent studies have uncovered several possible genetic mechanisms associated with kin discrimination and cheating behavior during asexual fruiting-body formation. By contrast, the molecular and evolutionary mechanisms that underlie sexual macrocyst formation remain largely enigmatic. D. discoideum, given its utility in molecular genetic studies, should continue to help us address these and other relevant questions in sociobiology, and thereby contribute to a coherent theoretical framework for the nature of social cooperation. PMID:21167620

  6. The cooperative amoeba: Dictyostelium as a model for social evolution.


    Li, Si I; Purugganan, Michael D


    Social interactions, including cooperation and altruism, are characteristic of numerous species, but many aspects of the evolution, ecology and genetics of social behavior remain unclear. The microbial soil amoeba Dictyostelium discoideum is a model system for the study of social evolution and provides insights into the nature of social cooperation and its genetic basis. This species exhibits altruism during both asexual and sexual cycles of its life history, and recent studies have uncovered several possible genetic mechanisms associated with kin discrimination and cheating behavior during asexual fruiting-body formation. By contrast, the molecular and evolutionary mechanisms that underlie sexual macrocyst formation remain largely enigmatic. D. discoideum, given its utility in molecular genetic studies, should continue to help us address these and other relevant questions in sociobiology, and thereby contribute to a coherent theoretical framework for the nature of social cooperation.

  7. Self-organized Motion During Dictyostelium amoebae aggregation

    NASA Astrophysics Data System (ADS)

    Levine, Herbert


    After starvation, amoeba of the cellular slime mold Dictyostelium discoideum aggregate to form rudimentary multicellular organisms. The coordination of the individual motions of hundreds of thousands of individual cells is an important ingredient in the success of this process. This coordination is accomplished by chemical signaling during the early stages and by direct cell-cell interactions once the cells reach the nascent mound. This talk will review the basic nonequilibrium physics underlying the spatial patterns formed by these cooperative motions, including high-density incoming streams and spontaneously rotating mounds.

  8. Skipper, an LTR retrotransposon of Dictyostelium.

    PubMed Central

    Leng, P; Klatte, D H; Schumann, G; Boeke, J D; Steck, T L


    The complete sequence of a retrotransposon from Dictyostelium discoideum , named skipper , was obtained from cDNA and genomic clones. The sequence of a nearly full-length skipper cDNA was similar to that of three other partially sequenced cDNAs. The corresponding retrotransposon is represented in approximately 15-20 copies and is abundantly transcribed. Skipper contains three open reading frames (ORFs) with an unusual sequence organization, aspects of which resemble certain mammalian retroviruses. ORFs 1 and 3 correspond to gag and pol genes; the second ORF, pro, corresponding to protease, was separated from gag by a single stop codon followed shortly thereafter by a potential pseudoknot. ORF3 (pol) was separated from pro by a +1 frameshift. ORFs 2 and 3 overlapped by 32 bp. The computed amino acid sequences of the skipper ORFs contain regions resembling retrotransposon polyprotein domains, including a nucleic acid binding protein, aspartyl protease, reverse transcriptase and integrase. Skipper is the first example of a retrotransposon with a separate pro gene. Skipper is also novel in that it appears to use stop codon suppression rather than frameshifting to modulate pro expression. Finally, skipper and its components may provide useful tools for the genetic characterization of Dictyostelium. PMID:9518497

  9. Dictyostelium Lipid Droplets Host Novel Proteins

    PubMed Central

    Du, Xiaoli; Barisch, Caroline; Paschke, Peggy; Herrfurth, Cornelia; Bertinetti, Oliver; Pawolleck, Nadine; Otto, Heike; Rühling, Harald; Feussner, Ivo; Herberg, Friedrich W.


    Across all kingdoms of life, cells store energy in a specialized organelle, the lipid droplet. In general, it consists of a hydrophobic core of triglycerides and steryl esters surrounded by only one leaflet derived from the endoplasmic reticulum membrane to which a specific set of proteins is bound. We have chosen the unicellular organism Dictyostelium discoideum to establish kinetics of lipid droplet formation and degradation and to further identify the lipid constituents and proteins of lipid droplets. Here, we show that the lipid composition is similar to what is found in mammalian lipid droplets. In addition, phospholipids preferentially consist of mainly saturated fatty acids, whereas neutral lipids are enriched in unsaturated fatty acids. Among the novel protein components are LdpA, a protein specific to Dictyostelium, and Net4, which has strong homologies to mammalian DUF829/Tmem53/NET4 that was previously only known as a constituent of the mammalian nuclear envelope. The proteins analyzed so far appear to move from the endoplasmic reticulum to the lipid droplets, supporting the concept that lipid droplets are formed on this membrane. PMID:24036346

  10. Cell signaling during development of Dictyostelium

    PubMed Central

    Loomis, William F.


    Continuous communication between cells is necessary for development of any multicellular organism and depends on the recognition of secreted signals. A wide range of molecules including proteins, peptides, amino acids, nucleic acids, steroids and polylketides are used as intercellular signals in plants and animals. They are also used for communication in the social amoeba Dictyostelium discoideum when the solitary cells aggregate to form multicellular structures. Many of the signals are recognized by surface receptors that are seven-transmembrane proteins coupled to trimeric G proteins, which pass the signal on to components within the cytoplasm. Dictyostelium cells have to judge when sufficient cell density has been reached to warrant transition from growth to differentiation. They have to recognize when exogenous nutrients become limiting, and then synchronously initiate development. A few hours later they signal each other with pulses of cAMP that regulate gene expression as well as direct chemotactic aggregation. They then have to recognize kinship and only continue developing when they are surrounded by close kin. Thereafter, the cells diverge into two specialized cell types, prespore and prestalk cells, that continue to signal each other in complex ways to form well proportioned fruiting bodies. In this way they can proceed through the stages of a dependent sequence in an orderly manner without cells being left out or directed down the wrong path. PMID:24726820

  11. Modeling oscillations and spiral waves in Dictyostelium populations

    NASA Astrophysics Data System (ADS)

    Noorbakhsh, Javad; Schwab, David J.; Sgro, Allyson E.; Gregor, Thomas; Mehta, Pankaj


    Unicellular organisms exhibit elaborate collective behaviors in response to environmental cues. These behaviors are controlled by complex biochemical networks within individual cells and coordinated through cell-to-cell communication. Describing these behaviors requires new mathematical models that can bridge scales—from biochemical networks within individual cells to spatially structured cellular populations. Here we present a family of "multiscale" models for the emergence of spiral waves in the social amoeba Dictyostelium discoideum. Our models exploit new experimental advances that allow for the direct measurement and manipulation of the small signaling molecule cyclic adenosine monophosphate (cAMP) used by Dictyostelium cells to coordinate behavior in cellular populations. Inspired by recent experiments, we model the Dictyostelium signaling network as an excitable system coupled to various preprocessing modules. We use this family of models to study spatially unstructured populations of "fixed" cells by constructing phase diagrams that relate the properties of population-level oscillations to parameters in the underlying biochemical network. We then briefly discuss an extension of our model that includes spatial structure and show how this naturally gives rise to spiral waves. Our models exhibit a wide range of novel phenomena. including a density-dependent frequency change, bistability, and dynamic death due to slow cAMP dynamics. Our modeling approach provides a powerful tool for bridging scales in modeling of Dictyostelium populations.

  12. Modeling oscillations and spiral waves in Dictyostelium populations.


    Noorbakhsh, Javad; Schwab, David J; Sgro, Allyson E; Gregor, Thomas; Mehta, Pankaj


    Unicellular organisms exhibit elaborate collective behaviors in response to environmental cues. These behaviors are controlled by complex biochemical networks within individual cells and coordinated through cell-to-cell communication. Describing these behaviors requires new mathematical models that can bridge scales-from biochemical networks within individual cells to spatially structured cellular populations. Here we present a family of "multiscale" models for the emergence of spiral waves in the social amoeba Dictyostelium discoideum. Our models exploit new experimental advances that allow for the direct measurement and manipulation of the small signaling molecule cyclic adenosine monophosphate (cAMP) used by Dictyostelium cells to coordinate behavior in cellular populations. Inspired by recent experiments, we model the Dictyostelium signaling network as an excitable system coupled to various preprocessing modules. We use this family of models to study spatially unstructured populations of "fixed" cells by constructing phase diagrams that relate the properties of population-level oscillations to parameters in the underlying biochemical network. We then briefly discuss an extension of our model that includes spatial structure and show how this naturally gives rise to spiral waves. Our models exhibit a wide range of novel phenomena. including a density-dependent frequency change, bistability, and dynamic death due to slow cAMP dynamics. Our modeling approach provides a powerful tool for bridging scales in modeling of Dictyostelium populations. PMID:26172740

  13. Guenther Gerisch and Dictyostelium, the microbial model for ameboid motility and multicellular morphogenesis.


    Bozzaro, Salvatore; Fisher, Paul R; Loomis, William; Satir, Peter; Segall, Jeffrey E


    Beginning in 1960 and continuing to this day, Guenther Gerisch's work on the social ameba Dictyostelium discoideum has helped to make it the model organism of choice for studies of cellular activities that depend upon the actomyosin cytoskeleton. Gerisch has brought insight and quantitative rigor to cell biology by developing novel assays and by applying advanced genetic, biochemical and microscopic techniques to topics as varied as cell-cell adhesion, chemotaxis, motility, endocytosis and cytokinesis. PMID:15450981

  14. One stop shop for everything Dictyostelium: dictyBase and the Dicty Stock Center in 2012

    PubMed Central

    Fey, Petra; Dodson, Robert J.; Basu, Siddhartha; Chisholm, Rex L.


    dictyBase (http://, the model organism database for Dictyostelium discoideum, includes the complete genome sequence and expression data for this organism. Relevant literature is integrated into the database, and gene models and functional annotation are manually curated from experimental results and comparative multigenome analyses. dictyBase has recently expanded to include the genome sequences of three additional Dictyostelids, and has added new software tools to facilitate multigenome comparisons. The Dicty Stock Center, a strain and plasmid repository for Dictyostelium research has relocated to Northwestern University in 2009. This allowed us integrating all Dictyostelium resources to better serve the research community. In this chapter, we will describe how to navigate the website and highlight some of our newer improvements. PMID:23494302

  15. Pycnosomes: Condensed Endosomal Structures Secreted by Dictyostelium Amoebae

    PubMed Central

    Sabra, Ayman; Leiba, Jade; Mas, Lauriane; Louwagie, Mathilde; Couté, Yohann; Journet, Agnès; Cosson, Pierre; Aubry, Laurence


    Dictyostelium discoideum has been used largely as a model organism to study the organization and function of the endocytic pathway. Here we describe dense structures present in D. discoideum endocytic compartments, which we named pycnosomes. Pycnosomes are constitutively secreted in the extracellular medium, from which they can be recovered by differential centrifugation. We identified the most abundant protein present in secreted pycnosomes, that we designated SctA. SctA defines a new family of proteins with four members in D. discoideum, and homologous proteins in other protists and eumetazoa. We developed a monoclonal antibody specific for SctA and used it to further characterize secreted and intracellular pycnosomes. Within cells, immunofluorescence as well as electron microscopy identified pycnosomes as SctA-enriched dense structures in the lumen of endocytic compartments. Pycnosomes are occasionally seen in continuity with intra-endosomal membranes, particularly in U18666A-treated cells where intraluminal budding is highly enhanced. While the exact nature, origin and cellular function of pycnosomes remain to be established, this study provides a first description of these structures as well as a characterization of reagents that can be used for further studies. PMID:27187592

  16. Pycnosomes: Condensed Endosomal Structures Secreted by Dictyostelium Amoebae.


    Sabra, Ayman; Leiba, Jade; Mas, Lauriane; Louwagie, Mathilde; Couté, Yohann; Journet, Agnès; Cosson, Pierre; Aubry, Laurence


    Dictyostelium discoideum has been used largely as a model organism to study the organization and function of the endocytic pathway. Here we describe dense structures present in D. discoideum endocytic compartments, which we named pycnosomes. Pycnosomes are constitutively secreted in the extracellular medium, from which they can be recovered by differential centrifugation. We identified the most abundant protein present in secreted pycnosomes, that we designated SctA. SctA defines a new family of proteins with four members in D. discoideum, and homologous proteins in other protists and eumetazoa. We developed a monoclonal antibody specific for SctA and used it to further characterize secreted and intracellular pycnosomes. Within cells, immunofluorescence as well as electron microscopy identified pycnosomes as SctA-enriched dense structures in the lumen of endocytic compartments. Pycnosomes are occasionally seen in continuity with intra-endosomal membranes, particularly in U18666A-treated cells where intraluminal budding is highly enhanced. While the exact nature, origin and cellular function of pycnosomes remain to be established, this study provides a first description of these structures as well as a characterization of reagents that can be used for further studies.

  17. Protein misfolding in Dictyostelium: Using a freak of nature to gain insight into a universal problem

    PubMed Central

    Malinovska, Liliana; Alberti, Simon


    Abstract Prion-like proteins can undergo conformational rearrangements from an intrinsically disordered to a highly ordered amyloid state. This ability to change conformation is encoded in distinctive domains, termed prion domains (PrDs). Previous work suggests that PrDs change conformation to affect protein function and create phenotypic diversity. More recent work shows that PrDs can also undergo many weak interactions when disordered, allowing them to organize the intracellular space into dynamic compartments. However, mutations within PrDs and altered aggregation properties have also been linked to age-related diseases in humans. Thus, the physiological role of prion-like proteins, the mechanisms regulating their conformational promiscuity and the links to disease are still unclear. Here, we summarize recent work with prion-like proteins in Dictyostelium discoideum. This work was motivated by the finding that D. discoideum has the highest content of prion-like proteins of all organisms investigated to date. Surprisingly, we find that endogenous and exogenous prion-like proteins remain soluble in D. discoideum and do not misfold and aggregate. We provide evidence that this is due to specific adaptations in the protein quality control machinery, which may allow D. discoideum to tolerate its highly aggregation-prone proteome. We predict that D. discoideum will be an important model to study the function of prion-like proteins and their mechanistic links to disease. PMID:26529309

  18. Protein misfolding in Dictyostelium: Using a freak of nature to gain insight into a universal problem.


    Malinovska, Liliana; Alberti, Simon


    Prion-like proteins can undergo conformational rearrangements from an intrinsically disordered to a highly ordered amyloid state. This ability to change conformation is encoded in distinctive domains, termed prion domains (PrDs). Previous work suggests that PrDs change conformation to affect protein function and create phenotypic diversity. More recent work shows that PrDs can also undergo many weak interactions when disordered, allowing them to organize the intracellular space into dynamic compartments. However, mutations within PrDs and altered aggregation properties have also been linked to age-related diseases in humans. Thus, the physiological role of prion-like proteins, the mechanisms regulating their conformational promiscuity and the links to disease are still unclear. Here, we summarize recent work with prion-like proteins in Dictyostelium discoideum. This work was motivated by the finding that D. discoideum has the highest content of prion-like proteins of all organisms investigated to date. Surprisingly, we find that endogenous and exogenous prion-like proteins remain soluble in D. discoideum and do not misfold and aggregate. We provide evidence that this is due to specific adaptations in the protein quality control machinery, which may allow D. discoideum to tolerate its highly aggregation-prone proteome. We predict that D. discoideum will be an important model to study the function of prion-like proteins and their mechanistic links to disease. PMID:26529309

  19. Naringenin is a novel inhibitor of Dictyostelium cell proliferation and cell migration

    SciTech Connect

    Russ, Misty; Martinez, Raquel; Ali, Hind; Steimle, Paul A. . E-mail:


    Naringenin is a flavanone compound that alters critical cellular processes such as cell multiplication, glucose uptake, and mitochondrial activity. In this study, we used the social amoeba, Dictyostelium discoideum, as a model system for examining the cellular processes and signaling pathways affected by naringenin. We found that naringenin inhibited Dictyostelium cell division in a dose-dependent manner (IC{sub 5} {approx} 20 {mu}M). Assays of Dictyostelium chemotaxis and multicellular development revealed that naringenin possesses a previously unrecognized ability to suppress amoeboid cell motility. We also found that naringenin, which is known to inhibit phosphatidylinositol 3-kinase activity, had no apparent effect on phosphatidylinositol 3,4,5-trisphosphate synthesis in live Dictyostelium cells; suggesting that this compound suppresses cell growth and migration via alternative signaling pathways. In another context, the discoveries described here highlight the value of using the Dictyostelium model system for identifying and characterizing the mechanisms by which naringenin, and related compounds, exert their effects on eukaryotic cells.

  20. How social evolution theory impacts our understanding of development in the social amoeba Dictyostelium.


    Strassmann, Joan E; Queller, David C


    Dictyostelium discoideum has been very useful for elucidating principles of development over the last 50 years, but a key attribute means there is a lot to be learned from a very different intellectual tradition: social evolution. Because Dictyostelium arrives at multicellularity by aggregation instead of through a single-cell bottleneck, the multicellular body could be made up of genetically distinct cells. If they are genetically distinct, natural selection will result in conflict over which cells become fertile spores and which become dead stalk cells. Evidence for this conflict includes unequal representation of two genetically different clones in spores of a chimera, the poison-like differentiation inducing factor (DIF) system that appears to involve some cells forcing others to become stalk, and reduced functionality in migrating chimeras. Understanding how selection operates on chimeras of genetically distinct clones is crucial for a comprehensive view of Dictyostelium multicellularity. In nature, Dictyostelium fruiting bodies are often clonal, or nearly so, meaning development will often be very cooperative. Relatedness levels tell us what benefits must be present for sociality to evolve. Therefore it is important to measure relatedness in nature, show that it has an impact on cooperation in the laboratory, and investigate genes that Dictyostelium uses to discriminate between relatives and non-relatives. Clearly, there is a promising future for research at the interface of development and social evolution in this fascinating group. PMID:21585362

  1. Naringenin is a novel inhibitor of Dictyostelium cell proliferation and cell migration.


    Misty, Russ; Martinez, Raquel; Ali, Hind; Steimle, Paul A


    Naringenin is a flavanone compound that alters critical cellular processes such as cell multiplication, glucose uptake, and mitochondrial activity. In this study, we used the social amoeba, Dictyostelium discoideum, as a model system for examining the cellular processes and signaling pathways affected by naringenin. We found that naringenin inhibited Dictyostelium cell division in a dose-dependent manner (IC(50) approximately 20 microM). Assays of Dictyostelium chemotaxis and multicellular development revealed that naringenin possesses a previously unrecognized ability to suppress amoeboid cell motility. We also found that naringenin, which is known to inhibit phosphatidylinositol 3-kinase activity, had no apparent effect on phosphatidylinositol 3,4,5-trisphosphate synthesis in live Dictyostelium cells; suggesting that this compound suppresses cell growth and migration via alternative signaling pathways. In another context, the discoveries described here highlight the value of using the Dictyostelium model system for identifying and characterizing the mechanisms by which naringenin, and related compounds, exert their effects on eukaryotic cells. PMID:16682000

  2. How social evolution theory impacts our understanding of development in the social amoeba Dictyostelium.


    Strassmann, Joan E; Queller, David C


    Dictyostelium discoideum has been very useful for elucidating principles of development over the last 50 years, but a key attribute means there is a lot to be learned from a very different intellectual tradition: social evolution. Because Dictyostelium arrives at multicellularity by aggregation instead of through a single-cell bottleneck, the multicellular body could be made up of genetically distinct cells. If they are genetically distinct, natural selection will result in conflict over which cells become fertile spores and which become dead stalk cells. Evidence for this conflict includes unequal representation of two genetically different clones in spores of a chimera, the poison-like differentiation inducing factor (DIF) system that appears to involve some cells forcing others to become stalk, and reduced functionality in migrating chimeras. Understanding how selection operates on chimeras of genetically distinct clones is crucial for a comprehensive view of Dictyostelium multicellularity. In nature, Dictyostelium fruiting bodies are often clonal, or nearly so, meaning development will often be very cooperative. Relatedness levels tell us what benefits must be present for sociality to evolve. Therefore it is important to measure relatedness in nature, show that it has an impact on cooperation in the laboratory, and investigate genes that Dictyostelium uses to discriminate between relatives and non-relatives. Clearly, there is a promising future for research at the interface of development and social evolution in this fascinating group.

  3. Bitter tastant responses in the amoeba Dictyostelium correlate with rat and human taste assays.


    Cocorocchio, Marco; Ives, Robert; Clapham, David; Andrews, Paul L R; Williams, Robin S B


    Treatment compliance is reduced when pharmaceutical compounds have a bitter taste and this is particularly marked for paediatric medications. Identification of bitter taste liability during drug discovery utilises the rat in vivo brief access taste aversion (BATA) test which apart from animal use is time consuming with limited throughput. We investigated the suitability of using a simple, non-animal model, the amoeba Dictyostelium discoideum to investigate taste-related responses and particularly identification of compounds with a bitter taste liability. The effect of taste-related compounds on Dictyostelium behaviour following acute exposure (15 minutes) was monitored. Dictyostelium did not respond to salty, sour, umami or sweet tasting compounds, however, cells rapidly responded to bitter tastants. Using time-lapse photography and computer-generated quantification to monitor changes in cell membrane movement, we developed an assay to assess the response of Dictyostelium to a wide range of structurally diverse known bitter compounds and blinded compounds. Dictyostelium showed varying responses to the bitter tastants, with IC50 values providing a rank order of potency. Comparison of Dictyostelium IC50 values to those observed in response to a similar range of compounds in the rat in vivo brief access taste aversion test showed a significant (p = 0.0172) positive correlation between the two models, and additionally a similar response to that provided by a human sensory panel assessment test. These experiments demonstrate that Dictyostelium may provide a suitable model for early prediction of bitterness for novel tastants and drugs. Interestingly, a response to bitter tastants appears conserved from single-celled amoebae to humans. PMID:26708104

  4. Bitter tastant responses in the amoeba Dictyostelium correlate with rat and human taste assays.


    Cocorocchio, Marco; Ives, Robert; Clapham, David; Andrews, Paul L R; Williams, Robin S B


    Treatment compliance is reduced when pharmaceutical compounds have a bitter taste and this is particularly marked for paediatric medications. Identification of bitter taste liability during drug discovery utilises the rat in vivo brief access taste aversion (BATA) test which apart from animal use is time consuming with limited throughput. We investigated the suitability of using a simple, non-animal model, the amoeba Dictyostelium discoideum to investigate taste-related responses and particularly identification of compounds with a bitter taste liability. The effect of taste-related compounds on Dictyostelium behaviour following acute exposure (15 minutes) was monitored. Dictyostelium did not respond to salty, sour, umami or sweet tasting compounds, however, cells rapidly responded to bitter tastants. Using time-lapse photography and computer-generated quantification to monitor changes in cell membrane movement, we developed an assay to assess the response of Dictyostelium to a wide range of structurally diverse known bitter compounds and blinded compounds. Dictyostelium showed varying responses to the bitter tastants, with IC50 values providing a rank order of potency. Comparison of Dictyostelium IC50 values to those observed in response to a similar range of compounds in the rat in vivo brief access taste aversion test showed a significant (p = 0.0172) positive correlation between the two models, and additionally a similar response to that provided by a human sensory panel assessment test. These experiments demonstrate that Dictyostelium may provide a suitable model for early prediction of bitterness for novel tastants and drugs. Interestingly, a response to bitter tastants appears conserved from single-celled amoebae to humans.

  5. Purification and properties of the Dictyostelium calpain-like protein, Cpl.


    Huang, Xinhua; Czerwinski, Eric; Mellgren, Ronald L


    Calpains are intracellular, cysteine proteases found in plants, animals, and fungi. There is emerging evidence that they are important mediators of cell adhesion and motility in animal cells. Because the cellular slime mold, Dictyostelium discoideum, is a genetically tractable model for cell adhesion and motility, we have investigated whether a calpain-like protein is expressed in this organism. Contig 13130 (Sanger Institute Dictyostelium sequencing project) was identified as a three-exon gene that encodes a calpain-like protein. Using a custom peptide antibody to assay for the presence of this putative protein, we identified Dictyostelium calpain-like protein (Cpl) and purified it to near homogeneity. Cpl is a 72278 Da cytosolic protein. Weak caseinolytic activity inhibitable by cysteine protease inhibitors was copurified with Cpl immunoreactivity, and purified Cpl appeared to undergo autoproteolysis upon transfer to inhibitor-free buffer. The major cleavage, generating a 51291 Da form, occurred after Pro 189. The Cpl domain structure resembles mammalian calpain 10, comprising an N-terminal catalytic domain followed by tandem calpain D-III domains. The putative catalytic domain appears to possess His and Gln active site residues, instead of the canonical His and Asn residues in calpains. The active site Cys has not yet been identified, and definitive proof of a proteolytic function awaits further study. Its phylogenetic distribution in D. discoideum and several protists suggests that the calpain D-III domain evolved early in eukaryotic cells.

  6. Cell Sorting in the Mound Stage of Dictyostelium

    NASA Astrophysics Data System (ADS)

    Jiang, Yi; Levine, Herbert; Glazier, James


    In the mound stage of slime mold Dictyostelium discoideum, cells differentiated into two types: pre-stalk and pre-spore. Pre-stalk cells sort and form a tip at the apex of the mound of prespore cells. How this pattern forms is as yet unknown. A cellular level model allows us to simulate both differential cell adhesion and chemotaxis, two principle mechanisms for cell migration. Simulations show that with differential adhesion only, pre-stalk cells move to the surface of the mound but form no tip. With chemotaxis driven by an outgoing circular wave only, a tip forms but contains both pre-stalk and pre-spore cells. Only for a narrow range of relative strengths between differential adhesion and chemotaxis, can both mechanisms work in concert to form a tip which contains only pre-stalk cells. The simulations provide a method to determine the processes necessary for patterning and suggest a series of further experiments.

  7. Burkholderia bacteria infectiously induce the proto-farming symbiosis of Dictyostelium amoebae and food bacteria.


    DiSalvo, Susanne; Haselkorn, Tamara S; Bashir, Usman; Jimenez, Daniela; Brock, Debra A; Queller, David C; Strassmann, Joan E


    Symbiotic associations can allow an organism to acquire novel traits by accessing the genetic repertoire of its partner. In the Dictyostelium discoideum farming symbiosis, certain amoebas (termed "farmers") stably associate with bacterial partners. Farmers can suffer a reproductive cost but also gain beneficial capabilities, such as carriage of bacterial food (proto-farming) and defense against competitors. Farming status previously has been attributed to amoeba genotype, but the role of bacterial partners in its induction has not been examined. Here, we explore the role of bacterial associates in the initiation, maintenance, and phenotypic effects of the farming symbiosis. We demonstrate that two clades of farmer-associated Burkholderia isolates colonize D. discoideum nonfarmers and infectiously endow them with farmer-like characteristics, indicating that Burkholderia symbionts are a major driver of the farming phenomenon. Under food-rich conditions, Burkholderia-colonized amoebas produce fewer spores than uncolonized counterparts, with the severity of this reduction being dependent on the Burkholderia colonizer. However, the induction of food carriage by Burkholderia colonization may be considered a conditionally adaptive trait because it can confer an advantage to the amoeba host when grown in food-limiting conditions. We observed Burkholderia inside and outside colonized D. discoideum spores after fruiting body formation; this observation, together with the ability of Burkholderia to colonize new amoebas, suggests a mixed mode of symbiont transmission. These results change our understanding of the D. discoideum farming symbiosis by establishing that the bacterial partner, Burkholderia, is an important causative agent of the farming phenomenon.

  8. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš


    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  9. A role for adaptor protein-3 complex in the organization of the endocytic pathway in Dictyostelium.


    Charette, Steve J; Mercanti, Valentina; Letourneur, François; Bennett, Nelly; Cosson, Pierre


    Dictyostelium discoideum cells continuously internalize extracellular material, which accumulates in well-characterized endocytic vacuoles. In this study, we describe a new endocytic compartment identified by the presence of a specific marker, the p25 protein. This compartment presents features reminiscent of mammalian recycling endosomes: it is localized in the pericentrosomal region but distinct from the Golgi apparatus. It specifically contains surface proteins that are continuously endocytosed but rapidly recycled to the cell surface and thus absent from maturing endocytic compartments. We evaluated the importance of each clathrin-associated adaptor complex in establishing a compartmentalized endocytic system by studying the phenotype of the corresponding mutants. In knockout cells for mu3, a subunit of the AP-3 clathrin-associated complex, membrane proteins normally restricted to p25-positive endosomes were mislocalized to late endocytic compartments. Our results suggest that AP-3 plays an essential role in the compartmentalization of the endocytic pathway in Dictyostelium. PMID:17010123

  10. Pattern formation in Dictyostelium via the dynamics of cooperative biological entities

    NASA Astrophysics Data System (ADS)

    Kessler, David A.; Levine, Herbert


    The cellular slime mold Dictyostelium discoideum exhibits a variety of spatial patterns as it aggregates to form a multicellular slug. These patterns arise via the interaction of the aggregating amoebae, either via contact or as mediated by chemical signals involving cyclic adenosine monophosphate (AMP). We model this system as a set of reaction-diffusion equations coupled to dynamical biological entities (bions), each of which is endowed with signal receptors and response rules. Simulations of our model reveal a close correspondence with the observed structures. Also, the general framework we propose should be suitable for modeling other biological pattern-forming processes.

  11. Spontaneous Symmetry Breaking Turing-Type Pattern Formation in a Confined Dictyostelium Cell Mass

    NASA Astrophysics Data System (ADS)

    Sawai, Satoshi; Maeda, Yasuo; Sawada, Yasuji


    We have discovered a new type of patterning which occurs in a two-dimensionally confined cell mass of the cellular slime mold Dictyostelium discoideum. Besides the longitudinal structure reported earlier, we observed a spontaneous symmetry breaking spot pattern whose wavelength shows similar strain dependency to that of the longitudinal pattern. We propose that these structures are due to a reaction-diffusion Turing instability similar to the one which has been exemplified by CIMA (chlorite-iodide-malonic acid) reaction. The present finding may exhibit the first biochemical Turing structure in a developmental system with a controllable boundary condition.

  12. Screening of genes involved in cell migration in Dictyostelium.


    Nagasaki, Akira; Uyeda, Taro Q P


    A single cell of wild-type Dictyostelium discoideum forms a visible colony on a plastic dish in several days, but due to enhanced cell migration, amiB-null mutant cells scatter over a large area and do not form noticeable colonies. Here, with an aim to identify genes involved in cell migration, we isolated suppresser mutants of amiB-null mutants that restore the ability to form colonies. From REMI (restriction enzyme-mediated integration)-mutagenized pool of double-mutants, we identified 18 responsible genes from them. These genes can be categorized into several biological processes. One cell line, Sab16 (Suppressor of amiB) was chosen for further analysis, which had a disrupted phospholipase D pldB gene. To confirm the role of pldB gene in cell migration, we knocked out the pldB gene and over-expressed gfp-pldB in wild-type cells. GFP-PLDB localized to plasma membrane and on vesicles, and in migrating cells, at the protruding regions of pseudopodia. Migration speed of vegetative pldB-null cells was reduced to 73% of that of the wild-type. These results suggest that PLDB plays an important role in migration in Dictyostelium cells, and that our screening system is useful for the identification of genes involved in cell migration. PMID:18164290

  13. Dissecting Spatial and Temporal Sensing in Dictyostelium Chemotaxis Using a Wave Gradient Generator.


    Nakajima, Akihiko; Sawai, Satoshi


    External cues that dictate the direction of cell migration are likely dynamic during many biological processes such as embryonic development and wound healing. Until recently, how cells integrate spatial and temporal information to determine the direction of migration has remained elusive. In Dictyostelium discoideum, the chemoattractant cAMP that directs cell aggregation propagates as periodic waves. In light of the fact that any temporally evolving complex signals, in principle, can be expressed as a sum of sinusoidal functions with various frequencies, the Dictyostelium system serves as a minimal example, where the dynamic signal is in the simplest form of near sinusoidal wave with one dominant frequency. Here, we describe a method to emulate the traveling waves in a fluidics device. The text provides step-by-step instructions on the device setup and describes ways to analyze the acquired data. These include quantification of membrane translocation of fluorescently labeled proteins in individual Dictyostelium cells and estimation of exogenous cAMP profiles. The described approach has already helped decipher spatial and temporal aspects of chemotactic sensing in Dictyostelium. More specifically, it allowed one to discriminate the temporal and the spatial sensing aspects of directional sensing. With some modifications, one should be able to implement similar analysis in other cell types. PMID:27271897

  14. Nucleomorphin. A novel, acidic, nuclear calmodulin-binding protein from dictyostelium that regulates nuclear number.


    Myre, Michael A; O'Day, Danton H


    Probing of Dictyostelium discoideum cell extracts after SDS-PAGE using (35)S-recombinant calmodulin (CaM) as a probe has revealed approximately three-dozen Ca(2+)-dependent calmodulin binding proteins. Here, we report the molecular cloning, expression, and subcellular localization of a gene encoding a novel calmodulin-binding protein (CaMBP); we have called nucleomorphin, from D. discoideum. A lambdaZAP cDNA expression library of cells from multicellular development was screened using a recombinant calmodulin probe ((35)S-VU1-CaM). The open reading frame of 1119 nucleotides encodes a polypeptide of 340 amino acids with a calculated molecular mass of 38.7 kDa and is constitutively expressed throughout the Dictyostelium life cycle. Nucleomorphin contains a highly acidic glutamic/aspartic acid inverted repeat (DEED) with significant similarity to the conserved nucleoplasmin domain and a putative transmembrane domain in the carboxyl-terminal region. Southern blotting reveals that nucleomorphin exists as a single copy gene. Using gel overlay assays and CaM-agarose we show that bacterially expressed nucleomorphin binds to bovine CaM in a Ca(2+)-dependent manner. Amino-terminal fusion to the green fluorescence protein (GFP) showed that GFP-NumA localized to the nucleus as distinct arc-like patterns similar to heterochromatin regions. GFP-NumA lacking the acidic DEED repeat still showed arc-like accumulations at the nuclear periphery, but the number of nuclei in these cells was increased markedly compared with control cells. Cells expressing GFP-NumA lacking the transmembrane domain localized to the nuclear periphery but did not affect nuclear number or gross morphology. Nucleomorphin is the first nuclear CaMBP to be identified in Dictyostelium. Furthermore, these data present the first identification of a member of the nucleoplasmin family as a calmodulin-binding protein and suggest nucleomorphin has a role in nuclear structure in Dictyostelium. PMID:11919178

  15. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    NASA Astrophysics Data System (ADS)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard


    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  16. Subunits I and II of Dictyostelium cytochrome c oxidase are specified by a single open reading frame transcribed into a large polycistronic RNA.


    Pellizzari, R; Anjard, C; Bisson, R


    A single open reading frame (ORF) encoding cytochrome c oxidase subunit I and II (cox1/2) was identified in the mitochondrial genome of the slime mold Dictyostelium discoideum. The cox1 coding region shares intron positions with its counterparts in fungi and algae. Northern blot analysis, using exon and intron-specific probes, suggests that the cox1/2 gene is transcribed as part of a large, efficiently processed, polycistronic RNA. PMID:9186775

  17. Searching strategies in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Li, Liang; Cox, Edward


    Levy walks are known to be the best strategy for optimizing non-destructive search times, while an intermittent two-state searching process optimizes the destructive case. Here we ask about hunting strategy in Dictyostelium amoebae when they cannot know where their food is. We show that correlated random walks with two typical correlation time scales bias their search, improving the search outcome. Further analysis indicates that cell trajectories consist of runs and turns. Strikingly, amoebae remember the last turn, and have a strong turning preference away from the last turn. Autocorrelation analysis of turn sequences indicates that this tendency does not persist beyond the nth+1 turn. Computer simulations reveal that this bias contributes to the longer of the two correlation times. The search rules are essentially the same when cells are continuously stimulated by cAMP, with different persistence times and lengths. Interestingly, new pseudopods form in an orientation opposite to the following turn. One of the correlation timescales is approximately 30 seconds in all cases, thus indicating a short-lived cellular process, while the other is 9 to 15 minutes suggesting a process sensitive to external signals, perhaps pseudopod extensions during turning.

  18. Dissecting the function of Atg1 complex in Dictyostelium autophagy reveals a connection with the pentose phosphate pathway enzyme transketolase.


    Mesquita, Ana; Tábara, Luis C; Martinez-Costa, Oscar; Santos-Rodrigo, Natalia; Vincent, Olivier; Escalante, Ricardo


    The network of protein-protein interactions of the Dictyostelium discoideum autophagy pathway was investigated by yeast two-hybrid screening of the conserved autophagic proteins Atg1 and Atg8. These analyses confirmed expected interactions described in other organisms and also identified novel interactors that highlight the complexity of autophagy regulation. The Atg1 kinase complex, an essential regulator of autophagy, was investigated in detail here. The composition of the Atg1 complex in D. discoideum is more similar to mammalian cells than to Saccharomyces cerevisiae as, besides Atg13, it contains Atg101, a protein not conserved in this yeast. We found that Atg101 interacts with Atg13 and genetic disruption of these proteins in Dictyostelium leads to an early block in autophagy, although the severity of the developmental phenotype and the degree of autophagic block is higher in Atg13-deficient cells. We have also identified a protein containing zinc-finger B-box and FNIP motifs that interacts with Atg101. Disruption of this protein increases autophagic flux, suggesting that it functions as a negative regulator of Atg101. We also describe the interaction of Atg1 kinase with the pentose phosphate pathway enzyme transketolase (TKT). We found changes in the activity of endogenous TKT activity in strains lacking or overexpressing Atg1, suggesting the presence of an unsuspected regulatory pathway between autophagy and the pentose phosphate pathway in Dictyostelium that seems to be conserved in mammalian cells.

  19. Dissecting the function of Atg1 complex in Dictyostelium autophagy reveals a connection with the pentose phosphate pathway enzyme transketolase

    PubMed Central

    Mesquita, Ana; Tábara, Luis C.; Martinez-Costa, Oscar; Santos-Rodrigo, Natalia; Vincent, Olivier; Escalante, Ricardo


    The network of protein–protein interactions of the Dictyostelium discoideum autophagy pathway was investigated by yeast two-hybrid screening of the conserved autophagic proteins Atg1 and Atg8. These analyses confirmed expected interactions described in other organisms and also identified novel interactors that highlight the complexity of autophagy regulation. The Atg1 kinase complex, an essential regulator of autophagy, was investigated in detail here. The composition of the Atg1 complex in D. discoideum is more similar to mammalian cells than to Saccharomyces cerevisiae as, besides Atg13, it contains Atg101, a protein not conserved in this yeast. We found that Atg101 interacts with Atg13 and genetic disruption of these proteins in Dictyostelium leads to an early block in autophagy, although the severity of the developmental phenotype and the degree of autophagic block is higher in Atg13-deficient cells. We have also identified a protein containing zinc-finger B-box and FNIP motifs that interacts with Atg101. Disruption of this protein increases autophagic flux, suggesting that it functions as a negative regulator of Atg101. We also describe the interaction of Atg1 kinase with the pentose phosphate pathway enzyme transketolase (TKT). We found changes in the activity of endogenous TKT activity in strains lacking or overexpressing Atg1, suggesting the presence of an unsuspected regulatory pathway between autophagy and the pentose phosphate pathway in Dictyostelium that seems to be conserved in mammalian cells. PMID:26246495

  20. Morphological changes and depressed phagocytic efficiency in Dictyostelium amoebae treated with toxic concentrations of cadmium

    SciTech Connect

    Cyr, R.J.; Bernstein, R.L.


    The morphology and phagocytic efficiency of Dictyostelium discoideum amoebae exposed to cadmium was investigated at two Cd concentrations: a low toxic concentration - 7 x 10/sup -5/ m, and a high toxic concentration - 2 x 10/sup -4/ m. Both concentrations inhibited growth completely; however, only in the culture containing a high toxic concentration of cadmium were severe ultrastructural anomalies observed, notably, nucleolar changes and autophagic vacuolar formation. Using biological indices it was concluded that the high concentration of cadmium was lethal and that morphological changes associated with this dose of cadmium may be secondary to cell death. In contrast, amoebae treated with a low toxic but nonlethal concentration of Cd showed an altered size distribution of cytoplasmic vacuoles and a decreased phagocytic efficiency. Cultures whose growth was completely inhibited with cobalt were also examined, as were untreated control cultures. By 24 hr Cd-treated amoebae showed a 20% decrease in the cytoplasmic mean-vacuolar diameter and a 69% decrease in phagocytic efficiency whereas Co and untreated controls showed no significant decrease in the cytoplasmic mean-vacuolar diameter. Phagocytic efficiency was only slightly diminished by Co. Changes in vacuolar profiles had been shown earlier to be related to membrane utilization in Dictyostelium amoebae. Cd at low toxic concentrations affects membrane function in Dictyostelium amoebae.

  1. Transmembrane myosin chitin synthase involved in mollusc shell formation produced in Dictyostelium is active

    SciTech Connect

    Schoenitzer, Veronika; Eichner, Norbert; Clausen-Schaumann, Hauke; Weiss, Ingrid M.


    Highlights: Black-Right-Pointing-Pointer Dictyostelium produces the 264 kDa myosin chitin synthase of bivalve mollusc Atrina. Black-Right-Pointing-Pointer Chitin synthase activity releases chitin, partly associated with the cell surface. Black-Right-Pointing-Pointer Membrane extracts of transgenic slime molds produce radiolabeled chitin in vitro. Black-Right-Pointing-Pointer Chitin producing Dictyostelium cells can be characterized by atomic force microscopy. Black-Right-Pointing-Pointer This model system enables us to study initial processes of chitin biomineralization. -- Abstract: Several mollusc shells contain chitin, which is formed by a transmembrane myosin motor enzyme. This protein could be involved in sensing mechanical and structural changes of the forming, mineralizing extracellular matrix. Here we report the heterologous expression of the transmembrane myosin chitin synthase Ar-CS1 of the bivalve mollusc Atrina rigida (2286 amino acid residues, M.W. 264 kDa/monomer) in Dictyostelium discoideum, a model organism for myosin motor proteins. Confocal laser scanning immunofluorescence microscopy (CLSM), chitin binding GFP detection of chitin on cells and released to the cell culture medium, and a radiochemical activity assay of membrane extracts revealed expression and enzymatic activity of the mollusc chitin synthase in transgenic slime mold cells. First high-resolution atomic force microscopy (AFM) images of Ar-CS1 transformed cellulose synthase deficient D. discoideumdcsA{sup -} cell lines are shown.

  2. Polymorphic members of the lag gene family mediate kin discrimination in Dictyostelium.


    Benabentos, Rocio; Hirose, Shigenori; Sucgang, Richard; Curk, Tomaz; Katoh, Mariko; Ostrowski, Elizabeth A; Strassmann, Joan E; Queller, David C; Zupan, Blaz; Shaulsky, Gad; Kuspa, Adam


    Self and kin discrimination are observed in most kingdoms of life and are mediated by highly polymorphic plasma membrane proteins. Sequence polymorphism, which is essential for effective recognition, is maintained by balancing selection. Dictyostelium discoideum are social amoebas that propagate as unicellular organisms but aggregate upon starvation and form fruiting bodies with viable spores and dead stalk cells. Aggregative development exposes Dictyostelium to the perils of chimerism, including cheating, which raises questions about how the victims survive in nature and how social cooperation persists. Dictyostelids can minimize the cost of chimerism by preferential cooperation with kin, but the mechanisms of kin discrimination are largely unknown. Dictyostelium lag genes encode transmembrane proteins with multiple immunoglobulin (Ig) repeats that participate in cell adhesion and signaling. Here, we describe their role in kin discrimination. We show that lagB1 and lagC1 are highly polymorphic in natural populations and that their sequence dissimilarity correlates well with wild-strain segregation. Deleting lagB1 and lagC1 results in strain segregation in chimeras with wild-type cells, whereas elimination of the nearly invariant homolog lagD1 has no such consequences. These findings reveal an early evolutionary origin of kin discrimination and provide insight into the mechanism of social recognition and immunity.

  3. Quantification of social behavior in D. discoideum reveals complex fixed and facultative strategies.


    Buttery, Neil J; Rozen, Daniel E; Wolf, Jason B; Thompson, Christopher R L


    Understanding the maintenance of cooperation requires an understanding of the nature of cheaters and the strategies used to mitigate their effects. However, it is often difficult to determine how cheating or differential social success has arisen. For example, cheaters may employ different strategies (e.g., fixed and facultative), whereas other causes of unequal fitness in social situations can result in winners and losers without cheating. To address these problems, we quantified the social success of naturally occurring genotypes of Dictyostelium discoideum during the formation of chimeric fruiting bodies, consisting of dead stalk cells and viable spores. We demonstrate that an apparent competitive dominance hierarchy of spore formation in chimera is partly due to a fixed strategy where genotypes exhibit dramatically different spore allocations. However, we also find complex, variable facultative strategies, where genotypes change their allocation in chimera. By determining the magnitude and direction of these changes, we partition facultative cheating into two forms: (1) promotion of individual fitness through selfish behaviour ("self-promotion") and (2) coercion of other genotypes to act cooperatively. Our results demonstrate and define social interactions between D. discoideum isolates, thus providing a conceptual framework for the study of the genetic mechanisms that underpin social evolution.

  4. Burkholderia bacteria infectiously induce the proto-farming symbiosis of Dictyostelium amoebae and food bacteria

    PubMed Central

    DiSalvo, Susanne; Haselkorn, Tamara S.; Bashir, Usman; Jimenez, Daniela; Brock, Debra A.; Queller, David C.; Strassmann, Joan E.


    Symbiotic associations can allow an organism to acquire novel traits by accessing the genetic repertoire of its partner. In the Dictyostelium discoideum farming symbiosis, certain amoebas (termed “farmers”) stably associate with bacterial partners. Farmers can suffer a reproductive cost but also gain beneficial capabilities, such as carriage of bacterial food (proto-farming) and defense against competitors. Farming status previously has been attributed to amoeba genotype, but the role of bacterial partners in its induction has not been examined. Here, we explore the role of bacterial associates in the initiation, maintenance, and phenotypic effects of the farming symbiosis. We demonstrate that two clades of farmer-associated Burkholderia isolates colonize D. discoideum nonfarmers and infectiously endow them with farmer-like characteristics, indicating that Burkholderia symbionts are a major driver of the farming phenomenon. Under food-rich conditions, Burkholderia-colonized amoebas produce fewer spores than uncolonized counterparts, with the severity of this reduction being dependent on the Burkholderia colonizer. However, the induction of food carriage by Burkholderia colonization may be considered a conditionally adaptive trait because it can confer an advantage to the amoeba host when grown in food-limiting conditions. We observed Burkholderia inside and outside colonized D. discoideum spores after fruiting body formation; this observation, together with the ability of Burkholderia to colonize new amoebas, suggests a mixed mode of symbiont transmission. These results change our understanding of the D. discoideum farming symbiosis by establishing that the bacterial partner, Burkholderia, is an important causative agent of the farming phenomenon. PMID:26305954

  5. Comparative study of the sensitivity of spores and amoebae of Dictyostelium discoideum to ultraviolet light

    SciTech Connect

    Hashimoto, Y.; Wada, M.


    We report the sensitivity change of plaque formation to ultraviolet light (uv) irradiation in several stages of the cellular slime mold from spore to stationary phase, under the special condition which we have obtained - a plating efficiency of 100%. For NC-4 (haploid) and H-1 (diploid), uv sensitivity of cells just after germination was almost equal to that of spores; then the sensitivity decreased with development, reached a minimum just before the first cell division, and remained at that level during logarithmic growth. As to the difference between NC-4 and H-1, NC-4 was more resistant than H-1 at low doses, and H-1 was more resistant than NC-4 at high doses for both spores and amoebae. We also report a pipetting effect which assured reproducible data for amoebae.

  6. EDTA treatment alters protein glycosylation in the cellular slime mold Dictyostelium discoideum

    SciTech Connect

    West, C.M.; Brownstein, S.A. )


    The authors have found that treatment of cells with EDTA resulted in the accumulation of lower molecular weight forms of two cell-type-specific glycoproteins. These new glycoproteins lacked a developmentally regulated glycoantigen defined by monoclonal antibody 54.2. Since EDTA dissociated the cells, the possible involvement of cell separation was tested by immobilizing cells in soft agarose. Glycoantigen expression on these proteins was found to be dependent on cAMP and high oxygen tension but not on cell contact, and was reversibly sensitive to EDTA regardless of the state of cell association. The EDTA effect was mimicked by other soluble, but not particulate, membrane impermeable chelators, could be completed by Zn{sup 2+} better than Mg{sup 2+}, and appeared to involve an intracellular mechanism. Studies with ({sup 14}C)EDTA showed that EDTA equilibrated with a cellular compartment in a temperature-dependent, Zn{sup 2+}-insensitive fashion with half-time kinetics of loading and unloading of 30-40 min. The data suggest that this step in glycosylation, which was found to be delayed 1 or more hours subsequent to protein synthesis, involves an intracellular, transition metal-ion-dependent process which can be modulated by chelators entering the cell through the endocytic pathway.

  7. Diverse Growth Kinetics in Suspension Culture of a Model Eukaryote Dictyostelium discoideum, Confirmation of Lagless Growth

    NASA Astrophysics Data System (ADS)

    Franck, Carl; Zhou, Xaio-Qiao S.; Deshmukh, Amrish; Bogart, Elijah; Lau, Sharon; Daie, Kayvon; Bae, Albert


    In recent work we explored the notion that the transition between slow and fast growth, the lag-log transition, with increasing density seen in shaken cell culture represents a collective effect. (Phys. Rev. E 77, 041905 (2008)). We reported preliminary observations in which the lag phase was apparently missing. Here, we present significantly more measurements than in our original work as well as increased sensitivity at low densities. We confirm that instances of nearly exponential (``log'') growth do in fact appear, but more frequently, we find evidence of lagging. The degree of lagging fluctuates significantly from run to run, in contrast to our earlier observations and theory, but in all cases exponential growth is established with increasing density once the range of 10^4 to 10^5 cells/ml is reached. We present evidence against two natural explanations for these fluctuations: 1) a mixture of strains which have different growth phenotypes or 2) a single strain variation due to an epigenetic switch which can be set to the low growth state by subjecting cells to high density environments. The appearance of such growth variations has considerable practical significance and suggests that there is an additional dynamical variable besides density in play.

  8. The dynamics of Dictyostelium development

    NASA Astrophysics Data System (ADS)

    Levine, Herbert

    The process whereby Dictyostelium amoebae change from a unicellular to multicellular mode of living offers substantial challenges for attempts at understanding how nonequilibrium physics enters into developmental biology. In this mini review, I describe recent attempts to use analytical and computational approaches to get at the fundamental mechanisms behind several stages of the aforementioned developmental process. These stages include the formation of a signaling wavefield often dominated by rotating spirals, the breakup of the cell density into aggregation streams, and the morphogenesis of the aggregate into a mound which then spontaneously forms a tip.

  9. An epithelial tissue in Dictyostelium challenges the traditional origin of metazoan multicellularity.


    Dickinson, Daniel J; Nelson, W James; Weis, William I


    We hypothesize that aspects of animal multicellularity originated before the divergence of metazoans from fungi and social amoebae. Polarized epithelial tissues are a defining feature of metazoans and contribute to the diversity of animal body plans. The recent finding of a polarized epithelium in the non-metazoan social amoeba Dictyostelium discoideum demonstrates that epithelial tissue is not a unique feature of metazoans, and challenges the traditional paradigm that multicellularity evolved independently in social amoebae and metazoans. An alternative view, presented here, is that the common ancestor of social amoebae, fungi, and animals spent a portion of its life cycle in a multicellular state and possessed molecular machinery necessary for forming an epithelial tissue. Some descendants of this ancestor retained multicellularity, while others reverted to unicellularity. This hypothesis makes testable predictions regarding tissue organization in close relatives of metazoans and provides a novel conceptual framework for studies of early animal evolution. PMID:22930590

  10. Linear patterning of magnetically labeled Dictyostelium cells to display confined development

    NASA Astrophysics Data System (ADS)

    Frasca, Guillaume; Raynaud, Franck; Bacri, Jean-Claude; Gazeau, Florence; Wilhelm, Claire


    In severe nutriment conditions, the social amoeba Dictyostelium discoideum enters a particular life cycle where it forms multicellular patterns to achieve aggregation. Extensively observed from an initial dispersed state, its developmental program can usefully be studied from a confined population to implement theoretical developments regarding biological self-organization. The challenge is then to form a cell assembly of well-defined geometrical dimensions without hindering cell behavior. To achieve this goal, we imposed transient constraints by applying temporary external magnetic gradients to trap magnetically labeled cells. Deposits of various numbers of cells were geometrically characterized for different magnetic exposure conditions. We demonstrated that the cell deposit was organized as a three-dimensional (3D) structure by both stacking layers of cells and extending these layers in the substrate plane. This structure evolves during the aggregation phase, forming periodic aggregative centers along the linear initial pattern.

  11. High relatedness is necessary and sufficient to maintain multicellularity in Dictyostelium.


    Kuzdzal-Fick, Jennie J; Fox, Sara A; Strassmann, Joan E; Queller, David C


    Most complex multicellular organisms develop clonally from a single cell. This should limit conflicts between cell lineages that could threaten the extensive cooperation of cells within multicellular bodies. Cellular composition can be manipulated in the social amoeba Dictyostelium discoideum, which allows us to test and confirm the two key predictions of this theory. Experimental evolution at low relatedness favored cheating mutants that could destroy multicellular development. However, under high relatedness, the forces of mutation and within-individual selection are too small for these destructive cheaters to spread, as shown by a mutation accumulation experiment. Thus, we conclude that the single-cell bottleneck is a powerful stabilizer of cellular cooperation in multicellular organisms. PMID:22174251

  12. Transmembrane myosin chitin synthase involved in mollusc shell formation produced in Dictyostelium is active.


    Schönitzer, Veronika; Eichner, Norbert; Clausen-Schaumann, Hauke; Weiss, Ingrid M


    Several mollusc shells contain chitin, which is formed by a transmembrane myosin motor enzyme. This protein could be involved in sensing mechanical and structural changes of the forming, mineralizing extracellular matrix. Here we report the heterologous expression of the transmembrane myosin chitin synthase Ar-CS1 of the bivalve mollusc Atrina rigida (2286 amino acid residues, M.W. 264 kDa/monomer) in Dictyostelium discoideum, a model organism for myosin motor proteins. Confocal laser scanning immunofluorescence microscopy (CLSM), chitin binding GFP detection of chitin on cells and released to the cell culture medium, and a radiochemical activity assay of membrane extracts revealed expression and enzymatic activity of the mollusc chitin synthase in transgenic slime mold cells. First high-resolution atomic force microscopy (AFM) images of Ar-CS1 transformed cellulose synthase deficient D. discoideumdcsA(-) cell lines are shown.

  13. Expression of an Arabidopsis plasma membrane aquaporin in Dictyostelium results in hypoosmotic sensitivity and developmental abnormalities.


    Chaumont, F; Loomis, W F; Chrispeels, M J


    The rd28 gene of Arabidopsis thaliana encodes a water channel protein, or aquaporin, of the plasma membrane. A construct in which transcription of the rd28 cDNA is controlled by the Dictyostelium actin15 promoter was transformed into Dictyostelium discoideum cells. Transformants contained RD28 protein in their plasma membranes. When shifted to a low-osmotic-strength buffer, cells expressing rd28 swelled rapidly and burst, indicating that the plant aquaporin allowed rapid water entry in the amoebae. The rate of osmotic lysis was a function of the osmotic pressure of the buffer. We also selected transformants in which the expression of the rd28 cDNA is driven by the promoter of the prespore cotB gene. These transformants accumulated rd28 mRNA uniquely in prespore cells. In low-osmotic-strength buffer, the cotB::rd28 cells aggregated and formed normally proportioned slugs but failed to form normal fruiting bodies. The number of spores was reduced 20-fold, and the stalks of the fruiting bodies were abnormally short. The consequences of expressing RD28 in prespore cells could be partially overcome by increasing the osmolarity of the medium. Under these conditions, the cotB::rd28 cells formed fruiting bodies of more normal appearance, and the number of viable spores increased slightly. Because prespore cells have to shrink and dehydrate to form spores, it was not unexpected that expression of an aquaporin would disrupt this process, but it was surprising to find that stalk differentiation was also affected by expression of rd28 in prespore cells. It appears that osmotic stress on prespore cells alters their ability to signal terminal differentiation in prestalk cells. The results provide independent confirmation that plant aquaporins can function in the cells of other organisms, and that D. discoideum can be used to study the properties of these water channels.

  14. Directional sensing and streaming in Dictyostelium aggregation.


    Almeida, Sofia; Dilão, Rui


    We merge the Kessler-Levine simple discrete model for Dictyostelium cyclic adenosine monophosphate (cAMP) production and diffusion with the Dilão-Hauser directional sensing aggregation mechanism. The resulting compound model describes all the known transient patterns that emerge during Dictyostelium aggregation, which include the spontaneous formation of cAMP self-sustained target and spiral waves and streaming. We show that the streaming patterns depend on the speed of the amoebae, on the relaxation time for the production of cAMP, on the cAMP degradation rate, and on directional sensing. Moreover, we show that different signaling centers emerge during Dictyostelium aggregation. PMID:27300919

  15. Directional sensing and streaming in Dictyostelium aggregation

    NASA Astrophysics Data System (ADS)

    Almeida, Sofia; Dilão, Rui


    We merge the Kessler-Levine simple discrete model for Dictyostelium cyclic adenosine monophosphate (cAMP) production and diffusion with the Dilão-Hauser directional sensing aggregation mechanism. The resulting compound model describes all the known transient patterns that emerge during Dictyostelium aggregation, which include the spontaneous formation of cAMP self-sustained target and spiral waves and streaming. We show that the streaming patterns depend on the speed of the amoebae, on the relaxation time for the production of cAMP, on the cAMP degradation rate, and on directional sensing. Moreover, we show that different signaling centers emerge during Dictyostelium aggregation.

  16. Directional sensing and streaming in Dictyostelium aggregation.


    Almeida, Sofia; Dilão, Rui


    We merge the Kessler-Levine simple discrete model for Dictyostelium cyclic adenosine monophosphate (cAMP) production and diffusion with the Dilão-Hauser directional sensing aggregation mechanism. The resulting compound model describes all the known transient patterns that emerge during Dictyostelium aggregation, which include the spontaneous formation of cAMP self-sustained target and spiral waves and streaming. We show that the streaming patterns depend on the speed of the amoebae, on the relaxation time for the production of cAMP, on the cAMP degradation rate, and on directional sensing. Moreover, we show that different signaling centers emerge during Dictyostelium aggregation.

  17. Argonaute Proteins Affect siRNA Levels and Accumulation of a Novel Extrachromosomal DNA from the Dictyostelium Retrotransposon DIRS-1*

    PubMed Central

    Boesler, Benjamin; Meier, Doreen; Förstner, Konrad U.; Friedrich, Michael; Hammann, Christian; Sharma, Cynthia M.; Nellen, Wolfgang


    The retrotransposon DIRS-1 is the most abundant retroelement in Dictyostelium discoideum and constitutes the pericentromeric heterochromatin of the six chromosomes in D. discoideum. The vast majority of cellular siRNAs is derived from DIRS-1, suggesting that the element is controlled by RNAi-related mechanisms. We investigated the role of two of the five Argonaute proteins of D. discoideum, AgnA and AgnB, in DIRS-1 silencing. Deletion of agnA resulted in the accumulation of DIRS-1 transcripts, the expression of DIRS-1-encoded proteins, and the loss of most DIRS-1-derived secondary siRNAs. Simultaneously, extrachromosomal single-stranded DIRS-1 DNA accumulated in the cytoplasm of agnA− strains. These DNA molecules appear to be products of reverse transcription and thus could represent intermediate structures before transposition. We further show that transitivity of endogenous siRNAs is impaired in agnA− strains. The deletion of agnB alone had no strong effect on DIRS-1 transposon regulation. However, in agnA−/agnB− double mutant strains strongly reduced accumulation of extrachromosomal DNA compared with the single agnA− strains was observed. PMID:25352599

  18. Dictyostelium calcium-binding protein 4a interacts with nucleomorphin, a BRCT-domain protein that regulates nuclear number.


    Myre, Michael A; O'Day, Danton H


    Nucleomorphin from Dictyostelium discoideum is a nuclear calmodulin-binding protein that is a member of the BRCT-domain containing cell cycle checkpoint proteins. Two differentially expressed isoforms, NumA and NumB, share an extensive acidic domain (DEED) that when deleted produces highly multinucleated cells. We performed a yeast two-hybrid screen of a Dictyostelium cDNA library using NumA as bait. Here we show that nucleomorphin interacts with calcium-binding protein 4a (CBP4a) in a Ca(2+)-dependent manner. Further deletion analysis suggests this interaction requires residues found within the DEED domain. NumA and CBP4a mRNAs are expressed at the same stages of development. CBP4a belongs to a large family of Dictyostelium CBPs, for which no cellular or developmental functions had previously been determined. Since the interaction of CBP4a with nucleomorphin requires the DEED domain, this suggests that CBP4a may respond to Ca(2+)-signalling through modulating factors that might function in concert to regulate nuclear number. PMID:15325281

  19. A potentially exhaustive screening strategy reveals two novel divergent myosins in Dictyostelium.


    Schwarz, E C; Geissler, H; Soldati, T


    In recent years, the myosin superfamily has kept expanding at an explosive rate, but the understanding of their complex functions has been lagging. Therefore, Dictyostelium discoideum, a genetically and biochemically tractable eukaryotic amoeba, appears as a powerful model organism to investigate the involvement of the actomyosin cytoskeleton in a variety of cellular tasks. Because of the relatively high degree of functional redundancy, such studies would be greatly facilitated by the prior knowledge of the whole myosin repertoire in this organism. Here, we present a strategy based on PCR amplification using degenerate primers and followed by negative hybridization screening which led to the potentially exhaustive identification of members of the myosin family in D. discoideum. Two novel myosins were identified and their genetic loci mapped by hybridization to an ordered YAC library. Preliminary inspection of myoK and myoM sequences revealed that, despite carrying most of the hallmarks of myosin motors, both molecules harbor features surprisingly divergent from most known myosins. PMID:10403059

  20. The GATA transcription factor GtaC regulates early developmental gene expression dynamics in Dictyostelium

    PubMed Central

    Santhanam, Balaji; Cai, Huaqing; Devreotes, Peter N.; Shaulsky, Gad; Katoh-Kurasawa, Mariko


    In many systems, including the social amoeba Dictyostelium discoideum, development is often marked by dynamic morphological and transcriptional changes orchestrated by key transcription factors. However, efforts to examine sequential genome-wide changes of gene regulation in developmental processes have been fairly limited. Here we report the developmental regulatory dynamics of GtaC, a GATA-type zinc-finger transcription factor, through the analyses of serial ChIP- and RNA-sequencing data. GtaC is essential for developmental progression, decoding extracellular cAMP pulses during early development and may play a role in mediating cell-type differentiation at later stages. We find that GtaC exhibits temporally distinctive DNA-binding patterns concordant with each developmental stage. We identify direct GtaC targets and observe cotemporaneous GtaC-binding and developmental expression regulation. Our results suggest that GtaC regulates multiple physiological processes as Dictyostelium transitions from a group of unicellular amoebae to an integrated multicellular organism. PMID:26144553

  1. Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.


    Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad


    Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. PMID:27307293

  2. AP180-mediated trafficking of Vamp7B limits homotypic fusion of Dictyostelium contractile vacuoles.


    Wen, Yujia; Stavrou, Irene; Bersuker, Kirill; Brady, Rebecca J; De Lozanne, Arturo; O'Halloran, Theresa J


    Clathrin-coated vesicles play an established role in endocytosis from the plasma membrane, but they are also found on internal organelles. We examined the composition of clathrin-coated vesicles on an internal organelle responsible for osmoregulation, the Dictyostelium discoideum contractile vacuole. Clathrin puncta on contractile vacuoles contained multiple accessory proteins typical of plasma membrane-coated pits, including AP2, AP180, and epsin, but not Hip1r. To examine how these clathrin accessory proteins influenced the contractile vacuole, we generated cell lines that carried single and double gene knockouts in the same genetic background. Single or double mutants that lacked AP180 or AP2 exhibited abnormally large contractile vacuoles. The enlarged contractile vacuoles in AP180-null mutants formed because of excessive homotypic fusion among contractile vacuoles. The SNARE protein Vamp7B was mislocalized and enriched on the contractile vacuoles of AP180-null mutants. In vitro assays revealed that AP180 interacted with the cytoplasmic domain of Vamp7B. We propose that AP180 directs Vamp7B into clathrin-coated vesicles on contractile vacuoles, creating an efficient mechanism for regulating the internal distribution of fusion-competent SNARE proteins and limiting homotypic fusions among contractile vacuoles. Dictyostelium contractile vacuoles offer a valuable system to study clathrin-coated vesicles on internal organelles within eukaryotic cells.

  3. Expression and one-step purification of Plasmodium proteins in dictyostelium.


    van Bemmelen, M X; Beghdadi-Rais, C; Desponds, C; Vargas, E; Herrera, S; Reymond, C D; Fasel, N


    Nearly full-length Circumsporozoite protein (CSP) from Plasmodium falciparum, the C-terminal fragments from both P. falciparm and P. yoelii CSP and a fragment comprising 351 amino acids of P.vivax MSPI were expressed in the slime mold Dictyostelium discoideum. Discoidin-tag expression vectors allowed both high yields of these proteins and their purification by a nearly single-step procedure. We exploited the galactose binding activity of Discoidin Ia to separate the fusion proteins by affinity chromatography on Sepharose-4B columns. Inclusion of a thrombin recognition site allowed cleavage of the Discoidin-tag from the fusion protein. Partial secretion of the protein was obtained via an ER independent pathway, whereas routing the recombinant proteins to the ER resulted in glycosylation and retention. Yields of proteins ranged from 0.08 to 3 mg l(-1) depending on the protein sequence and the purification conditions. The recognition of purified MSPI by sera from P. vivax malaria patients was used to confirm the native conformation of the protein expressed in Dictyostelium. The simple purification procedure described here, based on Sepharose-4B, should facilitate the expression and the large-scale purification of various Plasmodium polypeptides. PMID:11163444

  4. Molecular biological approaches to study myosin functions in cytokinesis of Dictyostelium.


    Uyeda, T Q; Yumura, S


    The cellular slime mold Dictyostelium discoideum is amenable to biochemical, cell biological, and molecular genetic analyses, and offers a unique opportunity for multifaceted approaches to dissect the mechanism of cytokinesis. One of the important questions that are currently under investigation using Dictyostelium is to understand how cleavage furrows or contractile rings are assembled in the equatorial region. Contractile rings consist of a number of components including parallel filaments of actin and myosin II. Phenotypic analyses and in vivo localization studies of cells expressing mutant myosin IIs have demonstrated that myosin II's transport to and localization at the equatorial region does not require regulation by phosphorylation of myosin II, specific amino acid sequences of myosin II, or the motor activity of myosin II. Rather, the transport appears to depend on a myosin II-independent flow of cortical cytoskeleton. What drives the flow of cortical cytoskeleton is still elusive. However, a growing number of mutants that affect assembly of contractile rings have been accumulated. Analyses of these mutations, identification of more cytokinesis-specific genes, and information deriving from other experimental systems, should allow us to understand the mechanism of contractile ring formation and other aspects of cytokinesis. PMID:10816252

  5. Controlling Collective Behaviors of Dictyostelium

    NASA Astrophysics Data System (ADS)

    Schwab, David; Mehta, Pankaj; Gregor, Thomas


    We study the collective dynamics of a population of Dictyostelium cells, focusing on how single cell dynamics influence, and give rise to, the behavior of the aggregate. Through analysis of quantitative single cell experiments, we develop a simple model of the single cell response to time-dependent pulses of the extracellular signaling molecule cAMP, characterized by a particular type of excitable system. We then use this model to study collective multicellular dynamics mediated by diffusion coupling. We first consider the mean-field case where we find an intriguing ``dynamical quorum sensing'' transition in which all cells simultaneously transition from quiescent to oscillating across the phase boundary. Then we include spatial dynamics and study pattern formation, both with and without the cells capable of chemotactic response to signal gradients. Finally, we highlight how modification of single cells can alter the collective dynamics.

  6. GxcDD, a putative RacGEF, is involved in Dictyostelium development

    PubMed Central

    Mondal, Subhanjan; Neelamegan, Dhamodharan; Rivero, Francisco; Noegel, Angelika A


    Background Rho subfamily GTPases are implicated in a large number of actin-related processes. They shuttle from an inactive GDP-bound form to an active GTP-bound form. This reaction is catalysed by Guanine nucleotide exchange factor (GEFs). GTPase activating proteins (GAPs) help the GTPase return to the inactive GDP-bound form. The social amoeba Dictyostelium discoideum lacks a Rho or Cdc42 ortholog but has several Rac related GTPases. Compared to our understanding of the downstream effects of Racs our understanding of upstream mechanisms that activate Rac GTPases is relatively poor. Results We report on GxcDD (Guanine exchange factor for Rac GTPases), a Dictyostelium RacGEF. GxcDD is a 180-kDa multidomain protein containing a type 3 CH domain, two IQ motifs, three PH domains, a RhoGEF domain and an ArfGAP domain. Inactivation of the gene results in defective streaming during development under different conditions and a delay in developmental timing. The characterization of single domains revealed that the CH domain of GxcDD functions as a membrane association domain, the RhoGEF domain can physically interact with a subset of Rac GTPases, and the ArfGAP-PH tandem accumulates in cortical regions of the cell and on phagosomes. Our results also suggest that a conformational change may be required for activation of GxcDD, which would be important for its downstream signaling. Conclusion The data indicate that GxcDD is involved in proper streaming and development. We propose that GxcDD is not only a component of the Rac signaling pathway in Dictyostelium, but is also involved in integrating different signals. We provide evidence for a Calponin Homology domain acting as a membrane association domain. GxcDD can bind to several Rac GTPases, but its function as a nucleotide exchange factor needs to be studied further. PMID:17584488

  7. Evidence for long poly(dA).poly(dT) tracts in D. discoideum DNA at high frequencies and their preferential avoidance of nucleosomal DNA core regions.


    Marx, Kenneth A; Zhou, Yue; Kishawi, Iman Q


    The eukaryote, Dictyostelium discoideum, has one of the most (A+T) rich genomes studied to date. Isolated nuclear D. discoideum DNA (AX3 strain) was used to qualitatively determine the frequency and length distribution of long (dA).(dT) homopolymer tracts in this genome, in comparison to the less (A+T) rich calf thymus and Schistosoma mansoni DNAs that had few observable long tracts. These experimental data accurately reflect the significantly elevated frequencies of long tracts found computationally within the D. discoideum intron and flanking sequences, but not exons. PCR amplification of long (dA).(dT) homopolymer tract containing sequences was carried out. Then experimental biotinylated (dT)18 probe hybridization to the PCR amplified DNA showed that the long (dA).(dT) homopolymer tracts were enriched in D. discoideum sequences only hundreds of base pair in length, under conditions where no equivalent hybridization was observed to S. mansoni DNA or calf DNA sequences. Similar probe hybridization to DNA isolated following micrococcal nuclease digestion of D. discoideum chromatin demonstrated that long (dA).(dT) homopolymer tracts were more highly enriched in nucleosomal DNA lengths that included the internucleosomal linker as compared to shorter linker free mononucleosomal lengths. This observation is in agreement with the frequency of tract spacing results calculated from GenBank sequence data. These frequency data indicate that adjacent long tracts plus the intervening spacer DNA are found at peak lengths (average 42 bp), exactly characteristic of the internucleosomal spacer region of D. discoideum chromatin and are in sufficient number to be found in nearly half of all nucleosomes. Compared to shuffled tract sequence controls, these lengths of adjacent long tracts plus the intervening spacer DNA were found to be significantly enriched. Lesser enrichments are observed at lengths corresponding to adjacent tracts being separated by nucleosomal core length DNA

  8. Phospholipase D Controls Dictyostelium Development By Regulating G Protein Signaling

    PubMed Central

    Ray, Sibnath; Chen, Yi; Ayoung, Joanna; Hanna, Rachel; Brazill, Derrick


    Dictyostelium discoideum cells normally exist as individual amoebae, but will enter a period of multicellular development upon starvation. The initial stages of development involve the aggregation of individual cells, using cAMP as a chemoattractant. Chemotaxis is initiated when cAMP binds to its receptor, cAR1, and activates the associated G protein, Gα2βγ. However, chemotaxis will not occur unless there is a high density of starving cells present, as measured by high levels of the secreted quorum sensing molecule, CMF. We previously demonstrated that cells lacking PldB bypass the need for CMF and can aggregate at low cell density, whereas cells overexpressing pldB do not aggregate even at high cell density. Here, we found that PldB controlled both cAMP chemotaxis and cell sorting. PldB was also required by CMF to regulate G protein signaling. Specifically, CMF used PldB, to regulate the dissociation of Gα2 from Gβγ. Using fluorescence resonance energy transfer (FRET), we found that along with cAMP, CMF increased the dissociation of the G protein. In fact, CMF augmented the dissociation induced by cAMP. This augmentation was lost in cells lacking PldB. PldB appears to mediate the CMF signal through the production of phosphatidic acid, as exogenously added phosphatidic acid phenocopies overexpression of pldB. These results suggest that phospholipase D activity is required for CMF to alter the kinetics of cAMP-induced G protein signaling. PMID:20950684

  9. Matricellular signal transduction involving calmodulin in the social amoebozoan dictyostelium.


    O'Day, Danton H; Huber, Robert J


    The social amoebozoan Dictyostelium discoideum undergoes a developmental sequence wherein an extracellular matrix (ECM) sheath surrounds a group of differentiating cells. This sheath is comprised of proteins and carbohydrates, like the ECM of mammalian tissues. One of the characterized ECM proteins is the cysteine-rich, EGF-like (EGFL) repeat-containing, calmodulin (CaM)-binding protein (CaMBP) CyrA. The first EGFL repeat of CyrA increases the rate of random cell motility and cyclic AMP-mediated chemotaxis. Processing of full-length CyrA (~63 kDa) releases two major EGFL repeat-containing fragments (~45 kDa and ~40 kDa) in an event that is developmentally regulated. Evidence for an EGFL repeat receptor also exists and downstream intracellular signaling pathways involving CaM, Ras, protein kinase A and vinculin B phosphorylation have been characterized. In total, these results identify CyrA as a true matricellular protein comparable in function to tenascin C and other matricellular proteins from mammalian cells. Insight into the regulation and processing of CyrA has also been revealed. CyrA is the first identified extracellular CaMBP in this eukaryotic microbe. In keeping with this, extracellular CaM (extCaM) has been shown to be present in the ECM sheath where it binds to CyrA and inhibits its cleavage to release the 45 kDa and 40 kDa EGFL repeat-containing fragments. The presence of extCaM and its role in regulating a matricellular protein during morphogenesis extends our understanding of CaM-mediated signal transduction in eukaryotes. PMID:24705101

  10. Matricellular signal transduction involving calmodulin in the social amoebozoan dictyostelium.


    O'Day, Danton H; Huber, Robert J


    The social amoebozoan Dictyostelium discoideum undergoes a developmental sequence wherein an extracellular matrix (ECM) sheath surrounds a group of differentiating cells. This sheath is comprised of proteins and carbohydrates, like the ECM of mammalian tissues. One of the characterized ECM proteins is the cysteine-rich, EGF-like (EGFL) repeat-containing, calmodulin (CaM)-binding protein (CaMBP) CyrA. The first EGFL repeat of CyrA increases the rate of random cell motility and cyclic AMP-mediated chemotaxis. Processing of full-length CyrA (~63 kDa) releases two major EGFL repeat-containing fragments (~45 kDa and ~40 kDa) in an event that is developmentally regulated. Evidence for an EGFL repeat receptor also exists and downstream intracellular signaling pathways involving CaM, Ras, protein kinase A and vinculin B phosphorylation have been characterized. In total, these results identify CyrA as a true matricellular protein comparable in function to tenascin C and other matricellular proteins from mammalian cells. Insight into the regulation and processing of CyrA has also been revealed. CyrA is the first identified extracellular CaMBP in this eukaryotic microbe. In keeping with this, extracellular CaM (extCaM) has been shown to be present in the ECM sheath where it binds to CyrA and inhibits its cleavage to release the 45 kDa and 40 kDa EGFL repeat-containing fragments. The presence of extCaM and its role in regulating a matricellular protein during morphogenesis extends our understanding of CaM-mediated signal transduction in eukaryotes.

  11. Adhesion of D. discoideum on Hydrophobic Substrate

    NASA Astrophysics Data System (ADS)

    Flanders, Bret; Ploscariu, Nicoleta


    Adhesion by amoeboid cells, such as D. discoideum, is poorly understood but critical for other behaviors such as phagocytosis and migration. Furthermore, both leucocytes and breast cancer cells employ the amoeboid mode of movement at various points in their life-cycles. Hence, improved knowledge of amoeboid adhesion may lead to be new strategies for controlling other important cellular processes. This study regards adhesion by D. discoideum on silanized glass substrates. Reflection interference contrast microscopy is used in conjunction with other methods to determine the contact angle, cell-medium interfacial energy, and adhesion energy of these cells. The contact angle of individual cells settling under gravity onto a substrate is observed to increase as the size of the contact patch increases. This behavior occurs on slower time-scales than expected for the settling of inert vesicles. The implications of this observation on the nature of the underlying forces will be discussed. This work was supported in part by NSF Grant PHY-646966.

  12. Actin Foci Adhesion of D. discoideum

    NASA Astrophysics Data System (ADS)

    Flanders, Bret; Paneru, Govind


    Amoeboid migration is a fast (10 μm min-1) integrin-independent mode of migration that is important with D. discoideum, leukocytes, and breast cancer cells. It is poorly understood, but depends on the establishment of adhesive contacts to the substrate where the cell transmits traction forces. In pre-aggregative D. discoideum, a model system for learning about amoeboid migration, these adhesive contacts are discrete complexes that are known as actin-foci. They have an area of ~ 0.5 μm2 and a lifetime of ~ 20 s. This talk will present measurements of the adhesive character of actin foci that have been obtained using a submicron force transducer that was designed for this purpose. Results on the rupture stresses and lifetimes of individual acting foci under nano-newton level forces will be described in the context of a general theory for cellular adhesion. This theory depends on, essentially, three cellular properties: the membrane-medium surface tension, the number density of adhesion receptors in the membrane, and the receptor-substrate potential energy surface. Therefore, the use of the transducer to determine the surface tension will be presented, as well.

  13. A flavin-dependent halogenase catalyzes the chlorination step in the biosynthesis of Dictyostelium differentiation-inducing factor 1

    PubMed Central

    Neumann, Christopher S.; Walsh, Christopher T.; Kay, Robert R.


    Differentiation-inducing factor 1 (DIF-1) is a polyketide-derived morphogen which drives stalk cell formation in the developmental cycle of Dictyostelium discoideum. Previous experiments demonstrated that the biosynthetic pathway proceeds via dichlorination of the precursor molecule THPH, but the enzyme responsible for this transformation has eluded characterization. Our recent studies on prokaryotic flavin-dependent halogenases and insights from the sequenced Dd genome led us to a candidate gene for this transformation. In this work, we present in vivo and in vitro evidence that chlA from Dd encodes a flavin-dependent halogenase capable of catalyzing both chlorinations in the biosynthesis of DIF-1. The results provide in vitro characterization of a eukaryotic oxygen-dependent halogenase and demonstrate a broad reach in biology for this molecular tailoring strategy, notably its involvement in the differentiation program of a social amoeba. PMID:20231486

  14. TipC and the chorea-acanthocytosis protein VPS13A regulate autophagy in Dictyostelium and human HeLa cells.


    Muñoz-Braceras, Sandra; Calvo, Rosa; Escalante, Ricardo


    Deficient autophagy causes a distinct phenotype in Dictyostelium discoideum, characterized by the formation of multitips at the mound stage. This led us to analyze autophagy in a number of multitipped mutants described previously (tipA(-), tipB(-), tipC(-), and tipD(-)). We found a clear autophagic dysfunction in tipC(-) and tipD(-) while the others showed no defects. tipD codes for a homolog of Atg16, which confirms the role of this protein in Dictyostelium autophagy and validates our approach. The tipC-encoded protein is highly similar to human VPS13A (also known as chorein), whose mutations cause the chorea-acanthocytosis syndrome. No member of the VPS13 protein family has been previously related to autophagy despite the presence of a region of similarity to Atg2 at the C terminus. This region also contains the conserved domain of unknown function DUF1162. Of interest, the expression of the TipC C-terminal coding sequence containing these 2 motifs largely complemented the mutant phenotype. Dictyostelium cells lacking TipC displayed a reduced number of autophagosomes visualized with the markers GFP-Atg18 and GFP-Atg8 and an impaired autophagic degradation as determined by a proteolytic cleavage assay. Downregulation of human VPS13A in HeLa cells by RNA interference confirmed the participation of the human protein in autophagy. VPS13A-depleted cells showed accumulation of autophagic markers and impaired autophagic flux.

  15. Dictyostelium Nramp1, which is structurally and functionally similar to mammalian DMT1 transporter, mediates phagosomal iron efflux

    PubMed Central

    Buracco, Simona; Peracino, Barbara; Cinquetti, Raffaella; Signoretto, Elena; Vollero, Alessandra; Imperiali, Francesca; Castagna, Michela; Bossi, Elena; Bozzaro, Salvatore


    ABSTRACT The Nramp (Slc11) protein family is widespread in bacteria and eukaryotes, and mediates transport of divalent metals across cellular membranes. The social amoeba Dictyostelium discoideum has two Nramp proteins. Nramp1, like its mammalian ortholog (SLC11A1), is recruited to phagosomal and macropinosomal membranes, and confers resistance to pathogenic bacteria. Nramp2 is located exclusively in the contractile vacuole membrane and controls, synergistically with Nramp1, iron homeostasis. It has long been debated whether mammalian Nramp1 mediates iron import or export from phagosomes. By selectively loading the iron-chelating fluorochrome calcein in macropinosomes, we show that Dictyostelium Nramp1 mediates iron efflux from macropinosomes in vivo. To gain insight in ion selectivity and the transport mechanism, the proteins were expressed in Xenopus oocytes. Using a novel assay with calcein, and electrophysiological and radiochemical assays, we show that Nramp1, similar to rat DMT1 (also known as SLC11A2), transports Fe2+ and manganese, not Fe3+ or copper. Metal ion transport is electrogenic and proton dependent. By contrast, Nramp2 transports only Fe2+ in a non-electrogenic and proton-independent way. These differences reflect evolutionary divergence of the prototypical Nramp2 protein sequence compared to the archetypical Nramp1 and DMT1 proteins. PMID:26208637

  16. Isolation and characterization of Dictyostelium thymidine kinase 1 as a calmodulin-binding protein.


    O'Day, Danton H; Chatterjee-Chakraborty, Munmun; Wagler, Stephanie; Myre, Michael A


    Probing of a cDNA expression library from multicellular development of Dictyostelium discoideum using a recombinant radiolabelled calmodulin probe (35S-VU1-CaM) led to the isolation of a cDNA encoding a putative CaM-binding protein (CaMBP). The cDNA contained an open reading frame of 951 bp encoding a 227aa polypeptide (25.5 kDa). Sequence comparisons led to highly significant matches with cytosolic thymidine kinases (TK1; EC from a diverse number of species including humans (7e-56; 59% Identities; 75% Positives) indicating that the encoded protein is D. discoideum TK1 (DdTK1; ThyB). DdTK1 has not been previously characterized in this organism. In keeping with its sequence similarity with DdTK1, antibodies against humanTK1 recognize DdTK1, which is expressed during growth but decreases in amount after starvation. A CaM-binding domain (CaMBD; 20GKTTELIRRIKRFNFANKKC30) was identified and wild type DdTK1 plus two constructs (DdTK deltaC36, DdTK deltaC75) possessing the domain were shown to bind CaM in vitro but only in the presence of calcium while a construct (DdTK deltaN72) lacking the region failed to bind to CaM. Thus, DdTK1 is a Ca2+-dependent CaMBP. Sequence alignments against TK1 from vertebrates to viruses show that CaM-binding region is highly conserved. The identified CaMBD overlaps the ATP-binding (P-loop) domain suggesting CaM might affect the activity of this kinase. Recombinant DdTK is enzymatically active and showed stimulation by CaM (113+/-0.5%) an in vitro enhancement that was prevented by co-addition of the CaM antagonists W7 (91.2+/-0.8%) and W13 (96.6+/-0.6%). The discovery that TK1 from D. discoideum, and possibly other species including humans and a large number of human viruses, is a Ca2+-dependent CaMBP opens up new avenues for research on this medically relevant protein. PMID:15883042

  17. Transcriptional profiling of Dictyostelium with RNA sequencing

    PubMed Central

    Miranda, Edward Roshan; Rot, Gregor; Toplak, Marko; Santhanam, Balaji; Curk, Tomaz; Shaulsky, Gad; Zupan, Blaz


    Summary Transcriptional profiling methods have been utilized in the analysis of various biological processes in Dictyostelium. Recent advances in high-throughput sequencing have increased the resolution and the dynamic range of transcriptional profiling. Here we describe the utility of RNA-sequencing with the Illumina technology for production of transcriptional profiles. We also describe methods for data mapping and storage as well as common and specialized tools for data analysis, both online and offline. PMID:23494306

  18. Dictyostelium ribosomal protein genes and the elongation factor 1B gene show coordinate developmental regulation which is under post-transcriptional control.


    Agarwal, A K; Blumberg, D D


    Starvation for amino acids initiates the developmental program in the cellular slime mold, Dictyostelium discoideum [19, 20]. One of the earliest developmental events is the decline in ribosomal protein synthesis [2, 17, 29, 30]. The ribosomal protein mRNAs are excluded from polysomes with 20 min to 1 h following the removal of nutrients, and their mRNA levels decline sharply at about 9 h into the 24-h developmental cycle [28, 31, 35, 36]. It has been generally assumed that the decline in r-protein mRNA levels during late development reflected a decline in the transcription rate [12, 32, 43]. Here we demonstrate that this is not the case. The transcription rates of three ribosomal protein genes, rpL11, rpL23 and rpS9 as well as an elongation factor 1B gene have been determined during growth and development in Dictyostelium. Throughout growth and development the transcription rate of the ribosomal protein genes remains relatively constant at 0.2%-0.5% of the rate of rRNA transcription while the elongation factor 1B gene is transcribed at 0.4%-0.6% of the rRNA rate. This low but constant transcription rate is in contrast to a spore coat protein gene Psp D, which is transcribed at 6% of the rRNA rate in late developing cells. The elongation factor 1B gene appears to be co-regulated with the ribosomal protein genes both in terms of its transcription rate and mRNA accumulation. Dictyostelium has been a popular model for understanding signal transduction and the growth to differentiation transition, thus it is of significance that the regulation of ribosome biosynthesis in Dictyostelium resembles that of higher eukaryotes in being regulated largely at the post-transcriptional level in response to starvation as opposed to yeasts where the regulation is largely transcriptional [27]. PMID:10374261

  19. Evidence for nucleolar subcompartments in Dictyostelium

    SciTech Connect

    Catalano, Andrew; O’Day, Danton H.


    Highlights: • Two nucleolar subcompartments (NoSC1, NoSC2) were found in Dictyostelium. • Specific nucleolar proteins localize to different nucleolar subcompartments. • Specific proteins exit NoSC1 and NoSC2 differently upon Actinomycin D treatment. • KRKR appears to function as an NoSC2 nucleolar subcompartment localization signal. - Abstract: The nucleolus is a multifunctional nuclear compartment usually consisting of two to three subcompartments which represent stages of ribosomal biogenesis. It is linked to several human diseases including viral infections, cancer, and neurodegeneration. Dictyostelium is a model eukaryote for the study of fundamental biological processes as well as several human diseases however comparatively little is known about its nucleolus. Unlike most nucleoli it does not possess visible subcompartments at the ultrastructural level. Several recently identified nucleolar proteins in Dictyostelium leave the nucleolus after treatment with the rDNA transcription inhibitor actinomycin-D (AM-D). Different proteins exit in different ways, suggesting that previously unidentified nucleolar subcompartments may exist. The identification of nucleolar subcompartments would help to better understand the nucleolus in this model eukaryote. Here, we show that Dictyostelium nucleolar proteins nucleomorphin isoform NumA1 and Bud31 localize throughout the entire nucleolus while calcium-binding protein 4a localizes to only a portion, representing nucleolar subcompartment 1 (NoSC1). SWI/SNF complex member Snf12 localizes to a smaller area within NoSC1 representing a second nucleolar subcompartment, NoSC2. The nuclear/nucleolar localization signal KRKR from Snf12 localized GFP to NoSC2, and thus also appears to function as a nucleolar subcompartment localization signal. FhkA localizes to the nucleolar periphery displaying a similar pattern to that of Hsp32. Similarities between the redistribution patterns of Dictyostelium nucleolar proteins during

  20. Role of SpdA in Cell Spreading and Phagocytosis in Dictyostelium

    PubMed Central

    Dias, Marco; Brochetta, Cristiana; Marchetti, Anna; Bodinier, Romain; Brückert, Franz; Cosson, Pierre


    Dictyostelium discoideum is a widely used model to study molecular mechanisms controlling cell adhesion, cell spreading on a surface, and phagocytosis. In this study we isolated and characterize a new mutant created by insertion of a mutagenic vector in the heretofore uncharacterized spdA gene. SpdA-ins mutant cells produce an altered, slightly shortened version of the SpdA protein. They spread more efficiently than WT cells when allowed to adhere to a glass substrate, and phagocytose particles more efficiently. On the contrary, a functional spdA knockout mutant where a large segment of the gene was deleted phagocytosed less efficiently and spread less efficiently on a substrate. These phenotypes were highly dependent on the cellular density, and were most visible at high cell densities, where secreted quorum-sensing factors inhibiting cell motility, spreading and phagocytosis are most active. These results identify the involvement of SpdA in the control of cell spreading and phagocytosis. The underlying molecular mechanisms, as well as the exact link between SpdA and cell spreading, remain to be established. PMID:27512991

  1. Quantitation of Membrane Sites in Aggregating Dictyostelium Cells by Use of Tritiated Univalent Antibody

    PubMed Central

    Beug, H.; Katz, F. E.; Stein, A.; Gerisch, G.


    Cell-to-cell adhesion during aggregation of Dictyostelium discoideum cells is completely blocked by univalent antibody (Fab) directed against two classes of target sites: surface structures characteristic for aggregation-competent cells (“contact sites A”) and others present also on growth-phase cells (“contact sites B”). 3 × 105 Fab molecules bound per cell are sufficient to block contact sites A completely, although the Fab fragments cover not more than 2% of the total cell surface. Up to 8-fold this value can be bound per cell when Fab fragments of another specificity are used, without affecting activity of contact sites A. Blockage of cell-to-cell adhesion therefore depends on the binding of Fab fragments to specific target sites, rather than on the total number of Fab molecules bound per cell. This conclusion is also valid for cell adhesion attributed to contact sites B. Contact sites therefore represent a special class of cell-surface sites which, in cell homogenates as well as in vivo, can be traced by Fab, and which are not identical with the bulk of cell-surface antigens present on aggregating cells. Images PMID:4522296

  2. Null mutations of the Dictyostelium cyclic nucleotide phosphodiesterase gene block chemotactic cell movement in developing aggregates.


    Sucgang, R; Weijer, C J; Siegert, F; Franke, J; Kessin, R H


    Extracellular cAMP is a critical messenger in the multicellular development of the cellular slime mold Dictyostelium discoideum. The levels of cAMP are controlled by a cyclic nucleotide phosphodiesterase (PDE) that is secreted by the cells. The PDE gene (pdsA) is controlled by three promoters that permit expression during vegetative growth, during aggregation, and in prestalk cells of the older structures. Targeted disruption of the gene aborts development, and complementation with a modified pdsA restores development. Two distinct promoters must be used for full complementation, and an inhibitory domain of the PDE must be removed. We took advantage of newly isolated PDE-null cells and the natural chimerism of the organism to ask whether the absence of PDE affected individual cell behavior. PDE-null cells aggregated with isogenic wild-type cells in chimeric mixtures, but could not move in a coordinated manner in mounds. The wild-type cells move inward toward the center of the mound, leaving many of the PDE-null cells at the periphery of the aggregate. During the later stages of development, PDE-null cells in the chimera segregate to regions which correspond to the prestalk region and the rear of the slug. Participation in the prespore/spore population returns with the restoration of a modified pdsA to the null cells. PMID:9405107

  3. Bleb-driven chemotaxis of Dictyostelium cells

    PubMed Central

    Zatulovskiy, Evgeny; Tyson, Richard; Bretschneider, Till


    Blebs and F-actin–driven pseudopods are alternative ways of extending the leading edge of migrating cells. We show that Dictyostelium cells switch from using predominantly pseudopods to blebs when migrating under agarose overlays of increasing stiffness. Blebs expand faster than pseudopods leaving behind F-actin scars, but are less persistent. Blebbing cells are strongly chemotactic to cyclic-AMP, producing nearly all of their blebs up-gradient. When cells re-orientate to a needle releasing cyclic-AMP, they stereotypically produce first microspikes, then blebs and pseudopods only later. Genetically, blebbing requires myosin-II and increases when actin polymerization or cortical function is impaired. Cyclic-AMP induces transient blebbing independently of much of the known chemotactic signal transduction machinery, but involving PI3-kinase and downstream PH domain proteins, CRAC and PhdA. Impairment of this PI3-kinase pathway results in slow movement under agarose and cells that produce few blebs, though actin polymerization appears unaffected. We propose that mechanical resistance induces bleb-driven movement in Dictyostelium, which is chemotactic and controlled through PI3-kinase. PMID:24616222

  4. Derivatives of Dictyostelium differentiation-inducing factors inhibit lysophosphatidic acid–stimulated migration of murine osteosarcoma LM8 cells

    SciTech Connect

    Kubohara, Yuzuru; Komachi, Mayumi; Homma, Yoshimi; Kikuchi, Haruhisa; Oshima, Yoshiteru


    Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), −2, and −3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5–20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC{sub 50} values of 5.5, 4.6, and 4.2 μM, respectively. On the other hand, the IC{sub 50} values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. - Highlights: • LPA induces cell migration (invasion) in murine osteosarcoma LM8 cells. • DIFs are novel lead anti-tumor agents found in Dictyostelium discoideum. • We examined the effects of DIF derivatives on LPA-induced LM8 cell migration in vitro. • Some of the DIF derivatives inhibited LPA-induced LM8 cell migration.

  5. A Dictyostelium mutant deficient in severin, an F-actin fragmenting protein, shows normal motility and chemotaxis

    PubMed Central


    A severin deficient mutant of Dictyostelium discoideum has been isolated by the use of colony immunoblotting after chemical mutagenesis. In homogenates of wild-type cells, severin is easily detected as a very active F-actin fragmenting protein. Tests for severin in the mutant, HG1132, included viscometry for the assay of F- actin fragmentation in fractions from DEAE-cellulose columns, labeling of blots with monoclonal and polyclonal antibodies, and immunofluorescent-labeling of cryosections. Severin could not be detected in the mutant using these methods. The mutation in HG1132 is recessive and has been mapped to linkage group VII. The mutant failed to produce the normal severin mRNA, but small amounts of a transcript that was approximately 100 bases larger than the wild-type mRNA were detected in the mutant throughout all stages of development. On the DNA level a new Mbo II restriction site was found in the mutant within the coding region of the severin gene. The severin deficient mutant cells grew at an approximately normal rate, aggregated and formed fruiting bodies with viable spores. By the use of an image processing system, speed of cell movement, turning rates, and precision of chemotactic orientation in a stable gradient of cyclic AMP were quantitated, and no significant differences between wild-type and mutant cells were found. Thus, under the culture conditions used, severin proved to be neither essential for growth of D. discoideum nor for any cell function that is important for aggregation or later development. PMID:2537840

  6. Isolation, characterization, and bioinformatic analysis of calmodulin-binding protein cmbB reveals a novel tandem IP22 repeat common to many Dictyostelium and Mimivirus proteins.


    O'Day, Danton H; Suhre, Karsten; Myre, Michael A; Chatterjee-Chakraborty, Munmun; Chavez, Sara E


    A novel calmodulin-binding protein cmbB from Dictyostelium discoideum is encoded in a single gene. Northern analysis reveals two cmbB transcripts first detectable at 4 h during multicellular development. Western blotting detects an approximately 46.6 kDa protein. Sequence analysis and calmodulin-agarose binding studies identified a "classic" calcium-dependent calmodulin-binding domain (179IPKSLRSLFLGKGYNQPLEF198) but structural analyses suggest binding may not involve classic alpha-helical calmodulin-binding. The cmbB protein is comprised of tandem repeats of a newly identified IP22 motif ([I,L]Pxxhxxhxhxxxhxxxhxxxx; where h = any hydrophobic amino acid) that is highly conserved and a more precise representation of the FNIP repeat. At least eight Acanthamoeba polyphaga Mimivirus proteins and over 100 Dictyostelium proteins contain tandem arrays of the IP22 motif and its variants. cmbB also shares structural homology to YopM, from the plague bacterium Yersenia pestis. PMID:16777069

  7. The protein domains of the Dictyostelium microprocessor that are required for correct subcellular localization and for microRNA maturation

    PubMed Central

    Kruse, Janis; Meier, Doreen; Zenk, Fides; Rehders, Maren; Nellen, Wolfgang; Hammann, Christian


    ABSTRACT The maturation pathways of microRNAs (miRNAs) have been delineated for plants and several animals, belonging to the evolutionary supergroups of Archaeplastida and Opisthokonta, respectively. Recently, we reported the discovery of the microprocessor complex in Dictyostelium discoideum of the Amoebozoa supergroup. The complex is composed of the Dicer DrnB and the dsRBD (double-stranded RNA binding domain) containing protein RbdB. Both proteins localize at nucleoli, where they physically interact, and both are required for miRNA maturation. Here we show that the miRNA phenotype of a ΔdrnB gene deletion strain can be rescued by ectopic expression of a series of DrnB GFP fusion proteins, which consistently showed punctate perinucleolar localization in fluorescence microscopy. These punctate foci appear surprisingly stable, as they persist both disintegration of nucleoli and degradation of cellular nucleic acids. We observed that DrnB expression levels influence the number of microprocessor foci and alter RbdB accumulation. An investigation of DrnB variants revealed that its newly identified nuclear localization signal is necessary, but not sufficient for the perinucleolar localization. Biogenesis of miRNAs, which are RNA Pol II transcripts, is correlated with that localization. Besides its bidentate RNase III domains, DrnB contains only a dsRBD, which surprisingly is dispensable for miRNA maturation. This dsRBD can, however, functionally replace the homologous domain in RbdB. Based on the unique setup of the Dictyostelium microprocessor with a subcellular localization similar to plants, but a protein domain composition similar to animals, we propose a model for the evolutionary origin of RNase III proteins acting in miRNA maturation. PMID:27416267

  8. The C Isoform of Dictyostelium Tetraspanins Localizes to the Contractile Vacuole and Contributes to Resistance against Osmotic Stress.


    Albers, Tineke; Maniak, Markus; Beitz, Eric; von Bülow, Julia


    Tetraspanins (Tsps) are membrane proteins that are widely expressed in eukaryotic organisms. Only recently, Tsps have started to acquire relevance as potential new drug targets as they contribute, via protein-protein interactions, to numerous pathophysiological processes including infectious diseases and cancer. However, due to a high number of isoforms and functional redundancy, knowledge on specific functions of most Tsps is still scarce. We set out to characterize five previously annotated Tsps, TspA-E, from Dictyostelium discoideum, a model for studying proteins that have human orthologues. Using reverse transcriptase PCRs, we found mRNAs for TspA-E in the multicellular slug stage, whereas vegetative cells expressed only TspA, TspC and, to a lesser extent, TspD. We raised antibodies against TspA, TspC and TspD and detected endogenous TspA, as well as heterologously expressed TspA and TspC by Western blot. N-deglycosylation assays and mutational analyses showed glycosylation of TspA and TspC in vivo. GFP-tagged Tsps co-localized with the proton pump on the contractile vacuole network. Deletion strains of TspC and TspD exibited unaltered growth, adhesion, random motility and development. Yet, tspC- cells showed a defect in coping with hypo-osmotic stress, due to accumulation of contractile vacuoles, but heterologous expression of TspC rescued their phenotype. In conclusion, our data fill a gap in Dictyostelium research and open up the possibility that Tsps in contractile vacuoles of e.g. Trypanosoma may one day constitute a valuable drug target for treating sleeping sickness, one of the most threatening tropical diseases. PMID:27597994

  9. The C Isoform of Dictyostelium Tetraspanins Localizes to the Contractile Vacuole and Contributes to Resistance against Osmotic Stress

    PubMed Central

    Albers, Tineke; Maniak, Markus; Beitz, Eric; von Bülow, Julia


    Tetraspanins (Tsps) are membrane proteins that are widely expressed in eukaryotic organisms. Only recently, Tsps have started to acquire relevance as potential new drug targets as they contribute, via protein-protein interactions, to numerous pathophysiological processes including infectious diseases and cancer. However, due to a high number of isoforms and functional redundancy, knowledge on specific functions of most Tsps is still scarce. We set out to characterize five previously annotated Tsps, TspA-E, from Dictyostelium discoideum, a model for studying proteins that have human orthologues. Using reverse transcriptase PCRs, we found mRNAs for TspA-E in the multicellular slug stage, whereas vegetative cells expressed only TspA, TspC and, to a lesser extent, TspD. We raised antibodies against TspA, TspC and TspD and detected endogenous TspA, as well as heterologously expressed TspA and TspC by Western blot. N-deglycosylation assays and mutational analyses showed glycosylation of TspA and TspC in vivo. GFP-tagged Tsps co-localized with the proton pump on the contractile vacuole network. Deletion strains of TspC and TspD exibited unaltered growth, adhesion, random motility and development. Yet, tspC− cells showed a defect in coping with hypo-osmotic stress, due to accumulation of contractile vacuoles, but heterologous expression of TspC rescued their phenotype. In conclusion, our data fill a gap in Dictyostelium research and open up the possibility that Tsps in contractile vacuoles of e.g. Trypanosoma may one day constitute a valuable drug target for treating sleeping sickness, one of the most threatening tropical diseases. PMID:27597994

  10. Shell tension forces propel Dictyostelium slugs forward.


    Rieu, Jean-Paul; Delanoë-Ayari, Hélène


    The Dictyostelium slug is an excellent model system for studying collective movements, as it is comprised of about 10(5) cells all moving together in the same direction. It still remains unclear how this movement occurs and what the physical mechanisms behind it are. By applying our recently developed 3D traction force microscopy, we propose a simple explanation for slug propulsion. Most of the forces are exerted by the sheath surrounding the slug. This secreted shell is under a rather uniform tension (around 50 mN m(-1)) and will give rise to a tissue under pressure. Finally, we propose that this pressure will naturally push the slug tip forwards if a gradient of shell mechanical properties takes place in the very anterior part of the raised tip.

  11. Neurofibromin controls macropinocytosis and phagocytosis in Dictyostelium.


    Bloomfield, Gareth; Traynor, David; Sander, Sophia P; Veltman, Douwe M; Pachebat, Justin A; Kay, Robert R


    Cells use phagocytosis and macropinocytosis to internalise bulk material, which in phagotrophic organisms supplies the nutrients necessary for growth. Wildtype Dictyostelium amoebae feed on bacteria, but for decades laboratory work has relied on axenic mutants that can also grow on liquid media. We used forward genetics to identify the causative gene underlying this phenotype. This gene encodes the RasGAP Neurofibromin (NF1). Loss of NF1 enables axenic growth by increasing fluid uptake. Mutants form outsized macropinosomes which are promoted by greater Ras and PI3K activity at sites of endocytosis. Relatedly, NF1 mutants can ingest larger-than-normal particles using phagocytosis. An NF1 reporter is recruited to nascent macropinosomes, suggesting that NF1 limits their size by locally inhibiting Ras signalling. Our results link NF1 with macropinocytosis and phagocytosis for the first time, and we propose that NF1 evolved in early phagotrophs to spatially modulate Ras activity, thereby constraining and shaping their feeding structures.

  12. TipC and the chorea-acanthocytosis protein VPS13A regulate autophagy in Dictyostelium and human HeLa cells

    PubMed Central

    Muñoz-Braceras, Sandra; Calvo, Rosa; Escalante, Ricardo


    Deficient autophagy causes a distinct phenotype in Dictyostelium discoideum, characterized by the formation of multitips at the mound stage. This led us to analyze autophagy in a number of multitipped mutants described previously (tipA−, tipB−, tipC−, and tipD−). We found a clear autophagic dysfunction in tipC− and tipD− while the others showed no defects. tipD codes for a homolog of Atg16, which confirms the role of this protein in Dictyostelium autophagy and validates our approach. The tipC-encoded protein is highly similar to human VPS13A (also known as chorein), whose mutations cause the chorea-acanthocytosis syndrome. No member of the VPS13 protein family has been previously related to autophagy despite the presence of a region of similarity to Atg2 at the C terminus. This region also contains the conserved domain of unknown function DUF1162. Of interest, the expression of the TipC C-terminal coding sequence containing these 2 motifs largely complemented the mutant phenotype. Dictyostelium cells lacking TipC displayed a reduced number of autophagosomes visualized with the markers GFP-Atg18 and GFP-Atg8 and an impaired autophagic degradation as determined by a proteolytic cleavage assay. Downregulation of human VPS13A in HeLa cells by RNA interference confirmed the participation of the human protein in autophagy. VPS13A-depleted cells showed accumulation of autophagic markers and impaired autophagic flux. PMID:25996471

  13. Three-dimensional Patterns and Redistribution of Myosin II and Actin in Mitotic Dictyostelium Cells

    PubMed Central

    Neujahr, Ralph; Heizer, Christina; Albrecht, Richard; Ecke, Maria; Schwartz, Jean-Marc; Weber, Igor; Gerisch, Günther


    Myosin II is not essential for cytokinesis in cells of Dictyostelium discoideum that are anchored on a substrate (Neujahr, R., C. Heizer, and G. Gerisch. 1997. J. Cell Sci. 110:123–137), in contrast to its importance for cell division in suspension (DeLozanne, A., and J.A. Spudich. 1987. Science. 236:1086–1091; Knecht, D.A., and W.F. Loomis. 1987. Science. 236: 1081–1085.). These differences have prompted us to investigate the three-dimensional distribution of myosin II in cells dividing under one of three conditions: (a) in shaken suspension, (b) in a fluid layer on a solid substrate surface, and (c) under mechanical stress applied by compressing the cells. Under the first and second conditions outlined above, myosin II does not form patterns that suggest a contractile ring is established in the furrow. Most of the myosin II is concentrated in the regions that flank the furrow on both sides towards the poles of the dividing cell. It is only when cells are compressed that myosin II extensively accumulates in the cleavage furrow, as has been previously described (Fukui, Y., T.J. Lynch, H. Brzeska, and E.D. Korn. 1989. Nature. 341:328–331), i.e., this massive accumulation is a response to the mechanical stress. Evidence is provided that the stress-associated translocation of myosin II to the cell cortex is a result of the dephosphorylation of its heavy chains. F-actin is localized in the dividing cells in a distinctly different pattern from that of myosin II. The F-actin is shown to accumulate primarily in protrusions at the two poles that ultimately form the leading edges of the daughter cells. This distribution changes dynamically as visualized in living cells with a green fluorescent protein–actin fusion. PMID:9412473

  14. An evolutionarily significant unicellular strategy in response to starvation in Dictyostelium social amoebae

    PubMed Central

    Dubravcic, Darja; van Baalen, Minus; Nizak, Clément


    The social amoeba Dictyostelium discoideum is widely studied for its multicellular development program as a response to starvation. Aggregates of up to 10 6 cells form fruiting bodies containing (i) dormant spores (~80%) that can persist for months in the absence of nutrients, and (ii) dead stalk cells (~20%) that promote the dispersion of the spores towards nutrient-rich areas. It is often overlooked that not all cells aggregate upon starvation. Using a new quantitative approach based on time-lapse fluorescence microscopy and a low ratio of reporting cells, we have quantified this fraction of non-aggregating cells. In realistic starvation conditions, up to 15% of cells do not aggregate, which makes this third cell fate a significant component of the population-level response of social amoebae to starvation. Non-aggregating cells have an advantage over cells in aggregates since they resume growth earlier upon arrival of new nutrients, but have a shorter lifespan under prolonged starvation. We find that phenotypic heterogeneities linked to cell nutritional state bias the representation of cells in the aggregating vs. non-aggregating fractions, and thus affect population partitioning. Next, we report that the fraction of non-aggregating cells depends on genetic factors that regulate the timing of starvation, signal sensing efficiency and aggregation efficiency. In addition, interactions between clones in mixtures of non-isogenic cells affect the partitioning of each clone into both fractions. We further build a numerical model to test the evolutionary significance of the non-aggregating cell fraction. The partitioning of cells into aggregating and non-aggregating fractions is optimal in fluctuating environments with an unpredictable duration of starvation periods. Our study highlights the unicellular component of the response of social amoebae to starvation, and thus extends its evolutionary and ecological framework. PMID:25309731

  15. An evolutionarily significant unicellular strategy in response to starvation in Dictyostelium social amoebae.


    Dubravcic, Darja; van Baalen, Minus; Nizak, Clément


    The social amoeba Dictyostelium discoideum is widely studied for its multicellular development program as a response to starvation. Aggregates of up to 10 (6) cells form fruiting bodies containing (i) dormant spores (~80%) that can persist for months in the absence of nutrients, and (ii) dead stalk cells (~20%) that promote the dispersion of the spores towards nutrient-rich areas. It is often overlooked that not all cells aggregate upon starvation. Using a new quantitative approach based on time-lapse fluorescence microscopy and a low ratio of reporting cells, we have quantified this fraction of non-aggregating cells. In realistic starvation conditions, up to 15% of cells do not aggregate, which makes this third cell fate a significant component of the population-level response of social amoebae to starvation. Non-aggregating cells have an advantage over cells in aggregates since they resume growth earlier upon arrival of new nutrients, but have a shorter lifespan under prolonged starvation. We find that phenotypic heterogeneities linked to cell nutritional state bias the representation of cells in the aggregating vs. non-aggregating fractions, and thus affect population partitioning. Next, we report that the fraction of non-aggregating cells depends on genetic factors that regulate the timing of starvation, signal sensing efficiency and aggregation efficiency. In addition, interactions between clones in mixtures of non-isogenic cells affect the partitioning of each clone into both fractions. We further build a numerical model to test the evolutionary significance of the non-aggregating cell fraction. The partitioning of cells into aggregating and non-aggregating fractions is optimal in fluctuating environments with an unpredictable duration of starvation periods. Our study highlights the unicellular component of the response of social amoebae to starvation, and thus extends its evolutionary and ecological framework. PMID:25309731

  16. The Dictyostelium MAPK ERK1 is phosphorylated in a secondary response to early developmental signaling

    PubMed Central

    Schwebs, David J.; Hadwiger, Jeffrey A.


    Previous reports have suggested that the two mitogen-activated protein kinases (MAPKs) in Dictyostelium discoideum, ERK1 and ERK2, can be directly activated in response to external cAMP even though these MAPKs play different roles in the developmental life cycle. To better characterize MAPK regulation, the levels of phosphorylated MAPKs were analyzed in response to external signals. Only ERK2 was rapidly phosphorylated in response to the chemoattractants, cAMP and folate. In contrast, the phosphorylation of ERK1 occurred as a secondary or indirect response to these stimuli and this phosphorylation was enhanced by cell-cell interactions, suggesting that other external signals can activate ERK1. The phosphorylation of ERK1 or ERK2 did not require the function of the other MAPK in these responses. Folate stimulation of a chimeric population of erk1− and gα4− cells revealed that the phosphorylation of ERK1 could be mediated through an intercellular signal other than folate. Loss of ERK1 function suppressed the developmental delay and the deficiency in anterior cell localization associated with gα5− mutants suggesting that ERK1 function can be down regulated through Gα5 subunit-mediated signaling. However, no major changes in the phosphorylation of ERK1 were observed in gα5− cells suggesting that the Gα5 subunit signaling pathway does not regulate the phosphorylation of ERK1. These findings suggest that the activation of ERK1 occurs as a secondary response to chemoattractants and that other cell-cell signaling mechanisms contribute to this activation. Gα5 subunit signaling can down regulate ERK1 function to promote prestalk cell development but not through major changes to the level of phosphorylated ERK1. PMID:25451080

  17. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.


    Sucic, J F; Selmin, O; Rutherford, C L


    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  18. Self-organization of chemoattractant waves in Dictyostelium depends on F-actin and cell–substrate adhesion

    PubMed Central

    Fukujin, Fumihito; Nakajima, Akihiko; Shimada, Nao; Sawai, Satoshi


    In the social amoeba Dictyostelium discoideum, travelling waves of extracellular cyclic adenosine monophosphate (cAMP) self-organize in cell populations and direct aggregation of individual cells to form multicellular fruiting bodies. In contrast to the large body of studies that addressed how movement of cells is determined by spatial and temporal cues encoded in the dynamic cAMP gradients, how cell mechanics affect the formation of a self-generated chemoattractant field has received less attention. Here, we show, by live cell imaging analysis, that the periodicity of the synchronized cAMP waves increases in cells treated with the actin inhibitor latrunculin. Detail analysis of the extracellular cAMP-induced transients of cytosolic cAMP (cAMP relay response) in well-isolated cells demonstrated that their amplitude and duration were markedly reduced in latrunculin-treated cells. Similarly, in cells strongly adhered to a poly-l-lysine-coated surface, the response was suppressed, and the periodicity of the population-level oscillations was markedly lengthened. Our results suggest that cortical F-actin is dispensable for the basic low amplitude relay response but essential for its full amplification and that this enhanced response is necessary to establish high-frequency signalling centres. The observed F-actin dependence may prevent aggregation centres from establishing in microenvironments that are incompatible with cell migration. PMID:27358278

  19. Self-organization of chemoattractant waves in Dictyostelium depends on F-actin and cell-substrate adhesion.


    Fukujin, Fumihito; Nakajima, Akihiko; Shimada, Nao; Sawai, Satoshi


    In the social amoeba Dictyostelium discoideum, travelling waves of extracellular cyclic adenosine monophosphate (cAMP) self-organize in cell populations and direct aggregation of individual cells to form multicellular fruiting bodies. In contrast to the large body of studies that addressed how movement of cells is determined by spatial and temporal cues encoded in the dynamic cAMP gradients, how cell mechanics affect the formation of a self-generated chemoattractant field has received less attention. Here, we show, by live cell imaging analysis, that the periodicity of the synchronized cAMP waves increases in cells treated with the actin inhibitor latrunculin. Detail analysis of the extracellular cAMP-induced transients of cytosolic cAMP (cAMP relay response) in well-isolated cells demonstrated that their amplitude and duration were markedly reduced in latrunculin-treated cells. Similarly, in cells strongly adhered to a poly-l-lysine-coated surface, the response was suppressed, and the periodicity of the population-level oscillations was markedly lengthened. Our results suggest that cortical F-actin is dispensable for the basic low amplitude relay response but essential for its full amplification and that this enhanced response is necessary to establish high-frequency signalling centres. The observed F-actin dependence may prevent aggregation centres from establishing in microenvironments that are incompatible with cell migration. PMID:27358278

  20. Analysis of the Microprocessor in Dictyostelium: The Role of RbdB, a dsRNA Binding Protein.


    Meier, Doreen; Kruse, Janis; Buttlar, Jann; Friedrich, Michael; Zenk, Fides; Boesler, Benjamin; Förstner, Konrad U; Hammann, Christian; Nellen, Wolfgang


    We identified the dsRNA binding protein RbdB as an essential component in miRNA processing in Dictyostelium discoideum. RbdB is a nuclear protein that accumulates, together with Dicer B, in nucleolar foci reminiscent of plant dicing bodies. Disruption of rbdB results in loss of miRNAs and accumulation of primary miRNAs. The phenotype can be rescued by ectopic expression of RbdB thus allowing for a detailed analysis of domain function. The lack of cytoplasmic dsRBD proteins involved in miRNA processing, suggests that both processing steps take place in the nucleus thus resembling the plant pathway. However, we also find features e.g. in the domain structure of Dicer which suggest similarities to animals. Reduction of miRNAs in the rbdB- strain and their increase in the Argonaute A knock out allowed the definition of new miRNAs one of which appears to belong to a new non-canonical class.

  1. The real factor for polypeptide elongation in Dictyostelium cells is EF-2B, not EF-2A

    SciTech Connect

    Yoshino, Tomoko; Maeda, Yasuo; Amagai, Aiko . E-mail:


    Polypeptide elongation factor 2 (EF-2) plays an essential role in protein synthesis and is believed to be indispensable for cell proliferation. Recently, it has been demonstrated that there are two kinds of EF-2 (EF-2A and EF-2B with 76.6% of sequence identity at the amino acid level) in Dictyostelium discoideum. Although the knockout of EF-2A slightly impaired cytokinesis, EF-2A null cells exhibited almost normal protein synthesis and cell growth, suggesting that there is another molecule capable of compensating for EF-2 function. Since EF-2B is the most likely candidate, we examined its function using ef-2b knockdown cells prepared by the RNAi method. Our results strongly suggest that EF-2B is required for protein synthesis and cell proliferation, functioning as the real EF-2. Interestingly, the expressions of ef-2a and ef-2b mRNAs during development are reversely regulated, and the ef-2b expression is greatly augmented in ef-2a null cells.

  2. Switching of chemoattractant receptors programs development and morphogenesis in Dictyostelium: receptor subtypes activate common responses at different agonist concentrations.


    Kim, J Y; Borleis, J A; Devreotes, P N


    One of the common functional features among G-protein coupled receptors is the occurrence of multiple subtypes involved in similar signal transduction events. The cAMP chemoattractant receptor family of Dictyostelium discoideum is composed of four receptors (cAR1-cAR4), which are expressed sequentially throughout the developmental transition from a unicellular to a multicellular organism. The receptors differ in affinity for cAMP and in the sequences of their C-terminal domains. In this study, we constitutively expressed cAR1, cAR2, and cAR3 as well as a series of chimeric and mutant receptors and assessed the capacity of each to mediate chemotaxis, activation of adenylyl cyclase and actin polymerization, and rescue the developmental defect of car1-/car3- cells. We found that various receptors and mutants sense different concentration ranges of cAMP but all can mediate identical responses during the aggregation stage of development. The responses displayed very similar kinetics, suggesting no major differences in regulatory properties attributable to the C-terminal domains. We speculate that switching of receptor subtypes during development enables the organism to respond to the changing concentrations of the chemoattractant and thereby program morphogenesis appropriately. PMID:9578623

  3. Analysis of the Microprocessor in Dictyostelium: The Role of RbdB, a dsRNA Binding Protein.


    Meier, Doreen; Kruse, Janis; Buttlar, Jann; Friedrich, Michael; Zenk, Fides; Boesler, Benjamin; Förstner, Konrad U; Hammann, Christian; Nellen, Wolfgang


    We identified the dsRNA binding protein RbdB as an essential component in miRNA processing in Dictyostelium discoideum. RbdB is a nuclear protein that accumulates, together with Dicer B, in nucleolar foci reminiscent of plant dicing bodies. Disruption of rbdB results in loss of miRNAs and accumulation of primary miRNAs. The phenotype can be rescued by ectopic expression of RbdB thus allowing for a detailed analysis of domain function. The lack of cytoplasmic dsRBD proteins involved in miRNA processing, suggests that both processing steps take place in the nucleus thus resembling the plant pathway. However, we also find features e.g. in the domain structure of Dicer which suggest similarities to animals. Reduction of miRNAs in the rbdB- strain and their increase in the Argonaute A knock out allowed the definition of new miRNAs one of which appears to belong to a new non-canonical class. PMID:27272207

  4. Analysis of the Microprocessor in Dictyostelium: The Role of RbdB, a dsRNA Binding Protein

    PubMed Central

    Buttlar, Jann; Friedrich, Michael; Zenk, Fides; Boesler, Benjamin; Hammann, Christian; Nellen, Wolfgang


    We identified the dsRNA binding protein RbdB as an essential component in miRNA processing in Dictyostelium discoideum. RbdB is a nuclear protein that accumulates, together with Dicer B, in nucleolar foci reminiscent of plant dicing bodies. Disruption of rbdB results in loss of miRNAs and accumulation of primary miRNAs. The phenotype can be rescued by ectopic expression of RbdB thus allowing for a detailed analysis of domain function. The lack of cytoplasmic dsRBD proteins involved in miRNA processing, suggests that both processing steps take place in the nucleus thus resembling the plant pathway. However, we also find features e.g. in the domain structure of Dicer which suggest similarities to animals. Reduction of miRNAs in the rbdB- strain and their increase in the Argonaute A knock out allowed the definition of new miRNAs one of which appears to belong to a new non-canonical class. PMID:27272207

  5. Dictyostelium acetoacetyl-CoA thiolase is a dual-localizing enzyme that localizes to peroxisomes, mitochondria and the cytosol.


    Isezaki, Nana; Sekiba, Atsushi; Itagaki, Shoko; Nagayama, Koki; Ochiai, Hiroshi; Ohmachi, Tetsuo


    Acetoacetyl-CoA thiolase is an enzyme that catalyses both the CoA-dependent thiolytic cleavage of acetoacetyl-CoA and the reverse condensation reaction. In Dictyostelium discoideum, acetoacetyl-CoA thiolase (DdAcat) is encoded by a single acat gene. The aim of this study was to assess the localization of DdAcat and to determine the mechanism of its cellular localization. Subcellular localization of DdAcat was investigated using a fusion protein with GFP, and it was found to be localized to peroxisomes. The findings showed that the targeting signal of DdAcat to peroxisomes is a unique nonapeptide sequence (15RMYTTAKNL23) similar to the conserved peroxisomal targeting signal-2 (PTS-2). Cell fractionation experiments revealed that DdAcat also exists in the cytosol. Distribution to the cytosol was caused by translational initiation from the second Met codon at position 16. The first 18 N-terminal residues also exhibited function as a mitochondrial targeting signal (MTS). These results indicate that DdAcat is a dual-localizing enzyme that localizes to peroxisomes, mitochondria and the cytosol using both PTS-2 and MTS signals, which overlap each other near the N-terminus, and the alternative utilization of start codons.

  6. Kin Discrimination in Dictyostelium Social Amoebae.


    Strassmann, Joan E


    Evolved cooperation is stable only when the benefactor is compensated, either directly or through its relatives. Social amoebae cooperate by forming a mobile multicellular body in which, about 20% of participants ultimately die to form a stalk. This benefits the remaining individuals that become hardy spores at the top of the stalk, together making up the fruiting body. In studied species with stalked migration, P. violaceum, D. purpureum, and D. giganteum, sorting based on clone identity occurs in laboratory mixes, maintaining high relatedness within the fruiting bodies. D. discoideum has unstalked migration, where cell fate is not fixed until the slug forms a fruiting body. Laboratory mixes show some degree of both spatial and genotype-based sorting, yet most laboratory fruiting bodies remain chimeric. However, wild fruiting bodies are made up mostly of clonemates. A genetic mechanism for sorting is likely to be cell adhesion genes tgrB1 and tgrC1, which bind to each other. They are highly variable, as expected for a kin discrimination gene. It is a puzzle that these genes do not cause stronger discrimination between mixed wild clones, but laboratory conditions or strong sorting early in the social stage diminished by later slug fusion could be explanations. PMID:26909677

  7. Perturbing Streaming in Dictyostelium discoidium Aggregation

    NASA Astrophysics Data System (ADS)

    Rericha, Erin; Garcia, Gene; Parent, Carole; Losert, Wolfgang


    The ability of cells to move towards environmental cues is a critical process allowing the destruction of intruders by the immune system, the formation of the vascular system and the whole scale remodeling of tissues during embryo development. We examine the initial transition from single cell to group migration in the social amoeba Dictyostelium discoidium. Upon starvation, D. discoidium cells enter into a developmental program that triggers solitary cells to aggregate into a multicellular structure. The aggregation is mediated by the small molecule, cyclic-AMP, that cells sense, synthesize, secrete and migrate towards often in a head-to-tail fashion called a stream. Using experiment and numerical simulation, we study the sensitivity of streams to perturbations in the cyclic-AMP concentration field. We find the stability of the streams requires cells to shape the cyclic-AMP field through localized secretion and degradation. In addition, we find the streaming phenotype is sensitive to changes in the substrate properties, with slicker surfaces leading to longer more branched streams that yield large initial aggregates.

  8. Neurofibromin controls macropinocytosis and phagocytosis in Dictyostelium

    PubMed Central

    Bloomfield, Gareth; Traynor, David; Sander, Sophia P; Veltman, Douwe M; Pachebat, Justin A; Kay, Robert R


    Cells use phagocytosis and macropinocytosis to internalise bulk material, which in phagotrophic organisms supplies the nutrients necessary for growth. Wildtype Dictyostelium amoebae feed on bacteria, but for decades laboratory work has relied on axenic mutants that can also grow on liquid media. We used forward genetics to identify the causative gene underlying this phenotype. This gene encodes the RasGAP Neurofibromin (NF1). Loss of NF1 enables axenic growth by increasing fluid uptake. Mutants form outsized macropinosomes which are promoted by greater Ras and PI3K activity at sites of endocytosis. Relatedly, NF1 mutants can ingest larger-than-normal particles using phagocytosis. An NF1 reporter is recruited to nascent macropinosomes, suggesting that NF1 limits their size by locally inhibiting Ras signalling. Our results link NF1 with macropinocytosis and phagocytosis for the first time, and we propose that NF1 evolved in early phagotrophs to spatially modulate Ras activity, thereby constraining and shaping their feeding structures. DOI: PMID:25815683

  9. Biochemical and structural characterizations of two Dictyostelium cellobiohydrolases from the amoebozoa kingdom reveal a high level of conservation between distant phylogenetic trees of life


    Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad; Taylor, II, Larry E.; Borisova, Anna S.; Podkaminer, Kara K.; VanderWall, Todd A.; Himmel, Michael E.; Decker, Stephen R.; Beckham, Gregg T.; et al


    Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7ACBM and DpuCel7ACBM, which were recombinantly expressed in T. reesei. DdiCel7ACBM and DpuCel7ACBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The Ki of cellobiose was significantly higher for DdiCel7ACBM and DpuCel7ACBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less

  10. MAPKs in development: insights from Dictyostelium signaling pathways

    PubMed Central

    Hadwiger, Jeffrey A.; Nguyen, Hoai-Nghia


    Mitogen activated protein kinases (MAPKs) play important roles in the development of eukaryotic organisms through the regulation of signal transduction pathways stimulated by external signals. MAPK signaling pathways have been associated with the regulation of cell growth, differentiation, and chemotaxis, indicating MAPKs contribute to a diverse set of developmental processes. In most eukaryotes, the diversity of external signals is likely to far exceed the diversity of MAPKs, suggesting that multiple signaling pathways might share MAPKs. Do different signaling pathways converge before MAPK function or can MAPKs maintain signaling specificity through interactions with specific proteins? The genetic and biochemical analysis of MAPK pathways in simple eukaryotes such as Dictyostelium offers opportunities to investigate functional specificity of MAPKs in G protein-mediated signal transduction pathways. This review considers the regulation and specificity of MAPK function in pathways that control Dictyostelium growth and development. PMID:21666837

  11. Autophagy in Dictyostelium: genes and pathways, cell death and infection.


    Calvo-Garrido, Javier; Carilla-Latorre, Sergio; Kubohara, Yuzuru; Santos-Rodrigo, Natalia; Mesquita, Ana; Soldati, Thierry; Golstein, Pierre; Escalante, Ricardo


    The use of simple organisms to understand the molecular and cellular function of complex processes is instrumental for the rapid development of biomedical research. A remarkable example has been the discovery in S. cerevisiae of a group of proteins involved in the pathways of autophagy. Orthologues of these proteins have been identified in humans and experimental model organisms. Interestingly, some mammalian autophagy proteins do not seem to have homologues in yeast but are present in Dictyostelium, a social amoeba with two distinctive life phases, a unicellular stage in nutrient-rich conditions that differentiates upon starvation into a multicellular stage that depends on autophagy. This review focuses on the identification and annotation of the putative Dictyostelium autophagy genes and on the role of autophagy in development, cell death and infection by bacterial pathogens. PMID:20603609

  12. Derivatives of Dictyostelium differentiation-inducing factors inhibit lysophosphatidic acid-stimulated migration of murine osteosarcoma LM8 cells.


    Kubohara, Yuzuru; Komachi, Mayumi; Homma, Yoshimi; Kikuchi, Haruhisa; Oshima, Yoshiteru


    Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), -2, and -3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5-20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC50 values of 5.5, 4.6, and 4.2 μM, respectively. On the other hand, the IC50 values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. PMID:26056940

  13. A mutation in repB, the dictyostelium homolog of the human xeroderma pigmentosum B gene, has increased sensitivity to UV-light but normal morphogenesis.


    Lee, S K; Yu, S L; Alexander, H; Alexander, S


    Nucleotide excision repair (NER) is an important cellular defense mechanism which protects the integrity of the genome by removing DNA damage caused by UV-light or chemical agents. In humans, defects in the NER pathway result in the disease xeroderma pigmentosum (XP) which is characterized by increased UV-sensitivity, with increased propensity for skin cancer, and an array of developmental abnormalities. Some XP patients exhibit, in addition, symptoms of Cockayne's syndrome (CS) and trichothiodystrophy (TTD), which are characterized by increased UV-sensitivity, without increased cancer incidence, and an array of developmental abnormalities. Some NER genes, including the DNA helicases XPB and XPD, have been shown to function in transcription as well as repair, by virtue of being an integral part of the transcription initiation factor TFIIH. This dual function may account for the above-mentioned wide pleiotropy of phenotypes associated with defects in NER genes, and may explain why some XP patients exhibit developmental abnormalities in addition to XP symptoms. To date, only five XPB patients with three different mutations in the XPB gene have been reported. One of these mutations is a C to A transversion at the splice site at the beginning of the last exon, which resulted in a frameshift throughout the last exon. This patient shows combined clinical symptoms of XP and CS. The recent cloning of the repB gene, the Dictyostelium discoideum homolog of XPB, allowed us to generate a similar C-terminal mutation in the Dictyostelium, in order to test whether the defect in this NER gene has an effect on growth or development. To this end, we have constructed a C-terminal deletion repB mutant in Dictyostelium. To avoid the possibility that a null mutant would be lethal, we used direct homologous recombination to create a 46 amino acid C-terminal deletion mutant. Indeed, we were unable to obtain mutants with a longer 95 amino acid deletion. The repB delta C46 mutants showed an

  14. Two Dictyostelium orthologs of the prokaryotic cell division protein FtsZ localize to mitochondria and are required for the maintenance of normal mitochondrial morphology.


    Gilson, Paul R; Yu, Xuan-Chuan; Hereld, Dale; Barth, Christian; Savage, Amelia; Kiefel, Ben R; Lay, Sui; Fisher, Paul R; Margolin, William; Beech, Peter L


    In bacteria, the protein FtsZ is the principal component of a ring that constricts the cell at division. Though all mitochondria probably arose through a single, ancient bacterial endosymbiosis, the mitochondria of only certain protists appear to have retained FtsZ, and the protein is absent from the mitochondria of fungi, animals, and higher plants. We have investigated the role that FtsZ plays in mitochondrial division in the genetically tractable protist Dictyostelium discoideum, which has two nuclearly encoded FtsZs, FszA and FszB, that are targeted to the inside of mitochondria. In most wild-type amoebae, the mitochondria are spherical or rod-shaped, but in fsz-null mutants they become elongated into tubules, indicating that a decrease in mitochondrial division has occurred. In support of this role in organelle division, antibodies to FszA and FszA-green fluorescent protein (GFP) show belts and puncta at multiple places along the mitochondria, which may define future or recent sites of division. FszB-GFP, in contrast, locates to an electron-dense, submitochondrial body usually located at one end of the organelle, but how it functions during division is unclear. This is the first demonstration of two differentially localized FtsZs within the one organelle, and it points to a divergence in the roles of these two proteins.

  15. Dictyostelium uses ether-linked inositol phospholipids for intracellular signalling

    PubMed Central

    Clark, Jonathan; Kay, Robert R; Kielkowska, Anna; Niewczas, Izabella; Fets, Louise; Oxley, David; Stephens, Len R; Hawkins, Phillip T


    Inositol phospholipids are critical regulators of membrane biology throughout eukaryotes. The general principle by which they perform these roles is conserved across species and involves binding of differentially phosphorylated inositol head groups to specific protein domains. This interaction serves to both recruit and regulate the activity of several different classes of protein which act on membrane surfaces. In mammalian cells, these phosphorylated inositol head groups are predominantly borne by a C38:4 diacylglycerol backbone. We show here that the inositol phospholipids of Dictyostelium are different, being highly enriched in an unusual C34:1e lipid backbone, 1-hexadecyl-2-(11Z-octadecenoyl)-sn-glycero-3-phospho-(1'-myo-inositol), in which the sn-1 position contains an ether-linked C16:0 chain; they are thus plasmanylinositols. These plasmanylinositols respond acutely to stimulation of cells with chemoattractants, and their levels are regulated by PIPKs, PI3Ks and PTEN. In mammals and now in Dictyostelium, the hydrocarbon chains of inositol phospholipids are a highly selected subset of those available to other phospholipids, suggesting that different molecular selectors are at play in these organisms but serve a common, evolutionarily conserved purpose. PMID:25180230

  16. Implications of expansin-like 3 gene in Dictyostelium morphogenesis.


    Kawata, Takefumi; Nakamura, Yuri; Saga, Yukika; Iwade, Yumi; Ishikawa, Megumi; Sakurai, Aya; Shimada, Nao


    Dictyostelium harbors multiple expansin-like genes with generally unknown functions. Thus, we analyzed the expansin-like 3 (expL3) gene and found that its expression was reduced in a null mutant for a STATa gene encoding a transcription factor. The expression of expL3 was developmentally regulated and its transcript was spliced only in the multicellular stages. The expL3 promoter was activated in the anterior prestalk region of the parental strain and downregulated in the STATa null slug, although the expL3 promoter was still expressed in the prestalk region. The expL3 overexpressing strain exhibited delayed development and occasionally formed an aberrant structure, i.e., a fruiting body-like structure with a short stalk. The ExpL3-myc protein bound cellulose.

  17. Ras activation and symmetry breaking during Dictyostelium chemotaxis.


    Kortholt, Arjan; Keizer-Gunnink, Ineke; Kataria, Rama; Van Haastert, Peter J M


    Central to chemotaxis is the molecular mechanism by which a shallow spatial gradient of chemoattractant induces symmetry breaking of activated signaling molecules. Previously, we have used Dictyostelium mutants to investigate the minimal requirements for chemotaxis, and identified a basal signaling module providing activation of Ras and F-actin at the leading edge. Here, we show that Ras activation after application of a pipette releasing the chemoattractant cAMP has three phases, each depending on specific guanine-nucleotide-exchange factors (GEFs). Initially a transient activation of Ras occurs at the entire cell boundary, which is proportional to the local cAMP concentrations and therefore slightly stronger at the front than in the rear of the cell. This transient Ras activation is present in gα2 (gpbB)-null cells but not in gβ (gpbA)-null cells, suggesting that Gβγ mediates the initial activation of Ras. The second phase is symmetry breaking: Ras is activated only at the side of the cell closest to the pipette. Symmetry breaking absolutely requires Gα2 and Gβγ, but not the cytoskeleton or four cAMP-induced signaling pathways, those dependent on phosphatidylinositol (3,4,5)-triphosphate [PtdIns(3,4,5)P3], cGMP, TorC2 and PLA2. As cells move in the gradient, the crescent of activated Ras in the front half of the cell becomes confined to a small area at the utmost front of the cell. Confinement of Ras activation leads to cell polarization, and depends on cGMP formation, myosin and F-actin. The experiments show that activation, symmetry breaking and confinement of Ras during Dictyostelium chemotaxis uses different G-protein subunits and a multitude of Ras GEFs and GTPase-activating proteins (GAPs).

  18. Heteromeric p97/p97R155C complexes induce dominant negative changes in wild-type and autophagy 9-deficient Dictyostelium strains.


    Arhzaouy, Khalid; Strucksberg, Karl-Heinz; Tung, Sze Man; Tangavelou, Karthikeyan; Stumpf, Maria; Faix, Jan; Schröder, Rolf; Clemen, Christoph S; Eichinger, Ludwig


    Heterozygous mutations in the human VCP (p97) gene cause autosomal-dominant IBMPFD (inclusion body myopathy with early onset Paget's disease of bone and frontotemporal dementia), ALS14 (amyotrophic lateral sclerosis with or without frontotemporal dementia) and HSP (hereditary spastic paraplegia). Most prevalent is the R155C point mutation. We studied the function of p97 in the social amoeba Dictyostelium discoideum and have generated strains that ectopically express wild-type (p97) or mutant p97 (p97(R155C)) fused to RFP in AX2 wild-type and autophagy 9 knock-out (ATG9(KO)) cells. Native gel electrophoresis showed that both p97 and p97(R155C) assemble into hexamers. Co-immunoprecipitation studies revealed that endogenous p97 and p97(R155C)-RFP form heteromers. The mutant strains displayed changes in cell growth, phototaxis, development, proteasomal activity, ubiquitinylated proteins, and ATG8(LC3) indicating mis-regulation of multiple essential cellular processes. Additionally, immunofluorescence analysis revealed an increase of protein aggregates in ATG9(KO)/p97(R155C)-RFP and ATG9(KO) cells. They were positive for ubiquitin in both strains, however, solely immunoreactive for p97 in the ATG9(KO) mutant. A major finding is that the expression of p97(R155C)-RFP in the ATG9(KO) strain partially or fully rescued the pleiotropic phenotype. We also observed dose-dependent effects of p97 on several cellular processes. Based on findings in the single versus the double mutants we propose a novel mode of p97 interaction with the core autophagy protein ATG9 which is based on mutual inhibition. PMID:23056506

  19. c-di-GMP induction of Dictyostelium cell death requires the polyketide DIF-1.


    Song, Yu; Luciani, Marie-Françoise; Giusti, Corinne; Golstein, Pierre


    Cell death in the model organism Dictyostelium, as studied in monolayers in vitro, can be induced by the polyketide DIF-1 or by the cyclical dinucleotide c-di-GMP. c-di-GMP, a universal bacterial second messenger, can trigger innate immunity in bacterially infected animal cells and is involved in developmental cell death in Dictyostelium. We show here that c-di-GMP was not sufficient to induce cell death in Dictyostelium cell monolayers. Unexpectedly, it also required the DIF-1 polyketide. The latter could be exogenous, as revealed by a telling synergy between c-di-GMP and DIF-1. The required DIF-1 polyketide could also be endogenous, as shown by the inability of c-di-GMP to induce cell death in Dictyostelium HMX44A cells and DH1 cells upon pharmacological or genetic inhibition of DIF-1 biosynthesis. In these cases, c-di-GMP-induced cell death was rescued by complementation with exogenous DIF-1. Taken together, these results demonstrated that c-di-GMP could trigger cell death in Dictyostelium only in the presence of the DIF-1 polyketide or its metabolites. This identified another element of control to this cell death and perhaps also to c-di-GMP effects in other situations and organisms.

  20. Dictyostelium development shows a novel pattern of evolutionary conservation.


    Tian, Xiangjun; Strassmann, Joan E; Queller, David C


    von Baer's law states that early stages of animal development are the most conserved. More recent evidence supports a modified "hourglass" pattern in which an early but somewhat later stage is most conserved. Both patterns have been explained by the relative complexity of either temporal or spatial interactions; the greatest conservation and lowest evolvability occur at the time of the most complex interactions, because these cause larger effects that are harder for selection to alter. This general kind of explanation might apply universally across independent multicellular systems, as supported by the recent finding of the hourglass pattern in plants. We use RNA-seq expression data from the development of the slime mold Dictyostelium to demonstrate that it does not follow either of the two canonical patterns but instead tends to show the strongest conservation and weakest evolvability late in development. We propose that this is consistent with a version of the spatial constraints model, modified for organisms that never achieve a high degree of developmental modularity. PMID:23329689

  1. Mechano-chemical signaling maintains the rapid movement of Dictyostelium cells

    SciTech Connect

    Lombardi, M.L.; Knecht, D.A.; Lee, J.


    The survival of Dictyostelium cells depends on their ability to efficiently chemotax, either towards food or to form multicellular aggregates. Although the involvement of Ca{sup 2+} signaling during chemotaxis is well known, it is not clear how this regulates cell movement. Previously, fish epithelial keratocytes have been shown to display transient increases in intracellular calcium ([Ca{sup 2+}]{sub i}) that are mediated by stretch-activated calcium channels (SACs), which play a role in retraction of the cell body [J. Lee, A. Ishihara, G. Oxford, B. Johnson, and K. Jacobson, Regulation of cell movement is mediated by stretch-activated calcium channels. Nature, 1999. 400(6742): p. 382-6.]. To investigate the involvement of SACs in Dictyostelium movement we performed high resolution calcium imaging in wild-type (NC4A2) Dictyostelium cells to detect changes in [Ca{sup 2+}]{sub i}. We observed small, brief, Ca{sup 2+} transients in randomly moving wild-type cells that were dependent on both intracellular and extracellular sources of calcium. Treatment of cells with the SAC blocker gadolinium (Gd{sup 3+}) inhibited transients and decreased cell speed, consistent with the involvement of SACs in regulating Dictyostelium motility. Additional support for SAC activity was given by the increase in frequency of Ca{sup 2+} transients when Dictyostelium cells were moving on a more adhesive substratum or when they were mechanically stretched. We conclude that mechano-chemical signaling via SACs plays a major role in maintaining the rapid movement of Dictyostelium cells.

  2. Employing Dictyostelium as an Advantageous 3Rs Model for Pharmacogenetic Research.


    Otto, Grant P; Cocorocchio, Marco; Munoz, Laura; Tyson, Richard A; Bretschneider, Till; Williams, Robin S B


    Increasing concern regarding the use of animals in research has triggered a growing need for non-animal research models in a range of fields. The development of 3Rs (replacement, refinement, and reduction) approaches in research, to reduce the reliance on the use of animal tissue and whole-animal experiments, has recently included the use of Dictyostelium. In addition to not feeling pain and thus being relatively free of ethical constraints, Dictyostelium provides a range of distinct methodological advantages for researchers that has led to a number of breakthroughs. These methodologies include using cell behavior (cell movement and shape) as a rapid indicator of sensitivity to poorly characterized medicines, natural products, and other chemicals to help understand the molecular mechanism of action of compounds. Here, we outline a general approach to employing Dictyostelium as a 3Rs research model, using cell behavior as a readout to better understand how compounds, such as the active ingredient in chilli peppers, capsaicin, function at a cellular level. This chapter helps scientists unfamiliar with Dictyostelium to rapidly employ it as an advantageous model system for research, to reduce the use of animals in research, and to make paradigm shift advances in our understanding of biological chemistry. PMID:27271898

  3. Characterization of a 1,4-{beta}-D-glucan synthase from Dictyostelium. Final technical report

    SciTech Connect

    Blanton, R.L.


    The study of cellulose biosynthesis has a long history of frustrations, false leads, and setbacks. The authors have been able to proceed further than others who have studied eukaryotic cellulose synthesis because of the high level of enzyme activity in crude membrane preparations from developing Dictyostelium cells. This has made possible experiments to study factors that influence the activity, to determine cellular localization, and to study the development regulation of the enzyme activity. In higher plants, the challenge is still to obtain highly active membrane preparations. However, they have not been able to move beyond the level of crude membranes. The high starting activity of Dictyostelium membranes gave hope that cellulose synthase activity could be purified, allowing the identification of the polypeptides involved in cellulose synthesis. The first step in the purification of a membrane-associated activity is the solubilization of the activity; this they have not yet been able to do. They have applied some of their methods developed in the study of the Dictyostelium glucan synthase to preparation of plant membranes to see if they can obtain any in vitro activity. For instance, the disruption medium, disruption methods, and assay conditions used in Dictyostelium were used to prepare plant membranes, but without obtaining significant levels of enzyme activity.

  4. Inositol Trisphosphate and Diacylglycerol Can Differentially Modulate Gene Expression in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Ginsburg, Gail; Kimmel, Alan R.


    We have previously shown that several genes expressed during Dictyostelium development could be induced in shaking culture by exogenous cAMP, even though the accumulation of intracellular cAMP was inhibited. The use of selected cAMP analogs indicated that the exogenous cAMP functioned by activating the cell surface cAMP receptor and not by interacting with the regulatory subunit of the intracellular cAMP-dependent protein kinase. Although some genes in Dictyostelium appear to be regulated by intracellular cAMP, these data suggest that this is not the case for all genes regulated by cAMP. Intracellular second messengers other than cAMP may, therefore, promote the expression of these other genes. Here, we have examined inositol trisphosphate and diacylglycerol as candidates for such mediators of signal transduction. We have studied three genes that exhibit disparate modes of temporal and spatial expression during development of Dictyostelium. In shaking cultures, maximal levels of expression of each are dependent on the accumulation of or exposure to extracellular cAMP. We show that the addition of inositol trisphosphate and/or diacylglycerol to cells in shaking culture has distinct effects on the expression of each gene and, under specific conditions, can bypass the requirement for extracellular cAMP. These data suggest that extracellular cAMP interacting with its cell surface receptor may promote synthesis of inositol trisphosphate and diacylglycerol to regulate gene expression and aspects of differentiation in Dictyostelium.

  5. Alignment of (dA).(dT) homopolymer tracts in gene flanking sequences suggests nucleosomal periodicity in D. discoideum DNA.


    Marx, K A; Hess, S T; Blake, R D


    It has been shown that the frequency versus size distribution of A and T overlapping and non-overlapping homopolymer tracts of N > 5 in D. discoideum gene flanking and intron regions are significantly greater than in coding regions(1). In the present report, we demonstrate, that a spatial periodicity exists in long A and T tracts (N > 10) in long flanking sequences by scored alignments of those tracts (N > 10) with the nucleosomal repeat. A tract spacing was found at 185-190 bp that corresponds to a maximum alignment score. This is exactly the average spacing of D. discoideum nucleosomes determined experimentally. A majority of A and T tracts in flanking sequences are often spaced by short DNA stretches and the total length of adjacent A and T tracts plus the interrupting short DNA stretch corresponds closely to the average experimentally measured nucleosomal linker DNA size in D. discoideum-42 bp. These data suggest a model which has A and T runs of N > 10 bp in flanking DNA of D. discoideum organized in a regular phase with nonhomopolymer sequences along the DNA. This model has functional implications for A and T tracts, suggesting that they are found in nucleosomal linker DNA regions of chromatin during some necessary portion(s) of the life of the cell.

  6. Novel Dictyostelium unconventional myosin, MyoM, has a putative RhoGEF domain.


    Oishi, N; Adachi, H; Sutoh, K


    We have cloned a novel unconventional myosin gene myoM in Dictyostelium. Phylogenetic analysis of the motor domain indicated that MyoM does not belong to any known subclass of the myosin superfamily. Following the motor domain, two calmodulin-binding IQ motifs, a putative coiled-coil region, and a Pro, Ser and Thr-rich domain, lies a combination of dbl homology and pleckstrin homology domains. These are conserved in Rho GDP/GTP exchange factors (RhoGEFs). We have identified for the first time the RhoGEF domain in the myosin sequences. The growth and terminal developmental phenotype of Dictyostelium cells were not affected by the myoM(-) mutation. Green fluorescent protein-tagged MyoM, however, accumulated at crown-shaped projections and membranes of phase lucent vesicles in growing cells, suggesting its possible roles in macropinocytosis. PMID:10828443

  7. Sequence and structure of the extrachromosomal palindrome encoding the ribosomal RNA genes in Dictyostelium.


    Sucgang, Richard; Chen, Guokai; Liu, Wen; Lindsay, Ryan; Lu, Jing; Muzny, Donna; Shaulsky, Gad; Loomis, William; Gibbs, Richard; Kuspa, Adam


    Ribosomal RNAs (rRNAs) are encoded by multicopy families of identical genes. In Dictyostelium and other protists, the rDNA is carried on extrachromosomal palindromic elements that comprise up to 20% of the nuclear DNA. We present the sequence of the 88 kb Dictyostelium rDNA element, noting that the rRNA genes are likely to be the only transcribed regions. By interrogating a library of ordered YAC clones, we provide evidence for a chromosomal copy of the rDNA on chromosome 4. This locus may provide master copies for the stable transmission of the extrachromosomal elements. The extrachromosomal elements were also found to form chromosome-sized clusters of DNA within nuclei of nocodazole-treated cells arrested in mitosis. These clusters resemble true chromosomes and may allow the efficient segregation of the rDNA during mitosis. These rDNA clusters may also explain the cytological observations of a seventh chromosome in this organism.

  8. Cell-cell signaling and adhesion in phagocytosis and early development of Dictyostelium.


    Bracco, E; Pergolizzi, B; Peracino, B; Ponte, E; Balbo, A; Mai, A; Ceccarelli, A; Bozzaro, S


    Cell-cell signaling and adhesion regulate transition from the unicellular to the multicellular stage of development in the cellular slime mold Dictyostelium. Essential gene networks involved in these processes have been identified and their interplay dissected. Heterotrimeric G protein-linked signal transduction plays a key role in regulating expression of genes mediating chemotaxis or cell adhesion, as well as coordinating actin-based cell motility during phagocytosis and chemotaxis. Two classes of cell adhesion molecules, one cadherin-like and the second belonging to the IgG superfamily, contribute to the strength of adhesion in Dictyostelium aggregates. The developmental role of genes involved in motility and adhesion, and their degree of redundancy, have been re-assessed by using novel developmental assay conditions which are closer to development in nature. PMID:11061438

  9. 4D traction force microscopy reveals asymmetric cortical forces in migrating Dictyostelium cells.


    Delanoë-Ayari, H; Rieu, J P; Sano, M


    We present a 4D (x; y; z; t) force map of Dictyostelium cells crawling on a soft gel substrate. Vertical forces are of the same order as the tangential ones. The cells pull the substratum upward along the cell, medium, or substratum contact line and push it downward under the cell except for the pseudopods. We demonstrate quantitatively that the variations in the asymmetry in cortical forces correlates with the variations of the direction and speed of cell displacement. PMID:21231559

  10. Control of cell differentiation by mitochondria, typically evidenced in dictyostelium development.


    Maeda, Yasuo; Chida, Junji


    In eukaryotic cells, mitochondria are self-reproducing organelles with their own DNA and they play a central role in adenosine triphosphate (ATP) synthesis by respiration. Increasing evidence indicates that mitochondria also have critical and multiple functions in the initiation of cell differentiation, cell-type determination, cell movement, and pattern formation. This has been most strikingly realized in development of the cellular slime mold Dictyostelium. For example, the expression of the mitochondrial ribosomal protein S4 (mt-rps4) gene is required for the initial differentiation. The Dictyostelium homologue (Dd-TRAP1) of TRAP-1 (tumor necrosis receptor-associated protein 1), a mitochondrial molecular chaperone belonging to the Hsp90 family, allows the prompt transition of cells from growth to differentiation through a novel prestarvation factor (PSF-3) in growth medium. Moreover, a cell-type-specific organelle named a prespore-specific vacuole (PSV) is constructed by mitochondrial transformation with the help of the Golgi complex. Mitochondria are also closely involved in a variety of cellular activities including CN-resistant respiration and apoptosis. These mitochondrial functions are reviewed in this article, with special emphasis on the regulation of Dictyostelium development. PMID:24970198

  11. Identification and characterization of DdPDE3, a cGMP-selective phosphodiesterase from Dictyostelium.

    PubMed Central

    Kuwayama, H; Snippe, H; Derks, M; Roelofs, J; Van Haastert, P J


    In Dictyostelium cAMP and cGMP have important functions as first and second messengers in chemotaxis and development. Two cyclic-nucleotide phosphodiesterases (DdPDE 1 and 2) have been identified previously, an extracellular dual-specificity enzyme and an intracellular cAMP-specific enzyme (encoded by the psdA and regA genes respectively). Biochemical data suggest the presence of at least one cGMP-specific phosphodiesterase (PDE) that is activated by cGMP. Using bioinformatics we identified a partial sequence in the Dictyostelium expressed sequence tag database that shows a high degree of amino acid sequence identity with mammalian PDE catalytic domains (DdPDE3). The deduced amino acid sequence of a full-length DdPDE3 cDNA isolated in this study predicts a 60 kDa protein with a 300-residue C-terminal PDE catalytic domain, which is preceded by approx. 200 residues rich in asparagine and glutamine residues. Expression of the DdPDE3 catalytic domain in Escherichia coli shows that the enzyme has Michaelis-Menten kinetics and a higher affinity for cGMP (K(m)=0.22 microM) than for cAMP (K(m)=145 microM); cGMP does not stimulate enzyme activity. The enzyme requires bivalent cations for activity; Mn(2+) is preferred to Mg(2+), whereas Ca(2+) yields no activity. DdPDE3 is inhibited by 3-isobutyl-1-methylxanthine with an IC(50) of approx. 60 microM. Overexpression of the DdPDE3 catalytic domain in Dictyostelium confirms these kinetic properties without indications of its activation by cGMP. The properties of DdPDE3 resemble those of mammalian PDE9, which also shows the highest sequence similarity within the catalytic domains. DdPDE3 is the first cGMP-selective PDE identified in lower eukaryotes. PMID:11171061

  12. Datasets from a vapor diffusion mineral precipitation protocol for Dictyostelium stalks.


    Eder, Magdalena; Muth, Christina; Weiss, Ingrid M


    Datasets from a slow carbonate vapor diffusion and mineral precipitation protocol for Dictyostelium ECM and cellulose stalks show examples for composite materials obtained by an in vitro approach, which differs substantially from the in vivo approach reported in The Journal of Structural Biology, doi: 10.1016/j.jsb.2016.03.015 [1]. Methods for obtaining the datasets include bright field transmitted light microscopy, fluorescence microscopy, LC-PolScope birefringence microscopy, variable pressure scanning electron microscopy (VP-SEM/ESEM), and Raman imaging spectroscopy. PMID:27158657

  13. Datasets from a vapor diffusion mineral precipitation protocol for Dictyostelium stalks

    PubMed Central

    Eder, Magdalena; Muth, Christina; Weiss, Ingrid M.


    Datasets from a slow carbonate vapor diffusion and mineral precipitation protocol for Dictyostelium ECM and cellulose stalks show examples for composite materials obtained by an in vitro approach, which differs substantially from the in vivo approach reported in The Journal of Structural Biology, doi: 10.1016/j.jsb.2016.03.015 [1]. Methods for obtaining the datasets include bright field transmitted light microscopy, fluorescence microscopy, LC-PolScope birefringence microscopy, variable pressure scanning electron microscopy (VP-SEM/ESEM), and Raman imaging spectroscopy. PMID:27158657

  14. Dictyostelium nucleomorphin is a member of the BRCT-domain family of cell cycle checkpoint proteins.


    Myre, Michael A; O'Day, Danton H


    A search of the Dictyostelium genome project database ( with nucleomorphin, a protein that regulates the nuclear number, predicted it to be encoded by a larger gene containing a putative breast cancer carboxy-terminus domain (BRCT). Using RT-PCR, Northern and Western blotting we have identified a differentially expressed, 2318 bp cDNA encoding a protein isoform of Dictyostelium NumA with an apparent molecular weight of 70 kDa that we have called NumB. It contains a single amino-terminal BRCT-domain spanning residues 125-201. Starvation of shaking cultures reduces NumA expression by approximately 88+/-5.6%, whereas NumB expression increases approximately 35+/-3.5% from vegetative levels. NumC, a third isoform that is also expressed during development but not growth, remains to be characterized. These findings suggest NumB may be a member of the BRCT-domain containing cell cycle checkpoint proteins. PMID:15535983

  15. Blebbistatin and blebbistatin-inactivated myosin II inhibit myosin II-independent processes in Dictyostelium

    PubMed Central

    Shu, Shi; Liu, Xiong; Korn, Edward D.


    Blebbistatin, a cell-permeable inhibitor of class-II myosins, was developed to provide a tool for studying the biologic roles of myosin II. Consistent with this use, we find that blebbistatin inhibits three myosin II-dependent processes in Dictyostelium (growth in suspension culture, capping of Con A receptors, and development to fruiting bodies) and does not inhibit growth on plates, which does not require myosin II. As expected, macropinocytosis (myosin I-dependent), contractile vacuole activity (myosin V-dependent), and phagocytosis (myosin VII-dependent), none of which requires myosin II, are not inhibited by blebbistatin in myosin II-null cells, but, unexpectedly, blebbistatin does inhibit macropinocytosis and phagocytosis by cells expressing myosin II. Expression of catalytically inactive myosin II in myosin II-null cells also inhibits macropinocytosis and phagocytosis. Both blebbistatin-inhibited myosin II and catalytically inactive myosin II form cytoplasmic aggregates, which may be why they inhibit myosin II-independent processes, but neither affects the distribution of actin filaments in vegetative cells or actin and myosin distribution in dividing or polarized cells. Blebbistatin also inhibits cell streaming and plaque expansion in myosin II-null cells. Our results are consistent with myosin II being the only Dictyostelium myosin that is inhibited by blebbistatin but also show that blebbistatin-inactivated myosin II inhibits some myosin II-independent processes and that blebbistatin inhibits other activities in the absence of myosin II. PMID:15671182

  16. Cellular Distribution and Functions of Wild-Type and Constitutively Activated Dictyostelium PakBV⃞

    PubMed Central

    de la Roche, Marc; Mahasneh, Amjad; Lee, Sheu-Fen; Rivero, Francisco; Côté, Graham P.


    Dictyostelium PakB, previously termed myosin I heavy chain kinase, is a member of the p21-activated kinase (PAK) family. Two-hybrid assays showed that PakB interacts with Dictyostelium Rac1a/b/c, RacA (a RhoBTB protein), RacB, RacC, and RacF1. Wild-type PakB displayed a cytosolic distribution with a modest enrichment at the leading edge of migrating cells and at macropinocytic and phagocytic cups, sites consistent with a role in activating myosin I. PakB fused at the N terminus to green fluorescent protein was proteolyzed in cells, resulting in removal of the catalytic domain. C-terminal truncated PakB and activated PakB lacking the p21-binding domain strongly localized to the cell cortex, to macropinocytic cups, to the posterior of migrating cells, and to the cleavage furrow of dividing cells. These data indicate that in its open, active state, the N terminus of PakB forms a tight association with cortical actin filaments. PakB-null cells displayed no significant behavioral defects, but cells expressing activated PakB were unable to complete cytokinesis when grown in suspension and exhibited increased rates of phagocytosis and pinocytosis. PMID:15509655

  17. Overexpression of cytoplasmic dynein's globular head causes a collapse of the interphase microtubule network in Dictyostelium.


    Koonce, M P; Samsó, M


    Cytoplasmic dynein is a minus-end directed microtubule-based motor. Using a molecular genetic approach, we have begun to dissect structure-function relationships of dynein in the cellular slime mold Dictyostelium. Expression of a carboxy-terminal 380-kDa fragment of the heavy chain produces a protein that approximates the size and shape of the globular, mechanochemical head of dynein. This polypeptide cosediments with microtubules in an ATP-sensitive fashion and undergoes a UV-vanadate cleavage reaction. The deleted amino-terminal region appears to participate in dimerization of the native protein and in binding the intermediate and light chains. Overexpression of the 380-kDa carboxy-terminal construct in Dictyostelium produces a distinct phenotype in which the interphase radial microtubule array appears collapsed. In many cells, the microtubules form loose bundles that are whorled around the nucleus. Similar expression of a central 107-kDa fragment of the heavy chain does not produce this result. The data presented here suggest that dynein may participate in maintaining the spatial pattern of the interphase microtubule network. PMID:8816999

  18. The polyketide MPBD initiates the SDF-1 signaling cascade that coordinates terminal differentiation in Dictyostelium.


    Anjard, Christophe; Su, Yongxuan; Loomis, William F


    Dictyostelium uses a wide array of chemical signals to coordinate differentiation as it switches from a unicellular to a multicellular organism. MPBD, the product of the polyketide synthase encoded by stlA, regulates stalk and spore differentiation by rapidly stimulating the release of the phosphopeptide SDF-1. By analyzing specific mutants affected in MPBD or SDF-1 production, we delineated a signal transduction cascade through the membrane receptor CrlA coupled to Gα1, leading to the inhibition of GskA so that the precursor of SDF-1 is released. It is then processed by the extracellular protease of TagB on prestalk cells. SDF-1 apparently acts through the adenylyl cyclase ACG to activate the cyclic AMP (cAMP)-dependent protein kinase A (PKA) and trigger the production of more SDF-1. This signaling cascade shows similarities to the SDF-2 signaling pathway, which acts later to induce rapid spore encapsulation. PMID:21602484

  19. Positive feedback may cause the biphasic response observed in the chemoattractant-induced response of Dictyostelium cells*

    PubMed Central

    Yang, Liu; Iglesias, Pablo A.


    After stimulation by chemoattractant, Dictyostelium cells exhibit a rapid response. The concentrations of several intracellular proteins rise rapidly reaching their maximum levels approximately 5–10 seconds, after which they return to prestimulus levels. This response, which is found in many other chemotaxing cells, is an example of a step disturbance rejection, a process known to biologists as perfect adaptation. Unlike other cells, however, the initial first peak observed in the chemoattractant-induced response of Dictyostelium cells is then followed by a slower, smaller phase peaking approximately one to two minutes after the stimulus. Until recently, the nature of this biphasic response has been poorly understood. Moreover, the origin for the second phase is unknown. In this paper we conjecture the existence of a feedback path between the response and stimulus. Using a mathematical model of the chemoattractant-induced response in cells, and standard tools from control engineering, we show that positive feedback may elicit this second peak. PMID:17401451

  20. A cytoplasmic prolyl hydroxylation and glycosylation pathway modifies Skp1 and regulates O2-dependent development in Dictyostelium.


    West, Christopher M; Wang, Zhuo A; van der Wel, Hanke


    The soil amoeba Dictyostelium is an obligate aerobe that monitors O(2) for informational purposes in addition to utilizing it for oxidative metabolism. Whereas low O(2) suffices for proliferation, a higher level is required for slugs to culminate into fruiting bodies, and O(2) influences slug polarity, slug migration, and cell-type proportioning. Dictyostelium expresses a cytoplasmic prolyl 4-hydroxylase (P4H1) known to mediate O(2)-sensing in animals, but lacks HIFalpha, a major hydroxylation target whose accumulation directly induces animal hypoxia-dependent transcriptional changes. The O(2)-requirement for culmination is increased by P4H1-gene disruption and reduced by P4H1 overexpression. A target of Dictyostelium P4H1 is Skp1, a subunit of the SCF-class of E3-ubiquitin ligases related to the VBC-class that mediates hydroxylation-dependent degradation of animal HIFalpha. Skp1 is a target of a novel cytoplasmic O-glycosylation pathway that modifies HyPro143 with a pentasaccharide, and glycosyltransferase mutants reveal that glycosylation intermediates have antagonistic effects toward P4H1 in O(2)-signaling. Current evidence indicates that Skp1 is the only glycosylation target in cells, based on metabolic labeling, biochemical complementation, and enzyme specificity studies. Bioinformatics studies suggest that the HyPro-modification pathway existed in the ancestral eukaryotic lineage and was retained in selected modern day unicellular organisms whose life cycles experience varying degrees of hypoxia. It is proposed that, in Dictyostelium and other protists including the agent for human toxoplasmosis Toxoplasma gondii, prolyl hydroxylation and glycosylation mediate O(2)-signaling in hierarchical fashion via Skp1 to control the proteome, directly via degradation rather than indirectly via transcription as found in animals.

  1. Characteristics of the large (dA).(dT) homopolymer tracts in D. discoideum gene flanking and intron sequences.


    Marx, K A; Hess, S T; Blake, R D


    D. discoideum, the slime mold, is one of the most AT rich eukaryotic genomes known. In this paper we examine this organism's database for overlapping N-tuples of high frequency and find A and T tracts possess among the highest frequencies in flanking sequences but not in coding sequences. We examined both overlapping and non-overlapping frequencies of the A, T, G and C homopolymer tracts of 2 < N < 6. Overlapping (dG).(dC) and (dA).(dT) tracts occur at greater frequencies than expected, based on random occurrence. Long (dA).(dT) tracts of N > 10 occur at well above expected frequencies in flanking and intron regions, while (dG).(dC) tracts above N = 5 are rarely found. Some of the implications of these findings for tract origins in slip-strand replication and for chromatin structure are discussed.

  2. Src1 is a Protein of the Inner Nuclear Membrane Interacting with the Dictyostelium Lamin NE81

    PubMed Central

    Batsios, Petros; Ren, Xiang; Baumann, Otto; Larochelle, Denis A.; Gräf, Ralph


    The nuclear envelope (NE) consists of the outer and inner nuclear membrane (INM), whereby the latter is bound to the nuclear lamina. Src1 is a Dictyostelium homologue of the helix-extension-helix family of proteins, which also includes the human lamin-binding protein MAN1. Both endogenous Src1 and GFP-Src1 are localized to the NE during the entire cell cycle. Immuno-electron microscopy and light microscopy after differential detergent treatment indicated that Src1 resides in the INM. FRAP experiments with GFP-Src1 cells suggested that at least a fraction of the protein could be stably engaged in forming the nuclear lamina together with the Dictyostelium lamin NE81. Both a BioID proximity assay and mis-localization of soluble, truncated mRFP-Src1 at cytosolic clusters consisting of an intentionally mis-localized mutant of GFP-NE81 confirmed an interaction of Src1 and NE81. Expression GFP-Src11–646, a fragment C-terminally truncated after the first transmembrane domain, disrupted interaction of nuclear membranes with the nuclear lamina, as cells formed protrusions of the NE that were dependent on cytoskeletal pulling forces. Protrusions were dependent on intact microtubules but not actin filaments. Our results indicate that Src1 is required for integrity of the NE and highlight Dictyostelium as a promising model for the evolution of nuclear architecture. PMID:26999214

  3. Src1 is a Protein of the Inner Nuclear Membrane Interacting with the Dictyostelium Lamin NE81.


    Batsios, Petros; Ren, Xiang; Baumann, Otto; Larochelle, Denis A; Gräf, Ralph


    The nuclear envelope (NE) consists of the outer and inner nuclear membrane (INM), whereby the latter is bound to the nuclear lamina. Src1 is a Dictyostelium homologue of the helix-extension-helix family of proteins, which also includes the human lamin-binding protein MAN1. Both endogenous Src1 and GFP-Src1 are localized to the NE during the entire cell cycle. Immuno-electron microscopy and light microscopy after differential detergent treatment indicated that Src1 resides in the INM. FRAP experiments with GFP-Src1 cells suggested that at least a fraction of the protein could be stably engaged in forming the nuclear lamina together with the Dictyostelium lamin NE81. Both a BioID proximity assay and mis-localization of soluble, truncated mRFP-Src1 at cytosolic clusters consisting of an intentionally mis-localized mutant of GFP-NE81 confirmed an interaction of Src1 and NE81. Expression GFP-Src1(1-646), a fragment C-terminally truncated after the first transmembrane domain, disrupted interaction of nuclear membranes with the nuclear lamina, as cells formed protrusions of the NE that were dependent on cytoskeletal pulling forces. Protrusions were dependent on intact microtubules but not actin filaments. Our results indicate that Src1 is required for integrity of the NE and highlight Dictyostelium as a promising model for the evolution of nuclear architecture.

  4. Two Dictyostelium tyrosine kinase–like kinases function in parallel, stress-induced STAT activation pathways

    PubMed Central

    Araki, Tsuyoshi; Vu, Linh Hai; Sasaki, Norimitsu; Kawata, Takefumi; Eichinger, Ludwig; Williams, Jeffrey G.


    When Dictyostelium cells are hyperosmotically stressed, STATc is activated by tyrosine phosphorylation. Unusually, activation is regulated by serine phosphorylation and consequent inhibition of a tyrosine phosphatase: PTP3. The identity of the cognate tyrosine kinase is unknown, and we show that two tyrosine kinase–like (TKL) enzymes, Pyk2 and Pyk3, share this function; thus, for stress-induced STATc activation, single null mutants are only marginally impaired, but the double mutant is nonactivatable. When cells are stressed, Pyk2 and Pyk3 undergo increased autocatalytic tyrosine phosphorylation. The site(s) that are generated bind the SH2 domain of STATc, and then STATc becomes the target of further kinase action. The signaling pathways that activate Pyk2 and Pyk3 are only partially overlapping, and there may be a structural basis for this difference because Pyk3 contains both a TKL domain and a pseudokinase domain. The latter functions, like the JH2 domain of metazoan JAKs, as a negative regulator of the kinase domain. The fact that two differently regulated kinases catalyze the same phosphorylation event may facilitate specific targeting because under stress, Pyk3 and Pyk2 accumulate in different parts of the cell; Pyk3 moves from the cytosol to the cortex, whereas Pyk2 accumulates in cytosolic granules that colocalize with PTP3. PMID:25143406

  5. Myosin II does not contribute to wound repair in Dictyostelium cells

    PubMed Central

    Yumura, Shigehiko; Hashima, Sayaka; Muranaka, Satsuki


    ABSTRACT Cells are always subjected to mechanical stresses, resulting in wounds of the cell membrane, but cells are able to repair and reseal their wounded membrane. Previous reports have shown that actin and myosin II accumulate around the wound and that the constriction of this purse-string closes the membrane pore. Here, we developed a microsurgical wound assay to assess wound repair in Dictyostelium cells. Fluorescent dye that had been incorporated into the cells leaked out for only 2–3 sec after wounding, and a GFP-derived, fluorescent Ca2+ sensor showed that intracellular Ca2+ transiently increased immediately after wounding. In the absence of external Ca2+, the cell failed to repair itself. During the repair process, actin accumulated at the wounded sites but myosin II did not. The wounds were repaired even in myosin II null cells to a comparable degree as the wild-type cells, suggesting that myosin II does not contribute to wound repair. Thus, the actomyosin purse-string constriction model is not a common mechanism for wound repair in eukaryotic cells, and this discrepancy may arise from the difference in cell size. PMID:25238760

  6. De novo actin polymerization is required for model Hirano body formation in Dictyostelium

    PubMed Central

    Dong, Yun; Shahid-Salles, Sonbol; Sherling, Dan; Fechheimer, Nathan; Iyer, Nathan; Wells, Lance; Fechheimer, Marcus


    ABSTRACT Hirano bodies are eosinophilic, actin-rich inclusions found in autopsied brains in numerous neurodegenerative diseases. The mechanism of Hirano body formation is unknown. Mass spectrometry analysis was performed to identify proteins from partially purified model Hirano bodies from Dictyostelium. This analysis identified proteins primarily belonging to ribosomes, proteasomes, mitochondria and cytoskeleton. Profilin, Arp/2/3 and WASH identified by mass spectrometry were found to colocalise with model Hirano bodies. Due to their roles in actin regulation, we selected these proteins for further investigation. Inhibition of the Arp2/3 complex by CK666 prevented formation of model Hirano bodies. Since Arp2/3 activation occurs via the WASH or WAVE complex, we next investigated how these proteins affect Hirano body formation. Whereas model Hirano bodies could form in WASH-deficient cells, they failed to form in cells lacking HSPC300, a member of the WAVE complex. We identified other proteins required for Hirano body formation that include profilin and VASP, an actin nucleation factor. In the case of VASP, both its G- and F-actin binding domains were required for model Hirano body formation. Collectively, our results indicate that de novo actin polymerization is required to form model Hirano bodies. PMID:27215322

  7. A Gα-Stimulated RapGEF Is a Receptor-Proximal Regulator of Dictyostelium Chemotaxis.


    Liu, Youtao; Lacal, Jesus; Veltman, Douwe M; Fusetti, Fabrizia; van Haastert, Peter J M; Firtel, Richard A; Kortholt, Arjan


    Chemotaxis, or directional movement toward extracellular chemical gradients, is an important property of cells that is mediated through G-protein-coupled receptors (GPCRs). Although many chemotaxis pathways downstream of Gβγ have been identified, few Gα effectors are known. Gα effectors are of particular importance because they allow the cell to distinguish signals downstream of distinct chemoattractant GPCRs. Here we identify GflB, a Gα2 binding partner that directly couples the Dictyostelium cyclic AMP GPCR to Rap1. GflB localizes to the leading edge and functions as a Gα-stimulated, Rap1-specific guanine nucleotide exchange factor required to balance Ras and Rap signaling. The kinetics of GflB translocation are fine-tuned by GSK-3 phosphorylation. Cells lacking GflB display impaired Rap1/Ras signaling and actin and myosin dynamics, resulting in defective chemotaxis. Our observations demonstrate that GflB is an essential upstream regulator of chemoattractant-mediated cell polarity and cytoskeletal reorganization functioning to directly link Gα activation to monomeric G-protein signaling. PMID:27237792

  8. High fidelity information processing in folic acid chemotaxis of Dictyostelium amoebae.


    Segota, Igor; Mong, Surin; Neidich, Eitan; Rachakonda, Archana; Lussenhop, Catherine J; Franck, Carl


    Living cells depend upon the detection of chemical signals for their existence. Eukaryotic cells can sense a concentration difference as low as a few per cent across their bodies. This process was previously suggested to be limited by the receptor-ligand binding fluctuations. Here, we first determine the chemotaxis response of Dictyostelium cells to static folic acid gradients and show that they can significantly exceed this sensitivity, responding to gradients as shallow as 0.2% across the cell body. Second, using a previously developed information theory framework, we compare the total information gained about the gradient (based on the cell response) to its upper limit: the information gained at the receptor-ligand binding step. We find that the model originally applied to cAMP sensing fails as demonstrated by the violation of the data processing inequality, i.e. the total information exceeds the information at the receptor-ligand binding step. We propose an extended model with multiple known receptor types and with cells allowed to perform several independent measurements of receptor occupancy. This does not violate the data processing inequality and implies the receptor-ligand binding noise dominates both for low- and high-chemoattractant concentrations. We also speculate that the interplay between exploration and exploitation is used as a strategy for accurate sensing of otherwise unmeasurable levels of a chemoattractant. PMID:24026470

  9. Origin and function of the stalk-cell vacuole in Dictyostelium.


    Uchikawa, Toru; Yamamoto, Akitsugu; Inouye, Kei


    Large vacuoles are characteristic of plant and fungal cells, and their origin has long attracted interest. The cellular slime mould provides a unique opportunity to study the de novo formation of vacuoles because, in its life cycle, a subset of the highly motile animal-like cells (prestalk cells) rapidly develops a single large vacuole and cellulosic cell wall to become plant-like cells (stalk cells). Here we describe the origin and process of vacuole formation using live-imaging of Dictyostelium cells expressing GFP-tagged ammonium transporter A (AmtA-GFP), which was found to reside on the membrane of stalk-cell vacuoles. We show that stalk-cell vacuoles originate from acidic vesicles and autophagosomes, which fuse to form autolysosomes. Their repeated fusion and expansion accompanied by concomitant cell wall formation enable the stalk cells to rapidly develop turgor pressure necessary to make the rigid stalk to hold the spores aloft. Contractile vacuoles, which are rich in H(+)-ATPase as in plant vacuoles, remained separate from these vacuoles. We further argue that AmtA may play an important role in the control of stalk-cell differentiation by modulating the pH of autolysosomes.

  10. Intracellular role of adenylyl cyclase in regulation of lateral pseudopod formation during Dictyostelium chemotaxis.


    Stepanovic, Vesna; Wessels, Deborah; Daniels, Karla; Loomis, William F; Soll, David R


    Cyclic AMP (cAMP) functions as the extracellular chemoattractant in the aggregation phase of Dictyostelium development. There is some question, however, concerning what role, if any, it plays intracellularly in motility and chemotaxis. To test for such a role, the behavior of null mutants of acaA, the adenylyl cyclase gene that encodes the enzyme responsible for cAMP synthesis during aggregation, was analyzed in buffer and in response to experimentally generated spatial and temporal gradients of extracellular cAMP. acaA- cells were defective in suppressing lateral pseudopods in response to a spatial gradient of cAMP and to an increasing temporal gradient of cAMP. acaA- cells were incapable of chemotaxis in natural waves of cAMP generated by majority control cells in mixed cultures. These results indicate that intracellular cAMP and, hence, adenylyl cyclase play an intracellular role in the chemotactic response. The behavioral defects of acaA- cells were surprisingly similar to those of cells of null mutants of regA, which encodes the intracellular phosphodiesterase that hydrolyzes cAMP and, hence, functions opposite adenylyl cyclase A (ACA). This result is consistent with the hypothesis that ACA and RegA are components of a receptor-regulated intracellular circuit that controls protein kinase A activity. In this model, the suppression of lateral pseudopods in the front of a natural wave depends on a complete circuit. Hence, deletion of any component of the circuit (i.e., RegA or ACA) would result in the same chemotactic defect.

  11. GBF-dependent family genes morphologically suppress the partially active Dictyostelium STATa strain.


    Shimada, Nao; Kanno-Tanabe, Naoko; Minemura, Kakeru; Kawata, Takefumi


    Transcription factor Dd-STATa, a functional Dictyostelium homologue of metazoan signal transducers and activators of transcription proteins, is necessary for culmination during development. We have isolated more than 18 putative multicopy suppressors of Dd-STATa using genetic screening. One was hssA gene, whose expression is known to be G-box-binding-factor-dependent and which was specific to prestalk A (pstA) cells, where Dd-STATa is activated. Also, hssA mRNA was expressed in pstA cells in the Dd-STATa-null mutant. At least 40 hssA-related genes are present in the genome and constitute a multigene family. The tagged HssA protein was translated; hssA encodes an unusually high-glycine-serine-rich small protein (8.37 kDa), which has strong homology to previously reported cyclic-adenosine-monophosphate-inducible 2C and 7E proteins. Overexpression of hssA mRNA as well as frame-shifted versions of hssA RNA suppressed the phenotype of the partially active Dd-STATa strain, suggesting that translation is not necessary for suppression. Although overexpression of prespore-specific genes among the family did not suppress the parental phenotype, prestalk-specific family members did. Although overexpression of the hssA did not revert the expression of Dd-STATa target genes, and although its suppression mechanism remains unknown, morphological reversion implies functional relationships between Dd-STATa and hssA.

  12. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.


    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J


    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  13. Developmental significance of cyanide-resistant respiration under stressed conditions: experiments in Dictyostelium cells.


    Kimura, Kei; Kuwayama, Hidekazu; Amagai, Aiko; Maeda, Yasuo


    We have previously reported that benzohydroxamic acid (BHAM), a potent inhibitor of cyanide (CN)-resistant respiration mediated by alternative oxidase (AOX), induces formation of unique cell masses (i.e., stalk-like cells with a large vacuole and thick cell wall) in starved Dictyostelium cells. Unexpectedly, however, aox-null cells prepared by homologous recombination exhibited normal development under normal culture conditions on agar, indicating that BHAM-induced stalk formation is not solely attributable to inhibition of CN-resistant respiration. This also suggests that a series of pharmacological approaches in the field of life science has serious limitations. Under stress (e.g., in submerged culture), starved aox-null cells exhibited slightly delayed aggregation compared with parental Ax-2 cells; most cells remained as loose aggregates even after prolonged incubation. Also, the developmental defects of aox-null cells became more marked upon incubation for 30 min just after starvation in the presence of ≥ 1.75 mmol/L H(2)O(2). This seems to indicate that CN-resistant respiration could mitigate cellular damage through reactive oxygen species (ROS), because AOX has a potential role in reduction of ROS production. Starved aox-null cells did not develop in the presence of 5 mmol/L KCN (which completely inhibited the conventional cytochrome-mediated respiration) and remained as non-aggregated single cells on agar even after prolonged incubation. Somewhat surprisingly, however, parental Ax-2 cells were found to develop normally, forming fruiting bodies even in the presence of 10 mmol/L KCN. Taken together, these results suggest that CN-resistant respiration might compensate for the production of adenosine tri-phosphate via oxidative phosphorylation.

  14. BzpF is a CREB-like transcription factor that regulates spore maturation and stability in Dictyostelium

    PubMed Central

    Huang, Eryong; Talukder, Shaheynoor; Hughes, Timothy R.; Curk, Tomaz; Zupan, Blaz; Shaulsky, Gad; Katoh-Kurasawa, Mariko


    The cAMP response element-binding protein (CREB) is a highly conserved transcription factor that integrates signaling through the cAMP-dependent protein kinase A (PKA) in many eukaryotes. PKA plays a critical role in Dictyostelium development but no CREB homologue has been identified in this system. Here we show that Dictyostelium utilizes a CREB-like protein, BzpF, to integrate PKA signaling during late development. bzpF– mutants produce compromised spores, which are extremely unstable and germination defective. Previously, we have found that BzpF binds the canonical CRE motif in vitro. In this paper, we determined the DNA binding specificity of BzpF using protein binding microarray (PBM) and showed that the motif with the highest specificity is a CRE-like sequence. BzpF is necessary to activate the transcription of at least 15 PKA-regulated, late-developmental target genes whose promoters contain BzpF binding motifs. BzpF is sufficient to activate two of these genes. The comparison of RNA sequencing data between wild type and bzpF– mutant revealed that the mutant fails to express 205 genes, many of which encode cellulose-binding and sugar-binding proteins. We propose that BzpF is a CREB-like transcription factor that regulates spore maturation and stability in a PKA-related manner. PMID:21810415

  15. Protein tyrosine phosphatase PTP1 negatively regulates Dictyostelium STATa and is required for proper cell-type proportioning.


    Early, A; Gamper, M; Moniakis, J; Kim, E; Hunter, T; Williams, J G; Firtel, R A


    The protein tyrosine phosphatase PTP1, which mediates reversible phosphorylation on tyrosine, has been shown to play an important regulatory role during Dictyostelium development. Mutants lacking PTP1 develop more rapidly than normal, while strains that overexpress PTP1 display aberrant morphology. However, the signalling pathways involved have not been characterised. In reexamining these strains, we have found that there is an inverse correlation between levels of PTP1 activity, the extent of tyrosine phosphorylation on Dictyostelium STATa after treatment with cAMP, and the proportion of the slug population exhibiting STATa nuclear enrichment in vivo. This suggests that PTP1 acts to attenuate the tyrosine phosphorylation of STATa and downstream STATa-mediated pathways. Consistent with this, we show that when PTP1 is overexpressed, there is increased expression of a prestalk cell marker at the slug posterior, a phenocopy of STATa null slugs. In ptp1 null strains, STATa tyrosine phosphorylation and nuclear enrichment in the slug anterior is increased. There is also a change in the prestalk to prespore cell ratio. Synergy experiments suggest that this is due to a cell-autonomous defect in forming the subset of prespore cells that are located in the anterior prespore region.

  16. Dictyostelium myosin II G680V suppressors exhibit overlapping spectra of biochemical phenotypes including facilitated phosphate release.

    PubMed Central

    Wu, Y; Nejad, M; Patterson, B


    We have biochemically characterized 13 intragenic suppressors of the G680V mutation of Dictyostelium myosin II. In the absence of the G680V mutation, the suppressors result in a number of deviant behaviors, most commonly an increase in the basal (actin-independent) ATPase of the motor. This phenotype is complementary to that of the G680V mutant and supports our proposal that the latter impairs phosphate release. Different subsets of the mutants also suffer from poor ATPase enhancement by 1 mg/ml actin, failure to release from actin in the presence of ATPgammaS (or ADP and salt), and excessive release from actin in the presence of ADP. The patterns of suppressor behaviors suggest that, in general, they are facilitating P(i)-releasing state(s) of the motor, but that different individual suppressors may secondarily perturb other states or actions of the motor. PMID:10471704

  17. Differentiation inducing factor-1 (DIF-1) induces gene and protein expression of the Dictyostelium nuclear calmodulin-binding protein nucleomorphin.


    O'Day, Danton H; Poloz, Yekaterina; Myre, Michael A


    The nucleomorphin gene numA1 from Dictyostelium codes for a multi-domain, calmodulin binding protein that regulates nuclear number. To gain insight into the regulation of numA, we assessed the effects of the stalk cell differentiation inducing factor-1 (DIF-1), an extracellular signalling molecule, on the expression of numA1 RNA and protein. For comparison, the extracellular signalling molecules cAMP (mediates chemotaxis, prestalk and prespore differentiation) and ammonia (NH(3)/NH(4)(+); antagonizes DIF) were also studied. Starvation, which is a signal for multicellular development, results in a greater than 80% decrease in numA1 mRNA expression within 4 h. Treatment with ammonium chloride led to a greater than 90% inhibition of numA1 RNA expression within 2 h. In contrast, the addition of DIF-1 completely blocked the decrease in numA1 gene expression caused by starvation. Treatment of vegetative cells with cAMP led to decreases in numA1 RNA expression that were equivalent to those seen with starvation. Western blotting after various morphogen treatments showed that the maintenance of vegetative levels of numA1 RNA by DIF-1 in starved cells was reflected in significantly increased numA1 protein levels. Treatment with cAMP and/or ammonia led to decreased protein expression and each of these morphogens suppressed the stimulatory effects of DIF-1. Protein expression levels of CBP4a, a calcium-dependent binding partner of numA1, were regulated in the same manner as numA1 suggesting this potential co-regulation may be related to their functional relationship. NumA1 is the first calmodulin binding protein shown to be regulated by developmental morphogens in Dictyostelium being upregulated by DIF-1 and down-regulated by cAMP and ammonia. PMID:19000924

  18. Nucleus-associated phosphorylation of Ins(1,4,5)P3 to InsP6 in Dictyostelium.

    PubMed Central

    Van der Kaay, J; Wesseling, J; Van Haastert, P J


    Although many cells contain large amounts of InsP6, its metabolism and function is still largely unknown. In Dictyostelium lysates, the formation of InsP6 by sequential phosphorylation of inositol via Ins(3,4,6)P3 has been described [Stevens and Irvine (1990) Nature (London) 346, 580-583]; the second messenger Ins(1,4,5)P3 was excluded as a potential substrate or intermediate for InsP6 formation. However, we observed that mutant cells labelled in vivo with [3H]inositol showed altered labelling of both [3H]Ins(1,4,5)P3 and [3H]InsP6. In this report we demonstrate that Ins(1,4,5)P3 is converted into InsP6 in vitro by nucleus-associated enzymes, in addition to the previously described stepwise phosphorylation of inositol to InsP6 that occurs in the cytosol. HPLC analysis indicates that Ins(1,4,5)P3 is converted into InsP6 via sequential phosphorylation at the 3-, 6- and 2-positions. Ins[32P]P6, isolated from cells briefly labelled with [32P]Pi, was analysed using Paramecium phytase, which removes the phosphates of InsP6 in a specific sequence. The 6-position contained significantly more 32P radioactivity than the 4- or 5-positions, indicating that the 6-position is phosphorylated after the other two positions. The results from these in vivo and in vitro experiments demonstrate a metabolic route involving the phosphorylation of Ins(1,4,5)P3 via Ins(1,3,4,5)P4 and Ins(1,3,4,5,6)P5 to InsP6 in a nucleus-associated fraction of Dictyostelium cells. PMID:8554538

  19. Vesicular Trafficking Defects, Developmental Abnormalities, and Alterations in the Cellular Death Process Occur in Cell Lines that Over-Express Dictyostelium GTPase, Rab2, and Rab2 Mutants.


    Maringer, Katherine; Saheb, Entsar; Bush, John


    Small molecular weight GTPase Rab2 has been shown to be a resident of pre-Golgi intermediates and required for protein transport from the ER to the Golgi complex, however, the function of Rab2 in Dictyostelium has yet to be fully characterized. Using cell lines that over-express DdRab2, as well as cell lines over-expressing constitutively active (CA), and dominant negative (DN) forms of the GTPase, we report a functional role in vesicular transport specifically phagocytosis, and endocytosis. Furthermore, Rab2 like other GTPases cycles between an active GTP-bound and an inactive GDP-bound state. We found that this GTP/GDP cycle for DdRab2 is crucial for normal Dictyostelium development and cell-cell adhesion. Similar to Rab5 and Rab7 in C. elegans, we found that DdRab2 plays a role in programmed cell death, possibly in the phagocytic removal of apoptotic corpses.

  20. Intracellular P2X receptors as novel calcium release channels and modulators of osmoregulation in Dictyostelium: a comparison of two common laboratory strains.


    Sivaramakrishnan, Venketesh; Fountain, Samuel J


    P2X receptors are calcium permeable ligand-gated ion channels activated by ATP. Their role as cell surface receptors for extracellular ATP released physiologically by mammalian cells is well established. However, the cellular function of P2X receptor subtypes that populate the membranes of intracellular compartments is not defined. An initial report described how intracellular P2X receptors control the function of the contractile vacuole, an osmoregulatory organelle in Dictyostelium and other protists, and that genetic disruption of P2X receptors severely impaired cell volume control during hypotonic stress. However, later studies refuted a functional role of intracellular P2X receptors in Dictyostelium. Here we provide evidence that the discrepancies reported between the studies are due to the laboratory strain of Dictyostelium employed, which display different phenotypes in response to hypotonic stress and a varied dependency upon P2X receptors for osmoregulation. We use the recent discovery that intracellular P2X receptors are novel calcium release channels to provide some mechanistic insight in an effort to explain why the strain variance may exist.

  1. Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.


    Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi


    Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

  2. An extracellular matrix, calmodulin-binding protein from Dictyostelium with EGF-like repeats that enhance cell motility.


    Suarez, Andres; Huber, Robert J; Myre, Michael A; O'Day, Danton H


    CyrA is a novel cysteine-rich protein with four EGFL repeats that was isolated using the calmodulin (CaM) binding overlay technique (CaMBOT), suggesting it is a CaM-binding protein (CaMBP). The full-length 63kDa cyrA is cleaved into two major C-terminal fragments, cyrA-C45 and cyrA-C40. A putative CaM-binding domain was detected and both CaM-agarose binding and CaM immunoprecipitation verified that cyrA-C45 and cyrA-C40 each bind to CaM in both a Ca(2+)-dependent and -independent manner. cyrA-C45 was present continuously throughout growth and development but was secreted at high levels during the multicellular slug stage of Dictyostelium development. At this time, cyrA localizes to the extracellular matrix (ECM). ECM purification verified the presence of cyrA-C45. An 18 amino acid peptide (DdEGFL1) from the first EGFL repeat sequence of cyrA (EGFL1) that is present in both cyrA-C45 and -C40 enhances both random cell motility and cAMP-mediated chemotaxis. Here we reveal that the dose-dependent enhancement of motility by DdEGFL1 is related to the time of cell starvation. Addition of DdEGFL1 also inhibits cyrA proteolysis. The status of cyrA as an extracellular CaMBP was further clarified by the demonstration that CaM is secreted during development. Antagonism of CaM with W7 resulted in enhanced cyrA proteolysis suggesting a functional role for extracellular CaM in protecting CaMBPs from proteolysis. cyrA is the first extracellular CaMBP identified in Dictyostelium and since it is an ECM protein with EGF-like repeats that enhance cell motility and it likely also represents the first matricellular protein identified in a lower eukaryote. PMID:21402150

  3. Sequential Activities of Phosphoinositide 3-Kinase, PKB/Akt, and Rab7 during Macropinosome Formation in Dictyostelium

    PubMed Central

    Rupper, Adam; Lee, Kyung; Knecht, David; Cardelli, James


    Macropinocytosis plays an important role in the internalization of antigens by dendritic cells and is the route of entry for many bacterial pathogens; however, little is known about the molecular mechanisms that regulate the formation or maturation of macropinosomes. Like dendritic cells, Dictyostelium amoebae are active in macropinocytosis, and various proteins have been identified that contribute to this process. As described here, microscopic analysis of null mutants have revealed that the class I phosphoinositide 3-kinases, PIK1 and PIK2, and the downstream effector protein kinase B (PKB/Akt) are important in regulating completion of macropinocytosis. Although actin-rich membrane protrusions form in these cell lines, they recede without forming macropinosomes. Imaging of cells expressing green fluorescent protein (GFP) fused to the pleckstrin homology domain (PH) of PKB (GFP-PHPKB) indicates that D3 phosphoinositides are enriched in the forming macropinocytic cup and remain associated with newly formed macropinosomes for <1 minute. A fusion protein, consisting of GFP fused to an F-actin binding domain, overlaps with GFP-PHPKB in the timing of association with forming macropinosomes. Although macropinocytosis is reduced in cells expressing dominant negative Rab7, microscopic imaging studies reveal that GFP-Rab7 associates only with formed macropinosomes at approximately the time that F-actin and D3 phosphoinositide levels decrease. These results support a model in which F-actin modulating proteins and vesicle trafficking proteins coordinately regulate the formation and maturation of macropinosomes. PMID:11553719

  4. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.


    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako


    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development.

  5. Differential distribution of cAMP receptors cAR2 and cAR3 during Dictyostelium development.


    Yu, Y; Saxe, C L


    Signal transduction via a family of cAMP receptor subtypes (cARs) is critical for proper development in the cellular slime mold Dictyostelium. Genes encoding four related subtypes have been cloned and their expression, based on RNA accumulation, has been previously reported. Here we report the differential spatial and temporal distribution of cAR2 and cAR3 proteins, based on indirect double immunofluorescence. Cells were transformed with a carB::lacZ construct, and an antibody against beta-galactosidase was used to visualize cAR2 expression. Simultaneously, a cAR3-specific antibody was used to identify cAR3-expressing cells. Results indicate that by the time of tip formation (12-14 hr) both receptors are expressed and distribute in a virtually nonoverlapping pattern, with cAR2 being expressed on anterior, prestalk cells and cAR3 present in the rest of the organism. Differential distribution of these two receptor subtypes may result in distinct cAMP signaling mechanisms in the two major regions of the organism. PMID:8575636

  6. SCAR, a WASP-related protein, isolated as a suppressor of receptor defects in late Dictyostelium development.


    Bear, J E; Rawls, J F; Saxe, C L


    G protein-coupled receptors trigger the reorganization of the actin cytoskeleton in many cell types, but the steps in this signal transduction cascade are poorly understood. During Dictyostelium development, extracellular cAMP functions as a chemoattractant and morphogenetic signal that is transduced via a family of G protein-coupled receptors, the cARs. In a strain where the cAR2 receptor gene is disrupted by homologous recombination, the developmental program arrests before tip formation. In a genetic screen for suppressors of this phenotype, a gene encoding a protein related to the Wiskott-Aldrich Syndrome protein was discovered. Loss of this protein, which we call SCAR (suppressor of cAR), restores tip formation and most later development to cAR2(-) strains, and causes a multiple-tip phenotype in a cAR2(+) strain as well as leading to the production of extremely small cells in suspension culture. SCAR-cells have reduced levels of F-actin staining during vegetative growth, and abnormal cell morphology and actin distribution during chemotaxis. Uncharacterized homologues of SCAR have also been identified in humans, mouse, Caenorhabditis elegans, and Drosophila. These data suggest that SCAR may be a conserved negative regulator of G protein-coupled signaling, and that it plays an important role in regulating the actin cytoskeleton.

  7. lagC-null and gbf-null cells define key steps in the morphogenesis of Dictyostelium mounds.


    Sukumaran, S; Brown, J M; Firtel, R A; McNally, J G


    The transition to multicellularity is a key feature of the Dictyostelium life cycle, and two genes, gbf and lagC, are known to play pivotal roles in regulating this developmental switch. lagC-null and gbf-null cells fail to induce cell-type-specific genes ordinarily expressed during multicellular development. The null mutants also share a similar morphological phenotype: mutant cells repeatedly aggregate to form a loose mound, disperse, and reform a mound, rather than proceeding to form a tip. To characterize defects in morphogenesis in these mutants, we examined cell motion in the mutant mounds. In analogy with the failed transition in gene expression, we found that lagC-null and gbf-null mounds failed to make a morphogenetic transition from random to rotational motion normally observed in the parent strain. One reason for this was the inability of the mutant mounds to establish a single, dominant signaling-wave center. This defect of lagC-null or gbf-null cells could be overcome by the addition of adenosine, which alters cAMP signaling, but then even in the presence of apparently normal signaling waves, cell motility was still aberrant. This motility defect, as well as the signaling-wave defect, could be overcome in lagC-null cells by overexpression of GBF, suggesting that lagC is dispensable if GBF protein levels are high enough. This set of morphogenetic defects that we have observed helps define key steps in mound morphogenesis. These include the establishment of a dominant signaling-wave center and the capacity of cells to move directionally within the cell mass in response to guidance cues.

  8. Identification of new modes of Dd-STATa regulation of gene expression in Dictyostelium by in situ hybridisation.


    Shimada, Nao; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi


    Signal Transducers and Activators of Transcription (STATs) are transcription factors which lie at the end of cytokine and growth signal transduction pathways. Dictyostelium Dd-STATa is a functional homologue of metazoan STATs. It is activated by cAMP and, at the slug stage, it translocates into the nuclei of the tip cells, which are a subset of the anterior, prestalk A (pstA) cells. Here we searched for novel Dd-STATa regulated genes by in situ hybridisation. A set of 54 cDNA clones whose gene expression patterns are known to be prestalk-specific (Maeda et al., 2003), were chosen as probes and we compared their expression patterns in parental and Dd-STATa-null strains. We identified 13 genes which are candidates for direct induction by Dd-STATa. In the parental strain, most of these genes are expressed in the cone shaped mass of pstAB cells which is located within the prestalk region. These cDNAs show little or no expression in the Dd-STATa-null strain. This contrasts markedly with the paradigmatic ecmB gene which is expressed in pstAB cells in parental cells, but which is expressed throughout the prestalk zone in the Dd-STATa-null strain. We also identified several genes which are normally expressed in pstA cells, or throughout the prestalk region, but whose expression is markedly down-regulated in the null mutant. Again, this contrasts with markers derived from the paradigmatic, ecmA gene which are expressed normally in the Dd-STATa-null strain. The identification of these novel genes provides valuable tools to investigate the role of Dd-STATa.

  9. Vesicular Trafficking Defects, Developmental Abnormalities, and Alterations in the Cellular Death Process Occur in Cell Lines that Over-Express Dictyostelium GTPase, Rab2, and Rab2 Mutants

    PubMed Central

    Maringer, Katherine; Saheb, Entsar; Bush, John


    Small molecular weight GTPase Rab2 has been shown to be a resident of pre-Golgi intermediates and required for protein transport from the ER to the Golgi complex, however, the function of Rab2 in Dictyostelium has yet to be fully characterized. Using cell lines that over-express DdRab2, as well as cell lines over-expressing constitutively active (CA), and dominant negative (DN) forms of the GTPase, we report a functional role in vesicular transport specifically phagocytosis, and endocytosis. Furthermore, Rab2 like other GTPases cycles between an active GTP-bound and an inactive GDP-bound state. We found that this GTP/GDP cycle for DdRab2 is crucial for normal Dictyostelium development and cell–cell adhesion. Similar to Rab5 and Rab7 in C. elegans, we found that DdRab2 plays a role in programmed cell death, possibly in the phagocytic removal of apoptotic corpses. PMID:25157910

  10. Autonomous and nonautonomous regulation of axis formation by antagonistic signaling via 7-span cAMP receptors and GSK3 in Dictyostelium.


    Ginsburg, G T; Kimmel, A R


    Early during Dictyostelium development a fundamental cell-fate decision establishes the anteroposterior (prestalk/prespore) axis. Signaling via the 7-transmembrane cAMP receptor CAR4 is essential for creating and maintaining a normal pattern; car4-null alleles have decreased levels of prestalk-specific mRNAs but enhanced expression of prespore genes. car4- cells produce all of the signals required for prestalk differentiation but lack an extracellular factor necessary for prespore differentiation of wild-type cells. This secreted factor decreases the sensitivity of prespore cells to inhibition by the prestalk morphogen DIF-1. At the cell autonomous level, CAR4 is linked to intracellular circuits that activate prestalk but inhibit prespore differentiation. The autonomous action of CAR4 is antagonistic to the positive intracellular signals mediated by another cAMP receptor, CAR1 and/or CAR3. Additional data indicate that these CAR-mediated pathways converge at the serine/threonine protein kinase GSK3, suggesting that the anterior (prestalk)/posterior (prespore) axis of Dictyostelium is regulated by an ancient mechanism that is shared by the Wnt/Fz circuits for dorsoventral patterning during early Xenopus development and establishing Drosophila segment polarity.

  11. Effectiveness of a dynein team in a tug of war helped by reduced load sensitivity of detachment: evidence from the study of bidirectional endosome transport in D. discoideum

    NASA Astrophysics Data System (ADS)

    Bhat, Deepak; Gopalakrishnan, Manoj


    Bidirectional cargo transport by molecular motors in cells is a complex phenomenon in which the cargo (usually a vesicle) alternately moves in retrograde and anterograde directions. In this case, teams of oppositely pulling motors (e.g., kinesin and dynein) bind to the cargo, simultaneously, and ‘coordinate’ their activity such that the motion consists of spells of positively and negatively directed segments, separated by pauses of varying duration. A set of recent experiments have analyzed the bidirectional motion of endosomes in the amoeba D. discoideum in detail. It was found that in between directional switches, a team of five to six dyneins stall a cargo against a stronger kinesin in a tug of war, which lasts for almost a second. As the mean detachment time of a kinesin under its stall load was also observed to be ˜1 s, we infer that the collective detachment time of the dynein assembly must also be similar. Here, we analyze this inference from a modeling perspective, using experimentally measured single-molecule parameters as inputs. We find that the commonly assumed exponential load-dependent detachment rate is inconsistent with observations, as it predicts that a five-dynein assembly will detach under its combined stall load in less than a hundredth of a second. A modified model where the load-dependent unbinding rate is assumed to saturate at stall-force level for super-stall loads gives results which are in agreement with experimental data. Our analysis suggests that the load-dependent detachment of a dynein in a team is qualitatively different at sub-stall and super-stall loads, a conclusion which is likely to have implications in other situations involving collective effects of many motors.

  12. Novel regulation of Skp1 by the Dictyostelium AgtA α-galactosyltransferase involves the Skp1-binding activity of its WD40 repeat domain.


    Schafer, Christopher M; Sheikh, M Osman; Zhang, Dongmei; West, Christopher M


    The role of Skp1 as an adaptor protein that links Cullin-1 to F-box proteins in E3 Skp1/Cullin-1/F-box protein (SCF) ubiquitin ligases is well characterized. In the social amoeba Dictyostelium and probably many other unicellular eukaryotes, Skp1 is modified by a pentasaccharide attached to a hydroxyproline near its C terminus. This modification is important for oxygen-sensing during Dictyostelium development and is mediated by a HIF-α type prolyl 4-hydroxylase and five sequentially acting cytoplasmic glycosyltransferase activities. Gene disruption studies show that AgtA, the enzyme responsible for addition of the final two galactose residues, in α-linkages to the Skp1 core trisaccharide, is unexpectedly critical for oxygen-dependent terminal development. AgtA possesses a WD40 repeat domain C-terminal to its single catalytic domain and, by use of domain deletions, binding studies, and enzyme assays, we find that the WD40 repeats confer a salt-sensitive second-site binding interaction with Skp1 that mediates novel catalytic activation in addition to simple substrate recognition. In addition, AgtA binds similarly well to precursor isoforms of Skp1 by a salt-sensitive mechanism that competes with binding to an F-box protein and recognition by early modification enzymes, and the effect of binding is diminished when AgtA modifies Skp1. Genetic studies show that loss of AgtA is more severe when an earlier glycosylation step is blocked, and overexpressed AgtA is deleterious if catalytically inactivated. Together, the findings suggest that AgtA mediates non-enzymatic control of unmodified and substrate precursor forms of Skp1 by a binding mechanism that is normally relieved by switch-like activation of its glycosylation function. PMID:24550398

  13. The Skp1 protein from Toxoplasma is modified by a cytoplasmic prolyl 4-hydroxylase associated with oxygen sensing in the social amoeba Dictyostelium.


    Xu, Yuechi; Brown, Kevin M; Wang, Zhuo A; van der Wel, Hanke; Teygong, Crystal; Zhang, Dongmei; Blader, Ira J; West, Christopher M


    In diverse types of organisms, cellular hypoxic responses are mediated by prolyl 4-hydroxylases that use O(2) and α-ketoglutarate as substrates to hydroxylate conserved proline residues in target proteins. Whereas in metazoans these enzymes control the stability of the HIFα family of transcription factor subunits, the Dictyostelium enzyme (DdPhyA) contributes to O(2) regulation of development by a divergent mechanism involving hydroxylation and subsequent glycosylation of DdSkp1, an adaptor subunit in E3(SCF) ubiquitin ligases. Sequences related to DdPhyA, DdSkp1, and the glycosyltransferases that cap Skp1 hydroxyproline occur also in the genomes of Toxoplasma and other protists, suggesting that this O(2) sensing mechanism may be widespread. Here we show by disruption of the TgphyA locus that this enzyme is required for Skp1 glycosylation in Toxoplasma and that disrupted parasites grow slowly at physiological O(2) levels. Conservation of cellular function was tested by expression of TgPhyA in DdphyA-null cells. Simple gene replacement did not rescue Skp1 glycosylation, whereas overexpression not only corrected Skp1 modification but also restored the O(2) requirement to a level comparable to that of overexpressed DdPhyA. Bacterially expressed TgPhyA protein can prolyl hydroxylate both Toxoplasma and Dictyostelium Skp1s. Kinetic analyses showed that TgPhyA has similar properties to DdPhyA, including a superimposable dependence on the concentration of its co-substrate α-ketoglutarate. Remarkably, however, TgPhyA had a significantly higher apparent affinity for O(2). The findings suggest that Skp1 hydroxylation by PhyA is a conserved process among protists and that this biochemical pathway may indirectly sense O(2) by detecting the levels of O(2)-regulated metabolites such as α-ketoglutarate.

  14. Dictyostelium possesses highly diverged presenilin/γ-secretase that regulates growth and cell-fate specification and can accurately process human APP: a system for functional studies of the presenilin/γ-secretase complex

    PubMed Central

    McMains, Vanessa C.; Myre, Michael; Kreppel, Lisa; Kimmel, Alan R.


    SUMMARY Presenilin (PS) is the catalytic moiety of the γ-secretase complex. PS and other γ-secretase components are well conserved among metazoa, but their presence and function in more-distant species are not resolved. Because inappropriate γ-secretase processing of amyloid precursor protein (APP) in humans is associated with familial Alzheimer’s disease, understanding essential elements within each γ-secretase component is crucial to functional studies. Diverged proteins have been identified in primitive plants but experiments have failed to demonstrate γ-secretase activity. We have identified highly diverged orthologs for each γ-secretase component in the ancient eukaryote Dictyostelium, which lacks equivalents of APP, Notch and other characterized PS/γ-secretase substrates. We show that wild-type (WT) Dictyostelium is capable of amyloidogenic processing of ectopically expressed human APP to generate amyloid-β peptides Aβ40 and Aβ42; strains deficient in γ-secretase cannot produce Aβ peptides but accumulate processed intermediates of APP that co-migrate with the C-terminal fragments α- and β-CTF of APP that are found in mammalian cells. We further demonstrate that Dictyostelium requires PS for phagocytosis and cell-fate specification in a cell-autonomous manner, and show that regulation of phagocytosis requires an active γ-secretase, a pathway suggested, but not proven, to occur in mammalian and Drosophila cells. Our results indicate that PS signaling is an ancient process that arose prior to metazoan radiation, perhaps independently of Notch. Dictyostelium might serve to identify novel PS/γ-secretase signaling targets and provide a unique system for high-throughput screening of small-molecule libraries to select new therapeutic targets for diseases associated with this pathway. PMID:20699477

  15. Dictyostelium possesses highly diverged presenilin/gamma-secretase that regulates growth and cell-fate specification and can accurately process human APP: a system for functional studies of the presenilin/gamma-secretase complex.


    McMains, Vanessa C; Myre, Michael; Kreppel, Lisa; Kimmel, Alan R


    Presenilin (PS) is the catalytic moiety of the gamma-secretase complex. PS and other gamma-secretase components are well conserved among metazoa, but their presence and function in more-distant species are not resolved. Because inappropriate gamma-secretase processing of amyloid precursor protein (APP) in humans is associated with familial Alzheimer's disease, understanding essential elements within each gamma-secretase component is crucial to functional studies. Diverged proteins have been identified in primitive plants but experiments have failed to demonstrate gamma-secretase activity. We have identified highly diverged orthologs for each gamma-secretase component in the ancient eukaryote Dictyostelium, which lacks equivalents of APP, Notch and other characterized PS/gamma-secretase substrates. We show that wild-type (WT) Dictyostelium is capable of amyloidogenic processing of ectopically expressed human APP to generate amyloid-beta peptides Abeta(40) and Abeta(42); strains deficient in gamma-secretase cannot produce Abeta peptides but accumulate processed intermediates of APP that co-migrate with the C-terminal fragments alpha- and beta-CTF of APP that are found in mammalian cells. We further demonstrate that Dictyostelium requires PS for phagocytosis and cell-fate specification in a cell-autonomous manner, and show that regulation of phagocytosis requires an active gamma-secretase, a pathway suggested, but not proven, to occur in mammalian and Drosophila cells. Our results indicate that PS signaling is an ancient process that arose prior to metazoan radiation, perhaps independently of Notch. Dictyostelium might serve to identify novel PS/gamma-secretase signaling targets and provide a unique system for high-throughput screening of small-molecule libraries to select new therapeutic targets for diseases associated with this pathway. PMID:20699477

  16. The N-Terminus of Dictyostelium Scar Interacts with Abi and HSPC300 and Is Essential for Proper Regulation and Function

    PubMed Central

    Caracino, Diana; Jones, Cheryl; Compton, Mark


    Scar/WAVE proteins, members of the conserved Wiskott-Aldrich syndrome (WAS) family, promote actin polymerization by activating the Arp2/3 complex. A number of proteins, including a complex containing Nap1, PIR121, Abi1/2, and HSPC300, interact with Scar/WAVE, though the role of this complex in regulating Scar function remains unclear. Here we identify a short N-terminal region of Dictyostelium Scar that is necessary and sufficient for interaction with HSPC300 and Abi in vitro. Cells expressing Scar lacking this N-terminal region show abnormalities in F-actin distribution, cell morphology, movement, and cytokinesis. This is true even in the presence of wild-type Scar. The data suggest that the first 96 amino acids of Scar are necessary for participation in a large-molecular-weight protein complex, and that this Scar-containing complex is responsible for the proper localization and regulation of Scar. The presence of mis-regulated or unregulated Scar has significant deleterious effects on cells and may explain the need to keep Scar activity tightly controlled in vivo either by assembly in a complex or by rapid degradation. PMID:17314411

  17. Adenylyl cyclase A expression is tip-specific in Dictyostelium slugs and directs StatA nuclear translocation and CudA gene expression.


    Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P


    cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA.

  18. Structure of the Dictyostelium Myosin-II Heavy Chain Kinase A (MHCK-A) α-kinase domain apoenzyme reveals a novel autoinhibited conformation

    PubMed Central

    Ye, Qilu; Yang, Yidai; van Staalduinen, Laura; Crawley, Scott William; Liu, Linda; Brennan, Stephanie; Côté, Graham P.; Jia, Zongchao


    The α-kinases are a family of a typical protein kinases present in organisms ranging from protozoa to mammals. Here we report an autoinhibited conformation for the α-kinase domain of Dictyostelium myosin-II heavy chain kinase A (MHCK-A) in which nucleotide binding to the catalytic cleft, located at the interface between an N-terminal and C-terminal lobe, is sterically blocked by the side chain of a conserved arginine residue (Arg592). Previous α-kinase structures have shown that an invariant catalytic aspartic acid residue (Asp766) is phosphorylated. Unexpectedly, in the autoinhibited conformation the phosphoryl group is transferred to the adjacent Asp663, creating an interaction network that stabilizes the autoinhibited state. The results suggest that Asp766 phosphorylation may play both catalytic and regulatory roles. The autoinhibited structure also provides the first view of a phosphothreonine residue docked into the phospho-specific allosteric binding site (Pi-pocket) in the C-lobe of the α-kinase domain. PMID:27211275

  19. An N-terminal nuclear localization sequence but not the calmodulin-binding domain mediates nuclear localization of nucleomorphin, a protein that regulates nuclear number in Dictyostelium.


    Myre, Michael A; O'Day, Danton H


    Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD (171EDVSRFIKGKLLQKQQKIYKDLERF195) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patches at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues 48KKSYQDPEIIAHSRPRK64 that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to 48EF49 abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the 48EF49 construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium. PMID:15896312

  20. The association of myosin IB with actin waves in dictyostelium requires both the plasma membrane-binding site and actin-binding region in the myosin tail.


    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A; Korn, Edward D


    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave.

  1. Analysis of a homologue of the adducin head gene which is a potential target for the Dictyostelium STAT protein Dd-STATa.


    Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi


    A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.

  2. Evidence that the Dictyostelium Dd-STATa protein is a repressor that regulates commitment to stalk cell differentiation and is also required for efficient chemotaxis.


    Mohanty, S; Jermyn, K A; Early, A; Kawata, T; Aubry, L; Ceccarelli, A; Schaap, P; Williams, J G; Firtel, R A


    Dd-STATa is a structural and functional homologue of the metazoan STAT (Signal Transducer and Activator of Transcription) proteins. We show that Dd-STATa null cells exhibit several distinct developmental phenotypes. The aggregation of Dd-STATa null cells is delayed and they chemotax slowly to a cyclic AMP source, suggesting a role for Dd-STATa in these early processes. In Dd-STATa null strains, slug-like structures are formed but they have an aberrant pattern of gene expression. In such slugs, ecmB/lacZ, a marker that is normally specific for cells on the stalk cell differentiation pathway, is expressed throughout the prestalk region. Stalk cell differentiation in Dictyostelium has been proposed to be under negative control, mediated by repressor elements present in the promoters of stalk cell-specific genes. Dd-STATa binds these repressor elements in vitro and the ectopic expression of ecmB/lacZ in the null strain provides in vivo evidence that Dd-STATa is the repressor protein that regulates commitment to stalk cell differentiation. Dd-STATa null cells display aberrant behavior in a monolayer assay wherein stalk cell differentiation is induced using the stalk cell morphogen DIF. The ecmB gene, a general marker for stalk cell differentiation, is greatly overinduced by DIF in Dd-STATa null cells. Also, Dd-STATa null cells are hypersensitive to DIF for expression of ST/lacZ, a marker for the earliest stages in the differentiation of one of the stalk cell sub-types. We suggest that both these manifestations of DIF hypersensitivity in the null strain result from the balance between activation and repression of the promoter elements being tipped in favor of activation when the repressor is absent. Paradoxically, although Dd-STATa null cells are hypersensitive to the inducing effects of DIF and readily form stalk cells in monolayer assay, the Dd-STATa null cells show little or no terminal stalk cell differentiation within the slug. Dd-STATa null slugs remain

  3. Chemotaxis: Under Agarose Assay.


    Brazill, Derrick


    The unicellular eukaryote Dictyostelium discoideum represents a superb model for examining chemotaxis. Under vegetative conditions, the amoebae are chemotactically responsive to pterins, such as folate. Under starved conditions, they lose their sensitivity to pterins, and become chemotactically responsive to cAMP. As an NIH model system, Dictyostelium offers a variety of advantages in studying chemotaxis, including its conservation of mammalian signaling pathways, its ease of growth, and its genetic tractability. In this chapter, we describe the use of the under agarose chemotaxis assay to identify proteins involved in controlling motility and directional sensing in Dictyostelium discoideum. Given the similarities between Dictyostelium and mammalian cells, this allows us to dissect the conserved pathways involved in eukaryotic chemotaxis.

  4. Rad53 homologue forkhead-associated kinase A (FhkA) and Ca2+-binding protein 4a (CBP4a) are nucleolar proteins that differentially redistribute during mitosis in Dictyostelium

    PubMed Central


    Background During mitosis most nucleolar proteins redistribute to other locales providing an opportunity to study the relationship between nucleolar protein localization and function. Dictyostelium is a model organism for the study of several fundamental biological processes and human diseases but only two nucleolar proteins have been studied during mitosis: NumA1 and Snf12. Both of them are linked to the cell cycle. To acquire a better understanding of nucleolar protein localization and dynamics in Dictyostelium we studied the nucleolar localization of two additional proteins during mitosis: Snf12-linked forkhead-associated kinase A (FhkA), which is involved in the cell cycle, and Ca2+-binding protein 4a (CBP4a), which is a binding partner of NumA1. Methods Polyclonal antibodies were produced in-house. Cells were fixed and probed with either anti-FhkA or anti-CBP4a in order to determine cellular localization during interphase and throughout the stages of mitosis. Colocalization with DAPI nuclear stain allowed us to determine the location of the nucleus and nucleolus while colocalization with anti-α-tubulin allowed us to determine the cell cycle stage. Results Here we verify two novel nucleolar proteins, Rad53 homologue FhkA which localized around the edge of the nucleolus and CBP4a which was detected throughout the entire nucleolus. Treatment with the Ca2+ chelator BAPTA (5 mM) showed that the nucleolar localization of CBP4a is Ca2+-dependent. In response to actinomycin D (0.05 mg/mL) CBP4a disappeared from the nucleolus while FhkA protruded from the nucleus, eventually pinching off as cytoplasmic circles. FhkA and CBP4a redistributed differently during mitosis. FhkA redistributed throughout the entire cell and at the nuclear envelope region from prometaphase through telophase. In contrast, during prometaphase CBP4a relocated to many large, discrete “CBP4a islands” throughout the nucleoplasm. Two larger “CBP4a islands” were also detected specifically

  5. Three-dimensional in vivo analysis of Dictyostelium mounds reveals directional sorting of prestalk cells and defines a role for the myosin II regulatory light chain in prestalk cell sorting and tip protrusion.


    Clow, P A; Chen, T; Chisholm, R L; McNally, J G


    During cell sorting in Dictyostelium, we observed that GFP-tagged prestalk cells (ecmAO-expressing cells) moved independently and directionally to form a cluster. This is consistent with a chemotaxis model for cell sorting (and not differential adhesion) in which a long-range signal attracts many of the prestalk cells to the site of cluster formation. Surprisingly, the ecmAO prestalk cluster that we observed was initially found at a random location within the mound of this Ax3 strain, defining an intermediate sorting stage not widely reported in Dictyostelium. The cluster then moved en masse to the top of the mound to produce the classic, apical pattern of ecmAO prestalk cells. Migration of the cluster was also directional, suggesting the presence of another long-range guidance cue. Once at the mound apex, the cluster continued moving upward leading to protrusion of the mound's tip. To investigate the role of the cluster in tip protrusion, we examined ecmAO prestalk-cell sorting in a myosin II regulatory light chain (RLC) null in which tips fail to form. In RLC-null mounds, ecmAO prestalk cells formed an initial cluster that began to move to the mound apex, but then arrested as a vertical column that extended from the mound's apex to its base. Mixing experiments with wild-type cells demonstrated that the RLC-null ecmAO prestalk-cell defect is cell autonomous. These observations define a specific mechanism for myosin's function in tip formation, namely a mechanical role in the upward movement of the ecmAO prestalk cluster. The wild-type data demonstrate that cell sorting can occur in two steps, suggesting that, in this Ax3 strain, spatially and temporally distinct cues may guide prestalk cells first to an initial cluster and then later to the tip.

  6. Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.


    Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi


    STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa.

  7. Amoeba Host Model for Evaluation of Streptococcus suis Virulence ▿

    PubMed Central

    Bonifait, Laetitia; Charette, Steve J.; Filion, Geneviève; Gottschalk, Marcelo; Grenier, Daniel


    The Gram-positive bacterium Streptococcus suis is a major swine pathogen worldwide that causes meningitis, septicemia, and endocarditis. In this study, we demonstrate that the amoeba Dictyostelium discoideum can be a relevant alternative system to study the virulence of S. suis. PMID:21742906

  8. Evidence that the Dictyostelium STAT protein Dd-STATa plays a role in the differentiation of inner basal disc cells and identification of a promoter element essential for expression in these cells.


    Shimada, Nao; Maruo, Toshinari; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi


    Dd-STATa, a Dictyostelium homolog of the metazoan STAT (signal transducers and activators of transcription) proteins, is necessary in the slug for correct entry into culmination. Dd-STATa-null mutant fails to culminate and its phenotype correlates with the loss of a funnel-shaped core region, the pstAB core region, which expresses both the ecmA and ecmB genes. To understand how the differentiation of pstAB core cells is regulated, we identified an EST that is expressed in the core cells of normal slugs but down-regulated in the Dd-STATa-null mutant. This EST, SSK348, encodes a close homolog of the Dictyostelium acetyl-CoA synthetase (ACS). A promoter fragment of the cognate gene, aslA (acetyl-CoA synthetase-like A), was fused to a lacZ reporter and the expression pattern determined. As expected from the behavior of the endogenous aslA gene, the aslA::lacZ fusion gene is not expressed in Dd-STATa-null slugs. In parental cells, the aslA promoter is first activated in the funnel-shaped core cells located at the slug anterior, the "pstAB core." During culmination, the pstAB core cells move down, through the prespore cells, to form the inner part of the basal disc. As the spore mass climbs the stalk, the aslA gene comes to be expressed in cells of the upper and lower cups, structures that cradle the spore head. Deletion and point mutation analyses of the promoter identified an AT-rich sequence that is necessary for expression in the pstAB core. This acts in combination with repressor regions that prevent ectopic aslA expression in the pre-stalk regions of slugs and the stalks of culminants. Thus, this study confirms that Dd-STATa is necessary for the differentiation of pstAB core cells, by showing that it is needed for the activation of the aslA gene. It also identifies aslA promoter elements that are likely to be regulated, directly or indirectly, by Dd-STATa.

  9. DictyBase 2013: integrating multiple Dictyostelid species.


    Basu, Siddhartha; Fey, Petra; Pandit, Yogesh; Dodson, Robert; Kibbe, Warren A; Chisholm, Rex L


    dictyBase ( is the model organism database for the social amoeba Dictyostelium discoideum. This contribution provides an update on dictyBase that has been previously presented. During the past 3 years, dictyBase has taken significant strides toward becoming a genome portal for the whole Amoebozoa clade. In its latest release, dictyBase has scaled up to host multiple Dictyostelids, including Dictyostelium purpureum [Sucgang, Kuo, Tian, Salerno, Parikh, Feasley, Dalin, Tu, Huang, Barry et al.(2011) (Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum. Genome Biol., 12, R20)], Dictyostelium fasciculatum and Polysphondylium pallidum [Heidel, Lawal, Felder, Schilde, Helps, Tunggal, Rivero, John, Schleicher, Eichinger et al. (2011) (Phylogeny-wide analysis of social amoeba genomes highlights ancient origins for complex intercellular communication. Genome Res., 21, 1882-1891)]. The new release includes a new Genome Browser with RNAseq expression, interspecies Basic Local Alignment Search Tool alignments and a unified Basic Local Alignment Search Tool search for cross-species comparisons.

  10. Biological soliton in multicellular movement

    NASA Astrophysics Data System (ADS)

    Kuwayama, Hidekazu; Ishida, Shuji


    Solitons have been observed in various physical phenomena. Here, we show that the distinct characteristics of solitons are present in the mass cell movement of non-chemotactic mutants of the cellular slime mould Dictyostelium discoideum. During starvation, D. discoideum forms multicellular structures that differentiate into spore or stalk cells and, eventually, a fruiting body. Non-chemotactic mutant cells do not form multicellular structures; however, they do undergo mass cell movement in the form of a pulsatile soliton-like structure (SLS). We also found that SLS induction is mediated by adhesive cell-cell interactions. These observations provide novel insights into the mechanisms of biological solitons in multicellular movement.

  11. Universal signals control slime mold stalk formation.


    van Es, S; Nieuwenhuijsen, B W; Lenouvel, F; van Deursen, E M; Schaap, P


    The primitive slime mold Dictyostelium minutum does not display oscillations during aggregation, cannot form migrating slugs, and does not form a prestalk/prespore pattern, all of which are characteristic for development of its advanced relative Dictyostelium discoideum. We used D. minutum to investigate whether slime molds share common mechanisms controlling development. In D. discoideum, the morphogen differentiation inducing factor (DIF) can induce stalk-cell differentiation in vitro. However, stalk formation in vivo is supposedly triggered by local depletion of DIF antagonists such as ammonia or cAMP. A homologue of the D. discoideum stalk gene ecmB was cloned in D. minutum that encodes a 3.4-kb mRNA, and its deduced amino acid sequence shows repeats of 24 amino acids that are characteristic for the D. discoideum ecmB gene. Remarkably, DIF effectively induces expression of the D. minutum ecmB gene and ammonia inhibits its expression. D. discoideum cells were transformed with a construct of the D. minutum ecmB promoter fused to the lacZ reporter gene and showed expression in the stalk, but not in the upper and lower cup of the fruiting body, which also express the D. discoideum ecmB gene. In D. discoideum, the D. minutum ecmB and the ecmB promoter are similarly activated by DIF and repressed by both cAMP and ammonia, suggesting that additional signaling is required for ecmB expression in upper and lower cup cells. Our data indicate that the extracellular signals controlling stalk formation and their intracellular signaling cascades including gene regulatory proteins remained highly conserved during slime mold evolution. PMID:8058783

  12. How cellular slime molds evade nematodes.

    PubMed Central

    Kessin, R H; Gundersen, G G; Zaydfudim, V; Grimson, M


    We have found a predator-prey association between the social amoeba Dictyostelium discoideum and the free soil living nematode Caenorhabditis elegans. C. elegans feeds on the amoebae and multiplies indefinitely when amoebae are the sole food source. In an environment created from soil, D. discoideum grows and develops, but not in the presence of C. elegans. During development, C. elegans feeds on amoebae until they aggregate and synthesize an extracellular matrix called the slime sheath. After the sheath forms, the aggregate and slug are protected. Adult nematodes ingest Dictyostelium spores, which pass through the gut of the worm without loss of structure and remain viable. Nematodes kill the amoebae but disperse the spores. The sheath that is constructed when the social amoebae aggregate and the spore coats of the individual cells may protect against this predator. Individual amoebae may also protect themselves by secreting compounds that repel nematodes. Images Fig. 1 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8643493

  13. Potassium Sensitive Optical Nanosensors Containing Voltage Sensitive Dyes.


    Xie, Xiaojiang; Gutiérrez, Agustín; Trofimov, Valentin; Szilagyi, Istvan; Soldati, Thierry; Bakker, Eric


    lonophore-based ion-selective optical nanosensors have been explored for a number of years. Voltage sensitive dyes (VSDs) have been introduced into this type of sensors only very recently, forming a new class of analytical tools. Here, K(+)-sensitive nanospheres incorporating a lipophilic VSD were successfully fabricated and characterized. The nanosensors were readily delivered into the social amoeba Dictyostelium discoideum in a non-invasive manner, forming a promising new platform for intracellular ion quantification and imaging. PMID:26668937

  14. A molecular genetic approach to understanding eukaryotic cellulose synthesis. Final technical report, March 15, 1995--March 14, 1997

    SciTech Connect

    Blanton, R.L.


    In an attempt to understand eukaryotic cellulose synthesis, this research investigates the cellulose biosynthetic pathway of Dictyostelium discoideum. Attention is focused on the following: use of a newly developed method of tagged insertional mutagenesis to generate mutants in cellulose biosynthesis; and exploiting the monolayer culture system to identify differences in mRNA populations between DIF-induced (and cellulose-synthesizing) versus non-induced cells.

  15. Computational analysis of amoeboid swimming at low Reynolds number.


    Wang, Qixuan; Othmer, Hans G


    Recent experimental work has shown that eukaryotic cells can swim in a fluid as well as crawl on a substrate. We investigate the swimming behavior of Dictyostelium discoideum  amoebae who swim by initiating traveling protrusions at the front that propagate rearward. In our model we prescribe the velocity at the surface of the swimming cell, and use techniques of complex analysis to develop 2D models that enable us to study the fluid-cell interaction. Shapes that approximate the protrusions used by Dictyostelium discoideum  can be generated via the Schwarz-Christoffel transformation, and the boundary-value problem that results for swimmers in the Stokes flow regime is then reduced to an integral equation on the boundary of the unit disk. We analyze the swimming characteristics of several varieties of swimming Dictyostelium discoideum  amoebae, and discuss how the slenderness of the cell body and the shapes of the protrusion effect the swimming of these cells. The results may provide guidance in designing low Reynolds number swimming models.





    Sonneborn, D. R. (Brandeis University, Waltham, Mass.), M. Sussman, and L. Levine. Serological analysis of cellular slime-mold development. I. Changes in antigenic activity during cell aggregation. J. Bacteriol. 87:1321-1329. 1964.-During aggregation in Dictyostelium discoideum, the concentration of a single antigenic determinant increased markedly, starting from very low or undetectable levels. Subsequently, the determinant appeared to segregate preferentially into the stalks of terminal fruiting bodies. Sera containing the antibody specific for this determinant inhibited the aggregation of D. discoideum without disturbing cell viability. The properties of the antigen during fractionation are consistent with the supposition that it may be a protein associated with the cell membrane. The ability or inability of three species to coaggregate with D. discoideum was correlated with the presence or absence of the antigenic determinant in aggregates of these species.

  17. High relatedness in a social amoeba: the role of kin-discriminatory segregation.


    Gilbert, Owen M; Strassmann, Joan E; Queller, David C


    A major challenge for social theory is to explain the importance of kin discrimination for the evolution of altruism. One way to assess the importance of kin discrimination is to test its effects on increasing relatedness within groups. The social amoeba Dictyostelium discoideum aggregates to form a fruiting body composed of dead stalk and live spores. Previous studies of a natural population showed that where D. discoideum occurs in the soil, multiple clones are often found in the same small soil samples. However, actual fruiting bodies usually contain only one clone. We here performed experiments to gauge the effect of kin-discriminatory segregation on increasing relatedness. We mixed co-occurring clones from this population using a relatedness level found in small soil samples. We found a lower proportion of uniclonal fruiting bodies and a lower level of relatedness compared with natural fruiting bodies. We found that the amount of relatedness increase attributable to kin-discriminatory segregation was small. These findings suggest a relatively minor influence of kin-discriminatory segregation on relatedness in D. discoideum. We discuss our results comparing with the results of previous studies, including those of wild clones and laboratory mutants. We ask why wild clones of D. discoideum exhibit a low degree of kin-discriminatory segregation, and what alternative factors might account for high relatedness in D. discoideum. PMID:22357265

  18. High relatedness in a social amoeba: the role of kin-discriminatory segregation.


    Gilbert, Owen M; Strassmann, Joan E; Queller, David C


    A major challenge for social theory is to explain the importance of kin discrimination for the evolution of altruism. One way to assess the importance of kin discrimination is to test its effects on increasing relatedness within groups. The social amoeba Dictyostelium discoideum aggregates to form a fruiting body composed of dead stalk and live spores. Previous studies of a natural population showed that where D. discoideum occurs in the soil, multiple clones are often found in the same small soil samples. However, actual fruiting bodies usually contain only one clone. We here performed experiments to gauge the effect of kin-discriminatory segregation on increasing relatedness. We mixed co-occurring clones from this population using a relatedness level found in small soil samples. We found a lower proportion of uniclonal fruiting bodies and a lower level of relatedness compared with natural fruiting bodies. We found that the amount of relatedness increase attributable to kin-discriminatory segregation was small. These findings suggest a relatively minor influence of kin-discriminatory segregation on relatedness in D. discoideum. We discuss our results comparing with the results of previous studies, including those of wild clones and laboratory mutants. We ask why wild clones of D. discoideum exhibit a low degree of kin-discriminatory segregation, and what alternative factors might account for high relatedness in D. discoideum.

  19. High relatedness in a social amoeba: the role of kin-discriminatory segregation

    PubMed Central

    Gilbert, Owen M.; Strassmann, Joan E.; Queller, David C.


    A major challenge for social theory is to explain the importance of kin discrimination for the evolution of altruism. One way to assess the importance of kin discrimination is to test its effects on increasing relatedness within groups. The social amoeba Dictyostelium discoideum aggregates to form a fruiting body composed of dead stalk and live spores. Previous studies of a natural population showed that where D. discoideum occurs in the soil, multiple clones are often found in the same small soil samples. However, actual fruiting bodies usually contain only one clone. We here performed experiments to gauge the effect of kin-discriminatory segregation on increasing relatedness. We mixed co-occurring clones from this population using a relatedness level found in small soil samples. We found a lower proportion of uniclonal fruiting bodies and a lower level of relatedness compared with natural fruiting bodies. We found that the amount of relatedness increase attributable to kin-discriminatory segregation was small. These findings suggest a relatively minor influence of kin-discriminatory segregation on relatedness in D. discoideum. We discuss our results comparing with the results of previous studies, including those of wild clones and laboratory mutants. We ask why wild clones of D. discoideum exhibit a low degree of kin-discriminatory segregation, and what alternative factors might account for high relatedness in D. discoideum. PMID:22357265

  20. Vacuole Membrane Protein 1 Is an Endoplasmic Reticulum Protein Required for Organelle Biogenesis, Protein Secretion, and Development

    PubMed Central

    Calvo-Garrido, Javier; Carilla-Latorre, Sergio; Lázaro-Diéguez, Francisco; Egea, Gustavo


    Vacuole membrane protein 1 (Vmp1) is membrane protein of unknown molecular function that has been associated with pancreatitis and cancer. The social amoeba Dictyostelium discoideum has a vmp1-related gene that we identified previously in a functional genomic study. Loss-of-function of this gene leads to a severe phenotype that compromises Dictyostelium growth and development. The expression of mammalian Vmp1 in a vmp1− Dictyostelium mutant complemented the phenotype, suggesting a functional conservation of the protein among evolutionarily distant species and highlights Dictyostelium as a valid experimental system to address the function of this gene. Dictyostelium Vmp1 is an endoplasmic reticulum protein necessary for the integrity of this organelle. Cells deficient in Vmp1 display pleiotropic defects in the secretory pathway and organelle biogenesis. The contractile vacuole, which is necessary to survive under hypoosmotic conditions, is not functional in the mutant. The structure of the Golgi apparatus, the function of the endocytic pathway and conventional protein secretion are also affected in these cells. Transmission electron microscopy of vmp1− cells showed the accumulation of autophagic features that suggests a role of Vmp1 in macroautophagy. In addition to these defects observed at the vegetative stage, the onset of multicellular development and early developmental gene expression are also compromised. PMID:18550798

  1. The cellular slime mold: eukaryotic model microorganism.


    Urushihara, Hideko


    Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.

  2. Mitochondrial genome evolution in the social amoebae.


    Heidel, Andrew J; Glöckner, Gernot


    Most mitochondria contain a core set of genes required for mitochondrial function, but beyond this base there are variable genomic features. The mitochondrial genome of the model species Dictyostelium discoideum demonstrated that the social amoebae mitochondrial genomes have a size between those of metazoans and plants, but no comparative study of social amoebae mitochondria has been performed. Here, we present a comparative analysis of social amoebae mitochondrial genomes using D. discoideum, Dictyostelium citrinum, Dictyostelium fasciculatum, and Polysphondylium pallidum. The social amoebae mitochondria have similar sizes, AT content, gene content and have a high level of synteny except for one segmental rearrangement and extensive displacement of tRNAs. From the species that contain the rearrangement, it can be concluded that the event occurred late in the evolution of social amoebae. A phylogeny using 36 mitochondrial genes produced a well-supported tree suggesting that the pairs of D. discoideum/D. citrinum and D. fasciculatum/P. pallidum are sister species although the position of the root is not certain. Group I introns and endonucleases are variable in number and location in the social amoebae. Phylogenies of the introns and endonucleases suggest that there have been multiple recent duplications or extinctions and confirm that endonucleases have the ability to insert into new areas. An analysis of dN/dS ratios in mitochondrial genes revealed that among groups of genes, adenosine triphosphate synthase complex genes have the highest ratio, whereas cytochrome oxidase and nicotinamide adenine dinucleotide (NADH) dehydrogenase genes had the lowest ratio. The genetic codes of D. citrinum, P. pallidum, and D. fasciculatum are the universal code although D. fasciculatum does not use the TGA stop codon. In D. fasciculatum, we demonstrate for the first time that a mitochondrial genome without the TGA stop codon still uses the release factor RF2 that recognizes TGA

  3. Alternative Eukaryotic Expression Systems for the Production of Proteins and Protein Complexes.


    Gómez, Sara; López-Estepa, Miguel; Fernández, Francisco J; Suárez, Teresa; Vega, M Cristina


    Besides the most established expression hosts, several eukaryotic microorganisms and filamentous fungi have also been successfully used as platforms for the production of foreign proteins. Filamentous fungi and Dictyostelium discoideum are two prominent examples. Filamentous fungi, typically Aspergillus and Trichoderma, are usually employed for the industrial production of enzymes and secondary metabolites for food processing, pharmaceutical drugs production, and textile and paper applications, with multiple products already accepted for their commercialization. The low cost of culture medium components, high secretion capability directly to the extracellular medium, and the intrinsic ability to produce post-translational modifications similar to the mammalian type, have promoted this group as successful hosts for the expression of proteins, including examples from phylogenetically distant groups: humans proteins such as IL-2, IL-6 or epithelial growth factor; α-galactosidase from plants; or endoglucanase from Cellulomonas fimi, among others. D. discoideum is a social amoeba that can be used as an expression platform for a variety of proteins, which has been extensively illustrated for cytoskeletal proteins. New vectors for heterologous expression in D. discoideum have been recently developed that might increase the usefulness of this system and expand the range of protein classes that can be tackled. Continuous developments are ongoing to improve strains, promoters, production and downstream processes for filamentous fungi, D. discoideum, and other alternative eukaryotic hosts. Either for the overexpression of individual genes, or in the coexpression of multiples genes, this chapter illustrates the enormous possibilities offered by these groups of eukaryotic organisms. PMID:27165325

  4. Alternative Eukaryotic Expression Systems for the Production of Proteins and Protein Complexes.


    Gómez, Sara; López-Estepa, Miguel; Fernández, Francisco J; Suárez, Teresa; Vega, M Cristina


    Besides the most established expression hosts, several eukaryotic microorganisms and filamentous fungi have also been successfully used as platforms for the production of foreign proteins. Filamentous fungi and Dictyostelium discoideum are two prominent examples. Filamentous fungi, typically Aspergillus and Trichoderma, are usually employed for the industrial production of enzymes and secondary metabolites for food processing, pharmaceutical drugs production, and textile and paper applications, with multiple products already accepted for their commercialization. The low cost of culture medium components, high secretion capability directly to the extracellular medium, and the intrinsic ability to produce post-translational modifications similar to the mammalian type, have promoted this group as successful hosts for the expression of proteins, including examples from phylogenetically distant groups: humans proteins such as IL-2, IL-6 or epithelial growth factor; α-galactosidase from plants; or endoglucanase from Cellulomonas fimi, among others. D. discoideum is a social amoeba that can be used as an expression platform for a variety of proteins, which has been extensively illustrated for cytoskeletal proteins. New vectors for heterologous expression in D. discoideum have been recently developed that might increase the usefulness of this system and expand the range of protein classes that can be tackled. Continuous developments are ongoing to improve strains, promoters, production and downstream processes for filamentous fungi, D. discoideum, and other alternative eukaryotic hosts. Either for the overexpression of individual genes, or in the coexpression of multiples genes, this chapter illustrates the enormous possibilities offered by these groups of eukaryotic organisms.

  5. Evolutionary dynamics of altruism and cheating among social amoebas.


    Brännström, A; Dieckmann, U


    Dictyostelium discoideum is a eukaryotic amoeba, which, when starvation is imminent, aggregates to form fruiting bodies consisting of a stalk of reproductively dead cells that supports spores. Because different clones may be involved in such aggregations, cheater strategies may emerge that allocate a smaller fraction of cells to stalk formation, thus gaining a reproductive advantage. In this paper, we model the evolutionary dynamics of allocation strategies in Dictyostelium under the realistic assumption that the number of clones involved in aggregations follows a random distribution. By determining the full course of evolutionary dynamics, we show that evolutionary branching in allocation strategies may occur, resulting in dimorphic populations that produce stalkless and stalked fruiting bodies. We also demonstrate that such dimorphisms are more likely to emerge when the variation in the number of clones involved in aggregations is large.

  6. The cold war of the social amoebae.


    Shaulsky, Gad; Kessin, Richard H


    When confronted with starvation, the amoebae of Dictyostelium discoideum initiate a developmental process that begins with cell aggregation and ends with a ball of spores supported on a stalk. Spores live and stalk cells die. Because the multicellular organism is produced by cell aggregation and not by growth and division of a single cell, genetically diverse amoebae may enter an aggregate and, if one lineage has a capacity to avoid the stalk cell fate, it may have a selective advantage. Such cheater mutants have been found among wild isolates and created in laboratory strains. The mutants raise a number of questions--how did such a cooperative system evolve in the face of cheating? What is the basis of self recognition? What genes are involved? How is cheating constrained? This review summarizes the results of studies on the social behavior of Dictyostelium and its relatives, including the familiar asexual developmental cycle and the lesser known, but puzzling, sexual cycle.

  7. JAKs and STATs in invertebrate model organisms.


    Dearolf, C R


    Invertebrate organisms provide systems to elucidate the developmental roles of Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathways, thereby complementing research conducted with mammalian cells and animals. Components of the JAK/STAT protein pathway have been identified and characterized in the fruit fly Drosophila melanogaster and the cellular slime mold Dictyostelium discoideum. This review summarizes the molecular and genetic data obtained from these model organisms. In particular, a Drosophila JAK/STAT pathway regulates normal segmentation, cell proliferation, and differentiation, and hyperactivation of the pathway leads to tumor formation and leukemia-like defects. A Dictyostelium STAT regulates the development of stalk cells during the multicellular part of the life cycle. Future research utilizing these organisms should continue to provide insights into the roles and regulation of these proteins and their signaling pathways. PMID:10526575

  8. Myosins and cell dynamics in cellular slime molds.


    Yumura, Shigehiko; Uyeda, Taro Q P


    Myosin is a mechanochemical transducer and serves as a motor for various motile activities such as cell migration, cytokinesis, maintenance of cell shape, phagocytosis, and morphogenesis. Nonmuscle myosin in vivo does not either stay static at specific subcellular regions or construct highly organized structures, such as sarcomere in skeletal muscle cells. The cellular slime mold Dictyostelium discoideum is an ideal "model organism" for the investigation of cell movement and cytokinesis. The advantages of this organism prompted researchers to carry out pioneering cell biological, biochemical, and molecular genetic studies on myosin II, which resulted in elucidation of many fundamental features of function and regulation of this most abundant molecular motor. Furthermore, recent molecular biological research has revealed that many unconventional myosins play various functions in vivo. In this article, how myosins are organized and regulated in a dynamic manner in Dictyostelium cells is reviewed and discussed. PMID:12722951

  9. Principle for performing attractor transits with single control in Boolean networks.


    Gao, Bo; Li, Lixiang; Peng, Haipeng; Kurths, Jürgen; Zhang, Wenguang; Yang, Yixian


    We present an algebraic approach to reveal attractor transitions in Boolean networks under single control based on the recently developed matrix semitensor product theory. In this setting, the reachability of attractors is estimated by the state transition matrices. We then propose procedures that compute the shortest control sequence and the result of each step of input (control) exactly. The general derivation is exemplified by numerical simulations for two kinds of gene regulation networks, the protein-nucleic acid interactions network and the cAMP receptor of Dictyostelium discoideum network. PMID:24483485

  10. Live cell flattening — traditional and novel approaches

    PubMed Central


    Eukaryotic cell flattening is valuable for improving microscopic observations, ranging from bright field (BF) to total internal reflection fluorescence (TIRF) microscopy. Fundamental processes, such as mitosis and in vivo actin polymerization, have been investigated using these techniques. Here, we review the well known agar overlayer protocol and the oil overlay method. In addition, we present more elaborate microfluidics-based techniques that provide us with a greater level of control. We demonstrate these techniques on the social amoebae Dictyostelium discoideum, comparing the advantages and disadvantages of each method. PACS Codes: 87.64.-t, 47.61.-k, 87.80.Ek PMID:20403171

  11. Novel chlorinated dibenzofurans isolated from the cellular slime mold, Polysphondylium filamentosum, and their biological activities.


    Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru


    Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster.

  12. Multiarmed Spirals in Excitable Media

    NASA Astrophysics Data System (ADS)

    Vasiev, Bakthier; Siegert, Florian; Weijer, Cornelis


    Numerical studies of the properties of multiarmed spirals show that they can form spontaneously in low excitability media. The maximum number of arms in a multiarmed spiral is proportional to the ratio of the single spiral period to the refractoriness of the medium. Multiarmed spirals are formed due to attraction of single spirals if these spirals rotate in the same direction and their tips are less than one wavelength apart, i.e., a spiral broken not far from its tip can evolve into a 2-armed spiral. We propose this mechanism to be responsible for the formation of multiarmed spirals in mounds of the slime mold Dictyostelium discoideum.

  13. Real-time visualization of intracellular hydrodynamics in single living cells.


    Potma, E; de Boeij, W P; van Haastert, P J; Wiersma, D A


    Intracellular water concentrations in single living cells were visualized by nonlinear coherent anti-Stokes Raman scattering (CARS) microscopy. In combination with isotopic exchange measurements, CARS microscopy allowed the real-time observation of transient intracellular hydrodynamics at a high spatial resolution. Studies of the hydrodynamics in the microorganism Dictyostelium discoideum indicated the presence of a microscopic region near the plasma membrane where the mobility of water molecules is severely restricted. Modeling the transient hydrodynamics eventuated in the determination of cell-specific cytosolic diffusion and plasma membrane permeability constants. Our experiments demonstrate that CARS microscopy offers an invaluable tool for probing single-cell water dynamics. PMID:11171993

  14. Development of novel DIF-1 derivatives that selectively suppress innate immune responses.


    Nguyen, Van Hai; Kikuchi, Haruhisa; Kubohara, Yuzuru; Takahashi, Katsunori; Katou, Yasuhiro; Oshima, Yoshiteru


    The multiple pharmacological activities of differentiation-inducing factor-1 (DIF-1) of the cellular slime mold Dictyostelium discoideum led us to examine the use of DIF-1 as a 'drug template' to develop promising seed compounds for drug discovery. DIF-1 and its derivatives were synthesized and evaluated for their regulatory activities in innate immune responses. We found two new derivatives (4d and 5e) with highly selective inhibitory activities against production of the antimicrobial peptide attacin in Drosophila S2 cells and against production of interleukin-2 in Jurkat cells. PMID:26122773

  15. Novel chlorinated dibenzofurans isolated from the cellular slime mold, Polysphondylium filamentosum, and their biological activities.


    Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru


    Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster. PMID:23746784

  16. When Cells Collide: A Model for Cell-Assisted Cell Growth based on Direct Contacts

    NASA Astrophysics Data System (ADS)

    Franck, Carl; Ip, Wui; Bae, Albert; Franck, Nathan; Bogart, Elijah; Thi Le, Thanhbinh


    Although intercellular communication is frequently viewed as involving the transport of small molecules through an intracellular fluid medium, biologists have proposed chemical signaling with chemical specificity due to chemical recognition through direct contacts. Considering the collective computation behind the decision of a cell to divide when it senses the presence of a sufficient number of like neighbors, we offer a model for the transition from slow to exponential growth in shaken suspension cell culture of the model eukaryote, Dictyostelium discoideum. Besides exploring an elegantly simple example of multicellular life, this discussion might well prove useful in considering the limits of cell culture on small spatial scales as required for contemporary massively parallel biotechnology.

  17. Alkylbenzoquinone involved in development of cellular slime molds.


    Takaya, Yoshiaki; Hotta, Rie; Fujiwara, Kenshu; Otani, Risa; Uchiyama, Yurika; Sakakibara, Mizuki; Fukuda, Eri; Niwa, Masatake; Inouye, Kei; Oohata, Akiko A


    The structure of the prespore-cell-promoting factor from Dictyostelium discoideum was determined to be 2-hydroxy-5-methyl-6-pentylbenzoquinone. The synthetic compound has prespore-cell-promoting activity similar to the natural one, with half-maximal induction at a concentration as low as 40 pM. It was also found that the factor induces aggregation in an aggregation-deficient mutant of a related species, Polysphodilium violaceum. Both these activities are sensitive to positional isomerism with the 6-methyl-5-pentyl isomer showing no detectable activity.

  18. Identification of Associated Proteins by Immunoprecipitation and Mass Spectrometry Analysis.


    Cao, Xiumei; Yan, Jianshe


    Protein-protein interactions play central roles in intercellular and intracellular signal transduction. Impairment of protein-protein interactions causes many diseases such as cancer, cardiomyopathies, diabetes, microbial infections, and genetic and neurodegenerative disorders. Immunoprecipitation is a technique in which a target protein of interest bound by an antibody is used to pull down the protein complex out of cell lysates, which can be identified by mass spectrometry. Here, we describe the protocol to immunoprecipitate and identify the components of the protein complexes of ElmoE in Dictyostelium discoideum cells. PMID:27271899

  19. SWISS-2DPAGE, ten years later.


    Hoogland, Christine; Mostaguir, Khaled; Sanchez, Jean-Charles; Hochstrasser, Denis F; Appel, Ron D


    The SWISS-2DPAGE database was established in 1993 and is maintained collaboratively by the Swiss Institute of Bioinformatics (SIB) and the Biomedical Proteomics Research Group (BPRG) of the Geneva University Hospital. During these years, SWISS-2DPAGE underwent constant modification and improvement. Current content includes about 4000 identified spots corresponding to 1200 different protein entries in 36 reference maps from human, mouse, Arabidopsis thaliana, Dictyostelium discoideum, Escherichia coli, Saccharomyces cerevisiae and Staphylococcus aureus origins. With a high level of annotation and integration with other relevant databases, SWISS-2DPAGE is a reference source in the proteomics world. Queries to SWISS-2DPAGE database currently reach 1000 hits per day.

  20. dictyBase 2015: Expanding data and annotations in a new software environment

    PubMed Central

    Jimenez-Morales, David; Dodson, Robert J.; Chisholm, Rex L.


    dictyBase is the model organism database for the social amoeba Dictyostelium discoideum and related species. The primary mission of dictyBase is to provide the biomedical research community with well-integrated high quality data, and tools that enable original research. Data presented at dictyBase is obtained from sequencing centers, groups performing high throughput experiments such as large-scale mutagenesis studies, and RNAseq data, as well as a growing number of manually added functional gene annotations from the published literature, including Gene Ontology, strain, and phenotype annotations. Through the Dicty Stock Center we provide the community with an impressive amount of annotated strains and plasmids. Recently dictyBase accomplished a major overhaul to adapt an outdated infrastructure to the current technological advances, thus facilitating the implementation of innovative tools and comparative genomics. It also provides new strategies for high quality annotations that enable bench researchers to benefit from the rapidly increasing volume of available data. dictyBase is highly responsive to its users needs, building a successful relationship that capitalizes on the vast efforts of the Dictyostelium research community. dictyBase has become the trusted data resource for Dictyostelium investigators, other investigators or organizations seeking information about Dictyostelium, as well as educators who use this model system. PMID:26088819

  1. dictyBase 2015: Expanding data and annotations in a new software environment.


    Basu, Siddhartha; Fey, Petra; Jimenez-Morales, David; Dodson, Robert J; Chisholm, Rex L


    dictyBase is the model organism database for the social amoeba Dictyostelium discoideum and related species. The primary mission of dictyBase is to provide the biomedical research community with well-integrated high quality data, and tools that enable original research. Data presented at dictyBase is obtained from sequencing centers, groups performing high throughput experiments such as large-scale mutagenesis studies, and RNAseq data, as well as a growing number of manually added functional gene annotations from the published literature, including Gene Ontology, strain, and phenotype annotations. Through the Dicty Stock Center we provide the community with an impressive amount of annotated strains and plasmids. Recently, dictyBase accomplished a major overhaul to adapt an outdated infrastructure to the current technological advances, thus facilitating the implementation of innovative tools and comparative genomics. It also provides new strategies for high quality annotations that enable bench researchers to benefit from the rapidly increasing volume of available data. dictyBase is highly responsive to its users needs, building a successful relationship that capitalizes on the vast efforts of the Dictyostelium research community. dictyBase has become the trusted data resource for Dictyostelium investigators, other investigators or organizations seeking information about Dictyostelium, as well as educators who use this model system.

  2. Defects in the synthetic pathway prevent DIF-1 mediated stalk lineage specification cascade in the non-differentiating social amoeba, Acytostelium subglobosum.


    Mohri, Kurato; Hata, Takashi; Kikuchi, Haruhisa; Oshima, Yoshiteru; Urushihara, Hideko


    Separation of somatic cells from germ-line cells is a crucial event for multicellular organisms, but how this step was achieved during evolution remains elusive. In Dictyostelium discoideum and many other dictyostelid species, solitary amoebae gather and form a multicellular fruiting body in which germ-line spores and somatic stalk cells differentiate, whereas in Acytostelium subglobosum, acellular stalks form and all aggregated amoebae become spores. In this study, because most D. discoideum genes known to be required for stalk cell differentiation have homologs in A. subglobosum, we inferred functional variations in these genes and examined conservation of the stalk cell specification cascade of D. discoideum mediated by the polyketide differentiation-inducing factor-1 (DIF-1) in A. subglobosum. Through heterologous expression of A. subglobosum orthologs of DIF-1 biosynthesis genes in D. discoideum, we confirmed that two of the three genes were functional equivalents, while DIF-methyltransferase (As-dmtA) involved at the final step of DIF-1 synthesis was not. In fact, DIF-1 activity was undetectable in A. subglobosum lysates and amoebae of this species were not responsive to DIF-1, suggesting a lack of DIF-1 production in this species. On the other hand, the molecular function of an A. subglobosum ortholog of DIF-1 responsive transcription factor was equivalent with that of D. discoideum and inhibition of polyketide synthesis caused developmental arrest in A. subglobosum, which could not be rescued by DIF-1 addition. These results suggest that non-DIF-1 polyketide cascades involving downstream transcription factors are required for fruiting body development of A. subglobosum. PMID:24876391

  3. Cross-species functional complementation of cellulose synthase during the development of cellular slime molds.


    Kuwayama, Hidekazu; Tohyama, Takeru; Urushihara, Hideko


    Cellulose is a major and important component of the extracellular matrix during the development of Dictyostelium discoideum. Upon starvation, solitary amoebae of D. discoideum gather and form fruiting bodies in which cells differentiate into stalk cells and spores. The stalk tubes and walls of spores and stalk cells are made of cellulose. In the genus Acytostelium, however, all cells are destined to become spores and the stalks comprise only a cellulose tube, suggesting species-specific regulation of cellulose synthesis. In this study, we cloned a putative cellulose synthase gene (cesA) of Acytostelium subglobosum and performed comparative analyses with the D. discoideum cellulose synthase gene (dcsA). Although the deduced amino acid sequences were highly conserved between cesA and dcsA, the numbers of transmembrane spans preceding the catalytic domain were dissimilar; 2 and 3, respectively. Since ectopic expression of cesA in dcsA(-) null cells failed to restore the developmental defects of the mutant, we constructed a series of chimerical genes for complementation analyses and found that the catalytic domain of cesA was functional in D. discoideum cells if the preceding transmembrane region was swapped with dcsA. The non-functional products that contained the cesA-derived transmembrane region were localized to lysosomes. These results indicate that the transmembrane region of cellulose synthase is essential for proper accumulation of cellulose during the development of D. discoideum and that its differential localization in A. subglobosum may be related to the characteristic morphogenesis in this species.

  4. Virulence determinants of the human pathogenic fungus Aspergillus fumigatus protect against soil amoeba predation.


    Hillmann, Falk; Novohradská, Silvia; Mattern, Derek J; Forberger, Tilmann; Heinekamp, Thorsten; Westermann, Martin; Winckler, Thomas; Brakhage, Axel A


    Filamentous fungi represent classical examples for environmentally acquired human pathogens whose major virulence mechanisms are likely to have emerged long before the appearance of innate immune systems. In natural habitats, amoeba predation could impose a major selection pressure towards the acquisition of virulence attributes. To test this hypothesis, we exploited the amoeba Dictyostelium discoideum to study its interaction with Aspergillus fumigatus, two abundant soil inhabitants for which we found co-occurrence in various sites. Fungal conidia were efficiently taken up by D. discoideum, but ingestion was higher when conidia were devoid of the green fungal spore pigment dihydroxynaphtalene melanin, in line with earlier results obtained for immune cells. Conidia were able to survive phagocytic processing, and intracellular germination was initiated only after several hours of co-incubation which eventually led to a lethal disruption of the host cell. Besides phagocytic interactions, both amoeba and fungus secreted cross inhibitory factors which suppressed fungal growth or induced amoeba aggregation with subsequent cell lysis, respectively. On the fungal side, we identified gliotoxin as the major fungal factor killing Dictyostelium, supporting the idea that major virulence attributes, such as escape from phagocytosis and the secretion of mycotoxins are beneficial to escape from environmental predators.

  5. Virulence determinants of the human pathogenic fungus Aspergillus fumigatus protect against soil amoeba predation.


    Hillmann, Falk; Novohradská, Silvia; Mattern, Derek J; Forberger, Tilmann; Heinekamp, Thorsten; Westermann, Martin; Winckler, Thomas; Brakhage, Axel A


    Filamentous fungi represent classical examples for environmentally acquired human pathogens whose major virulence mechanisms are likely to have emerged long before the appearance of innate immune systems. In natural habitats, amoeba predation could impose a major selection pressure towards the acquisition of virulence attributes. To test this hypothesis, we exploited the amoeba Dictyostelium discoideum to study its interaction with Aspergillus fumigatus, two abundant soil inhabitants for which we found co-occurrence in various sites. Fungal conidia were efficiently taken up by D. discoideum, but ingestion was higher when conidia were devoid of the green fungal spore pigment dihydroxynaphtalene melanin, in line with earlier results obtained for immune cells. Conidia were able to survive phagocytic processing, and intracellular germination was initiated only after several hours of co-incubation which eventually led to a lethal disruption of the host cell. Besides phagocytic interactions, both amoeba and fungus secreted cross inhibitory factors which suppressed fungal growth or induced amoeba aggregation with subsequent cell lysis, respectively. On the fungal side, we identified gliotoxin as the major fungal factor killing Dictyostelium, supporting the idea that major virulence attributes, such as escape from phagocytosis and the secretion of mycotoxins are beneficial to escape from environmental predators. PMID:25684622

  6. Toxicity assessment through multiple endpoint bioassays in soils posing environmental risk according to regulatory screening values.


    Rodriguez-Ruiz, A; Asensio, V; Zaldibar, B; Soto, M; Marigómez, I


    Toxicity profiles of two soils (a brownfield in Legazpi and an abandoned iron mine in Zugaztieta; Basque Country) contaminated with several metals (As, Zn, Pb and Cu in Legazpi; Zn, Pb, Cd and Cu in Zugaztieta) and petroleum hydrocarbons (in Legazpi) were determined using a multi-endpoint bioassay approach. Investigated soils exceeded screening values (SVs) of regulatory policies in force (Basque Country; Europe). Acute and chronic toxicity bioassays were conducted with a selected set of test species (Vibrio fischeri, Dictyostelium discoideum, Lactuca sativa, Raphanus sativus and Eisenia fetida) in combination with chemical analysis of soils and elutriates, as well as with bioaccumulation studies in earthworms. The sensitivity of the test species and the toxicity endpoints varied depending on the soil. It was concluded that whilst Zugaztieta soil showed very little or no toxicity, Legazpi soil was toxic according to almost all the toxicity tests (solid phase Microtox, D. discoideum inhibition of fruiting body formation and developmental cycle solid phase assays, lettuce seed germination and root elongation test, earthworm acute toxicity and reproduction tests, D. discoideum cell viability and replication elutriate assays). Thus, albeit both soils had similar SVs, their ecotoxicological risk, and therefore the need for intervening, was different for each soil as unveiled after toxicity profiling based on multiple endpoint bioassays. Such a toxicity profiling approach is suitable to be applied for scenario-targeted soil risk assessment in those cases where applicable national/regional soil legislation based on SVs demands further toxicity assessment. PMID:24819436

  7. Toxicity assessment through multiple endpoint bioassays in soils posing environmental risk according to regulatory screening values.


    Rodriguez-Ruiz, A; Asensio, V; Zaldibar, B; Soto, M; Marigómez, I


    Toxicity profiles of two soils (a brownfield in Legazpi and an abandoned iron mine in Zugaztieta; Basque Country) contaminated with several metals (As, Zn, Pb and Cu in Legazpi; Zn, Pb, Cd and Cu in Zugaztieta) and petroleum hydrocarbons (in Legazpi) were determined using a multi-endpoint bioassay approach. Investigated soils exceeded screening values (SVs) of regulatory policies in force (Basque Country; Europe). Acute and chronic toxicity bioassays were conducted with a selected set of test species (Vibrio fischeri, Dictyostelium discoideum, Lactuca sativa, Raphanus sativus and Eisenia fetida) in combination with chemical analysis of soils and elutriates, as well as with bioaccumulation studies in earthworms. The sensitivity of the test species and the toxicity endpoints varied depending on the soil. It was concluded that whilst Zugaztieta soil showed very little or no toxicity, Legazpi soil was toxic according to almost all the toxicity tests (solid phase Microtox, D. discoideum inhibition of fruiting body formation and developmental cycle solid phase assays, lettuce seed germination and root elongation test, earthworm acute toxicity and reproduction tests, D. discoideum cell viability and replication elutriate assays). Thus, albeit both soils had similar SVs, their ecotoxicological risk, and therefore the need for intervening, was different for each soil as unveiled after toxicity profiling based on multiple endpoint bioassays. Such a toxicity profiling approach is suitable to be applied for scenario-targeted soil risk assessment in those cases where applicable national/regional soil legislation based on SVs demands further toxicity assessment.

  8. The Evolution of Aggregative Multicellularity and Cell-Cell Communication in the Dictyostelia.


    Du, Qingyou; Kawabe, Yoshinori; Schilde, Christina; Chen, Zhi-Hui; Schaap, Pauline


    Aggregative multicellularity, resulting in formation of a spore-bearing fruiting body, evolved at least six times independently amongst both eukaryotes and prokaryotes. Amongst eukaryotes, this form of multicellularity is mainly studied in the social amoeba Dictyostelium discoideum. In this review, we summarise trends in the evolution of cell-type specialisation and behavioural complexity in the four major groups of Dictyostelia. We describe the cell-cell communication systems that control the developmental programme of D. discoideum, highlighting the central role of cAMP in the regulation of cell movement and cell differentiation. Comparative genomic studies showed that the proteins involved in cAMP signalling are deeply conserved across Dictyostelia and their unicellular amoebozoan ancestors. Comparative functional analysis revealed that cAMP signalling in D. discoideum originated from a second messenger role in amoebozoan encystation. We highlight some molecular changes in cAMP signalling genes that were responsible for the novel roles of cAMP in multicellular development. PMID:26284972

  9. Extracellular and intracellular factors regulating the migration direction of a chemotactic cell in traveling-wave chemotaxis

    NASA Astrophysics Data System (ADS)

    Ishiwata, R.; Iwasa, M.


    This report presents a simple model that describes the motion of a single Dictyostelium discoideum cell exposed to a traveling wave of cyclic adenosine monophosphate (cAMP). The model incorporates two types of responses to stimulation by cAMP: the changes in the polarity and motility of the cell. The periodic change in motility is assumed to be induced by periodic cAMP stimulation on the basis of previous experimental studies. Consequently, the net migration of the cell occurs in a particular direction with respect to wave propagation, which explains the migration of D. discoideum cells in aggregation. The wave period and the difference between the two response times are important parameters that determine the direction of migration. The theoretical prediction compared with experiments presented in another study. The transition from the single-cell state of the population of D. discoideum cells to the aggregation state is understood to be a specific example of spontaneous breakage of symmetry in biology.

  10. The IQGAP-related protein DGAP1 interacts with Rac and is involved in the modulation of the F-actin cytoskeleton and control of cell motility.


    Faix, J; Clougherty, C; Konzok, A; Mintert, U; Murphy, J; Albrecht, R; Mühlbauer, B; Kuhlmann, J


    DGAP1 of Dictyostelium discoideum is a cell cortex associated 95 kDa protein that shows homology to both RasGTPase-activating proteins (RasGAPs) and RasGAP-related proteins. When tested for RasGAP activity, recombinant DGAP1 protein did not promote the GTPase activity of human H-Ras or of Dictyostelium RasG in vitro. Instead, DGAP1 bound to Dictyostelium Rac1A and human Rac1, but not to human Cdc42. DGAP1 preferentially interacted with the activated GTP-bound forms of Rac1 and Rac1A, but did not affect the GTPase activities. Since Rho-type GTPases are implicated in the formation of specific F-actin structures and in the control of cell morphology, the microfilament system of mutants that either lack or overexpress DGAP1 has been analysed. DGAP1-null mutants showed elevated levels of F-actin that was organised in large leading edges, membrane ruffles or numerous large filopods. Expression of actin fused to green fluorescent protein (GFP) was used to monitor the actin dynamics in these cells, and revealed that the F-actin cytoskeleton of DGAP1-null cells was rapidly re-arranged to form ruffles and filopods. Conversely, in DGAP1-overexpressing cells, the formation of cellular projections containing F-actin was largely suppressed. Measurement of cell migration demonstrated that DGAP1 expression is inversely correlated with the speed of cell motility. PMID:9739079

  11. Defective ribosome assembly in Shwachman-Diamond syndrome.


    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J


    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  12. Temporal and non-permanent division of labor during sorocarp formation in the social amoeba Acytostelium subglobosum.


    Mohri, Kurato; Kiyota, Yu; Kuwayama, Hidekazu; Urushihara, Hideko


    Somatic cell differentiation is crucial for the development of multicellular organisms. While the development of a fruiting body in Dictyostelium discoideum represents a simple model of this process with separation of stalk cells from the spore lineage, that of Acytostelium subglobosum is not accompanied by cell type separation. This species produces acellular stalks and, seemingly, all aggregated amoebae become spores; however, it possesses homologs for the stalk-cell marker genes of D. discoideum. In this study, we analyzed the spatio-temporal expression of A. subglobosum orthologs for D. discoideum stalk- or spore-lineage markers to clarify the developmental process of A. subglobosum. We first found that the prespore vesicles, which contained spore coat proteins, started to accumulate in the tip region and were observed in the entire sorogen throughout later development, confirming that all A. subglobosum cells became spores. The expression of a stalk-lineage gene ortholog, As-ecmA, started at the mound stage and was prominent in the protruding sorogen. Although two spore-lineage gene orthologs, As-cotD1 and -cotD2, were likewise detected shortly after cell aggregation and increased in intensity until tip formation, their expression diminished in the protruding sorogen. Double-fluorescence staining of these prestalk and prespore marker genes revealed that the expression of these marker genes was mutually exclusive and that expression switching occurred in the early tip. Our results indicate that A. subglobosum cells become committed to the spore lineage first, and then, while keeping this commitment intact, participate in stalk formation. Instead of the permanent division of labor observed in D. discoideum, A. subglobosum produces fruiting bodies by all cells contributing to the formation of the stalk as well as forming spores.

  13. Phylogenetic analysis of CDK and cyclin proteins in premetazoan lineages

    PubMed Central


    Background The molecular history of animal evolution from single-celled ancestors remains a major question in biology, and little is known regarding the evolution of cell cycle regulation during animal emergence. In this study, we conducted a comprehensive evolutionary analysis of CDK and cyclin proteins in metazoans and their unicellular relatives. Results Our analysis divided the CDK family into eight subfamilies. Seven subfamilies (CDK1/2/3, CDK5, CDK7, CDK 20, CDK8/19, CDK9, and CDK10/11) are conserved in metazoans and fungi, with the remaining subfamily, CDK4/6, found only in eumetazoans. With respect to cyclins, cyclin C, H, L, Y subfamilies, and cyclin K and T as a whole subfamily, are generally conserved in animal, fungi, and amoeba Dictyostelium discoideum. In contrast, cyclin subfamilies B, A, E, and D, which are cell cycle-related, have distinct evolutionary histories. The cyclin B subfamily is generally conserved in D. discoideum, fungi, and animals, whereas cyclin A and E subfamilies are both present in animals and their unicellular relatives such as choanoflagellate Monosiga brevicollis and filasterean Capsaspora owczarzaki, but are absent in fungi and D. discoideum. Although absent in fungi and D. discoideum, cyclin D subfamily orthologs can be found in the early-emerging, non-opisthokont apusozoan Thecamonas trahens. Within opisthokonta, the cyclin D subfamily is conserved only in eumetazoans, and is absent in fungi, choanoflagellates, and the basal metazoan Amphimedon queenslandica. Conclusions Our data indicate that the CDK4/6 subfamily and eumetazoans emerged simultaneously, with the evolutionary conservation of the cyclin D subfamily also tightly linked with eumetazoan appearance. Establishment of the CDK4/6-cyclin D complex may have been the key step in the evolution of cell cycle control during eumetazoan emergence. PMID:24433236

  14. Evolution of centrosomes and the nuclear lamina: Amoebozoan assets.


    Gräf, Ralph; Batsios, Petros; Meyer, Irene


    The current eukaryotic tree of life groups most eukaryotes into one of five supergroups, the Opisthokonta, Amoebozoa, Archaeplastida, Excavata and SAR (Stramenopile, Alveolata, Rhizaria). Molecular and comparative morphological analyses revealed that the last eukaryotic common ancestor (LECA) already contained a rather sophisticated equipment of organelles including a mitochondrion, an endomembrane system, a nucleus with a lamina, a microtubule-organizing center (MTOC), and a flagellar apparatus. Recent studies of MTOCs, basal bodies/centrioles, and nuclear envelope organization of organisms in different supergroups have clarified our picture of how the nucleus and MTOCs co-evolved from LECA to extant eukaryotes. In this review we summarize these findings with special emphasis on valuable contributions of research on a lamin-like protein, nuclear envelope proteins, and the MTOC in the amoebozoan model organism Dictyostelium discoideum. PMID:25952183

  15. Pathogen vacuole purification from legionella-infected amoeba and macrophages.


    Hoffmann, Christine; Finsel, Ivo; Hilbi, Hubert


    Legionella pneumophila replicates intracellularly in environmental and immune phagocytes within a unique membrane-bound compartment, the Legionella-containing vacuole (LCV). Formation of LCVs is strictly dependent on the Icm/Dot type IV secretion system and the translocation of "effector" proteins into the cell. Some effector proteins decorate the LCV membrane and subvert host cell vesicle trafficking pathways. Here we describe a method to purify intact LCVs from Dictyostelium discoideum amoebae and RAW 264.7 murine macrophages. The method comprises a two-step protocol: first, LCVs are enriched by immuno-magnetic separation using an antibody against a bacterial effector protein specifically localizing to the LCV membrane, and second, the LCVs are further purified by density gradient centrifugation. The purified LCVs can be characterized by proteomics and other biochemical approaches.

  16. Free-living amoebae, a training field for macrophage resistance of mycobacteria.


    Salah, I B; Ghigo, E; Drancourt, M


    Mycobacterium species evolved from an environmental recent common ancestor by reductive evolution and lateral gene transfer. Strategies selected through evolution and developed by mycobacteria resulted in resistance to predation by environmental unicellular protists, including free-living amoebae. Indeed, mycobacteria are isolated from the same soil and water environments as are amoebae, and experimental models using Acanthamoeba spp. and Dictyostelium discoideum were exploited to analyse the mechanisms for intracellular survival. Most of these mechanisms have been further reproduced in macrophages for mycobacteria regarded as opportunistic and obligate pathogens. Amoebal cysts may protect intracellular mycobacteria against adverse conditions and may act as a vector for mycobacteria. The latter hypothesis warrants further environmental and clinical studies to better assess the role of free-living amoebae in the epidemiology of infections caused by mycobacteria.

  17. Method for detecting the signature of noise-induced structures in spatiotemporal data sets: an application to excitable media

    NASA Astrophysics Data System (ADS)

    Huett, Marc-Thorsten


    We formulate mathematical tools for analyzing spatiotemporal data sets. The tools are based on nearest-neighbor considerations similar to cellular automata. One of the analysis tools allows for reconstructing the noise intensity in a data set and is an appropriate method for detecting a variety of noise-induced phenomena in spatiotemporal data. The functioning of these methods is illustrated on sample data generated with the forest fire model and with networks of nonlinear oscillators. It is seen that these methods allow the characterization of spatiotemporal stochastic resonance (STSR) in experimental data. Application of these tools to biological spatiotemporal patterns is discussed. For one specific example, the slime mold Dictyostelium discoideum, it is seen, how transitions between different patterns are clearly marked by changes in the spatiotemporal observables.

  18. Induction of Electrode-Cellular Interfaces with ˜ 0.05 μm^2 Contact Areas

    NASA Astrophysics Data System (ADS)

    Flanders, Bret; Thapa, Prem


    Individual cells of the slime mold Dictyostelium discoideum attach themselves to negatively biased nanoelectrodes that are separated by 30 μm from grounded electrodes. There is a -43 mV voltage-threshold for cell-to-electrode attachment, with negligible probability across the 0 to -38 mV range but probability that approaches 0.7 across the -46 to -100 mV range. A cell initiates contact by extending a pseudopod to the electrode and maintains contact until the voltage is turned off. Scanning electron micrographs of these interfaces show the contact areas to be of the order of 0.05 μm^2. Insight into this straight-forward, reproducible process may lead to new electrode-cellular attachment strategies that complement established approaches, such as blind sampling and patch clamp.

  19. Multiscale dynamics of biological cells with chemotactic interactions: From a discrete stochastic model to a continuous description

    NASA Astrophysics Data System (ADS)

    Alber, Mark; Chen, Nan; Glimm, Tilmann; Lushnikov, Pavel M.


    The cellular Potts model (CPM) has been used for simulating various biological phenomena such as differential adhesion, fruiting body formation of the slime mold Dictyostelium discoideum, angiogenesis, cancer invasion, chondrogenesis in embryonic vertebrate limbs, and many others. We derive a continuous limit of a discrete one-dimensional CPM with the chemotactic interactions between cells in the form of a Fokker-Planck equation for the evolution of the cell probability density function. This equation is then reduced to the classical macroscopic Keller-Segel model. In particular, all coefficients of the Keller-Segel model are obtained from parameters of the CPM. Theoretical results are verified numerically by comparing Monte Carlo simulations for the CPM with numerics for the Keller-Segel model.