Science.gov

Sample records for differential expression proteomics

  1. Detecting differential protein expression in large-scale population proteomics

    SciTech Connect

    Ryu, Soyoung; Qian, Weijun; Camp, David G.; Smith, Richard D.; Tompkins, Ronald G.; Davis, Ronald W.; Xiao, Wenzhong

    2014-06-17

    Mass spectrometry-based high-throughput quantitative proteomics shows great potential in clinical biomarker studies, identifying and quantifying thousands of proteins in biological samples. However, methods are needed to appropriately handle issues/challenges unique to mass spectrometry data in order to detect as many biomarker proteins as possible. One issue is that different mass spectrometry experiments generate quite different total numbers of quantified peptides, which can result in more missing peptide abundances in an experiment with a smaller total number of quantified peptides. Another issue is that the quantification of peptides is sometimes absent, especially for less abundant peptides and such missing values contain the information about the peptide abundance. Here, we propose a Significance Analysis for Large-scale Proteomics Studies (SALPS) that handles missing peptide intensity values caused by the two mechanisms mentioned above. Our model has a robust performance in both simulated data and proteomics data from a large clinical study. Because varying patients’ sample qualities and deviating instrument performances are not avoidable for clinical studies performed over the course of several years, we believe that our approach will be useful to analyze large-scale clinical proteomics data.

  2. Differential proteomic and tissue expression analyses identify valuable diagnostic biomarkers of hepatocellular differentiation and hepatoid adenocarcinomas.

    PubMed

    Reis, Henning; Padden, Juliet; Ahrens, Maike; Pütter, Carolin; Bertram, Stefanie; Pott, Leona L; Reis, Anna-Carinna; Weber, Frank; Juntermanns, Benjamin; Hoffmann, Andreas-C; Eisenacher, Martin; Schlaak, Joörg F; Canbay, Ali; Meyer, Helmut E; Sitek, Barbara; Baba, Hideo A

    2015-10-01

    The exact discrimination of lesions with true hepatocellular differentiation from secondary tumours and neoplasms with hepatocellular histomorphology like hepatoid adenocarcinomas (HAC) is crucial. Therefore, we aimed to identify ancillary protein biomarkers by using complementary proteomic techniques (2D-DIGE, label-free MS). The identified candidates were immunohistochemically validated in 14 paired samples of hepatocellular carcinoma (HCC) and non-tumourous liver tissue (NT). The candidates and HepPar1/Arginase1 were afterwards tested for consistency in a large cohort of hepatocellular lesions and NT (n = 290), non-hepatocellular malignancies (n = 383) and HAC (n = 13). Eight non-redundant, differentially expressed proteins were suitable for further immunohistochemical validation and four (ABAT, BHMT, FABP1, HAOX1) for further evaluation. Sensitivity and specificity rates for HCC/HAC were as follows: HepPar1 80.2%, 94.3% / 80.2%, 46.2%; Arginase1 82%, 99.4% / 82%, 69.2%; BHMT 61.4%, 93.8% / 61.4%, 100%; ABAT 84.4%, 33.7% / 84.4%, 30.8%; FABP1 87.2%, 95% / 87.2%, 69.2%; HAOX1 95.5%, 36.3% / 95.5%, 46.2%. The best 2×/3× biomarker panels for the diagnosis of HCC consisted of Arginase1/HAOX1 and BHMT/Arginase1/HAOX1 and for HAC consisted of Arginase1/FABP1 and BHMT/Arginase1/FABP1. In summary, we successfully identified, validated and benchmarked protein biomarker candidates of hepatocellular differentiation. BHMT in particular exhibited superior diagnostic characteristics in hepatocellular lesions and specifically in HAC. BHMT is therefore a promising (panel based) biomarker candidate in the differential diagnostic process of lesions with hepatocellular aspect.

  3. A Hybrid Approach to Protein Differential Expression in Mass Spectrometry-Based Proteomics

    SciTech Connect

    Wang, Xuan; Anderson, Gordon A.; Smith, Richard D.; Dabney, Alan R.

    2012-04-19

    Motivation: Quantitative mass spectrometry-based proteomics involves statistical inference on protein abundance, based on the intensities of each protein's associated spectral peaks. However, typical MS-based proteomics data sets have substantial proportions of missing observations, due at least in part to censoring of low intensities. This complicates intensity-based differential expression analysis. Results: We outline a statistical method for protein differential expression, based on a simple Binomial likelihood. By modeling peak intensities as binary, in terms of 'presence/ absence,' we enable the selection of proteins not typically amendable to quantitative analysis; e.g., 'one-state' proteins that are present in one condition but absent in another. In addition, we present an analysis protocol that combines quantitative and presence/ absence analysis of a given data set in a principled way, resulting in a single list of selected proteins with a single associated FDR.

  4. Proteomic analysis of cow, yak, buffalo, goat and camel milk whey proteins: quantitative differential expression patterns.

    PubMed

    Yang, Yongxin; Bu, Dengpan; Zhao, Xiaowei; Sun, Peng; Wang, Jiaqi; Zhou, Lingyun

    2013-04-05

    To aid in unraveling diverse genetic and biological unknowns, a proteomic approach was used to analyze the whey proteome in cow, yak, buffalo, goat, and camel milk based on the isobaric tag for relative and absolute quantification (iTRAQ) techniques. This analysis is the first to produce proteomic data for the milk from the above-mentioned animal species: 211 proteins have been identified and 113 proteins have been categorized according to molecular function, cellular components, and biological processes based on gene ontology annotation. The results of principal component analysis showed significant differences in proteomic patterns among goat, camel, cow, buffalo, and yak milk. Furthermore, 177 differentially expressed proteins were submitted to advanced hierarchical clustering. The resulting clustering pattern included three major sample clusters: (1) cow, buffalo, and yak milk; (2) goat, cow, buffalo, and yak milk; and (3) camel milk. Certain proteins were chosen as characterization traits for a given species: whey acidic protein and quinone oxidoreductase for camel milk, biglycan for goat milk, uncharacterized protein (Accession Number: F1MK50 ) for yak milk, clusterin for buffalo milk, and primary amine oxidase for cow milk. These results help reveal the quantitative milk whey proteome pattern for analyzed species. This provides information for evaluating adulteration of specific specie milk and may provide potential directions for application of specific milk protein production based on physiological differences among animal species.

  5. Quantitative Proteomic Analysis of Differentially Expressed Protein Profiles Involved in Pancreatic Ductal Adenocarcinoma

    PubMed Central

    Kuo, Kung-Kai; Kuo, Chao-Jen; Chiu, Chiang-Yen; Liang, Shih-Shin; Huang, Chun-Hao; Chi, Shu-Wen; Tsai, Kun-Bow; Chen, Chiao-Yun; Hsi, Edward; Cheng, Kuang-Hung; Chiou, Shyh-Horng

    2016-01-01

    Objectives The aim of this study was to identify differentially expressed proteins among various stages of pancreatic ductal adenocarcinoma (PDAC) by shotgun proteomics using nano-liquid chromatography coupled tandem mass spectrometry and stable isotope dimethyl labeling. Methods Differentially expressed proteins were identified and compared based on the mass spectral differences of their isotope-labeled peptide fragments generated from protease digestion. Results Our quantitative proteomic analysis of the differentially expressed proteins with stable isotope (deuterium/hydrogen ratio, ≥2) identified a total of 353 proteins, with at least 5 protein biomarker proteins that were significantly differentially expressed between cancer and normal mice by at least a 2-fold alteration. These 5 protein biomarker candidates include α-enolase, α-catenin, 14-3-3 β, VDAC1, and calmodulin with high confidence levels. The expression levels were also found to be in agreement with those examined by Western blot and histochemical staining. Conclusions The systematic decrease or increase of these identified marker proteins may potentially reflect the morphological aberrations and diseased stages of pancreas carcinoma throughout progressive developments leading to PDAC. The results would form a firm foundation for future work concerning validation and clinical translation of some identified biomarkers into targeted diagnosis and therapy for various stages of PDAC. PMID:26262590

  6. Differential Expression of Proteins Associated with the Hair Follicle Cycle - Proteomics and Bioinformatics Analyses

    PubMed Central

    Tian, Tian; Yang, Mifang; Li, Zhongming; Ping, Fengfeng; Fan, Weixin

    2016-01-01

    Hair follicle cycling can be divided into the following three stages: anagen, catagen, and telogen. The molecular signals that orchestrate the follicular transition between phases are still unknown. To better understand the detailed protein networks controlling this process, proteomics and bioinformatics analyses were performed to construct comparative protein profiles of mouse skin at specific time points (0, 8, and 20 days). Ninety-five differentially expressed protein spots were identified by MALDI-TOF/TOF as 44 proteins, which were found to change during hair follicle cycle transition. Proteomics analysis revealed that these changes in protein expression are involved in Ca2+-regulated biological processes, migration, and regulation of signal transduction, among other processes. Subsequently, three proteins were selected to validate the reliability of expression patterns using western blotting. Cluster analysis revealed three expression patterns, and each pattern correlated with specific cell processes that occur during the hair cycle. Furthermore, bioinformatics analysis indicated that the differentially expressed proteins impacted multiple biological networks, after which detailed functional analyses were performed. Taken together, the above data may provide insight into the three stages of mouse hair follicle morphogenesis and provide a solid basis for potential therapeutic molecular targets for this hair disease. PMID:26752403

  7. Proteomic analyses of methamphetamine (METH)-induced differential protein expression by immature dendritic cells (IDC).

    PubMed

    Reynolds, Jessica L; Mahajan, Supriya D; Sykes, Donald E; Schwartz, Stanley A; Nair, Madhavan P N

    2007-04-01

    In the US, the increase in methamphetamine (METH) use has been associated with increased human immunodeficiency virus (HIV-1) infection. Dendritic cells (DC) are the first line of defense against HIV-1. DC play a critical role in harboring HIV-1 and facilitate the infection of neighboring T cells. However, the role of METH on HIV-1 infectivity and the expression of the proteome of immature dendritic cells (IDC) has not been elucidated. We hypothesize that METH modulates the expression of a number of proteins by IDC that foster the immunopathogenesis of HIV-1 infection. We utilized LTR amplification, p24 antigen assay and the proteomic method of difference gel electrophoresis (DIGE) combined with protein identification through high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) to analyze the effects of METH on HIV-1 infectivity (HIV-1 IIIB; CXCR4-tropic, X4 strain) and the proteomic profile of IDC. Our results demonstrate that METH potentiates HIV-1 replication in IDC. Furthermore, METH significantly differentially regulates the expression of several proteins including CXCR3, protein disulfide isomerase, procathepsin B, peroxiredoxin and galectin-1. Identification of unique, METH-induced proteins may help to develop novel markers for diagnostic, preventive and therapeutic targeting in METH using subjects.

  8. f-divergence cutoff index to simultaneously identify differential expression in the integrated transcriptome and proteome

    PubMed Central

    Tang, Shaojun; Hemberg, Martin; Cansizoglu, Ertugrul; Belin, Stephane; Kosik, Kenneth; Kreiman, Gabriel; Steen, Hanno; Steen, Judith

    2016-01-01

    The ability to integrate ‘omics’ (i.e. transcriptomics and proteomics) is becoming increasingly important to the understanding of regulatory mechanisms. There are currently no tools available to identify differentially expressed genes (DEGs) across different ‘omics’ data types or multi-dimensional data including time courses. We present fCI (f-divergence Cut-out Index), a model capable of simultaneously identifying DEGs from continuous and discrete transcriptomic, proteomic and integrated proteogenomic data. We show that fCI can be used across multiple diverse sets of data and can unambiguously find genes that show functional modulation, developmental changes or misregulation. Applying fCI to several proteogenomics datasets, we identified a number of important genes that showed distinctive regulation patterns. The package fCI is available at R Bioconductor and http://software.steenlab.org/fCI/. PMID:26980280

  9. Identification of differentially expressed peptides in high-throughput proteomics data.

    PubMed

    van Ooijen, Michiel P; Jong, Victor L; Eijkemans, Marinus J C; Heck, Albert J R; Andeweg, Arno C; Binai, Nadine A; van den Ham, Henk-Jan

    2017-03-23

    With the advent of high-throughput proteomics, the type and amount of data pose a significant challenge to statistical approaches used to validate current quantitative analysis. Whereas many studies focus on the analysis at the protein level, the analysis of peptide-level data provides insight into changes at the sub-protein level, including splice variants, isoforms and a range of post-translational modifications. Statistical evaluation of liquid chromatography-mass spectrometry/mass spectrometry peptide-based label-free differential data is most commonly performed using a t-test or analysis of variance, often after the application of data imputation to reduce the number of missing values. In high-throughput proteomics, statistical analysis methods and imputation techniques are difficult to evaluate, given the lack of gold standard data sets. Here, we use experimental and resampled data to evaluate the performance of four statistical analysis methods and the added value of imputation, for different numbers of biological replicates. We find that three or four replicates are the minimum requirement for high-throughput data analysis and confident assignment of significant changes. Data imputation does increase sensitivity in some cases, but leads to a much higher actual false discovery rate. Additionally, we find that empirical Bayes method (limma) achieves the highest sensitivity, and we thus recommend its use for performing differential expression analysis at the peptide level.

  10. Quantitative Analysis of Differential Proteome Expression in Bladder Cancer vs. Normal Bladder Cells Using SILAC Method

    PubMed Central

    Yang, Ganglong; Xu, Zhipeng; Lu, Wei; Li, Xiang; Sun, Chengwen; Guo, Jia; Xue, Peng; Guan, Feng

    2015-01-01

    The best way to increase patient survival rate is to identify patients who are likely to progress to muscle-invasive or metastatic disease upfront and treat them more aggressively. The human cell lines HCV29 (normal bladder epithelia), KK47 (low grade nonmuscle invasive bladder cancer, NMIBC), and YTS1 (metastatic bladder cancer) have been widely used in studies of molecular mechanisms and cell signaling during bladder cancer (BC) progression. However, little attention has been paid to global quantitative proteome analysis of these three cell lines. We labeled HCV29, KK47, and YTS1 cells by the SILAC method using three stable isotopes each of arginine and lysine. Labeled proteins were analyzed by 2D ultrahigh-resolution liquid chromatography LTQ Orbitrap mass spectrometry. Among 3721 unique identified and annotated proteins in KK47 and YTS1 cells, 36 were significantly upregulated and 74 were significantly downregulated with >95% confidence. Differential expression of these proteins was confirmed by western blotting, quantitative RT-PCR, and cell staining with specific antibodies. Gene ontology (GO) term and pathway analysis indicated that the differentially regulated proteins were involved in DNA replication and molecular transport, cell growth and proliferation, cellular movement, immune cell trafficking, and cell death and survival. These proteins and the advanced proteome techniques described here will be useful for further elucidation of molecular mechanisms in BC and other types of cancer. PMID:26230496

  11. Proteomics identification of differentially expressed proteins associated with pollen germination and tube growth reveals characteristics of germinated Oryza sativa pollen.

    PubMed

    Dai, Shaojun; Chen, Taotao; Chong, Kang; Xue, Yongbiao; Liu, Siqi; Wang, Tai

    2007-02-01

    Mature pollen from most plant species is metabolically quiescent; however, after pollination, it germinates quickly and gives rise to a pollen tube to transport sperms into the embryo sac. Because methods for collecting a large amount of in vitro germinated pollen grains for transcriptomics and proteomics studies from model plants of Arabidopsis and rice are not available, molecular information about the germination developmental process is lacking. Here we describe a method for obtaining a large quantity of in vitro germinating rice pollen for proteomics study. Two-dimensional electrophoresis of approximately 2300 protein spots revealed 186 that were differentially expressed in mature and germinated pollen. Most showed a changed level of expression, and only 66 appeared to be specific to developmental stages. Furthermore 160 differentially expressed protein spots were identified on mass spectrometry to match 120 diverse protein species. These proteins involve different cellular and metabolic processes with obvious functional skew toward wall metabolism, protein synthesis and degradation, cytoskeleton dynamics, and carbohydrate/energy metabolism. Wall metabolism-related proteins are prominently featured in the differentially expressed proteins and the pollen proteome as compared with rice sporophytic proteomes. Our study also revealed multiple isoforms and differential expression patterns between isoforms of a protein. These results provide novel insights into pollen function specialization.

  12. Proteomic analysis reveals differentially expressed proteins in the rat frontal cortex after methamphetamine treatment.

    PubMed

    Faure, J J; Hattingh, S M; Stein, D J; Daniels, W M

    2009-12-01

    Methamphetamine (MA) is an addictive psycho-stimulant and the illicit use of the drug is escalating. In the present study, we examined protein expression profiles in the rat frontal cortex exposed to a total of eight MA injections (1 mg/kg, intraperitoneal) using 2-DE based proteomics. We investigated protein changes occurring in both the cytosolic fraction and the membrane fraction. 2-DE analysis resulted in 62 cytosolic and 44 membrane protein spots that were differentially regulated in the frontal cortex of rats exposed to MA when compared to control animals. Of these spots, 47 cytosolic and 42 membrane proteins were identified respectively, using ESI-Quad-TOF, which included ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCH-L1), beta-synuclein, 78 kDa glucose-regulated protein (GRP 78), gamma-enolase, dihydropyrimidase-related protein 2 (DRP 2), complexin 2 and synapsin II. These proteins are associated with protein degradation, redox regulation, energy metabolism, cellular growth, cytoskeletal modifications and synaptic function. Proteomic research may be useful in exploring the complex underlying molecular mechanisms of MA dependence.

  13. Comparative proteomic analysis of differentially expressed proteins between peripheral sensory and motor nerves.

    PubMed

    He, Qianru; Man, Lili; Ji, Yuhua; Zhang, Shuqiang; Jiang, Maorong; Ding, Fei; Gu, Xiaosong

    2012-06-01

    Peripheral sensory and motor nerves have different functions and different approaches to regeneration, especially their distinct ability to accurately reinervate terminal nerve pathways. To understand the molecular aspects underlying these differences, the proteomics technique by coupling isobaric tags for relative and absolute quantitation (iTRAQ) with online two-dimensional liquid chromatography tandem mass spectrometry (2D LC-MS/MS) was used to investigate the protein profile of sensory and motor nerve samples from rats. A total of 1472 proteins were identified in either sensory or motor nerve. Of them, 100 proteins showed differential expressions between both nerves, and some of them were validated by quantitative real time RT-PCR, Western blot analysis, and immunohistochemistry. In the light of functional categorization, the differentially expressed proteins in sensory and motor nerves, belonging to a broad range of classes, were related to a diverse array of biological functions, which included cell adhesion, cytoskeleton, neuronal plasticity, neurotrophic activity, calcium-binding, signal transduction, transport, enzyme catalysis, lipid metabolism, DNA-binding, synaptosome function, actin-binding, ATP-binding, extracellular matrix, and commitment to other lineages. The relatively higher expressed proteins in either sensory or motor nerve were tentatively discussed in combination with their specific molecular characteristics. It is anticipated that the database generated in this study will provide a solid foundation for further comprehensive investigation of functional differences between sensory and motor nerves, including the specificity of their regeneration.

  14. Do cultural conditions induce differential protein expression: Profiling of extracellular proteome of Aspergillus terreus CM20.

    PubMed

    M, Saritha; Singh, Surender; Tiwari, Rameshwar; Goel, Renu; Nain, Lata

    2016-11-01

    The present study reports the diversity in extracellular proteins expressed by the filamentous fungus, Aspergillus terreus CM20 with respect to differential hydrolytic enzyme production profiles in submerged fermentation (SmF) and solid-state fermentation (SSF) conditions, and analysis of the extracellular proteome. The SSF method was superior in terms of increase in enzyme activities resulting in 1.5-3 fold enhancement as compared to SmF, which was explained by the difference in growth pattern of the fungus under the two culture conditions. As revealed by zymography, multiple isoforms of endo-β-glucanase, β-glucosidase and xylanase were expressed in SSF, but not in SmF. Extracellular proteome profiling of A. terreus CM20 under SSF condition using liquid chromatography coupled tandem mass spectrometry (LC-MS/MS) identified 63 proteins. Functional classification revealed the hydrolytic system to be composed of glycoside hydrolases (56%), proteases (16%), oxidases and dehydrogenases (6%), decarboxylases (3%), esterases (3%) and other proteins (16%). Twenty families of glycoside hydrolases (GH) (1, 3, 5, 7, 10, 11, 12, 15, 16, 28, 30, 32, 35, 43, 54, 62, 67, 72, 74 and 125), and one family each of auxiliary activities (AA7) and carbohydrate esterase (CE1) were detected, unveiling the vast diversity of synergistically acting biomass-cleaving enzymes expressed by the fungus. Saccharification of alkali-pretreated paddy straw with A. terreus CM20 proteins released high amounts of glucose (439.63±1.50mg/gds), xylose (121.04±1.25mg/gds) and arabinose (56.13±0.56mg/gds), thereby confirming the potential of the enzyme cocktail in bringing about considerable conversion of lignocellulosic polysaccharides to sugar monomers.

  15. Identification and validation of differentially expressed proteins in epithelial ovarian cancers using quantitative proteomics

    PubMed Central

    Cao, Guangming; Liu, Chongdong; Xu, Jiatong; Deng, Haiteng; Zhang, Zhenyu

    2016-01-01

    Ovarian cancer is the most lethal gynecological malignant tumor because of its high recurrence rate. In the present work, in order to find new therapeutic targets, we identified 8480 proteins in thirteen pairs of ovarian cancer tissues and normal ovary tissues through quantitative proteomics. 498 proteins were found to be differentially expressed in ovarian cancer, which involved in various cellular processes, including metabolism, response to stimulus and biosynthetic process. The expression levels of chloride intracellular channel protein 1 (CLIC1) and lectin galactoside-binding soluble 3 binding protein (LGALS3BP) in epithelial ovarian cancer tissues were significantly higher than those in normal ovary tissues as confirmed by western blotting and immunohistochemistry. The knockdown of CLIC1 in A2780 cell line downregulated expression of CTPS1, leading to the decrease of CTP and an arrest of cell cycle G1 phase, which results into a slower proliferation. CLIC1-knockdown can also slow down the tumor growth in vivo. Besides, CLIC1-knockdown cells showed an increased sensitivity to hydrogen peroxide and cisplatin, suggesting that CLIC1 was involved in regulation of redox and drug resistance in ovarian cancer cells. These results indicate CLIC1 promotes tumorgenesis, and is a potential therapeutic target in epithelial ovarian cancer treatment. PMID:27825122

  16. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation

    PubMed Central

    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J.; Zhang, Jianyi; Ge, Ying

    2015-01-01

    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function. PMID:26033914

  17. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation.

    PubMed

    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J; Zhang, Jianyi; Ge, Ying

    2015-08-01

    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function.

  18. Comparative proteomic changes of differentially expressed whey proteins in clinical mastitis and healthy yak cows.

    PubMed

    Li, X; Ding, X Z; Wan, Y L; Liu, Y M; Du, G Z

    2014-08-28

    Under the traditional grazing system on the Qinghai-Tibetan Plateau, the amount of milk in domesticated yak (Bos grunniens) with clinical mastitis decreases and the milk composition is altered. To understand the mechanisms of mammary gland secreted milk and disease infection, changes in the protein composition of milk during clinical mastitis were investigated using a proteomic approach. Milk whey from yak with clinical mastitis was compared to whey from healthy animals with two-dimensional gel electrophoresis using a mass spectrometer. Thirteen protein spots were identified to be four differentially expressed proteins. Increases in the concentrations of proteins of blood serum origin, including lactoferrin, were identified in mastitic whey compared to normal whey, while concentrations of the major whey proteins, casocidin-I, a-lactalbumin, and b-lactoglobulin, were downregulated in mastitic whey. These results indicated significant differences in protein expression between healthy yaks and those with clinical mastitis, and they may provide valuable information for finding new regulation markers and potential protein targets for the treatment of mastitis.

  19. Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development.

    PubMed

    Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

    2016-01-01

    Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa (Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and

  20. Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development

    PubMed Central

    Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

    2016-01-01

    Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa (Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and

  1. Proteomic analysis of differential protein expression and processing induced modifications in peanuts and peanut skins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peanut (Arachis hypogaea L.) is grown extensively worldwide for its edible seed and oil. Proteomics has become a powerful tool in plant research; however, studies involving legumes, and especially peanuts, are in their infancy. Furthermore, protein expression in the peanut seed coat (skin), which is...

  2. Comparative proteomic study for profiling differentially expressed proteins between Chinese left- and right-sided colon cancers.

    PubMed

    Shen, Hong; Huang, Jinlin; Pei, Haiping; Zeng, Shan; Tao, Yiming; Shen, Liangfang; Zeng, Liang; Zhu, Hong

    2013-01-01

    The aim of the present study is to profile differentially expressed protein markers between left-sided colon cancer (LSCC) and right-sided colon cancer (RSCC). Fresh tumor tissue samples from LSCC (n = 7) and RSCC (n = 7) groups were analyzed by two-dimensional electrophoresis coupled with MALDI-TOF-MS, followed by Western blotting. In 50 paraffin embedded samples from each group, levels of four differentially expressed proteins (identified by proteomics analysis) were measured by tissue microarray with immunohistochemistry staining to compare the different protein markers between LSCC and RSCC. Sixteen proteins were found to be differentially expressed between LSCC and RSCC. Ten proteins including HSP-60 and PDIA1 were identified to be highly expressed in LSCC (P < 0.01 or P < 0.05), while the expression of six proteins including EEF1D and HSP-27 were higher in RSCC (P < 0.01 or P < 0.05). Virtually all of the indentified proteins were involved in cellular energy metabolism, protein folding/unfolding, and/or oxidative stress. Human colon tumors at various locations have different proteomic biomarkers. Differentially expressed proteins associated with energy metabolism, protein folding/unfolding and oxidative stress contribute to different tumorigenesis, tumor progression, and prognosis between left- and right-sided colon cancer.

  3. Identification of stromal differentially expressed proteins in the colon carcinoma by quantitative proteomics.

    PubMed

    Mu, Yibing; Chen, Yongheng; Zhang, Guiying; Zhan, Xianquan; Li, Yuanyuan; Liu, Ting; Li, Guoqing; Li, Maoyu; Xiao, Zhefeng; Gong, Xiaoxiang; Chen, Zhuchu

    2013-06-01

    Tumor microenvironment plays very important roles in the carcinogenesis. A variety of stromal cells in the microenvironment have been modified to support the unique needs of the malignant state. This study was to discover stromal differentially expressed proteins (DEPs) that were involved in colon carcinoma carcinogenesis. Laser capture microdissection (LCM) was captured and isolated the stromal cells from colon adenocarcinoma (CAC) and non-neoplastic colon mucosa (NNCM) tissues, respectively. Seventy DEPs were identified between the pooled LCM-enriched CAC and NNCM stroma samples by iTRAQ-based quantitative proteomics. Gene Ontology (GO) relationship analysis revealed that DEPs were hierarchically grouped into 10 clusters, and were involved in multiple biological functions that were altered during carcinogenesis, including extracellular matrix organization, cytoskeleton, transport, metabolism, inflammatory response, protein polymerization, and cell motility. Pathway network analysis revealed 6 networks and 56 network eligible proteins with Ingenuity pathway analysis. Four significant networks functioned in digestive system development and its function, inflammatory disease, and developmental disorder. Eight DEPs (DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ) were validated by Western blotting, and four DEPs (DCN, FN1, PKM2, and HSP90B1) were validated by immunohistochemical analysis. It is the first report of stromal DEPs between CAC and NNCM tissues. It will be helpful to recognize the roles of stromas in the colon carcinoma microenvironment, and improve the understanding of carcinogenesis in colon carcinoma. The present data suggest that DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ might be the potential targets for colon cancer prevention and therapy.

  4. [Application of differential proteomics in mechanism research of acupuncture].

    PubMed

    Yu, Lin-na; Pei, Jian

    2011-08-01

    Proteomics, a new branch of science, has been used to study protein expressions on the molecular level with a dynamic perspective. Organisms under varying states may express different proteins, which results in the set-up of differential proteomics. Research methods of differential proteomics include the separation and identification of proteins. Differential proteomics has a rapid development in recent years. In the study of acupuncture, researchers have reached certain achievements using differential proteomics to investigate the mechanisms of acupuncture treatment for some diseases, including acute spinal cord injury, ischemic cerebrovascular disease, Parkinson's disease and neuralgia.

  5. Maize (Zea mays L.) seedling leaf nuclear proteome and differentially expressed proteins between a hybrid and its parental lines.

    PubMed

    Guo, Baojian; Chen, Yanhong; Li, Chuan; Wang, Tianya; Wang, Rui; Wang, Bo; Hu, Sha; Du, Xiaofen; Xing, Hongyan; Song, Xiao; Yao, Yingyin; Sun, Qixin; Ni, Zhongfu

    2014-05-01

    To better understand the underlying molecular basis of leaf development in maize, a reference map of nuclear proteins in basal region of seedling leaf was established using a combination of 2DE and MALDI-TOF-MS. In total, 441 reproducible protein spots in nuclear proteome of maize leaf basal region were detected with silver staining in a pH range of 3-10, among which 203 spots corresponding to 163 different proteins were identified. As expected, proteins implicated in RNA and protein-associated functions were overrepresented in nuclear proteome. Remarkably, a high percentage (10%) of proteins was identified to be involved in cell division and growth. In addition, comparative nuclear proteomic analysis in leaf basal region of highly heterotic hybrid Mo17/B73 and its parental lines was also performed and 52 of 445 (11.69%) detected protein spots were differentially expressed between the hybrid and its parental lines, among which 16 protein spots displayed nonadditively expressed pattern. These results indicated that hybridization between two parental lines can cause changes in the expression of a variety of nuclear proteins, which may be responsible for the observed leaf size heterosis.

  6. Proteomic analysis from haploid and diploid embryos of Quercus suber L. identifies qualitative and quantitative differential expression patterns.

    PubMed

    Gómez, Aranzazu; López, Juan Antonio; Pintos, Beatriz; Camafeita, Emilio; Bueno, Ma Angeles

    2009-09-01

    Quercus suber L. is a Mediterranean forest species with ecological, social and economic value. Clonal propagation of Q. suber elite trees has been successfully obtained from in vitro-derived somatic and gametic embryos. These clonal lines play a main role in breeding and genetic studies of Q. suber. To aid in unravelling diverse genetic and biological unknowns, a proteomic approach is proposed. The proteomic analysis of Q. suber somatic and gametic in vitro culture-derived embryos, based on DIGE and MALDI-MS, has produced for the first time proteomic data on this species. Seventeen differentially expressed proteins have been identified which display significantly altered levels between gametic and somatic embryos. These proteins are involved in a variety of cellular processes, most of which had been neither previously associated with embryo development nor identified in the genus Quercus. Some of these proteins are involved in stress and pollen development and others play a role in the metabolism of tannins and phenylpropanoids, which represent two of the major pathways for the synthesis of cork chemical components. Furthermore, the augmented expression levels found for specific proteins are probably related to the homozygous state of a doubled-haploid sample. Proteins involved in synthesis of cork components can be detected at such early stages of development, showing the potential of the method to be useful in searching for biomarkers related to cork quality.

  7. Proteomics-based study on asthenozoospermia: differential expression of proteasome alpha complex.

    PubMed

    Siva, Archana Bharadwaj; Kameshwari, Duvvuri Butchi; Singh, Vaibhav; Pavani, Kadupu; Sundaram, Curam Sreenivasacharlu; Rangaraj, Nandini; Deenadayal, Mamata; Shivaji, Sisinthy

    2010-07-01

    With a view to understand the molecular basis of sperm motility, we have tried to establish the human sperm proteome by two-dimensional PAGE MALDI MS/MS analysis. We report identification of 75 different proteins in the human spermatozoa. Comparative proteome analysis was carried out for asthenozoospermic and normozoospermic patients to understand the molecular basis of sperm motility. Analysis revealed eight proteins (including one unidentified) with altered intensity between the groups. Differential proteins distributed into three functional groups: 'energy and metabolism' (triose-phosphate isomerase, glycerol kinase 2, testis specific isoform and succinyl-CoA:3-ketoacid co-enzyme A transferase 1, mitochondrial precursor); 'movement and organization' (tubulin beta 2C and tektin 1) and 'protein turnover, folding and stress response' (proteasome alpha 3 subunit and heat shock-related 70 kDa protein 2). It was interesting to note that although the proteins falling in the functional group of 'energy and metabolism' are higher in the asthenozoospermic patients, the other two functional groups contain proteins, which are higher in the normozoospermic samples. Validation of results carried out for proteasome alpha 3 subunit by immunoblotting and confocal microscopy, confirmed significant changes in intensity of proteasome alpha 3 subunit in asthenozoospermic samples when compared with normozoospermic controls. Significant positive correlation too was found between proteasome alpha 3 subunit levels and rapid, linear progressive motility of the spermatozoa. In our understanding, this data would contribute appreciably to the presently limited information available about the proteins implicated in human sperm motility.

  8. Unraveling the equine lymphocyte proteome: differential septin 7 expression associates with immune cells in equine recurrent uveitis.

    PubMed

    Degroote, Roxane L; Hauck, Stefanie M; Amann, Barbara; Hirmer, Sieglinde; Ueffing, Marius; Deeg, Cornelia A

    2014-01-01

    Equine recurrent uveitis is a spontaneous, lymphocyte-driven autoimmune disease. It affects horses worldwide and presents with painful remitting-relapsing inflammatory attacks of inner eye structures eventually leading to blindness. Since lymphocytes are the key players in equine recurrent uveitis, we were interested in potential changes of their protein repertoire which may be involved in disease pathogenesis. To create a reference for differential proteome analysis, we first unraveled the equine lymphocyte proteome by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subsequently identified 352 protein spots. Next, we compared lymphocytes from ERU cases and healthy horses with a two-dimensional fluorescence difference in gel electrophoresis approach. With this technique, we identified seven differentially expressed proteins between conditions. One of the significantly lower expressed candidates, septin 7, plays a role in regulation of cell shape, motility and migration. Further analyses revealed T cells as the main cell type with decreased septin 7 abundance in equine recurrent uveitis. These findings point to a possible pathogenetic role of septin 7 in this sight-threatening disease.

  9. Unraveling the Equine Lymphocyte Proteome: Differential Septin 7 Expression Associates with Immune Cells in Equine Recurrent Uveitis

    PubMed Central

    Degroote, Roxane L.; Hauck, Stefanie M.; Amann, Barbara; Hirmer, Sieglinde; Ueffing, Marius; Deeg, Cornelia A.

    2014-01-01

    Equine recurrent uveitis is a spontaneous, lymphocyte-driven autoimmune disease. It affects horses worldwide and presents with painful remitting-relapsing inflammatory attacks of inner eye structures eventually leading to blindness. Since lymphocytes are the key players in equine recurrent uveitis, we were interested in potential changes of their protein repertoire which may be involved in disease pathogenesis. To create a reference for differential proteome analysis, we first unraveled the equine lymphocyte proteome by two-dimensional sodium dodecyl sulfate - polyacrylamide gel electrophoresis and subsequently identified 352 protein spots. Next, we compared lymphocytes from ERU cases and healthy horses with a two-dimensional fluorescence difference in gel electrophoresis approach. With this technique, we identified seven differentially expressed proteins between conditions. One of the significantly lower expressed candidates, septin 7, plays a role in regulation of cell shape, motility and migration. Further analyses revealed T cells as the main cell type with decreased septin 7 abundance in equine recurrent uveitis. These findings point to a possible pathogenetic role of septin 7 in this sight-threatening disease. PMID:24614191

  10. Proteomic Analysis of Signaling Network Regulation in Renal Cell Carcinomas with Differential Hypoxia-Inducible Factor-2α Expression

    PubMed Central

    Nagaprashantha, Lokesh Dalasanur; Talamantes, Tatjana; Singhal, Jyotsana; Guo, Jia; Vatsyayan, Rit; Rauniyar, Navin; Awasthi, Sanjay

    2013-01-01

    Background The loss of von Hippel–Lindau (VHL) protein function leads to highly vascular renal tumors characterized by an aggressive course of disease and refractoriness to chemotherapy and radiotherapy. Loss of VHL in renal tumors also differs from tumors of other organs in that the oncogenic cascade is mediated by an increase in the levels of hypoxia-inducible factor-2α (HIF2α) instead of hypoxia-inducible factor-1α (HIF1α). Methods and Principal Findings We used renal carcinoma cell lines that recapitulate the differences between mutant VHL and wild-type VHL genotypes. Utilizing a method relying on extracted peptide intensities as a label-free approach for quantitation by liquid chromatography–mass spectrometry, our proteomics study revealed regulation of key proteins important for cancer cell survival, proliferation and stress-resistance, and implicated differential regulation of signaling networks in VHL-mutant renal cell carcinoma. We also observed upregulation of cellular energy pathway enzymes and the stress-responsive mitochondrial 60-kDa heat shock protein. Finding reliance on glutaminolysis in VHL-mutant renal cell carcinoma was of particular significance, given the generally predominant dependence of tumors on glycolysis. The data have been deposited to the ProteomeXchange with identifier PXD000335. Conclusions and Significance Pathway analyses provided corroborative evidence for differential regulation of molecular and cellular functions influencing cancer energetics, metabolism and cell proliferation in renal cell carcinoma with distinct VHL genotype. Collectively, the differentially regulated proteome characterized by this study can potentially guide translational research specifically aimed at effective clinical interventions for advanced VHL-mutant, HIF2α-over-expressing tumors. PMID:23940778

  11. Proteomic Study of Differential Protein Expression in Mouse Lung Tissues after Aerosolized Ricin Poisoning

    PubMed Central

    Guo, Zhendong; Han, Chao; Du, Jiajun; Zhao, Siyan; Fu, Yingying; Zheng, Guanyu; Sun, Yucheng; Zhang, Yi; Liu, Wensen; Wan, Jiayu; Qian, Jun; Liu, Linna

    2014-01-01

    Ricin is one of the most poisonous natural toxins from plants and is classified as a Class B biological threat pathogen by the Centers for Disease Control and Prevention (CDC) of U.S.A. Ricin exposure can occur through oral or aerosol routes. Ricin poisoning has a rapid onset and a short incubation period. There is no effective treatment for ricin poisoning. In this study, an aerosolized ricin-exposed mouse model was developed and the pathology was investigated. The protein expression profile in the ricin-poisoned mouse lung tissue was analyzed using proteomic techniques to determine the proteins that were closely related to the toxicity of ricin. 2D gel electrophoresis, mass spectrometry and subsequent biological functional analysis revealed that six proteins including Apoa1 apolipoprotein, Ywhaz 14-3-3 protein, Prdx6 Uncharacterized Protein, Selenium-binding protein 1, HMGB1, and DPYL-2, were highly related to ricin poisoning. PMID:24786090

  12. Proteomic study of differential protein expression in mouse lung tissues after aerosolized ricin poisoning.

    PubMed

    Guo, Zhendong; Han, Chao; Du, Jiajun; Zhao, Siyan; Fu, Yingying; Zheng, Guanyu; Sun, Yucheng; Zhang, Yi; Liu, Wensen; Wan, Jiayu; Qian, Jun; Liu, Linna

    2014-04-28

    Ricin is one of the most poisonous natural toxins from plants and is classified as a Class B biological threat pathogen by the Centers for Disease Control and Prevention (CDC) of U.S.A. Ricin exposure can occur through oral or aerosol routes. Ricin poisoning has a rapid onset and a short incubation period. There is no effective treatment for ricin poisoning. In this study, an aerosolized ricin-exposed mouse model was developed and the pathology was investigated. The protein expression profile in the ricin-poisoned mouse lung tissue was analyzed using proteomic techniques to determine the proteins that were closely related to the toxicity of ricin. 2D gel electrophoresis, mass spectrometry and subsequent biological functional analysis revealed that six proteins including Apoa1 apolipoprotein, Ywhaz 14-3-3 protein, Prdx6 Uncharacterized Protein, Selenium-binding protein 1, HMGB1, and DPYL-2, were highly related to ricin poisoning.

  13. Differentially expressed proteins underlying childhood cortical dysplasia with epilepsy identified by iTRAQ proteomic profiling

    PubMed Central

    Liu, Shiyong; Liu, Yi; Yang, Yixuan; Yang, Hui; Chen, Yangmei; Chen, Lifen

    2017-01-01

    Cortical dysplasia accounts for at least 14% of epilepsy cases, and is mostly seen in children. However, the understanding of molecular mechanisms and pathogenesis underlying cortical dysplasia is limited. The aim of this cross-sectional study is to identify potential key molecules in the mechanisms of cortical dysplasia by screening the proteins expressed in brain tissues of childhood cortical dysplasia patients with epilepsy using isobaric tags for relative and absolute quantitation-based tandem mass spectrometry compared to controls, and several differentially expressed proteins that are not reported to be associated with cortical dysplasia previously were selected for validation using real-time polymerase chain reaction, immunoblotting and immunohistochemistry. 153 out of 3340 proteins were identified differentially expressed between childhood cortical dysplasia patients and controls. And FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, and FABP3 were selected for validation and identified to be increased in childhood cortical dysplasia patients, while PRDX6 and PSAP were identified decreased. This is the first report on differentially expressed proteins in childhood cortical dysplasia. We identified differential expression of FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, FABP3, PRDX6 and PSAP in childhood cortical dysplasia patients, these proteins are involved in various processes and have various function. These results may provide new directions or targets for the research of childhood cortical dysplasia, and may be helpful in revealing molecular mechanisms and pathogenesis and/or pathophysiology of childhood cortical dysplasia if further investigated. PMID:28222113

  14. A differentially expressed proteomic analysis in placental tissues in relation to pungency during the pepper fruit development.

    PubMed

    Lee, Je Min; Kim, Seyoon; Lee, Ji Young; Yoo, Eun Young; Cho, Myeong Cheoul; Cho, Min Rae; Kim, Byung-Dong; Bahk, Young Yil

    2006-10-01

    Using proteomic analysis including 2-DE, image analysis, and protein identification with LC-MS/MS, an investigation aimed at a better understanding of the differentially expressed proteins and/or gene products was carried out with total cell extracts from placental tissues in nonpungent (Capsicum annuum cv. Saeng-Ryeog #213) and pungent peppers (C. annuum cv. Saeng-Ryeog #211). Mobilization of the most abundant proteins, which were on the gels of pH ranges of 4-7, 4.5-5.5, 5.5-6.7, and 6-9, and showed very similar profiles in the two tissues, revealing approximately 2600 protein spots consisting of 1200 on pH 4-7, 600 on 4.5-5.5, 550 on 5.5-6.7, 250 on 6-9. Of these, 37 protein spots, which appeared in only pungent tissues but not in nonpungent tissues or markedly increased in their staining intensities on the gels from pungent tissue, were selected, excised, in-gel trypsin digested, and analyzed by LC-ESI-MS/MS. Peptide MS/MS data were searched against publicly available protein and EST databases, and 22 proteins were identified. Based on this result, we tested and compared the differential expression during fruit development on the 2-DE gels with total cell extracts from placental tissues of pungent and nonpungent peppers at an interval of 10 days from 10 to 40 days after flowering. In addition, this differential protein expression was further confirmed for some subsets of candidates by Northern-blot analysis with RNA samples from placental tissues harvested from each pepper fruit at the same sampling intervals. In this study, the physiological implications, revealed from the experimental data in the levels of proteome and transcripts, are discussed in the context of a complex biosynthesis network of capsaicinoids in pepper cells responsive to pungency.

  15. Proteomic analysis of differentially expressed proteins in bovine milk during experimentally induced Escherichia coli mastitis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives of the current study were to profile changes in protein composition using 2-dimensional gel electrophoresis (2D-GE) on whey samples from a group of 8 cows prior to and 18 hours after infection with Escherichia coli, and to identify differentially expressed milk proteins by peptide seq...

  16. Proteomic analysis of human brain microvascular endothelial cells reveals differential protein expression in response to enterovirus 71 infection.

    PubMed

    Luo, Wenying; Zhong, Jiayu; Zhao, Wei; Liu, Jianjun; Zhang, Renli; Peng, Liang; Hong, Wenxu; Huang, Sheng He; Cao, Hong

    2015-01-01

    2D DIGE technology was employed on proteins prepared from human brain microvascular endothelial cells (HBMEC), to study the differentially expressed proteins in cells at 0 h, 1 h, 16 h, and 24 h after infection. Proteins found to be differentially expressed were identified with matrix-assisted laser desorption/ionization time-of-flight/time-of-flight mass spectrometry (MALDITOF/TOF MS) analysis. We identified 43 spots showing changes of at least 2.5 fold up- or downregulated expressions in EV71-infected cells at different time when comparing to control, and 28 proteins could be successfully identified by MALDI TOF/TOF mass spectrometry analysis. 4 proteins were significantly upregulated, and 6 proteins were downregulated, another 18 proteins were different expression at different incubation time. We identified changes in the expression of 12 cellular metabolism-related proteins, 5 molecules involved in cytoskeleton, 3 molecules involved in energy metabolism, 2 molecules involved in signal transduction, 1 molecule involved in the ubiquitin-proteasome pathway, 1 molecule involved in cell cycle, 1 molecule involved in apoptosis-related protein, 1 molecular chaperone, and 2 unknown proteins. These findings build up a comprehensive profile of the HBMEC proteome and provide a useful basis for further analysis of the pathogenic mechanism that underlies EV71 infections to induce severe neural complications.

  17. Comparative proteomic analysis of differentially expressed proteins induced by hydrogen sulfide in Spinacia oleracea leaves.

    PubMed

    Chen, Juan; Liu, Ting-Wu; Hu, Wen-Jun; Simon, Martin; Wang, Wen-Hua; Chen, Juan; Liu, Xiang; Zheng, Hai-Lei

    2014-01-01

    Hydrogen sulfide (H2S), as a potential gaseous messenger molecule, has been suggested to play important roles in a wide range of physiological processes in plants. The aim of present study was to investigate which set of proteins is involved in H2S-regulated metabolism or signaling pathways. Spinacia oleracea seedlings were treated with 100 µM NaHS, a donor of H2S. Changes in protein expression profiles were analyzed by 2-D gel electrophoresis coupled with MALDI-TOF MS. Over 1000 protein spots were reproducibly resolved, of which the abundance of 92 spots was changed by at least 2-fold (sixty-five were up-regulated, whereas 27 were down-regulated). These proteins were functionally divided into 9 groups, including energy production and photosynthesis, cell rescue, development and cell defense, substance metabolism, protein synthesis and folding, cellular signal transduction. Further, we found that these proteins were mainly localized in cell wall, plasma membrane, chloroplast, mitochondria, nucleus, peroxisome and cytosol. Our results demonstrate that H2S is involved in various cellular and physiological activities and has a distinct influence on photosynthesis, cell defense and cellular signal transduction in S. oleracea leaves. These findings provide new insights into proteomic responses in plants under physiological levels of H2S.

  18. Proteomic analysis of differentially expressed proteins in the two developmental stages of Ichthyophthirius multifiliis.

    PubMed

    Yao, Jia-Yun; Xu, Yang; Yuan, Xue-Mei; Yin, Wen-Lin; Yang, Gui-Lian; Lin, Ling-Yun; Pan, Xiao-Yi; Wang, Chun-Feng; Shen, Jin-Yu

    2017-02-01

    Ichthyophthirius is a severe disease of farmed freshwater fish caused by the parasitic ciliate Ichthyophthirius multifiliis (Ich). This disease can lead to considerable economic loss, but the protein profiles in different developmental stages of the parasite remain unknown. In the present study, proteins from trophonts and theronts of Ich were identified by isobaric tags for relative and absolute quantitation (iTRAQ). A total of 2300 proteins were identified in the two developmental stages, of which 1520 proteins were differentially expressed. Among them, 84 proteins were uniquely expressed in the theronts stage, while 656 proteins were expressed only in trophonts. The differentially expressed proteins were catalogued (assorted) to various functions of Ich life cycle, including biological process, cellular component, and molecular function that occur at distinct stages. Using a 1.5-fold change in expression as a physiologically significant benchmark, a lot of differentially expressed proteins were reliably quantified by iTRAQ analysis. Two hundred forty upregulated and 57 downregulated proteins in the trophonts stage were identified as compared with theronts. The identified proteins were involved in various functions of the I. multifiliis life cycle, including binding, catalytic activity, structural molecule activity, and transporter activity. Further investigation of the transcriptional levels of periplasmic immunogenic protein, transketolase, zinc finger, isocitrate dehydrogenase, etc., from the different protein profiles using quantitative RT-PCR showed identical results to the iTRAQ analysis. This work provides an effective resource to further our understanding of Ich biology, and lays the groundwork for the identification of potential drug targets and vaccines candidates for the control of this devastating fish pathogen.

  19. The use of proteomics in identifying differentially expressed serum proteins in humans with type 2 diabetes

    PubMed Central

    Sundsten, Tea; Eberhardson, Michael; Göransson, Michael; Bergsten, Peter

    2006-01-01

    Background The aim of the study was to optimize protocols for finding and identifying serum proteins that are differentially expressed in persons with normal glucose tolerance (NGT) compared to individuals with type 2 diabetes mellitus (T2DM). Serum from persons with NGT and persons with T2DM was profiled using ProteinChip arrays and time-of-flight mass spectra were generated by surface enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS). Results Mass spectra from NGT- and T2DM-groups were compared. Fifteen proteins ranging from 5 to 79 kDa were differentially expressed (p < 0.05). Five of these proteins showed decreased and ten showed increased serum levels in individuals with T2DM. To be able to identify the proteins, the complexity of the sample was reduced by fractionation approaches. Subsequently, the purified fractions containing biomarkers were separated by one-dimensional SDS-polyacrylamide gel electrophoresis (SDS-PAGE) in two identical lanes. Protein bands of the first lane were excised and subjected to passive elution to recapture the biomarkers on ProteinChip arrays. The corresponding bands of the second lane were subjected to peptide-mass fingerprinting (PMF). Using this approach four of the differentially expressed proteins were identified as apolipoprotein C3 (9.4 kDa), transthyretin (13.9 kDa), albumin (66 kDa) and transferrin (79 kDa). Whereas apolipoprotein C3 and transthyretin were up-regulated, albumin and transferrin were down-regulated in T2DM. Conclusion Protocols for protein profiling by SELDI-TOF MS and protein identification by fractionation, SDS-PAGE and PMF were optimized for serum from humans with T2DM. With these protocols differentially expressed proteins were discovered and identified when serum from NGT- and T2DM-individuals was analyzed. PMID:17163994

  20. Proteomic identification of differentially expressed proteins in Gossypium thurberi inoculated with cotton Verticillium dahliae.

    PubMed

    Zhao, Fu'an; Fang, Weiping; Xie, Deyi; Zhao, Yuanming; Tang, Zhongjie; Li, Wu; Nie, Lihong; Lv, Shuping

    2012-04-01

    Thurber's cotton (Gossypium thurberi) is the wild relative of cultivated cotton. It is highly resistant to cotton Verticillium wilt, a disease that significantly affects cotton yield and quality. To reveal the mechanism of disease resistance in G. thurberi and to clone resistance-related genes, we used two-dimensional electrophoresis (2-DE) and tandem time-of-flight mass spectrometry (MALDI-TOF-MS) to identify differentially expressed proteins in Thurber's cotton after inoculation with Verticillium dahliae. A total of 57 different protein spots were upregulated, including 52 known proteins representing 11% of the total protein spots. These proteins are involved in resistance to stress and disease, transcriptional regulation, signal transduction, protein processing and degradation, photosynthesis, production capacity, basic metabolism, and other processes. In addition, five disease resistance proteins showed intense upregulation, indicating that resistance genes (R genes) may play a critical role in resistance to Verticillium wilt in Thurber's cotton. Our results suggest that disease and stress resistance are the combined effects of multiple co-expressed genes. This provides a basis for further, detailed investigation into the mechanisms underlying Verticillium wilt resistance of G. thurberi and for cloning essential genes into cotton cultivars to produce Verticillium wilt resistant plants.

  1. Differential proteome and gene expression for testis of mice exposed to carbon ion radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Hong; Li, Hongyan

    Objective To investigate the effect and mechanism of high linear energy transfer (LET) carbon ion irradiation (CIR) on reproduction in the testis of male Swiss Webster mice, and assess the risk associated with space environment. Methods Male mice underwent whole-body irradiation with CIR (0.5, 1 and 4Gy), and matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF) analysis was used to determine the alteration in protein expression in 2-DE (two-dimensional gel electrophoresis) gels of testes caused by irradiation after 7, 14 days. Results 15 differentially expressed proteins, such as glucose-regulated protein(GRP78), aconitate hydratase-mitochondrial precursor (ACO), pyruvate kinase isozymes M1/M2 (PKM1/M2), glutathione-S-transferaseA3 (GSTA3), glutathione S-transferase Pi 1 (GSTP1), Cu/Zn super-oxide dismutase (SOD1), Peptidyl-prolyl cis-trans isomerase (Pin1) and Heat shock 70 kDa protein 4L (HSPa4L), were identified and these proteins were mainly involved in energy supply, the endoplasmic reticulum, cell proliferation, cell cycle, antioxidant capacity and mitochondrial respiration, which play important roles in the inhibition of testicular function in response to CIR. Furthermore, we confirmed the relationship between transcription of mRNA and the abundance of proteins. Conclusion The findings of the present study demonstrated that these proteins may lead to new insights into the molecular mechanism of CIR toxicity, and suggested that the gene expression response to CIR involves diverse regulatory mechanisms from transcription of mRNA to the formation of functional proteins. These data also may provide a scientific basis for protecting astronauts and space traveler’s health and safety.

  2. Proteomic Analysis of Differentially Expressed Proteins Involved in Peel Senescence in Harvested Mandarin Fruit.

    PubMed

    Li, Taotao; Zhang, Jingying; Zhu, Hong; Qu, Hongxia; You, Shulin; Duan, Xuewu; Jiang, Yueming

    2016-01-01

    Mandarin (Citrus reticulata), a non-climacteric fruit, is an economically important fruit worldwide. The mechanism underlying senescence of non-climacteric fruit is poorly understood. In this study, a gel-based proteomic study followed by LC-ESI-MS/MS analysis was carried out to investigate the proteomic changes involved in peel senescence in harvested mandarin "Shatangju" fruit stored for 18 days. Over the course of the storage period, the fruit gradually senesced, accompanied by a decreased respiration rate and increased chlorophyll degradation and disruption of membrane integrity. Sixty-three proteins spots that showed significant differences in abundance were identified. The up-regulated proteins were mainly associated with cell wall degradation, lipid degradation, protein degradation, senescence-related transcription factors, and transcription-related proteins. In contrast, most proteins associated with ATP synthesis and scavenging of reactive oxygen species were significantly down-regulated during peel senescence. Three thioredoxin proteins and three Ca(2+) signaling-related proteins were significantly up-regulated during peel senescence. It is suggested that mandarin peel senescence is associated with energy supply efficiency, decreased antioxidant capability, and increased protein and lipid degradation. In addition, activation of Ca(2+) signaling and transcription factors might be involved in cell wall degradation and primary or secondary metabolism.

  3. Proteomic Analysis of Differentially Expressed Proteins Involved in Peel Senescence in Harvested Mandarin Fruit

    PubMed Central

    Li, Taotao; Zhang, Jingying; Zhu, Hong; Qu, Hongxia; You, Shulin; Duan, Xuewu; Jiang, Yueming

    2016-01-01

    Mandarin (Citrus reticulata), a non-climacteric fruit, is an economically important fruit worldwide. The mechanism underlying senescence of non-climacteric fruit is poorly understood. In this study, a gel-based proteomic study followed by LC-ESI-MS/MS analysis was carried out to investigate the proteomic changes involved in peel senescence in harvested mandarin “Shatangju” fruit stored for 18 days. Over the course of the storage period, the fruit gradually senesced, accompanied by a decreased respiration rate and increased chlorophyll degradation and disruption of membrane integrity. Sixty-three proteins spots that showed significant differences in abundance were identified. The up-regulated proteins were mainly associated with cell wall degradation, lipid degradation, protein degradation, senescence-related transcription factors, and transcription-related proteins. In contrast, most proteins associated with ATP synthesis and scavenging of reactive oxygen species were significantly down-regulated during peel senescence. Three thioredoxin proteins and three Ca2+ signaling-related proteins were significantly up-regulated during peel senescence. It is suggested that mandarin peel senescence is associated with energy supply efficiency, decreased antioxidant capability, and increased protein and lipid degradation. In addition, activation of Ca2+ signaling and transcription factors might be involved in cell wall degradation and primary or secondary metabolism. PMID:27303420

  4. Differential protein expression using proteomics from a crustacean brine shrimp (Artemia sinica) under CO2-driven seawater acidification.

    PubMed

    Chang, Xue-Jiao; Zheng, Chao-Qun; Wang, Yu-Wei; Meng, Chuang; Xie, Xiao-Lu; Liu, Hai-Peng

    2016-11-01

    Gradually increasing atmospheric CO2 partial pressure (pCO2) has caused an imbalance in carbonate chemistry and resulted in decreased seawater pH in marine ecosystems, termed seawater acidification. Anthropogenic seawater acidification is postulated to affect the physiology of many marine calcifying organisms. To understand the possible effects of seawater acidification on the proteomic responses of a marine crustacean brine shrimp (Artemia sinica) three groups of cysts were hatched and further raised in seawater at different pH levels (8.2 as control and 7.8 and 7.6 as acidification stress levels according to the predicted levels at the end of this century and next century, respectively) for 1, 7 and 14 days followed by examination of the protein expression changes via two-dimensional gel electrophoresis. Searches of protein databases revealed that 67 differential protein spots were altered due to lower pH level (7.6 and 7.8) stress in comparison to control groups (pH 8.2) by mass spectrometry. Generally, these differentially expressed proteins included the following: 1) metabolic process-related proteins involved in glycolysis and glucogenesis, nucleotide/amino acid/fatty acid metabolism, protein biosynthesis, DNA replication and apoptosis; 2) stress response-related proteins, such as peroxiredoxin, thioredoxin peroxidase, 70-kDa heat shock protein, Na/K ATPase, and ubiquinol-cytochrome c reductase; 3) immune defence-related proteins, such as prophenoloxidase and ferritin; 4) cytoskeletal-related proteins, such as myosin light chain, TCP1 subunit 2, tropomyosin and tubulin alpha chain; and 5) signal transduction-related proteins, such as phospholipase C-like protein, 14-3-3 zeta, translationally controlled tumour protein and RNA binding motif protein. Taken together, these data support the idea that CO2-driven seawater acidification may affect protein expression in the crustacean A. sinica and possibly also in other species that feed on brine shrimp in the

  5. Comparative Proteomic Analysis of saccharopolyspora spinosa SP06081 and PR2 strains reveals the differentially expressed proteins correlated with the increase of spinosad yield

    PubMed Central

    2011-01-01

    Background Saccharopolyspora spinosa produces the environment-friendly biopesticide spinosad, a mixture of two polyketide-derived macrolide active ingredients called spinosyns A and D. Therefore considerable interest is in the improvement of spinosad production because of its low yield in wild-type S. spinosa. Recently, a spinosad-hyperproducing PR2 strain with stable heredity was obtained from protoplast regeneration of the wild-type S. spinosa SP06081 strain. A comparative proteomic analysis was performed on the two strains during the first rapid growth phase (RG1) in seed medium (SM) by using label-free quantitative proteomics to investigate the underlying mechanism leading to the enhancement of spinosad yield. Results In total, 224 proteins from the SP06081 strain and 204 proteins from the PR2 strain were unambiguously identified by liquid chromatography-tandem mass spectrometry analysis, sharing 140 proteins. A total of 12 proteins directly related to spinosad biosynthesis were identified from the two strains in RG1. Comparative analysis of the shared proteins revealed that approximately 31% of them changed their abundance significantly and fell in all of the functional groups, such as tricarboxylic acid cycles, glycolysis, biosynthetic processes, catabolic processes, transcription, translation, oxidation and reduction. Several key enzymes involved in the synthesis of primary metabolic intermediates used as precursors for spinosad production, energy supply, polyketide chain assembly, deoxysugar methylation, and antioxidative stress were differentially expressed in the same pattern of facilitating spinosad production by the PR2 strain. Real-time reverse transcriptase polymerase chain reaction analysis revealed that four of five selected genes showed a positive correlation between changes at the translational and transcriptional expression level, which further confirmed the proteomic analysis. Conclusions The present study is the first comprehensive and

  6. Proteomic Profiling for Identification of Novel Biomarkers Differentially Expressed in Human Ovaries from Polycystic Ovary Syndrome Patients

    PubMed Central

    Li, Li; Zhang, Jiangyu; Deng, Qingshan; Li, Jieming; Li, Zhengfen; Xiao, Yao; Hu, Shuiwang; Li, Tiantian; Tan, Qiuxiao; Li, Xiaofang; Luo, Bingshu; Mo, Hui

    2016-01-01

    Objectives To identify differential protein expression pattern associated with polycystic ovary syndrome (PCOS). Methods Twenty women were recruited for the study, ten with PCOS as a test group and ten without PCOS as a control group. Differential in-gel electrophoresis (DIGE) analysis and mass spectroscopy were employed to identify proteins that were differentially expressed between the PCOS and normal ovaries. The differentially expressed proteins were further validated by western blot (WB) and immunohistochemistry (IHC). Results DIGE analysis revealed eighteen differentially expressed proteins in the PCOS ovaries of which thirteen were upregulated, and five downregulated. WB and IHC confirmed the differential expression of membrane-associated progesterone receptor component 1 (PGRMC1), retinol-binding protein 1 (RBP1), heat shock protein 90B1, calmodulin 1, annexin A6, and tropomyosin 2. Also, WB analysis revealed significantly (P<0.05) higher expression of PGRMC1 and RBP1 in PCOS ovaries as compared to the normal ovaries. The differential expression of the proteins was also validated by IHC. Conclusions The present study identified novel differentially expressed proteins in the ovarian tissues of women with PCOS that can serve as potential biomarkers for the diagnosis and development of novel therapeutics for the treatment of PCOS using molecular interventions. PMID:27846214

  7. Proteomic analysis of the nuclear matrix in the early stages of rat liver carcinogenesis: Identification of differentially expressed and MAR-binding proteins

    SciTech Connect

    Barboro, Paola; D'Arrigo, Cristina; Repaci, Erica; Bagnasco, Luca; Orecchia, Paola; Carnemolla, Barbara; Patrone, Eligio; Balbi, Cecilia

    2009-01-15

    Tumor progression is characterized by definite changes in the protein composition of the nuclear matrix (NM). The interactions of chromatin with the NM occur via specific DNA sequences called MARs (matrix attachment regions). In the present study, we applied a proteomic approach along with a Southwestern assay to detect both differentially expressed and MAR-binding NM proteins, in persistent hepatocyte nodules (PHN) in respect with normal hepatocytes (NH). In PHN, the NM undergoes changes both in morphology and in protein composition. We detected over 500 protein spots in each two dimensional map and 44 spots were identified. Twenty-three proteins were differentially expressed; among these, 15 spots were under-expressed and 8 spots were over-expressed in PHN compared to NH. These changes were synchronous with several modifications in both NM morphology and the ability of NM proteins to bind nuclear RNA and/or DNA containing MARs sequences. In PHN, we observed a general decrease in the expression of the basic proteins that bound nuclear RNA and the over-expression of two species of Mw 135 kDa and 81 kDa and pI 6.7-7.0 and 6.2-7.4, respectively, which exclusively bind to MARs. These results suggest that the deregulated expression of these species might be related to large-scale chromatin reorganization observed in the process of carcinogenesis by modulating the interaction between MARs and the scaffold structure.

  8. Proteomic Analysis of Frankliniella occidentalis and Differentially Expressed Proteins in Response to Tomato Spotted Wilt Virus Infection

    PubMed Central

    Badillo-Vargas, I. E.; Rotenberg, D.; Schneweis, D. J.; Hiromasa, Y.; Tomich, J. M.

    2012-01-01

    Tomato spotted wilt virus (TSWV) is transmitted by Frankliniella occidentalis in a persistent propagative manner. Despite the extensive replication of TSWV in midgut and salivary glands, there is little to no pathogenic effect on F. occidentalis. We hypothesize that the first-instar larva (L1) of F. occidentalis mounts a response to TSWV that protects it from pathogenic effects caused by virus infection and replication in various insect tissues. A partial thrips transcriptome was generated using 454-Titanium sequencing of cDNA generated from F. occidentalis exposed to TSWV. Using these sequences, the L1 thrips proteome that resolved on a two-dimensional gel was characterized. Forty-seven percent of the resolved protein spots were identified using the thrips transcriptome. Real-time quantitative reverse transcriptase PCR (RT-PCR) analysis of virus titer in L1 thrips revealed a significant increase in the normalized abundance of TSWV nucleocapsid RNA from 2 to 21 h after a 3-h acquisition access period on virus-infected plant tissue, indicative of infection and accumulation of virus. We compared the proteomes of infected and noninfected L1s to identify proteins that display differential abundances in response to virus. Using four biological replicates, 26 spots containing 37 proteins were significantly altered in response to TSWV. Gene ontology assignments for 32 of these proteins revealed biological roles associated with the infection cycle of other plant- and animal-infecting viruses and antiviral defense responses. Our findings support the hypothesis that L1 thrips display a complex reaction to TSWV infection and provide new insights toward unraveling the molecular basis of this interaction. PMID:22696645

  9. A proteomic approach to identifying proteins differentially expressed in conidia and mycelium of the entomopathogenic fungus Metarhizium acridum.

    PubMed

    Barros, Bruno H R; da Silva, Sérgio H; dos ReisMarques, Everaldo Dos Reis; Rosa, José C; Yatsuda, Ana Patrícia; Roberts, Donald W; Braga, Gilberto U L

    2010-07-01

    Metarhizium spp. is an important worldwide group of entomopathogenic fungi used as an interesting alternative to chemical insecticides in programs of agricultural pest and disease vector control. Metarhizium conidia are important in fungal propagation and also are responsible for host infection. Despite their importance, several aspects of conidial biology, including their proteome, are still unknown. We have established conidial and mycelial proteome reference maps for Metarhizium acridum using two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF MS). In all, 1130±102 and 1200±97 protein spots were detected in ungerminated conidia and fast-growing mycelia, respectively. Comparison of the two protein-expression profiles reveled that only 35% of the protein spots were common to both developmental stages. Out of 94 2-DE protein spots (65 from conidia, 25 from mycelia and two common to both) analyzed using mass spectrometry, seven proteins from conidia, 15 from mycelia and one common to both stages were identified. The identified protein spots exclusive to conidia contained sequences similar to known fungal stress-protector proteins (such as heat shock proteins (HSP) and 6-phosphogluconate dehydrogenase) plus the fungal allergen Alt a 7, actin and the enzyme cobalamin-independent methionine synthase. The identified protein spots exclusive to mycelia included proteins involved in several cell housekeeping biological processes. Three proteins (HSP 90, 6-phosphogluconate dehydrogenase and allergen Alt a 7) were present in spots in conidial and mycelial gels, but they differed in their locations on the two gels.

  10. Bottom-up proteomics suggests an association between differential expression of mitochondrial proteins and chronic fatigue syndrome.

    PubMed

    Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L

    2016-09-27

    Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments.

  11. Quantitative proteomics analysis of differential protein expression and oxidative modification of specific proteins in the brains of old mice.

    PubMed

    Poon, H Fai; Vaishnav, Radhika A; Getchell, Thomas V; Getchell, Marilyn L; Butterfield, D Allan

    2006-07-01

    The brain is susceptible to oxidative stress, which is associated with age-related brain dysfunction, because of its high content of peroxidizable unsaturated fatty acids, high oxygen consumption per unit weight, high content of key components for oxidative damage, and the relative scarcity of antioxidant defense systems. Protein oxidation, which results in functional disruption, is not random but appears to be associated with increased oxidation in specific proteins. By using a proteomics approach, we have compared the protein levels and specific protein carbonyl levels, an index of oxidative damage in the brains of old mice, to these parameters in the brains of young mice and have identified specific proteins that are altered as a function of aging. We show here that the expression levels of dihydropyrimidinase-like 2 (DRP2), alpha-enolase (ENO1), dynamin-1 (DNM1), and lactate dehydrogenase 2 (LDH2) were significantly increased in the brains of old versus young mice; the expression levels of three unidentified proteins were significantly decreased. The specific carbonyl levels of beta-actin (ACTB), glutamine synthase (GS), and neurofilament 66 (NF-66) as well as a novel protein were significantly increased, indicating protein oxidation, in the brains of old versus young mice. These results were validated by immunochemistry. In addition, enzyme activity assays demonstrated that oxidation was associated with decreased GS activity, while the activity of lactate dehydrogenase was unchanged in spite of an up-regulation of LDH2 levels. Several of the up-regulated and oxidized proteins in the brains of old mice identified in this report are known to be oxidized in neurodegenerative diseases as well, suggesting that these proteins may be particularly susceptible to processes associated with neurodegeneration. Our results establish an initial basis for understanding protein alterations that may lead to age-related cellular dysfunction in the brain.

  12. Comparative proteomic analysis of differentially expressed proteins in the earthworm Eisenia fetida during Escherichia coli O157:H7 stress.

    PubMed

    Wang, Xing; Chang, Li; Sun, Zhenjun; Zhang, Yufeng

    2010-12-03

    Escherichia coli O157:H7 is an intestine-inhabiting bacterium associated with many severe disease outbreaks worldwide. It may enter the soil environment with the excreta of infected animals (e.g., horses, cattle, chickens) and humans. Earthworms can protect themselves against invading pathogens because of their efficient innate defense system. Identification of differential proteomic responses to E. coli O157:H7 may provide a better understanding of the survival mechanisms of the earthworm Eisenia fetida that lives in E. coli O157:H7-polluted environments. Whole earthworm extracts, collected at days 7, 14, 21, and 28 after E. coli O157:H7 stress, were analyzed by two-dimensional gel electrophoresis and quantitative image analysis. In total, 124 proteins demonstrated significant regulation at least at one time point, and 52 proteins were identified by matrix-assisted laser desorption/ionization-tandem time-of-flight mass spectrometry and database searching. Compared with control samples, 11 protein spots were up-regulated and 41 were down-regulated for at least one time point. The identified proteins, including heat shock protein 90, fibrinolytic protease 0, gelsolin-like protein, lombricine kinase, coelomic cytolytic factor-1, manganous superoxide dismutase, catalase, triosephosphate isomerase, extracellular globin-4, lysenin, intermediate filament protein, and glyceraldehyde-3-phosphate dehydrogenase, are involved in several processes, including transcription, translation, the tricarboxylic acid cycle, and the glucose metabolic process. Thus, our study provides a functional profile of the E. coli O157:H7-responsive proteins in earthworms. We suggest that the variable levels and trends in these spots on the gel may be useful as biomarker profiles to investigate E. coli O157:H7 contamination levels in soils.

  13. Increased cell proliferation and differential protein expression induced by low-level Er:YAG laser irradiation in human gingival fibroblasts: proteomic analysis.

    PubMed

    Ogita, Mayumi; Tsuchida, Sachio; Aoki, Akira; Satoh, Mamoru; Kado, Sayaka; Sawabe, Masanori; Nanbara, Hiromi; Kobayashi, Hiroaki; Takeuchi, Yasuo; Mizutani, Koji; Sasaki, Yoshiyuki; Nomura, Fumio; Izumi, Yuichi

    2015-09-01

    Erbium-doped yttrium aluminum garnet (Er:YAG) laser treatment has demonstrated favorable wound healing effect after periodontal therapy. One of the reasons may be the positive biological effect of the low-level laser on the irradiated tissues, although the mechanism remains unclear. The aim of this study was to investigate the effect of low-level Er:YAG laser irradiation on cell proliferation and laser-induced differential expression of proteins in human gingival fibroblasts (HGFs) by proteomic analysis. In the first experiment, HGFs were exposed to low-level Er:YAG laser irradiation and the laser-induced cell proliferation and damage were evaluated on day 3. In the second experiment, proteomic analysis was performed on day 1 after irradiation. The peptides prepared from HGFs were analyzed by a hybrid ion trap-Fourier transform mass spectrometer, Mascot search engine, and UniProtKB database. A significant increase in cell proliferation without cell damage after irradiation was observed. Among the total identified 377 proteins, 59 proteins, including galectin-7, which was associated with the process of wound healing, were upregulated and 15 proteins were downregulated in laser-treated HGFs. In the third experiment, the increase in messenger RNA (mRNA) and protein expression of galectin-7 in the irradiated HGFs was validated by various analytical techniques. In addition, the effect of recombinant human galectin-7 on the modulation of HGFs proliferation was confirmed. The results indicate that low-level Er:YAG laser irradiation can promote HGF proliferation and induce a significant change in protein expression and the upregulation of galectin-7 expression may partly contribute to the increase in cell proliferation.

  14. Bottom-up proteomics suggests an association between differential expression of mitochondrial proteins and chronic fatigue syndrome

    PubMed Central

    Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L

    2016-01-01

    Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments. PMID:27676445

  15. Proteomic analysis of differentially expressed proteins in vitreous humor of patients with retinoblastoma using iTRAQ-coupled ESI-MS/MS approach.

    PubMed

    Naru, Jasmine; Aggarwal, Ritu; Singh, Usha; Mohanty, Ashok Kumar; Bansal, Deepak; Mangat, Navdeep; Kakkar, Nandita; Agnihotri, Navneet

    2016-10-01

    There is close proximity of vitreous humor with the tumor bulk in eyes with retinoblastoma. This renders vitreous humor a promising source to evaluate disease-specific protein targets in retinoblastoma. We studied the differential proteome of vitreous fluid in retinoblastoma tumors (n = 4) as compared to controls (n = 4). The vitreous humor was depleted off the high abundant fraction using MARS-6 affinity column. Subsequently, the tryptic peptides were derivatised with iTRAQ labels. The labelled peptides were pooled and subjected to fractionation using bRPLC. This was followed by protein identification and quantification using electrospray ionisation mass spectrometry (ESI-MS/MS) approach. The identified proteins were subjected to bioinformatics analysis utilizing PANTHER 7.0 and IPA software. Four hundred and thirty-one non-redundant (362 upregulated and 69 downregulated) proteins (≥2 unique peptides, ± 1.5 folds, p < 0.05) were identified. The majority of the proteins were cytoplasmic (40 %), majorly involved in catalytic (32.7 %) and binding activities (26.3 %). Highly deregulated proteins included MMP2, TNC, CD44, SUZ12 and CRABP1. The protein expression of GFAP, CRABP1, MMP2 and TNC was validated by western blotting. Pathway and network analyses revealed p38MAPK and Akt signalling to be the most significantly regulated pathways in retinoblastoma. This is the first report of differential vitreous proteome of retinoblastoma and highlights novel protein targets, such as MMP2, TNC and CRABP1. Further investigations into unravelling the biological role of the proteins and their prospects of being utilised as potential candidates in therapeutics are warranted.

  16. A proteomic study of the differential protein expression in MDBK cells after bovine herpesvirus type 1 infection (BHV-1) strain treatment

    PubMed Central

    Guo, Li; Yang, Yanling; Liu, Linna; Liao, Peng; Wen, Yongjun; Wu, Hua; Cheng, Shipeng

    2015-01-01

    Different BHV-1 strains, such as the virulent IBRV LN01/08 strains and the attenuated vaccine strain IBRV LNM, produces different clinical immune responses; however, the study of the differential protein expression in Madin-Darby bovine kidney (MDBK) cells after BHV-1-infection still remains unclear. Here, we applied a comparative proteomic strategy, based on 2D and MALDI-TOF/MS platforms, to examine the differential expression of proteins in MDBK cells that were treated and not treated with virulent IBRV LN01/08 and attenuated IBRV LNM strains. A total of eight differential proteins, including pyruvate kinase, heat shock protein (HSP) 90 (HSP90AA1 and HSP90AB1), annexin A, albumin (ALB), scinderin (SCIN), tubulin (alpha 1a) and vimentin (VIM), were identified. Among these proteins, pyruvate kinase, and HSP90 (HSP90AB1), tubulin and vimentin were identified in the virulent IBRV LN01/08 strain group, but were not identified in the attenuated IBRV LNM group. These results play an important role in tumor formation and development, cell migration, tumor cell line apoptosis, cell invasion and viral infection. The HSP90 (HSP90AA1) protein was identified in the control group and the attenuated IBRV LNM-infected group. Most studies have shown that HSP90 proteins were more of a cancer gene target, and inhibiting its function would result to oncogene degradation during cancer treatment. On the other hand, ALB is associated to cell differentiation, apoptosis, necrosis, cell death, viral infection, autophagy, interstitial tissue inflammation, and cell survival. These results provide a theoretical basis for the systematic understanding of BHV-1-infection mechanisms and BHV-1-induced immune responses. PMID:26064331

  17. Capillary Isoelectric Focusing Immunoassay for Fat Cell Differentiation Proteomics.

    PubMed

    Johlfs, Mary G; Gorjala, Priyatham; Urasaki, Yasuyo; Le, Thuc T; Fiscus, Ronald R

    2015-01-01

    Profiling cellular proteome is critical to understanding signal integration during cell fate determination. In this study, the capability of capillary isoelectric focusing (cIEF) immunoassays to detect post-translational modifications (PTM) of protein isoforms is demonstrated. cIEF immunoassays exhibit protein detection sensitivity at up to 5 orders of magnitude higher than traditional methods. This detection ultra-sensitivity permits proteomic profiling of several nanograms of tissue samples. cIEF immunoassays are employed to simultaneously profile three protein kinases during fat cell differentiation: cGMP-dependent protein kinase type I (PKG-I) of the nitric oxide (NO) signaling pathway, protein kinase B (Akt) of the insulin signaling pathway, and extracellular signal-regulated kinase (ERK) of the mitogen-activated protein kinase (MAPK) signaling pathway. Interestingly, a switch in the expression level of PKG- isoforms is observed during fat cell differentiation. While both PKG-Iα and PKG-Iβ isoforms are present in preadipocytes, only PKG-Iβ isoform is expressed in adipocytes. On the other hand, the phosphorylation level increases for Akt while decreases for ERK1 and ERK2 following the maturation of preadipocytes into adipocytes. Taken together, cIEF immunoassay provides a highly sensitive means to study fat cell differentiation proteomics. cIEF immunoassay should be a powerful proteomics tool to study complex protein signal integration in biological systems.

  18. Capillary Isoelectric Focusing Immunoassay for Fat Cell Differentiation Proteomics

    PubMed Central

    Johlfs, Mary G.; Gorjala, Priyatham; Urasaki, Yasuyo; Le, Thuc T.; Fiscus, Ronald R.

    2015-01-01

    Profiling cellular proteome is critical to understanding signal integration during cell fate determination. In this study, the capability of capillary isoelectric focusing (cIEF) immunoassays to detect post-translational modifications (PTM) of protein isoforms is demonstrated. cIEF immunoassays exhibit protein detection sensitivity at up to 5 orders of magnitude higher than traditional methods. This detection ultra-sensitivity permits proteomic profiling of several nanograms of tissue samples. cIEF immunoassays are employed to simultaneously profile three protein kinases during fat cell differentiation: cGMP-dependent protein kinase type I (PKG-I) of the nitric oxide (NO) signaling pathway, protein kinase B (Akt) of the insulin signaling pathway, and extracellular signal-regulated kinase (ERK) of the mitogen-activated protein kinase (MAPK) signaling pathway. Interestingly, a switch in the expression level of PKG- isoforms is observed during fat cell differentiation. While both PKG-Iα and PKG-Iβ isoforms are present in preadipocytes, only PKG-Iβ isoform is expressed in adipocytes. On the other hand, the phosphorylation level increases for Akt while decreases for ERK1 and ERK2 following the maturation of preadipocytes into adipocytes. Taken together, cIEF immunoassay provides a highly sensitive means to study fat cell differentiation proteomics. cIEF immunoassay should be a powerful proteomics tool to study complex protein signal integration in biological systems. PMID:26132171

  19. Differential proteomics of Helicobacter pylori associated with autoimmune atrophic gastritis.

    PubMed

    Repetto, Ombretta; Zanussi, Stefania; Casarotto, Mariateresa; Canzonieri, Vincenzo; De Paoli, Paolo; Cannizzaro, Renato; De Re, Valli

    2014-02-28

    Atrophic autoimmune gastritis (AAG) is a condition of chronic inflammation and atrophy of stomach mucosa, for which development can be partially triggered by the bacterial pathogen Helicobacter pylori (HP). HP can cause a variety of gastric diseases, such as duodenal ulcer (DU) or gastric cancer (GC). In this study, a comparative proteomic approach was used by two-dimensional fluorescence difference gel electrophoresis (DIGE) to identify differentially expressed proteins of HP strains isolated from patients with AAG, to identify markers of HP strain associated with AAG. Proteome profiles of HP isolated from GC or DU were used as a reference to compare proteomic levels. Proteomics analyses revealed 27 differentially expressed spots in AAG-associated HP in comparison with GC, whereas only 9 differential spots were found in AAG-associated HP profiles compared with DU. Proteins were identified after matrix-assisted laser desorption ionization (MALDI)-TOF and peptide mass fingerprinting. Some AAG-HP differential proteins were common between DU- and GC-HP (peroxiredoxin, heat shock protein 70 [HSP70], adenosine 5'-triphosphate [ATP] synthase subunit α, flagellin A). Our results presented here may suggest that comparative proteomes of HP isolated from AAG and DU share more common protein expression than GC and provide subsets of putative AAG-specific upregulated or downregulated proteins that could be proposed as putative markers of AAG-associated HP. Other comparative studies by two-dimensional maps integrated with functional genomics of candidate proteins will undoubtedly contribute to better decipher the biology of AAG-associated HP strains.

  20. Proteomic analysis of differentially expressed proteins involved in ethylene-induced chilling tolerance in harvested banana fruit

    PubMed Central

    Li, Taotao; Yun, Ze; Zhang, Dandan; Yang, Chengwei; Zhu, Hong; Jiang, Yueming; Duan, Xuewu

    2015-01-01

    To better understand the mechanism involved in ethylene-induced chilling tolerance in harvested banana fruit, a gel-based proteomic study followed by MALDI-TOF-TOF MS was carried out. Banana fruit were treated with 500 ppm ethylene for 12 h and then stored at 6°C. During cold storage, the chilling tolerance was assessed and the proteins from the peel were extracted for proteomic analysis. It was observed that ethylene pretreatment significantly induced the chilling tolerance in harvested banana fruit, manifesting as increases in maximal chlorophyll fluorescence (Fv/Fm) and decreased electrolyte leakage. Sixty-four proteins spots with significant differences in abundance were identified, most of which were induced by ethylene pretreatment during cold storage. The up-regulated proteins induced by ethylene pretreatment were mainly related to energy metabolism, stress response and defense, methionine salvage cycle and protein metabolism. These proteins were involved in ATP synthesis, ROS scavenging, protective compounds synthesis, protein refolding and degradation, and polyamine biosynthesis. It is suggested that these up-regulated proteins might play a role in the ethylene-induced chilling tolerance in harvested banana fruit. PMID:26528309

  1. Comparative proteomic analysis of differentially expressed proteins in β-aminobutyric acid enhanced Arabidopsis thaliana tolerance to simulated acid rain.

    PubMed

    Liu, Tingwu; Jiang, Xinwu; Shi, Wuliang; Chen, Juan; Pei, Zhenming; Zheng, Hailei

    2011-05-01

    Acid rain is a worldwide environmental issue that has seriously destroyed forest ecosystems. As a highly effective and broad-spectrum plant resistance-inducing agent, β-aminobutyric acid could elevate the tolerance of Arabidopsis when subjected to simulated acid rain. Using comparative proteomic strategies, we analyzed 203 significantly varied proteins of which 175 proteins were identified responding to β-aminobutyric acid in the absence and presence of simulated acid rain. They could be divided into ten groups according to their biological functions. Among them, the majority was cell rescue, development and defense-related proteins, followed by transcription, protein synthesis, folding, modification and destination-associated proteins. Our conclusion is β-aminobutyric acid can lead to a large-scale primary metabolism change and simultaneously activate antioxidant system and salicylic acid, jasmonic acid, abscisic acid signaling pathways. In addition, β-aminobutyric acid can reinforce physical barriers to defend simulated acid rain stress.

  2. Proteomic Characterization Reveals a Molecular Portrait of Nasopharyngeal Carcinoma Differentiation

    PubMed Central

    Xiao, Zhefeng; Li, Maoyu; Li, Guoqing; Fu, Ying; Peng, Fang; Chen, Yongheng; Chen, Zhuchu

    2017-01-01

    Nasopharyngeal carcinoma (NPC) is categorized into three different differentiated subtypes by World Health Organization (WHO). Based on an earlier comparative proteomic database of the three histological subtypes, the study was to deepen our understanding of molecular mechanisms associated with NPC differentiation through bio-information mining. Among the three subtypes were 194 differentially expressed proteins (DEPs) of 725 identified proteins. Two DEPs, heat shock protein family B (small) member 1 (HSPB1) and keratin 5 (KRT5), were validated in a series of NPC tissue samples by using immunohistochemistry. Quantified protein families including keratins, S100 proteins (S100s) and heat shock proteins exhibited characteristic expression alterations. Comparisons of predicted bio-function activation states among different subtypes, including formation of cellular protrusion, metastasis, cell death, and viral infections, were conducted. Canonical pathway analysis inferred that Rho GTPases related signaling pathways regulated the motility and invasion of dedifferentiated NPC. In conclusion, the study explored the proteomic characteristics of NPC differentiation, which could deepen our knowledge of NPC tumorigenesis and allow the development of novel targets of therapeutic and prognostic value in NPC. PMID:28367237

  3. Directed shotgun proteomics guided by saturated RNA-seq identifies a complete expressed prokaryotic proteome

    PubMed Central

    Omasits, Ulrich; Quebatte, Maxime; Stekhoven, Daniel J.; Fortes, Claudia; Roschitzki, Bernd; Robinson, Mark D.; Dehio, Christoph; Ahrens, Christian H.

    2013-01-01

    Prokaryotes, due to their moderate complexity, are particularly amenable to the comprehensive identification of the protein repertoire expressed under different conditions. We applied a generic strategy to identify a complete expressed prokaryotic proteome, which is based on the analysis of RNA and proteins extracted from matched samples. Saturated transcriptome profiling by RNA-seq provided an endpoint estimate of the protein-coding genes expressed under two conditions which mimic the interaction of Bartonella henselae with its mammalian host. Directed shotgun proteomics experiments were carried out on four subcellular fractions. By specifically targeting proteins which are short, basic, low abundant, and membrane localized, we could eliminate their initial underrepresentation compared to the estimated endpoint. A total of 1250 proteins were identified with an estimated false discovery rate below 1%. This represents 85% of all distinct annotated proteins and ∼90% of the expressed protein-coding genes. Genes that were detected at the transcript but not protein level, were found to be highly enriched in several genomic islands. Furthermore, genes that lacked an ortholog and a functional annotation were not detected at the protein level; these may represent examples of overprediction in genome annotations. A dramatic membrane proteome reorganization was observed, including differential regulation of autotransporters, adhesins, and hemin binding proteins. Particularly noteworthy was the complete membrane proteome coverage, which included expression of all members of the VirB/D4 type IV secretion system, a key virulence factor. PMID:23878158

  4. Directed Shotgun Proteomics Guided by Saturated RNA-seq Identifies a Complete Expressed Prokaryotic Proteome

    SciTech Connect

    Omasits, U.; Quebatte, Maxime; Stekhoven, Daniel J.; Fortes, Claudia; Roschitzki, Bernd; Robinson, Mark D.; Dehio, Christoph; Ahrens, Christian H.

    2013-11-01

    Prokaryotes, due to their moderate complexity, are particularly amenable to the comprehensive identification of the protein repertoire expressed under different conditions. We applied a generic strategy to identify a complete expressed prokaryotic proteome, which is based on the analysis of RNA and proteins extracted from matched samples. Saturated transcriptome profiling by RNA-seq provided an endpoint estimate of the protein-coding genes expressed under two conditions which mimic the interaction of Bartonella henselae with its mammalian host. Directed shotgun proteomics experiments were carried out on four subcellular fractions. By specifically targeting proteins which are short, basic, low abundant, and membrane localized, we could eliminate their initial underrepresentation compared to the estimated endpoint. A total of 1250 proteins were identified with an estimated false discovery rate below 1%. This represents 85% of all distinct annotated proteins and ~90% of the expressed protein-coding genes. Genes that were detected at the transcript but not protein level, were found to be highly enriched in several genomic islands. Furthermore, genes that lacked an ortholog and a functional annotation were not detected at the protein level; these may represent examples of overprediction in genome annotations. A dramatic membrane proteome reorganization was observed, including differential regulation of autotransporters, adhesins, and hemin binding proteins. Particularly noteworthy was the complete membrane proteome coverage, which included expression of all members of the VirB/D4 type IV secretion system, a key virulence factor.

  5. Quantitative proteomics of fractionated membrane and lumen exosome proteins from isogenic metastatic and nonmetastatic bladder cancer cells reveal differential expression of EMT factors.

    PubMed

    Jeppesen, Dennis Kjølhede; Nawrocki, Arkadiusz; Jensen, Steffen Grann; Thorsen, Kasper; Whitehead, Bradley; Howard, Kenneth A; Dyrskjøt, Lars; Ørntoft, Torben Falck; Larsen, Martin R; Ostenfeld, Marie Stampe

    2014-03-01

    Cancer cells secrete soluble factors and various extracellular vesicles, including exosomes, into their tissue microenvironment. The secretion of exosomes is speculated to facilitate local invasion and metastatic spread. Here, we used an in vivo metastasis model of human bladder carcinoma cell line T24 without metastatic capacity and its two isogenic derivate cell lines SLT4 and FL3, which form metastases in the lungs and liver of mice, respectively. Cultivation in CLAD1000 bioreactors rather than conventional culture flasks resulted in a 13- to 16-fold increased exosome yield and facilitated quantitative proteomics of fractionated exosomes. Exosomes from T24, SLT4, and FL3 cells were partitioned into membrane and luminal fractions and changes in protein abundance related to the gain of metastatic capacity were identified by quantitative iTRAQ proteomics. We identified several proteins linked to epithelial-mesenchymal transition, including increased abundance of vimentin and hepatoma-derived growth factor in the membrane, and casein kinase II α and annexin A2 in the lumen of exosomes, respectively, from metastatic cells. The change in exosome protein abundance correlated little, although significant for FL3 versus T24, with changes in cellular mRNA expression. Our proteomic approach may help identification of proteins in the membrane and lumen of exosomes potentially involved in the metastatic process.

  6. Leaf proteome analysis of transgenic plants expressing antiviral antibodies.

    PubMed

    Di Carli, Mariasole; Villani, Maria Elena; Renzone, Giovanni; Nardi, Luca; Pasquo, Alessandra; Franconi, Rosella; Scaloni, Andrea; Benvenuto, Eugenio; Desiderio, Angiola

    2009-02-01

    The expression of exogenous antibodies in plant is an effective strategy to confer protection against viral infection or to produce molecules with pharmaceutical interest. However, the acceptance of the transgenic technology to obtain self-protecting plants depends on the assessment of their substantial equivalence compared to non-modified crops with an established history of safe use. In fact, the possibility exists that the introduction of transgenes in plants may alter expression of endogenous genes and/or normal production of metabolites. In this study, we investigated whether the expression in plant of recombinant antibodies directed against viral proteins may influence the host leaf proteome. Two transgenic plant models, generated by Agrobacterium tumefaciens-mediated transformation, were analyzed for this purpose, namely, Lycopersicon esculentum cv. MicroTom and Nicotiana benthamiana, expressing recombinant antibodies against cucumber mosaic virus and tomato spotted wilt virus, respectively. To obtain a significant representation of plant proteomes, optimized extraction procedures have been devised for each plant species. The proteome repertoire of antibody-expressing and control plants was compared by 2-DE associated to DIGE technology. Among the 2000 spots detected within the gels, about 10 resulted differentially expressed in each transgenic model and were identified by MALDI-TOF PMF and muLC-ESI-IT-MS/MS procedures. Protein variations were restricted to a limited number of defined differences with an average ratio below 2.4. Most of the differentially expressed proteins were related to photosynthesis or defense function. The overall results suggest that the expression of recombinant antibodies in both systems does not significantly alter the leaf proteomic profile, contributing to assess the biosafety of resistant plants expressing antiviral antibodies.

  7. Proteomic analysis of placentas from cloned cat embryos identifies a set of differentially expressed proteins related to oxidative damage, senescence and apoptosis.

    PubMed

    Bang, Jae-Il; Bae, Dong-Won; Lee, Hyo-Sang; Deb, Gautam K; Kim, Myeong-Ok; Sohn, Sea-Hwan; Han, Chang-Hee; Kong, Il-Keun

    2011-12-01

    Production of cloned mammals by somatic cell nuclear transfer is associated with functional and structural abnormalities of placentation and with abnormal fetal development. A proteomic analysis was performed in domestic cats (Felis catus) to compare cloned term placentas (CTP) obtained from cesarean section (CS) to control placentas obtained from CS or vaginal delivery. The expression of 20 proteins was altered in CTP (p<0.05) compared to control placentas. The two control groups showed that the method of delivery, vaginal delivery or CS, did not affect protein expression (p>0.05). A total of 13 proteins were up-regulated in CTP, including apoptosis-related cathepsin D (CD), annexin A1 and heat shock protein 27 (HSP 27), and seven proteins were down-regulated in CTP, including prohibitin (PHB). The expression of PHB and CD was confirmed by Western blotting and immunofluorescence staining. The abnormal expression of PHB and CD correlated with the generation of reactive oxygen species, leading to decreased mitochondrial membrane potential and telomeric DNA, which are associated with cellular senescence and apoptosis. In summary, a specific pattern of abnormal protein expression is associated with the impaired development and functions of cloned placentas and hence with decreased fetal viability. Strategies aimed at restoring normal placental protein expression may increase the efficiency of somatic cell nuclear transfer and transgenic cat production and help restore endangered species.

  8. Melanogenesis stimulation in B16-F10 melanoma cells induces cell cycle alterations, increased ROS levels and a differential expression of proteins as revealed by proteomic analysis

    SciTech Connect

    Cunha, Elizabeth S.; Kawahara, Rebeca; Kadowaki, Marina K.; Amstalden, Hudson G.; Noleto, Guilhermina R.; Cadena, Silvia Maria S.C.; Winnischofer, Sheila M.B.; Martinez, Glaucia R.

    2012-09-10

    Considering that stimulation of melanogenesis may lead to alterations of cellular responses, besides melanin production, our main goal was to study the cellular effects of melanogenesis stimulation of B16-F10 melanoma cells. Our results show increased levels of the reactive oxygen species after 15 h of melanogenesis stimulation. Following 48 h of melanogenesis stimulation, proliferation was inhibited (by induction of cell cycle arrest in the G1 phase) and the expression levels of p21 mRNA were increased. In addition, melanogenesis stimulation did not induce cellular senescence. Proteomic analysis demonstrated the involvement of proteins from other pathways besides those related to the cell cycle, including protein disulfide isomerase A3, heat-shock protein 70, and fructose biphosphate aldolase A (all up-regulated), and lactate dehydrogenase (down-regulated). In RT-qPCR experiments, the levels of pyruvate kinase M2 mRNA dropped, whereas the levels of ATP synthase (beta-F1) mRNA increased. These data indicate that melanogenesis stimulation of B16-F10 cells leads to alterations in metabolism and cell cycle progression that may contribute to an induction of cell quiescence, which may provide a mechanism of resistance against cellular injury promoted by melanin synthesis. -- Highlights: Black-Right-Pointing-Pointer Melanogenesis stimulation by L-tyrosine+NH{sub 4}Cl in B16-F10 melanoma cells increases ROS levels. Black-Right-Pointing-Pointer Melanogenesis inhibits cell proliferation, and induced cell cycle arrest in the G1 phase. Black-Right-Pointing-Pointer Proteomic analysis showed alterations in proteins of the cell cycle and glucose metabolism. Black-Right-Pointing-Pointer RT-qPCR analysis confirmed alterations of metabolic targets after melanogenesis stimulation.

  9. Image analysis tools and emerging algorithms for expression proteomics

    PubMed Central

    English, Jane A.; Lisacek, Frederique; Morris, Jeffrey S.; Yang, Guang-Zhong; Dunn, Michael J.

    2012-01-01

    Since their origins in academic endeavours in the 1970s, computational analysis tools have matured into a number of established commercial packages that underpin research in expression proteomics. In this paper we describe the image analysis pipeline for the established 2-D Gel Electrophoresis (2-DE) technique of protein separation, and by first covering signal analysis for Mass Spectrometry (MS), we also explain the current image analysis workflow for the emerging high-throughput ‘shotgun’ proteomics platform of Liquid Chromatography coupled to MS (LC/MS). The bioinformatics challenges for both methods are illustrated and compared, whilst existing commercial and academic packages and their workflows are described from both a user’s and a technical perspective. Attention is given to the importance of sound statistical treatment of the resultant quantifications in the search for differential expression. Despite wide availability of proteomics software, a number of challenges have yet to be overcome regarding algorithm accuracy, objectivity and automation, generally due to deterministic spot-centric approaches that discard information early in the pipeline, propagating errors. We review recent advances in signal and image analysis algorithms in 2-DE, MS, LC/MS and Imaging MS. Particular attention is given to wavelet techniques, automated image-based alignment and differential analysis in 2-DE, Bayesian peak mixture models and functional mixed modelling in MS, and group-wise consensus alignment methods for LC/MS. PMID:21046614

  10. Eukaryotic expression: developments for structural proteomics.

    PubMed

    Aricescu, A R; Assenberg, R; Bill, R M; Busso, D; Chang, V T; Davis, S J; Dubrovsky, A; Gustafsson, L; Hedfalk, K; Heinemann, U; Jones, I M; Ksiazek, D; Lang, C; Maskos, K; Messerschmidt, A; Macieira, S; Peleg, Y; Perrakis, A; Poterszman, A; Schneider, G; Sixma, T K; Sussman, J L; Sutton, G; Tarboureich, N; Zeev-Ben-Mordehai, T; Jones, E Yvonne

    2006-10-01

    The production of sufficient quantities of protein is an essential prelude to a structure determination, but for many viral and human proteins this cannot be achieved using prokaryotic expression systems. Groups in the Structural Proteomics In Europe (SPINE) consortium have developed and implemented high-throughput (HTP) methodologies for cloning, expression screening and protein production in eukaryotic systems. Studies focused on three systems: yeast (Pichia pastoris and Saccharomyces cerevisiae), baculovirus-infected insect cells and transient expression in mammalian cells. Suitable vectors for HTP cloning are described and results from their use in expression screening and protein-production pipelines are reported. Strategies for co-expression, selenomethionine labelling (in all three eukaryotic systems) and control of glycosylation (for secreted proteins in mammalian cells) are assessed.

  11. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes

    PubMed Central

    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee

    2017-01-01

    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren’s syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation. PMID:28158262

  12. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes.

    PubMed

    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee

    2017-01-01

    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren's syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation.

  13. Proteomic analysis identifies differentially expressed proteins in AML1/ETO acute myeloid leukemia cells treated with DNMT inhibitors azacitidine and decitabine.

    PubMed

    Buchi, Francesca; Spinelli, Elena; Masala, Erico; Gozzini, Antonella; Sanna, Alessandro; Bosi, Alberto; Ferrari, Germano; Santini, Valeria

    2012-05-01

    Azacitidine and decitabine are DNA methyltransferase inhibitors used to treat myelodysplastic syndromes and acute myeloid leukemias. To further characterize different mechanisms between these two agents, cellular extracts from leukemic cells untreated or treated with either drug were analyzed using 2D electrophoresis. Numerous differentially expressed proteins were identified with MALDI-TOF/TOF-MS. Cyclophilin A, Catalase, Nucleophosmin and PCNA were decreased exclusively by azacitidine, TCP1 and hnRNP A2/B1 by both drugs; alpha-Enolase and Peroxiredoxin-1 by decitabine. Interestingly, the expression of the proinflammatory protein Cyclophilin A, also suggested as marker of cell necrosis, was stimulated by decitabine. Finally, a comprehensive pathway analysis of data highlighted a relationship between the identified proteins and potential effectors.

  14. Reproducibility of Differential Proteomic Technologies in CPTAC Fractionated Xenografts

    PubMed Central

    2015-01-01

    The NCI Clinical Proteomic Tumor Analysis Consortium (CPTAC) employed a pair of reference xenograft proteomes for initial platform validation and ongoing quality control of its data collection for The Cancer Genome Atlas (TCGA) tumors. These two xenografts, representing basal and luminal-B human breast cancer, were fractionated and analyzed on six mass spectrometers in a total of 46 replicates divided between iTRAQ and label-free technologies, spanning a total of 1095 LC–MS/MS experiments. These data represent a unique opportunity to evaluate the stability of proteomic differentiation by mass spectrometry over many months of time for individual instruments or across instruments running dissimilar workflows. We evaluated iTRAQ reporter ions, label-free spectral counts, and label-free extracted ion chromatograms as strategies for data interpretation (source code is available from http://homepages.uc.edu/~wang2x7/Research.htm). From these assessments, we found that differential genes from a single replicate were confirmed by other replicates on the same instrument from 61 to 93% of the time. When comparing across different instruments and quantitative technologies, using multiple replicates, differential genes were reproduced by other data sets from 67 to 99% of the time. Projecting gene differences to biological pathways and networks increased the degree of similarity. These overlaps send an encouraging message about the maturity of technologies for proteomic differentiation. PMID:26653538

  15. Reproducibility of Differential Proteomic Technologies in CPTAC Fractionated Xenografts

    SciTech Connect

    Tabb, David L.; Wang, Xia; Carr, Steven A.; Clauser, Karl R.; Mertins, Philipp; Chambers, Matthew C.; Holman, Jerry D.; Wang, Jing; Zhang, Bing; Zimmerman, Lisa J.; Chen, Xian; Gunawardena, Harsha P.; Davies, Sherri R.; Ellis, Matthew J. C.; Li, Shunqiang; Townsend, R. Reid; Boja, Emily S.; Ketchum, Karen A.; Kinsinger, Christopher R.; Mesri, Mehdi; Rodriguez, Henry; Liu, Tao; Kim, Sangtae; McDermott, Jason E.; Payne, Samuel H.; Petyuk, Vladislav A.; Rodland, Karin D.; Smith, Richard D.; Yang, Feng; Chan, Daniel W.; Zhang, Bai; Zhang, Hui; Zhang, Zhen; Zhou, Jian-Ying; Liebler, Daniel C.

    2016-03-04

    The NCI Clinical Proteomic Tumor Analysis Consortium (CPTAC) employed a pair of reference xenograft proteomes for initial platform validation and ongoing quality control of its data collection for The Cancer Genome Atlas (TCGA) tumors. These two xenografts, representing basal and luminal-B human breast cancer, were fractionated and analyzed on six mass spectrometers in a total of 46 replicates divided between iTRAQ and label-free technologies, spanning a total of 1095 LC-MS/MS experiments. These data represent a unique opportunity to evaluate the stability of proteomic differentiation by mass spectrometry over many months of time for individual instruments or across instruments running dissimilar workflows. We evaluated iTRAQ reporter ions, label-free spectral counts, and label-free extracted ion chromatograms as strategies for data interpretation. From these assessments we found that differential genes from a single replicate were confirmed by other replicates on the same instrument from 61-93% of the time. When comparing across different instruments and quantitative technologies, differential genes were reproduced by other data sets from 67-99% of the time. Projecting gene differences to biological pathways and networks increased the similarities. These overlaps send an encouraging message about the maturity of technologies for proteomic differentiation.

  16. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

    PubMed Central

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

    2016-01-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

  17. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei.

    PubMed

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J

    2016-02-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes.

  18. Identification of differentially expressed proteins of Arthrospira (Spirulina) plantensis-YZ under salt-stress conditions by proteomics and qRT-PCR analysis

    PubMed Central

    2013-01-01

    Arthrospira (Spirulina) platensis as a representative species of cyanobacteria has been recognized and used worldwide as a source of protein in the food, which possesses some unusual and valuable physiological characteristics, such as alkali and salt tolerance. Based on complete genome sequencing of Arthrospira (Spirulina) plantensis-YZ, we compared the protein expression profiles of this organism under different salt-stress conditions (i.e. 0.02 M, 0.5 M and 1.0 M NaCl, respectively), using 2-D electrophoresis and peptide mass fingerprinting, and retrieved 141 proteins showing significantly differential expression in response to salt-stress. Of the 141 proteins, 114 Arthrospira (Spirulina) plantensis-YZ proteins were found with significant homology to those found in Arthrospira (76 proteins in Arthrospira platensis str. Paraca and 38 in Arthrospira maxima CS-328). The remaining 27 proteins belong to other bacteria. Subsequently, we determined the transcriptional level of 29 genes in vivo in response to NaCl treatments and verified them by qRT-PCR. We found that 12 genes keep consistency at both transcription and protein levels, and transcription of all of them but one were up-regulated. We classified the 141 differentially expressed proteins into 18 types of function categories using COG database, and linked them to their respective KEGG metabolism pathways. These proteins are involved in 31 metabolism pathways, such as photosynthesis, glucose metabolism, cysteine and methionine metabolism, lysine synthesis, fatty acid metabolism, glutathione metabolism. Additionally, the SRPs, heat shock protein and ABC transporter proteins were identified, which probably render Arthrospira (Spirulina) plantensis’s resistance against high salt stress. PMID:23363438

  19. Proteomic Analysis of Differential Expression of Cellular Proteins in Response to Avian H9N2 Virus Infection of A549 Cells

    PubMed Central

    Yu, Guanliu; Liang, Wei; Liu, Jiyuan; Meng, Dan; Wei, Liangmeng; Chai, Tongjie; Cai, Yumei

    2016-01-01

    In this study, differentially expressed proteins in A549 cells (human lung adenocarcinoma epithelial cell line) infected with H9N2 avian influenza virus (AIV) were investigated by two-dimensional electrophoresis (2-DE). Sixteen different spots between the groups (ratio > 2, p < 0.05) were identified with mass spectrometry identification. Proteins located in the downstream of the NF-κB and IFN transcription factor pathways were identified, e.g., ISG15. Actin and keratin were also identified, suggesting that the cytoskeleton may plays an important role in the AIV infection of mammalian cells. These findings could provide insights into the interaction between host and influenza viruses and might provide valuable information for clarifying the pathogenesis of viral infections as well. PMID:28018302

  20. Differential Secreted Proteome Approach in Murine Model for Candidate Biomarker Discovery in Colon Cancer

    PubMed Central

    Rangiah, Kannan; Tippornwong, Montri; Sangar, Vineet; Austin, David; Tétreault, Marie-Pier; Rustgi, Anil K.; Blair, Ian A.; Yu, Kenneth H.

    2009-01-01

    The complexity and heterogeneity of the plasma proteome have presented significant challenges in the identification of protein changes associated with tumor development. We used cell culture as a model system and identified differentially expressed, secreted proteins which may constitute serological biomarkers. A stable isotope labeling by amino acids in cell culture (SILAC) approach was used to label the entire secreted proteomes of the CT26 murine colon cancer cell line and normal young adult mouse colon (YAMC) cell line, thereby creating a stable isotope labeled proteome (SILAP) standard. This SILAP standard was added to unlabeled murine CT26 colon cancer cell or normal murine YAMC colon epithelial cell secreted proteome samples. A multidimensional approach combining isoelectric focusing (IEF), strong cation exchange (SCX) followed by reversed phase liquid chromatography was used for extensive protein and peptide separation. A total of 614 and 929 proteins were identified from the YAMC and CT26 cell lines, with 418 proteins common to both cell lines. Twenty highly abundant differentially expressed proteins from these groups were selected for liquid chromatography-multiple reaction monitoring/mass spectrometry (LC-MRM/MS) analysis in sera. Differential secretion into the serum was observed for several proteins when Apcmin mice were compared with control mice. These findings were then confirmed by Western blot analysis. PMID:19769411

  1. [FUNCTIONAL DIFFERENTIATION IN BRYOZOAN COLONY: A PROTEOMIC ANALYSIS].

    PubMed

    Kutyumov, V A; Maltseva, A L; Kotenko, N; Ostrovsky, A N

    2016-01-01

    Bryozoans are typical modular organisms. They consist of repetitive structural units, the zooids. Bryozoan colonies grow by zooidal budding, with the distribution pattern of the budding loci underlying the diversity of colony forms. Budding is usually restricted to the zooids at the periphery of the colony, which form a "growing edge" or local terminal growth zones. Non-budding parts of the colony can be functionally subdivided, too. In many species colonies consists of regular, often repetitive zones of feeding and non-feeding modules, associated with a periodical degeneration and regeneration of the polypide, retractile tentacle crown with a gut and the accompanying musculature. So, there is functional differentiation in bryozoan colonies but its mechanisms are unknown. Presumably, budding and/or polypide recycling in different colony parts are induced or inhibited by certain determinants of functional specialization. An effective tool of their identification is the comparison of proteomes of functionally different zones. Here we report the results of proteomic analysis of three bryozoan species from the White Sea, which have a different colony form: Flustrellidra hispida, Terminoflustra membranaceotruncata and Securiflustra securifrons. Using differential two-dimensional electrophoresis (2D-DIGE), we compared proteomes of the growing edge and the zones consisting of feeding and non-feeding zooids in these species. We estimated the overall proteome variability, revealed proteins whose relative abundance gradually changed along the proximal-distal colony axis and suggested that they might be involved in the functional differentiation of the colony.

  2. Proteome analysis reveals differential expression of proteins involved in triacylglycerol accumulation by Rhodococcus jostii RHA1 after addition of methyl viologen.

    PubMed

    Dávila Costa, José Sebastián; Silva, Roxana A; Leichert, Lars; Alvarez, Héctor M

    2017-03-01

    Rhodococcus jostii RHA1 is able to degrade toxic compounds and accumulate high amounts of triacylglycerols (TAG) upon nitrogen starvation. These NADPH-dependent processes are essential for the adaptation of rhodococci to fluctuating environmental conditions. In this study, we used an MS-based, label-free and quantitative proteomic approach to better understand the integral response of R. jostii RHA1 to the presence of methyl viologen (MV) in relation to the synthesis and accumulation of TAG. The addition of MV promoted a decrease of TAG accumulation in comparison to cells cultivated under nitrogen-limiting conditions in the absence of this pro-oxidant. Proteomic analyses revealed that the abundance of key proteins of fatty acid biosynthesis, the Kennedy pathway, glyceroneogenesis and methylmalonyl-CoA pathway, among others, decreased in the presence of MV. In contrast, some proteins involved in lipolysis and β-oxidation of fatty acids were upregulated. Some metabolic pathways linked to the synthesis of NADPH remained activated during oxidative stress as well as under nitrogen starvation conditions. Additionally, exposure to MV resulted in the activation of complete antioxidant machinery comprising superoxide dismutases, catalases, mycothiol biosynthesis, mycothione reductase and alkyl hydroperoxide reductases, among others. Our study suggests that oxidative stress response affects TAG accumulation under nitrogen-limiting conditions through programmed molecular mechanisms when both stresses occur simultaneously.

  3. Temporal profiling of the adipocyte proteome during differentiation using a 5-plex SILAC based strategy

    PubMed Central

    Ruch, Travis; Kim, Jae-Woo; Mortensen, Peter; Otto, Tamara; Nalli, Anuradha; Tang, Qi-Qun; Lane, M. Daniel; Chaerkady, Raghothama; Pandey, Akhilesh

    2008-01-01

    The adipose tissue has important secretory and endocrine functions in humans. The regulation of adipocyte differentiation has been actively pursued using transcriptomic methods over the last several years. Quantitative proteomics has emerged as a promising approach to obtain temporal profiles of biological processes such as differentiation. Stable isotope labeling with amino acids in cell culture (SILAC) is a simple and robust method for labeling proteins in vivo. Here, we describe the development and application of a five-plex SILAC experiment using four different heavy stable isotopic forms of arginine to study the nuclear proteome and the secretome during the course of adipocyte differentiation. Tandem mass spectrometry analysis using a quadrupole time-of-flight instrument resulted in identification of a total 882 proteins from these two proteomes. Of these proteins, 427 were identified on the basis of one or more arginine containing peptides that allowed quantitation. In addition to previously reported molecules that are differentially expressed during the process of adipogenesis (e.g. adiponectin and lipoprotein lipase), we identified several proteins whose differential expression during adipocyte differentiation has not been documented previously. For example, THO complex 4, a context-dependent transcriptional activator in the T-cell receptor alpha enhancer complex, showed highest expression at middle stage of adipogenesis while SNF2 alpha, a chromatin remodeling protein, was downregulated upon initiation of adipogenesis and remained so during subsequent time points. This study using a 5-plex SILAC to investigate dynamics illustrates the power of this approach to identify differentially expressed proteins in a temporal fashion. PMID:18947249

  4. Differential proteomics analysis of Bacillus amyloliquefaciens and its genome-shuffled mutant for improving surfactin production.

    PubMed

    Zhao, Junfeng; Cao, Lin; Zhang, Chong; Zhong, Lei; Lu, Jing; Lu, Zhaoxin

    2014-10-31

    Genome shuffling technology was used as a novel whole-genome engineering approach to rapidly improve the antimicrobial lipopeptide yield of Bacillus amyloliquefaciens. Comparative proteomic analysis of the parental ES-2-4 and genome-shuffled FMB38 strains was conducted to examine the differentially expressed proteins. The proteome was separated by 2-DE (two dimensional electrophoresis) and analyzed by MS (mass spectrum). In the shuffled strain FMB38, 51 differentially expressed protein spots with higher than two-fold spot density were detected by gel image comparison. Forty-six protein spots were detectable by silver staining and further MS analysis. The results demonstrated that among the 46 protein spots expressed particularly induced in the genome-shuffled mutant, 15 were related to metabolism, five to DNA replication, recombination and repair, six to translation and post-translational modifications, one to cell secretion and signal transduction mechanisms, three to surfactin synthesis, two to energy production and conversion, and 14 to others. All these indicated that the metabolic capability of the mutant was improved by the genome shuffling. The study will enable future detailed investigation of gene expression and function linked with surfactin synthesis. The results of proteome analysis may provide information for metabolic engineering of Bacillus amyloliquefaciens for overproduction of surfactin.

  5. Differential alkylation-based redox proteomics--Lessons learnt.

    PubMed

    Wojdyla, Katarzyna; Rogowska-Wrzesinska, Adelina

    2015-12-01

    Cysteine is one of the most reactive amino acids. This is due to the electronegativity of sulphur atom in the side chain of thiolate group. It results in cysteine being present in several distinct redox forms inside the cell. Amongst these, reversible oxidations, S-nitrosylation and S-sulfenylation are crucial mediators of intracellular redox signalling, with known associations to health and disease. Study of their functionalities has intensified thanks to the development of various analytical strategies, with particular contribution from differential alkylation-based proteomics methods. Presented here is a critical evaluation of differential alkylation-based strategies for the analysis of S-nitrosylation and S-sulfenylation. The aim is to assess the current status and to provide insights for future directions in the dynamically evolving field of redox proteomics. To achieve that we collected 35 original research articles published since 2010 and analysed them considering the following parameters, (i) resolution of modification site, (ii) quantitative information, including correction of modification levels by protein abundance changes and determination of modification site occupancy, (iii) throughput, including the amount of starting material required for analysis. The results of this meta-analysis are the core of this review, complemented by issues related to biological models and sample preparation in redox proteomics, including conditions for free thiol blocking and labelling of target cysteine oxoforms.

  6. Differential proteomics analysis of mononuclear cells in cerebrospinal fluid of Parkinson's disease.

    PubMed

    Xing, Lifei; Wang, Dongtao; Wang, Lihong; Lan, Wenjie; Pan, Suyue

    2015-01-01

    Parkinson's disease (PD) is one common neurodegenerative disease featured with degeneration of dopaminergic neurons in substantia nigra. Multiple factors participate in the pathogenesis and progression of PD. In this study, we investigated the proteomics profiles of mononuclear cells in cerebrospinal fluids from both PD patients and normal people, in order to explore the correlation between disease factors and PD. Cerebrospinal fluid samples were collected from both PD and normal people and were separated for mononuclear cells in vitro. Proteins were then extracted and separated by 2-dimensional gel electrophoresis. Proteins with differential expressions were identified by comparison to standard proteome expression profile map, followed by software and database analysis. In PD patients, there were 8 proteins with consistent expression profile and 16 proteins with differential expressions. Those differential proteins identified include cytoskeleton proteins (actin, myosin), signal transduction proteins (adenosine cyclase binding protein 1, calcium binding protein, talin) and anti-oxidation factor (thioredoxin peroxide reductase). PD patients had differential protein expressional profiles in the mononuclear cells of cerebrospinal fluids compared to normal people, suggesting the potential involvement of cytoskeleton and signal transduction proteins in apoptosis of neuronal apoptosis and PD pathogenesis.

  7. Proteomic analysis of nipple aspirate fluid from women with early-stage breast cancer using isotope-coded affinity tags and tandem mass spectrometry reveals differential expression of vitamin D binding protein

    PubMed Central

    Pawlik, Timothy M; Hawke, David H; Liu, Yanna; Krishnamurthy, Savitri; Fritsche, Herbert; Hunt, Kelly K; Kuerer, Henry M

    2006-01-01

    Background Isotope-coded affinity tag (ICAT) tandem mass spectrometry (MS) allows for qualitative and quantitative analysis of paired protein samples. We sought to determine whether ICAT technology could quantify and identify differential expression of tumor-specific proteins in nipple aspirate fluid (NAF) from the tumor-bearing and contralateral disease-free breasts of patients with unilateral early-stage breast cancer. Methods Paired NAF samples from 18 women with stage I or II unilateral invasive breast carcinoma and 4 healthy volunteers were analyzed using ICAT labeling, sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), liquid chromatography, and MS. Proteins were identified by sequence database analysis. Western blot analysis of NAF from an independent sample set from 12 women (8 with early-stage breast cancer and 4 healthy volunteers) was also performed. Results 353 peptides were identified from tandem mass spectra and matched to peptide sequences in the National Center for Biotechnology Information database. Equal numbers of peptides were up- versus down-regulated. Alpha2HS-glycoprotein [Heavy:Light (H:L) ratio 0.63] was underexpressed in NAF from tumor-bearing breasts, while lipophilin B (H:L ratio 1.42), beta-globin (H:L ratio 1.98), hemopexin (H:L ratio 1.73), and vitamin D-binding protein precursor (H:L ratio 1.82) were overexpressed. Western blot analysis of pooled samples of NAF from healthy volunteers versus NAF from women with breast cancer confirmed the overexpression of vitamin D-binding protein in tumor-bearing breasts. Conclusion ICAT tandem MS was able to identify and quantify differences in specific protein expression between NAF samples from tumor-bearing and disease-free breasts. Proteomic screening techniques using ICAT and NAF may be used to find markers for diagnosis of breast cancer. PMID:16542425

  8. Proteome Dynamics during Plastid Differentiation in Rice1[W

    PubMed Central

    Kleffmann, Torsten; von Zychlinski, Anne; Russenberger, Doris; Hirsch-Hoffmann, Matthias; Gehrig, Peter; Gruissem, Wilhelm; Baginsky, Sacha

    2007-01-01

    We have analyzed proteome dynamics during light-induced development of rice (Oryza sativa) chloroplasts from etioplasts using quantitative two-dimensional gel electrophoresis and tandem mass spectrometry protein identification. In the dark, the etioplast allocates the main proportion of total protein mass to carbohydrate and amino acid metabolism and a surprisingly high number of proteins to the regulation and expression of plastid genes. Chaperones, proteins for photosynthetic energy metabolism, and enzymes of the tetrapyrrole pathway were identified among the most abundant etioplast proteins. The detection of 13 N-terminal acetylated peptides allowed us to map the exact localization of the transit peptide cleavage site, demonstrating good agreement with the prediction for most proteins. Based on the quantitative etioplast proteome map, we examined early light-induced changes during chloroplast development. The transition from heterotrophic metabolism to photosynthesis-supported autotrophic metabolism was already detectable 2 h after illumination and affected most essential metabolic modules. Enzymes in carbohydrate metabolism, photosynthesis, and gene expression were up-regulated, whereas enzymes in amino acid and fatty acid metabolism were significantly decreased in relative abundance. Enzymes involved in nucleotide metabolism, tetrapyrrole biosynthesis, and redox regulation remained unchanged. Phosphoprotein-specific staining at different time points during chloroplast development revealed light-induced phosphorylation of a nuclear-encoded plastid RNA-binding protein, consistent with changes in plastid RNA metabolism. Quantitative information about all identified proteins and their regulation by light is available in plprot, the plastid proteome database (http://www.plprot.ethz.ch). PMID:17189339

  9. Dissecting the Escherichia coli periplasmic chaperone network using differential proteomics

    PubMed Central

    Vertommen, Didier; Silhavy, Thomas J.; Collet, Jean-Francois

    2013-01-01

    β-barrel proteins, or outer membrane proteins (OMPs), perform many essential functions in Gram-negative bacteria, but questions remain about the mechanism by which they are assembled into the outer membrane (OM). In Escherichia coli, β-barrels are escorted across the periplasm by chaperones, most notably SurA and Skp. However, the contributions of these two chaperones to the assembly of the OM proteome remained unclear. We used differential proteomics to determine how the elimination of Skp and SurA affects the assembly of many OMPs. We have shown that removal of Skp has no impact on the levels of the 63 identified OM proteins. However, depletion of SurA in the skp strain has a marked impact on the OM proteome, diminishing the levels of almost all β-barrel proteins. Our results are consistent with a model in which SurA plays a primary chaperone role in E. coli. Furthermore, they suggest that while no OMPs prefer the Skp chaperone pathway in wild-type cells, most can use Skp efficiently when SurA is absent. Our data, which provide a unique glimpse into the protein content of the non-viable surA skp mutant, clarify the roles of the periplasmic chaperones in E. coli. PMID:22589188

  10. Soybean proteome database: a data resource for plant differential omics.

    PubMed

    Sakata, Katsumi; Ohyanagi, Hajime; Nobori, Hiroya; Nakamura, Takuji; Hashiguchi, Akiko; Nanjo, Yohei; Mikami, Yoji; Yunokawa, Harunobu; Komatsu, Setsuko

    2009-07-01

    The Soybean Proteome Database aims to be a data repository for functional analyses of soybean responses to flooding injury, recognized as a major constraint for establishment and production of this plant. The current release contains 21 reference maps of soybean (Glycine max cv. Enrei) proteins electrophoresed on two-dimensional polyacrylamide gels of which the samples were collected from several organs, tissues and organelles. These reference maps include 7311 detected proteins and 532 identified proteins, or proteins for which a sequence or peptide peak has been determined. The database is searchable by protein properties such as accession number, description and isoelectric point and molecular weight range. The Soybean Proteome Database also integrates multiple "omes". An omics table reveals relationships among 106 mRNAs, 51 proteins and 89 metabolites that vary over time under flooding stress. The tabulated metabolites are anchored to a metabolome network. A unified temporal-profile tag attached to the mRNAs, proteins and metabolites facilitates retrieval of the data based on the temporal expression profiles. A graphical user interface based on dynamic HTML facilitates viewing the metabolome network as well as the profiles of multiple omes in a uniform manner. The entire database is available at http://proteome.dc.affrc.go.jp/Soybean/.

  11. Differential Expression Analysis for Pathways

    PubMed Central

    Haynes, Winston A.; Higdon, Roger; Stanberry, Larissa; Collins, Dwayne; Kolker, Eugene

    2013-01-01

    Life science technologies generate a deluge of data that hold the keys to unlocking the secrets of important biological functions and disease mechanisms. We present DEAP, Differential Expression Analysis for Pathways, which capitalizes on information about biological pathways to identify important regulatory patterns from differential expression data. DEAP makes significant improvements over existing approaches by including information about pathway structure and discovering the most differentially expressed portion of the pathway. On simulated data, DEAP significantly outperformed traditional methods: with high differential expression, DEAP increased power by two orders of magnitude; with very low differential expression, DEAP doubled the power. DEAP performance was illustrated on two different gene and protein expression studies. DEAP discovered fourteen important pathways related to chronic obstructive pulmonary disease and interferon treatment that existing approaches omitted. On the interferon study, DEAP guided focus towards a four protein path within the 26 protein Notch signalling pathway. PMID:23516350

  12. Systems biology definition of the core proteome of metabolism and expression is consistent with high-throughput data

    PubMed Central

    Yang, Laurence; Tan, Justin; O’Brien, Edward J.; Monk, Jonathan M.; Kim, Donghyuk; Li, Howard J.; Charusanti, Pep; Ebrahim, Ali; Lloyd, Colton J.; Yurkovich, James T.; Du, Bin; Dräger, Andreas; Thomas, Alex; Sun, Yuekai; Saunders, Michael A.; Palsson, Bernhard O.

    2015-01-01

    Finding the minimal set of gene functions needed to sustain life is of both fundamental and practical importance. Minimal gene lists have been proposed by using comparative genomics-based core proteome definitions. A definition of a core proteome that is supported by empirical data, is understood at the systems-level, and provides a basis for computing essential cell functions is lacking. Here, we use a systems biology-based genome-scale model of metabolism and expression to define a functional core proteome consisting of 356 gene products, accounting for 44% of the Escherichia coli proteome by mass based on proteomics data. This systems biology core proteome includes 212 genes not found in previous comparative genomics-based core proteome definitions, accounts for 65% of known essential genes in E. coli, and has 78% gene function overlap with minimal genomes (Buchnera aphidicola and Mycoplasma genitalium). Based on transcriptomics data across environmental and genetic backgrounds, the systems biology core proteome is significantly enriched in nondifferentially expressed genes and depleted in differentially expressed genes. Compared with the noncore, core gene expression levels are also similar across genetic backgrounds (two times higher Spearman rank correlation) and exhibit significantly more complex transcriptional and posttranscriptional regulatory features (40% more transcription start sites per gene, 22% longer 5′UTR). Thus, genome-scale systems biology approaches rigorously identify a functional core proteome needed to support growth. This framework, validated by using high-throughput datasets, facilitates a mechanistic understanding of systems-level core proteome function through in silico models; it de facto defines a paleome. PMID:26261351

  13. Systems biology definition of the core proteome of metabolism and expression is consistent with high-throughput data.

    PubMed

    Yang, Laurence; Tan, Justin; O'Brien, Edward J; Monk, Jonathan M; Kim, Donghyuk; Li, Howard J; Charusanti, Pep; Ebrahim, Ali; Lloyd, Colton J; Yurkovich, James T; Du, Bin; Dräger, Andreas; Thomas, Alex; Sun, Yuekai; Saunders, Michael A; Palsson, Bernhard O

    2015-08-25

    Finding the minimal set of gene functions needed to sustain life is of both fundamental and practical importance. Minimal gene lists have been proposed by using comparative genomics-based core proteome definitions. A definition of a core proteome that is supported by empirical data, is understood at the systems-level, and provides a basis for computing essential cell functions is lacking. Here, we use a systems biology-based genome-scale model of metabolism and expression to define a functional core proteome consisting of 356 gene products, accounting for 44% of the Escherichia coli proteome by mass based on proteomics data. This systems biology core proteome includes 212 genes not found in previous comparative genomics-based core proteome definitions, accounts for 65% of known essential genes in E. coli, and has 78% gene function overlap with minimal genomes (Buchnera aphidicola and Mycoplasma genitalium). Based on transcriptomics data across environmental and genetic backgrounds, the systems biology core proteome is significantly enriched in nondifferentially expressed genes and depleted in differentially expressed genes. Compared with the noncore, core gene expression levels are also similar across genetic backgrounds (two times higher Spearman rank correlation) and exhibit significantly more complex transcriptional and posttranscriptional regulatory features (40% more transcription start sites per gene, 22% longer 5'UTR). Thus, genome-scale systems biology approaches rigorously identify a functional core proteome needed to support growth. This framework, validated by using high-throughput datasets, facilitates a mechanistic understanding of systems-level core proteome function through in silico models; it de facto defines a paleome.

  14. Proteomic analysis of MG132-treated germinating pollen reveals expression signatures associated with proteasome inhibition.

    PubMed

    Vannini, Candida; Bracale, Marcella; Crinelli, Rita; Marconi, Valerio; Campomenosi, Paola; Marsoni, Milena; Scoccianti, Valeria

    2014-01-01

    Chemical inhibition of the proteasome has been previously found to effectively impair pollen germination and tube growth in vitro. However, the mediators of these effects at the molecular level are unknown. By performing 2DE proteomic analysis, 24 differentially expressed protein spots, representing 14 unique candidate proteins, were identified in the pollen of kiwifruit (Actinidia deliciosa) germinated in the presence of the MG132 proteasome inhibitor. qPCR analysis revealed that 11 of these proteins are not up-regulated at the mRNA level, but are most likely stabilized by proteasome inhibition. These differentially expressed proteins are predicted to function in various pathways including energy and lipid metabolism, cell wall synthesis, protein synthesis/degradation and stress responses. In line with this evidence, the MG132-induced changes in the proteome were accompanied by an increase in ATP and ROS content and by an alteration in fatty acid composition.

  15. Dissecting Escherichia coli Outer Membrane Biogenesis Using Differential Proteomics

    PubMed Central

    Martorana, Alessandra M.; Motta, Sara; Di Silvestre, Dario; Falchi, Federica; Dehò, Gianni; Mauri, Pierluigi; Sperandeo, Paola; Polissi, Alessandra

    2014-01-01

    The cell envelope of Gram-negative bacteria is a complex multi-layered structure comprising an inner cytoplasmic membrane and an additional asymmetric lipid bilayer, the outer membrane, which functions as a selective permeability barrier and is essential for viability. Lipopolysaccharide, an essential glycolipid located in the outer leaflet of the outer membrane, greatly contributes to the peculiar properties exhibited by the outer membrane. This complex molecule is transported to the cell surface by a molecular machine composed of seven essential proteins LptABCDEFG that form a transenvelope complex and function as a single device. While advances in understanding the mechanisms that govern the biogenesis of the cell envelope have been recently made, only few studies are available on how bacterial cells respond to severe envelope biogenesis defects on a global scale. Here we report the use of differential proteomics based on Multidimensional Protein Identification Technology (MudPIT) to investigate how Escherichia coli cells respond to a block of lipopolysaccharide transport to the outer membrane. We analysed the envelope proteome of a lptC conditional mutant grown under permissive and non permissive conditions and identified 123 proteins whose level is modulated upon LptC depletion. Most such proteins belong to pathways implicated in cell envelope biogenesis, peptidoglycan remodelling, cell division and protein folding. Overall these data contribute to our understanding on how E. coli cells respond to LPS transport defects to restore outer membrane functionality. PMID:24967819

  16. Differential Proteomics Analysis of Colonic Tissues in Patients of Slow Transit Constipation

    PubMed Central

    Wan, Songlin; Liu, Weicheng; Tian, Cuiping; Ren, Xianghai; Ding, Zhao; Qian, Qun; Jiang, Congqing; Wu, Yunhua

    2016-01-01

    Objective. To investigate and screen the different expression of proteins in STC and normal group with a comparative proteomic approach. Methods. Two-dimensional electrophoresis was applied to separate the proteins in specimens from both 5 STC patients and 5 normal controls. The proteins with statistically significant differential expression between two groups were identified by computer aided image analysis and matrix assisted laser desorption ionization tandem time of flight mass spectrometry (MALDI-TOF-MS). Results. A total of 239 protein spots were identified in the average gel of the normal control and 215 in patients with STC. A total of 197 protein spots were matched and the mean matching rate was 82%. There were 14 protein spots which were expressed with statistically significant differences from others. Of those 14 protein spots, the expression of 12 spots increased markedly, while that of 2 spots decreased significantly. Conclusion. The proteomics expression in colonic specimens of STC patients is statistically significantly different from that of normal control, which may be associated with the pathogenesis of STC. PMID:27239471

  17. Exploration of Serum Proteomic Profiling and Diagnostic Model That Differentiate Crohn's Disease and Intestinal Tuberculosis

    PubMed Central

    Zhang, Fenming; Xu, Chengfu; Ning, Longgui; Hu, Fengling; Shan, Guodong; Chen, Hongtan; Yang, Ming; Chen, Wenguo; Yu, Jiekai; Xu, Guoqiang

    2016-01-01

    Aim To explore the diagnostic models of Crohn’s disease (CD), Intestinal tuberculosis (ITB) and the differential diagnostic model between CD and ITB by analyzing serum proteome profiles. Methods Serum proteome profiles from 30 CD patients, 21 ITB patients and 30 healthy controls (HCs) were analyzed by using weak cationic magnetic beads combined with MALDI-TOF-MS technique to detect the differentially expressed proteins of serum samples. Three groups were made and compared accordingly: group of CD patients and HCs, group of ITB patients and HCs, group of CD patients and ITB patients. Wilcoxon rank sum test was used to screen the ten most differentiated protein peaks (P < 0.05). Genetic algorithm combining with support vector machine (SVM) was utilized to establish the optimal diagnostic models for CD, ITB and the optimal differential diagnostic model between CD and ITB. The predictive effects of these models were evaluated by Leave one out (LOO) cross validation method. Results There were 236 protein peaks differently expressed between group of CD patients and HCs, 305 protein peaks differently expressed between group of ITB patients and HCs, 332 protein peaks differently expressed between group of CD patients and ITB patients. Ten most differentially expressed peaks were screened out between three groups respectively (P < 0.05) to establish diagnostic models and differential diagnostic model. A diagnostic model comprising of four protein peaks (M/Z 4964, 3029, 2833, 2900) can well distinguish CD patients and HCs, with a specificity and sensitivity of 96.7% and 96.7% respectively. A diagnostic model comprising four protein peaks (M/Z 3030, 2105, 2545, 4210) can well distinguish ITB patients and HCs, with a specificity and sensitivity of 93.3% and 95.2% respectively. A differential diagnostic model comprising three potential biomarkers protein peaks (M/Z 4267, 4223, 1541) can well distinguish CD patients and ITB patients, with a specificity and sensitivity of 76

  18. Comparative Proteomics for the Evaluation of Protein Expression and Modifications in Neurodegenerative Diseases.

    PubMed

    Conti, Antonio; Alessio, Massimo

    2015-01-01

    Together with hypothesis-driven approaches, high-throughput differential proteomic analysis performed primarily not only in human cerebrospinal fluid and serum but also on protein content of other tissues (blood cells, muscles, peripheral nerves, etc.) has been used in the last years to investigate neurodegenerative diseases. Even if the goal for these analyses was mainly the discovery of neurodegenerative disorders biomarkers, the characterization of specific posttranslational modifications (PTMs) and the differential protein expression resulted in being very informative to better define the pathological mechanisms. In this chapter are presented and discussed the positive aspects and challenges of the outcomes of some of our investigations on neurological and neurodegenerative disease, in order to highlight the important role of protein PTMs studies in proteomics-based approaches.

  19. Morphological and proteomic analysis of early stage of osteoblast differentiation in osteoblastic progenitor cells

    SciTech Connect

    Hong, Dun; Chen, Hai-Xiao; Yu, Hai-Qiang; Liang, Yong; Wang, Carrie; Lian, Qing-Quan; Deng, Hai-Teng; Ge, Ren-Shan

    2010-08-15

    Bone remodeling relies on a dynamic balance between bone formation and resorption, mediated by osteoblasts and osteoclasts, respectively. Under certain stimuli, osteoprogenitor cells may differentiate into premature osteoblasts and further into mature osteoblasts. This process is marked by increased alkaline phosphatase (ALP) activity and mineralized nodule formation. In this study, we induced osteoblast differentiation in mouse osteoprogenitor MC3T3-E1 cells and divided the process into three stages. In the first stage (day 3), the MC3T3-E1 cell under osteoblast differentiation did not express ALP or deposit a mineralized nodule. In the second stage, the MC3T3-E1 cell expressed ALP but did not form a mineralized nodule. In the third stage, the MC3T3-E1 cell had ALP activity and formed mineralized nodules. In the present study, we focused on morphological and proteomic changes of MC3T3-E1 cells in the early stage of osteoblast differentiation - a period when premature osteoblasts transform into mature osteoblasts. We found that mean cell area and mean stress fiber density were increased in this stage due to enhanced cell spreading and decreased cell proliferation. We further analyzed the proteins in the signaling pathway of regulation of the cytoskeleton using a proteomic approach and found upregulation of IQGAP1, gelsolin, moesin, radixin, and Cfl1. After analyzing the focal adhesion signaling pathway, we found the upregulation of FLNA, LAMA1, LAMA5, COL1A1, COL3A1, COL4A6, and COL5A2 as well as the downregulation of COL4A1, COL4A2, and COL4A4. In conclusion, the signaling pathway of regulation of the cytoskeleton and focal adhesion play critical roles in regulating cell spreading and actin skeleton formation in the early stage of osteoblast differentiation.

  20. Proteomic analysis of hyperadhesive Candida glabrata clinical isolates reveals a core wall proteome and differential incorporation of adhesins.

    PubMed

    Gómez-Molero, Emilia; de Boer, Albert D; Dekker, Henk L; Moreno-Martínez, Ana; Kraneveld, Eef A; Ichsan; Chauhan, Neeraj; Weig, Michael; de Soet, Johannes J; de Koster, Chris G; Bader, Oliver; de Groot, Piet W J

    2015-12-01

    Attachment to human host tissues or abiotic medical devices is a key step in the development of infections by Candida glabrata. The genome of this pathogenic yeast codes for a large number of adhesins, but proteomic work using reference strains has shown incorporation of only few adhesins in the cell wall. By making inventories of the wall proteomes of hyperadhesive clinical isolates and reference strain CBS138 using mass spectrometry, we describe the cell wall proteome of C. glabrata and tested the hypothesis that hyperadhesive isolates display differential incorporation of adhesins. Two clinical strains (PEU382 and PEU427) were selected, which both were hyperadhesive to polystyrene and showed high surface hydrophobicity. Cell wall proteome analysis under biofilm-forming conditions identified a core proteome of about 20 proteins present in all C. glabrata strains. In addition, 12 adhesin-like wall proteins were identified in the hyperadherent strains, including six novel adhesins (Awp8-13) of which only Awp12 was also present in CBS138. We conclude that the hyperadhesive capacity of these two clinical C. glabrata isolates is correlated with increased and differential incorporation of cell wall adhesins. Future studies should elucidate the role of the identified proteins in the establishment of C. glabrata infections.

  1. Differential proteomics analysis of liver failure in peripheral blood mononuclear cells using isobaric tags for relative and absolute quantitation

    PubMed Central

    Lin, Hua; Tan, Qiu-Pei; Sui, Wei-Guo; Chen, Wen-Biao; Peng, Wu-Jian; Liu, Xing-Chao; Dai, Yong

    2017-01-01

    The aim of the present study was to examine differentially expressed proteome profiles for candidate biomarkers in peripheral blood mononuclear cells (PBMCs) of liver failure (LF) patients. Ten patients were diagnosed as LF and 10 age- and gender-matched subjects were recruited as healthy controls. Isobaric tags for relative and absolute quantitation (iTRAQ)-based quantitative proteomic technology is efficiently applicable for identification and relative quantitation of the proteomes of PBMCs. Eight-plex iTRAQ coupled with strong cation exchange chromatography, and liquid chromatography coupled with tandem mass spectrometry were used to analyze total proteins in LF patients and healthy control subjects. Molecular variations were detected using the iTRAQ method, and western blotting was used to verify the results. LF is a complex type of medical emergency that evolves following a catastrophic insult to the liver, and its outcome remains the most ominous of all gastroenterologic diseases. Serious complications tend to occur during the course of the disease and further exacerbate the problems. Using the iTRAQ method, differentially expressed proteome profiles of LF patients were determined. In the present study, 627 proteins with different expression levels were identified in LF patients compared with the control subjects; with 409 proteins upregulated and 218 proteins downregulated. Among them, four proteins were significantly differentially expressed; acylaminoacyl-peptide hydrolase and WW domain binding protein 2 were upregulated, and resistin and tubulin β 2A class IIa were downregulated. These proteins demonstrated differences in their expression levels compared with other proteins with normal expression levels and the significant positive correlation with LF. The western blot results were consistent with the results from iTRAQ. Thus, investigation of the molecular mechanism of the proteins involved in LF may facilitate an improved understanding of the

  2. Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients

    PubMed Central

    2014-01-01

    Background Rheumatoid arthritis and osteoarthritis are two common musculoskeletal disorders that affect the joints. Despite high prevalence rates, etiological factors involved in these disorders remain largely unknown. Dissecting the molecular aspects of these disorders will significantly contribute to improving their diagnosis and clinical management. In order to identify proteins that are differentially expressed between these two conditions, a quantitative proteomic profiling of synovial fluid obtained from rheumatoid arthritis and osteoarthritis patients was carried out by using iTRAQ labeling followed by high resolution mass spectrometry analysis. Results We have identified 575 proteins out of which 135 proteins were found to be differentially expressed by ≥3-fold in the synovial fluid of rheumatoid arthritis and osteoarthritis patients. Proteins not previously reported to be associated with rheumatoid arthritis including, coronin-1A (CORO1A), fibrinogen like-2 (FGL2), and macrophage capping protein (CAPG) were found to be upregulated in rheumatoid arthritis. Proteins such as CD5 molecule-like protein (CD5L), soluble scavenger receptor cysteine-rich domain-containing protein (SSC5D), and TTK protein kinase (TTK) were found to be upregulated in the synovial fluid of osteoarthritis patients. We confirmed the upregulation of CAPG in rheumatoid arthritis synovial fluid by multiple reaction monitoring assay as well as by Western blot. Pathway analysis of differentially expressed proteins revealed a significant enrichment of genes involved in glycolytic pathway in rheumatoid arthritis. Conclusions We report here the largest identification of proteins from the synovial fluid of rheumatoid arthritis and osteoarthritis patients using a quantitative proteomics approach. The novel proteins identified from our study needs to be explored further for their role in the disease pathogenesis of rheumatoid arthritis and osteoarthritis. Sartaj Ahmad and Raja Sekhar Nirujogi

  3. Comparative proteomic analysis of four Bacillus clausii strains: proteomic expression signature distinguishes protein profile of the strains.

    PubMed

    Lippolis, Rosa; Gnoni, Antonio; Abbrescia, Anna; Panelli, Damiano; Maiorano, Stefania; Paternoster, Maria Stefania; Sardanelli, Anna Maria; Papa, Sergio; Gaballo, Antonio

    2011-11-18

    A comparative proteomic approach, using two dimensional gel electrophoresis and mass spectrometry, has been developed to compare and elucidate the differences among the cellular proteomes of four closely related isogenic O/C, SIN, N/R and T, B. clausii strains during both exponential and stationary phases of growth. Image analysis of the electropherograms reveals a high degree of concordance among the four proteomes, some proteins result, however, differently expressed. The proteins spots exhibiting high different expression level were identified, by mass-spectrometry analysis, as alcohol dehydrogenase (ADHA, EC1.2.1.3; ABC0046 isoform) aldehyde dehydrogenase (DHAS, EC 1.2.1.3; ABC0047 isoform) and flagellin-protein of B. clausii KSM-k16. The different expression levels of the two dehydrogenases were confirmed by quantitative RT-PCR and dehydrogenases enzymatic activity. The different patterns of protein expression can be considered as cell proteome signatures of the different strains.

  4. Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum

    PubMed Central

    Gao, Hua-Jun; Chen, Ya-Jing; Zuo, Duo; Xiao, Ming-Ming; Li, Ying; Guo, Hua; Zhang, Ning; Chen, Rui-Bing

    2015-01-01

    Objective Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths. Novel serum biomarkers are required to increase the sensitivity and specificity of serum screening for early HCC diagnosis. This study employed a quantitative proteomic strategy to analyze the differential expression of serum glycoproteins between HCC and normal control serum samples. Methods Lectin affinity chromatography (LAC) was used to enrich glycoproteins from the serum samples. Quantitative mass spectrometric analysis combined with stable isotope dimethyl labeling and 2D liquid chromatography (LC) separations were performed to examine the differential levels of the detected proteins between HCC and control serum samples. Western blot was used to analyze the differential expression levels of the three serum proteins. Results A total of 2,280 protein groups were identified in the serum samples from HCC patients by using the 2D LC-MS/MS method. Up to 36 proteins were up-regulated in the HCC serum, whereas 19 proteins were down-regulated. Three differential glycoproteins, namely, fibrinogen gamma chain (FGG), FOS-like antigen 2 (FOSL2), and α-1,6-mannosylglycoprotein 6-β-N-acetylglucosaminyltransferase B (MGAT5B) were validated by Western blot. All these three proteins were up-regulated in the HCC serum samples. Conclusion A quantitative glycoproteomic method was established and proven useful to determine potential novel biomarkers for HCC. PMID:26487969

  5. Differential proteome analysis of human embryonic kidney cell line (HEK-293) following mycophenolic acid treatment

    PubMed Central

    2011-01-01

    Background Mycophenolic acid (MPA) is widely used as a post transplantation medicine to prevent acute organ rejection. In the present study we used proteomics approach to identify proteome alterations in human embryonic kidney cells (HEK-293) after treatment with therapeutic dose of MPA. Following 72 hours MPA treatment, total protein lysates were prepared, resolved by two dimensional gel electrophoresis and differentially expressed proteins were identified by QTOF-MS/MS analysis. Expressional regulations of selected proteins were further validated by real time PCR and Western blotting. Results The proliferation assay demonstrated that therapeutic MPA concentration causes a dose dependent inhibition of HEK-293 cell proliferation. A significant apoptosis was observed after MPA treatment, as revealed by caspase 3 activity. Proteome analysis showed a total of 12 protein spots exhibiting differential expression after incubation with MPA, of which 7 proteins (complement component 1 Q subcomponent-binding protein, electron transfer flavoprotein subunit beta, cytochrome b-c1 complex subunit, peroxiredoxin 1, thioredoxin domain-containing protein 12, myosin regulatory light chain 2, and profilin 1) showed significant increase in their expression. The expression of 5 proteins (protein SET, stathmin, 40S ribosomal protein S12, histone H2B type 1 A, and histone H2B type 1-C/E/F/G/I) were down-regulated. MPA mainly altered the proteins associated with the cytoskeleton (26%), chromatin structure/dynamics (17%) and energy production/conversion (17%). Both real time PCR and Western blotting confirmed the regulation of myosin regulatory light chain 2 and peroxiredoxin 1 by MPA treatment. Furthermore, HT-29 cells treated with MPA and total kidney cell lysate from MMF treated rats showed similar increased expression of myosin regulatory light chain 2. Conclusion The emerging use of MPA in diverse pathophysiological conditions demands in-depth studies to understand molecular basis of

  6. Differential proteomics analysis of female and male adults of Angiostrongylus cantonensis.

    PubMed

    Song, Zengmei; Huang, Huicong; Tan, Feng; Zhang, Erpeng; Hu, Jianwen; Pan, Changwang

    2012-06-01

    In this study, we identified the differentially expressed proteins of female and male adults of Angiostrongylus cantonensis through differential proteomics. We extracted and purified total proteins from male and female adults, separated proteins by two-dimensional difference gel electrophoresis (2D-DIGE) in pH 4-7, analyzed the gel images by DeCyder 7.0 software, and sacrificed the infected rats to count the number of male and female adults. It was found 28 protein spots that were differentially expressed; seven protein spots were then identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Five proteins were up-regulated and two proteins down-regulated in male adults compared with female adults. Three of the five up-regulated proteins with known functions ascribed to them were identified as galectin-1, proteasome alpha subunit and peroxiredoxin. The two down-regulated proteins were identified as indoleamine dioxygenase like-myoglobin and galectin. Furthermore, the female was significantly greater than male adults (P<0.01) in the rats. The findings demonstrate the differences in protein expression profiles and the ability to survive in the final host between female and male adults of A. cantonensis, and may provide a theoretical basis to study their developmental biology further.

  7. A combined proteomic and transcriptomic approach to the study of stage differentiation in Leishmania infantum.

    PubMed

    McNicoll, François; Drummelsmith, Jolyne; Müller, Michaela; Madore, Eric; Boilard, Nathalie; Ouellette, Marc; Papadopoulou, Barbara

    2006-06-01

    Protozoan parasites of the genus Leishmania are found as promastigotes in the sandfly vector and as amastigotes in mammalian macrophages. Mechanisms controlling stage-regulated gene expression in these organisms are poorly understood. Here, we applied a comprehensive approach consisting of protein prefractionation, global proteomics and targeted DNA microarray analysis to the study of stage differentiation in Leishmania. By excluding some abundant structural proteins and reducing complexity, we detected and identified numerous novel differentially expressed protein isoforms in L. infantum. Using 2-D gels, over 2200 protein isoforms were visualized in each developmental stage. Of these, 6.1% were strongly increased or appeared unique in the promastigote stage, while the relative amounts of 12.4% were increased in amastigotes. Amastigote-specific protein isoform and mRNA expression trends correlated modestly (53%), while no correlation was found for promastigote-specific spots. Even where direction of regulation was similar, fold-changes were more modest at the RNA than protein level. Many proteins were present in multiple spots, suggesting that PTM is extensive in this organism. In several cases, different isoforms appeared to be specific to different life stages. Our results suggest that post-transcriptional controls at translational and post-translational levels could play major roles in differentiation in Leishmania parasites.

  8. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication.

    PubMed

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  9. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    PubMed Central

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  10. Mild caloric restriction up-regulates the expression of prohibitin: A proteome study

    SciTech Connect

    Takahashi, Shoko; Masuda, Junko; Shimagami, Hiroshi; Ohta, Yutaka; Kanda, Tomomasa; Saito, Kenji; Kato, Hisanori

    2011-02-18

    Research highlights: {yields} Proteomic analysis was performed to elucidate physiological alterations induced by mild CR. {yields} The results suggest good reproducibility and possibility to grasp the important response of CR. {yields} The increase in prohibitin abundance was observed in CR groups by proteomic analysis. {yields} We hypothesize that prohibitin might be involved in the longevity induced by CR. -- Abstract: Caloric restriction (CR) is well known to expand lifespan in a variety of species and to retard many age-related diseases. The effects of relatively mild CR on the proteome profile in relation to lifespan have not yet been reported, despite the more extensive studies of the stricter CR conditions. Thus, the present study was conducted to elucidate the protein profiles in rat livers after mild CR for a relatively short time. Young growing rats were fed CR diets (10% and 30% CR) for 1 month. We performed the differential proteomic analysis of the rat livers using two-dimensional electrophoresis combined with MALDI-TOF mass spectrometry. The most remarkable protein among the differentially expressed proteins was found to be prohibitin, the abundance of which was increased by 30% CR. Prohibitin is a ubiquitously expressed protein shown to suppress cell proliferation and to be related to longevity. The increase in prohibitin was observed both in 10% and 30% CR by Western blot analysis. Furthermore, induction of AMP-activated kinase (AMPK) protein, related to the actions of prohibitin in promoting longevity, was observed. The increased prohibitin level in response to subtle CR suggests that this increase may be one of the early events leading to the expansion of lifespan in response to CR.

  11. Differential proteome and secretome analysis during rice-pathogen interaction.

    PubMed

    Wang, Yiming; Kim, Sang Gon; Wu, Jingni; Kim, Sun Tae; Kang, Kyu Young

    2014-01-01

    Substantial evidences implicate that sample preparation and protein extraction in proteomic studies of plant-pathogen interactions are critical to understand cross talk between host and pathogen. Therefore, interest is growing in applying proteomics techniques to investigate simultaneously secreted proteins from rice and pathogen. We have found, however, that most proteins of interest are low abundant so that proper prefractionation or extraction of secreted proteins from extracellular space (ECS) in the rice leaf is required to excavate relevant protein. This chapter describes the preparation of sample and extraction procedure to enrich the proteins interested before separation by 2-DE or LC-MS/MS. This method significantly increases the sensitivity of proteomic comparisons.

  12. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  13. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  14. Transcriptome and proteome characterization of surface ectoderm cells differentiated from human iPSCs

    PubMed Central

    Qu, Ying; Zhou, Bo; Yang, Wei; Han, Bingchen; Yu-Rice, Yi; Gao, Bowen; Johnson, Jeffery; Svendsen, Clive N.; Freeman, Michael R.; Giuliano, Armando E.; Sareen, Dhruv; Cui, Xiaojiang

    2016-01-01

    Surface ectoderm (SE) cells give rise to structures including the epidermis and ectodermal associated appendages such as hair, eye, and the mammary gland. In this study, we validate a protocol that utilizes BMP4 and the γ-secretase inhibitor DAPT to induce SE differentiation from human induced pluripotent stem cells (hiPSCs). hiPSC-differentiated SE cells expressed markers suggesting their commitment to the SE lineage. Computational analyses using integrated quantitative transcriptomic and proteomic profiling reveal that TGFβ superfamily signaling pathways are preferentially activated in SE cells compared with hiPSCs. SE differentiation can be enhanced by selectively blocking TGFβ-RI signaling. We also show that SE cells and neural ectoderm cells possess distinct gene expression patterns and signaling networks as indicated by functional Ingenuity Pathway Analysis. Our findings advance current understanding of early human SE cell development and pave the way for modeling of SE-derived tissue development, studying disease pathogenesis, and development of regenerative medicine approaches. PMID:27550649

  15. iTRAQ-based differential proteomic analysis in Mongolian gerbil brains chronically infected with Toxoplasma gondii.

    PubMed

    Lv, Lin; Wang, Yapei; Feng, Weili; Hernandez, Jorge A; Huang, Wanyi; Zheng, Yuxiang; Zhou, Xue; Lv, Shumei; Chen, Yajun; Yuan, Zi-Guo

    2017-03-17

    The aim of our study was to detect differentially regulated proteins and specific signaling pathways in Mongolian gerbil brains during chronic Toxoplasma gondii (T.gondii) PRU strain infection. We use a iTRAQ-based strategy to detecte 4935 proteins, out of which 110 proteins were differentially expressed (>/=2.0-fold, p value <0.05) when the brain of gerbils infected with T.gondii was compared to control brain tissues. We confirmed the authenticity and the accuracy of iTRAQ results through quantitative real-time PCR and western blot (WB), which was consistent with mass spectrometry analysis. Pathway analysis and GO (Gene Ontology) annotations indicated the deregulation of several pathways related to immune response, metabolism and neurological processes, like neuronal growth and neurotransmitter transport. Through the iTRAQ-based strategy, we obtained a comparative proteome profile of brain tissues from Mongolian gerbils with chronic infection of T.gondii. Several differentially expressed proteins involved in neurological pathways, like Parvalbumin, Drebrin or Synaptotagmin, can be further investigated to enhance our understanding of central nervous system (CNS) injury caused by T.gondii.

  16. High-Throughput Proteomics Reveals the Unicellular Roots of Animal Phosphosignaling and Cell Differentiation.

    PubMed

    Sebé-Pedrós, Arnau; Peña, Marcia Ivonne; Capella-Gutiérrez, Salvador; Antó, Meritxell; Gabaldón, Toni; Ruiz-Trillo, Iñaki; Sabidó, Eduard

    2016-10-24

    Cell-specific regulation of protein levels and activity is essential for the distribution of functions among multiple cell types in animals. The finding that many genes involved in these regulatory processes have a premetazoan origin raises the intriguing possibility that the mechanisms required for spatially regulated cell differentiation evolved prior to the appearance of animals. Here, we use high-throughput proteomics in Capsaspora owczarzaki, a close unicellular relative of animals, to characterize the dynamic proteome and phosphoproteome profiles of three temporally distinct cell types in this premetazoan species. We show that life-cycle transitions are linked to extensive proteome and phosphoproteome remodeling and that they affect key genes involved in animal multicellularity, such as transcription factors and tyrosine kinases. The observation of shared features between Capsaspora and metazoans indicates that elaborate and conserved phosphosignaling and proteome regulation supported temporal cell-type differentiation in the unicellular ancestor of animals.

  17. Novel markers of osteogenic and adipogenic differentiation of human bone marrow stromal cells identified using a quantitative proteomics approach.

    PubMed

    Granéli, Cecilia; Thorfve, Anna; Ruetschi, Ulla; Brisby, Helena; Thomsen, Peter; Lindahl, Anders; Karlsson, Camilla

    2014-01-01

    Today, the tool that is most commonly used to evaluate the osteogenic differentiation of bone marrow stromal cells (BMSCs) in vitro is the demonstration of the expression of multiple relevant markers, such as ALP, RUNX2 and OCN. However, as yet, there is no single surface marker or panel of markers which clearly defines human BMSCs (hBMSCs) differentiating towards the osteogenic lineage. The aim of this study was therefore to examine this issue. Stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomics was utilized to investigate differently expressed surface markers in osteogenically differentiated and undifferentiated hBMSCs. Labeled membrane proteins were analyzed by mass spectrometry (MS) and 52 proteins with an expression ratio above 2, between osteogenically differentiated and undifferentiated cells, were identified. Subsequent validation, by flow cytometry and ELISA, of the SILAC expression ratios for a number of these proteins and investigations of the lineage specificity of three candidate markers were performed. The surface markers, CD10 and CD92, demonstrated significantly increased expression in hBMSCs differentiated towards the osteogenic and adipogenic lineages. In addition, there was a slight increase in CD10 expression during chondrogenic differentiation. Furthermore, the expression of the intracellular protein, crystalline-αB (CRYaB), was only significantly increased in osteogenically differentiated hBMSCs and not affected during differentiation towards the chondrogenic or adipogenic lineages. It has been concluded from the present results that CD10 and CD92 are potential markers of osteogenic and adipogenic differentiation and that CRYaB is a potential novel osteogenic marker specifically expressed during the osteogenic differentiation of hBMSCs in vitro.

  18. Differential proteomics analysis of low- and high-grade of astrocytoma using iTRAQ quantification

    PubMed Central

    Ren, Tong; Lin, Shide; Wang, Zhongfeng; Shang, Aijia

    2016-01-01

    Astrocytoma is one of the most common types of brain tumor, which is histologically and clinically classified into four grades (I–IV): I (pilocytic astrocytoma), II (diffuse astrocytoma), III (anaplastic astrocytoma), and IV (glioblastoma multiforme). A higher grade astrocytoma represents a worse prognosis and is more aggressive. In this study, we compared the differential proteome profile of astrocytoma from grades I to IV. The protein samples from clinical specimens of grades I, II, III, and IV astrocytoma were analyzed by two-dimensional liquid chromatography–tandem mass spectrometry and isobaric tags for relative and absolute quantitation and quantification. A total of 2,190 proteins were identified. Compared to grade I astrocytoma, 173 (12.4%), 304 (14%), and 462 (21.2%) proteins were aberrantly expressed in grades II, III, and IV, respectively. By bioinformatics analysis, the cell proliferation, invasion, and angiogenesis-related pathways increase from low- to high-grade of astrocytoma. Five differentially expressed proteins were validated by Western blot. Within them, matrix metalloproteinase-9 and metalloproteinase inhibitor 1 were upregulated in glioblastoma multiforme group; whereas fibulin-2 and -5 were downregulated in grade II/III/IV astrocytoma, and the negative expression was significantly associated with advanced clinical stage. Functional analysis showed that both fibulin-2 and -5 may exert an antitumor effect by inhibiting cell proliferation, in vitro migration/invasion in glioma cells. New molecular biomarkers are likely to be used for accurate classification of astrocytoma and likely to be the target for drug development. PMID:27713642

  19. Differential Proteomic Analysis Using iTRAQ Reveals Alterations in Hull Development in Rice (Oryza sativa L.).

    PubMed

    Wang, Shuzhen; Chen, Wenyue; Xiao, Wenfei; Yang, Changdeng; Xin, Ya; Qiu, Jieren; Hu, Weimin; Ying, Wu; Fu, Yaping; Tong, Jianxin; Hu, Guocheng; Chen, Zhongzhong; Fang, Xianping; Yu, Hong; Lai, Wenguo; Ruan, Songlin; Ma, Huasheng

    2015-01-01

    Rice hull, the outer cover of the rice grain, determines grain shape and size. Changes in the rice hull proteome in different growth stages may reflect the underlying mechanisms involved in grain development. To better understand these changes, isobaric tags for relative and absolute quantitative (iTRAQ) MS/MS was used to detect statistically significant changes in the rice hull proteome in the booting, flowering, and milk-ripe growth stages. Differentially expressed proteins were analyzed to predict their potential functions during development. Gene ontology (GO) terms and pathways were used to evaluate the biological mechanisms involved in rice hull at the three growth stages. In total, 5,268 proteins were detected and characterized, of which 563 were differentially expressed across the development stages. The results showed that the flowering and milk-ripe stage proteomes were more similar to each other (r=0.61) than either was to the booting stage proteome. A GO enrichment analysis of the differentially expressed proteins was used to predict their roles during rice hull development. The potential functions of 25 significantly differentially expressed proteins were used to evaluate their possible roles at various growth stages. Among these proteins, an unannotated protein (Q7X8A1) was found to be overexpressed especially in the flowering stage, while a putative uncharacterized protein (B8BF94) and an aldehyde dehydrogenase (Q9FPK6) were overexpressed only in the milk-ripe stage. Pathways regulated by differentially expressed proteins were also analyzed. Magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase (Q9SDJ2), and two magnesium-chelatase subunits, ChlD (Q6ATS0), and ChlI (Q53RM0), were associated with chlorophyll biosynthesis at different developmental stages. The expression of Q9SDJ2 in the flowering and milk-ripe stages was validated by qRT-PCR. The 25 candidate proteins may be pivotal markers for controlling rice hull development at various

  20. Proteomic and gene expression analyses during bolting-related leaf color change in Brassica rapa.

    PubMed

    Zhang, Y W; Guo, M H; Tang, X B; Jin, D; Fang, Z Y

    2016-08-12

    Bolting and flowering are key processes during the growth and development of Chinese cabbage (Brassica rapa L. ssp pekinensis). Understanding the molecular mechanisms underlying bolting and flowering is of significance for improving production of the vegetable. A leaf-color change from bright green to gray-green has been observed following differentiation of the flowering stem and before bolting in the vegetable, and is considered to be a signal for bolting. Proteomics in meristem tissues of an inbred line (C30) were analyzed by two-dimensional electrophoresis during the transition period. We found that some proteins were specifically expressed while others were differentially expressed. Among these, 17 proteins were specifically expressed before the color change, 18 were specifically expressed after the color change, 21 were downregulated during the color change, and 29 were upregulated. Mass spectrometric analysis (MALDI-TOF-TOF/MS) was used to analyze 17 protein spots, and four proteins (subunit E1 of vacuolar-type H+ transporter ATPase, the large subunit of Rubicon, S-adenosylmethionine synthetase, and tubulin α-2) were identified. qPCR analysis was conducted to quantify the expression of genes encoding these proteins during the transitional period. The expression of BrVHA-E1, BrSAMS, BrrbcL, and BrTUA6 was significantly different before and after the leaf-color change, suggesting that these genes might be involved in regulating flower differentiation and bolting.

  1. Differential Aminoacylase Expression in Neuroblastoma

    PubMed Central

    Long, Patrick M.; Stradecki, Holly M.; Minturn, Jane E.; Wesley, Umadevi V.; Jaworski, Diane M.

    2012-01-01

    Neuroblastoma, a cancer of the sympathetic nervous system, is the most common extracranial solid tumor in children. MYCN amplification and increased BDNF/TrkB signaling are features of high-risk tumors; yet, only ~25% of malignant tumors display these features. Thus, the identification of additional biomarkers and therapeutic targets is essential. Since aminoacylase 1 (ACY1), an amino acid deacetylase, is a putative tumor suppressor in small cell lung and renal cell carcinomas, we investigated whether it or the other family members aspartoacylase (ASPA, aminoacylase 2) or aminoacylase 3 (ACY3) could serve a similar function in neuroblastoma. Aminoacylase expression was examined in TrkB-positive, MYCN-amplified (SMS-KCNR and SK-N-BE) and TrkB-negative, non-MYCN amplified (SK-N-AS, SK-N-SH, SH-SY5Y, and SH-EP) neuroblastoma cell lines. Each aminoacylase exhibited distinct spatial localization (i.e., cytosolic ACY1, membrane-associated ASPA, and nuclear ACY3). When SK-N-SH cells were treated with neural differentiation agents (e.g., retinoic acid, cAMP) in media containing 10% serum ACY1 was the only aminoacylase whose expression was up-regulated. ASPA was primarily expressed in SH-EP cells of a glial sublineage. ACY3 was more highly expressed in the TrkB-positive, MYCN-amplified lines. All three aminoacylases were expressed in normal human adrenal gland, a common site of neuroblastoma origin, but only ACY1 and ACY3 displayed detectable expression in primary neuroblastoma tumor. Bioinformatics data mining of Kaplan-Meier survival revealed that high ACY3 expression is correlated with poor prognosis; while, low expression of ACY1 or ASPA is correlated with poor prognosis. These data suggest that aminoacylase expression is dysregulated in neuroblastoma. PMID:21128244

  2. Teaching Expression Proteomics: From the Wet-Lab to the Laptop

    ERIC Educational Resources Information Center

    Teixeira, Miguel C.; Santos, Pedro M.; Rodrigues, Catarina; Sa-Correia, Isabel

    2009-01-01

    Expression proteomics has become, in recent years, a key genome-wide expression approach in fundamental and applied life sciences. This postgenomic technology aims the quantitative analysis of all the proteins or protein forms (the so-called proteome) of a given organism in a given environmental and genetic context. It is a challenge to provide…

  3. Differential proteomics profiling of the ova between healthy and Rice stripe virus-infected female insects of Laodelphax striatellus

    PubMed Central

    Liu, Beibei; Qin, Faliang; Liu, Wenwen; Wang, Xifeng

    2016-01-01

    Rice stripe virus-infected females of the small brown planthopper (SBPH, Laodelphax striatellus) usually lay fewer eggs with a longer hatch period, low hatchability, malformation and retarded or defective development compared with healthy females. To explore the molecular mechanism of those phenomena, we analyzed the differential proteomics profiling of the ova between viruliferous and healthy female insects using an isobaric tag for relative and absolute quantitation (iTRAQ) approach. We obtained 147 differentially accumulated proteins: 98 (66.7%) proteins increased, but 49 (33.3%) decreased in the ova of the viruliferous females. RT-qPCR was used to verify the 12 differential expressed proteins from iTRAQ, finding that trends in the transcriptional change for the 12 genes were consistent with those at the proteomic level. Differentially expressed proteins that were associated with meiosis (serine/threonine-protein phosphatase 2B and cyclin B3) and mitosis (cyclin B3 and dynein heavy chain) in viruliferous ova may contribute to low hatchability and defective or retarded development. Alterations in the abundance of proteins involved in the respiratory chain and nutrition metabolism may affect embryonic development. Our study begins to explain macroscopical developmental phenomena and explore the mechanisms by which Rice stripe virus impacts the development of SBPH. PMID:27277140

  4. Cardioinductive network guiding stem cell differentiation revealed by proteomic cartography of tumor necrosis factor alpha-primed endodermal secretome.

    PubMed

    Arrell, D Kent; Niederländer, Nicolas J; Faustino, Randolph S; Behfar, Atta; Terzic, Andre

    2008-02-01

    In the developing embryo, instructive guidance from the ventral endoderm secures cardiac program induction within the anterolateral mesoderm. Endoderm-guided cardiogenesis, however, has yet to be resolved at the proteome level. Here, through cardiopoietic priming of the endoderm with the reprogramming cytokine tumor necrosis factor alpha (TNFalpha), candidate effectors of embryonic stem cell cardiac differentiation were delineated by comparative proteomics. Differential two-dimensional gel electrophoretic mapping revealed that more than 75% of protein species increased >1.5-fold in the TNFalpha-primed versus unprimed endodermal secretome. Protein spot identification by linear ion trap quadrupole (LTQ) tandem mass spectrometry (MS/MS) and validation by shotgun LTQ-Fourier transform MS/MS following multidimensional chromatography mapped 99 unique proteins from 153 spot assignments. A definitive set of 48 secretome proteins was deduced by iterative bioinformatic screening using algorithms for detection of canonical and noncanonical indices of secretion. Protein-protein interaction analysis, in conjunction with respective expression level changes, revealed a nonstochastic TNFalpha-centric secretome network with a scale-free hierarchical architecture. Cardiovascular development was the primary developmental function of the resolved TNFalpha-anchored network. Functional cooperativity of the derived cardioinductive network was validated through direct application of the TNFalpha-primed secretome on embryonic stem cells, potentiating cardiac commitment and sarcomerogenesis. Conversely, inhibition of primary network hubs negated the procardiogenic effects of TNFalpha priming. Thus, proteomic cartography establishes a systems biology framework for the endodermal secretome network guiding stem cell cardiopoiesis.

  5. Comparative Proteomics Reveals Novel Components at the Plasma Membrane of Differentiated HepaRG Cells and Different Distribution in Hepatocyte- and Biliary-Like Cells

    PubMed Central

    Woods, Alisa G.; Lazar, Catalin; Radu, Gabriel L.; Darie, Costel C.; Branza-Nichita, Norica

    2013-01-01

    Hepatitis B virus (HBV) is a human pathogen causing severe liver disease and eventually death. Despite important progress in deciphering HBV internalization, the early virus-cell interactions leading to infection are not known. HepaRG is a human bipotent liver cell line bearing the unique ability to differentiate towards a mixture of hepatocyte- and biliary-like cells. In addition to expressing metabolic functions normally found in liver, differentiated HepaRG cells support HBV infection in vitro, thus resembling cultured primary hepatocytes more than other hepatoma cells. Therefore, extensive characterization of the plasma membrane proteome from HepaRG cells would allow the identification of new cellular factors potentially involved in infection. Here we analyzed the plasma membranes of non-differentiated and differentiated HepaRG cells using nanoliquid chromatography-tandem mass spectrometry to identify the differences between the proteomes and the changes that lead to differentiation of these cells. We followed up on differentially-regulated proteins in hepatocytes- and biliary-like cells, focusing on Cathepsins D and K, Cyclophilin A, Annexin 1/A1, PDI and PDI A4/ERp72. Major differences between the two proteomes were found, including differentially regulated proteins, protein-protein interactions and intracellular localizations following differentiation. The results advance our current understanding of HepaRG differentiation and the unique properties of these cells. PMID:23977166

  6. Inoculation with endophytic Bacillus megaterium 1Y31 increases Mn accumulation and induces the growth and energy metabolism-related differentially-expressed proteome in Mn hyperaccumulator hybrid pennisetum.

    PubMed

    Zhang, Wen-hui; He, Lin-yan; Wang, Qi; Sheng, Xia-Fang

    2015-12-30

    In this study, a hydroponic culture experiment was conducted in a greenhouse to investigate the molecular and microbial mechanisms involved in the endophytic Bacillus megaterium 1Y31-enhanced Mn tolerance and accumulation in Mn hyperaccumulator hybrid pennisetum. Strain 1Y31 significantly increased the dry weights (ranging from 28% to 94%) and total Mn uptake (ranging from 23% to 112%) of hybrid pennisetum treated with 0, 2, and 10mM Mn compared to the control. Total 98 leaf differentially expressed proteins were identified between the live and dead bacterial inoculated hybrid pennisetum. The major leaf differentially expressed proteins were involved in energy generation, photosynthesis, response to stimulus, metabolisms, and unknown function. Furthermore, most of the energy generation and photosynthesis-related proteins were up-regulated, whereas most of the response to stimulus and metabolism-related proteins were down-regulated under Mn stress. Notably, the proportion of indole-3-acetic acid (IAA)-producing endophytic bacteria was significantly higher in the bacterial inoculated plants under Mn stress. The results suggested that strain 1Y31 increased the growth and Mn uptake of hybrid pennisetum through increasing the efficiency of photosynthesis and energy metabolism as well as the proportion of plant growth-promoting endophytic bacteria in the plants.

  7. Stromal proteome expression profile and muscle-invasive bladder cancer research

    PubMed Central

    2012-01-01

    Background To globally characterize the cancer stroma expression profile of muscle-invasive transitional cell carcinoma and to discuss the cancer biology as well as biomarker discovery from stroma. Laser capture micro dissection was used to harvest purified muscle-invasive bladder cancer stromal cells and normal urothelial stromal cells from 4 paired samples. Two-dimensional liquid chromatography tandem mass spectrometry was used to identify the proteome expression profile. The differential proteins were further analyzed using bioinformatics tools and compared with the published literature. Results We identified 868/872 commonly expressed proteins and 978 differential proteins from 4 paired cancer and normal stromal samples using laser capture micro dissection coupled with two-dimensional liquid chromatography tandem mass spectrometry. 487/491 proteins uniquely expressed in cancer/normal stroma. Differential proteins were compared with the entire list of the international protein index (IPI), and there were 42/42 gene ontology (GO) terms exhibited as enriched and 8/5 exhibited as depleted in cellular Component, respectively. Significantly altered pathways between cancer/normal stroma mainly include metabolic pathways, ribosome, focal adhesion, etc. Finally, descriptive statistics show that the stromal proteins with extremes of PI and MW have the same probability to be a biomarker. Conclusions Based on our results, stromal cells are essential component of the cancer, biomarker discovery and network based multi target therapy should consider neoplastic cells itself and corresponding stroma as whole one. PMID:22920603

  8. Differential proteomic analysis of an engineered Streptomyces coelicolor strain reveals metabolic pathways supporting growth on n-hexadecane.

    PubMed

    Gallo, Giuseppe; Lo Piccolo, Luca; Renzone, Giovanni; La Rosa, Ruggero; Scaloni, Andrea; Quatrini, Paola; Puglia, Anna Maria

    2012-06-01

    The alkB gene, encoding an alkane monooxygenase in the actinomycete Gordonia sp. SoCg, was expressed in the non-alkane-degrading actinomycete Streptomyces coelicolor M145. The resulting engineered strain, M145-AH, can grow on n-hexadecane as sole carbon source. To unravel proteins associated with growth on n-alkanes, proteome of M145-AH after 6, 24, and 48 h of incubation in the Bushnell-Haas (BH) mineral medium containing n-hexadecane as sole carbon source (H condition) and in BH without any carbon source (0 condition) were compared using 2D-differential gel electrophoresis. Proteome analysis revealed significant changes only at 48 h, showing 48 differentially abundant proteins identified by mass spectrometry procedures. To asses if these proteins were specifically related to n-hexadecane metabolism, their expression was investigated, comparing H proteome with that of M145-AH incubated in BH with glucose as sole carbon source (G condition). Thus, protein expression profiles at 6, 24, and 48 h under H, 0, and G conditions were combined, revealing that M145-AH regulates in a temporally- and carbon source-dependent manner the expression of proteins involved in regulatory events, central carbon metabolism, respiration, β-oxidation, membrane transport, and amino acid and protein metabolism. Interestingly, 21 % of them, mostly involved in membrane transport and protein metabolism, showed a n-hexadecane-dependent regulation with regulatory proteins such as CRP likely to have a key role in M145-AH n-hexadecane growth. These results, expanding the knowledge on n-alkane utilization in Gram-positive bacteria, reveal genes to be targeted to develop an efficient S. coelicolor M145-AH-based bioremediation system.

  9. Functional Differentiation of Bundle Sheath and Mesophyll Maize Chloroplasts Determined by Comparative ProteomicsW⃞

    PubMed Central

    Majeran, Wojciech; Cai, Yang; Sun, Qi; van Wijk, Klaas J.

    2005-01-01

    Chloroplasts of maize (Zea mays) leaves differentiate into specific bundle sheath (BS) and mesophyll (M) types to accommodate C4 photosynthesis. Consequences for other plastid functions are not well understood but are addressed here through a quantitative comparative proteome analysis of purified M and BS chloroplast stroma. Three independent techniques were used, including cleavable stable isotope coded affinity tags. Enzymes involved in lipid biosynthesis, nitrogen import, and tetrapyrrole and isoprenoid biosynthesis are preferentially located in the M chloroplasts. By contrast, enzymes involved in starch synthesis and sulfur import preferentially accumulate in BS chloroplasts. The different soluble antioxidative systems, in particular peroxiredoxins, accumulate at higher levels in M chloroplasts. We also observed differential accumulation of proteins involved in expression of plastid-encoded proteins (e.g., EF-Tu, EF-G, and mRNA binding proteins) and thylakoid formation (VIPP1), whereas others were equally distributed. Enzymes related to the C4 shuttle, the carboxylation and regeneration phase of the Calvin cycle, and several regulators (e.g., CP12) distributed as expected. However, enzymes involved in triose phosphate reduction and triose phosphate isomerase are primarily located in the M chloroplasts, indicating that the M-localized triose phosphate shuttle should be viewed as part of the BS-localized Calvin cycle, rather than a parallel pathway. PMID:16243905

  10. Proteomics

    SciTech Connect

    Hixson, Kim K.; Lopez-Ferrer, Daniel; Robinson, Errol W.; Pasa-Tolic, Ljiljana

    2010-02-01

    Proteomics aims to characterize the spatial distribution and temporal dynamics of proteins in biological systems, the protein response to environmental stimuli, and the differences in protein states between diseased and control biological systems. Mass spectrometry (MS) plays a crucial role in enabling the analysis of proteomes and typically is the method of choice for identifying proteins present in biological systems. Peptide (and consequently protein) identifications are made by comparing measured masses to calculated values obtained from genome data. Several methodologies based on MS have been developed for the analysis of proteomes. The complexity of the biological systems requires that the proteome be separated prior to analysis. Both gel based and liquid chromatography based separations have proven very useful in this regard. Typically, separated proteins are analyzed with MS either intact (top-down proteomics) or are digested into peptides (bottom-up) prior to MS analysis. Additionally, several procedures, with and without stable isotopic labeling, have been introduced to facilitate protein quantitation (e.g. characterize changes in protein abundances between given biological states).

  11. Proteomics Perspectives in Rotator Cuff Research: A Systematic Review of Gene Expression and Protein Composition in Human Tendinopathy

    PubMed Central

    Sejersen, Maria Hee Jung; Frost, Poul; Hansen, Torben Bæk; Deutch, Søren Rasmussen; Svendsen, Susanne Wulff

    2015-01-01

    Background Rotator cuff tendinopathy including tears is a cause of significant morbidity. The molecular pathogenesis of the disorder is largely unknown. This review aimed to present an overview of the literature on gene expression and protein composition in human rotator cuff tendinopathy and other tendinopathies, and to evaluate perspectives of proteomics – the comprehensive study of protein composition - in tendon research. Materials and Methods We conducted a systematic search of the literature published between 1 January 1990 and 18 December 2012 in PubMed, Embase, and Web of Science. We included studies on objectively quantified differential gene expression and/or protein composition in human rotator cuff tendinopathy and other tendinopathies as compared to control tissue. Results We identified 2199 studies, of which 54 were included; 25 studies focussed on rotator cuff or biceps tendinopathy. Most of the included studies quantified prespecified mRNA molecules and proteins using polymerase chain reactions and immunoassays, respectively. There was a tendency towards an increase of collagen I (11 of 15 studies) and III (13 of 14), metalloproteinase (MMP)-1 (6 of 12), -9 (7 of 7), -13 (4 of 7), tissue inhibitor of metalloproteinase (TIMP)-1 (4 of 7), and vascular endothelial growth factor (4 of 7), and a decrease in MMP-3 (10 of 12). Fourteen proteomics studies of tendon tissues/cells failed inclusion, mostly because they were conducted in animals or in vitro. Conclusions Based on methods, which only allowed simultaneous quantification of a limited number of prespecified mRNA molecules or proteins, several proteins appeared to be differentially expressed/represented in rotator cuff tendinopathy and other tendinopathies. No proteomics studies fulfilled our inclusion criteria, although proteomics technologies may be a way to identify protein profiles (including non-prespecified proteins) that characterise specific tendon disorders or stages of tendinopathy. Thus

  12. Differential expression profiling of serum proteins and metabolites for biomarker discovery

    NASA Astrophysics Data System (ADS)

    Roy, Sushmita Mimi; Anderle, Markus; Lin, Hua; Becker, Christopher H.

    2004-11-01

    A liquid chromatography-mass spectrometry (LC-MS) proteomics and metabolomics platform is presented for quantitative differential expression analysis. Proteome profiles obtained from 1.5 [mu]L of human serum show ~5000 de-isotoped and quantifiable molecular ions. Approximately 1500 metabolites are observed from 100 [mu]L of serum. Quantification is based on reproducible sample preparation and linear signal intensity as a function of concentration. The platform is validated using human serum, but is generally applicable to all biological fluids and tissues. The median coefficient of variation (CV) for ~5000 proteomic and ~1500 metabolomic molecular ions is approximately 25%. For the case of C-reactive protein, results agree with quantification by immunoassay. The independent contributions of two sources of variance, namely sample preparation and LC-MS analysis, are respectively quantified as 20.4 and 15.1% for the proteome, and 19.5 and 13.5% for the metabolome, for median CV values. Furthermore, biological diversity for ~20 healthy individuals is estimated by measuring the variance of ~6500 proteomic and metabolomic molecular ions in sera for each sample; the median CV is 22.3% for the proteome and 16.7% for the metabolome. Finally, quantitative differential expression profiling is applied to a clinical study comparing healthy individuals and rheumatoid arthritis (RA) patients.

  13. Optimal control of gene expression for fast proteome adaptation to environmental change.

    PubMed

    Pavlov, Michael Y; Ehrenberg, Måns

    2013-12-17

    Bacterial populations growing in a changing world must adjust their proteome composition in response to alterations in the environment. Rapid proteome responses to growth medium changes are expected to increase the average growth rate and fitness value of these populations. Little is known about the dynamics of proteome change, e.g., whether bacteria use optimal strategies of gene expression for rapid proteome adjustments and if there are lower bounds to the time of proteome adaptation in response to growth medium changes. To begin answering these types of questions, we modeled growing bacteria as stoichiometrically coupled networks of metabolic pathways. These are balanced during steady-state growth in a constant environment but are initially unbalanced after rapid medium shifts due to a shortage of enzymes required at higher concentrations in the new environment. We identified an optimal strategy for rapid proteome adjustment in the absence of protein degradation and found a lower bound to the time of proteome adaptation after medium shifts. This minimal time is determined by the ratio between the Kullback-Leibler distance from the pre- to the postshift proteome and the postshift steady-state growth rate. The dynamics of optimally controlled proteome adaptation has a simple analytical solution. We used detailed numerical modeling to demonstrate that realistic bacterial control systems can emulate this optimal strategy for rapid proteome adaptation. Our results may provide a conceptual link between the physiology and population genetics of growing bacteria.

  14. Optimal control of gene expression for fast proteome adaptation to environmental change

    PubMed Central

    Pavlov, Michael Y.; Ehrenberg, Måns

    2013-01-01

    Bacterial populations growing in a changing world must adjust their proteome composition in response to alterations in the environment. Rapid proteome responses to growth medium changes are expected to increase the average growth rate and fitness value of these populations. Little is known about the dynamics of proteome change, e.g., whether bacteria use optimal strategies of gene expression for rapid proteome adjustments and if there are lower bounds to the time of proteome adaptation in response to growth medium changes. To begin answering these types of questions, we modeled growing bacteria as stoichiometrically coupled networks of metabolic pathways. These are balanced during steady-state growth in a constant environment but are initially unbalanced after rapid medium shifts due to a shortage of enzymes required at higher concentrations in the new environment. We identified an optimal strategy for rapid proteome adjustment in the absence of protein degradation and found a lower bound to the time of proteome adaptation after medium shifts. This minimal time is determined by the ratio between the Kullback–Leibler distance from the pre- to the postshift proteome and the postshift steady-state growth rate. The dynamics of optimally controlled proteome adaptation has a simple analytical solution. We used detailed numerical modeling to demonstrate that realistic bacterial control systems can emulate this optimal strategy for rapid proteome adaptation. Our results may provide a conceptual link between the physiology and population genetics of growing bacteria. PMID:24297927

  15. Visualization and Differential Analysis of Protein Expression Data Using R.

    PubMed

    Silva, Tomé S; Richard, Nadège

    2016-01-01

    Data analysis is essential to derive meaningful conclusions from proteomic data. This chapter describes ways of performing common data visualization and differential analysis tasks on gel-based proteomic datasets using a freely available statistical software package (R). A workflow followed is illustrated using a synthetic dataset as example.

  16. Differential proteomics of human seminal plasma: A potential target for searching male infertility marker proteins.

    PubMed

    Tomar, Anil Kumar; Sooch, Balwinder Singh; Singh, Sarman; Yadav, Savita

    2012-04-01

    The clinical fertility tests, available in the market, fail to define the exact cause of male infertility in almost half of the cases and point toward a crucial need of developing better ways of infertility investigations. The protein biomarkers may help us toward better understanding of unknown cases of male infertility that, in turn, can guide us to find better therapeutic solutions. Many clinical attempts have been made to identify biomarkers of male infertility in sperm proteome but only few studies have targeted seminal plasma. Human seminal plasma is a rich source of proteins that are essentially required for development of sperm and successful fertilization. This viewpoint article highlights the importance of human seminal plasma proteome in reproductive physiology and suggests that differential proteomics integrated with functional analysis may help us in searching potential biomarkers of male infertility.

  17. Diabetic retinopathy: Proteomic approaches to help the differential diagnosis and to understand the underlying molecular mechanisms.

    PubMed

    Csősz, Éva; Deák, Eszter; Kalló, Gergő; Csutak, Adrienne; Tőzsér, József

    2017-01-06

    Diabetic retinopathy is the most common diabetic eye disease and a leading cause of blindness among patients with diabetes. The appearance and the severity of the symptoms correlate with the duration of diabetes and poor blood glucose level management. Diabetic retinopathy is also categorized as a chronic low-level inflammatory disease; the high blood glucose level promotes the accumulation of the advanced glycation end products and leads to the stimulation of monocytes and macrophages. Examination of protein level alterations in tears using state-of the art proteomics techniques have identified several proteins as possible biomarkers for the different stages of the diabetic retinopathy. Some of the differentially expressed tear proteins have a role in the barrier function of tears linking the diabetic retinopathy with another eye complication of diabetes, namely the diabetic keratopathy resulting in impaired wound healing. Understanding the molecular events leading to the eye complications caused by hyperglycemia may help the identification of novel biomarkers as well as therapeutic targets in order to improve quality of life of diabetic patients.

  18. Differential chromatin proteomics of the MMS-induced DNA damage response in yeast

    PubMed Central

    2011-01-01

    Background Protein enrichment by sub-cellular fractionation was combined with differential-in-gel-electrophoresis (DIGE) to address the detection of the low abundance chromatin proteins in the budding yeast proteome. Comparisons of whole-cell extracts and chromatin fractions were used to provide a measure of the degree of chromatin association for individual proteins, which could be compared across sample treatments. The method was applied to analyze the effect of the DNA damaging agent methyl methanesulfonate (MMS) on levels of chromatin-associated proteins. Results Up-regulation of several previously characterized DNA damage checkpoint-regulated proteins, such as Rnr4, Rpa1 and Rpa2, was observed. In addition, several novel DNA damage responsive proteins were identified and assessed for genotoxic sensitivity using either DAmP (decreased abundance by mRNA perturbation) or knockout strains, including Acf2, Arp3, Bmh1, Hsp31, Lsp1, Pst2, Rnr4, Rpa1, Rpa2, Ste4, Ycp4 and Yrb1. A strain in which the expression of the Ran-GTPase binding protein Yrb1 was reduced was found to be hypersensitive to genotoxic stress. Conclusion The described method was effective at unveiling chromatin-associated proteins that are less likely to be detected in the absence of fractionation. Several novel proteins with altered chromatin abundance were identified including Yrb1, pointing to a role for this nuclear import associated protein in DNA damage response. PMID:21967861

  19. Proteome analysis of functionally differentiated bovine (Bos indicus) mammary epithelial cells isolated from milk.

    PubMed

    Janjanam, Jagadeesh; Jamwal, Manu; Singh, Surender; Kumar, Saravanan; Panigrahi, Aswini K; Hariprasad, Gururao; Jena, Manoj K; Anand, Vijay; Kumar, Sudarshan; Kaushik, Jai K; Dang, Ajay K; Mukesh, Manishi; Mishra, Bishnu P; Srinivasan, Alagiri; Reddy, Vanga S; Mohanty, Ashok K

    2013-11-01

    Mammary gland is made up of a branching network of ducts that end in alveoli. Terminally differentiated mammary epithelial cells (MECs) constitute the innermost layer of aveoli. They are milk-secreting cuboidal cells that secrete milk proteins during lactation. Little is known about the expression profile of proteins in the metabolically active MECs during lactation or their functional role in the lactation process. In the present investigation, we have reported the proteome map of MECs in lactating cows using 2DE MALDI-TOF/TOF MS and 1D-Gel-LC-MS/MS. MECs were isolated from milk using immunomagnetic beads and confirmed by RT-PCR and Western blotting. The 1D-Gel-LC-MS/MS and 2DE-MS/MS based approaches led to identification of 431 and 134 proteins, respectively, with a total of 497 unique proteins. Proteins identified in this study were clustered into functional groups using bioinformatics tools. Pathway analysis of the identified proteins revealed 28 pathways (p < 0.05) providing evidence for involvement of various proteins in lactation function. This study further provides experimental evidence for the presence of many proteins that have been predicted in annotated bovine genome. The data generated further provide a set of bovine MEC-specific proteins that will help the researchers to understand the molecular events taking place during lactation.

  20. Differential skeletal muscle proteome of high- and low-active mice

    PubMed Central

    Dangott, Lawrence J.; Schmitt, Emily E.; Vellers, Heather L.; Lightfoot, J. Timothy

    2014-01-01

    Physical inactivity contributes to cardiovascular disease, type II diabetes, obesity, and some types of cancer. While the literature is clear that there is genetic regulation of physical activity with existing gene knockout data suggesting that skeletal muscle mechanisms contribute to the regulation of activity, actual differences in end-protein expression between high- and low-active mice have not been investigated. This study used two-dimensional differential gel electrophoresis coupled with mass spectrometry to evaluate the proteomic differences between high-active (C57L/J) and low-active (C3H/HeJ) mice in the soleus and extensor digitorum longus (EDL). Furthermore, vivo-morpholinos were used to transiently knockdown candidate proteins to confirm their involvement in physical activity regulation. Proteins with higher expression patterns generally fell into the calcium-regulating and Krebs (TCA) cycle pathways in the high-active mice (e.g., annexin A6, P = 0.0031; calsequestrin 1; P = 0.000025), while the overexpressed proteins in the low-active mice generally fell into cytoskeletal structure- and electron transport chain-related pathways (e.g., ATPase, P = 0.031; NADH dehydrogenase, P = 0.027). Transient knockdown of annexin A6 and calsequestrin 1 protein of high-active mice with vivo-morpholinos resulted in decreased physical activity levels (P = 0.001). These data suggest that high- and low-active mice have unique protein expression patterns and that each pattern contributes to the peripheral capability to be either high- or low-active, suggesting that different specific mechanisms regulate activity leading to the high- or low-activity status of the animal. PMID:24505100

  1. Mass spectrometry-based proteomics identifies UPF1 as a critical gene expression regulator in MonoMac 6 cells.

    PubMed

    Ochs, Meike J; Ossipova, Elena; Oliynyk, Ganna; Steinhilber, Dieter; Suess, Beatrix; Jakobsson, Per-Johan

    2013-06-07

    5-Lipoxygenase (5-LO) catalyzes the two initial steps in the biosynthesis of leukotrienes, a group of inflammatory lipid mediators derived from arachidonic acid. Recently, we have demonstrated that 5-LO mRNA expression is regulated by alternative splicing and nonsense-mediated mRNA decay (NMD). In addition to this, 5-LO protein expression was reduced on translational level in UPF1 knockdown cells, suggesting that UPF1 has a positive influence on 5-LO translation. Therefore, a mass spectrometry-based proteomics study was performed to identify compartment-specific protein expression changes upon UPF1 knockdown in differentiated and undifferentiated MM6 cells. The proteomics analysis revealed that the knockdown of UPF1 results in numerous protein changes in the microsomal fraction (~21%) but not in the cytosolic fraction (<1%). The results suggest that UPF1 is a critical gene expression regulator in a compartment-specific way. During differentiation by TGFβ and calcitriol, the majority of UPF1 regulated proteins were adjusted to normal level. This indicates that the translational regulation by UPF1 can potentially be cell differentiation-dependent.

  2. Chronic Cocaine Use Causes Changes in the Striatal Proteome Depending on the Endogenous Expression of Pleiotrophin.

    PubMed

    Vicente-Rodríguez, Marta; Herradón, Gonzalo; Ferrer-Alcón, Marcel; Uribarri, María; Pérez-García, Carmen

    2015-07-20

    The neurotrophic factor pleiotrophin (PTN) is upregulated in different brain areas after the administration of different drugs of abuse, including psychostimulants. PTN has been shown to prevent cocaine-induced cytotoxicity in NG108-15 and PC12 cells. We previously demonstrated that specific phosphoproteins related to neurodegeneration processes are differentially regulated in the mouse striatum by a single cocaine (15 mg/kg) administration depending on the endogenous expression of PTN. Since neurodegenerative processes are usually observed in patients exposed to toxicants for longer duration, we have now performed a striatal proteomic study using samples enriched in phosphorylated proteins from PTN knockout (PTN-/-) mice, from mice with transgenic PTN overexpression (PTN-Tg) in the brain, and from wild type (WT) mice after a chronic treatment with cocaine (15 mg/kg/day for 7 days). We have successfully identified 23 proteins significantly affected by chronic cocaine exposure, genotype, or both. Most of these proteins, including peroxiredoxin-6 (PRDX6), triosephosphate isomerase (TPI1), ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHL1), and annexins A5 (ANXA5) and A7 (ANXA7), may be of significant importance because they were previously identified in proteomic studies in animals treated with psychostimulants and/or because they are related to neurodegenerative disorders such as Parkinson's disease and Alzheimer's disease. The data support a protective role of PTN against chronic cocaine-induced neural alterations.

  3. Differential proteome analysis of the cell differentiation regulated by BCC, CRH, CXCR4, GnRH, GPCR, IL1 signaling pathways in Chinese fire-bellied newt limb regeneration.

    PubMed

    Geng, Xiaofang; Xu, Tiantian; Niu, Zhipeng; Zhou, Xiaochun; Zhao, Lijun; Xie, Zhaohui; Xue, Deming; Zhang, Fuchun; Xu, Cunshuan

    2014-01-01

    Following amputation, the newt has the remarkable ability to regenerate its limb, and this process involves dedifferentiation, proliferation and differentiation. To investigate the potential proteome during a dynamic network of Chinese fire-bellied newt limb regeneration (CNLR), two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) and mass spectrum (MS) were applied to examine changes in the proteome that occurred at 11 time points after amputation. Meanwhile, several proteins were selected to validate their expression levels by Western blot. The results revealed that 1476 proteins had significantly changed as compared to the control group. Gene Ontology annotation and protein network analysis by Ingenuity Pathway Analysis 9.0 (IPA) software suggested that the differentially expressed proteins were involved in 33 kinds of physiological activities including signal transduction, cell proliferation, cell differentiation, etc. Among these proteins, 407 proteins participated in cell differentiation with 212 proteins in the differentiation of skin cell, myocyte, neurocyte, chondrocyte and osteocyte, and 37 proteins participated in signaling pathways of BCC, CRH, CXCR4, GnRH, GPCR and IL1 which regulated cell differentiation and redifferentiation. On the other hand, the signal transduction activity and cell differentiation activity were analyzed by IPA based on the changes in the expression of these proteins. The results showed that BCC, CRH, CXCR4, GnRH, GPCR and IL1 signaling pathways played an important role in regulating the differentiation of skin cell, myocyte, neurocyte, chondrocyte and osteocyte during CNLR.

  4. Characterization of human reflex tear proteome reveals high expression of lacrimal proline-rich protein 4 (PRR4).

    PubMed

    Perumal, Natarajan; Funke, Sebastian; Wolters, Dominik; Pfeiffer, Norbert; Grus, Franz H

    2015-10-01

    In-depth studies on the proteome of reflex tears are still inadequate. Hence, further studies on this subject will unravel the key proteins which are conjectured to possess vital functions in the protection of the ocular surface. Therefore, this study investigated the differences in the expression levels in proteome of reflex compared to basal tears. Basal (n = 10) and reflex (n = 10) tear samples from healthy subjects were collected employing the capillary method, subsequently pooled and the proteomes were characterized employing 1DE combined with LC-ESI-MS/MS strategy for label-free quantitative (LFQ) analysis. The differentially expressed proteins were validated by 2DE combined with LC-ESI-MS/MS and targeted-MS approach called accurate inclusion mass screening (AIMS) strategies. The analysis of the reflex tear proteome demonstrated increased abundance in proline-rich protein 4 (PRR4) and zymogen granule protein 16 homolog B (ZG16B) for the first time. Other abundant lacrimal proteins, e.g. lactotransferrin and lysozyme remained constant. Predominantly, the lacrimal gland-specific PRR4 represents the major increased protein in reflex tears in an attempt to wash out irritants that come into contact with the eye. Conversely, decreased abundance in Ig alpha-1 chain C, polymeric immunoglobulin receptor, cystatin S/SN, clusterin and mammaglobin were observed. This study had further unraveled the intricate proteome regulation during reflex tearing, especially the potential role of PRR4, which may be the key player in the protection and maintenance of dynamic balance of the ocular surface.

  5. Differential abundance of sarcoplasmic proteome explains animal effect on beef Longissimus lumborum color stability.

    PubMed

    Canto, Anna C V C S; Suman, Surendranath P; Nair, Mahesh N; Li, Shuting; Rentfrow, Gregg; Beach, Carol M; Silva, Teofilo J P; Wheeler, Tommy L; Shackelford, Steven D; Grayson, Adria; McKeith, Russell O; King, D Andy

    2015-04-01

    The sarcoplasmic proteome of beef Longissimus lumborum demonstrating animal-to-animal variation in color stability was examined to correlate proteome profile with color. Longissimus lumborum (36 h post-mortem) muscles were obtained from 73 beef carcasses, aged for 13 days, and fabricated to 2.5-cm steaks. One steak was allotted to retail display, and another was immediately vacuum packaged and frozen at -80°C. Aerobically packaged steaks were stored under display, and color was evaluated on days 0 and 11. The steaks were ranked based on redness and color stability on day 11, and ten color-stable and ten color-labile carcasses were identified. Sarcoplasmic proteome of frozen steaks from the selected carcasses was analyzed. Nine proteins were differentially abundant in color-stable and color-labile steaks. Three glycolytic enzymes (phosphoglucomutase-1, glyceraldehyde-3-phosphate dehydrogenase, and pyruvate kinase M2) were over-abundant in color-stable steaks and positively correlated (P<0.05) to redness and color stability. These results indicated that animal variations in proteome contribute to differences in beef color.

  6. Combined gene expression and proteomic analysis of EGF induced apoptosis in A431 cells suggests multiple pathways trigger apoptosis.

    PubMed

    Alanazi, Ibrahim; Ebrahimie, Esmaeil; Hoffmann, Peter; Adelson, David L

    2013-11-01

    A431 cells, derived from epidermoid carcinoma, overexpress the epidermal growth factor receptor (EGFR) and when treated with a high dose of EGF will undergo apoptosis. We exploited microarray and proteomics techniques and network prediction to study the regulatory mechanisms of EGF-induced apoptosis in A431 cells. We observed significant changes in gene expression in 162 genes, approximately evenly split between pro-apoptotic and anti-apoptotic genes and identified 30 proteins from the proteomic data that had either pro or anti-apoptotic annotation. Our correlation analysis of gene expression and proteome modeled a number of distinct sub-networks that are associated with the onset of apoptosis, allowing us to identify specific pathways and components. These include components of the interferon signalling pathway, and down stream components, including cytokines and suppressors of cytokine signalling. A central component of almost all gene expression sub-networks identified was TP53, which is mutated in A431 cells, and was down regulated. This down regulation of TP53 appeared to be correlated with proteomic sub-networks of cytoskeletal or cell adhesion components that might induce apoptosis by triggering cytochrome C release. Of the only three genes also differentially expressed as proteins, only serpinb1 had a known association with apoptosis. We confirmed that up regulation and cleavage of serpinb1 into L-DNAaseII was correlated with the induction of apoptosis. It is unlikely that a single pathway, but more likely a combination of pathways is needed to trigger EGF induced apoptosis in A431cells.

  7. Differential Response and Priming Dose Effect on the Proteome of Human Fibroblast and Stem Cells Induced by Exposure to Low Doses of Ionizing Radiation.

    PubMed

    Hauptmann, Monika; Haghdoost, Siamak; Gomolka, Maria; Sarioglu, Hakan; Ueffing, Marius; Dietz, Anne; Kulka, Ulrike; Unger, Kristian; Babini, Gabriele; Harms-Ringdahl, Mats; Ottolenghi, Andrea; Hornhardt, Sabine

    2016-03-01

    It has been suggested that a mechanistic understanding of the cellular responses to low dose and dose rate may be valuable in reducing some of the uncertainties involved in current risk estimates for cancer- and non-cancer-related radiation effects that are inherited in the linear no-threshold hypothesis. In this study, the effects of low-dose radiation on the proteome in both human fibroblasts and stem cells were investigated. Particular emphasis was placed on examining: 1. the dose-response relationships for the differential expression of proteins in the low-dose range (40-140 mGy) of low-linear energy transfer (LET) radiation; and 2. the effect on differential expression of proteins of a priming dose given prior to a challenge dose (adaptive response effects). These studies were performed on cultured human fibroblasts (VH10) and human adipose-derived stem cells (ADSC). The results from the VH10 cell experiments demonstrated that low-doses of low-LET radiation induced unique patterns of differentially expressed proteins for each dose investigated. In addition, a low priming radiation dose significantly changed the protein expression induced by the subsequent challenge exposure. In the ADSC the number of differentially expressed proteins was markedly less compared to VH10 cells, indicating that ADSC differ in their intrinsic response to low doses of radiation. The proteomic results are further discussed in terms of possible pathways influenced by low-dose irradiation.

  8. Expression Profiling and Proteomic Analysis of JIN Chinese Herbal Formula in Lung Carcinoma H460 Xenografts

    PubMed Central

    Zheng, Luyu; Zhang, Weiyi; Jiang, Miao; Zhang, Huarong; Xiong, Fei; Yu, Yang; Chen, Meijuan; Zhou, Jing; Dai, Xiaoming; Jiang, Ming; Wang, Mingyan; Cheng, Ge; Duan, Jinao; Yu, Wei; Lin, Biaoyang; Fu, Haian; Zhang, Xu

    2013-01-01

    Many traditional Chinese medicine (TCM) formulae have been used in cancer therapy. The JIN formula is an ancient herbal formula recorded in the classic TCM book Jin Kui Yao Lue (Golden Chamber). The JIN formula significantly delayed the growth of subcutaneous human H460 xenografted tumors in vivo compared with the growth of mock controls. Gene array analysis of signal transduction in cancer showed that the JIN formula acted on multiple targets such as the mitogen-activated protein kinase, hedgehog, and Wnt signaling pathways. The coformula treatment of JIN and diamminedichloroplatinum (DDP) affected the stress/heat shock pathway. Proteomic analysis showed 36 and 84 differentially expressed proteins between the mock and DDP groups and between the mock and JIN groups, respectively. GoMiner analysis revealed that the differentially expressed proteins between the JIN and mock groups were enriched during cellular metabolic processes, and so forth. The ones between the DDP and mock groups were enriched during protein-DNA complex assembly, and so forth. Most downregulated proteins in the JIN group were heat shock proteins (HSPs) such as HSP90AA1 and HSPA1B, which could be used as markers to monitor responses to the JIN formula therapy. The mechanism of action of the JIN formula on HSP proteins warrants further investigation. PMID:24066008

  9. Efficient isolation and proteomic analysis of cell plasma membrane proteins in gastric cancer reveal a novel differentiation and progression related cell surface marker, R-cadherin.

    PubMed

    Chen, Bo; Luo, Qi-Cong; Chen, Jian-Bo; Lin, Li-E; Luo, Ming-Xu; Ren, Hong-Yue; Chen, Pei-Qiong; Shi, Lian-Guo

    2016-09-01

    Cell plasma membrane proteins, playing a crucial role in cell malignant transformation and development, were the main targets of tumor detection and therapy. In this study, CyDye/biotin double-labeling proteomic approach was adopted to profile the membrane proteome of gastric cancer cell line BGC-823 and paired immortalized gastric epithelial cell GES-1. Real-time PCR, Western blotting, and immunohistochemical staining were used to validate the differential expression of a novel identified cell surface marker R-cadherin in gastric cancer cells and tissues. Clinicopathological study and survival analysis were performed to estimate its roles in tumor progression and outcome prediction. Real-time PCR and Western blotting showed that the expression level of R-cadherin in gastric cancer were significantly lower than non-cancerous epithelial cell and tissues. Clinicopathological study indicated that R-cadherin was dominantly expressed on cell surface of normal gastric epithelium, and its expression deletion in gastric cancer tissues was associated with tumor site, differentiation, lymph node metastasis, and pTNM (chi-square test, P < 0.05). Those patients with R-cadherin positive expression displayed better overall survivals than negative expression group (log-rank test, P = 0.000). Cox multivariate survival analysis revealed lacking the expression of R-cadherin was a main independent predictor for poor clinical outcome in gastric cancer (RR = 5.680, 95 % CI 2.250-14.341, P < 0.01). We have established a fundamental membrane proteome database for gastric cancer and identified R-cadherin as a tumor differentiation and progression-related cell surface marker of gastric cancer. Lacking the expression of R-cadherin indicates poor prognosis in patients with gastric cancer.

  10. Epigenetic and Proteomic Expression Changes Promoted by Eating Addictive-Like Behavior.

    PubMed

    Mancino, Samantha; Burokas, Aurelijus; Gutiérrez-Cuesta, Javier; Gutiérrez-Martos, Miriam; Martín-García, Elena; Pucci, Mariangela; Falconi, Anastasia; D'Addario, Claudio; Maccarrone, Mauro; Maldonado, Rafael

    2015-11-01

    An increasing perspective conceptualizes obesity and overeating as disorders related to addictive-like processes that could share common neurobiological mechanisms. In the present study, we aimed at validating an animal model of eating addictive-like behavior in mice, based on the DSM-5 substance use disorder criteria, using operant conditioning maintained by highly palatable chocolate-flavored pellets. For this purpose, we evaluated persistence of food-seeking during a period of non-availability of food, motivation for food, and perseverance of responding when the reward was associated with a punishment. This model has allowed identifying extreme subpopulations of mice related to addictive-like behavior. We investigated in these subpopulations the epigenetic and proteomic changes. A significant decrease in DNA methylation of CNR1 gene promoter was revealed in the prefrontal cortex of addict-like mice, which was associated with an upregulation of CB1 protein expression in the same brain area. The pharmacological blockade (rimonabant 3 mg/kg; i.p.) of CB1 receptor during the late training period reduced the percentage of mice that accomplished addiction criteria, which is in agreement with the reduced performance of CB1 knockout mice in this operant training. Proteomic studies have identified proteins differentially expressed in mice vulnerable or not to addictive-like behavior in the hippocampus, striatum, and prefrontal cortex. These changes included proteins involved in impulsivity-like behavior, synaptic plasticity, and cannabinoid signaling modulation, such as alpha-synuclein, phosphatase 1-alpha, doublecortin-like kinase 2, and diacylglycerol kinase zeta, and were validated by immunoblotting. This model provides an excellent tool to investigate the neurobiological substrate underlying the vulnerability to develop eating addictive-like behavior.

  11. Epigenetic and Proteomic Expression Changes Promoted by Eating Addictive-Like Behavior

    PubMed Central

    Mancino, Samantha; Burokas, Aurelijus; Gutiérrez-Cuesta, Javier; Gutiérrez-Martos, Miriam; Martín-García, Elena; Pucci, Mariangela; Falconi, Anastasia; D'Addario, Claudio; Maccarrone, Mauro; Maldonado, Rafael

    2015-01-01

    An increasing perspective conceptualizes obesity and overeating as disorders related to addictive-like processes that could share common neurobiological mechanisms. In the present study, we aimed at validating an animal model of eating addictive-like behavior in mice, based on the DSM-5 substance use disorder criteria, using operant conditioning maintained by highly palatable chocolate-flavored pellets. For this purpose, we evaluated persistence of food-seeking during a period of non-availability of food, motivation for food, and perseverance of responding when the reward was associated with a punishment. This model has allowed identifying extreme subpopulations of mice related to addictive-like behavior. We investigated in these subpopulations the epigenetic and proteomic changes. A significant decrease in DNA methylation of CNR1 gene promoter was revealed in the prefrontal cortex of addict-like mice, which was associated with an upregulation of CB1 protein expression in the same brain area. The pharmacological blockade (rimonabant 3 mg/kg; i.p.) of CB1 receptor during the late training period reduced the percentage of mice that accomplished addiction criteria, which is in agreement with the reduced performance of CB1 knockout mice in this operant training. Proteomic studies have identified proteins differentially expressed in mice vulnerable or not to addictive-like behavior in the hippocampus, striatum, and prefrontal cortex. These changes included proteins involved in impulsivity-like behavior, synaptic plasticity, and cannabinoid signaling modulation, such as alpha-synuclein, phosphatase 1-alpha, doublecortin-like kinase 2, and diacylglycerol kinase zeta, and were validated by immunoblotting. This model provides an excellent tool to investigate the neurobiological substrate underlying the vulnerability to develop eating addictive-like behavior. PMID:25944409

  12. Proteomic profiling of the mesenteric lymph after hemorrhagic shock: Differential gel electrophoresis and mass spectrometry analysis

    PubMed Central

    2011-01-01

    Experiments show that upon traumatic injury the composition of mesenteric lymph changes such that it initiates an immune response that can ultimately result in multiple organ dysfunction syndrome (MODS). To identify candidate protein mediators of this process we carried out a quantitative proteomic study on mesenteric lymph from a well characterized rat shock model. We analyzed three animals using analytical 2D differential gel electrophoresis. Intra-animal variation for the majority of protein spots was minor. Functional clustering of proteins revealed changes arising from several global classes that give novel insight into fundamental mechanisms of MODS. Mass spectrometry based proteomic analysis of proteins in mesenteric lymph can effectively be used to identify candidate mediators and loss of protective agents in shock models. PMID:21906351

  13. Comparative Analysis of Salivary Gland Proteomes of Two Glossina Species that Exhibit Differential Hytrosavirus Pathologies.

    PubMed

    Kariithi, Henry M; İnce, İkbal Agah; Boeren, Sjef; Murungi, Edwin K; Meki, Irene K; Otieno, Everlyne A; Nyanjom, Steven R G; van Oers, Monique M; Vlak, Just M; Abd-Alla, Adly M M

    2016-01-01

    Glossina pallidipes salivary gland hypertrophy virus (GpSGHV; family Hytrosaviridae) is a dsDNA virus exclusively pathogenic to tsetse flies (Diptera; Glossinidae). The 190 kb GpSGHV genome contains 160 open reading frames and encodes more than 60 confirmed proteins. The asymptomatic GpSGHV infection in flies can convert to symptomatic infection that is characterized by overt salivary gland hypertrophy (SGH). Flies with SGH show reduced general fitness and reproductive dysfunction. Although the occurrence of SGH is an exception rather than the rule, G. pallidipes is thought to be the most susceptible to expression of overt SGH symptoms compared to other Glossina species that are largely asymptomatic. Although Glossina salivary glands (SGs) play an essential role in GpSGHV transmission, the functions of the salivary components during the virus infection are poorly understood. In this study, we used mass spectrometry to study SG proteomes of G. pallidipes and G. m. morsitans, two Glossina model species that exhibit differential GpSGHV pathologies (high and low incidence of SGH, respectively). A total of 540 host proteins were identified, of which 23 and 9 proteins were significantly up- and down-regulated, respectively, in G. pallidipes compared to G. m. morsitans. Whereas 58 GpSGHV proteins were detected in G. pallidipes F1 progenies, only 5 viral proteins were detected in G. m. morsitans. Unlike in G. pallidipes, qPCR assay did not show any significant increase in virus titers in G. m. morsitans F1 progenies, confirming that G. m. morsitans is less susceptible to GpSGHV infection and replication compared to G. pallidipes. Based on our results, we speculate that in the case of G. pallidipes, GpSGHV employs a repertoire of host intracellular signaling pathways for successful infection. In the case of G. m. morsitans, antiviral responses appeared to be dominant. These results are useful for designing additional tools to investigate the Glossina-GpSGHV interactions.

  14. Comparative Analysis of Salivary Gland Proteomes of Two Glossina Species that Exhibit Differential Hytrosavirus Pathologies

    PubMed Central

    Kariithi, Henry M.; İnce, İkbal Agah; Boeren, Sjef; Murungi, Edwin K.; Meki, Irene K.; Otieno, Everlyne A.; Nyanjom, Steven R. G.; van Oers, Monique M.; Vlak, Just M.; Abd-Alla, Adly M. M.

    2016-01-01

    Glossina pallidipes salivary gland hypertrophy virus (GpSGHV; family Hytrosaviridae) is a dsDNA virus exclusively pathogenic to tsetse flies (Diptera; Glossinidae). The 190 kb GpSGHV genome contains 160 open reading frames and encodes more than 60 confirmed proteins. The asymptomatic GpSGHV infection in flies can convert to symptomatic infection that is characterized by overt salivary gland hypertrophy (SGH). Flies with SGH show reduced general fitness and reproductive dysfunction. Although the occurrence of SGH is an exception rather than the rule, G. pallidipes is thought to be the most susceptible to expression of overt SGH symptoms compared to other Glossina species that are largely asymptomatic. Although Glossina salivary glands (SGs) play an essential role in GpSGHV transmission, the functions of the salivary components during the virus infection are poorly understood. In this study, we used mass spectrometry to study SG proteomes of G. pallidipes and G. m. morsitans, two Glossina model species that exhibit differential GpSGHV pathologies (high and low incidence of SGH, respectively). A total of 540 host proteins were identified, of which 23 and 9 proteins were significantly up- and down-regulated, respectively, in G. pallidipes compared to G. m. morsitans. Whereas 58 GpSGHV proteins were detected in G. pallidipes F1 progenies, only 5 viral proteins were detected in G. m. morsitans. Unlike in G. pallidipes, qPCR assay did not show any significant increase in virus titers in G. m. morsitans F1 progenies, confirming that G. m. morsitans is less susceptible to GpSGHV infection and replication compared to G. pallidipes. Based on our results, we speculate that in the case of G. pallidipes, GpSGHV employs a repertoire of host intracellular signaling pathways for successful infection. In the case of G. m. morsitans, antiviral responses appeared to be dominant. These results are useful for designing additional tools to investigate the Glossina-GpSGHV interactions

  15. Differential proteomics and functional research following gene therapy in a mouse model of Leber congenital amaurosis.

    PubMed

    Zheng, Qinxiang; Ren, Yueping; Tzekov, Radouil; Zhang, Yuanping; Chen, Bo; Hou, Jiangping; Zhao, Chunhui; Zhu, Jiali; Zhang, Ying; Dai, Xufeng; Ma, Shan; Li, Jia; Pang, Jijing; Qu, Jia; Li, Wensheng

    2012-01-01

    Leber congenital amaurosis (LCA) is one of the most severe forms of inherited retinal degeneration and can be caused by mutations in at least 15 different genes. To clarify the proteomic differences in LCA eyes, a cohort of retinal degeneration 12 (rd12) mice, an LCA2 model caused by a mutation in the RPE65 gene, were injected subretinally with an AAV vector (scAAV5-smCBA-hRPE65) in one eye, while the contralateral eye served as a control. Proteomics were compared between untreated rd12 and normal control retinas on P14 and P21, and among treated and untreated rd12 retinas and control retinas on P42. Gene therapy in rd12 mice restored retinal function in treated eyes, which was demonstrated by electroretinography (ERG). Proteomic analysis successfully identified 39 proteins expressed differently among the 3 groups. The expression of 3 proteins involved in regulation of apoptosis and neuroptotection (alpha A crystallin, heat shock protein 70 and peroxiredoxin 6) were investigated further. Immunofluorescence, Western blot and real-time PCR confirmed the quantitative changes in their expression. Furthermore, cell culture studies suggested that peroxiredoxin 6 could act in an antioxidant role in rd12 mice. Our findings support the feasibility of gene therapy in LCA2 patients and support a role for alpha A crystallin, heat shock protein 70 and peroxiredoxin 6 in the pathogenetic mechanisms involved in LCA2 disease process.

  16. Quantitative Proteomics Reveals GIMAP Family Proteins 1 and 4 to Be Differentially Regulated during Human T Helper Cell Differentiation *S⃞

    PubMed Central

    Filén, Jan-Jonas; Filén, Sanna; Moulder, Robert; Tuomela, Soile; Ahlfors, Helena; West, Anne; Kouvonen, Petri; Kantola, Suvi; Björkman, Mari; Katajamaa, Mikko; Rasool, Omid; Nyman, Tuula A.; Lahesmaa, Riitta

    2009-01-01

    T helper (Th) cells differentiate into functionally distinct effector cell subsets of which Th1 and Th2 cells are best characterized. Besides T cell receptor signaling, IL-12-induced STAT4 and T-bet- and IL-4-induced STAT6 and GATA3 signaling pathways are the major players regulating the Th1 and Th2 differentiation process, respectively. However, there are likely to be other yet unknown factors or pathways involved. In this study we used quantitative proteomics exploiting cleavable ICAT labeling and LC-MS/MS to identify IL-4-regulated proteins from the microsomal fractions of CD4+ cells extracted from umbilical cord blood. We were able to identify 557 proteins of which 304 were also quantified. This study resulted in the identification of the down-regulation of small GTPases GIMAP1 and GIMAP4 by IL-4 during Th2 differentiation. We also showed that both GIMAP1 and GIMAP4 genes are up-regulated by IL-12 and other Th1 differentiation-inducing cytokines in cells induced to differentiate toward Th1 lineage and down-regulated by IL-4 in cells induced to Th2. Our results indicate that the GIMAP (GTPase of the immunity-associated protein) family of proteins is differentially regulated during Th cell differentiation. PMID:18701445

  17. In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine

    PubMed Central

    Sinha, Ankit; Nyalwidhe, Julius O.; Brooks, Jasmin; Semmes, O. John; Troyer, Dean A.; Lance, Raymond S.; Kislinger, Thomas; Drake, Richard R.

    2013-01-01

    Expressed prostatic secretions (EPS) are proximal fluids of the prostate that are increasingly being utilized as a clinical source for diagnostic and prognostic assays for prostate cancer (PCa). These fluids contain an abundant amount of microvesicles reflecting the secretory function of the prostate gland, and their protein composition remains poorly defined in relation to PCa. Using expressed prostatic secretions in urine (EPS-urine), exosome preparations were characterized by a shotgun proteomics procedure. In pooled EPS-urine exosome samples, ~900 proteins were detected. Many of these have not been previously observed in the soluble proteome of EPS generated by our labs or other related exosome proteomes. We performed systematic comparisons of our data against previously published, prostate-related proteomes and global annotation analyses to highlight functional processes within the proteome of EPS-urine derived exosomes. The acquired proteomic data has been deposited to the Tranche repository and will lay the foundation for more extensive investigations of PCa derived exosomes in the context of biomarker discovery and cancer biology. PMID:23533145

  18. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  19. Proteome profiling of the growth phases of Leishmania pifanoi promastigotes in axenic culture reveals differential abundance of immunostimulatory proteins.

    PubMed

    Alcolea, Pedro J; Alonso, Ana; García-Tabares, Francisco; Mena, María del Carmen; Ciordia, Sergio; Larraga, Vicente

    2016-06-01

    Leishmaniasis is a term that encompasses a compendium of neglected tropical diseases caused by dimorphic and digenetic protozoan parasites from the genus Leishmania (Kinetoplastida: Trypanosomatidae). The clinical manifestations of neotropical cutaneous leishmaniasis (NCL) caused by Leishmania pifanoi and other species of the "Leishmania mexicana complex" mainly correspond to anergic diffuse cutaneous leishmaniasis (ADCL), which is the origin of considerable morbidity. Despite the outstanding advances in the characterization of the trypanosomatid genomes and proteomes, the biology of this species has been scarcely explored. However, the close relation of L. pifanoi to the sequenced species L. mexicana and others included in the "L. mexicana complex" allowed us to perform a two-dimension electrophoresis (2DE) approach to the promastigote proteome at the differential expression level. Protein identifications were performed by matrix-assisted laser desorption-ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF). This insight has revealed similarities and differences between L. pifanoi and other species responsible for cutaneous and visceral leishmaniasis. Interestingly, certain proteins that were previously described as immunostimulatory (elongation factor 1β, trypanothione peroxidase, heat shock protein 70, enolase, GDP-forming succinyl-CoA and aldehyde dehydrogenase) are more abundant in the final growth stages of promastigotes (late-logarithmic and/or stationary phase) in the case of L. pifanoi.

  20. Utility of proteomics techniques for assessing protein expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years, proteomic technologies have been frequently used as an effective analytical tool for examining modifications of protein profiles for accessing the bio-safety of genetically modified crops (GMO). Understanding of natural variation of soybean seed proteins is critical for determining...

  1. Differential effects of Zn exposure on male and female oysters (Crassostrea angulata) as revealed by label-free quantitative proteomics.

    PubMed

    Luo, Lianzhong; Zhang, Qinghong; Kong, Xue; Huang, Heqing; You, Weiwei; Ke, Caihuan

    2017-03-17

    Oysters accumulate Zn as an adaptation to Zn exposure; however, it is not known whether male and female oysters respond differently to Zn exposure. Here, proteomic and real-time polymerase chain reaction analyses were used to investigate differential responses of male and female oysters (Crassostrea angulata) to Zn exposure. After exposure to 50 µg.L(-1) or 500 µg.L(-1) Zn for 30 days, gonads of female oysters accumulated more Zn than those of males, and gonadal development was accelerated in females but was abnormal in males. Differentially expressed proteins after exposure to Zn were identified and shown to function in Zn transport, Ca transport, phosphate metabolism, energy metabolism, immune regulation, oxidative stress responses, gene expression regulation, and fat metabolism. Proteins with functions in Zn transportation and storage, and multi-functional proteins, such as hemicentin-1 and histidinol dehydrogenase, were expressed at significantly higher levels in the gonads of female than male oysters after Zn exposure. This article is protected by copyright. All rights reserved.

  2. Plumbagin elicits differential proteomic responses mainly involving cell cycle, apoptosis, autophagy, and epithelial-to-mesenchymal transition pathways in human prostate cancer PC-3 and DU145 cells.

    PubMed

    Qiu, Jia-Xuan; Zhou, Zhi-Wei; He, Zhi-Xu; Zhao, Ruan Jin; Zhang, Xueji; Yang, Lun; Zhou, Shu-Feng; Mao, Zong-Fu

    2015-01-01

    Plumbagin (PLB) has exhibited a potent anticancer effect in preclinical studies, but the molecular interactome remains elusive. This study aimed to compare the quantitative proteomic responses to PLB treatment in human prostate cancer PC-3 and DU145 cells using the approach of stable-isotope labeling by amino acids in cell culture (SILAC). The data were finally validated using Western blot assay. First, the bioinformatic analysis predicted that PLB could interact with 78 proteins that were involved in cell proliferation and apoptosis, immunity, and signal transduction. Our quantitative proteomic study using SILAC revealed that there were at least 1,225 and 267 proteins interacting with PLB and there were 341 and 107 signaling pathways and cellular functions potentially regulated by PLB in PC-3 and DU145 cells, respectively. These proteins and pathways played a critical role in the regulation of cell cycle, apoptosis, autophagy, epithelial to mesenchymal transition (EMT), and reactive oxygen species generation. The proteomic study showed substantial differences in response to PLB treatment between PC-3 and DU145 cells. PLB treatment significantly modulated the expression of critical proteins that regulate cell cycle, apoptosis, and EMT signaling pathways in PC-3 cells but not in DU145 cells. Consistently, our Western blotting analysis validated the bioinformatic and proteomic data and confirmed the modulating effects of PLB on important proteins that regulated cell cycle, apoptosis, autophagy, and EMT in PC-3 and DU145 cells. The data from the Western blot assay could not display significant differences between PC-3 and DU145 cells. These findings indicate that PLB elicits different proteomic responses in PC-3 and DU145 cells involving proteins and pathways that regulate cell cycle, apoptosis, autophagy, reactive oxygen species production, and antioxidation/oxidation homeostasis. This is the first systematic study with integrated computational, proteomic, and

  3. In vitro differentiation of bone marrow mesenchymal stem cells into endometrial epithelial cells in mouse: a proteomic analysis

    PubMed Central

    Cong, Qing; Li, Bin; Wang, Yisheng; Zhang, Wenbi; Cheng, Mingjun; Wu, Zhiyong; Zhang, Xiaoyan; Jiang, Wei; Xu, Congjian

    2014-01-01

    Objective: Mouse bone marrow mesenchymal stem cells (BMSCs) have been demonstrated to differentiate into female endometrial epithelial cells (EECs) in vivo. Our previous studies demonstrated that BMSCs can differentiate in the direction of EECs when co-cultured with endometrial stromal cells in vitro. Here, we obtain and analyse differential proteins and their relevant pathways in the process of BMSCs differentiating into EECs by isobaric tags for relative and absolute quantitation (iTRAQ) proteomic analysis. Methods: A 0.4-μm pore size indirect co-culture system was established with female mice endometrial stromal cells (EStCs) restricted in the upper Transwell chamber and BMSCs in the lower well plate. After indirect co-culture for several days, the BMSCs were revealed to progressively differentiate towards EECs in vitro. Then, four groups were divided according to different co-culture days with single culture groups of BMSCs as controls. Proteins were detected using iTRAQ based on 2DLC-ESI-MS/MS and data were analysed by bioinformatics. Results: A total number of 311 proteins were detected, of which 210 proteins were identified with relative quantitation. Among them, 107 proteins were differentially expressed with a 1.2-fold change as the benchmark, with 61 up-regulated and 46 down-regulated proteins. Differential proteins CK19 and CK8 were epithelial markers and upregulated. Stromal marker vimentin were downregulated. Top canonical pathways was “remodeling of epithelial adhesions junctions” and “actin cytoskeleton signaling”. Top networks was “cell-to-cell signaling and interaction, tissue development and cellular movement” regulated by ERK/MAPK and α-catenin. Conclusion: To the best of our knowledge, this is the first preliminary study of differential protein expression in the differentiation process of BMSCs into EECs in vitro. We further elucidated BMSCs differentiated in the direction of EECs. In addition, ERK/MAPK and α-catenin played

  4. Proteomic analysis of protein expression in Lactobacillus plantarum in response to alkaline stress.

    PubMed

    Lee, KiBeom; Rho, Beom-Seop; Pi, KyungBae; Kim, Ho-Jin; Choi, Yun-Jaie

    2011-04-20

    Lactobacillus plantarum, a probiotic organism that plays an important role in the microbial fermentation of alkaline materials in fermenting foods, faces alkaline stress during the fermentation process. Here, we report the patterns of protein expression in L. plantarum subjected to transient (1h) alkaline stress at pH 7.7, 8.7 or 9.7. Thirty-three alkaline-responsive proteins were identified by two-dimensional electrophoresis and matrix-assisted laser desorption/ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS). Identification of proteins showing differential expression in response to alkaline stress revealed that the alkaline stress response of L. plantarum is a complex process. Some proteins appear to be induced, others repressed. These proteins could be clustered into nine groups based on their probable functions: energy metabolism, transport system, purine/pyrimidine metabolism, amino acid metabolism, proteolytic activity, transcription-translation, stress-related, general function, and unknown functions. These proteomic analyses are expected to prove useful in understanding the adaptive response of L. plantarum strains to alkaline stress and may facilitate future investigations into the genetic and physiological aspects of this response.

  5. Triphenyltin degradation and proteomic response by an engineered Escherichia coli expressing cytochrome P450 enzyme.

    PubMed

    Yi, Wenying; Yang, Kunliang; Ye, Jinshao; Long, Yan; Ke, Jing; Ou, Huase

    2017-03-01

    Although triphenyltin (TPT) degradation pathway has been determined, information about the enzyme and protein networks involved was severely limited. To this end, a cytochrome P450 hydroxylase (CYP450) gene from Bacillus thuringiensis was cloned and expressed in Escherichia coli BL21 (DE3), namely E. coli pET32a-CYP450, whose dosage at 1gL(-1) could degrade 54.6% TPT at 1mgL(-1) within 6 d through attacking the carbon-tin bonds of TPT by CYP450. Sequence analysis verified that the CYP450 gene had a 1214bp open reading frame, encoding a protein with 404 amino acids. Proteomic analysis determined that 60 proteins were significantly differentially regulated expression in E. coli pET32a-CYP450 after TPT degradation. The up-regulated proteins enriched in a network related to transport, cell division, biosynthesis of amino acids and secondary metabolites, and microbial metabolism in diverse environments. The current findings demonstrated for the first time that P450 received electrons transferring from NADH could effectively cleave carbon-metal bonds.

  6. Differential proteome analysis of bone marrow mesenchymal stem cells from adolescent idiopathic scoliosis patients.

    PubMed

    Zhuang, Qianyu; Li, Jing; Wu, Zhihong; Zhang, Jianguo; Sun, Wei; Li, Tao; Yan, Yujuan; Jiang, Ying; Zhao, Robert Chunhua; Qiu, Guixing

    2011-04-22

    Adolescent idiopathic scoliosis (AIS) is a complex three-dimensional deformity of the spine. The cause and pathogenesis of scoliosis and the accompanying generalized osteopenia remain unclear despite decades of extensive research. In this study, we utilized two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) coupled with mass spectrometry (MS) to analyze the differential proteome of bone marrow mesenchymal stem cells (BM-MSCs) from AIS patients. In total, 41 significantly altered protein spots were detected, of which 34 spots were identified by MALDI-TOF/TOF analysis and found to represent 25 distinct gene products. Among these proteins, five related to bone growth and development, including pyruvate kinase M2, annexin A2, heat shock 27 kDa protein, γ-actin, and β-actin, were found to be dysregulated and therefore selected for further validation by Western blot analysis. At the protein level, our results supported the previous hypothesis that decreased osteogenic differentiation ability of MSCs is one of the mechanisms leading to osteopenia in AIS. In summary, we analyzed the differential BM-MSCs proteome of AIS patients for the first time, which may help to elucidate the underlying molecular mechanisms of bone loss in AIS and also increase understanding of the etiology and pathogenesis of AIS.

  7. A proteomic study showing differential regulation of stress, redox regulation and peroxidase proteins by iron supply and the transcription factor FER.

    PubMed

    Brumbarova, Tzvetina; Matros, Andrea; Mock, Hans-Peter; Bauer, Petra

    2008-04-01

    Plants need to mobilize iron in the soil, and the basic helix-loop-helix transcription factor FER is a central regulator of iron acquisition in tomato roots. FER activity is controlled by iron supply. To analyse to what extent FER influences Fe-regulated protein expression, we investigated the root proteome of wild-type tomato, the fer mutant and a transgenic FER overexpression line under low-iron conditions versus sufficient and generous iron supply. The root proteomes were analysed by two-dimensional gel electrophoresis with three technical and three biological replicates. Statistical analysis identified 39 protein spots that were differentially regulated in selected pairwise comparisons of experimental conditions. Of these, 24 were correlated with expression clusters revealed by principal component analysis. The 39 protein spots were analysed by MALDI-TOF and nanoLC-MS/MS to deduce their possible functions. We investigated the functional representation in the identified expression clusters, and found that loss of FER function in iron-cultured plants mimicked an iron-deficiency status. The largest identified protein expression cluster was upregulated by iron deficiency and in the fer mutant. Two iron-regulated proteins required FER activity for induction by iron deficiency. Few proteins were suppressed by iron deficiency. The differentially expressed proteins belonged predominantly to the functional categories 'stress', 'redox regulation' and 'miscellaneous peroxidases'. Hence, we were able to identify distinct expression clusters of proteins with distinct functions.

  8. Proteomic exploration of the impacts of pomegranate fruit juice on the global gene expression of prostate cancer cell.

    PubMed

    Lee, Song-Tay; Wu, Yi-Ling; Chien, Lan-Hsiang; Chen, Szu-Ting; Tzeng, Yu-Kai; Wu, Ting-Feng

    2012-11-01

    Prostate cancer has been known to be the second highest cause of death in cancer among men. Pomegranate is rich in polyphenols with the potent antioxidant activity and inhibits cell proliferation, invasion, and promotes apoptosis in various cancer cells. This study demonstrated that pomegranate fruit juice could effectively hinder the proliferation of human prostate cancer DU145 cell. The results of apoptotic analyses implicated that fruit juice might trigger the apoptosis in DU145 cells via death receptor signaling and mitochondrial damage pathway. In this study, we exploited 2DE-based proteomics to compare nine pairs of the proteome maps collected from untreated and treated DU145 cells to identify the differentially expressed proteins. Comparative proteomics indicated that 11 proteins were deregulated in affected DU145 cells with three upregulated and eight downregulated proteins. These dys-regulated proteins participated in cytoskeletal functions, antiapoptosis, proteasome activity, NF-κB signaling, cancer cell proliferation, invasion, and angiogenesis. Western immunoblotting were implemented to confirm the deregulated proteins and the downstream signaling proteins. The analytical results of this study help to provide insight into the molecular mechanism of inducing prostate cancer cell apoptosis by pomegranate fruit juice and to develop a novel mechanism-based chemopreventive strategy for prostate cancer.

  9. Differential expression of proteins in response to molybdenum deficiency in winter wheat leaves under low-temperature stress

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Molybdenum (Mo) is an essential micronutrient for plants. To obtain a better understanding of the molecular mechanisms of cold resistance enhanced by molybdenum application in winter wheat, we applied a proteomic approach to investigate the differential expression of proteins in response to molybden...

  10. Differential protein expression in Phalaenopsis under low temperature.

    PubMed

    Yuan, Xiu-Yun; Liang, Fang; Jiang, Su-Hua; Wan, Mo-Fei; Ma, Jie; Zhang, Xian-Yun; Cui, Bo

    2015-01-01

    A comparative proteomic analysis was carried out to explore the molecular mechanisms of responses to cold stress in Phalaenopsis after treated by low temperature (13/8 °C day/night) for 15 days. Differentially expressed proteins were examined using two-dimensional electrophoresis (2-DE) and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-TOF/MS). Among 85 differentially expressed proteins, 73 distinct proteins were identified. Comparative analysis revealed that the identified proteins mainly participate in photosynthesis, protein synthesis, folding and degradation, respiration, defense response, amino acid metabolism, energy pathway, cytoskeleton, transcription regulation, signal transduction, and seed storage protein, while the functional classification of the remaining four proteins was not determined. These data suggested that the proteins might work cooperatively to establish a new homeostasis under cold stress; 37 % of the identified cold-responsive proteins were associated with various aspects of chloroplast physiology, and 56 % of them were predicted to be located in the chloroplasts, implying that the cold stress tolerance of Phalaenopsis was achieved, at least partly, by regulation of chloroplast function. Moreover, the protein destination control, which was mediated by chaperones and proteases, plays an important role in tolerance to cold stress.

  11. Screening for Expressed Nonribosomal Peptide Synthetases and Polyketide Synthases Using LC-MS/MS-Based Proteomics

    PubMed Central

    Chen, Yunqiu; McClure, Ryan A.; Kelleher, Neil L.

    2016-01-01

    Liquid chromatography–mass spectrometry (LC-MS)-based proteomics is a powerful technique for the profiling of protein expression in cells in a high-throughput fashion. Herein we report a protocol using LC-MS/MS-based proteomics for the screening of enzymes involved in natural product biosynthesis, such as nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) from bacterial strains. Taking advantage of the large size of modular NRPSs and PKSs (often >200 kDa), size-based separation (SDS-PAGE) is employed prior to LC-MS/MS analysis. Based upon the protein identifications obtained through software search, we can accurately pinpoint the expressed NRPS and/or PKS gene clusters from a given strain and growth condition. The proteomics screening result can be used to guide the discovery of potentially new nonribosomal peptide and polyketide natural products. PMID:26831706

  12. Proteomics unveil corticoid-induced S100A11 shuttling in keratinocyte differentiation

    SciTech Connect

    Dezitter, Xavier; Hammoudi, Fatma; Belverge, Nicolas; Deloulme, Jean-Christophe; Drobecq, Herve; Masselot, Bernadette; Formstecher, Pierre; Mendy, Denise; Idziorek, Thierry . E-mail: thierry.idziorek@lille.inserm.fr

    2007-08-31

    Unlike classical protein extraction techniques, proteomic mapping using a selective subcellular extraction kit revealed S100A11 as a new member of the S100 protein family modulated by glucocorticoids in keratinocytes. Glucocorticoids (GC)-induced S100A11 redistribution in the 'organelles and membranes' compartment. Microscopic examination indicated that glucocorticoids specifically routed cytoplasmic S100A11 toward perinuclear compartment. Calcium, a key component of skin terminal differentiation, directed S100A11 to the plasma membrane as previously reported. When calcium was added to glucocorticoids, minor change was observed at the proteomic level while confocal microscopy revealed a rapid and dramatic translocation of S100A11 toward plasma membrane. This effect was accompanied by strong nuclear condensation, loss of mitochondrial potential and DNA content, and increased high molecular weight S100A11 immunoreactivity, suggesting corticoids accelerate calcium-induced terminal differentiation. Finally, our results suggest GC-induced S100A11 relocalization could be a key step in both keratinocyte homeostasis and glucocorticoids side effects in human epidermis.

  13. Introducing Knowledge into Differential Expression Analysis

    PubMed Central

    Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin

    2010-01-01

    Abstract Gene expression measurements allow determining sets of up- or down-regulated, or unchanged genes in a particular experimental condition. Additional biological knowledge can suggest examples of genes from one of these sets. For instance, known target genes of a transcriptional activator are expected, but are not certain to go down after this activator is knocked out. Available differential expression analysis tools do not take such imprecise examples into account. Here we put forward a novel partially supervised mixture modeling methodology for differential expression analysis. Our approach, guided by imprecise examples, clusters expression data into differentially expressed and unchanged genes. The partially supervised methodology is implemented by two methods: a newly introduced belief-based mixture modeling, and soft-label mixture modeling, a method proved efficient in other applications. We investigate on synthetic data the input example settings favorable for each method. In our tests, both belief-based and soft-label methods prove their advantage over semi-supervised mixture modeling in correcting for erroneous examples. We also compare them to alternative differential expression analysis approaches, showing that incorporation of knowledge yields better performance. We present a broad range of knowledge sources and data to which our partially supervised methodology can be applied. First, we determine targets of Ste12 based on yeast knockout data, guided by a Ste12 DNA-binding experiment. Second, we distinguish miR-1 from miR-124 targets in human by clustering expression data under transfection experiments of both microRNAs, using their computationally predicted targets as examples. Finally, we utilize literature knowledge to improve clustering of time-course expression profiles. PMID:20726790

  14. Copper response of Proteus hauseri based on proteomic and genetic expression and cell morphology analyses.

    PubMed

    Ng, I-Son; Zheng, Xuesong; Wang, Nan; Chen, Bor-Yann; Zhang, Xia; Lu, Yinghua

    2014-07-01

    The copper response of Proteus hauseri ZMd44 was determined using one-dimensional (1D) gel electrophoresis coupled with MALDI-TOF-TOF mass spectrometry for a similarity analysis of proteins isolated from P. hauseri ZMd44 cultured in CuSO4-bearing LB medium. Candidate proteins identified as a copper-transporting P-type ATPase (CTPP), phosphoenolpyruvate carboxykinase (PEPCK), flagellin (Fla), and outer membrane proteins (Omps) were the major copper-associated proteins in P. hauseri. In a comparative analysis of subcellular (i.e., periplasmic, intracellular, and inner membranes) and cellular debris, proteomics analysis revealed a distinct differential expression of proteins in P. hauseri with and without copper ion exposure. These findings were consistent with the transcription level dynamics determined using quantitative real-time PCR. Based on a genetic cluster analysis of copper-associated proteins from P. hauseri, Fla and one of the Omps showed greater diversity in their protein sequences compared to those of other Proteus species. Transmission electron microscopy (TEM) and the observed growth on LB agar plates showed that the swarming motility of cells was significantly suppressed and inhibited upon Cu(II) exposure. Thus, copper stress could have important therapeutic significance due to the loss of swarming motility capacity in P. hauseri, which causes urinary tract infections.

  15. Potential applications of global protein expression analysis (proteomics) in morbid obesity and bariatric surgery.

    PubMed

    Brandacher, Gerald; Golderer, Georg; Kienzl, Katrin; Werner, Ernst R; Margreiter, Raimund; Weiss, Helmut G

    2008-07-01

    Global protein expression analysis, known as proteomics, has emerged as a novel scientific technology currently successfully applied to several fields of medicine including cancer and transplantation. Thereby, a thorough exploration of the pathogenic mechanisms and a better understanding of the pathophysiology of diseases as well as identification of diagnostic biomarkers have been achieved. In this paper, we outline the basic principles and potential applications of this promising tool in bariatric surgery where proteomics might hold great potential for new insights into diagnostic and therapeutic decision making based on improved knowledge of metabolic regulations pre- and postsurgical interventions in morbidly obese patients.

  16. Differential expression of hemolymph proteins between susceptible and insecticide-resistant Blattella germanica (Blattodea: Blattellidae).

    PubMed

    Zhang, F; Wang, X J; Huang, Y H; Zhao, Z G; Zhang, S S; Gong, X S; Xie, L; Kang, D M; Jing, X

    2014-08-01

    A proteomic approach combining two-dimensional polyacrylamide gel electrophoresis and tandem mass spectrometry was used to compare hemolymph expression profiles of a beta-cypermethrin-resistant Blattella germanica L. strain and a beta-cypermethrin-susceptible strain. Twenty-eight hemolymph proteins were differentially expressed in the resistant cockroach strain; 19 proteins were upregulated and 9 proteins were downregulated compared with the susceptible strain. Protein identification indicated that expression of putative cuticular protein, nitric oxide synthase, triosephosphate isomerase, alpha-amylase, ABC transporter, and Per a 3 allergen was elevated, and expression of arginine kinase and glycosidase was reduced. The differential expression of these proteins reflects the overall change in cellular structure and metabolism related to the resistance of pyrethroid insecticides.

  17. Proteomic Profiling Of Two-Dimensional Gel Electrophoresis Protein Expression Data

    NASA Astrophysics Data System (ADS)

    Ahmad, Norhaiza; Zhang, J.; Brown, P. J.; James, D. C.; Birch, J. R.; Racher, A. J.; Smales, C. M.

    2008-01-01

    We have undertaken two-dimensional gel electrophoresis (2-DE) proteomic profiling on a series of cell lines with different recombinant antibody production rates. Due to the nature of 2-DE proteomic investigations there will always be `process variability' factors in any data set collected in this way. Some of this variation will arise during sample preparation, gel running and staining, while further variation will arise from the gel analysis procedure. Therefore, in order to identify all significant changes in protein expression between biological samples when analysed by 2-DE, the system precision or `error', and how this correlates to protein abundance, must be known. Only then can the system be considered robust and investigators accurately and confidently report all observable statistically significant changes in protein expression. We introduce an expression variability test to identify protein spots whose expression correlates with increased antibody production. The results have highlighted a small number of candidate proteins for further investigation.

  18. Differential proteomic analysis of human erythroblasts undergoing apoptosis induced by epo-withdrawal.

    PubMed

    Pellegrin, Stéphanie; Heesom, Kate J; Satchwell, Timothy J; Hawley, Bethan R; Daniels, Geoff; van den Akker, Emile; Toye, Ashley M

    2012-01-01

    The availability of Erythropoietin (Epo) is essential for the survival of erythroid progenitors. Here we study the effects of Epo removal on primary human erythroblasts grown from peripheral blood CD34(+) cells. The erythroblasts died rapidly from apoptosis, even in the presence of SCF, and within 24 hours of Epo withdrawal 60% of the cells were Annexin V positive. Other classical hallmarks of apoptosis were also observed, including cytochrome c release into the cytosol, loss of mitochondrial membrane potential, Bax translocation to the mitochondria and caspase activation. We adopted a 2D DIGE approach to compare the proteomes of erythroblasts maintained for 12 hours in the presence or absence of Epo. Proteomic comparisons demonstrated significant and reproducible alterations in the abundance of proteins between the two growth conditions, with 18 and 31 proteins exhibiting altered abundance in presence or absence of Epo, respectively. We observed that Epo withdrawal induced the proteolysis of the multi-functional proteins Hsp90 alpha, Hsp90 beta, SET, 14-3-3 beta, 14-3-3 gamma, 14-3-3 epsilon, and RPSA, thereby targeting multiple signaling pathways and cellular processes simultaneously. We also observed that 14 proteins were differentially phosphorylated and confirmed the phosphorylation of the Hsp90 alpha and Hsp90 beta proteolytic fragments in apoptotic cells using Nano LC mass spectrometry. Our analysis of the global changes occurring in the proteome of primary human erythroblasts in response to Epo removal has increased the repertoire of proteins affected by Epo withdrawal and identified proteins whose aberrant regulation may contribute to ineffective erythropoiesis.

  19. Differential Proteomic Analysis of Human Erythroblasts Undergoing Apoptosis Induced by Epo-Withdrawal

    PubMed Central

    Pellegrin, Stéphanie; Heesom, Kate J.; Satchwell, Timothy J.; Hawley, Bethan R.; Daniels, Geoff; van den Akker, Emile; Toye, Ashley M.

    2012-01-01

    The availability of Erythropoietin (Epo) is essential for the survival of erythroid progenitors. Here we study the effects of Epo removal on primary human erythroblasts grown from peripheral blood CD34+ cells. The erythroblasts died rapidly from apoptosis, even in the presence of SCF, and within 24 hours of Epo withdrawal 60% of the cells were Annexin V positive. Other classical hallmarks of apoptosis were also observed, including cytochrome c release into the cytosol, loss of mitochondrial membrane potential, Bax translocation to the mitochondria and caspase activation. We adopted a 2D DIGE approach to compare the proteomes of erythroblasts maintained for 12 hours in the presence or absence of Epo. Proteomic comparisons demonstrated significant and reproducible alterations in the abundance of proteins between the two growth conditions, with 18 and 31 proteins exhibiting altered abundance in presence or absence of Epo, respectively. We observed that Epo withdrawal induced the proteolysis of the multi-functional proteins Hsp90 alpha, Hsp90 beta, SET, 14-3-3 beta, 14-3-3 gamma, 14-3-3 epsilon, and RPSA, thereby targeting multiple signaling pathways and cellular processes simultaneously. We also observed that 14 proteins were differentially phosphorylated and confirmed the phosphorylation of the Hsp90 alpha and Hsp90 beta proteolytic fragments in apoptotic cells using Nano LC mass spectrometry. Our analysis of the global changes occurring in the proteome of primary human erythroblasts in response to Epo removal has increased the repertoire of proteins affected by Epo withdrawal and identified proteins whose aberrant regulation may contribute to ineffective erythropoiesis. PMID:22723854

  20. Label-Free Proteome Analysis of Plasma from Patients with Breast Cancer: Stage-Specific Protein Expression

    PubMed Central

    Lobo, Marina Duarte Pinto; Moreno, Frederico Bruno Mendes Batista; Souza, Gustavo Henrique Martins Ferreira; Verde, Sara Maria Moreira Lima; Moreira, Renato de Azevedo; Monteiro-Moreira, Ana Cristina de Oliveira

    2017-01-01

    Breast cancer is one of the most commonly diagnosed types of cancer among women. Breast cancer mortality rates remain high probably because its diagnosis is hampered by inaccurate detection methods. Since changes in protein expression as well as modifications in protein glycosylation have been frequently reported in cancer development, the aim of this work was to study the differential expression as well as modifications of glycosylation of proteins from plasma of women with breast cancer at different stages of disease (n = 30) compared to healthy women (n = 10). A proteomics approach was used that depleted albumin and IgG from plasma followed by glycoprotein enrichment using immobilized Moraceae lectin (frutalin)-affinity chromatography and data-independent label-free mass spectrometric analysis. Data are available via ProteomeXchange with identifier PXD003106. As result, 57,016 peptides and 4,175 proteins among all samples were identified. From this, 40 proteins present in unbound (PI—proteins that did not interact with lectin) and bound (PII—proteins that interacted with lectin) fractions were differentially expressed. High levels of apolipoprotein A-II were detected here that were elevated significantly in the early and advanced stages of the disease. Apolipoprotein C-III was detected in both fractions, and its level was increased slightly in the PI fraction of patients with early-stage breast cancer and expressed at higher levels in the PII fraction of patients with early and intermediate stages. Clusterin was present at higher levels in both fractions of patients with early and intermediate stages of breast cancer. Our findings reveal a correlation between alterations in protein glycosylation, lipid metabolism, and the progression of breast cancer. PMID:28210565

  1. Label-Free Differential Proteomics and Quantification of Exoenzymes from Isolates of the Entomopathogenic Fungus Beauveria bassiana.

    PubMed

    Dionisio, Giuseppe; Kryger, Per; Steenberg, Tove

    2016-10-14

    Beauveria bassiana is an entomopathogenic fungus that grows both in vivo and in vitro. In vivo it can colonize live insect hosts, and tissue digestion occurs by secreted hydrolytic exoenzymes. It can also colonize dead insect tissue provided this is free from competing microorganisms. Depending on whether the host is alive or dead the expression (quality/quantity) of the exoenzymes may vary. We have grown several isolates of B. bassiana in shaking flasks for 120 h at 25 °C in order to evaluate the maximal exoenzyme production using two diet regimes. As sole carbon, nitrogen, and phosphate sources we used 1% shrimp chitin and either 0.5% w/v of dead intact American cockroach (Periplaneta americana) or their isolated cuticles. This is the first report of a differential proteomics of B. bassiana exoenzymes performed by label-free nano-LC MS/MS. Total proteolytic enzyme activity was mainly due to Pr1A or Pr1B depending on the isolate and the diet regime. The most differentially secreted enzymes were: the cuticle-degrading subtilisin Pr1A, GH13 alpha-glycosidase, glucan endo-1,3-beta-glucosidase, subtilisin-like proteinase Spm1, lipase 1, beta-1,3 exoglucanase, and endo-1,3-beta-glucosidase. Among the B. bassiana isolates analyzed, Bb 678 and Bb BG were the most active in Pr1A secretion.

  2. Differential proteomic analysis of midguts from Nosema ceranae-infected honeybees reveals manipulation of key host functions.

    PubMed

    Vidau, Cyril; Panek, Johan; Texier, Catherine; Biron, David G; Belzunces, Luc P; Le Gall, Morgane; Broussard, Cédric; Delbac, Frédéric; El Alaoui, Hicham

    2014-09-01

    Many invasive pathogens effectively bypass the insect defenses to ensure the completion of their life cycle. Among those, an invasive microsporidian species, Nosema ceranae, can cause nosemosis in honeybees. N. ceranae was first described in the Asian honeybee Apis cerana and is suspected to be involved in Western honeybee (Apis mellifera) declines worldwide. The midgut of honeybees is the first barrier against N. ceranae attacks. To bring proteomics data on honeybee/N. ceranae crosstalk and more precisely to decipher the worker honeybee midgut response after an oral inoculation of N. ceranae (10days post-infection), we used 2D-DIGE (2-Dimensional Differential In-Gel Electrophoresis) combined with mass spectrometry. Forty-five protein spots produced by the infected worker honeybee group were shown to be differentially expressed when compared to the uninfected group; 14 were subsequently identified by mass spectrometry. N. ceranae mainly caused a modulation of proteins involved in three key host biological functions: (i) energy production, (ii) innate immunity (reactive oxygen stress) and (iii) protein regulation. The modulation of these host biological functions suggests that N. ceranae creates a zone of "metabolic habitat modification" in the honeybee midgut favoring its development by enhancing availability of nutrients and reducing the worker honeybee defense.

  3. Label-Free Differential Proteomics and Quantification of Exoenzymes from Isolates of the Entomopathogenic Fungus Beauveria bassiana

    PubMed Central

    Dionisio, Giuseppe; Kryger, Per; Steenberg, Tove

    2016-01-01

    Beauveria bassiana is an entomopathogenic fungus that grows both in vivo and in vitro. In vivo it can colonize live insect hosts, and tissue digestion occurs by secreted hydrolytic exoenzymes. It can also colonize dead insect tissue provided this is free from competing microorganisms. Depending on whether the host is alive or dead the expression (quality/quantity) of the exoenzymes may vary. We have grown several isolates of B. bassiana in shaking flasks for 120 h at 25 °C in order to evaluate the maximal exoenzyme production using two diet regimes. As sole carbon, nitrogen, and phosphate sources we used 1% shrimp chitin and either 0.5% w/v of dead intact American cockroach (Periplaneta americana) or their isolated cuticles. This is the first report of a differential proteomics of B. bassiana exoenzymes performed by label-free nano-LC MS/MS. Total proteolytic enzyme activity was mainly due to Pr1A or Pr1B depending on the isolate and the diet regime. The most differentially secreted enzymes were: the cuticle-degrading subtilisin Pr1A, GH13 alpha-glycosidase, glucan endo-1,3-beta-glucosidase, subtilisin-like proteinase Spm1, lipase 1, beta-1,3 exoglucanase, and endo-1,3-beta-glucosidase. Among the B. bassiana isolates analyzed, Bb 678 and Bb BG were the most active in Pr1A secretion. PMID:27754403

  4. Proteomic responses of European flounder to temperature and hypoxia as interacting stressors: Differential sensitivities of populations.

    PubMed

    Pédron, Nicolas; Artigaud, Sébastien; Infante, José-Luis Zambonino; Le Bayon, Nicolas; Charrier, Grégory; Pichereau, Vianney; Laroche, Jean

    2017-02-16

    In the context of global change, ectotherms are increasingly impacted by abiotic perturbations. Along the distribution area of a species, the populations at low latitudes are particularly exposed to temperature increase and hypoxic events. In this study, we have compared the proteomic responses in the liver of European flounder populations, by using 2-D electrophoresis. One southern peripheral population from Portugal vs two northern core populations from France, were reared in a common garden experiment. Most of the proteomic differences were observed between the two experimental conditions, a cold vs a warm and hypoxic conditions. Consistent differentiations between populations were observed in accumulation of proteins involved in the bioenergetics- and methionine-metabolisms, fatty acids transport, and amino-acid catabolism. The specific regulation of crucial enzymes like ATP-synthase and G6PDH, in the liver of the southern population, could be related to a possible local adaptation. This southern peripheral population is spatially distant from northern core populations and has experienced dissimilar ecological conditions; thus it may contain genotypes that confer resilience to climate changes.

  5. Classical Galactosemia: Insight into Molecular Pathomechanisms by Differential Membrane Proteomics of Fibroblasts under Galactose Stress.

    PubMed

    Staubach, Simon; Müller, Stefan; Pekmez, Murat; Hanisch, Franz-Georg

    2017-02-03

    Classical galactosemia, a hereditary metabolic disease caused by the deficiency of galactose-1-phosphate uridyltransferase (GALT; EC 2.7.712), results in an impaired galactose metabolism and serious long-term developmental affection of the CNS and ovaries, potentially related in part to endogenous galactose-induced protein dysglycosylation. In search for galactose-induced changes in membrane raft proteomes of GALT-deficient cells, we performed differential analyses of lipid rafts from patient-derived (Q) and sex- and age-matched control fibroblasts (H) in the presence or absence of the stressor. Label-based proteomics revealed of the total 454 (female) or 678 (male) proteins a proportion of ∼12% in at least one of four relevant ratios as fold-changed. GALT(-) cell-specific effects in the absence of stressor revealed cell-model-dependent affection of biological processes related to protein targeting to the plasma membrane (female) or to cellular migration (male). However, a series of common galactose-induced effects were observed, among them the strongly increased ER-stress marker GRP78 and calreticulin involved in N-glycoprotein quality control. The membrane-anchored N-glycoprotein receptor CD109 was concertedly decreased under galactose-stress together with cadherin-13, GLIPR1, glypican-1, and semaphorin-7A. A series of proteins showed opposite fold-changes in the two cell models, whereas others fluctuated in only one of the two models.

  6. Differential proteomic analysis of bovine conceptus fluid proteins in pregnancies generated by assisted reproductive technologies.

    PubMed

    Riding, George A; Hill, Jonathan R; Jones, Alun; Holland, Michael K; Josh, Peter F; Lehnert, Sigrid A

    2008-07-01

    Proteomic analysis of bovine conceptus fluid proteins during early pregnancy has the potential to expose protein species indicative of both the overall health of the fetal-maternal environment and fetal developmental status. In this study, we examined the differential abundance of bovine conceptus fluid proteins (5-50 kDa fraction) from naturally conceived, in vitro fertilisation (IVF) and somatic cell nuclear transfer (SCNT)-derived pregnancies at days 45 and 90 of gestation. In day 45 allantoic fluid (AllF) samples, an atypical cluster of low molecular weight ( approximately 14-16 kDa), low pI (between 3.0 and 4.5 pH units) protein species was increased in three of four IVF samples (30-100-fold increase in protein spot volumes compared to normal). These proteins were identified as paralogs of the bovine cathelicidin antimicrobial protein (CAMP) by MALDI-TOF MS peptide mass fingerprint and MALDI-TOF MS/MS peptide sequence analysis. Peptidoglycan recognition protein and serine (or cysteine) proteinase inhibitor clade B1, were also significantly increased in the corresponding IVF samples. In two of four SCNT AllF samples, a 2-10-fold increase in CAMP protein spot volumes were detected. No aberrant abundance levels of individual protein species were observed in amniotic fluid samples, or in day 90 IVF AllF samples. Identification of unique protein species present in the normal bovine AllF proteome at day 45 is also reported.

  7. Use of proteomic differential displays to assess functional discrepancies and adjustments of human bone marrow- and Wharton jelly-derived mesenchymal stem cells.

    PubMed

    Kuo, Hsing-Chun; Chiu, Chi-Chin; Chang, Wan-Ching; Sheen, Jiunn-Ming; Ou, Chia-Yu; Kuo, Ho-Chang; Chen, Rong-Fu; Hsu, Te-Yao; Chang, Jen-Chieh; Hsaio, Chang-Chun; Wang, Feng-Sheng; Huang, Chung-Cheng; Huang, Hsuan-Ying; Yang, Kuender D

    2011-03-04

    Mesenchymal stem cells (MSCs) from bone marrow are suitable for the reconstruction of connective tissues and even brain tissue but have limitations in terms of cell expansion and fully specific differentiation. In our current study, we have attempted to adjust and improve the cell expansion and differentiation properties of human MSCs from different tissues. MSCs from normal bone marrow and Wharton jelly were subjected to proteomic differential displays, followed by functional adjustments based on these displays. Bone marrow MSCs expressed more transgelin-2 and differentiated more rapidly into bone nodules but showed a slower growth rate. A knockdown of transgelin-2 expression by specific small interfering RNA (siRNA) significantly increased the growth rate of these cells, the G1/S phase cell cycle transition, and the interaction of cyclin D1 with cdk2. Wharton jelly MSCs expressed the chaperone protein HSP90β at higher levels and differentiated slowly toward an osteogenic lineage. However, the knockdown of HSP90β expression significantly increased bone nodule formation, inhibited cell growth, decreased the number of cells in the G1/S phase of the cell cycle, and decreased the interaction of cyclin D1 with cdk2 and of cyclin E with cdk2. These results were validated by the in vivo repair of segmental bone defects in a mouse model with severe combined immunodeficiency. We thus demonstrate an improvement in the cell expansion and tissue regeneration properties of human MSCs through specific adjustments.

  8. Serum immune-related proteins are differentially expressed during hibernation in the American black bear.

    PubMed

    Chow, Brian A; Donahue, Seth W; Vaughan, Michael R; McConkey, Brendan; Vijayan, Mathilakath M

    2013-01-01

    Hibernation is an adaptation to conserve energy in the face of extreme environmental conditions and low food availability that has risen in several animal phyla. This phenomenon is characterized by reduced metabolic rate (∼25% of the active basal metabolic rate in hibernating bears) and energy demand, while other physiological adjustments are far from clear. The profiling of the serum proteome of the American black bear (Ursus americanus) may reveal specific proteins that are differentially modulated by hibernation, and provide insight into the remarkable physiological adaptations that characterize ursid hibernation. In this study, we used differential gel electrophoresis (DIGE) analysis, liquid chromatography coupled to tandem mass spectrometry, and subsequent MASCOT analysis of the mass spectra to identify candidate proteins that are differentially expressed during hibernation in captive black bears. Seventy serum proteins were identified as changing by ±1.5 fold or more, out of which 34 proteins increased expression during hibernation. The majority of identified proteins are involved in immune system processes. These included α2-macroglobulin, complement components C1s and C4, immunoglobulin μ and J chains, clusterin, haptoglobin, C4b binding protein, kininogen 1, α2-HS-glycoprotein, and apoplipoproteins A-I and A-IV. Differential expression of a subset of these proteins identified by proteomic analysis was also confirmed by immunodetection. We propose that the observed serum protein changes contribute to the maintenance of the hibernation phenotype and health, including increased capacities for bone maintenance and wound healing during hibernation in bears.

  9. Gibberellin-Stimulation of Rhizome Elongation and Differential GA-Responsive Proteomic Changes in Two Grass Species

    PubMed Central

    Ma, Xiqing; Huang, Bingru

    2016-01-01

    Rapid and extensive rhizome development is a desirable trait for perennial grass growth and adaptation to environmental stresses. The objective of this study was to determine proteomic changes and associated metabolic pathways of gibberellin (GA) -regulation of rhizome elongation in two perennial grass species differing in rhizome development. Plants of a short-rhizome bunch-type tall fescue (TF; Festuca arundinacea; ‘BR’) and an extensive rhizomatous Kentucky bluegrass (KB; Poa pratensis; ‘Baron’) were treated with 10 μM GA3 in hydroponic culture in growth chambers. The average rhizome length in KB was significantly longer than that in TF regardless of GA3 treatment, and increased significantly with GA3 treatment, to a greater extent than that in TF. Comparative proteomic analysis using two-dimensional electrophoresis and mass spectrometry was performed to further investigate proteins and associated metabolic pathways imparting increased rhizome elongation by GA. A total of 37 and 38 differentially expressed proteins in response to GA3 treatment were identified in TF and KB plants, respectively, which were mainly involved in photosynthesis, energy and amino acid metabolism, protein synthesis, defense and cell development processes. Accelerated rhizome elongation in KB by GA could be mainly associated with the increased abundance of proteins involved in energy metabolism (glyceraldehyde-3-phosphate dehydrogenase, fructose-bisphosphate aldolase, and ATP synthase), amino acid metabolism (S-adenosylmethionine and adenosylhomocysteinase), protein synthesis (HSP90, elongation factor Tu and eukaryotic translation initiation factor 5A), cell-wall development (cell dividion cycle protein, alpha tubulin-2A and actin), and signal transduction (calreticulin). These proteins could be used as candidate proteins for further analysis of molecular mechanisms controlling rhizome growth. PMID:27446135

  10. Towards a Proteomic Catalogue and Differential Annotation of Salivary Gland Proteins in Blood Fed Malaria Vector Anopheles culicifacies by Mass Spectrometry

    PubMed Central

    Rawal, Ritu; Vijay, Sonam; Kadian, Kavita; Singh, Jagbir; Pande, Veena; Sharma, Arun

    2016-01-01

    In order to understand the importance of functional proteins in mosquito behavior, following blood meal, a baseline proteomic dataset is essential for providing insights into the physiology of blood feeding. Therefore, in this study as first step, in solution and 1-D electrophoresis digestion approach combined with tandem mass spectrometry (nano LC-MS/MS) and computational bioinformatics for data mining was used to prepare a baseline proteomic catalogue of salivary gland proteins of sugar fed An. culicifacies mosquitoes. A total of 106 proteins were identified and analyzed by SEQUEST algorithm against mosquito protein database from Uniprot/NCBI. Importantly, D7r1, D7r2, D7r4, salivary apyrase, anti-platelet protein, calreticulin, antigen 5 family proteins were identified and grouped on the basis of biological and functional roles. Secondly, differential protein expression and annotations between salivary glands of sugar fed vs blood fed mosquitoes was analyzed using 2-Delectrophoresis combined with MALDI-TOF mass spectrometry. The alterations in the differential expression of total 38 proteins was observed out of which 29 proteins like beclin-1, phosphorylating proteins, heme oxygenase 1, ferritin, apoptotic proteins, coagulation and immunity like, serine proteases, serpins, c-type lectin and protein in regulation of blood feeding behavior were found to be up regulated while 9 proteins related to blood feeding, juvenile hormone epoxide hydrolase ii, odorant binding proteins and energy metabolic enzymes were found to be down regulated. To our knowledge, this study provides a first time baseline proteomic dataset and functional annotations of An. culicifacies salivary gland proteins that may be involved during the blood feeding. Identification of differential salivary proteins between sugar fed and blood fed mosquitoes and their plausible role may provide insights into the physiological processes associated with feeding behavior and sporozoite transmission during the

  11. Comparative proteomic analysis of differential responses of Pinus massoniana and Taxus wallichiana var. mairei to simulated acid rain.

    PubMed

    Hu, Wen-Jun; Chen, Juan; Liu, Ting-Wu; Simon, Martin; Wang, Wen-Hua; Chen, Juan; Wu, Fei-Hua; Liu, Xiang; Shen, Zhi-Jun; Zheng, Hai-Lei

    2014-03-12

    Acid rain (AR), a serious environmental issue, severely affects plant growth and development. As the gymnosperms of conifer woody plants, Pinus massoniana (AR-sensitive) and Taxus wallichiana var. mairei (AR-resistant) are widely distributed in southern China. Under AR stress, significant necrosis and collapsed lesions were found in P. massoniana needles with remarkable yellowing and wilting tips, whereas T. wallichiana var. mairei did not exhibit chlorosis and visible damage. Due to the activation of a large number of stress-related genes and the synthesis of various functional proteins to counteract AR stress, it is important to study the differences in AR-tolerance mechanisms by comparative proteomic analysis of tolerant and sensitive species. This study revealed a total of 65 and 26 differentially expressed proteins that were identified in P. massoniana and T. wallichiana var. mairei, respectively. Among them, proteins involved in metabolism, photosynthesis, signal transduction and transcription were drastically down-regulated in P. massoniana, whereas most of the proteins participating in metabolism, cell structure, photosynthesis and transcription were increased in T. wallichiana var. mairei. These results suggest the distinct patterns of protein expression in the two woody species in response to AR, allowing a deeper understanding of diversity on AR tolerance in forest tree species.

  12. BRCA1 deficiency in ovarian cancer is associated with alteration in expression of several key regulators of cell motility - A proteomics study.

    PubMed

    Gau, David M; Lesnock, Jamie L; Hood, Brian L; Bhargava, Rohit; Sun, Mai; Darcy, Kathleen; Luthra, Soumya; Chandran, Uma; Conrads, Thomas P; Edwards, Robert P; Kelley, Joseph L; Krivak, Thomas C; Roy, Partha

    2015-01-01

    Functional loss of expression of breast cancer susceptibility gene 1(BRCA1) has been implicated in genomic instability and cancer progression. There is emerging evidence that BRCA1 gene product (BRCA1) also plays a role in cancer cell migration. We performed a quantitative proteomics study of EOC patient tumor tissues and identified changes in expression of several key regulators of actin cytoskeleton/cell adhesion and cell migration (CAPN1, 14-3-3, CAPG, PFN1, SPTBN1, CFN1) associated with loss of BRCA1 function. Gene expression analyses demonstrate that several of these proteomic hits are differentially expressed between early and advanced stage EOC thus suggesting clinical relevance of these proteins to disease progression. By immunohistochemistry of ovarian tumors with BRCA1(+/+) and BRCA1(null) status, we further verified our proteomic-based finding of elevated PFN1 expression associated with BRCA1 deficiency. Finally, we established a causal link between PFN1 and BRCA1-induced changes in cell migration thus uncovering a novel mechanistic basis for BRCA1-dependent regulation of ovarian cancer cell migration. Overall, findings of this study open up multiple avenues by which BRCA1 can potentially regulate migration and metastatic phenotype of EOC cells.

  13. BRCA1 deficiency in ovarian cancer is associated with alteration in expression of several key regulators of cell motility – A proteomics study

    PubMed Central

    Gau, David M; Lesnock, Jamie L; Hood, Brian L; Bhargava, Rohit; Sun, Mai; Darcy, Kathleen; Luthra, Soumya; Chandran, Uma; Conrads, Thomas P; Edwards, Robert P; Kelley, Joseph L; Krivak, Thomas C; Roy, Partha

    2015-01-01

    Functional loss of expression of breast cancer susceptibility gene 1(BRCA1) has been implicated in genomic instability and cancer progression. There is emerging evidence that BRCA1 gene product (BRCA1) also plays a role in cancer cell migration. We performed a quantitative proteomics study of EOC patient tumor tissues and identified changes in expression of several key regulators of actin cytoskeleton/cell adhesion and cell migration (CAPN1, 14-3-3, CAPG, PFN1, SPTBN1, CFN1) associated with loss of BRCA1 function. Gene expression analyses demonstrate that several of these proteomic hits are differentially expressed between early and advanced stage EOC thus suggesting clinical relevance of these proteins to disease progression. By immunohistochemistry of ovarian tumors with BRCA1+/+ and BRCA1null status, we further verified our proteomic-based finding of elevated PFN1 expression associated with BRCA1 deficiency. Finally, we established a causal link between PFN1 and BRCA1-induced changes in cell migration thus uncovering a novel mechanistic basis for BRCA1-dependent regulation of ovarian cancer cell migration. Overall, findings of this study open up multiple avenues by which BRCA1 can potentially regulate migration and metastatic phenotype of EOC cells. PMID:25927284

  14. Proteomic Profiles in Acute Respiratory Distress Syndrome Differentiates Survivors from Non-Survivors

    PubMed Central

    Bhargava, Maneesh; Becker, Trisha L.; Viken, Kevin J.; Jagtap, Pratik D.; Dey, Sanjoy; Steinbach, Michael S.; Wu, Baolin; Kumar, Vipin; Bitterman, Peter B.; Ingbar, David H.; Wendt, Christine H.

    2014-01-01

    Acute Respiratory Distress Syndrome (ARDS) continues to have a high mortality. Currently, there are no biomarkers that provide reliable prognostic information to guide clinical management or stratify risk among clinical trial participants. The objective of this study was to probe the bronchoalveolar lavage fluid (BALF) proteome to identify proteins that differentiate survivors from non-survivors of ARDS. Patients were divided into early-phase (1 to 7 days) and late-phase (8 to 35 days) groups based on time after initiation of mechanical ventilation for ARDS (Day 1). Isobaric tags for absolute and relative quantitation (iTRAQ) with LC MS/MS was performed on pooled BALF enriched for medium and low abundance proteins from early-phase survivors (n = 7), early-phase non-survivors (n = 8), and late-phase survivors (n = 7). Of the 724 proteins identified at a global false discovery rate of 1%, quantitative information was available for 499. In early-phase ARDS, proteins more abundant in survivors mapped to ontologies indicating a coordinated compensatory response to injury and stress. These included coagulation and fibrinolysis; immune system activation; and cation and iron homeostasis. Proteins more abundant in early-phase non-survivors participate in carbohydrate catabolism and collagen synthesis, with no activation of compensatory responses. The compensatory immune activation and ion homeostatic response seen in early-phase survivors transitioned to cell migration and actin filament based processes in late-phase survivors, revealing dynamic changes in the BALF proteome as the lung heals. Early phase proteins differentiating survivors from non-survivors are candidate biomarkers for predicting survival in ARDS. PMID:25290099

  15. Differential antennal proteome comparison of adult honeybee drone, worker and queen (Apis mellifera L.).

    PubMed

    Fang, Yu; Song, Feifei; Zhang, Lan; Aleku, Dereje Woltedji; Han, Bin; Feng, Mao; Li, Jianke

    2012-01-04

    To understand the olfactory mechanism of honeybee antennae in detecting specific volatile compounds in the atmosphere, antennal proteome differences of drone, worker and queen were compared using 2-DE, mass spectrometry and bioinformatics. Therefore, 107 proteins were altered their expressions in the antennae of drone, worker and queen bees. There were 54, 21 and 32 up-regulated proteins in the antennae of drone, worker and queen, respectively. Proteins upregulated in the drone antennae were involved in fatty acid metabolism, antioxidation, carbohydrate metabolism and energy production, protein folding and cytoskeleton. Proteins upregulated in the antennae of worker and queen bees were related to carbohydrate metabolism and energy production while molecular transporters were upregulated in the queen antennae. Our results explain the role played by the antennae of drone is to aid in perceiving the queen sexual pheromones, in the worker antennae to assist for food search and social communication and in the queen antennae to help pheromone communication with the worker and the drone during the mating flight. This first proteomic study significantly extends our understanding of honeybee olfactory activities and the possible mechanisms played by the antennae in response to various environmental, social, biological and biochemical signals.

  16. Differential proteomics reveals novel insights into Nosema-honey bee interactions.

    PubMed

    Kurze, Christoph; Dosselli, Ryan; Grassl, Julia; Le Conte, Yves; Kryger, Per; Baer, Boris; Moritz, Robin F A

    2016-12-01

    Host manipulation is a common strategy by parasites to reduce host defense responses, enhance development, host exploitation, reproduction and, ultimately, transmission success. As these parasitic modifications can reduce host fitness, increased selection pressure may result in reciprocal adaptations of the host. Whereas the majority of studies on host manipulation have explored resistance against parasites (i.e. ability to prevent or limit an infection), data describing tolerance mechanisms (i.e. ability to limit harm of an infection) are scarce. By comparing differential protein abundance, we provide evidence of host-parasite interactions in the midgut proteomes of N. ceranae-infected and uninfected honey bees from both Nosema-tolerant and Nosema-sensitive lineages. We identified 16 proteins out of 661 protein spots that were differentially abundant between experimental groups. In general, infections of Nosema resulted in an up-regulation of the bee's energy metabolism. Additionally, we identified 8 proteins that were differentially abundant between tolerant and sensitive honey bees regardless of the Nosema infection. Those proteins were linked to metabolism, response to oxidative stress and apoptosis. In addition to bee proteins, we also identified 3 Nosema ceranae proteins. Interestingly, abundance of two of these Nosema proteins were significantly higher in infected Nosema-sensitive honeybees relative to the infected Nosema-tolerant lineage. This may provide a novel candidate for studying the molecular interplay between N. ceranae and its honey bee host in more detail.

  17. A Bayesian algorithm for detecting differentially expressed proteins and its application in breast cancer research

    NASA Astrophysics Data System (ADS)

    Santra, Tapesh; Delatola, Eleni Ioanna

    2016-07-01

    Presence of considerable noise and missing data points make analysis of mass-spectrometry (MS) based proteomic data a challenging task. The missing values in MS data are caused by the inability of MS machines to reliably detect proteins whose abundances fall below the detection limit. We developed a Bayesian algorithm that exploits this knowledge and uses missing data points as a complementary source of information to the observed protein intensities in order to find differentially expressed proteins by analysing MS based proteomic data. We compared its accuracy with many other methods using several simulated datasets. It consistently outperformed other methods. We then used it to analyse proteomic screens of a breast cancer (BC) patient cohort. It revealed large differences between the proteomic landscapes of triple negative and Luminal A, which are the most and least aggressive types of BC. Unexpectedly, majority of these differences could be attributed to the direct transcriptional activity of only seven transcription factors some of which are known to be inactive in triple negative BC. We also identified two new proteins which significantly correlated with the survival of BC patients, and therefore may have potential diagnostic/prognostic values.

  18. Utility of proteomics techniques for assessing protein expression.

    PubMed

    Natarajan, Savithiry S; Xu, Chenping; Cregan, Perry; Caperna, Thomas J; Garrett, Wesley M; Luthria, Devanand

    2009-08-01

    Proteomic technologies are currently used as an effective analytical tool for examining modifications in protein profiles. Understanding the natural variation of soybean seed proteins is necessary to evaluate potential unintended (collateral) effects due to transgenic modifications in genetically modified (GMO) soybeans. We used two-dimensional polyacrylamide gel electrophoresis (2D-PAGE), matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry, and liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) to separate, identify and quantify the different classes of soybean seed proteins. Sixteen soybean genotypes, including four wild and twelve cultivated genotypes, belonging to four different subgroups were used as models for protein profile evaluation. Significant variations of allergen and anti-nutritional protein profiles were observed between two different groups, cultivated and wild soybean genotypes. However, only minor variations in protein profiles were observed within the soybean samples from the same group (cultivated or wild). These results may be useful to scientists needing to compare GMO and non-GMO soybeans once additional data are generated on additional soybean varieties and the same varieties grown at different geographical locations.

  19. Differential expression of genes and proteins associated with wool follicle cycling.

    PubMed

    Liu, Nan; Li, Hegang; Liu, Kaidong; Yu, Juanjuan; Cheng, Ming; De, Wei; Liu, Jifeng; Shi, Shuyan; He, Yanghua; Zhao, Jinshan

    2014-08-01

    Sheep are valuable resources for the wool industry. Wool growth of Aohan fine wool sheep has cycled during different seasons in 1 year. Therefore, identifying genes that control wool growth cycling might lead to ways for improving the quality and yield of fine wool. In this study, we employed Agilent sheep gene expression microarray and proteomic technology to compare the gene expression patterns of the body side skins at August and December time points in Aohan fine wool sheep (a Chinese indigenous breed). Microarray study revealed that 2,223 transcripts were differentially expressed, including 1,162 up-regulated and 1,061 down-regulated transcripts, comparing body side skin at the August time point to the December one (A/D) in Aohan fine wool sheep. Then seven differentially expressed genes were selected to validated the reliability of the gene chip data. The majority of the genes possibly related to follicle development and wool growth could be assigned into the categories including regulation of receptor binding, extracellular region, protein binding and extracellular space. Proteomic study revealed that 84 protein spots showed significant differences in expression levels. Of the 84, 63 protein spots were upregulated and 21 were downregulated in A/D. Finally, 55 protein points were determined through MALDI-TOF/MS analyses. Furthermore, the regulation mechanism of hair follicle might resemble that of fetation.

  20. Unifying expression scale for peptide hydrophobicity in proteomic reversed phase high-pressure liquid chromatography experiments.

    PubMed

    Grigoryan, Marine; Shamshurin, Dmitry; Spicer, Victor; Krokhin, Oleg V

    2013-11-19

    As an initial step in our efforts to unify the expression of peptide retention times in proteomic liquid chromatography-mass spectrometry (LC-MS) experiments, we aligned the chromatographic properties of a number of peptide retention standards against a collection of peptides commonly observed in proteomic experiments. The standard peptide mixtures and tryptic digests of samples of different origins were separated under the identical chromatographic condition most commonly employed in proteomics: 100 Å C18 sorbent with 0.1% formic acid as an ion-pairing modifier. Following our original approach (Krokhin, O. V.; Spicer, V. Anal. Chem. 2009, 81, 9522-9530) the retention characteristics of these standards and collection of tryptic peptides were mapped into hydrophobicity index (HI) or acetonitrile percentage units. This scale allows for direct visualization of the chromatographic outcome of LC-MS acquisitions, monitors the performance of the gradient LC system, and simplifies method development and interlaboratory data alignment. Wide adoption of this approach would significantly aid understanding the basic principles of gradient peptide RP-HPLC and solidify our collective efforts in acquiring confident peptide retention libraries, a key component in the development of targeted proteomic approaches.

  1. dbDEPC 2.0: updated database of differentially expressed proteins in human cancers

    PubMed Central

    He, Ying; Zhang, Menghuan; Ju, Yuanhu; Yu, Zhonghao; Lv, Daqing; Sun, Han; Yuan, Weilan; He, Fei; Zhang, Jianshe; Li, Hong; Li, Jing; Wang-Sattler, Rui; Li, Yixue; Zhang, Guoqing; Xie, Lu

    2012-01-01

    A large amount of differentially expressed proteins (DEPs) have been identified in various cancer proteomics experiments, curation and annotation of these proteins are important in deciphering their roles in oncogenesis and tumor progression, and may further help to discover potential protein biomarkers for clinical applications. In 2009, we published the first database of DEPs in human cancers (dbDEPCs). In this updated version of 2011, dbDEPC 2.0 has more than doubly expanded to over 4000 protein entries, curated from 331 experiments across 20 types of human cancers. This resource allows researchers to search whether their interested proteins have been reported changing in certain cancers, to compare their own proteomic discovery with previous studies, to picture selected protein expression heatmap across multiple cancers and to relate protein expression changes with aberrance in other genetic level. New important developments include addition of experiment design information, advanced filter tools for customer-specified analysis and a network analysis tool. We expect dbDEPC 2.0 to be a much more powerful tool than it was in its first release and can serve as reference to both proteomics and cancer researchers. dbDEPC 2.0 is available at http://lifecenter.sgst.cn/dbdepc/index.do. PMID:22096234

  2. Genetic Basis of Differential Heat Resistance between Two Species of Congeneric Freshwater Snails: Insights from Quantitative Proteomics and Base Substitution Rate Analysis.

    PubMed

    Mu, Huawei; Sun, Jin; Fang, Ling; Luan, Tiangang; Williams, Gray A; Cheung, Siu Gin; Wong, Chris K C; Qiu, Jian-Wen

    2015-10-02

    We compared the heat tolerance, proteomic responses to heat stress, and adaptive sequence divergence in the invasive snail Pomacea canaliculata and its noninvasive congener Pomacea diffusa. The LT50 of P. canaliculata was significantly higher than that of P. diffusa. More than 3350 proteins were identified from the hepatopancreas of the snails exposed to acute and chronic thermal stress using iTRAQ-coupled mass spectrometry. Acute exposure (3 h exposure at 37 °C with 25 °C as control) resulted in similar numbers (27 in P. canaliculata and 23 in P. diffusa) of differentially expressed proteins in the two species. Chronic exposure (3 weeks of exposure at 35 °C with 25 °C as control) caused differential expression of more proteins (58 in P. canaliculata and 118 in P. diffusa), with many of them related to restoration of damaged molecules, ubiquitinating dysfunctional molecules, and utilization of energy reserves in both species; but only in P. diffusa was there a shift from carbohydrate to lipid catabolism. Analysis of orthologous genes encoding the differentially expressed proteins revealed two genes having clear evidence of positive selection (Ka/Ks > 1) and seven candidates for more detailed analysis of positive selection (Ka/Ks between 0.5 and 1). These nine genes are related to energy metabolism, cellular oxidative homeostasis, signaling, and binding processes. Overall, the proteomic and base substitution rate analyses indicate genetic basis of differential resistance to heat stress between the two species, and such differences could affect their further range expansion in a warming climate.

  3. Comparative Proteomics and Expression Analysis of Five Genes in Epicauta chinensis Larvae from the First to Fifth Instar

    PubMed Central

    Li, Qiurong; Wang, Dun; Lv, Shumin; Zhang, Yalin

    2014-01-01

    Blister beetle is an important insect model for both medicinal and pure research. Previous research has mainly focused on its biology and biochemistry, but very little data is yet available in the molecular biology. This study uses differential proteomics technology to analyze the soluble proteins extracted from each of the 5 instars larvae of Epicauta chinensis. 42 of the differentially-expressed proteins were identified successfully by MALDI-TOF/TOF-MS. Some of these proteins’ function and their expression profiles are analyzed. Our analysis revealed dynamics regulation of the following proteins: Axin-like protein pry-1 (APR-1), dihydrolipoyl dehydrogenase (DLD), vitellogenin (Vg) and lysozyme C (Lmz-S). APR-1 negatively regulates the Wnt signaling pathway. Its overexpression could result in embryo, leg, eye and ovary ectopica or malformation. DLD catalyzes the pyruvate into acetyl-CoA, the latter is the starting material of juvenile hormone (JH) and ipsdienol biosynthesis through the MVA pathway in insects. While Vg synthesis can be regulated by JH and stimulated by food factors. So DLD may affect the synthesis of JH, ipsdienol and Vg indirectly. The activity of lysozyme is an indicator of the immunity. Nutrition/food should be taken into account for its potential role during the development of larva in the future. Among the five genes and their corresponding proteins’ expression, only hsc70 gene showed a good correspondence with the protein level. This reflects the fluctuating relationship between mRNA and protein levels. PMID:24586908

  4. Differential lysine acetylation profiles of Erwinia amylovora strains revealed by proteomics.

    PubMed

    Wu, Xia; Vellaichamy, Adaikkalam; Wang, Dongping; Zamdborg, Leonid; Kelleher, Neil L; Huber, Steven C; Zhao, Youfu

    2013-02-21

    Protein lysine acetylation (LysAc) has recently been demonstrated to be widespread in E. coli and Salmonella, and to broadly regulate bacterial physiology and metabolism. However, LysAc in plant pathogenic bacteria is largely unknown. Here we first report the lysine acetylome of Erwinia amylovora, an enterobacterium causing serious fire blight disease of apples and pears. Immunoblots using generic anti-lysine acetylation antibodies demonstrated that growth conditions strongly affected the LysAc profiles in E. amylovora. Differential LysAc profiles were also observed for two E. amylovora strains, known to have differential virulence in plants, indicating translational modification of proteins may be important in determining virulence of bacterial strains. Proteomic analysis of LysAc in two E. amylovora strains identified 141 LysAc sites in 96 proteins that function in a wide range of biological pathways. Consistent with previous reports, 44% of the proteins are involved in metabolic processes, including central metabolism, lipopolysaccharide, nucleotide and amino acid metabolism. Interestingly, for the first time, several proteins involved in E. amylovora virulence, including exopolysaccharide amylovoran biosynthesis- and type III secretion-associated proteins, were found to be lysine acetylated, suggesting that LysAc may play a major role in bacterial virulence. Comparative analysis of LysAc sites in E. amylovora and E. coli further revealed the sequence and structural commonality for LysAc in the two organisms. Collectively, these results reinforce the notion that LysAc of proteins is widespread in bacterial metabolism and virulence.

  5. Differential proteins of the optic ganglion in octopus vulgaris under methanol stress revealed using proteomics.

    PubMed

    Huang, Lin; Huang, Qing-Yu; Chen, Hai-Bin; Huang, Fu-Sheng; Huang, He-Qing

    2011-10-01

    An analytical approach using the two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) technique separated the proteome from the optic ganglia of Octopus vulgaris (OVOG). Approximately 600 protein spots were detected from the extraction when applying 150 μg protein to a 2D-PAGE gel in the pH range 5.0-8.0. Compared to the control, significant changes of 18 protein spots were observed in OVOG under the stress of native seawater containing 2% methanol for 72 h. Among these spots, we found that eight were down-regulated and ten were up-regulated in the gels, which were further identified using both peptide mass fingerprinting and database searches. Significant proteins such as glyceraldehyde-3-phosphate dehydrogenase, alpha subunit of succinyl-CoA synthetase, alcohol dehydrogenase, and long-chain specific acyl-CoA dehydrogenase were up-regulated proteins, whereas putative ABC transporter was a down -regulated protein. These differential proteins at the level of subcellular localization were further classified using LOCtree software with a hierarchical system of support vector machines. We found that most of the differential proteins in the gel could be identified as mitochondrial proteins, suggesting that these protective or marker proteins might help to prevent methanol poisoning via the mitochondria in the optical ganglia. The results indicated that both beta-tubulin and beta-actin were potential biomarkers as up-regulated proteins for monitoring methanol toxicosis associated with fish foods such as octopus and shark.

  6. A High Efficiency Cloning and Expression System for Proteomic Analysis

    DTIC Science & Technology

    2006-03-19

    Research, Rockville, MD, USA 0 U.a . The recent description of the complete genomes of the two most pathogenic species of Brucella Received: Januarp9...level high-efficiency cloning and expression system (HECES) that Accepted: March 19, 2006 allow expression of large numbers of Brucella proteins based...method will allow selection of new reagents for diagnosis of bru- cellosis and development of vaccine against Brucella , an important zoonotic disease and

  7. Differential Proteomic Analysis by iTRAQ Reveals the Mechanism of Pyropia haitanensis Responding to High Temperature Stress

    PubMed Central

    Shi, Jianzhi; Chen, Yuting; Xu, Yan; Ji, Dehua; Chen, Changsheng; Xie, Chaotian

    2017-01-01

    Global warming increases sea temperature and leads to high temperature stress, which affects the yield and quality of Pyropia haitanensis. To understand the molecular mechanisms underlying high temperature stress in a high temperature tolerance strain Z-61, the iTRAQ technique was employed to reveal the global proteomic response of Z-61 under different durations of high temperature stress. We identified 151 differentially expressed proteins and classified them into 11 functional categories. The 4 major categories of these are protein synthesis and degradation, photosynthesis, defense response, and energy and carbohydrate metabolism. These findings indicated that photosynthesis, protein synthesis, and secondary metabolism are inhibited by heat to limit damage to a repairable level. As time progresses, misfolded proteins and ROS accumulate and lead to the up-regulation of molecular chaperones, proteases, and antioxidant systems. Furthermore, to cope with cells injured by heat, PCD works to remove them. Additionally, sulfur assimilation and cytoskeletons play essential roles in maintaining cellular and redox homeostasis. These processes are based on signal transduction in the phosphoinositide pathway and multiple ways to supply energy. Conclusively, Z-61 establishes a new steady-state balance of metabolic processes and survives under higher temperature stress. PMID:28303955

  8. Differential Proteomic Analysis by iTRAQ Reveals the Mechanism of Pyropia haitanensis Responding to High Temperature Stress.

    PubMed

    Shi, Jianzhi; Chen, Yuting; Xu, Yan; Ji, Dehua; Chen, Changsheng; Xie, Chaotian

    2017-03-17

    Global warming increases sea temperature and leads to high temperature stress, which affects the yield and quality of Pyropia haitanensis. To understand the molecular mechanisms underlying high temperature stress in a high temperature tolerance strain Z-61, the iTRAQ technique was employed to reveal the global proteomic response of Z-61 under different durations of high temperature stress. We identified 151 differentially expressed proteins and classified them into 11 functional categories. The 4 major categories of these are protein synthesis and degradation, photosynthesis, defense response, and energy and carbohydrate metabolism. These findings indicated that photosynthesis, protein synthesis, and secondary metabolism are inhibited by heat to limit damage to a repairable level. As time progresses, misfolded proteins and ROS accumulate and lead to the up-regulation of molecular chaperones, proteases, and antioxidant systems. Furthermore, to cope with cells injured by heat, PCD works to remove them. Additionally, sulfur assimilation and cytoskeletons play essential roles in maintaining cellular and redox homeostasis. These processes are based on signal transduction in the phosphoinositide pathway and multiple ways to supply energy. Conclusively, Z-61 establishes a new steady-state balance of metabolic processes and survives under higher temperature stress.

  9. A peptide identification-free, genome sequence-independent shotgun proteomics workflow for strain-level bacterial differentiation.

    PubMed

    Shao, Wenguang; Zhang, Min; Lam, Henry; Lau, Stanley C K

    2015-09-23

    Shotgun proteomics is an emerging tool for bacterial identification and differentiation. However, the identification of the mass spectra of peptides to genome-derived peptide sequences remains a key issue that limits the use of shotgun proteomics to bacteria with genome sequences available. In this proof-of-concept study, we report a novel bacterial fingerprinting method that enjoys the resolving power and accuracy of mass spectrometry without the burden of peptide identification (i.e. genome sequence-independent). This method uses a similarity-clustering algorithm to search for mass spectra that are derived from the same peptide and merge them into a unique consensus spectrum as the basis to generate proteomic fingerprints of bacterial isolates. In comparison to a traditional peptide identification-based shotgun proteomics workflow and a PCR-based DNA fingerprinting method targeting the repetitive extragenic palindromes elements in bacterial genomes, the novel method generated fingerprints that were richer in information and more discriminative in differentiating E. coli isolates by their animal sources. The novel method is readily deployable to any cultivable bacteria, and may be used for several fields of study such as environmental microbiology, applied microbiology, and clinical microbiology.

  10. A peptide identification-free, genome sequence-independent shotgun proteomics workflow for strain-level bacterial differentiation

    PubMed Central

    Shao, Wenguang; Zhang, Min; Lam, Henry; Lau, Stanley C. K.

    2015-01-01

    Shotgun proteomics is an emerging tool for bacterial identification and differentiation. However, the identification of the mass spectra of peptides to genome-derived peptide sequences remains a key issue that limits the use of shotgun proteomics to bacteria with genome sequences available. In this proof-of-concept study, we report a novel bacterial fingerprinting method that enjoys the resolving power and accuracy of mass spectrometry without the burden of peptide identification (i.e. genome sequence-independent). This method uses a similarity-clustering algorithm to search for mass spectra that are derived from the same peptide and merge them into a unique consensus spectrum as the basis to generate proteomic fingerprints of bacterial isolates. In comparison to a traditional peptide identification-based shotgun proteomics workflow and a PCR-based DNA fingerprinting method targeting the repetitive extragenic palindromes elements in bacterial genomes, the novel method generated fingerprints that were richer in information and more discriminative in differentiating E. coli isolates by their animal sources. The novel method is readily deployable to any cultivable bacteria, and may be used for several fields of study such as environmental microbiology, applied microbiology, and clinical microbiology. PMID:26395646

  11. A Proteomic Approach to Investigating Gene Cluster Expression and Secondary Metabolite Functionality in Aspergillus fumigatus

    PubMed Central

    Owens, Rebecca A.; Hammel, Stephen; Sheridan, Kevin J.; Jones, Gary W.; Doyle, Sean

    2014-01-01

    A combined proteomics and metabolomics approach was utilised to advance the identification and characterisation of secondary metabolites in Aspergillus fumigatus. Here, implementation of a shotgun proteomic strategy led to the identification of non-redundant mycelial proteins (n = 414) from A. fumigatus including proteins typically under-represented in 2-D proteome maps: proteins with multiple transmembrane regions, hydrophobic proteins and proteins with extremes of molecular mass and pI. Indirect identification of secondary metabolite cluster expression was also achieved, with proteins (n = 18) from LaeA-regulated clusters detected, including GliT encoded within the gliotoxin biosynthetic cluster. Biochemical analysis then revealed that gliotoxin significantly attenuates H2O2-induced oxidative stress in A. fumigatus (p>0.0001), confirming observations from proteomics data. A complementary 2-D/LC-MS/MS approach further elucidated significantly increased abundance (p<0.05) of proliferating cell nuclear antigen (PCNA), NADH-quinone oxidoreductase and the gliotoxin oxidoreductase GliT, along with significantly attenuated abundance (p<0.05) of a heat shock protein, an oxidative stress protein and an autolysis-associated chitinase, when gliotoxin and H2O2 were present, compared to H2O2 alone. Moreover, gliotoxin exposure significantly reduced the abundance of selected proteins (p<0.05) involved in de novo purine biosynthesis. Significantly elevated abundance (p<0.05) of a key enzyme, xanthine-guanine phosphoribosyl transferase Xpt1, utilised in purine salvage, was observed in the presence of H2O2 and gliotoxin. This work provides new insights into the A. fumigatus proteome and experimental strategies, plus mechanistic data pertaining to gliotoxin functionality in the organism. PMID:25198175

  12. Teaching expression proteomics: From the wet-lab to the laptop.

    PubMed

    Teixeira, Miguel C; Santos, Pedro M; Rodrigues, Catarina; Sá-Correia, Isabel

    2009-09-01

    Expression proteomics has become, in recent years, a key genome-wide expression approach in fundamental and applied life sciences. This postgenomic technology aims the quantitative analysis of all the proteins or protein forms (the so-called proteome) of a given organism in a given environmental and genetic context. It is a challenge to provide effective training in this area due to its demanding laboratory procedures and laborious computational data analysis. However, the effective training of undergraduates and postgraduates in this field is highly recommended to prepare them for the challenges of postgenomic research and of medical, industrial and other economical activities. Since 2004, the area of Biological Sciences at the Department of Chemical and Biological Engineering of Instituto Superior Técnico (IST) has been teaching Expression Proteomics to undergraduate and postgraduate students in three formats: 1) as modules of curricular units (CU), in particular of Functional Genomics and Bioinformatics (FGB), offered as a mandatory CU to IST Biological Engineering or Biotechnology Master courses students, or as an elective CU to other MSc courses with a biological component and to the MSc in Information Systems and Computer Engineering; the topic is also part of the PhD program in Biotechnology; 2) as mentored coaching, in which IST students integrate ongoing research programs at the Biological Sciences Research Group of IBB at IST; and 3) as intensive thematic courses open to the external community. In this article, educational programs and teaching methodologies and tools that we have been using are outlined, from the wet-lab to the laptop. The current role of quantitative proteomics in biological research, with emphasis on microbial stress response and on biomedical and biotechnological applications, is addressed, as a case-study, anchored on our group research activities.

  13. Quantitative proteomics of Xenopus laevis embryos: expression kinetics of nearly 4000 proteins during early development

    NASA Astrophysics Data System (ADS)

    Sun, Liangliang; Bertke, Michelle M.; Champion, Matthew M.; Zhu, Guijie; Huber, Paul W.; Dovichi, Norman J.

    2014-03-01

    While there is a rich literature on transcription dynamics during the development of many organisms, protein data is limited. We used iTRAQ isotopic labeling and mass spectrometry to generate the largest developmental proteomic dataset for any animal. Expression dynamics of nearly 4,000 proteins of Xenopus laevis was generated from fertilized egg to neurula embryo. Expression clusters into groups. The cluster profiles accurately reflect the major events that mark changes in gene expression patterns during early Xenopus development. We observed decline in the expression of ten DNA replication factors after the midblastula transition (MBT), including a marked decline of the licensing factor XCdc6. Ectopic expression of XCdc6 leads to apoptosis; temporal changes in this protein are critical for proper development. Measurement of expression in single embryos provided no evidence for significant protein heterogeneity between embryos at the same stage of development.

  14. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  15. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  16. Proteomic analysis of increased Parkin expression and its interactants provides evidence for a role in modulation of mitochondrial function.

    PubMed

    Davison, Eleanor J; Pennington, Kyla; Hung, Chao-Chun; Peng, Jianhe; Rafiq, Rumana; Ostareck-Lederer, Antje; Ostareck, Dirk H; Ardley, Helen C; Banks, Rosamonde E; Robinson, Philip A

    2009-09-01

    Parkin is an ubiquitin-protein ligase (E3), mutations of which cause juvenile onset - autosomal recessive Parkinson's disease, and result in reduced enzymic activity. In contrast, increased levels are protective against mitochondrial dysfunction and neurodegeneration, the mechanism of which is largely unknown. In this study, 2-DE and MS proteomic techniques were utilised to investigate the effects of increased Parkin levels on protein expression in whole cell lysates using in an inducible Parkin expression system in HEK293 cells, and also to isolate potential interactants of Parkin using tandem affinity purification and MS. Nine proteins were significantly differentially expressed (+/-2-fold change; p<0.05) using 2-DE analysis. MS revealed the identity of these proteins to be ACAT2, HNRNPK, HSPD1, PGK1, PRDX6, VCL, VIM, TPI1, and IMPDH2. The first seven of these were reduced in expression. Western blot analysis confirmed the reduction in one of these proteins (HNRNPK), and that its levels were dependent on 26S proteasomal activity. Tandem affinity purification/MS revealed 14 potential interactants of Parkin; CKB, DBT, HSPD1, HSPA9, LRPPRC, NDUFS2, PRDX6, SLC25A5, TPI1, UCHL1, UQCRC1, VCL, YWHAZ, YWHAE. Nine of these are directly involved in mitochondrial energy metabolism and glycolysis; four were also identified in the 2-DE study (HSP60, PRDX6, TPI1, and VCL). This study provides further evidence for a role for Parkin in regulating mitochondrial activity within cells.

  17. A high efficiency cloning and expression system for proteomic analysis.

    PubMed

    Ding, Xuan Z; Paulsen, Ian T; Bhattacharjee, Apurba K; Nikolich, Mikeljon P; Myers, Gary; Hoover, David L

    2006-07-01

    The recent description of the complete genomes of the two most pathogenic species of Brucella opens the way for genome-based analysis of the antigenicity of their proteins. In the present report, we describe a bench-level high-efficiency cloning and expression system (HECES) that allow expression of large numbers of Brucella proteins based on genomic sequence information. Purified proteins are produced with high efficiency in a microarray format conducive to analysis of their sero-reactivity against serum from immunized animals. This method is applicable at either small or large scale of protein processing. While it does not require robotics, the format is amenable to robotic implementation for all aspects of the process and subsequent analysis of protein characteristics. This method will allow selection of new reagents for diagnosis of brucellosis and development of vaccine against Brucella, an important zoonotic disease and biothreat agent.

  18. Clinical implications from proteomic studies in neurodegenerative diseases: lessons from mitochondrial proteins.

    PubMed

    Butterfield, D Allan; Palmieri, Erika M; Castegna, Alessandra

    2016-01-01

    Mitochondria play a key role in eukaryotic cells, being mediators of energy, biosynthetic and regulatory requirements of these cells. Emerging proteomics techniques have allowed scientists to obtain the differentially expressed proteome or the proteomic redox status in mitochondria. This has unmasked the diversity of proteins with respect to subcellular location, expression and interactions. Mitochondria have become a research 'hot spot' in subcellular proteomics, leading to identification of candidate clinical targets in neurodegenerative diseases in which mitochondria are known to play pathological roles. The extensive efforts to rapidly obtain differentially expressed proteomes and unravel the redox proteomic status in mitochondria have yielded clinical insights into the neuropathological mechanisms of disease, identification of disease early stage and evaluation of disease progression. Although current technical limitations hamper full exploitation of the mitochondrial proteome in neurosciences, future advances are predicted to provide identification of specific therapeutic targets for neurodegenerative disorders.

  19. Clinical implications from proteomic studies in neurodegenerative diseases: lessons from mitochondrial proteins

    PubMed Central

    Butterfield, D. Allan; Palmieri, Erika M.; Castegna, Alessandra

    2016-01-01

    Mitochondria play a key role in eukaryotic cells, being mediators of energy, biosynthetic and regulatory requirements of these cells. Emerging proteomics techniques have allowed scientists to obtain the differentially expressed proteome or the proteomic redox status in mitochondria. This has unmasked the diversity of proteins with respect to subcellular location, expression and interactions. Mitochondria have become a research ‘hot spot’ in subcellular proteomics, leading to identification of candidate clinical targets in neurodegenerative diseases in which mitochondria are known to play pathological roles. The extensive efforts to rapidly obtain differentially expressed proteomes and unravel the redox proteomic status in mitochondria have yielded clinical insights into the neuropathological mechanisms of disease, identification of disease early stage and evaluation of disease progression. Although current technical limitations hamper full exploitation of the mitochondrial proteome in neurosciences, future advances are predicted to provide identification of specific therapeutic targets for neurodegenerative disorders. PMID:26837425

  20. A proteomic chronology of gene expression through the cell cycle in human myeloid leukemia cells.

    PubMed

    Ly, Tony; Ahmad, Yasmeen; Shlien, Adam; Soroka, Dominique; Mills, Allie; Emanuele, Michael J; Stratton, Michael R; Lamond, Angus I

    2014-01-01

    Technological advances have enabled the analysis of cellular protein and RNA levels with unprecedented depth and sensitivity, allowing for an unbiased re-evaluation of gene regulation during fundamental biological processes. Here, we have chronicled the dynamics of protein and mRNA expression levels across a minimally perturbed cell cycle in human myeloid leukemia cells using centrifugal elutriation combined with mass spectrometry-based proteomics and RNA-Seq, avoiding artificial synchronization procedures. We identify myeloid-specific gene expression and variations in protein abundance, isoform expression and phosphorylation at different cell cycle stages. We dissect the relationship between protein and mRNA levels for both bulk gene expression and for over ∼6000 genes individually across the cell cycle, revealing complex, gene-specific patterns. This data set, one of the deepest surveys to date of gene expression in human cells, is presented in an online, searchable database, the Encyclopedia of Proteome Dynamics (http://www.peptracker.com/epd/). DOI: http://dx.doi.org/10.7554/eLife.01630.001.

  1. In-depth LC-MS/MS analysis of the chicken ovarian cancer proteome reveals conserved and novel differentially regulated proteins in humans

    PubMed Central

    Nepomuceno, Angelito I.; Shao, Huanjie; Jing, Kai; Ma, Yibao; Petitte, James N.; Idowu, Michael O.; Muddiman, David C.; Fang, Xianjun

    2017-01-01

    Ovarian cancer (OVC) remains the most lethal gynecological malignancy in the world due to the combined lack of early-stage diagnostics and effective therapeutic strategies. The development and application of advanced proteomics technology and new experimental models has created unique opportunities for translational studies. In this study, we investigated the ovarian cancer proteome of the chicken, an emerging experimental model of OVC that develops ovarian tumors spontaneously. Matched plasma, ovary, and oviduct tissue biospecimens derived from healthy, early-stage OVC, and late-stage OVC birds were quantitatively characterized by label-free proteomics. Over 2600 proteins were identified in this study, 348 of which were differentially expressed by more than twofold (p≤0.05) in early- and late-stage ovarian tumor tissue specimens relative to healthy ovarian tissues. Several of the 348 proteins are known to be differentially regulated in human cancers including B2M, CLDN3, EPCAM, PIGR, S100A6, S100A9, S100A11, and TPD52. Of particular interest was ovostatin 2 (OVOS2), a novel 165-kDa protease inhibitor found to be strongly upregulated in chicken ovarian tumors (p=0.0005) and matched plasma (p=0.003). Indeed, RT-quantitative PCR and Western blot analysis demonstrated that OVOS2 mRNA and protein were also upregulated in multiple human OVC cell lines compared to normal ovarian epithelia (NOE) cells and immunohistochemical staining confirmed overexpression of OVOS2 in primary human ovarian cancers relative to non-cancerous tissues. Collectively, these data provide the first evidence for involvement of OVOS2 in the pathogenesis of both chicken and human ovarian cancer. PMID:26159569

  2. High-specificity quantification method for almond-by-products, based on differential proteomic analysis.

    PubMed

    Zhang, Shiwei; Wang, Shifeng; Huang, Jingmin; Lai, Xintian; Du, Yegang; Liu, Xiaoqing; Li, Bifang; Feng, Ronghu; Yang, Guowu

    2016-03-01

    A highly specific competitive enzyme-linked immunosorbent assay (ELISA) protocol has been developed to identify and classify almond products based on differential proteomic analysis. We applied two-dimensional electrophoresis to compare the differences between almond and apricot kernels to search for almond-specific proteins. The amino acid of apricot Pru-1 was sequenced and aligned to almond Pru-1. One peptide, RQGRQQGRQQQEEGR, which exists in almond but not in apricot, was used as hapten to prepare monoclonal antibody against almond Pru-1. An optimized ELISA method was established using this antibody. The assay did not exhibit cross-reactivity with the tested apricot kernels and other edible plant seeds. The limit of detection (LOD) was 2.5-100μg/g based on different food samples. The recoveries of fortified samples at levels of twofold and eightfold LOD ranged from 82% to 96%. The coefficients of variation were less than 13.0%. Using 7M urea as extracting solution, the heat-treated protein loss ratios were 2%, 5% and 15% under pasteurization (65°C for 30min), baking (150°C for 30min) and autoclaved sterilization (120°C for 15min), respectively.

  3. Detection of Structural and Metabolic Changes in Traumatically Injured Hippocampus by Quantitative Differential Proteomics

    PubMed Central

    Wu, Ping; Zhao, Yingxin; Haidacher, Sigmund J.; Wang, Enyin; Parsley, Margaret O.; Gao, Junling; Sadygov, Rovshan G.; Starkey, Jonathan M.; Luxon, Bruce A.; Spratt, Heidi; DeWitt, Douglas S.; Prough, Donald S.

    2013-01-01

    Abstract Traumatic brain injury (TBI) is a complex and common problem resulting in the loss of cognitive function. In order to build a comprehensive knowledge base of the proteins that underlie these cognitive deficits, we employed unbiased quantitative mass spectrometry, proteomics, and bioinformatics to identify and quantify dysregulated proteins in the CA3 subregion of the hippocampus in the fluid percussion model of TBI in rats. Using stable isotope 18O-water differential labeling and multidimensional tandem liquid chromatography (LC)-MS/MS with high stringency statistical analyses and filtering, we identified and quantified 1002 common proteins, with 124 increased and 76 decreased. The Ingenuity Pathway Analysis (IPA) bioinformatics tool identified that TBI had profound effects on downregulating global energy metabolism, including glycolysis, the Krebs cycle, and oxidative phosphorylation, as well as cellular structure and function. Widespread upregulation of actin-related cytoskeletal dynamics was also found. IPA indicated a common integrative signaling node, calcineurin B1 (CANB1, CaNBα, or PPP3R1), which was downregulated by TBI. Western blotting confirmed that the calcineurin regulatory subunit, CANB1, and its catalytic binding partner PP2BA, were decreased without changes in other calcineurin subunits. CANB1 plays a critical role in downregulated networks of calcium signaling and homeostasis through calmodulin and calmodulin-dependent kinase II to highly interconnected structural networks dominated by tubulins. This large-scale knowledge base lays the foundation for the identification of novel therapeutic targets for cognitive rescue in TBI. PMID:22757692

  4. Differential Proteomics of Urinary Exovesicles from Classical Galactosemic Patients Reveals Subclinical Kidney Insufficiency.

    PubMed

    Staubach, Simon; Pekmez, Murat; Hanisch, Franz-Georg

    2016-06-03

    Classical galactosemia is caused by a nearly complete deficiency of galactose-1-phosphate uridyltransferase (GALT; EC 2.7.712), resulting in a severely impaired galactose metabolism with galactose-1-phosphate and galactitol accumulation. Even on a galactose-restricted diet, patients develop serious long-term complications of the central nervous system and ovaries that may result from chronic cell-toxic effects exerted by endogenous galactose. To address the question of whether disease-associated cellular perturbations could affect the kidney function of the patients, we performed differential proteomics of detergent-resistant membranes from urinary exovesicles. Galactosemic samples (showing drastic shifts from high-mannose to complex-type N-glycosylation on exosomal N-glycoproteins) and healthy, sex-matched controls were analyzed in quadruplex iTRAQ experiments performed in biological and technical replicates. Particularly in the female patient group, the most striking finding was a drastic increase of abundant serum (glyco)proteins, like albumin, leucine-rich α-2-glycoprotein, fetuin, immunoglobulins, prostaglandin H2 d-isomerase, and α-1-microglobulin protein (AMBP), pointing to a subclinical failure of kidney filter function in galactosemic patients and resulting in a heavy overload of exosomal membranes with adsorbed serum (glyco)proteins. Several of these proteins are connected to TBMN and IgAN, proteinuria, and renal damage. The impairment of renal protein filtration was also indicated by increased protein contents derived from extracellular matrices and lysosomes.

  5. Differential abundance of sarcoplasmic proteome explains animal effect on beef Longissimus lumborum color stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sarcoplasmic proteome of beef Longissimus lumborum demonstrating animal-to-animal variation in color stability was examined to correlate proteome profile with color. Longissimus lumborum (36 h post-mortem) muscles were obtained from 73 beef carcasses, aged for 13 days, and fabricated to 2.5-cm s...

  6. Functional and differential proteomic analyses to identify platelet derived factors affecting ex vivo expansion of mesenchymal stromal cells

    PubMed Central

    2013-01-01

    Background Multilineage differentiation, immunomodulation and secretion of trophic factors render mesenchymal stromal cells (MSC) highly attractive for clinical application. Human platelet derivatives such as pooled human platelet lysate (pHPL) and thrombin-activated platelet releasate in plasma (tPRP) have been introduced as alternatives to fetal bovine serum (FBS) to achieve GMP-compliance. However, whereas both pHPL and tPRP support similar proliferation kinetics of lipoaspirate-derived MSC (LA-MSC), only pHPL significantly accelerates bone marrow-derived MSC (BM-MSC) expansion. To identify functionally bioactive factors affecting ex vivo MSC expansion, a differential proteomic approach was performed and identified candidate proteins were evaluated within a bioassay. Results Two dimensional difference gel electrophoresis (2D-DIGE), MALDI-TOF analyses and complementary Western blotting revealed 20 differential protein species. 14 candidate proteins occured at higher concentrations in pHPL compared to tPRP and 6 at higher concentrations in tPRP. The candidate proteins fibrinogen and apolipoprotein A1 differentially affected LA- and BM-MSC proliferation. In a second set of experiments, reference cytokines known to foster proliferation in FBS were tested for their effects in the human supplements. Interestingly although these cytokines promoted proliferation in FBS, they failed to do so when added to the humanized system. Conclusions The differential proteomic approach identified novel platelet derived factors differentially acting on human MSC proliferation. Complementary testing of reference cytokines revealed a lack of stimulation in the human supplements compared to FBS. The data describe a new coherent approach to combine proteomic technologies with functional testing to develop novel, humanized, GMP-compliant conditions for MSC expansion. PMID:24168020

  7. Primer: Shotgun Proteomics in Neuroscience

    PubMed Central

    Liao, Lujian; McClatchy, Daniel B.; Yates, John R.

    2009-01-01

    Mass spectrometry-based proteomics is increasingly used to address basic and clinical questions in biomedical research through studies of differential protein expression, protein-protein interactions, and post-translational modifications. The complex structural and functional organization of the human brain warrants the application of high-throughput, systematic approaches to understand the functional alterations under normal physiological conditions and the perturbations of neurological diseases. This primer focuses on shotgun proteomics based tandem mass spectrometry for the identification of proteins in a complex mixture. It describes the basic concepts of protein differential expression analysis and post-translational modification analysis and discusses several strategies to improve the coverage of the proteome. PMID:19607789

  8. The Effect of Pericellular Oxygen Levels on Proteomic Profile and Lipogenesis in 3T3-L1 Differentiated Preadipocytes Cultured on Gas-Permeable Cultureware.

    PubMed

    Weiszenstein, Martin; Pavlikova, Nela; Elkalaf, Moustafa; Halada, Petr; Seda, Ondrej; Trnka, Jan; Kovar, Jan; Polak, Jan

    2016-01-01

    Pericellular oxygen concentration represents an important factor in the regulation of cell functions, including cell differentiation, growth and mitochondrial energy metabolism. Hypoxia in adipose tissue has been associated with altered adipokine secretion profile and suggested as a possible factor in the development of type 2 diabetes. In vitro experiments provide an indispensable tool in metabolic research, however, physical laws of gas diffusion make prolonged exposure of adherent cells to desired pericellular O2 concentrations questionable. The aim of this study was to investigate the direct effect of various O2 levels (1%, 4% and 20% O2) on the proteomic profile and triglyceride accumulation in 3T3-L1 differentiated preadipocytes using gas-permeable cultureware. Following differentiation of cells under desired pericellular O2 concentrations, cell lysates were subjected to two-dimensional gel electrophoresis and protein visualization using Coomassie blue staining. Spots showing differential expression under hypoxia were analyzed using matrix-assisted laser desorption/ionization mass spectrometry. All identified proteins were subjected to pathway analysis. We observed that protein expression of 26 spots was reproducibly affected by 4% and 1% O2 (17 upregulated and 9 downregulated). Pathway analysis showed that mitochondrial energy metabolism and triglyceride synthesis were significantly upregulated by hypoxia. In conclusion, this study demonstrated the direct effects of pericellular O2 levels on adipocyte energy metabolism and triglyceride synthesis, probably mediated through the reversed tricarboxylic acid cycle flux.

  9. The Effect of Pericellular Oxygen Levels on Proteomic Profile and Lipogenesis in 3T3-L1 Differentiated Preadipocytes Cultured on Gas-Permeable Cultureware

    PubMed Central

    Weiszenstein, Martin; Pavlikova, Nela; Elkalaf, Moustafa; Halada, Petr; Seda, Ondrej; Trnka, Jan; Kovar, Jan; Polak, Jan

    2016-01-01

    Pericellular oxygen concentration represents an important factor in the regulation of cell functions, including cell differentiation, growth and mitochondrial energy metabolism. Hypoxia in adipose tissue has been associated with altered adipokine secretion profile and suggested as a possible factor in the development of type 2 diabetes. In vitro experiments provide an indispensable tool in metabolic research, however, physical laws of gas diffusion make prolonged exposure of adherent cells to desired pericellular O2 concentrations questionable. The aim of this study was to investigate the direct effect of various O2 levels (1%, 4% and 20% O2) on the proteomic profile and triglyceride accumulation in 3T3-L1 differentiated preadipocytes using gas-permeable cultureware. Following differentiation of cells under desired pericellular O2 concentrations, cell lysates were subjected to two-dimensional gel electrophoresis and protein visualization using Coomassie blue staining. Spots showing differential expression under hypoxia were analyzed using matrix-assisted laser desorption/ionization mass spectrometry. All identified proteins were subjected to pathway analysis. We observed that protein expression of 26 spots was reproducibly affected by 4% and 1% O2 (17 upregulated and 9 downregulated). Pathway analysis showed that mitochondrial energy metabolism and triglyceride synthesis were significantly upregulated by hypoxia. In conclusion, this study demonstrated the direct effects of pericellular O2 levels on adipocyte energy metabolism and triglyceride synthesis, probably mediated through the reversed tricarboxylic acid cycle flux. PMID:27023342

  10. Proteome-wide characterization of sugarbeet seed vigor and its tissue specific expression

    PubMed Central

    Catusse, Julie; Strub, Jean-Marc; Job, Claudette; Van Dorsselaer, Alain; Job, Dominique

    2008-01-01

    Proteomic analysis of mature sugarbeet seeds led to the identification of 759 proteins and their specific tissue expression in root, cotyledons, and perisperm. In particular, the proteome of the perispermic storage tissue found in many seeds of the Caryophyllales is described here. The data allowed us to reconstruct in detail the metabolism of the seeds toward recapitulating facets of seed development and provided insights into complex behaviors such as germination. The seed appears to be well prepared to mobilize the major classes of reserves (the proteins, triglycerides, phytate, and starch) during germination, indicating that the preparation of the seed for germination is mainly achieved during its maturation on the mother plant. Furthermore, the data revealed several pathways that can contribute to seed vigor, an important agronomic trait defined as the potential to produce vigorous seedlings, such as glycine betaine accumulation in seeds. This study also identified several proteins that, to our knowledge, have not previously been described in seeds. For example, the data revealed that the sugarbeet seed can initiate translation either through the traditional cap-dependent mechanism or by a cap-independent process. The study of the tissue specificity of the seed proteome demonstrated a compartmentalization of metabolic activity between the roots, cotyledons, and perisperm, indicating a division of metabolic tasks between the various tissues. Furthermore, the perisperm, although it is known as a dead tissue, appears to be very active biochemically, playing multiple roles in distributing sugars and various metabolites to other tissues of the embryo. PMID:18635686

  11. Lupus anti-ribosomal P autoantibody proteomes express convergent biclonal signatures.

    PubMed

    Al Kindi, M A; Colella, A D; Beroukas, D; Chataway, T K; Gordon, T P

    2016-04-01

    Lupus-specific anti-ribosomal P (anti-Rib-P) autoantibodies have been implicated in the pathogenesis of neurological complications in systemic lupus erythematosus (SLE). The aim of the present study was to determine variable (V)-region signatures of secreted autoantibody proteomes specific for the Rib-P heterocomplex and investigate the molecular basis of the reported cross-reactivity with Sm autoantigen. Anti-Rib-P immunoglobulins (IgGs) were purified from six anti-Rib-P-positive sera by elution from enzyme-linked immunosorbent assay (ELISA) plates coated with either native Rib-P proteins or an 11-amino acid peptide (11-C peptide) representing the conserved COOH-terminal P epitope. Rib-P- and 11-C peptide-specific IgGs were analysed for heavy (H) and light (L) chain clonality and V-region expression using an electrophoretic and de-novo and database-driven mass spectrometric sequencing workflow. Purified anti-Rib-P and anti-SmD IgGs were tested for cross-reactivity on ELISA and their proteome data sets analysed for shared clonotypes. Anti-Rib-P autoantibody proteomes were IgG1 kappa-restricted and comprised two public clonotypes defined by unique H/L chain pairings. The major clonotypic population was specific for the common COOH-terminal epitope, while the second shared the same pairing signature as a recently reported anti-SmD clonotype, accounting for two-way immunoassay cross-reactivity between these lupus autoantibodies. Sequence convergence of anti-Rib-P proteomes suggests common molecular pathways of autoantibody production and identifies stereotyped clonal populations that are thought to play a pathogenic role in neuropsychiatric lupus. Shared clonotypic structures for anti-Rib-P and anti-Sm responses suggest a common B cell clonal origin for subsets of these lupus-specific autoantibodies.

  12. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  13. 2D-DIGE-based proteome expression changes in leaves of rice seedlings exposed to low-level gamma radiation at Iitate village, Fukushima.

    PubMed

    Hayashi, Gohei; Moro, Carlo F; Rohila, Jai Singh; Shibato, Junko; Kubo, Akihiro; Imanaka, Tetsuji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Hori, Motohide; Fukumoto, Manabu; Rakwal, Randeep

    2015-01-01

    The present study continues our previous research on investigating the biological effects of low-level gamma radiation in rice at the heavily contaminated Iitate village in Fukushima, by extending the experiments to unraveling the leaf proteome. 14-days-old plants of Japonica rice (Oryza sativa L. cv. Nipponbare) were subjected to gamma radiation level of upto 4 µSv/h, for 72 h. Following exposure, leaf samples were taken from the around 190 µSv/3 d exposed seedling and total proteins were extracted. The gamma irradiated leaf and control leaf (harvested at the start of the experiment) protein lysates were used in a 2-D differential gel electrophoresis (2D-DIGE) experiment using CyDye labeling in order to asses which spots were differentially represented, a novelty of the study. 2D-DIGE analysis revealed 91 spots with significantly different expression between samples (60 positive, 31 negative). MALDI-TOF and TOF/TOF mass spectrometry analyses revealed those as comprising of 59 different proteins (50 up-accumulated, 9 down-accumulated). The identified proteins were subdivided into 10 categories, according to their biological function, which indicated that the majority of the differentially expressed proteins consisted of the general (non-energy) metabolism and stress response categories. Proteome-wide data point to some effects of low-level gamma radiation exposure on the metabolism of rice leaves.

  14. 2D-DIGE-based proteome expression changes in leaves of rice seedlings exposed to low-level gamma radiation at Iitate village, Fukushima

    PubMed Central

    Hayashi, Gohei; Moro, Carlo F; Rohila, Jai Singh; Shibato, Junko; Kubo, Akihiro; Imanaka, Tetsuji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Hori, Motohide; Fukumoto, Manabu; Rakwal, Randeep

    2015-01-01

    The present study continues our previous research on investigating the biological effects of low-level gamma radiation in rice at the heavily contaminated Iitate village in Fukushima, by extending the experiments to unraveling the leaf proteome. 14-days-old plants of Japonica rice (Oryza sativa L. cv. Nipponbare) were subjected to gamma radiation level of upto 4 µSv/h, for 72 h. Following exposure, leaf samples were taken from the around 190 µSv/3 d exposed seedling and total proteins were extracted. The gamma irradiated leaf and control leaf (harvested at the start of the experiment) protein lysates were used in a 2-D differential gel electrophoresis (2D-DIGE) experiment using CyDye labeling in order to asses which spots were differentially represented, a novelty of the study. 2D-DIGE analysis revealed 91 spots with significantly different expression between samples (60 positive, 31 negative). MALDI-TOF and TOF/TOF mass spectrometry analyses revealed those as comprising of 59 different proteins (50 up-accumulated, 9 down-accumulated). The identified proteins were subdivided into 10 categories, according to their biological function, which indicated that the majority of the differentially expressed proteins consisted of the general (non-energy) metabolism and stress response categories. Proteome-wide data point to some effects of low-level gamma radiation exposure on the metabolism of rice leaves. PMID:26451896

  15. Deep immune profiling by mass cytometry links human T and NK cell differentiation and cytotoxic molecule expression patterns.

    PubMed

    Bengsch, Bertram; Ohtani, Takuya; Herati, Ramin Sedaghat; Bovenschen, Niels; Chang, Kyong-Mi; Wherry, E John

    2017-03-19

    The elimination of infected or tumor cells by direct lysis is a key T and NK cell effector function. T and NK cells can kill target cells by coordinated secretion of cytotoxic granules containing one or both pore-forming proteins, perforin and granulysin and combinations of granzyme (Gzm) family effector proteases (in humans: Gzm A, B, K, M and H). Understanding the pattern of expression of cytotoxic molecules and the relationship to different states of T and NK cells may have direct relevance for immune responses in autoimmunity, infectious disease and cancer. Approaches capable of simultaneously evaluating expression of multiple cytotoxic molecules with detailed information on T and NK differentiation state, however, remain limited. Here, we established a high dimensional mass cytometry approach to comprehensively interrogate single cell proteomic expression of cytotoxic programs and lymphocyte differentiation. This assay identified a coordinated expression pattern of cytotoxic molecules linked to CD8 T cell differentiation stages. Coordinated high expression of perforin, granulysin, Gzm A, Gzm B and Gzm M was associated with markers of late effector memory differentiation and expression of chemokine receptor CX3CR1. However, classical gating and dimensionality reduction approaches also identified other discordant patterns of cytotoxic molecule expression in CD8 T cells, including reduced perforin, but high Gzm A, Gzm K and Gzm M expression. When applied to non-CD8 T cells, this assay identified different patterns of cytotoxic molecule co-expression by CD56(hi) versus CD56(dim) defined NK cell developmental stages; in CD4 T cells, low expression of cytotoxic molecules was found mainly in TH1 phenotype cells, but not in Tregs or T follicular helper cells (TFH). Thus, this comprehensive, single cell, proteomic assessment of cytotoxic protein co-expression patterns demonstrates specialized cytotoxic programs in T cells and NK cells linked to their differentiation

  16. Natural Genetic Variation Differentially Affects the Proteome and Transcriptome in Caenorhabditis elegans.

    PubMed

    Kamkina, Polina; Snoek, L Basten; Grossmann, Jonas; Volkers, Rita J M; Sterken, Mark G; Daube, Michael; Roschitzki, Bernd; Fortes, Claudia; Schlapbach, Ralph; Roth, Alexander; von Mering, Christian; Hengartner, Michael O; Schrimpf, Sabine P; Kammenga, Jan E

    2016-05-01

    Natural genetic variation is the raw material of evolution and influences disease development and progression. An important question is how this genetic variation translates into variation in protein abundance. To analyze the effects of the genetic background on gene and protein expression in the nematode Caenorhabditis elegans, we quantitatively compared the two genetically highly divergent wild-type strains N2 and CB4856. Gene expression was analyzed by microarray assays, and proteins were quantified using stable isotope labeling by amino acids in cell culture. Among all transcribed genes, we found 1,532 genes to be differentially transcribed between the two wild types. Of the total 3,238 quantified proteins, 129 proteins were significantly differentially expressed between N2 and CB4856. The differentially expressed proteins were enriched for genes that function in insulin-signaling and stress-response pathways, underlining strong divergence of these pathways in nematodes. The protein abundance of the two wild-type strains correlates more strongly than protein abundance versus transcript abundance within each wild type. Our findings indicate that in C. elegans only a fraction of the changes in protein abundance can be explained by the changes in mRNA abundance. These findings corroborate with the observations made across species.

  17. Proteomics of Plant Pathogenic Fungi

    PubMed Central

    González-Fernández, Raquel; Prats, Elena; Jorrín-Novo, Jesús V.

    2010-01-01

    Plant pathogenic fungi cause important yield losses in crops. In order to develop efficient and environmental friendly crop protection strategies, molecular studies of the fungal biological cycle, virulence factors, and interaction with its host are necessary. For that reason, several approaches have been performed using both classical genetic, cell biology, and biochemistry and the modern, holistic, and high-throughput, omic techniques. This work briefly overviews the tools available for studying Plant Pathogenic Fungi and is amply focused on MS-based Proteomics analysis, based on original papers published up to December 2009. At a methodological level, different steps in a proteomic workflow experiment are discussed. Separate sections are devoted to fungal descriptive (intracellular, subcellular, extracellular) and differential expression proteomics and interactomics. From the work published we can conclude that Proteomics, in combination with other techniques, constitutes a powerful tool for providing important information about pathogenicity and virulence factors, thus opening up new possibilities for crop disease diagnosis and crop protection. PMID:20589070

  18. Microfluidic chips for protein differential expression profiling.

    PubMed

    Armenta, Jenny M; Dawoud, Abdulilah A; Lazar, Iulia M

    2009-04-01

    Biomarker discovery and screening using novel proteomic technologies is an area that is attracting increased attention in the biomedical community. Early detection of abnormal physiological conditions will be highly beneficial for diagnosing various diseases and increasing survivability rates. Clearly, progress in this area will depend on the development of fast, reliable, and highly sensitive and specific sample bioanalysis methods. Microfluidics has emerged as a technology that could become essential in proteomics research as it enables the integration of all sample preparation, separation, and detection steps, with the added benefit of enhanced sample throughput. The combination of these advantages with the sensitivity and capability of MS detection to deliver precise structural information makes microfluidics-MS a very competitive technology for biomarker discovery. The integration of LC microchip devices with MS detection, and specifically their applicability to biomarker screening applications in MCF-7 breast cancer cellular extracts is reported in this manuscript. Loading approximately 0.1-1 microg of crude protein extract tryptic digest on the chip has typically resulted in the reliable identification of approximately 40-100 proteins. The potential of an LC-ESI-MS chip for comparative proteomic analysis of isotopically labeled MCF-7 breast cancer cell extracts is explored for the first time.

  19. Integrated Analysis of Transcriptomic and Proteomic Datasets Reveals Information on Protein Expressivity and Factors Affecting Translational Efficiency.

    PubMed

    Wang, Jiangxin; Wu, Gang; Chen, Lei; Zhang, Weiwen

    2016-01-01

    Integrated analysis of large-scale transcriptomic and proteomic data can provide important insights into the metabolic mechanisms underlying complex biological systems. In this chapter, we present methods to address two aspects of issues related to integrated transcriptomic and proteomic analysis. First, due to the fact that proteomic datasets are often incomplete, and integrated analysis of partial proteomic data may introduce significant bias. To address these issues, we describe a zero-inflated Poisson (ZIP)-based model to uncover the complicated relationships between protein abundances and mRNA expression levels, and then apply them to predict protein abundance for the proteins not experimentally detected. The ZIP model takes into consideration the undetected proteins by assuming that there is a probability mass at zero representing expressed proteins that were undetected owing to technical limitations. The model validity is demonstrated using biological information of operons, regulons, and pathways. Second, weak correlation between transcriptomic and proteomic datasets is often due to biological factors affecting translational processes. To quantify the effects of these factors, we describe a multiple regression-based statistical framework to quantitatively examine the effects of various translational efficiency-related sequence features on mRNA-protein correlation. Using the datasets from sulfate-reducing bacteria Desulfovibrio vulgaris, the analysis shows that translation-related sequence features can contribute up to 15.2-26.2% of the total variation of the correlation between transcriptomic and proteomic datasets, and also reveals the relative importance of various features in translation process.

  20. Proteomic analysis of human hepatoma cells expressing methionine adenosyltransferase I/III☆

    PubMed Central

    Schröder, Paul C.; Fernández-Irigoyen, Joaquín; Bigaud, Emilie; Serna, Antonio; Renández-Alcoceba, Rubén; Lu, Shelly C.; Mato, José M.; Prieto, Jesús; Corrales, Fernando J.

    2015-01-01

    Methionine adenosyltransferase I/III (MATI/III) synthesizes S-adenosylmethionine (SAM) in quiescent hepatocytes. Its activity is compromised in most liver diseases including liver cancer. Since SAM is a driver of hepatocytes fate we have studied the effect of re-expressing MAT1A in hepatoma Huh7 cells using proteomics. MAT1A expression leads to SAM levels close to those found in quiescent hepatocytes and induced apoptosis. Normalization of intracellular SAM induced alteration of 128 proteins identified by 2D-DIGE and gel-free methods, accounting for deregulation of central cellular functions including apoptosis, cell proliferation and survival. Human Dead-box protein 3 (DDX3X), a RNA helicase regulating RNA splicing, export, transcription and translation was down-regulated upon MAT1A expression. Our data support the regulation of DDX3X levels by SAM in a concentration and time dependent manner. Consistently, DDX3X arises as a primary target of SAM and a principal intermediate of its antitumoral effect. Based on the parallelism between SAM and DDX3X along the progression of liver disorders, and the results reported here, it is tempting to suggest that reduced SAM in the liver may lead to DDX3X up-regulation contributing to the pathogenic process and that replenishment of SAM might prove to have beneficial effects, at least in part by reducing DDX3X levels. This article is part of a Special Issue entitled: Proteomics: The clinical link. PMID:22270009

  1. Differential diagnosis of azoospermia with proteomic biomarkers ECM1 and TEX101 quantified in seminal plasma.

    PubMed

    Drabovich, Andrei P; Dimitromanolakis, Apostolos; Saraon, Punit; Soosaipillai, Antoninus; Batruch, Ihor; Mullen, Brendan; Jarvi, Keith; Diamandis, Eleftherios P

    2013-11-20

    Male fertility problems range from diminished production of sperm, or oligozoospermia, to nonmeasurable levels of sperm in semen, or azoospermia, which is diagnosed in nearly 2% of men in the general population. Testicular biopsy is the only definitive diagnostic method to distinguish between obstructive (OA) and nonobstructive (NOA) azoospermia and to identify the NOA subtypes of hypospermatogenesis, maturation arrest and Sertoli cell-only syndrome. We measured by selected reaction monitoring assay 18 biomarker candidates in 119 seminal plasma samples from men with normal spermatogenesis and azoospermia, and identified two proteins, epididymis-expressed ECM1 and testis-expressed TEX101, which differentiated OA and NOA with high specificities and sensitivities. The performance of ECM1 was confirmed by enzyme-linked immunosorbent assay. On the basis of a cutoff level of 2.3 μg/ml derived from the current data, we could distinguish OA from normal spermatogenesis with 100% specificity, and OA from NOA with 73% specificity, at 100% sensitivity. Immunohistochemistry and an immunoenrichment mass spectrometry-based assay revealed the differential expression of TEX101 in distinct NOA subtypes. TEX101 semen concentrations differentiated Sertoli cell-only syndrome from the other categories of NOA. As a result, we propose a simple two-biomarker decision tree for the differential diagnosis of OA and NOA and, in addition, for the differentiation of NOA subtypes. Clinical assays for ECM1 and TEX101 have the potential to replace most of the diagnostic testicular biopsies and facilitate the prediction of outcome of sperm retrieval procedures, thus increasing the reliability and success of assisted reproduction techniques.

  2. Differential protein expression in metallothionein protection from depleted uranium-induced nephrotoxicity

    PubMed Central

    Hao, Yuhui; Huang, Jiawei; Liu, Cong; Li, Hong; Liu, Jing; Zeng, Yiping; Yang, Zhangyou; Li, Rong

    2016-01-01

    The purpose of this study was to investigate the underlying mechanism of metallothionein (MT) protection from depleted uranium (DU) using a proteomics approach to search for a DU toxicity-differential protein. MT−/− and MT+/+ mice were administrated with a single dose of DU (10 mg/kg, i.p.) or equal volume of saline. After 4 days, protein changes in kidney tissues were evaluated using a proteomics approach. A total of 13 differentially expressed proteins were identified using two-dimensional electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The validating results showed that the expression of aminoacylase-3 (ACY-3) and the mitochondrial ethylmalonic encephalopathy 1 (ETHE1) decreased significantly after DU exposure; in addition, the reduction in MT−/− mice was more significant than that in MT+/+ mice. The results also showed that exogenous ETHE1 or ACY-3 could increase the survival rate of human embryonic kidney 293 (HEK293) cells after DU exposure. A specific siRNA of ETHE1 significantly increased cell apoptosis rates after DU exposure, whereas exogenous ETHE1 significantly decreased cell apoptosis rates. In summary, ACY-3 and ETHE1 might involve in protection roles of MT. ETHE1 could be a new sensitive molecular target of DU-induced cell apoptosis. PMID:27966587

  3. The workflow for quantitative proteome analysis of chloroplast development and differentiation, chloroplast mutants, and protein interactions by spectral counting.

    PubMed

    Friso, Giulia; Olinares, Paul Dominic B; van Wijk, Klaas J

    2011-01-01

    This chapter outlines a quantitative proteomics workflow using a label-free spectral counting technique. The workflow has been tested on different aspects of chloroplast biology in maize and Arabidopsis, including chloroplast mutant analysis, cell-type specific chloroplast differentiation, and the proplastid-to-chloroplast transition. The workflow involves one-dimensional SDS-PAGE of the proteomes of leaves or chloroplast subfractions, tryptic digestions, online LC-MS/MS using a mass spectrometer with high mass accuracy and duty cycle, followed by semiautomatic data processing. The bioinformatics analysis can effectively select best gene models and deals with quantification of closely related proteins; the workflow avoids overidentification of proteins and results in more accurate protein quantification. The final output includes pairwise comparative quantitative analysis, as well as hierarchical clustering for discovery of temporal and spatial patterns of protein accumulation. A brief discussion about potential pitfalls, as well as the advantages and disadvantages of spectral counting, is provided.

  4. Proteomic analysis reveals differential accumulation of small heat shock proteins and late embryogenesis abundant proteins between ABA-deficient mutant vp5 seeds and wild-type Vp5 seeds in maize

    PubMed Central

    Wu, Xiaolin; Gong, Fangping; Yang, Le; Hu, Xiuli; Tai, Fuju; Wang, Wei

    2014-01-01

    ABA is a major plant hormone that plays important roles during many phases of plant life cycle, including seed development, maturity and dormancy, and especially the acquisition of desiccation tolerance. Understanding of the molecular basis of ABA-mediated plant response to stress is of interest not only in basic research on plant adaptation but also in applied research on plant productivity. Maize mutant viviparous-5 (vp5), deficient in ABA biosynthesis in seeds, is a useful material for studying ABA-mediated response in maize. Due to carotenoid deficiency, vp5 endosperm is white, compared to yellow Vp5 endosperm. However, the background difference at proteome level between vp5 and Vp5 seeds is unclear. This study aimed to characterize proteome alterations of maize vp5 seeds and to identify ABA-dependent proteins during seed maturation. We compared the embryo and endosperm proteomes of vp5 and Vp5 seeds by gel-based proteomics. Up to 46 protein spots, most in embryos, were found to be differentially accumulated between vp5 and Vp5. The identified proteins included small heat shock proteins (sHSPs), late embryogenesis abundant (LEA) proteins, stress proteins, storage proteins and enzymes among others. However, EMB564, the most abundant LEA protein in maize embryo, accumulated in comparable levels between vp5 and Vp5 embryos, which contrasted to previously characterized, greatly lowered expression of emb564 mRNA in vp5 embryos. Moreover, LEA proteins and sHSPs displayed differential accumulations in vp5 embryos: six out of eight identified LEA proteins decreased while nine sHSPs increased in abundance. Finally, we discussed the possible causes of global proteome alterations, especially the observed differential accumulation of identified LEA proteins and sHSPs in vp5 embryos. The data derived from this study provides new insight into ABA-dependent proteins and ABA-mediated response during maize seed maturation. PMID:25653661

  5. Differential Proteomic Analysis of Platelets Suggested Possible Signal Cascades Network in Platelets Treated with Salvianolic Acid B

    PubMed Central

    Ma, Chao; Yao, Yan; Yue, Qing-Xi; Zhou, Xin-Wen; Yang, Peng-Yuan; Wu, Wan-Ying; Guan, Shu-Hong; Jiang, Bao-Hong; Yang, Min; Liu, Xuan; Guo, De-An

    2011-01-01

    Background Salvianolic acid B (SB) is an active component isolated from Danshen, a traditional Chinese medicine widely used for the treatment of cardiovascular disorders. Previous study suggested that SB might inhibit adhesion as well as aggregation of platelets by a mechanism involving the integrin α2β1. But, the signal cascades in platelets after SB binding are still not clear. Methodology/Principal Findings In the present study, a differential proteomic analysis (two-dimensional electrophoresis) was conducted to check the protein expression profiles of rat platelets with or without treatment of SB. Proteins altered in level after SB exposure were identified by MALDI-TOF MS/MS. Treatment of SB caused regulation of 20 proteins such as heat shock-related 70 kDa protein 2 (hsp70), LIM domain protein CLP-36, copine I, peroxiredoxin-2, coronin-1 B and cytoplasmic dynein intermediate chain 2C. The regulation of SB on protein levels was confirmed by Western blotting. The signal cascades network induced by SB after its binding with integrin α2β1 was predicted. To certify the predicted network, binding affinity of SB to integrin α2β1 was checked in vitro and ex vivo in platelets. Furthermore, the effects of SB on protein levels of hsp70, coronin-1B and intracellular levels of Ca(2+) and reactive oxygen species (ROS) were checked with or without pre-treatment of platelets using antibody against integrin α2β1. Electron microscopy study confirmed that SB affected cytoskeleton structure of platelets. Conclusions/Significance Integrin α2β1 might be one of the direct target proteins of SB in platelets. The signal cascades network of SB after binding with integrin α2β1 might include regulation of intracellular Ca(2+) level, cytoskeleton-related proteins such as coronin-1B and cytoskeleton structure of platelets. PMID:21379382

  6. Proteomic analysis of cAMP-mediated signaling during differentiation of 3 T3-L1 preadipocytes.

    PubMed

    Borkowski, Kamil; Wrzesinski, Krzysztow; Rogowska-Wrzesinska, Adelina; Audouze, Karine; Bakke, Jesse; Petersen, Rasmus Koefoed; Haj, Fawaz G; Madsen, Lise; Kristiansen, Karsten

    2014-12-01

    Initiation of adipocyte differentiation is promoted by the synergistic action of insulin/insulin-like growth factor, glucocorticoids, and agents activating cAMP-dependent signaling. The action of cAMP is mediated via PKA and Epac, where at least part of the PKA function relates to strong repression of Rho kinase activity, whereas Epac counteracts the reduction in insulin/insulin-like growth factor signaling associated with complete repression of Rho kinase activity. However, detailed knowledge of the Epac-dependent branch and the interplay with PKA is still limited. In the present study, we present a comprehensive evaluation of Epac-mediated processes and their interplay with PKA during the initiation of 3 T3-L1 preadipocyte differentiation using a combination of proteomics, molecular approaches, and bioinformatics. Proteomic analyses revealed 7 proteins specifically regulated in response to Epac activation, 4 in response to PKA activation, and 11 in response to the combined activation of Epac and PKA during the initial phase of differentiation. Network analyses indicated that the identified proteins are involved in pathways of importance for glucose metabolism, inositol metabolism, and calcium-dependent signaling thereby adding a novel facet to our understanding of cAMP-mediated potentiation of adipocyte differentiation.

  7. Regional Differences of Proteins Expressing in Adipose Depots Isolated from Cows, Steers and Bulls as Identified by a Proteomic Approach.

    PubMed

    Cho, Jin Hyoung; Jeong, Jin Young; Lee, Ra Ham; Park, Mi Na; Kim, Seok-Ho; Park, Seon-Min; Shin, Jae-Cheon; Jeon, Young-Joo; Shim, Jung-Hyun; Choi, Nag-Jin; Seo, Kang Seok; Cho, Young Sik; Kim, MinSeok S; Ko, Sungho; Seo, Jae-Min; Lee, Seung-Youp; Chae, Jung-Il; Lee, Hyun-Jeong

    2016-08-01

    Adipose tissue in the loin muscle area of beef cattle as a marbling factor is directly associated with beef quality. To elucidate whether properties of proteins involved in depot specific adipose tissue were sex-dependent, we analyzed protein expression of intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) from Hanwoo cows, steers, and bulls of Korean native beef cattle by liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based proteomic analysis, quantitative polymerase chain reaction (PCR) and western blot analysis. Two different adipose depots (i.e. intramuscular and omental) were collected from cows (n = 7), steers (n = 7), or bulls (n = 7). LC-MS/MS revealed a total of 55 and 35 proteins in IMAT and OMAT, respectively. Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively. Tropomyosin (TPM) 1, TPM 2, and TPM3 were subjected to verification by quantitative PCR and western blot analysis in IMAT and OMAT of Hanwoo cows, steers, and bulls as key factors closely associated with muscle development. Both mRNA levels and protein levels of TPM1, TPM2, and TPM3 in IMAT were lower in bulls compared to in cows or steers suggesting that they were positively correlated with marbling score and quality grade. Our results may aid the regulation of marbling development and improvement of meat quality grades in beef cattle.

  8. Regional Differences of Proteins Expressing in Adipose Depots Isolated from Cows, Steers and Bulls as Identified by a Proteomic Approach

    PubMed Central

    Cho, Jin Hyoung; Jeong, Jin Young; Lee, Ra Ham; Park, Mi Na; Kim, Seok-Ho; Park, Seon-Min; Shin, Jae-Cheon; Jeon, Young-Joo; Shim, Jung-Hyun; Choi, Nag-Jin; Seo, Kang Seok; Cho, Young Sik; Kim, MinSeok S.; Ko, Sungho; Seo, Jae-Min; Lee, Seung-Youp; Chae, Jung-Il; Lee, Hyun-Jeong

    2016-01-01

    Adipose tissue in the loin muscle area of beef cattle as a marbling factor is directly associated with beef quality. To elucidate whether properties of proteins involved in depot specific adipose tissue were sex-dependent, we analyzed protein expression of intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) from Hanwoo cows, steers, and bulls of Korean native beef cattle by liquid chromatography-tandem mass spectrometry (LC-MS/MS)–based proteomic analysis, quantitative polymerase chain reaction (PCR) and western blot analysis. Two different adipose depots (i.e. intramuscular and omental) were collected from cows (n = 7), steers (n = 7), or bulls (n = 7). LC-MS/MS revealed a total of 55 and 35 proteins in IMAT and OMAT, respectively. Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively. Tropomyosin (TPM) 1, TPM 2, and TPM3 were subjected to verification by quantitative PCR and western blot analysis in IMAT and OMAT of Hanwoo cows, steers, and bulls as key factors closely associated with muscle development. Both mRNA levels and protein levels of TPM1, TPM2, and TPM3 in IMAT were lower in bulls compared to in cows or steers suggesting that they were positively correlated with marbling score and quality grade. Our results may aid the regulation of marbling development and improvement of meat quality grades in beef cattle. PMID:27165017

  9. Proteome analysis of tobacco leaves reveals dynamic changes in protein expression among different cultivation areas.

    PubMed

    Lu, L M; Ye, K Y; Tang, Z X; Liu, L; Chen, Y; Luo, J; Huang, Y B

    2015-11-30

    The leaves of tobacco plants were used to analyze differences in protein content of tobacco grown in the four main flue-cured tobacco-producing areas of Sichuan Province, China. An improved protein extraction method, isoelectric focusing/sodium dodecyl sulfate-polyacrylamide gel electrophoresis two-dimensional gel electrophoretic separation, was used to extract and separate total protein from tobacco leaves. Proteomic maps with relatively high resolution and repeatability were produced. At isoelectric points 4 to 7 and molecular weight ranging from 20-100 kDa, we detected 1032, 1030, 1019, and 1011 clearly visible protein spots in tobacco leaves from the four study areas. Proteome comparison between these protein spots showed that 119 spots with a greater than 2-fold change in expression quantity contributed to the variation in expression. Of which, 115 were successfully identified and annotated. According to the annotation results, these proteins participate in photosynthesis, energy metabolism, mineral nutrition, terpene metabolism, defensive reaction, and other physiological and biochemical processes. This study preliminarily explains the effects of ecological conditions on the physiological metabolism of tobacco leaves and how such effects directly or indirectly contribute to tobacco leaf quality.

  10. Differential quantitative proteomics of Porphyromonas gingivalis by linear ion trap mass spectrometry: Non-label methods comparison, q-values and LOWESS curve fitting

    NASA Astrophysics Data System (ADS)

    Xia, Qiangwei; Wang, Tiansong; Park, Yoonsuk; Lamont, Richard J.; Hackett, Murray

    2007-01-01

    Differential analysis of whole cell proteomes by mass spectrometry has largely been applied using various forms of stable isotope labeling. While metabolic stable isotope labeling has been the method of choice, it is often not possible to apply such an approach. Four different label free ways of calculating expression ratios in a classic "two-state" experiment are compared: signal intensity at the peptide level, signal intensity at the protein level, spectral counting at the peptide level, and spectral counting at the protein level. The quantitative data were mined from a dataset of 1245 qualitatively identified proteins, about 56% of the protein encoding open reading frames from Porphyromonas gingivalis, a Gram-negative intracellular pathogen being studied under extracellular and intracellular conditions. Two different control populations were compared against P. gingivalis internalized within a model human target cell line. The q-value statistic, a measure of false discovery rate previously applied to transcription microarrays, was applied to proteomics data. For spectral counting, the most logically consistent estimate of random error came from applying the locally weighted scatter plot smoothing procedure (LOWESS) to the most extreme ratios generated from a control technical replicate, thus setting upper and lower bounds for the region of experimentally observed random error.

  11. Proteomic Analysis of Tissue from α1,3-galactosyltransferase Knockout Mice Reveals That a Wide Variety of Proteins and Protein Fragments Change Expression Level

    PubMed Central

    Thorlacius-Ussing, Louise; Ludvigsen, Maja; Kirkeby, Svend

    2013-01-01

    A barrier in a pig-to-man xenotransplantation is that the Galα1-3Galβ1-4GlcNAc-R carbohydrate (α-Gal epitope) expressed on pig endothelial cells reacts with naturally occurring antibodies in the recipient’s blood leading to rejection. Deletion of the α1,3-galactosyltransferase gene prevents the synthesis of the α-Gal epitope. Therefore, knockout models of the α1,3-galactosyltransferase gene are widely used to study xenotransplantation. We have performed proteomic studies on liver and pancreas tissues from wild type and α1,3-galactosyltransferase gene knockout mice. The tissues were analyzed by two-dimensional polyacrylamide gel electrophoresis and liquid chromatography - tandem mass spectrometry. The analyses revealed that a wide variety of proteins and protein fragments are differentially expressed suggesting that knockout of the α1,3-galactosyltransferase gene affects the expression of several other genes. PMID:24244699

  12. Heterologous Expression and Purification Systems for Structural Proteomics of Mammalian Membrane Proteins

    PubMed Central

    2002-01-01

    Membrane proteins (MPs) are responsible for the interface between the exterior and the interior of the cell. These proteins are implicated in numerous diseases, such as cancer, cystic fibrosis, epilepsy, hyperinsulinism, heart failure, hypertension and Alzheimer's disease. However, studies on these disorders are hampered by a lack of structural information about the proteins involved. Structural analysis requires large quantities of pure and active proteins. The majority of medically and pharmaceutically relevant MPs are present in tissues at very low concentration, which makes heterologous expression in large-scale production-adapted cells a prerequisite for structural studies. Obtaining mammalian MP structural data depends on the development of methods that allow the production of large quantities of MPs. This review focuses on the different heterologous expression systems, and the purification strategies, used to produce large amounts of pure mammalian MPs for structural proteomics. PMID:18629259

  13. Differential proteomic responses of selectively bred and wild-type Sydney rock oyster populations exposed to elevated CO2.

    PubMed

    Thompson, E L; O'Connor, W; Parker, L; Ross, P; Raftos, D A

    2015-03-01

    Previous work suggests that larvae from Sydney rock oysters that have been selectively bred for fast growth and disease resistance are more resilient to the impacts of ocean acidification than nonselected, wild-type oysters. In this study, we used proteomics to investigate the molecular differences between oyster populations in adult Sydney rock oysters and to identify whether these form the basis for observations seen in larvae. Adult oysters from a selective breeding line (B2) and nonselected wild types (WT) were exposed for 4 weeks to elevated pCO2 (856 μatm) before their proteomes were compared to those of oysters held under ambient conditions (375 μatm pCO2 ). Exposure to elevated pCO2 resulted in substantial changes in the proteomes of oysters from both the selectively bred and wild-type populations. When biological functions were assigned, these differential proteins fell into five broad, potentially interrelated categories of subcellular functions, in both oyster populations. These functional categories were energy production, cellular stress responses, the cytoskeleton, protein synthesis and cell signalling. In the wild-type population, proteins were predominantly upregulated. However, unexpectedly, these cellular systems were downregulated in the selectively bred oyster population, indicating cellular dysfunction. We argue that this reflects a trade-off, whereby an adaptive capacity for enhanced mitochondrial energy production in the selectively bred population may help to protect larvae from the effects of elevated CO2 , whilst being deleterious to adult oysters.

  14. Differential Cysteine Labeling and Global Label-Free Proteomics Reveals an Altered Metabolic State in Skeletal Muscle Aging

    PubMed Central

    2014-01-01

    The molecular mechanisms underlying skeletal muscle aging and associated sarcopenia have been linked to an altered oxidative status of redox-sensitive proteins. Reactive oxygen and reactive nitrogen species (ROS/RNS) generated by contracting skeletal muscle are necessary for optimal protein function, signaling, and adaptation. To investigate the redox proteome of aging gastrocnemius muscles from adult and old male mice, we developed a label-free quantitative proteomic approach that includes a differential cysteine labeling step. The approach allows simultaneous identification of up- and downregulated proteins between samples in addition to the identification and relative quantification of the reversible oxidation state of susceptible redox cysteine residues. Results from muscles of adult and old mice indicate significant changes in the content of chaperone, glucose metabolism, and cytoskeletal regulatory proteins, including Protein DJ-1, cAMP-dependent protein kinase type II, 78 kDa glucose regulated protein, and a reduction in the number of redox-responsive proteins identified in muscle of old mice. Results demonstrate skeletal muscle aging causes a reduction in redox-sensitive proteins involved in the generation of precursor metabolites and energy metabolism, indicating a loss in the flexibility of the redox energy response. Data is available via ProteomeXchange with identifier PXD001054. PMID:25181601

  15. Differential cysteine labeling and global label-free proteomics reveals an altered metabolic state in skeletal muscle aging.

    PubMed

    McDonagh, Brian; Sakellariou, Giorgos K; Smith, Neil T; Brownridge, Philip; Jackson, Malcolm J

    2014-11-07

    The molecular mechanisms underlying skeletal muscle aging and associated sarcopenia have been linked to an altered oxidative status of redox-sensitive proteins. Reactive oxygen and reactive nitrogen species (ROS/RNS) generated by contracting skeletal muscle are necessary for optimal protein function, signaling, and adaptation. To investigate the redox proteome of aging gastrocnemius muscles from adult and old male mice, we developed a label-free quantitative proteomic approach that includes a differential cysteine labeling step. The approach allows simultaneous identification of up- and downregulated proteins between samples in addition to the identification and relative quantification of the reversible oxidation state of susceptible redox cysteine residues. Results from muscles of adult and old mice indicate significant changes in the content of chaperone, glucose metabolism, and cytoskeletal regulatory proteins, including Protein DJ-1, cAMP-dependent protein kinase type II, 78 kDa glucose regulated protein, and a reduction in the number of redox-responsive proteins identified in muscle of old mice. Results demonstrate skeletal muscle aging causes a reduction in redox-sensitive proteins involved in the generation of precursor metabolites and energy metabolism, indicating a loss in the flexibility of the redox energy response. Data is available via ProteomeXchange with identifier PXD001054.

  16. Differential Effects of Growth Hormone Versus Insulin-Like Growth Factor-I on the Mouse Plasma Proteome

    PubMed Central

    Ding, Juan; List, Edward O.; Bower, Brian D.

    2011-01-01

    The GH/IGF-I axis has both pre- and postpubertal metabolic effects. However, the differential effects of GH and/or IGF-I on animal physiology or the plasma proteome are still being unraveled. In this report, we analyzed several physiological effects along with the plasma proteome after treatment of mice with recombinant bovine GH or recombinant human IGF-I. GH and IGF-I showed similar effects in increasing body length, body weight, lean and fluid masses, and organ weights including muscle, kidney, and spleen. However, GH significantly increased serum total cholesterol, whereas IGF-I had no effect on it. Both acute and longer-term effects on the plasma proteome were determined. Proteins found to be significantly changed by recombinant bovine GH and/or recombinant human IGF-I injections were identified by mass spectrometry (MS) and MS/MS. The identities of these proteins were further confirmed by Western blotting analysis. Isoforms of apolipoprotein A4, apolipoprotein E, serum amyloid protein A-1, clusterin, transthyretin, and several albumin fragments were found to be differentially regulated by GH vs. IGF-I in mouse plasma. Thus, we have identified several plasma protein biomarkers that respond specifically and differentially to GH or IGF-I and may represent new physiological targets of these hormones. These findings may lead to better understanding of the independent biological effects of GH vs. IGF-I. In addition, these novel biomarkers may be useful for the development of tests to detect illicit use of GH or IGF-I. PMID:21791560

  17. Annotated differentially expressed salivary proteins of susceptible and insecticide-resistant mosquitoes of Anopheles stephensi.

    PubMed

    Vijay, Sonam; Rawal, Ritu; Kadian, Kavita; Raghavendra, Kamaraju; Sharma, Arun

    2015-01-01

    Vector control is one of the major global strategies for control of malaria. However, the major obstacle for vector control is the development of multiple resistances to organochlorine, organophosphorus insecticides and pyrethroids that are currently being used in public health for spraying and in bednets. Salivary glands of vectors are the first target organ for human-vector contact during biting and parasite-vector contact prior to parasite development in the mosquito midguts. The salivary glands secrete anti-haemostatic, anti-inflammatory biologically active molecules to facilitate blood feeding from the host and also inadvertently inject malaria parasites into the vertebrate host. The Anopheles stephensi mosquito, an urban vector of malaria to both human and rodent species has been identified as a reference laboratory model to study mosquito-parasite interactions. In this study, we adopted a conventional proteomic approach of 2D-electrophoresis coupled with MALDI-TOF mass spectrometry and bioinformatics to identify putative differentially expressed annotated functional salivary proteins between An. stephensi susceptible and multiresistant strains with same genetic background. Our results show 2D gel profile and MALDI-TOF comparisons that identified 31 differentially expressed putative modulated proteins in deltamethrin/DDT resistant strains of An. stephensi. Among these 15 proteins were found to be upregulated and 16 proteins were downregulated. Our studies interpret that An. stephensi (multiresistant) caused an upregulated expression of proteins and enzymes like cytochrome 450, short chain dehyrdogenase reductase, phosphodiesterase etc that may have an impact in insecticide resistance and xenobiotic detoxification. Our study elucidates a proteomic response of salivary glands differentially regulated proteins in response to insecticide resistance development which include structural, redox and regulatory enzymes of several pathways. These identified proteins

  18. Differential proteome analysis of mature and germinated embryos of Araucaria angustifolia.

    PubMed

    Balbuena, Tiago S; Jo, Leonardo; Pieruzzi, Fernanda P; Dias, Leonardo L C; Silveira, Vanildo; Santa-Catarina, Claudete; Junqueira, Magno; Thelen, Jay J; Shevchenko, Andrej; Floh, Eny I S

    2011-04-01

    Araucaria angustifolia is an endangered Brazilian native conifer tree. The aim of the present work was to identify differentially expressed proteins between mature and germinated embryos of A. angustifolia, using one and two dimensional gel electrophoresis approaches followed by protein identification by tandem mass spectrometry. The identities of 32 differentially expressed protein spots from two dimensional gel maps were successfully determined, including proteins and enzymes involved in storage mobilization such as the vicilin-like storage protein and proteases. A label free approach, based on spectral counts, resulted in detection of 10 and 14 mature and germinated enriched proteins, respectively. Identified proteins were mainly related to energetic metabolism pathways, translational processes, oxidative stress regulation and cellular signaling. The integrated use of both strategies permitted a comprehensive protein expression overview of changes in germinated embryos in relation to matures, providing insights into the this process in a recalcitrant seed species. Applications of the data generated on the monitoring and control of in vitro somatic embryos were discussed.

  19. A Method for Label-Free, Differential Top-Down Proteomics

    PubMed Central

    Ntai, Ioanna; Toby, Timothy K.; LeDuc, Richard D.; Kelleher, Neil L.

    2016-01-01

    Biomarker discovery in the translational research has heavily relied on labeled and label-free quantitative bottom-up proteomics. Here, we describe a new approach to biomarker studies that utilizes high-throughput top-down proteomics and is the first to offer whole protein characterization and relative quantitation within the same experiment. Using yeast as a model, we report procedures for a label-free approach to quantify the relative abundance of intact proteins ranging from 0 to 30 kDa in two different states. In this chapter, we describe the integrated methodology for the large-scale profiling and quantitation of the intact proteome by liquid chromatography-mass spectrometry (LC-MS) without the need for metabolic or chemical labeling. This recent advance for quantitative top-down proteomics is best implemented with a robust and highly controlled sample preparation workflow before data acquisition on a high-resolution mass spectrometer, and the application of a hierarchical linear statistical model to account for the multiple levels of variance contained in quantitative proteomic comparisons of samples for basic and clinical research. PMID:26867742

  20. A Method for Label-Free, Differential Top-Down Proteomics.

    PubMed

    Ntai, Ioanna; Toby, Timothy K; LeDuc, Richard D; Kelleher, Neil L

    2016-01-01

    Biomarker discovery in the translational research has heavily relied on labeled and label-free quantitative bottom-up proteomics. Here, we describe a new approach to biomarker studies that utilizes high-throughput top-down proteomics and is the first to offer whole protein characterization and relative quantitation within the same experiment. Using yeast as a model, we report procedures for a label-free approach to quantify the relative abundance of intact proteins ranging from 0 to 30 kDa in two different states. In this chapter, we describe the integrated methodology for the large-scale profiling and quantitation of the intact proteome by liquid chromatography-mass spectrometry (LC-MS) without the need for metabolic or chemical labeling. This recent advance for quantitative top-down proteomics is best implemented with a robust and highly controlled sample preparation workflow before data acquisition on a high-resolution mass spectrometer, and the application of a hierarchical linear statistical model to account for the multiple levels of variance contained in quantitative proteomic comparisons of samples for basic and clinical research.

  1. Studies of a Biochemical Factory: Tomato Trichome Deep Expressed Sequence Tag Sequencing and Proteomics1[W][OA

    PubMed Central

    Schilmiller, Anthony L.; Miner, Dennis P.; Larson, Matthew; McDowell, Eric; Gang, David R.; Wilkerson, Curtis; Last, Robert L.

    2010-01-01

    Shotgun proteomics analysis allows hundreds of proteins to be identified and quantified from a single sample at relatively low cost. Extensive DNA sequence information is a prerequisite for shotgun proteomics, and it is ideal to have sequence for the organism being studied rather than from related species or accessions. While this requirement has limited the set of organisms that are candidates for this approach, next generation sequencing technologies make it feasible to obtain deep DNA sequence coverage from any organism. As part of our studies of specialized (secondary) metabolism in tomato (Solanum lycopersicum) trichomes, 454 sequencing of cDNA was combined with shotgun proteomics analyses to obtain in-depth profiles of genes and proteins expressed in leaf and stem glandular trichomes of 3-week-old plants. The expressed sequence tag and proteomics data sets combined with metabolite analysis led to the discovery and characterization of a sesquiterpene synthase that produces β-caryophyllene and α-humulene from E,E-farnesyl diphosphate in trichomes of leaf but not of stem. This analysis demonstrates the utility of combining high-throughput cDNA sequencing with proteomics experiments in a target tissue. These data can be used for dissection of other biochemical processes in these specialized epidermal cells. PMID:20431087

  2. Global features of gene expression on the proteome and transcriptome levels in S. coelicolor during germination.

    PubMed

    Strakova, Eva; Bobek, Jan; Zikova, Alice; Vohradsky, Jiri

    2013-01-01

    Streptomycetes have been studied mostly as producers of secondary metabolites, while the transition from dormant spores to an exponentially growing culture has largely been ignored. Here, we focus on a comparative analysis of fluorescently and radioactively labeled proteome and microarray acquired transcriptome expressed during the germination of Streptomyces coelicolor. The time-dynamics is considered, starting from dormant spores through 5.5 hours of growth with 13 time points. Time series of the gene expressions were analyzed using correlation, principal components analysis and an analysis of coding genes utilization. Principal component analysis was used to identify principal kinetic trends in gene expression and the corresponding genes driving S. coelicolor germination. In contrast with the correlation analysis, global trends in the gene/protein expression reflected by the first principal components showed that the prominent patterns in both the protein and the mRNA domains are surprisingly well correlated. Analysis of the number of expressed genes identified functional groups activated during different time intervals of the germination.

  3. Microwave & Magnetic (M2) Proteomics Reveals CNS-Specific Protein Expression Waves that Precede Clinical Symptoms of Experimental Autoimmune Encephalomyelitis

    NASA Astrophysics Data System (ADS)

    Raphael, Itay; Mahesula, Swetha; Purkar, Anjali; Black, David; Catala, Alexis; Gelfond, Jonathon A. L.; Forsthuber, Thomas G.; Haskins, William E.

    2014-09-01

    Central nervous system-specific proteins (CSPs), transported across the damaged blood-brain-barrier (BBB) to cerebrospinal fluid (CSF) and blood (serum), might be promising diagnostic, prognostic and predictive protein biomarkers of disease in individual multiple sclerosis (MS) patients because they are not expected to be present at appreciable levels in the circulation of healthy subjects. We hypothesized that microwave & magnetic (M2) proteomics of CSPs in brain tissue might be an effective means to prioritize putative CSP biomarkers for future immunoassays in serum. To test this hypothesis, we used M2 proteomics to longitudinally assess CSP expression in brain tissue from mice during experimental autoimmune encephalomyelitis (EAE), a mouse model of MS. Confirmation of central nervous system (CNS)-infiltrating inflammatory cell response and CSP expression in serum was achieved with cytokine ELISPOT and ELISA immunoassays, respectively, for selected CSPs. M2 proteomics (and ELISA) revealed characteristic CSP expression waves, including synapsin-1 and α-II-spectrin, which peaked at day 7 in brain tissue (and serum) and preceded clinical EAE symptoms that began at day 10 and peaked at day 20. Moreover, M2 proteomics supports the concept that relatively few CNS-infiltrating inflammatory cells can have a disproportionally large impact on CSP expression prior to clinical manifestation of EAE.

  4. Differential expression of proteins in Listeria monocytogenes under thermotolerance-inducing, heat shock, and prolonged heat shock conditions.

    PubMed

    Agoston, Réka; Soni, Kamlesh; Jesudhasan, Palmy R; Russell, William K; Mohácsi-Farkas, Csilla; Pillai, Suresh D

    2009-11-01

    Listeria monocytogenes is a foodborne pathogen capable of employing stress adaptive responses to evade a variety of stressors including temperature stress. We employed two-dimensional gel electrophoresis coupled with matrix-assisted laser desorption/ionization-time of flight analysis to study the differential expression of L. monocytogenes (ATCC 43256) soluble proteins at heat shock (60 degrees C) conditions, prolonged heat shock (60 degrees C for 9 minutes) conditions, and thermotolerance-inducing (48 degrees C for 30 minutes followed by 60 degrees C for 9 minutes) conditions. We compared the proteome of L. monocytogenes under these conditions to the proteome at 37 degrees C. Eighteen proteins were differentially expressed at 60 degrees C (6 up-regulated and 12 down-regulated), 21 proteins were differentially expressed (12 up-regulated and 9 down-regulated) when the cells were exposed to 60 degrees C for 9 minutes, and 20 proteins were differentially expressed (10 up-regulated and 10 down-regulated) when cells were initially exposed to 48 degrees C for 30 minutes before 60 degrees C for 9 minutes. There was one unidentifiable protein with observed molecular weight of 50 kDa which was differentially expressed across the three temperature treatments. Thermotolerance-inducing conditions caused the up-regulation of a protein by as much as 12-fold. DnaN, a previously identified stress protein, was up-regulated almost threefold at 60 degrees C. TcsA, a lipoprotein (CD4 T cell-stimulating antigen), and Gap (glyceraldehyde-3-phosphate-dehydrogenase) were selectively expressed under prolonged heat shock conditions suggesting their potential as candidate marker proteins targets for identifying temperature-stressed L. monocytogenes cells.

  5. Adaptation to acetaminophen exposure elicits major changes in expression and distribution of the hepatic proteome.

    PubMed

    Eakins, R; Walsh, J; Randle, L; Jenkins, R E; Schuppe-Koistinen, I; Rowe, C; Starkey Lewis, P; Vasieva, O; Prats, N; Brillant, N; Auli, M; Bayliss, M; Webb, S; Rees, J A; Kitteringham, N R; Goldring, C E; Park, B K

    2015-11-26

    Acetaminophen overdose is the leading cause of acute liver failure. One dose of 10-15 g causes severe liver damage in humans, whereas repeated exposure to acetaminophen in humans and animal models results in autoprotection. Insight of this process is limited to select proteins implicated in acetaminophen toxicity and cellular defence. Here we investigate hepatic adaptation to acetaminophen toxicity from a whole proteome perspective, using quantitative mass spectrometry. In a rat model, we show the response to acetaminophen involves the expression of 30% of all proteins detected in the liver. Genetic ablation of a master regulator of cellular defence, NFE2L2, has little effect, suggesting redundancy in the regulation of adaptation. We show that adaptation to acetaminophen has a spatial component, involving a shift in regionalisation of CYP2E1, which may prevent toxicity thresholds being reached. These data reveal unexpected complexity and dynamic behaviour in the biological response to drug-induced liver injury.

  6. Adaptation to acetaminophen exposure elicits major changes in expression and distribution of the hepatic proteome

    PubMed Central

    Eakins, R.; Walsh, J.; Randle, L.; Jenkins, R. E.; Schuppe-Koistinen, I.; Rowe, C.; Starkey Lewis, P.; Vasieva, O.; Prats, N.; Brillant, N.; Auli, M.; Bayliss, M.; Webb, S.; Rees, J. A.; Kitteringham, N. R.; Goldring, C. E.; Park, B. K.

    2015-01-01

    Acetaminophen overdose is the leading cause of acute liver failure. One dose of 10–15 g causes severe liver damage in humans, whereas repeated exposure to acetaminophen in humans and animal models results in autoprotection. Insight of this process is limited to select proteins implicated in acetaminophen toxicity and cellular defence. Here we investigate hepatic adaptation to acetaminophen toxicity from a whole proteome perspective, using quantitative mass spectrometry. In a rat model, we show the response to acetaminophen involves the expression of 30% of all proteins detected in the liver. Genetic ablation of a master regulator of cellular defence, NFE2L2, has little effect, suggesting redundancy in the regulation of adaptation. We show that adaptation to acetaminophen has a spatial component, involving a shift in regionalisation of CYP2E1, which may prevent toxicity thresholds being reached. These data reveal unexpected complexity and dynamic behaviour in the biological response to drug-induced liver injury. PMID:26607827

  7. The proteome of Toxoplasma gondii: integration with the genome provides novel insights into gene expression and annotation

    PubMed Central

    Xia, Dong; Sanderson, Sanya J; Jones, Andrew R; Prieto, Judith H; Yates, John R; Bromley, Elizabeth; Tomley, Fiona M; Lal, Kalpana; Sinden, Robert E; Brunk, Brian P; Roos, David S; Wastling, Jonathan M

    2008-01-01

    Background Although the genomes of many of the most important human and animal pathogens have now been sequenced, our understanding of the actual proteins expressed by these genomes and how well they predict protein sequence and expression is still deficient. We have used three complementary approaches (two-dimensional electrophoresis, gel-liquid chromatography linked tandem mass spectrometry and MudPIT) to analyze the proteome of Toxoplasma gondii, a parasite of medical and veterinary significance, and have developed a public repository for these data within ToxoDB, making for the first time proteomics data an integral part of this key genome resource. Results The draft genome for Toxoplasma predicts around 8,000 genes with varying degrees of confidence. Our data demonstrate how proteomics can inform these predictions and help discover new genes. We have identified nearly one-third (2,252) of all the predicted proteins, with 2,477 intron-spanning peptides providing supporting evidence for correct splice site annotation. Functional predictions for each protein and key pathways were determined from the proteome. Importantly, we show evidence for many proteins that match alternative gene models, or previously unpredicted genes. For example, approximately 15% of peptides matched more convincingly to alternative gene models. We also compared our data with existing transcriptional data in which we highlight apparent discrepancies between gene transcription and protein expression. Conclusion Our data demonstrate the importance of protein data in expression profiling experiments and highlight the necessity of integrating proteomic with genomic data so that iterative refinements of both annotation and expression models are possible. PMID:18644147

  8. Multi-Modal Proteomic Analysis of Retinal Protein Expression Alterations in a Rat Model of Diabetic Retinopathy

    PubMed Central

    Kutzler, Lydia; Brucklacher, Robert M.; Bronson, Sarah K.; Kimball, Scot R.; Freeman, Willard M.

    2011-01-01

    Background As a leading cause of adult blindness, diabetic retinopathy is a prevalent and profound complication of diabetes. We have previously reported duration-dependent changes in retinal vascular permeability, apoptosis, and mRNA expression with diabetes in a rat model system. The aim of this study was to identify retinal proteomic alterations associated with functional dysregulation of the diabetic retina to better understand diabetic retinopathy pathogenesis and that could be used as surrogate endpoints in preclinical drug testing studies. Methodology/Principal Findings A multi-modal proteomic approach of antibody (Luminex)-, electrophoresis (DIGE)-, and LC-MS (iTRAQ)-based quantitation methods was used to maximize coverage of the retinal proteome. Transcriptomic profiling through microarray analysis was included to identify additional targets and assess potential regulation of protein expression changes at the mRNA level. The proteomic approaches proved complementary, with limited overlap in proteomic coverage. Alterations in pro-inflammatory, signaling and crystallin family proteins were confirmed by orthogonal methods in multiple independent animal cohorts. In an independent experiment, insulin replacement therapy normalized the expression of some proteins (Dbi, Anxa5) while other proteins (Cp, Cryba3, Lgals3, Stat3) were only partially normalized and Fgf2 and Crybb2 expression remained elevated. Conclusions/Significance These results expand the understanding of the changes in retinal protein expression occurring with diabetes and their responsiveness to normalization of blood glucose through insulin therapy. These proteins, especially those not normalized by insulin therapy, may also be useful in preclinical drug development studies. PMID:21249158

  9. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  10. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  11. Identification of Annexin A1 protein expression in human gastric adenocarcinoma using proteomics and tissue microarray

    PubMed Central

    Zhang, Zhi-Qiang; Li, Xiu-Juan; Liu, Gui-Tao; Xia, Yu; Zhang, Xiang-Yang; Wen, Hao

    2013-01-01

    AIM: To study the differential expression of Annexin A1 (ANXA1) protein in human gastric adenocarcinoma. This study was also designed to analyze the relationship between ANXA1 expression and the clinicopathological parameters of gastric carcinoma. METHODS: Purified gastric adenocarcinoma cells (GAC) and normal gastric epithelial cells (NGEC) were obtained from 15 patients with gastric cancer by laser capture microdissection. All of the peptide specimens were labeled as 18O/16O after trypsin digestion. Differential protein expressions were quantitatively identified between GAC and NGEC by nanoliter-reverse-phase liquid chromatography-mass/mass spectrometry (nano-RPLC-MS/MS). The expressions of ANXA1 in GAC and NGEC were verified by western blot analysis. The tissue microarray containing the expressed ANXA1 in 75 pairs of gastric carcinoma and paracarcinoma specimens was detected by immunohistochemistry (IHC). The relationship between ANXA1 expression and clinicopathological parametes of gastric carcinoma was analyzed. RESULTS: A total of 78 differential proteins were identified. Western blotting revealed that ANXA1 expression was significantly upregulated in GAC (2.17/1, P < 0.01). IHC results showed the correlations between ANXA1 protein expression and the clinicopathological parameters, including invasive depth (T stage), lymph node metastasis (N stage), distant metastasis (M stage) and tumour-lymph node metastasis stage (P < 0.01). However, the correlations between ANXA1 protein expression and the remaining clinicopathological parameters, including sex, age, histological differentiation and the size of tumour were not found (P > 0.05). CONCLUSION: The upregulated ANXA1 expression may be associated with carcinogenesis, progression, invasion and metastasis of GAC. This protein could be considered as a biomarker of clinical prognostic prediction and targeted therapy of GAC. PMID:24282368

  12. Comparative proteomics of cerebrospinal fluid reveals a predictive model for differential diagnosis of pneumococcal, meningococcal, and enteroviral meningitis, and novel putative therapeutic targets

    PubMed Central

    2015-01-01

    Background Meningitis is the inflammation of the meninges in response to infection or chemical agents. While aseptic meningitis, most frequently caused by enteroviruses, is usually benign with a self-limiting course, bacterial meningitis remains associated with high morbidity and mortality rates, despite advances in antimicrobial therapy and intensive care. Fast and accurate differential diagnosis is crucial for assertive choice of the appropriate therapeutic approach for each form of meningitis. Methods We used 2D-PAGE and mass spectrometry to identify the cerebrospinal fluid proteome specifically related to the host response to pneumococcal, meningococcal, and enteroviral meningitis. The disease-specific proteome signatures were inspected by pathway analysis. Results Unique cerebrospinal fluid proteome signatures were found to the three aetiological forms of meningitis investigated, and a qualitative predictive model with four protein markers was developed for the differential diagnosis of these diseases. Nevertheless, pathway analysis of the disease-specific proteomes unveiled that Kallikrein-kinin system may play a crucial role in the pathophysiological mechanisms leading to brain damage in bacterial meningitis. Proteins taking part in this cellular process are proposed as putative targets to novel adjunctive therapies. Conclusions Comparative proteomics of cerebrospinal fluid disclosed candidate biomarkers, which were combined in a qualitative and sequential predictive model with potential to improve the differential diagnosis of pneumococcal, meningococcal and enteroviral meningitis. Moreover, we present the first evidence of the possible implication of Kallikrein-kinin system in the pathophysiology of bacterial meningitis. PMID:26040285

  13. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  14. Proteomics and deep sequencing comparison of seasonally active venom glands in the platypus reveals novel venom peptides and distinct expression profiles.

    PubMed

    Wong, Emily S W; Morgenstern, David; Mofiz, Ehtesham; Gombert, Sara; Morris, Katrina M; Temple-Smith, Peter; Renfree, Marilyn B; Whittington, Camilla M; King, Glenn F; Warren, Wesley C; Papenfuss, Anthony T; Belov, Katherine

    2012-11-01

    The platypus is a venomous monotreme. Male platypuses possess a spur on their hind legs that is connected to glands in the pelvic region. They produce venom only during the breeding season, presumably to fight off conspecifics. We have taken advantage of this unique seasonal production of venom to compare the transcriptomes of in- and out-of-season venom glands, in conjunction with proteomic analysis, to identify previously undiscovered venom genes. Comparison of the venom glands revealed distinct gene expression profiles that are consistent with changes in venom gland morphology and venom volumes in and out of the breeding season. Venom proteins were identified through shot-gun sequenced venom proteomes of three animals using RNA-seq-derived transcripts for peptide-spectral matching. 5,157 genes were expressed in the venom glands, 1,821 genes were up-regulated in the in-season gland, and 10 proteins were identified in the venom. New classes of platypus-venom proteins identified included antimicrobials, amide oxidase, serpin protease inhibitor, proteins associated with the mammalian stress response pathway, cytokines, and other immune molecules. Five putative toxins have only been identified in platypus venom: growth differentiation factor 15, nucleobindin-2, CD55, a CXC-chemokine, and corticotropin-releasing factor-binding protein. These novel venom proteins have potential biomedical and therapeutic applications and provide insights into venom evolution.

  15. Proteomic analysis of acquired tamoxifen resistance in MCF-7 cells reveals expression signatures associated with enhanced migration

    PubMed Central

    2012-01-01

    Introduction Acquired tamoxifen resistance involves complex signaling events that are not yet fully understood. Successful therapeutic intervention to delay the onset of hormone resistance depends critically on mechanistic elucidation of viable molecular targets associated with hormone resistance. This study was undertaken to investigate the global proteomic alterations in a tamoxifen resistant MCF-7 breast cancer cell line obtained by long term treatment of the wild type MCF-7 cell line with 4-hydroxytamoxifen (4-OH Tam). Methods We cultured MCF-7 cells with 4-OH Tam over a period of 12 months to obtain the resistant cell line. A gel-free, quantitative proteomic method was used to identify and quantify the proteome of the resistant cell line. Nano-flow high-performance liquid chromatography coupled to high resolution Fourier transform mass spectrometry was used to analyze fractionated peptide mixtures that were isobarically labeled from the resistant and control cell lysates. Real time quantitative PCR and Western blots were used to verify selected proteomic changes. Lentiviral vector transduction was used to generate MCF-7 cells stably expressing S100P. Online pathway analysis was performed to assess proteomic signatures in tamoxifen resistance. Survival analysis was done to evaluate clinical relevance of altered proteomic expressions. Results Quantitative proteomic analysis revealed a wide breadth of signaling events during transition to acquired tamoxifen resistance. A total of 629 proteins were found significantly changed with 364 up-regulated and 265 down-regulated. Collectively, these changes demonstrated the suppressed state of estrogen receptor (ER) and ER-regulated genes, activated survival signaling and increased migratory capacity of the resistant cell line. The protein S100P was found to play a critical role in conferring tamoxifen resistance and enhanced cell motility. Conclusions Our data demonstrate that the adaptive changes in the proteome of

  16. Differentially expressed proteins in fluconazole-susceptible and fluconazole-resistant isolates of Candida glabrata.

    PubMed

    Shen, Yinzhong; Zhang, Lijun; Jia, Xiaofang; Zhang, Yongxin; Lu, Hongzhou

    2015-06-01

    The current study aimed to identify the differences presented in the proteome of fluconazole-susceptible isolates of Candida glabrata compared to those with fluconazole-resistant ones. Two-dimensional differential gel electrophoresis was applied to identify proteins that were differentially expressed in fluconazole-susceptible and fluconazole-resistant isolates of C. glabrata. Eight proteins including aspartyl-tRNA synthetase, translation elongation factor 3, 3-phosphoglycerate kinase, ribosomal protein L5, coproporphyrinogen III oxidase, pyruvate kinase, G-beta like protein, and F1F0-ATPase alpha subunit were found to be more abundantly represented, while four proteins including vitamin B12-(cobalamin)-independent isozyme of methionine synthase, microtubule-associated protein, adenylosuccinate synthetase, and aldose reductase were found to be less abundantly represented in fluconazole-resistant strains versus those with fluconazole-susceptible ones. These differentially expressed proteins were primarily associated with energy metabolism, stress response, and macromolecule synthesis. Proteins associated with energy metabolism, stress response, and macromolecule synthesis may play a role in the development of fluconazole resistance in the clinical isolates of C. glabrata. Multiple different mechanisms are involved in the development of fluconazole resistance in C. glabrata. These findings provide a scientific basis for discovering new genes and mechanisms associated with fluconazole resistance in C. glabrata.

  17. Proteomic Analysis of Fetal Ovaries Reveals That Primordial Follicle Formation and Transition Are Differentially Regulated

    PubMed Central

    Xu, Mengmeng; Che, Long; Yang, Zhenguo; Zhang, Pan; Shi, Jiankai; Li, Jian; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Feng, Bin; Wu, De

    2017-01-01

    Primordial follicle formation represents a critical phase of the initiation of embryonic reproductive organ development, while the primordial follicle transition into primary follicle determines whether oestrus or ovulation will occur in female animals. To identify molecular mechanism of new proteins which are involved in ovarian development, we employed 2D-DIGE to compare the protein expression profiles of primordial follicles and primary follicles of fetal ovaries in pigs. Fetal ovaries were collected at distinct time-points of the gestation cycle (g55 and g90). The identified proteins at the g55 time-point are mainly involved in the development of anatomical structures [reticulocalbin-1 (RCN1), reticulocalbin-3 (RCN3)], cell differentiation (actin), and stress response [heterogeneous nuclear ribonucleoprotein K (HNRNPK)]. Meanwhile, at the g90 stage, the isolated proteins with altered expression levels were mainly associated with cell proliferation [major vault protein (MVP)] and stress response [heat shock-related 70 kDa protein 2 (HSPA2)]. In conclusion, our work revealed that primordial follicle formation is regulated by RCN1, RCN3, actin, and HNRNPK, while the primordial follicle transformation to primary follicle is regulated by MVP and HSPA2. Therefore, our results provide further information for the prospective understanding of the molecular mechanism(s) involved in the regulation of the ovarian follicle development. PMID:28265575

  18. Leaf proteome rebalancing in Nicotiana benthamiana for upstream enrichment of a transiently expressed recombinant protein.

    PubMed

    Robert, Stéphanie; Goulet, Marie-Claire; D'Aoust, Marc-André; Sainsbury, Frank; Michaud, Dominique

    2015-10-01

    A key factor influencing the yield of biopharmaceuticals in plants is the ratio of recombinant to host proteins in crude extracts. Postextraction procedures have been devised to enrich recombinant proteins before purification. Here, we assessed the potential of methyl jasmonate (MeJA) as a generic trigger of recombinant protein enrichment in Nicotiana benthamiana leaves before harvesting. Previous studies have reported a significant rebalancing of the leaf proteome via the jasmonate signalling pathway, associated with ribulose 1,5-bisphosphate carboxylase oxygenase (RuBisCO) depletion and the up-regulation of stress-related proteins. As expected, leaf proteome alterations were observed 7 days post-MeJA treatment, associated with lowered RuBisCO pools and the induction of stress-inducible proteins such as protease inhibitors, thionins and chitinases. Leaf infiltration with the Agrobacterium tumefaciens bacterial vector 24 h post-MeJA treatment induced a strong accumulation of pathogenesis-related proteins after 6 days, along with a near-complete reversal of MeJA-mediated stress protein up-regulation. RuBisCO pools were partly restored upon infiltration, but most of the depletion effect observed in noninfiltrated plants was maintained over six more days, to give crude protein samples with 50% less RuBisCO than untreated tissue. These changes were associated with net levels reaching 425 μg/g leaf tissue for the blood-typing monoclonal antibody C5-1 expressed in MeJA-treated leaves, compared to less than 200 μg/g in untreated leaves. Our data confirm overall the ability of MeJA to trigger RuBisCO depletion and recombinant protein enrichment in N. benthamiana leaves, estimated here for C5-1 at more than 2-fold relative to host proteins.

  19. Combined effect of gender and caloric restriction on liver proteomic expression profile.

    PubMed

    Valle, Adamo; Silvestri, Elena; Moreno, Maria; Chambery, Angela; Oliver, Jordi; Roca, Pilar; Goglia, Fernando

    2008-07-01

    We analyzed the combined effect of gender and CR on protein expression profile in liver. We identified 27 differentially expressed proteins involved in several cellular functions such as substrate metabolism, antioxidant systems, stress response, iron homeostasis and cardiovascular protection. This study reveals new cellular pathways liable to be similarly regulated in females and calorie restricted rats and which could be related with the greater longevity in these animals.

  20. Differential Proteomic Profiles of Pleurotus ostreatus in Response to Lignocellulosic Components Provide Insights into Divergent Adaptive Mechanisms

    PubMed Central

    Xiao, Qiuyun; Ma, Fuying; Li, Yan; Yu, Hongbo; Li, Chengyun; Zhang, Xiaoyu

    2017-01-01

    Pleurotus ostreatus is a white rot fungus that grows on lignocellulosic biomass by metabolizing the main constituents. Extracellular enzymes play a key role in this process. During the hydrolysis of lignocellulose, potentially toxic molecules are released from lignin, and the molecules are derived from hemicellulose or cellulose that trigger various responses in fungus, thereby influencing mycelial growth. In order to characterize the mechanism underlying the response of P. ostreatus to lignin, we conducted a comparative proteomic analysis of P. ostreatus grown on different lignocellulose substrates. In this work, the mycelium proteome of P. ostreatus grown in liquid minimal medium with lignin, xylan, and carboxymethyl cellulose (CMC) was analyzed using the complementary two-dimensional gel electrophoresis (2-DE) approach; 115 proteins were identified, most of which were classified into five types according to their function. Proteins with an antioxidant function that play a role in the stress response were upregulated in response to lignin. Most proteins involving in carbohydrate and energy metabolism were less abundant in lignin. Xylan and CMC may enhanced the process of carbohydrate metabolism by regulating the level of expression of various carbohydrate metabolism-related proteins. The change of protein expression level was related to the adaptability of P. ostreatus to lignocellulose. These findings provide novel insights into the mechanisms underlying the response of white-rot fungus to lignocellulose. PMID:28386251

  1. Proteomics studies of pancreatic cancer

    PubMed Central

    Chen, Ru; Pan, Sheng; Aebersold, Ruedi; Brentnall, Teresa A.

    2008-01-01

    Pancreatic cancer is the fourth leading cause of cancer death in the United States, with 4% survival 5 years after diagnosis. Biomarkers are desperately needed to improve earlier, more curable cancer diagnosis and to develop new effective therapeutic targets. The development of quantitative proteomics technologies in recent years offers great promise for understanding the complex molecular events of tumorigenesis at the protein level, and has stimulated great interest in applying the technology for pancreatic cancer studies. Proteomic studies of pancreatic tissues, juice, serum/plasma, and cell lines have recently attempted to identify differentially expressed proteins in pancreatic cancer to dissect the abnormal signaling pathways underlying oncogenesis, and to detect new biomarkers. It can be expected that the continuing evolution of proteomics technology with better resolution and sensitivity will greatly enhance our capability in combating pancreatic cancer. PMID:18633454

  2. Proteomic profile of primary isolated rat mesangial cells in high-glucose culture condition and decreased expression of PSMA6 in renal cortex of diabetic rats.

    PubMed

    Li, Zhiguo; Zhang, Haojun; Dong, Xi; Burczynski, Frank J; Choy, Patrick; Yang, Fang; Liu, Hui; Li, Ping; Gong, Yuewen

    2010-08-01

    Diabetic nephropathy (DN) is one of the most important complications of diabetic patients and is characterized histologically by an accumulation of extracellular matrix (ECM) protein in the glomerular mesangium. Therefore, mesangial cells likely play an important role in the development of diabetic nephropathy. Here, we employed proteomic techniques to investigate the protein profile of rat mesangial cells under high-glucose culture conditions. Primary isolated rat glomerular mesangial cells were cultured under different concentrations of glucose (5.4 mmol.L-1 for normal control and 30 mmol.L-1 for high glucose) for 0, 8, 16, and 72 h, as well as for 25 days. Cellular total proteins were isolated from these cells and employed for two-dimensional gel electrophoresis (2-DE). Differentially expressed proteins were identified by matrix-assisted laser desorption - ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and some of these proteins were documented in rat models of diabetes by Western blot. Rat mesangial cells were successfully isolated in the laboratory and their proliferation rates were significantly inhibited by high glucose. Two-dimensional gel electrophoresis analyses revealed 28 differentially expressed protein spots between the normal and high-glucose groups. After MALDI-TOF-MS analysis, all 28 protein spots were successfully identified with the peptide mass fingerprint (PMF) method. Representatively, SOD1, PCBP1 and PSMA6 were validated by Western blot analysis following protein extractions from the normal and high-glucose groups. Abundance of these proteins was consistent with that found in 2-DE. Moreover, expression of SOD1, PCBP1, and PSMA6 in renal cortex was further examined in two rat models of diabetes (streptozotocin-induced and spontaneous OLETF diabetic models). Abundance of SOD1 and PCBP1 proteins did not show any significant difference between normal control and diabetic rats. However, abundance of the PSMA6 protein was significantly

  3. Proteomic analysis of the secretome of HepG2 cells indicates differential proteolytic processing after infection with dengue virus.

    PubMed

    Caruso, Marjolly B; Trugilho, Monique R O; Higa, Luiza M; Teixeira-Ferreira, André S; Perales, Jonas; Da Poian, Andrea T; Zingali, Russolina B

    2017-01-16

    Secretome analysis can be described as a subset of proteomics studies consisting in the analysis of the molecules secreted by cells or tissues. Dengue virus (DENV) infection can lead to a broad spectrum of clinical manifestations, with the severe forms of the disease characterized by hemostasis abnormalities and liver injury. The hepatocytes are a relevant site of viral replication and a major source of plasma proteins. Until now, we had limited information on the small molecules secreted by hepatic cells after infection by DENV. In the present study, we analysed a fraction of the secretome of mock- and DENV-infected hepatic cells (HepG2 cells) containing molecules with <10kDa, using different proteomic approaches. We identified 175 proteins, with 57 detected only in the samples from mock-infected cells, 59 only in samples from DENV-infected cells, and 59 in both conditions. Most of the peptides identified were derived from proteins larger than 10kDa, suggesting a proteolytic processing of the secreted molecules. Using in silico analysis, we predicted consistent differences between the proteolytic processing occurring in mock and DENV-infected samples, raising, for the first time, the hypothesis that differential proteolysis of secreted molecules would be involved in the pathogenesis of dengue.

  4. Proteomic responses reveal the differential effects induced by cadmium in mussels Mytilus galloprovincialis at early life stages.

    PubMed

    Xu, Lanlan; Peng, Xiao; Yu, Deliang; Ji, Chenglong; Zhao, Jianmin; Wu, Huifeng

    2016-08-01

    Cadmium (Cd) has become an important metal contaminant and posed severe risk on the organisms in the coastal environments of the Bohai Sea. Marine mussel Mytilus galloprovincialis is widely distributed along the Bohai coast and consumed as seafood by local residents. Evidences indicate that the early stages of marine organisms are more sensitive to metal contaminants. In this study, we applied two-dimensional electrophoresis-based proteomics to characterize the biological effects of Cd (50 μg L(-1)) in the early life stages (D-shape larval and juvenile) of mussels. The different proteomic responses demonstrated the differential responsive mechanisms to Cd exposure in these two early life stages of mussels. In details, results indicated that Cd mainly induced immune and oxidative stresses in both D-shape larval and juvenile mussels via different pathways. In addition, the significant up-regulation of triosephosphate isomerase and metallothionein confirmed the enhanced energy demand and mobilized detoxification mechanism in D-shape larval mussels exposed to Cd. In juvenile mussels, Cd exposure also induced clear apoptosis. Overall, this work suggests that Cd is a potential immune toxicant to mussel M. galloprovincialis at early life stages.

  5. Poly(I:C) treatment influences the expression of calreticulin and profilin-1 in a human HNSCC cell line: a proteomic study.

    PubMed

    Matijević, Tanja; Pavelić, Jasminka

    2012-08-01

    Polyinosinic:polycytidylic acid (poly (I:C)) has been formerly known to be an interferon inducer but the mechanism of its action was not revealed until the discovery of Toll-like receptors (TLRs). TLRs are members of transmembrane proteins that recognize conserved molecular motifs of viral and bacterial origin and initiate innate immune response. Recent studies have shown that they are also expressed on tumor cells, but their role in these cells is still not clear. TLR3 recognizes double-stranded RNA (poly (I:C)) and is primarily involved in the defense against viruses. TLR3 ligand binding initiates the activation of transcription factors NF-κB, IRF family members, and AP-1, which can induce wide cascading effect on the cell and consequently activate many cellular processes. Since little is known about TLR3 target genes, we have used the proteomic approach to widen the current knowledge. In this study, we have discovered 15 differentially expressed proteins, mostly connected with protein metabolic processes. Furthermore, we have confirmed by Western blot that calreticulin and profilin-1, proteins which have been shown previously to be involved in processes connected with tumor progression, are differentially expressed after poly(I:C) treatment. By using TLR3 small interfering RNA, we showed that calreticulin expression might be TLR3 dependent, unlike profilin-1.

  6. Differentially expressed nuclear proteins in human CCRF-CEM, HL-60, MEC-1 and Raji cells correlate with cellular properties.

    PubMed

    Henrich, Silke; Crossett, Ben; Christopherson, Richard I

    2007-10-01

    The human cell lines CCRF-CEM (T-cell acute lymphocytic leukemia), HL-60 (acute myeloid leukemia), MEC-1 (B-cell chronic lymphocytic leukemia) and Raji (Burkitt's B-cell lymphoma) have been analysed for differences in their nuclear proteomes. Using 2-D DIGE, 55 nuclear proteins have been identified that are differentially expressed (p<0.025) between the four cell lines, including proteins associated with transcription, proliferation, DNA repair and apoptosis. Of these 55 proteins, 22 were over-expressed in just one cell line, and four were down-regulated in one cell line. Proteins uniquely over-expressed between myeloid and lymphoid cell lines include those that may have use as markers for diagnosis, disease progression and B-cell maturation and differentiation. Expression of various proliferation-associated nuclear proteins correlated with relative growth rates of the cell lines, giving these proteins potential diagnostic applications for distinction of chronic versus acute subtypes of haematological malignancies. Identification of these differentially expressed nuclear proteins should facilitate elucidation of the molecular mechanisms underlying leukocyte differentiation and transformation to leukemias and lymphomas. The nuclear expression profiles should enable classification of subtypes of leukemia, and identify potential nuclear protein targets for development of diagnostic and therapeutic strategies.

  7. Identification of Differentially Expressed Proteins in Direct Expressed Prostatic Secretions of Men with Organ-confined Versus Extracapsular Prostate Cancer*

    PubMed Central

    Kim, Yunee; Ignatchenko, Vladimir; Yao, Cindy Q.; Kalatskaya, Irina; Nyalwidhe, Julius O.; Lance, Raymond S.; Gramolini, Anthony O.; Troyer, Dean A.; Stein, Lincoln D.; Boutros, Paul C.; Medin, Jeffrey A.; Semmes, O. John; Drake, Richard R.; Kislinger, Thomas

    2012-01-01

    Current protocols for the screening of prostate cancer cannot accurately discriminate clinically indolent tumors from more aggressive ones. One reliable indicator of outcome has been the determination of organ-confined versus nonorgan-confined disease but even this determination is often only made following prostatectomy. This underscores the need to explore alternate avenues to enhance outcome prediction of prostate cancer patients. Fluids that are proximal to the prostate, such as expressed prostatic secretions (EPS), are attractive sources of potential prostate cancer biomarkers as these fluids likely bathe the tumor. Direct-EPS samples from 16 individuals with extracapsular (n = 8) or organ-confined (n = 8) prostate cancer were used as a discovery cohort, and were analyzed in duplicate by a nine-step MudPIT on a LTQ-Orbitrap XL mass spectrometer. A total of 624 unique proteins were identified by at least two unique peptides with a 0.2% false discovery rate. A semiquantitative spectral counting algorithm identified 133 significantly differentially expressed proteins in the discovery cohort. Integrative data mining prioritized 14 candidates, including two known prostate cancer biomarkers: prostate-specific antigen and prostatic acid phosphatase, which were significantly elevated in the direct-EPS from the organ-confined cancer group. These and five other candidates (SFN, MME, PARK7, TIMP1, and TGM4) were verified by Western blotting in an independent set of direct-EPS from patients with biochemically recurrent disease (n = 5) versus patients with no evidence of recurrence upon follow-up (n = 10). Lastly, we performed proof-of-concept SRM-MS-based relative quantification of the five candidates using unpurified heavy isotope-labeled synthetic peptides spiked into pools of EPS-urines from men with extracapsular and organ-confined prostate tumors. This study represents the first efforts to define the direct-EPS proteome from two major subclasses of prostate cancer

  8. The genomics and proteomics of biofilm formation

    PubMed Central

    Sauer, Karin

    2003-01-01

    Bacterial communities that are attached to a surface, so-called biofilms, and their inherent resistance to antimicrobial agents are a cause of many persistent and chronic bacterial infections. Recent genomic and proteomic studies have identified many of the genes and gene products differentially expressed during biofilm formation, revealing the complexity of this developmental process. PMID:12801407

  9. Differential proteomic response to heat stress in thermal Agrostis scabra and heat-sensitive Agrostis stolonifera.

    PubMed

    Xu, Chenping; Huang, Bingru

    2010-06-01

    Knowledge of heat-responsive proteins is critical for further understanding of the molecular mechanisms of heat tolerance. The objective of this study was to compare proteins differentially expressed in two C(3) grass species contrasting in heat tolerance, heat-tolerant thermal Agrostis scabra and heat-sensitive Agrostis stolonifera L., and to identify heat-responsive proteins for short- and long-term responses. Plants were exposed to 20/15 degrees C (day/night, control) or 40/35 degrees C (day/night, heat stress) in growth chambers. Leaves were harvested at 2 and 10 days after temperature treatment. Proteins were extracted and separated by fluorescence difference gel electrophoresis (DIGE). Thermal A. scabra had superior heat tolerance than A. stolonifera, as indicated by the maintenance of higher chlorophyll content and photochemical efficiency under heat stress. The two-dimensional difference electrophoresis detected 68 heat-responsive proteins in the two species. Thermal A. scabra had more protein spots either down- or up-regulated at 2 days of heat stress, but fewer protein spots were altered at 10 days of heat stress compared with A. stolonifera. Many protein spots exhibited transient down-regulation in thermal A. scabra (only at 2 days of heat treatment), whereas down-regulation of many proteins was also found at 10 days of heat treatment in A. stolonifera, which suggested that protein metabolism in thermal A. scabra might acclimate to heat stress more rapidly than those in A. stolonifera. The sequences of 56 differentially expressed protein spots were identified using mass spectrometry. The results suggest that the maintenance or less severe down-regulation of proteins during long-term (10 days) heat stress may contribute to the superior heat tolerance in thermal A. scabra, including those involved in photosynthesis [RuBisCo, RuBisCo activase, chloroplastic glyceraldehydes-3-phosphate dehydrogenase (GAPDH), chloroplastic aldolase, oxygen-evolving complex

  10. Proteomic identification of abnormally expressed proteins in early-stage placenta derived from cloned cat embryos.

    PubMed

    Bang, Jae-Il; Lee, Hyo-Sang; Deb, Gautam Kumar; Ha, A-Na; Kwon, Young-Sang; Cho, Seong-Keun; Kim, Byeong-Woo; Cho, Kyu-Woan; Kong, Il-Keun

    2013-01-15

    It is unknown whether gene expression in cloned placenta during pre- and postimplantation is associated with early pregnancy failure in the cat. In this study, protein expression patterns were examined in early-stage (21-day-old) domestic cat placentas of fetuses derived from AI (CP; N = 4) and cloned embryo transfer (CEP; N = 2). Differentially expressed proteins were analyzed by two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight (TOF) mass spectrometry (MS). A total of 21 proteins were aberrantly expressed (P < 0.05) by >1.5-fold in CEP compared with CP. Compared with CP, 12 proteins were upregulated in CEP (peptidyl-prolyl cis-trans isomerase A, annexin A2, protein DJ-1, adenylate kinase isoenzyme 1, protein disulfide-isomerase A3, actin cytoplasmic 1, serum albumin, protein disulfide-isomerase A6, and triosephosphate isomerase), and nine proteins were downregulated (triosephosphate isomerase; heterogeneous nuclear ribonucleoprotein H; tropomyosin alpha-4; triosephosphate isomerase 1; 60 kDa heat shock protein, mitochondrial; serum albumin; calumenin; keratin type 1; and prohibitin). The identities of the differentially expressed proteins were validated by peptide mass fingerprinting using matrix-assisted laser desorption/ionization-TOF/TOF MS/MS. The abnormally expressed proteins identified in this study might be associated with impaired development and dysfunction of CEP during early pregnancy. Abnormal protein expression might also induce fetal loss and contribute to failure to maintain pregnancy to term.

  11. α-Syntrophin Modulates Myogenin Expression in Differentiating Myoblasts

    PubMed Central

    Kim, Min Jeong; Hwang, Sung Ho; Lim, Jeong A.; Froehner, Stanley C.; Adams, Marvin E.; Kim, Hye Sun

    2010-01-01

    Background α-Syntrophin is a scaffolding protein linking signaling proteins to the sarcolemmal dystrophin complex in mature muscle. However, α-syntrophin is also expressed in differentiating myoblasts during the early stages of muscle differentiation. In this study, we examined the relationship between the expression of α-syntrophin and myogenin, a key muscle regulatory factor. Methods and Findings The absence of α-syntrophin leads to reduced and delayed myogenin expression. This conclusion is based on experiments using muscle cells isolated from α-syntrophin null mice, muscle regeneration studies in α-syntrophin null mice, experiments in Sol8 cells (a cell line that expresses only low levels of α-syntrophin) and siRNA studies in differentiating C2 cells. In primary cultured myocytes isolated from α-syntrophin null mice, the level of myogenin was less than 50% that from wild type myocytes (p<0.005) 40 h after differentiation induction. In regenerating muscle, the expression of myogenin in the α-syntrophin null muscle was reduced to approximately 25% that of wild type muscle (p<0.005). Conversely, myogenin expression is enhanced in primary cultures of myoblasts isolated from a transgenic mouse over-expressing α-syntrophin and in Sol8 cells transfected with a vector to over-express α-syntrophin. Moreover, we find that myogenin mRNA is reduced in the absence of α-syntrophin and increased by α-syntrophin over-expression. Immunofluorescence microscopy shows that α-syntrophin is localized to the nuclei of differentiating myoblasts. Finally, immunoprecipitation experiments demonstrate that α-syntrophin associates with Mixed-Lineage Leukemia 5, a regulator of myogenin expression. Conclusions We conclude that α-syntrophin plays an important role in regulating myogenesis by modulating myogenin expression. PMID:21179410

  12. Proteomic analysis reveals contrasting stress response to uranium in two nitrogen-fixing Anabaena strains, differentially tolerant to uranium.

    PubMed

    Panda, Bandita; Basu, Bhakti; Acharya, Celin; Rajaram, Hema; Apte, Shree Kumar

    2017-01-01

    Two strains of the nitrogen-fixing cyanobacterium Anabaena, native to Indian paddy fields, displayed differential sensitivity to exposure to uranyl carbonate at neutral pH. Anabaena sp. strain PCC 7120 and Anabaena sp. strain L-31 displayed 50% reduction in survival (LD50 dose), following 3h exposure to 75μM and 200μM uranyl carbonate, respectively. Uranium responsive proteome alterations were visualized by 2D gel electrophoresis, followed by protein identification by MALDI-ToF mass spectrometry. The two strains displayed significant differences in levels of proteins associated with photosynthesis, carbon metabolism, and oxidative stress alleviation, commensurate with their uranium tolerance. Higher uranium tolerance of Anabaena sp. strain L-31 could be attributed to sustained photosynthesis and carbon metabolism and superior oxidative stress defense, as compared to the uranium sensitive Anabaena sp. strain PCC 7120.

  13. Environmental enrichment alters protein expression as well as the proteomic response to cocaine in rat nucleus accumbens

    PubMed Central

    Lichti, Cheryl F.; Fan, Xiuzhen; English, Robert D.; Zhang, Yafang; Li, Dingge; Kong, Fanping; Sinha, Mala; Andersen, Clark R.; Spratt, Heidi; Luxon, Bruce A.; Green, Thomas A.

    2014-01-01

    Prior research demonstrated that environmental enrichment creates individual differences in behavior leading to a protective addiction phenotype in rats. Understanding the mechanisms underlying this phenotype will guide selection of targets for much-needed novel pharmacotherapeutics. The current study investigates differences in proteome expression in the nucleus accumbens of enriched and isolated rats and the proteomic response to cocaine self-administration using a liquid chromatography mass spectrometry (LCMS) technique to quantify 1917 proteins. Results of complementary Ingenuity Pathways Analyses (IPA) and gene set enrichment analyses (GSEA), both performed using protein quantitative data, demonstrate that cocaine increases vesicular transporters for dopamine and glutamate as well as increasing proteins in the RhoA pathway. Further, cocaine regulates proteins related to ERK, CREB and AKT signaling. Environmental enrichment altered expression of a large number of proteins implicated in a diverse number of neuronal functions (e.g., energy production, mRNA splicing, and ubiquitination), molecular cascades (e.g., protein kinases), psychiatric disorders (e.g., mood disorders), and neurodegenerative diseases (e.g., Huntington's and Alzheimer's diseases). Upregulation of energy metabolism components in EC rats was verified using RNA sequencing. Most of the biological functions and pathways listed above were also identified in the Cocaine X Enrichment interaction analysis, providing clear evidence that enriched and isolated rats respond quite differently to cocaine exposure. The overall impression of the current results is that enriched saline-administering rats have a unique proteomic complement compared to enriched cocaine-administering rats as well as saline and cocaine-taking isolated rats. These results identify possible mechanisms of the protective phenotype and provide fertile soil for developing novel pharmacotherapeutics. Proteomics data are available via

  14. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  15. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  16. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  17. Medicago truncatula root nodule proteome analysis reveals differential plant and bacteroid responses to drought stress.

    PubMed

    Larrainzar, Estíbaliz; Wienkoop, Stefanie; Weckwerth, Wolfram; Ladrera, Rubén; Arrese-Igor, Cesar; González, Esther M

    2007-07-01

    Drought is one of the environmental factors most affecting crop production. Under drought, symbiotic nitrogen fixation is one of the physiological processes to first show stress responses in nodulated legumes. This inhibition process involves a number of factors whose interactions are not yet understood. This work aims to further understand changes occurring in nodules under drought stress from a proteomic perspective. Drought was imposed on Medicago truncatula 'Jemalong A17' plants grown in symbiosis with Sinorhizobium meliloti strain 2011. Changes at the protein level were analyzed using a nongel approach based on liquid chromatography coupled to tandem mass spectrometry. Due to the complexity of nodule tissue, the separation of plant and bacteroid fractions in M. truncatula root nodules was first checked with the aim of minimizing cross contamination between the fractions. Second, the protein plant fraction of M. truncatula nodules was profiled, leading to the identification of 377 plant proteins, the largest description of the plant nodule proteome so far. Third, both symbiotic partners were independently analyzed for quantitative differences at the protein level during drought stress. Multivariate data mining allowed for the classification of proteins sets that were involved in drought stress responses. The isolation of the nodule plant and bacteroid protein fractions enabled the independent analysis of the response of both counterparts, gaining further understanding of how each symbiotic member is distinctly affected at the protein level under a water-deficit situation.

  18. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  19. Remedial Strategies in Structural Proteomics: Expression, Purification and Crystallization of the Vav1/Rac1 Complex

    PubMed Central

    Brooun, Alexei; Foster, Scott A.; Chrencik, Jill E.; Chien, Ellen Y.T.; Kolatkar, Anand R.; Streiff, Markus; Ramage, Paul; Widmer, Hans; Weckbecker, Gisbert; Kuhn, Peter

    2007-01-01

    The signal transduction pathway involving the Vav1 guanine nucleotide exchange factor (GEF) and the Rac1 GTPase plays several key roles in the immune response mediated by the T cell receptor. Vav1 is also a unique member of the GEF family in that it contains a cysteine-rich domain (CRD) that is critical for Rac1 binding and maximal guanine nucleotide exchange activity, and thus may provide a unique protein-protein interface compared to other GEF/GTPase pairs. Here we have applied a number of remedial structural proteomics strategies, such as construct and expression optimization, surface mutagenesis, limited proteolysis, and protein formulation to successfully express, purify, and crystallize the Vav1-DH-PH-CRD/Rac1 complex in an active conformation. We have also systematically characterized various Vav1 domains in a GEF assay, and Rac1 in vitro binding experiments. In the context of Vav1-DH-PH-CRD, the zinc finger motif of the CRD is required for the expression of stable Vav1, as well as for activity in both a GEF assay and in vitro formation of a Vav1/Rac1 complex suitable for biophysical and structural characterization. Our data also indicate that the isolated CRD maintains a low level of specific binding to Rac1, appears to be folded based on 1D-NMR analysis and coordinates two zinc ions based on ICP-MS analysis. The protein reagents generated here are essential tools for the determination of a three dimensional Vav1/Rac1 complex crystal structure and possibly for the identification of inhibitors of the Vav1/Rac1 protein-protein interaction with potential to inhibit lymphocyte activation. PMID:17275330

  20. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia.

    PubMed

    Schrans-Stassen, B H; van de Kant, H J; de Rooij, D G; van Pelt, A M

    1999-12-01

    The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16%+/-2% (mean +/- SD), in VII 45%+/-15%, in IX/X 78%+/-14% and in XII 90%+/-1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.

  1. Quantitative proteomic analysis to decipher the differential apoptotic response of bortezomib-treated APL cells before and after retinoic acid differentiation reveals involvement of protein toxicity mechanisms.

    PubMed

    Uttenweiler-Joseph, Sandrine; Bouyssié, David; Calligaris, David; Lutz, Pierre G; Monsarrat, Bernard; Burlet-Schiltz, Odile

    2013-01-01

    The ubiquitin-proteasome system allows the targeted degradation of proteins and plays a critical role in the regulation of many cellular processes. Proteasome inhibition is a recent antitumor therapeutic strategy and bortezomib was the first proteasome inhibitor approved for clinical use. In this study, we used the NB4 cell line to investigate the effects of bortezomib toward acute promyelocytic leukemia cells before and after retinoic acid-induced differentiation. We showed that apoptosis level after bortezomib treatment is higher in NB4 cells than in differentiated NB4 cells. To compare early protein variations upon bortezomib treatment in both NB4 cell populations, we performed a quantitative proteomic analysis based on iTRAQ peptide labeling followed by data analysis with in-house developed scripts. This strategy revealed the regulation of 14 proteins principally involved in protein stress response and apoptosis in NB4 cells after proteasome inhibition. Altogether, our results suggest that the differential level of apoptosis induced by bortezomib treatment in both NB4 cell populations could result from distinct protein toxicity level.

  2. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.

    2015-01-01

    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor (http://bioconductor.org/). Contact: jtleek@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  3. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  4. Spirulina phycocyanin induces differential protein expression and apoptosis in SKOV-3 cells.

    PubMed

    Pan, Ruowang; Lu, Rongmao; Zhang, Ying; Zhu, Mei; Zhu, Wen; Yang, Rongrong; Zhang, Enyong; Ying, Jun; Xu, Teng; Yi, Huiguang; Li, Jinsong; Shi, Mengru; Zhou, Li; Xu, Zuyuan; Li, Peizhen; Bao, Qiyu

    2015-11-01

    The present study was designed to determine the effects of phycocyanin (PC) on Human ovarian cancer SKOV-3 cells and the underlying molecular mechanisms of action. The inhibitory effects of PC on the cell proliferation were detected by MTT assay. The IC50 values of PC were 182.0μM and 133.6μM for 24h and 48h exposure, respectively. PC induced apoptosis in SKOV-3 cells was observed by electron microscopy and flow cytometry. The apoptosis rate was increased from 1.6% to 19.8% after PC exposure. The fluorescence intensity of ROS and the activities of Caspase-3, Caspase-8, and Caspase-9 were increased. Differentiated expression protein spots were selected and identified using proteomic techniques. There were 698±73 and 683±79 protein spots resolved in untreated and PC-treated cells, respectively. Forty five differential protein spots were analyzed by MALDI-TOF-MS, including mtSSB, PSME3, and nucleolin. The mRNA expression profiles determined by RT-PCR were consistent with that of the two-dimensional electrophoresis. The decreased proteins such as HSP60, nucleolin, PPase, peroxiredoxin-4 and the increased protein (mtSSB) were identified in SKOV-3 cells after PC treatment, indicating that the effects of PC on tumor cell apoptosis may be relate to multiple target proteins. And the mitochondrial pathway may be the main pathway for PC-induced apoptosis.

  5. Gene Expression and Proteome Analysis as Sources of Biomarkers in Basal Cell Carcinoma

    PubMed Central

    Ghita, Mihaela Adriana; Voiculescu, Suzana; Rosca, Adrian E.; Moraru, Liliana; Greabu, Maria

    2016-01-01

    Basal cell carcinoma (BCC) is the world's leading skin cancer in terms of frequency at the moment and its incidence continues to rise each year, leading to profound negative psychosocial and economic consequences. UV exposure is the most important environmental factor in the development of BCC in genetically predisposed individuals, this being reflected by the anatomical distribution of lesions mainly on sun-exposed skin areas. Early diagnosis and prompt management are of crucial importance in order to prevent local tissue destruction and subsequent disfigurement. Although various noninvasive or minimal invasive techniques have demonstrated their utility in increasing diagnostic accuracy of BCC and progress has been made in its treatment options, recurrent, aggressive, and metastatic variants of BCC still pose significant challenge for the healthcare system. Analysis of gene expression and proteomic profiling of tumor cells and of tumoral microenvironment in various tissues strongly suggests that certain molecules involved in skin cancer pathogenic pathways might represent novel predictive and prognostic biomarkers in BCC. PMID:27578920

  6. Differential Expression and Network Inferences through Functional Data Modeling

    PubMed Central

    Telesca, Donatello; Inoue, Lurdes Y.T.; Neira, Mauricio; Etzioni, Ruth; Gleave, Martin; Nelson, Colleen

    2010-01-01

    Time–course microarray data consist of mRNA expression from a common set of genes collected at different time points. Such data are thought to reflect underlying biological processes developing over time. In this article we propose a model that allows us to examine differential expression and gene network relationships using time course microarray data. We model each gene expression profile as a random functional transformation of the scale, amplitude and phase of a common curve. Inferences about the gene–specific amplitude parameters allow us to examine differential gene expression. Inferences about measures of functional similarity based on estimated time transformation functions allow us to examine gene networks while accounting for features of the gene expression profiles. We discuss applications to simulated data as well as to microarray data on prostate cancer progression. PMID:19053995

  7. Differential Expression of Cysteine Dioxygenase 1 in Complex Karyotype Liposarcomas

    PubMed Central

    Shaker, Mohammed; Pascarelli, Kara M; Plantinga, Matthew J; Love, Miles A; Lazar, Alexander J; Ingram, Davis R; von Mehren, Margaret; Lev, Dina; Kipling, David; Broccoli, Dominique

    2014-01-01

    Altered cysteine dioxygenase 1 (CDO1) gene expression has been observed in several cancers but has not yet been investigated in liposarcomas. The aim of this study was to evaluate CDO1 expression in a cohort of liposarcomas and to determine its association with clinicopathological features. Existing microarray data indicated variable CDO1 expression in liposarcoma subtypes. CDO1 mRNA from a larger cohort of liposarcomas was quantified by real time-PCR, and CDO1 protein expression was determined by immunohistochemistry (IHC) in more than 300 tumor specimens. Well-differentiated liposarcomas (WDLSs) had significantly higher CDO1 gene expression and protein levels than dedifferentiated liposarcomas (DDLSs) (P < 0.001). Location of the tumor was not predictive of the expression level of CDO1 mRNA in any histological subtype of liposarcoma. Recurrent tumors did not show any difference in CDO1 expression when compared to primary tumors. CDO1 expression was upregulated as human mesenchymal stem cells (hMSCs) undergo differentiation into mature adipocytes. Our results suggest that CDO1 is a marker of liposarcoma progression and adipogenic differentiation. PMID:24741338

  8. Differential Expression of In Vivo and In Vitro Protein Profile of Outer Membrane of Acidovorax avenae Subsp. avenae

    PubMed Central

    Qiu, Hui; Li, Bin; Jabeen, Amara; Li, Liping; Liu, He; Kube, Michael; Xie, Guanlin; Wang, Yanli; Sun, Guochang

    2012-01-01

    Outer membrane (OM) proteins play a significant role in bacterial pathogenesis. In this work, we examined and compared the expression of the OM proteins of the rice pathogen Acidovorax avenae subsp. avenae strain RS-1, a Gram-negative bacterium, both in an in vitro culture medium and in vivo rice plants. Global proteomic profiling of A. avenae subsp. avenae strain RS-1 comparing in vivo and in vitro conditions revealed the differential expression of proteins affecting the survival and pathogenicity of the rice pathogen in host plants. The shotgun proteomics analysis of OM proteins resulted in the identification of 97 proteins in vitro and 62 proteins in vivo by mass spectrometry. Among these OM proteins, there is a high number of porins, TonB-dependent receptors, lipoproteins of the NodT family, ABC transporters, flagellins, and proteins of unknown function expressed under both conditions. However, the major proteins such as phospholipase and OmpA domain containing proteins were expressed in vitro, while the proteins such as the surface anchored protein F, ATP-dependent Clp protease, OmpA and MotB domain containing proteins were expressed in vivo. This may indicate that these in vivo OM proteins have roles in the pathogenicity of A. avenae subsp. avenae strain RS-1. In addition, the LC-MS/MS identification of OmpA and MotB validated the in silico prediction of the existance of Type VI secretion system core components. To the best of our knowledge, this is the first study to reveal the in vitro and in vivo protein profiles, in combination with LC-MS/MS mass spectra, in silico OM proteome and in silico genome wide analysis, of pathogenicity or plant host required proteins of a plant pathogenic bacterium. PMID:23166741

  9. Proteomic dataset for altered glycoprotein expression upon GALNT3 knockdown in ovarian cancer cells.

    PubMed

    Sheta, Razan; Roux-Dalvai, Florence; Woo, Christina M; Fournier, Frédéric; Bourassa, Sylvie; Bertozzi, Carolyn R; Droit, Arnaud; Bachvarov, Dimcho

    2016-09-01

    This article contains raw and processed data related to research published in "Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation" [1]. The data presented here was obtained with the application of a bioorthogonal chemical reporter strategy analyzing differential glycoprotein expression following the knock-down (KD) of the GALNT3 gene in the epithelial ovarian cancer (EOC) cell line A2780s. LC-MS/MS mass spectrometry analysis was then performed and the processed data related to the identified glycoproteins show that several hundred proteins are differentially expressed between control and GALNT3 KD A2780s cells. The obtained data also uncover numerous novel glycoproteins; some of which could represent new potential EOC biomarkers and/or therapeutic targets.

  10. Integration of amplified differential gene expression (ADGE) and DNA microarray.

    PubMed

    Chen, Zhijian J; Gaté, Laurent; Davis, Warren; Ile, Kristina E; Tew, Kenneth D

    2002-12-01

    Amplified Differential Gene Expression (ADGE) provides a new concept that the ratios of differentially expressed genes are magnified before detection in order to improve both sensitivity and accuracy. This technology is now implemented with integration of DNA reassociation and PCR. The ADGE technique can be used either as a stand-alone method or in series with DNA microarray. ADGE is used in sample preprocessing and DNA microarray is used as a displaying system in the series combination. These two techniques are mutually synergistic: the quadratic magnification of ratios of differential gene expression achieved by ADGE improves the detection sensitivity and accuracy; the PCR amplification of templates enhances the signal intensity and reduces the requirement for large amounts of starting material; the high throughput for DNA microarray is maintained.

  11. Differential protein expression on the cell surface of colorectal cancer cells associated to tumor metastasis.

    PubMed

    Luque-García, Jose Luis; Martínez-Torrecuadrada, Jorge Luis; Epifano, Carolina; Cañamero, Marta; Babel, Ingrid; Casal, J Ignacio

    2010-03-01

    Progression to metastasis is the critical point in colorectal cancer (CRC) survival. However, the proteome associated to CRC metastasis is very poorly understood at the moment. In this study, we used stable isotope labeling by amino acids in cell culture to compare two CRC cell lines: KM12C and KM12SM, representing poorly versus highly metastatic potential, to find and quantify the differences in protein expression, mostly at the cell surface level. After biotinylation followed by affinity purification, membrane proteins were separated by SDS-PAGE and analyzed using nanoflow LC-ESI-LTQ. A total of 291 membrane and membrane-associated proteins were identified with a p value<0.01, from which 60 proteins were found to be differentially expressed by more than 1.5-fold. We identified a number of cell signaling, CDs, integrins and other cell adhesion molecules (cadherin 17, junction plakoglobin (JUP)) among the most deregulated proteins. They were validated by Western blot, confocal microscopy and flow cytometry analysis. Immunohistochemical analysis of paired tumoral samples confirmed that these differentially expressed proteins were also altered in human tumoral tissues. A good correlation with a major abundance in late tumor stages was observed for JUP and 17-beta-hydroxysteroid dehydrogenase type 8 (HSD17B8). Moreover, the combined increase in JUP, occludin and F11 receptor expression together with cadherin 17 expression could suggest a reversion to a more epithelial phenotype in highly metastatic cells. Relevant changes were observed also at the metabolic level in the pentose phosphate pathway and several amino acid transporters. In summary, the identified proteins provide us with a better understanding of the events involved in liver colonization and CRC metastasis.

  12. Annotating N termini for the human proteome project: N termini and Nα-acetylation status differentiate stable cleaved protein species from degradation remnants in the human erythrocyte proteome.

    PubMed

    Lange, Philipp F; Huesgen, Pitter F; Nguyen, Karen; Overall, Christopher M

    2014-04-04

    A goal of the Chromosome-centric Human Proteome Project is to identify all human protein species. With 3844 proteins annotated as "missing", this is challenging. Moreover, proteolytic processing generates new protein species with characteristic neo-N termini that are frequently accompanied by altered half-lives, function, interactions, and location. Enucleated and largely void of internal membranes and organelles, erythrocytes are simple yet proteomically challenging cells due to the high hemoglobin content and wide dynamic range of protein concentrations that impedes protein identification. Using the N-terminomics procedure TAILS, we identified 1369 human erythrocyte natural and neo-N-termini and 1234 proteins. Multiple semitryptic N-terminal peptides exhibited improved mass spectrometric identification properties versus the intact tryptic peptide enabling identification of 281 novel erythrocyte proteins and six missing proteins identified for the first time in the human proteome. With an improved bioinformatics workflow, we developed a new classification system and the Terminus Cluster Score. Thereby we described a new stabilizing N-end rule for processed protein termini, which discriminates novel protein species from degradation remnants, and identified protein domain hot spots susceptible to cleavage. Strikingly, 68% of the N-termini were within genome-encoded protein sequences, revealing alternative translation initiation sites, pervasive endoproteolytic processing, and stabilization of protein fragments in vivo. The mass spectrometry proteomics data have been deposited to ProteomeXchange with the data set identifier .

  13. Plant proteomics update (2007-2008): Second-generation proteomic techniques, an appropriate experimental design, and data analysis to fulfill MIAPE standards, increase plant proteome coverage and expand biological knowledge.

    PubMed

    Jorrín-Novo, Jesús V; Maldonado, Ana M; Echevarría-Zomeño, Sira; Valledor, Luis; Castillejo, Mari A; Curto, Miguel; Valero, José; Sghaier, Besma; Donoso, Gabriel; Redondo, Inmaculada

    2009-04-13

    This review is the continuation of three previously published articles [Jorrin JV, Maldonado AM, Castillejo MA. Plant proteome analysis: a 2006 update. Proteomics 2007; 7: 2947-2962; Rossignol M, Peltier JB, Mock HP, Matros A, Maldonado AM, Jorrin JV. Plant proteome analysis: a 2004-2006 update. Proteomics 2006; 6: 5529-5548; Canovas FM, Dumas-Gaudot E, Recorbet G, Jorrin J, Mock HP, Rossignol M. Plant proteome analysis. Proteomics 2004; 4: 285-298] and aims to update the contribution of Proteomics to plant research between 2007 and September 2008 by reviewing most of the papers, which number approximately 250, that appeared in the Plant Proteomics field during that period. Most of the papers published deal with the proteome of Arabidopsis thaliana and rice (Oryza sativa), and focus on profiling organs, tissues, cells or subcellular proteomes, and studying developmental processes and responses to biotic and abiotic stresses using a differential expression strategy. Although the platform based on 2-DE is still the most commonly used, the use of gel-free and second-generation Quantitative Proteomic techniques has increased. Proteomic data are beginning to be validated using complementary -omics or classical biochemical or cellular biology techniques. In addition, appropriate experimental design and statistical analysis are being carried out in accordance with the required Minimal Information about a Proteomic Experiment (MIAPE) standards. As a result, the coverage of the plant cell proteome and the plant biology knowledge is increasing. Compared to human and yeast systems, however, plant biology research has yet to exploit fully the potential of proteomics, in particular its applications to PTMs and Interactomics.

  14. Proteomics of Breast Muscle Tissue Associated with the Phenotypic Expression of Feed Efficiency within a Pedigree Male Broiler Line: I. Highlight on Mitochondria

    PubMed Central

    Kong, Byung-Whi; Lassiter, Kentu; Piekarski-Welsher, Alissa; Dridi, Sami; Reverter-Gomez, Antonio; Hudson, Nicholas James; Bottje, Walter Gay

    2016-01-01

    As feed represents 60 to 70% of the cost of raising an animal to market weight, feed efficiency (the amount of dry weight intake to amount of wet weight gain) remains an important genetic trait in animal agriculture. To gain greater understanding of cellular mechanisms of feed efficiency (FE), shotgun proteomics was conducted using in-gel trypsin digestion and tandem mass spectrometry on breast muscle samples obtained from pedigree male (PedM) broilers exhibiting high feed efficiency (FE) or low FE phenotypes (n = 4 per group). The high FE group had greater body weight gain (P = 0.004) but consumed the same amount of feed (P = 0.30) from 6 to 7 wk resulting in higher FE (P < 0.001). Over 1800 proteins were identified, of which 152 were different (P < 0.05) by at least 1.3 fold and ≤ 15 fold between the high and low FE phenotypes. Data were analyzed for a modified differential expression (DE) metric (Phenotypic Impact Factors or PIF) and interpretation of protein expression data facilitated using the Ingenuity Pathway Analysis (IPA) program. In the entire data set, 228 mitochondrial proteins were identified whose collective expression indicates a higher mitochondrial expression in the high FE phenotype (binomial probability P < 0.00001). Within the top up and down 5% PIF molecules in the dataset, there were 15 mitoproteome proteins up-regulated and only 5 down-regulated in the high FE phenotype. Pathway enrichment analysis also identified mitochondrial dysfunction and oxidative phosphorylation as the number 1 and 5 differentially expressed canonical pathways (up-regulated in high FE) in the proteomic dataset. Upstream analysis (based on DE of downstream molecules) predicted that insulin receptor, insulin like growth receptor 1, nuclear factor, erythroid 2-like 2, AMP activated protein kinase (α subunit), progesterone and triiodothyronine would be activated in the high FE phenotype whereas rapamycin independent companion of target of rapamycin, mitogen activated

  15. Proteomic Analyses Reveal High Expression of Decorin and Endoplasmin (HSP90B1) Are Associated with Breast Cancer Metastasis and Decreased Survival

    PubMed Central

    Dharsee, Moyez; Tran-Thanh, Danh; Ackloo, Suzanne; Zhu, Pei Hong; Sardana, Girish; Chen, Jian; Kupchak, Peter; Jacks, Lindsay M.; Miller, Naomi A.; Youngson, Bruce J.; Iakovlev, Vladimir; Guidos, Cynthia J.; Vallis, Katherine A.; Evans, Kenneth R.; McCready, David; Leong, Wey L.; Done, Susan J.

    2012-01-01

    Background Breast cancer is the most common malignancy among women worldwide in terms of incidence and mortality. About 10% of North American women will be diagnosed with breast cancer during their lifetime and 20% of those will die of the disease. Breast cancer is a heterogeneous disease and biomarkers able to correctly classify patients into prognostic groups are needed to better tailor treatment options and improve outcomes. One powerful method used for biomarker discovery is sample screening with mass spectrometry, as it allows direct comparison of protein expression between normal and pathological states. The purpose of this study was to use a systematic and objective method to identify biomarkers with possible prognostic value in breast cancer patients, particularly in identifying cases most likely to have lymph node metastasis and to validate their prognostic ability using breast cancer tissue microarrays. Methods and Findings Differential proteomic analyses were employed to identify candidate biomarkers in primary breast cancer patients. These analyses identified decorin (DCN) and endoplasmin (HSP90B1) which play important roles regulating the tumour microenvironment and in pathways related to tumorigenesis. This study indicates that high expression of Decorin is associated with lymph node metastasis (p<0.001), higher number of positive lymph nodes (p<0.0001) and worse overall survival (p = 0.01). High expression of HSP90B1 is associated with distant metastasis (p<0.0001) and decreased overall survival (p<0.0001) these patients also appear to benefit significantly from hormonal treatment. Conclusions Using quantitative proteomic profiling of primary breast cancers, two new promising prognostic and predictive markers were found to identify patients with worse survival. In addition HSP90B1 appears to identify a group of patients with distant metastasis with otherwise good prognostic features. PMID:22363530

  16. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  17. Comparative proteome profiling of bovine and human Staphylococcus epidermidis strains for screening specifically expressed virulence and adaptation proteins.

    PubMed

    Siljamäki, Pia; Varmanen, Pekka; Kankainen, Matti; Pyörälä, Satu; Karonen, Taru; Iivanainen, Antti; Auvinen, Petri; Paulin, Lars; Laine, Pia K; Taponen, Suvi; Simojoki, Heli; Sukura, Antti; Nyman, Tuula A; Savijoki, Kirsi

    2014-08-01

    The present study reports a comparative proteome cataloging of a bovine mastitis and a human-associated Staphylococcus epidermidis strain with a specific focus on surfome (cell-wall bound and extracellular) proteins. Protein identification by 1DE coupled with LC-MS/MS analyses resulted in 1400 and 1287 proteins from the bovine (PM221) and human (ATCC12228) strains, respectively, covering over 50% of all predicted and more than 30% of all predicted surfome proteins in both strains. Comparison of the identification results suggests elevated levels of proteins involved in adherence, biofilm formation, signal transduction, house-keeping functions, and immune evasion in PM221, whereas ATCC12228 was more effective in expressing host defense evasion proteases, skin adaptation lipases, hemagglutination, and heavy-metal resistance proteins. Phenotypic analyses showed that only PM221 displays protein- and DNA-mediated adherent growth, and that PM221 was more efficient in cleaving tributyrin, a natural compound of milk fat under low CO2 conditions. These findings are in line with the identification data and suggest that distinct expression of lipases and adhesive surfome proteins could lead to the observed phenotypes. This study is the first extensive survey of S. epidermidis proteomes to date, providing several protein candidates to be examined for their roles in adaptation and virulence in vivo. All MS data have been deposited in the ProteomeXchange with identifier PXD000404 (http://proteomecentral.proteomexchange.org/dataset/PXD000404).

  18. Spinach (Spinacia oleracea L.) modulates its proteome differentially in response to salinity, cadmium and their combination stress.

    PubMed

    Bagheri, Rita; Bashir, Humayra; Ahmad, Javed; Iqbal, Muhammad; Qureshi, M Irfan

    2015-12-01

    Cadmium (Cd) contamination and salinity are common stressors in agricultural soils all over the globe. Sensitivity and modulation of plant proteome lead to proper signal execution and adaptation to abiotic stress via molecular responses, which strengthen plant defence system. A comparative proteomic study, employing 2DE-MALDI TOF/TOF MS, of Spinacia oleracea plants exposed to cadmium (50 μg CdCl2 g(-1) soil), salinity (10 mg NaCl g(-1) soil) and their combination (NaCl + Cd) was conducted to understand the minimum common adaptation to multiple stress. Analysis of 2D gel maps showed significant increase and decrease in relative abundance of 14 and 39 proteins by Cd; 11 and 46 by salinity and 22 and 37 by combined stress of Cd and salinity, respectively. Peptide mass fingerprinting (PMF) helped in the identification of maturase K and PPD4 with increased relative abundance under all stresses; whereas salinity stress and combination stress silenced the presence of one protein (polycomb protein EZ2) and two proteins (cellulose synthase-like protein and ubiquitin conjugation factor E4), respectively. The identified proteins were functionally associated with signal transduction (15%), protein synthesis (16%), stress response and defence (33%), photosynthesis (13%), plant growth/cell division (9%), energy generation (4%), transport (4%), secondary metabolism (3%), and cell death (3%); clearly indicating the importance and necessity of keeping a higher ratio of defence and disease-responsive proteins. The results suggest that plant may increase the abundance of defence proteins and may also lower the abundance of catabolic proteins. Proteins with altered ratios of abundance belonged to different functional categories, suggesting that plants have differential mechanisms to respond to Cd, salinity, and their combined stress, but with unique sets of proteins.

  19. Expression of Molecular Differentiation Markers Does Not Correlate with Histological Differentiation Grade in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Demarez, Céline; Hubert, Catherine; Sempoux, Christine; Lemaigre, Frédéric P.

    2016-01-01

    The differentiation status of tumor cells, defined by histomorphological criteria, is a prognostic factor for survival of patients affected with intrahepatic cholangiocarcinoma (ICC). To strengthen the value of morphological differentiation criteria, we wished to correlate histopathological differentiation grade with expression of molecular biliary differentiation markers and of microRNAs previously shown to be dysregulated in ICC. We analysed a series of tumors that were histologically classified as well, moderately or poorly differentiated, and investigated the expression of cytokeratin 7, 19 and 903 (CK7, CK19, CK903), SRY-related HMG box transcription factors 4 and 9 (SOX4, SOX9), osteopontin (OPN), Hepatocyte Nuclear Factor-1 beta (HNF1β), Yes-associated protein (YAP), Epithelial cell adhesion molecule (EPCAM), Mucin 1 (MUC1) and N-cadherin (NCAD) by qRT-PCR and immunostaining, and of miR-31, miR-135b, miR-132, miR-200c, miR-221 and miR-222. Unexpectedly, except for subcellular location of SOX9 and OPN, no correlation was found between the expression levels of these molecular markers and histopathological differentiation grade. Therefore, our data point toward necessary caution when investigating the evolution and prognosis of ICC on the basis of cell differentiation criteria. PMID:27280413

  20. Quantitative Proteomics Analysis of the Nuclear Fraction of Human CD4+ Cells in the Early Phases of IL-4-induced Th2 Differentiation*

    PubMed Central

    Moulder, Robert; Lönnberg, Tapio; Elo, Laura L.; Filén, Jan-Jonas; Rainio, Eeva; Corthals, Garry; Oresic, Matej; Nyman, Tuula A.; Aittokallio, Tero; Lahesmaa, Riitta

    2010-01-01

    We used stable isotope labeling with 4-plex iTRAQ (isobaric tags for relative and absolute quantification) reagents and LC-MS/MS to investigate proteomic changes in the nucleus of activated human CD4+ cells during the early stages of Th2 cell differentiation. The effects of IL-4 stimulation upon activated naïve CD4+ cells were measured in the nuclear fractions from 6 and 24 h in three biological replicates, each using pooled cord blood samples derived from seven or more individuals. In these analyses, in the order of 800 proteins were detected with two or more peptides and quantified in three biological replicates. In addition to consistent differences observed with the nuclear localization/expression of established human Th2 and Th1 markers, there were changes that suggested the involvement of several proteins either only recently reported or otherwise not known in this context. These included SATB1 and among the novel changes detected and validated an IL-4-induced increase in the level of YB1. This unique data set from human cord blood CD4+ T cells details an extensive list of protein determinations that compares with and complements previous data determined from the Jurkat cell nucleus. PMID:20467038

  1. Differential Proteomic Analysis of the Bacillus anthracis Secretome: Distinct Plasmid and Chromosome CO2-Dependent Cross Talk Mechanisms Modulate Extracellular Proteolytic Activities†

    PubMed Central

    Chitlaru, Theodor; Gat, Orit; Gozlan, Yael; Ariel, Naomi; Shafferman, Avigdor

    2006-01-01

    The secretomes of a virulent Bacillus anthracis strain and of avirulent strains (cured of the virulence plasmids pXO1 and pXO2), cultured in rich and minimal media, were studied by a comparative proteomic approach. More than 400 protein spots, representing the products of 64 genes, were identified, and a unique pattern of protein relative abundance with respect to the presence of the virulence plasmids was revealed. In minimal medium under high CO2 tension, conditions considered to simulate those encountered in the host, the presence of the plasmids leads to enhanced expression of 12 chromosome-carried genes (10 of which could not be detected in the absence of the plasmids) in addition to expression of 5 pXO1-encoded proteins. Furthermore, under these conditions, the presence of the pXO1 and pXO2 plasmids leads to the repression of 14 chromosomal genes. On the other hand, in minimal aerobic medium not supplemented with CO2, the virulent and avirulent B. anthracis strains manifest very similar protein signatures, and most strikingly, two proteins (the metalloproteases InhA1 and NprB, orthologs of gene products attributed to the Bacillus cereus group PlcR regulon) represent over 90% of the total secretome. Interestingly, of the 64 identified gene products, at least 31 harbor features characteristic of virulence determinants (such as toxins, proteases, nucleotidases, sulfatases, transporters, and detoxification factors), 22 of which are differentially regulated in a plasmid-dependent manner. The nature and the expression patterns of proteins in the various secretomes suggest that distinct CO2-responsive chromosome- and plasmid-encoded regulatory factors modulate the secretion of potential novel virulence factors, most of which are associated with extracellular proteolytic activities. PMID:16672610

  2. Expression Differentiation Is Constrained to Low-Expression Proteins over Ecological Timescales.

    PubMed

    Margres, Mark J; Wray, Kenneth P; Seavy, Margaret; McGivern, James J; Herrera, Nathanael D; Rokyta, Darin R

    2016-01-01

    Protein expression level is one of the strongest predictors of protein sequence evolutionary rate, with high-expression protein sequences evolving at slower rates than low-expression protein sequences largely because of constraints on protein folding and function. Expression evolutionary rates also have been shown to be negatively correlated with expression level across human and mouse orthologs over relatively long divergence times (i.e., ∼100 million years). Long-term evolutionary patterns, however, often cannot be extrapolated to microevolutionary processes (and vice versa), and whether this relationship holds for traits evolving under directional selection within a single species over ecological timescales (i.e., <5000 years) is unknown and not necessarily expected. Expression is a metabolically costly process, and the expression level of a particular protein is predicted to be a tradeoff between the benefit of its function and the costs of its expression. Selection should drive the expression level of all proteins close to values that maximize fitness, particularly for high-expression proteins because of the increased energetic cost of production. Therefore, stabilizing selection may reduce the amount of standing expression variation for high-expression proteins, and in combination with physiological constraints that may place an upper bound on the range of beneficial expression variation, these constraints could severely limit the availability of beneficial expression variants. To determine whether rapid-expression evolution was restricted to low-expression proteins owing to these constraints on highly expressed proteins over ecological timescales, we compared venom protein expression levels across mainland and island populations for three species of pit vipers. We detected significant differentiation in protein expression levels in two of the three species and found that rapid-expression differentiation was restricted to low-expression proteins. Our

  3. Nitrogen-Deficiency Stress Induces Protein Expression Differentially in Low-N Tolerant and Low-N Sensitive Maize Genotypes

    PubMed Central

    Nazir, Muslima; Pandey, Renu; Siddiqi, Tariq O.; Ibrahim, Mohamed M.; Qureshi, Mohammad I.; Abraham, Gerard; Vengavasi, Krishnapriya; Ahmad, Altaf

    2016-01-01

    Nitrogen (N) is essential for proper plant growth and its application has proven to be critical for agricultural produce. However, for unavoidable economic and environmental problems associated with excessive use of N-fertilizers, it is an urgent demand to manage application of fertilizers. Improving the N-use efficiency (NUE) of crop plants to sustain productivity even at low N levels is the possible solution. In the present investigation, contrasting low-N sensitive (HM-4) and low-N tolerant (PEHM-2) genotypes were identified and used for comparative proteome-profiling of leaves under optimum and low N as well as restoration of low N on 3rd (NR3) and 5th (NR5) days after re-supplying N. The analysis of differential expression pattern of proteins was performed by 2-D gel electrophoresis. Significant variations in the expression of proteins were observed under low N, which were genotype specific. In the leaf proteome, 25 spots were influenced by N treatment and four spots were different between the two genotypes. Most of the proteins that were differentially accumulated in response to N level and were involved in photosynthesis and metabolism, affirming the relationship between N and carbon metabolism. In addition to this, greater intensity of some defense proteins in the low N tolerant genotype was found that may have a possible role in imparting it tolerance under N starvation conditions. The new insights generated on maize proteome in response to N-starvation and restoration would be useful toward improvement of NUE in maize. PMID:27047497

  4. Differential Expression of CXCL12 and CXCR4 During Human Fetal Neural Progenitor Cell Differentiation

    PubMed Central

    Peng, Hui; Kolb, Ryan; Kennedy, J. E.

    2007-01-01

    Stromal cell-derived factor 1 alpha (SDF-1α, CXCL12) and its receptor CXCR4 play an important role in the central nervous system (CNS) development and adulthood by mediating cell migration, enhancing precursor cell proliferation, assisting in neuronal circuit formation, and possibly regulating migration during repair. The expression pattern of CXCR4 and CXCL12 during neurogenesis has not been thoroughly elucidated. In this study, we investigated the expression of CXCL12 and CXCR4 during neural progenitor cells (NPC) differentiation by microarray analysis and reverse transcriptase-polymerase chain reaction (RT-PCR) using human fetal NPC as a model system. The production of CXCL12 was measured by enzyme-linked immunosorbent assay (ELISA). CXCR4 expression was determined by florescence-activated cell sorting (FACS) analysis, immunocytochemical staining, and CXCR4-mediated inhibition of cyclic AMP (cAMP) accumulation. Our data demonstrated that CXCR4 expression is significantly upregulated when NPC are differentiated into neuronal precursors, whereas CXCL12 is upregulated when differentiated into astrocytes. We also provide evidence that CXCR4 localization changes as neurons mature. In neuronal precursors, CXCR4 is localized in both neuronal processes and the cell body, whereas in mature neurons, it is primarily expressed on axons and dendrites. This differential expression of CXCR4 and CXCL12 may be important for the temporal regulation of neuronal migration and circuit formation during development and possibly in adult neurogenesis and repair. PMID:18040858

  5. Differential Expression Profile of MicroRNAs during Differentiation of Cardiomyocytes Exposed to Polychlorinated Biphenyls

    PubMed Central

    Zhu, Chun; Yu, Zhang-Bin; Zhu, Jin-Gai; Hu, Xiao-Shan; Chen, Yu-Lin; Qiu, Yu-Fang; Xu, Zheng-Feng; Qian, Lin-Mei; Han, Shu-Ping

    2012-01-01

    Exposure to persistent environmental pollutants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of congenital heart defects. MicroRNAs (miRNAs) have been shown to be involved in cardiac development. The objective of this study was to investigate changes in miRNA expression profiles during the differentiation of cardiomyocytes exposed to PCBs. For that purpose, PCBs (Aroclor 1254) at a concentration of 2.5 μmol/L were added on day 0 of differentiation of P19 mouse embryonal carcinoma cells into cardiac myocytes. The relative expression of miRNA genes was determined by miRNA microarray and real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) analyses. The microarray results revealed that 45 miRNAs, of which 14 were upregulated and 31 were downregulated, were differentially expressed in P19 cells treated with PCBs compared with control cells. The miRNA expression data was validated with real-time RT-PCR. The expression of certain potential target genes (Wnt1) was found to be reduced in P19 cells treated with PCBs, whereas the expression of other potential predicted target genes (GSK3β) was increased. Our results demonstrate a critical role of miRNAs in mediating the effect of PCBs during the differentiation of P19 cells into cardiac myocytes. PMID:23443104

  6. Differentially-Expressed Pseudogenes in HIV-1 Infection

    PubMed Central

    Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

    2015-01-01

    Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

  7. From 'differential expression' to 'differential networking' - identification of dysfunctional regulatory networks in diseases.

    PubMed

    de la Fuente, Alberto

    2010-07-01

    Understanding diseases requires identifying the differences between healthy and affected tissues. Gene expression data have revolutionized the study of diseases by making it possible to simultaneously consider thousands of genes. The identification of disease-associated genes requires studying the genes in the context of the regulatory systems they are involved in. A major goal is to identify specific regulatory networks that are dysfunctional in a given disease state. Although we still have not reached a stage where the elucidation of differential regulatory networks is commonly feasible, recent advances have described the first steps towards this goal - the identification of differential coexpression networks. This review describes the shift from differential gene expression to differential networking and outlines how this shift will affect the study of the genetic basis of disease.

  8. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  9. Variation in the salivary proteomes of differentially virulent greenbug (Schizaphis graminum Rondani) biotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Greenbug (Schizaphis graminum Rondani) biotypes are classified by their differential virulence to wheat, barley, and sorghum varieties possessing greenbug resistance genes. Virulent greenbug biotypes exert phytotoxic effects upon their hosts during feeding, directly inducing physiological and metab...

  10. Preparation of Arabidopsis thaliana seedling proteomes for identifying metacaspase substrates by N-terminal COFRADIC.

    PubMed

    Tsiatsiani, Liana; Stael, Simon; Van Damme, Petra; Van Breusegem, Frank; Gevaert, Kris

    2014-01-01

    Proteome-wide discovery of in vivo metacaspase substrates can be obtained by positional proteomics approaches such as N-terminal COFRADIC, for example by comparing the N-terminal proteomes (or N-terminomes) of wild-type plants to transgenic plants not expressing a given metacaspase. In this chapter we describe a protocol for the preparation of plant tissue proteomes, including differential isotopic labelling allowing for a comparison of in vivo N-terminomes that serves as the starting point for N-terminal COFRADIC studies.

  11. Differential expression of Notch family members in astrocytomas and medulloblastomas.

    PubMed

    Xu, Peng; Yu, Shizhu; Jiang, Rongcai; Kang, Chunsheng; Wang, Guangxiu; Jiang, Hao; Pu, Peiyu

    2009-12-01

    Notch signaling pathway plays an integral role in determining cell fates in development. Growing evidence demonstrates that Notch signaling pathway has versatile effects in tumorigenesis depending on the tumor type, grade and stage. Notch signaling pathway is deregulated in some brain tumors. To examine the differential expression of Notch family members (Notch1, 2, 3, 4) in human astrocytomas and medulloblastomas, and to evaluate their roles in the development of both tumor types. Immunohistochemical staining and Western blot analysis were used to detect Notch1, 2, 3, 4 expression in tissue microarray and freshly resected tissue samples of normal brain, astrocytomas and medulloblastomas. Notch family members were not expressed or barely detectable in normal brain tissues. Notch1, 3, 4 were highly expressed but Notch2 was not expressed in astrocytomas. The percentage of immunopositive tumor cells and level of Notch1 expression was increased with tumor grade. In addition, overexpression of Notch2 was detected in medulloblastomas in contrast to low or no expression of Notch1, 3, 4. Differential expression of Notch1, 2, 3, 4 is detected in astrocytomas and medulloblastomas, that may be related to their different roles playing in the development of brain tumors.

  12. Proteomic analysis of zebrafish caudal fin regeneration.

    PubMed

    Saxena, Sandeep; Singh, Sachin K; Lakshmi, Mula G Meena; Meghah, Vuppalapaty; Bhatti, Bhawna; Swamy, Cherukuvada V Brahmendra; Sundaram, Curam S; Idris, Mohammed M

    2012-06-01

    The epimorphic regeneration of zebrafish caudal fin is rapid and complete. We have analyzed the biomechanism of zebrafish caudal fin regeneration at various time points based on differential proteomics approaches. The spectrum of proteome changes caused by regeneration were analyzed among controls (0 h) and 1, 12, 24, 48, and 72 h postamputation involving quantitative differential proteomics analysis based on two-dimensional gel electrophoresis matrix-assisted laser desorption/ionization and differential in-gel electrophoresis Orbitrap analysis. A total of 96 proteins were found differentially regulated between the control nonregenerating and regenerating tissues of different time points for having at least 1.5-fold changes. 90 proteins were identified as differentially regulated for regeneration based on differential in-gel electrophoresis analysis between the control and regenerating tissues. 35 proteins were characterized for its expression in all of the five regenerating time points against the control samples. The proteins identified and associated with regeneration were found to be directly allied with various molecular, biological, and cellular functions. Based on network pathway analysis, the identified proteome data set for regeneration was majorly associated in maintaining cellular structure and architecture. Also the proteins were found associated for the cytoskeleton remodeling pathway and cellular immune defense mechanism. The major proteins that were found differentially regulated during zebrafish caudal fin regeneration includes keratin and its 10 isoforms, cofilin 2, annexin a1, skeletal α1 actin, and structural proteins. Annexin A1 was found to be exclusively undergoing phosphorylation during regeneration. The obtained differential proteome and the direct association of the various proteins might lead to a new understanding of the regeneration mechanism.

  13. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  14. Proteomic Signatures of Thymomas

    PubMed Central

    Shilo, Konstantin; Hitchcock, Charles L.; Freitas, Michael A.

    2016-01-01

    Based on the histological features and outcome, the current WHO classification separates thymomas into A, AB, B1, B2 and B3 subtypes. It is hypothesized that the type A thymomas are derived from the thymic medulla while the type B thymomas are derived from the cortex. Due to occasional histological overlap between the tumor subtypes creating difficulties in their separation, the aim of this study was to provide their proteomic characterization and identify potential immunohistochemical markers aiding in tissue diagnosis. Pair-wise comparison of neoplastic and normal thymus by liquid chromatography tandem mass spectrometry (LC-MS/MS) of formalin fixed paraffin embedded tissue revealed 61 proteins differentially expressed in thymomas compared to normal tissue. Hierarchical clustering showed distinct segregation of subtypes AB, B1 and B2 from that of A and B3. Most notably, desmoyokin, a protein that is encoded by the AHNAK gene, was associated with type A thymomas and medulla of normal thymus, by LC-MS/MS and immunohistochemistry. In this global proteomic characterization of the thymoma, several proteins unique to different thymic compartments and thymoma subtypes were identified. Among differentially expressed proteins, desmoyokin is a marker specific for thymic medulla and is potentially promising immunohistochemical marker in separation of type A and B3 thymomas. PMID:27832160

  15. Identification of Chlamydia trachomatis outer membrane complex proteins by differential proteomics.

    PubMed

    Liu, Xiaoyun; Afrane, Mary; Clemmer, David E; Zhong, Guangming; Nelson, David E

    2010-06-01

    The extracellular chlamydial infectious particle, or elementary body (EB), is enveloped by an intra- and intermolecular cysteine cross-linked protein shell called the chlamydial outer membrane complex (COMC). A few abundant proteins, including the major outer membrane protein and cysteine-rich proteins (OmcA and OmcB), constitute the overwhelming majority of COMC proteins. The identification of less-abundant COMC proteins has been complicated by limitations of proteomic methodologies and the contamination of COMC fractions with abundant EB proteins. Here, we used parallel liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analyses of Chlamydia trachomatis serovar L2 434/Bu EB, COMC, and Sarkosyl-soluble EB fractions to identify proteins enriched or depleted from COMC. All well-described COMC proteins were specifically enriched in the COMC fraction. In contrast, multiple COMC-associated proteins found in previous studies were strongly enriched in the Sarkosyl-soluble fraction, suggesting that these proteins are not COMC components or are not stably associated with COMC. Importantly, we also identified novel proteins enriched in COMC. The list of COMC proteins identified in this study has provided reliable information for further understanding chlamydial protein secretion systems and modeling COMC and EB structures.

  16. Differentially expressed genes in giant cell tumor of bone.

    PubMed

    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula

    2011-04-01

    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  17. Expression of Cellulosome Components and Type IV Pili within the Extracellular Proteome of Ruminococcus flavefaciens 007

    PubMed Central

    Vodovnik, Maša; Duncan, Sylvia H.; Reid, Martin D.; Cantlay, Louise; Turner, Keith; Parkhill, Julian; Lamed, Raphael; Yeoman, Carl J.; Miller, Margret E. Berg.; White, Bryan A.; Bayer, Edward A.; Marinšek-Logar, Romana; Flint, Harry J.

    2013-01-01

    Background Ruminococcus flavefaciens is an important fibre-degrading bacterium found in the mammalian gut. Cellulolytic strains from the bovine rumen have been shown to produce complex cellulosome structures that are associated with the cell surface. R. flavefaciens 007 is a highly cellulolytic strain whose ability to degrade dewaxed cotton, but not Avicel cellulose, was lost following initial isolation in the variant 007S. The ability was recovered after serial subculture to give the cotton-degrading strain 007C. This has allowed us to investigate the factors required for degradation of this particularly recalcitrant form of cellulose. Methodology/Principal Findings The major proteins associated with the bacterial cell surface and with the culture supernatant were analyzed for R. flavefaciens 007S and 007C grown with cellobiose, xylan or Avicel cellulose as energy sources. Identification of the proteins was enabled by a draft genome sequence obtained for 007C. Among supernatant proteins a cellulosomal GH48 hydrolase, a rubrerthyrin-like protein and a protein with type IV pili N-terminal domain were the most strongly up-regulated in 007C cultures grown on Avicel compared with cellobiose. Strain 007S also showed substrate-related changes, but supernatant expression of the Pil protein and rubrerythrin in particular were markedly lower in 007S than in 007C during growth on Avicel. Conclusions/Significance This study provides new information on the extracellular proteome of R. flavefaciens and its regulation in response to different growth substrates. Furthermore it suggests that the cotton cellulose non-degrading strain (007S) has altered regulation of multiple proteins that may be required for breakdown of cotton cellulose. One of these, the type IV pilus was previously shown to play a role in adhesion to cellulose in R. albus, and a related pilin protein was identified here for the first time as a major extracellular protein in R. flavefaciens. PMID:23750253

  18. Isolation of differentially expressed cDNAs during ferret tracheal development: application of differential display PCR.

    PubMed

    Sehgal, A; Presente, A; Dudus, L; Engelhardt, J F

    1996-01-01

    The technique of differential display polymerase chain reaction (DD-PCR) was used to identify cDNA sequences, which are temporally expressed during ferret tracheal airway development. Such differentially expressed cDNAs may ultimately prove to be useful markers in elucidating mechanisms of epithelial differentiation and submucosal gland development in the airway. Using two sets of oligonucleotide primers 15 differentially amplified cDNAs were isolated by comparative reverse transcriptase (RT) PCR of 6-h and 3-day postnatal tracheal poly-A mRNA. In situ hybridization was used to assess the reliability of this method and confirm the differential mRNA expression patterns of cloned cDNAs. Results of in situ hybridization analysis demonstrated that 10 of the 15 cDNA sequences gave a temporally regulated pattern of expression, which was concordant with that of the differential display. Furthermore, sequence analysis of the 15 isolated cDNAs revealed that the majority of clones were amplified from two inverted decamer primers. These findings demonstrate the lack of poly-T priming in the differential display reaction, which suggests that this method may yield substantially more information regarding the coding sequence of cloned genes. In support of this observation, 6 of the 15 cDNA sequences contained one complete open reading frame. Although the majority of cDNAs demonstrated no homology to sequence data bases at the DNA or amino acid level, clone FT-4, which demonstrated a differential expression pattern limited to 3-day tracheal time points, was composed of a 10-amino acid repeat domain that was structurally similar to neuropeptide anthoRFamide and barley D hordein seed protein. A second interesting clone, FT-3, demonstrated an infrequent pattern of expression within a subset of epithelial cells limited to early developmental time points (6 h) and was dramatically reduced by 3 days postnatally. Several additional clones with no homologies to previously cloned genes

  19. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    PubMed

    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso

    2011-04-04

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  20. The proteomic analysis of an adipocyte differentiated from human mesenchymal stem cells using two-dimensional gel electrophoresis.

    PubMed

    Lee, Hyun-Kyung; Lee, Byung-Hyo; Park, Seung-Ah; Kim, Chan-Wha

    2006-02-01

    Adipose tissues play a crucial endocrine role in the control of whole body glucose homeostasis and insulin sensitivity. Considering the current substantial rise in obesity and obesity-related diseases, including diabetes, it is important to understand the molecular basis of adipocyte differentiation and its control. In this study, we have analyzed the protein expression inherent to adipogenic differentiation, by 2-DE, MALDI-TOF, and RT-PCR. This study focused on proteins that were differentially expressed by the differentiation of human mesenchymal stem cells (hMSCs) to adipocytes. We conducted 2-DE for each set of proteins in the cytosol of adipocytes that had differentiated from hMSC, in a pH range from 3-10. Thirty-two protein spots were shown to have different expression levels. Among these, eight up-regulated proteins were identified by MALDI-TOF/MS, as the following: syntaxin binding protein 3, OSBP-related protein 3, phosphodiesterase, glycophorin, immunoglobulin kappa chain variable region, peroxisome proliferative activated receptor gamma (PPAR-gamma), bA528A10.3.1 (novel protein similar to KIAA01616, isoform 1), and T cell receptor V-beta 4. Four proteins: syntaxin-3, OSBP-related protein 3, PPAR-gamma and glycophorin were associated with adipogenesis.

  1. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation

    PubMed Central

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-01-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1. PMID:25502213

  2. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation.

    PubMed

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-11-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1.

  3. Proteome Analysis During Chondrocyte Differentiation in a New Chondrogenesis Model Using Human Umbilical Cord Stroma Mesenchymal Stem Cells*

    PubMed Central

    De la Fuente, Alexandre; Mateos, Jesús; Lesende-Rodríguez, Iván; Calamia, Valentina; Fuentes-Boquete, Isaac; de Toro, Francisco J.; Arufe, Maria C.; Blanco, Francisco J.

    2012-01-01

    Umbilical cord stroma mesenchymal stem cells were differentiated toward chondrocyte-like cells using a new in vitro model that consists of the random formation of spheroids in a medium supplemented with fetal bovine serum on a nonadherent surface. The medium was changed after 2 days to one specific for the induction of chondrocyte differentiation. We assessed this model using reverse transcriptase-polymerase chain reaction, flow cytometry, immunohistochemistry, and secretome analyses. The purpose of this study was to determine which proteins were differentially expressed during chondrogenesis. Differential gel electrophoresis analysis was performed, followed by matrix-assisted laser desorption/ionization mass spectrometry protein identification. A total of 97 spots were modulated during the chondrogenesis process, 54 of these spots were identified as 39 different proteins and 15 were isoforms. Of the 39 different proteins identified 15 were down-regulated, 21 were up-regulated, and 3 were up- and down-regulated during the chondrogenesis process. Using Pathway Studio 7.0 software, our results showed that the major cell functions modulated during chondrogenesis were cellular differentiation, proliferation, and migration. Five proteins involved in cartilage extracellular matrix metabolism found during the differential gel electrophoresis study were confirmed using Western blot. The results indicate that our in vitro chondrogenesis model is an efficient and rapid technique for obtaining cells similar to chondrocytes that express proteins characteristic of the cartilage extracellular matrix. These chondrocyte-like cells could prove useful for future cell therapy treatment of cartilage pathologies. PMID:22008206

  4. Proteome analysis during chondrocyte differentiation in a new chondrogenesis model using human umbilical cord stroma mesenchymal stem cells.

    PubMed

    De la Fuente, Alexandre; Mateos, Jesús; Lesende-Rodríguez, Iván; Calamia, Valentina; Fuentes-Boquete, Isaac; de Toro, Francisco J; Arufe, Maria C; Blanco, Francisco J

    2012-02-01

    Umbilical cord stroma mesenchymal stem cells were differentiated toward chondrocyte-like cells using a new in vitro model that consists of the random formation of spheroids in a medium supplemented with fetal bovine serum on a nonadherent surface. The medium was changed after 2 days to one specific for the induction of chondrocyte differentiation. We assessed this model using reverse transcriptase-polymerase chain reaction, flow cytometry, immunohistochemistry, and secretome analyses. The purpose of this study was to determine which proteins were differentially expressed during chondrogenesis. Differential gel electrophoresis analysis was performed, followed by matrix-assisted laser desorption/ionization mass spectrometry protein identification. A total of 97 spots were modulated during the chondrogenesis process, 54 of these spots were identified as 39 different proteins and 15 were isoforms. Of the 39 different proteins identified 15 were down-regulated, 21 were up-regulated, and 3 were up- and down-regulated during the chondrogenesis process. Using Pathway Studio 7.0 software, our results showed that the major cell functions modulated during chondrogenesis were cellular differentiation, proliferation, and migration. Five proteins involved in cartilage extracellular matrix metabolism found during the differential gel electrophoresis study were confirmed using Western blot. The results indicate that our in vitro chondrogenesis model is an efficient and rapid technique for obtaining cells similar to chondrocytes that express proteins characteristic of the cartilage extracellular matrix. These chondrocyte-like cells could prove useful for future cell therapy treatment of cartilage pathologies.

  5. Proteomic analysis of Clostridium thermocellum core metabolism: relative protein expression profiles and growth phase-dependent changes in protein expression

    PubMed Central

    2012-01-01

    Background Clostridium thermocellum produces H2 and ethanol, as well as CO2, acetate, formate, and lactate, directly from cellulosic biomass. It is therefore an attractive model for biofuel production via consolidated bioprocessing. Optimization of end-product yields and titres is crucial for making biofuel production economically feasible. Relative protein expression profiles may provide targets for metabolic engineering, while understanding changes in protein expression and metabolism in response to carbon limitation, pH, and growth phase may aid in reactor optimization. We performed shotgun 2D-HPLC-MS/MS on closed-batch cellobiose-grown exponential phase C. thermocellum cell-free extracts to determine relative protein expression profiles of core metabolic proteins involved carbohydrate utilization, energy conservation, and end-product synthesis. iTRAQ (isobaric tag for relative and absolute quantitation) based protein quantitation was used to determine changes in core metabolic proteins in response to growth phase. Results Relative abundance profiles revealed differential levels of putative enzymes capable of catalyzing parallel pathways. The majority of proteins involved in pyruvate catabolism and end-product synthesis were detected with high abundance, with the exception of aldehyde dehydrogenase, ferredoxin-dependent Ech-type [NiFe]-hydrogenase, and RNF-type NADH:ferredoxin oxidoreductase. Using 4-plex 2D-HPLC-MS/MS, 24% of the 144 core metabolism proteins detected demonstrated moderate changes in expression during transition from exponential to stationary phase. Notably, proteins involved in pyruvate synthesis decreased in stationary phase, whereas proteins involved in glycogen metabolism, pyruvate catabolism, and end-product synthesis increased in stationary phase. Several proteins that may directly dictate end-product synthesis patterns, including pyruvate:ferredoxin oxidoreductases, alcohol dehydrogenases, and a putative bifurcating hydrogenase

  6. Proteomic Analysis of the Protein Expression Profile in the Mature Nigella sativa (Black Seed).

    PubMed

    Alanazi, Ibrahim O; Benabdelkamel, Hicham; Alfadda, Assim A; AlYahya, Sami A; Alghamdi, Waleed M; Aljohi, Hasan A; Almalik, Abdulaziz; Masood, Afshan

    2016-08-01

    Nigella sativa (N. sativa) seed has been used as an important nutritional flavoring agent and in traditional medicine for treating many illnesses since ancient times. Understanding the proteomic component of the seed may lead to enhance the understanding of its structural and biological functional complexity. In this study, we have analyzed its proteome profile based on gel-based proteome mapping technique that includes one-dimensional gel electrophoresis followed by liquid chromatography and tandem mass spectrometry strategy. We have not come across any such studies that have been performed in N. sativa seeds up to date. A total of 277 proteins were identified, and their functional, metabolic, and location-wise annotations were carried out using the UniProt database. The majority of proteins identified in the proteome dataset based on their function were those involved in enzyme catalytic activity, nucleotide binding, and protein binding while the major cellular processes included regulation of biological process followed by regulation of secondary biological process, cell organization and biogenesis, protein metabolism, and transport. The identified proteome was localized mainly to the nucleus then to the cytoplasm, plasma membrane, mitochondria, plastid, and others. A majority of the proteins were involved in biochemical pathways involving carbohydrate metabolism, amino acid and shikimate pathway, lipid metabolism, nucleotide, cell organization and biogenesis, transport, and defense processes. The identified proteins in the dataset help to improve our understanding of the pathways involved in N. sativa seed metabolism and its biochemical features and detail out useful information that may help to utilize these proteins. This study could thus pave a way for future further high-throughput studies using a more targeted proteomic approach.

  7. Proteomic Study to Survey the CIGB-552 Antitumor Effect

    PubMed Central

    Rodríguez-Ulloa, Arielis; Gil, Jeovanis; Ramos, Yassel; Hernández-Álvarez, Lilian; Flores, Lisandra; Oliva, Brizaida; García, Dayana; Sánchez-Puente, Aniel; Musacchio-Lasa, Alexis; Fernández-de-Cossio, Jorge; Padrón, Gabriel; González López, Luis J.; Besada, Vladimir; Guerra-Vallespí, Maribel

    2015-01-01

    CIGB-552 is a cell-penetrating peptide that exerts in vitro and in vivo antitumor effect on cancer cells. In the present work, the mechanism involved in such anticancer activity was studied using chemical proteomics and expression-based proteomics in culture cancer cell lines. CIGB-552 interacts with at least 55 proteins, as determined by chemical proteomics. A temporal differential proteomics based on iTRAQ quantification method was performed to identify CIGB-552 modulated proteins. The proteomic profile includes 72 differentially expressed proteins in response to CIGB-552 treatment. Proteins related to cell proliferation and apoptosis were identified by both approaches. In line with previous findings, proteomic data revealed that CIGB-552 triggers the inhibition of NF-κB signaling pathway. Furthermore, proteins related to cell invasion were differentially modulated by CIGB-552 treatment suggesting new potentialities of CIGB-552 as anticancer agent. Overall, the current study contributes to a better understanding of the antitumor action mechanism of CIGB-552. PMID:26576414

  8. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  9. Phage-Induced Expression of CRISPR-Associated Proteins is Revealed by Shotgun Proteomics in Streptococcus thermophilus

    SciTech Connect

    Young, Jacque C; Dill, Brian; Pan, Chongle; Hettich, Robert {Bob} L; Banfield, Jillian F.; Shah, Manesh B; Fremaux, Christophe; Horvath, Philippe; Barrangou, Rodolphe; Verberkmoes, Nathan C

    2012-01-01

    The CRISPR/Cas system, comprised of clustered regularly interspaced short palindromic repeats along with their associated (Cas) proteins, protects bacteria and archaea from viral predation and invading nucleic acids. While the mechanism of action for this acquired immunity is currently under investigation, the response of Cas protein expression to phage infection has yet to be elucidated. In this study, we employed shotgun proteomics to measure the global proteome expression in a model system for studying the CRISPR/Cas response: infection of S. thermophilus DGCC7710 with phage 2972. Host and viral proteins were simultaneously measured following inoculation at two different multiplicities of infection and across various time points using two-dimensional liquid chromatography tandem mass spectroscopy. Thirty-seven out of forty predicted viral proteins were detected, including all proteins of the structural virome and viral effector proteins. In total, 1,013 of 2,079 predicted S. thermophilus proteins were detected, facilitating the monitoring of host protein synthesis changes in response to virus infection. Importantly, Cas proteins from all four CRISPR loci in the S. thermophilus DGCC7710 genome were detected, including loci previously thought to be inactive. Many Cas proteins were found to be constitutively expressed, but several demonstrated increased abundance during peak infection, including the Cas9 proteins from the CRISPR1 and CRISPR3 loci, which are key players in the interference phase of the CRISPR/Cas response. Altogether, these results provide novel insights into the proteomic response of S. thermophilus, specifically CRISPR-associated proteins, upon phage 2972 infection.

  10. Proteomic Analysis of the Rat Canalicular Membrane Reveals Expression of a Complex System of P4-ATPases in Liver

    PubMed Central

    Chaubey, Pururawa Mayank; Hofstetter, Lia; Roschitzki, Bernd; Stieger, Bruno

    2016-01-01

    Transport processes in the canalicular membrane are key elements in bile formation and are the driving force of the enterohepatic circulation of bile salts. The canalicular membrane is constantly exposed to the detergent action of bile salts. One potential element protecting the canalicular membrane from the high canalicular bile salt concentrations may be bile salt resistant microdomains, however additional factors are likely to play a role. To obtain more insights into the molecular composition of the canalicular membrane, the proteome of highly purified rat canalicular membrane vesicles was determined. Isolated rat canalicular membrane vesicles were stripped from adhering proteins, deglycosylated and protease digested before subjecting the samples to shot gun proteomic analysis. The expression of individual candidates was studied by PCR, Western blotting and immunohistochemistry. A total of 2449 proteins were identified, of which 1282 were predicted to be membrane proteins. About 50% of the proteins identified here were absent from previously published liver proteomes. In addition to ATP8B1, four more P4-ATPases were identified. ATP8A1 and ATP9A showed expression specific to the canalicular membrane, ATP11C at the bLPM and ATP11A in an intracellular vesicular compartment partially colocalizing with RAB7A and EEA1 as markers of the endosomal compartment. This study helped to identify additional P4-ATPases from rat liver particularly in the canalicular membrane, previously not known to be expressed in liver. These P4-ATPases might be contributing for maintaining transmembrane lipid homeostasis in hepatocytes. PMID:27347675

  11. A semi-quantitative GeLC-MS analysis of temporal proteome expression in the emerging nosocomial pathogen Ochrobactrum anthropi

    PubMed Central

    Graham, Robert Leslie James; Sharma, Mohit K; Ternan, Nigel G; Weatherly, D Brent; Tarleton, Rick L; McMullan, Geoff

    2007-01-01

    Background The α-Proteobacteria are capable of interaction with eukaryotic cells, with some members, such as Ochrobactrum anthropi, capable of acting as human pathogens. O. anthropi has been the cause of a growing number of hospital-acquired infections; however, little is known about its growth, physiology and metabolism. We used proteomics to investigate how protein expression of this organism changes with time during growth. Results This first gel-based liquid chromatography-mass spectrometry (GeLC-MS) temporal proteomic analysis of O. anthropi led to the positive identification of 131 proteins. These were functionally classified and physiochemically characterized. Utilizing the emPAI protocol to estimate protein abundance, we assigned molar concentrations to all proteins, and thus were able to identify 19 with significant changes in their expression. Pathway reconstruction led to the identification of a variety of central metabolic pathways, including nucleotide biosynthesis, fatty acid anabolism, glycolysis, TCA cycle and amino acid metabolism. In late phase growth we identified a number of gene products under the control of the oxyR regulon, which is induced in response to oxidative stress and whose protein products have been linked with pathogen survival in response to host immunity reactions. Conclusion This study identified distinct proteomic profiles associated with specific growth points for O. anthropi, while the use of emPAI allowed semi-quantitative analyses of protein expression. It was possible to reconstruct central metabolic pathways and infer unique functional and adaptive processes associated with specific growth phases, thereby resulting in a deeper understanding of the physiology and metabolism of this emerging pathogenic bacterium. PMID:17567905

  12. Comparative Proteomic Analysis Reveals Differential Root Proteins in Medicago sativa and Medicago truncatula in Response to Salt Stress

    PubMed Central

    Long, Ruicai; Li, Mingna; Zhang, Tiejun; Kang, Junmei; Sun, Yan; Cong, Lili; Gao, Yanli; Liu, Fengqi; Yang, Qingchuan

    2016-01-01

    Salt stress is an important abiotic stress that causes decreased crop yields. Root growth and plant activities are affected by salt stress through the actions of specific genes that help roots adapt to adverse environmental conditions. For a more comprehensive understanding of proteins affected by salinity, we used two-dimensional gel electrophoresis and mass spectrometry to characterize the proteome-level changes associated with salt stress response in Medicago sativa cv. Zhongmu-1 and Medicago truncatula cv. Jemalong A17 roots. Our physiological and phenotypic observations indicated that Zhongmu-1 was more salt tolerant than Jemalong A17. We identified 93 and 30 proteins whose abundance was significantly affected by salt stress in Zhongmu-1 and Jemalong A17 roots, respectively. The tandem mass spectrometry analysis of the differentially accumulated proteins resulted in the identification of 60 and 26 proteins in Zhongmu-1 and Jemalong A17 roots, respectively. Function analyses indicated molecule binding and catalytic activity were the two primary functional categories. These proteins have known functions in various molecular processes, including defense against oxidative stress, metabolism, photosynthesis, protein synthesis and processing, and signal transduction. The transcript levels of four identified proteins were determined by quantitative reverse transcription polymerase chain reaction. Our results indicate that some of the identified proteins may play key roles in salt stress tolerance. PMID:27066057

  13. Comparative Proteomic Analysis Reveals Differential Root Proteins in Medicago sativa and Medicago truncatula in Response to Salt Stress.

    PubMed

    Long, Ruicai; Li, Mingna; Zhang, Tiejun; Kang, Junmei; Sun, Yan; Cong, Lili; Gao, Yanli; Liu, Fengqi; Yang, Qingchuan

    2016-01-01

    Salt stress is an important abiotic stress that causes decreased crop yields. Root growth and plant activities are affected by salt stress through the actions of specific genes that help roots adapt to adverse environmental conditions. For a more comprehensive understanding of proteins affected by salinity, we used two-dimensional gel electrophoresis and mass spectrometry to characterize the proteome-level changes associated with salt stress response in Medicago sativa cv. Zhongmu-1 and Medicago truncatula cv. Jemalong A17 roots. Our physiological and phenotypic observations indicated that Zhongmu-1 was more salt tolerant than Jemalong A17. We identified 93 and 30 proteins whose abundance was significantly affected by salt stress in Zhongmu-1 and Jemalong A17 roots, respectively. The tandem mass spectrometry analysis of the differentially accumulated proteins resulted in the identification of 60 and 26 proteins in Zhongmu-1 and Jemalong A17 roots, respectively. Function analyses indicated molecule binding and catalytic activity were the two primary functional categories. These proteins have known functions in various molecular processes, including defense against oxidative stress, metabolism, photosynthesis, protein synthesis and processing, and signal transduction. The transcript levels of four identified proteins were determined by quantitative reverse transcription polymerase chain reaction. Our results indicate that some of the identified proteins may play key roles in salt stress tolerance.

  14. Up-to-Date Workflow for Plant (Phospho)proteomics Identifies Differential Drought-Responsive Phosphorylation Events in Maize Leaves.

    PubMed

    Vu, Lam Dai; Stes, Elisabeth; Van Bel, Michiel; Nelissen, Hilde; Maddelein, Davy; Inzé, Dirk; Coppens, Frederik; Martens, Lennart; Gevaert, Kris; De Smet, Ive

    2016-12-02

    Protein phosphorylation is one of the most common post-translational modifications (PTMs), which can regulate protein activity and localization as well as protein-protein interactions in numerous cellular processes. Phosphopeptide enrichment techniques enable plant researchers to acquire insight into phosphorylation-controlled signaling networks in various plant species. Most phosphoproteome analyses of plant samples still involve stable isotope labeling, peptide fractionation, and demand a lot of mass spectrometry (MS) time. Here, we present a simple workflow to probe, map, and catalogue plant phosphoproteomes, requiring relatively low amounts of starting material, no labeling, no fractionation, and no excessive analysis time. Following optimization of the different experimental steps on Arabidopsis thaliana samples, we transferred our workflow to maize, a major monocot crop, to study signaling upon drought stress. In addition, we included normalization to protein abundance to identify true phosphorylation changes. Overall, we identified a set of new phosphosites in both Arabidopsis thaliana and maize, some of which are differentially phosphorylated upon drought. All data are available via ProteomeXchange with identifier PXD003634, but to provide easy access to our model plant and crop data sets, we created an online database, Plant PTM Viewer ( bioinformatics.psb.ugent.be/webtools/ptm_viewer/ ), where all phosphosites identified in our study can be consulted.

  15. Expression of YY1 in Differentiated Thyroid Cancer.

    PubMed

    Arribas, Jéssica; Castellví, Josep; Marcos, Ricard; Zafón, Carles; Velázquez, Antonia

    2015-05-01

    The transcription factor Yin Yang 1 (YY1) has an important regulatory role in tumorigenesis, but its implication in thyroid cancer has not been yet investigated. In the present study, we have analyzed the expression of YY1 in differentiated thyroid cancer and assessed the association of YY1 expression with clinical features. Expression of YY1 was evaluated in human thyroid cancer cell lines, a series of matched normal/tumor thyroid tissues and in a thyroid cancer tissue microarray, using real-time PCR, Western blot, and/or immunohistochemistry. YY1 was overexpressed in thyroid cancer cells, at transcription and protein levels. A significant increase of YY1 mRNA was also observed in tumor thyroid tissues. Moreover, immunohistochemical analysis of the thyroid cancer tissue microarray revealed that both papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) present increased YY1 protein levels (48 and 19%, respectively). After stratification by the level of YY1 protein, positive YY1 expression identifies 88% of patients with PTC. The association of YY1 expression with clinicopathological features in PTC and FTC showed that YY1 expression was related with age at diagnosis. Our data indicates for the first time overexpression of YY1 in differentiated thyroid cancer, with YY1 being more frequently overexpressed in the PTC subtype.

  16. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  17. Leveraging Genomics Software to Improve Proteomics Results

    SciTech Connect

    Fodor, I K; Nelson, D O

    2005-09-06

    Rigorous data analysis techniques are essential in quantifying the differential expression of proteins in biological samples of interest. Statistical methods from the microarray literature were applied to the analysis of two-dimensional difference gel electrophoresis (2-D DIGE) proteomics experiments, in the context of technical variability studies involving human plasma. Protein expression measurements were corrected to account for observed intensity-dependent biases within gels, and normalized to mitigate observed gel to gel variations. The methods improved upon the results achieved using the best currently available 2-D DIGE proteomics software. The spot-wise protein variance was reduced by 10% and the number of apparently differentially expressed proteins was reduced by over 50%.

  18. Targeted proteomics identifies liquid-biopsy signatures for extracapsular prostate cancer

    PubMed Central

    Kim, Yunee; Jeon, Jouhyun; Mejia, Salvador; Yao, Cindy Q; Ignatchenko, Vladimir; Nyalwidhe, Julius O; Gramolini, Anthony O; Lance, Raymond S; Troyer, Dean A; Drake, Richard R; Boutros, Paul C; Semmes, O. John; Kislinger, Thomas

    2016-01-01

    Biomarkers are rapidly gaining importance in personalized medicine. Although numerous molecular signatures have been developed over the past decade, there is a lack of overlap and many biomarkers fail to validate in independent patient cohorts and hence are not useful for clinical application. For these reasons, identification of novel and robust biomarkers remains a formidable challenge. We combine targeted proteomics with computational biology to discover robust proteomic signatures for prostate cancer. Quantitative proteomics conducted in expressed prostatic secretions from men with extraprostatic and organ-confined prostate cancers identified 133 differentially expressed proteins. Using synthetic peptides, we evaluate them by targeted proteomics in a 74-patient cohort of expressed prostatic secretions in urine. We quantify a panel of 34 candidates in an independent 207-patient cohort. We apply machine-learning approaches to develop clinical predictive models for prostate cancer diagnosis and prognosis. Our results demonstrate that computationally guided proteomics can discover highly accurate non-invasive biomarkers. PMID:27350604

  19. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    SciTech Connect

    Jang, Min-Kyung; Jung, Myeong Ho

    2014-11-07

    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  20. Proteomic Expression Patterns in Fathead Minnows Exposed to Trenbolone and Flutamide

    EPA Science Inventory

    Insights into androgen signaling in the liver of fathead minnow (Pimephales promelas) was obtained using non-gel based proteomics analysis. We exposed female fathead minnows for 48 hr through the water to a prototypical androgen (17b-trenbolone, 5 ?g/L), a prototypical anti-andr...

  1. Comparison of Transcriptomic and Proteomic Expression Patterns in Fathead Minnows Exposed to Trenbolone and Flutamide

    EPA Science Inventory

    Androgen signaling in the liver of fathead minnows (Pimephales promelas) was examined both at the transcriptome level and the proteome level. We exposed female fathead minnows for 48 hr to a prototypical androgen (17b-trenbolone, 5 ug/L), to an antiandrogen (flutamide, 50...

  2. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  3. Expression of dystrophin Dp71 during PC12 cell differentiation.

    PubMed

    Cisneros, B; Rendon, A; Genty, V; Aranda, G; Marquez, F; Mornet, D; Montañez, C

    1996-08-02

    The expression of dystrophin-protein 71 (Dp71) was investigated during nerve growth factor (NGF) induced differentiation of PC12 cells. A semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assay was designed to measure Dp71 mRNA, whereas the Dp71 protein amount was evaluated by immunoblot analysis using an anti-dystrophin monoclonal antibody. Comparison with control cultures showed that Dp71 mRNA and protein levels increased in parallel with NGF treatment peaking with increments of 60% and 1.4 times, respectively. The upregulation of Dp71 expression during PC12 cells differentiation point at PC12 cells as a suitable model for studying the function of Dp71 in neuronal cells.

  4. Strontium promotes cementoblasts differentiation through inhibiting sclerostin expression in vitro.

    PubMed

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan; Hu, Min

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.

  5. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  6. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  7. Comparative proteomics analysis of spermary and ovary in Hyriopsis schlegelii.

    PubMed

    Shi, Jianwu; Wang, Dexia; Zhou, Yan; Gu, Yiran; Wu, Di; Wang, Junhua; Hong, Yijiang

    2017-03-01

    We provide the first large-scale quantitative proteomics analysis in Hyriopsis schlegelii. To investigate the proteins expressed in the gonads, a quantitative proteomics approach has been utilized to analyze differentially expressed proteins between the spermary and ovary. In this study, we identified and quantified 2416 proteins in the gonads of Hyriopsis schlegelii. Of these, 559 proteins showed significantly different expression between the spermary and ovary. Some specific proteins expressed in either the spermary or ovary were identified in Hyriopsis schlegelii. In addition, a series of proteins related to gametogenesis were also identified. Compared with previous reports, many proteins in Hyriopsis schlegelii identified here have different expression patterns between the spermary and ovary. The special hermaphroditism in Hyriopsis schlegelii may contribute to these inconsistent results. The provided proteomics data could be considered as a starting point for subsequent studies focusing on the proteins involved in sexual gland development and maturity.

  8. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  9. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  10. Proteomic Characterization of Differential Abundant Proteins Accumulated between Lower and Upper Epidermises of Fleshy Scales in Onion (Allium cepa L.) Bulbs

    PubMed Central

    Wu, Xiaolin

    2016-01-01

    The onion (Allium cepa L.) is widely planted worldwide as a valuable vegetable crop. The scales of an onion bulb are a modified type of leaf. The one-layer-cell epidermis of onion scales is commonly used as a model experimental material in botany and molecular biology. The lower epidermis (LE) and upper epidermis (UE) of onion scales display obvious differences in microscopic structure, cell differentiation and pigment synthesis; however, associated proteomic differences are unclear. LE and UE can be easily sampled as single-layer-cell tissues for comparative proteomic analysis. In this study, a proteomic approach based on 2-DE and mass spectrometry (MS) was applied to compare LE and UE of fleshy scales from yellow and red onions. We identified 47 differential abundant protein spots (representing 31 unique proteins) between LE and UE in red and yellow onions. These proteins are mainly involved in pigment synthesis, stress response, and cell division. Particularly, the differentially accumulated chalcone-flavanone isomerase and flavone O-methyltransferase 1-like in LE may result in the differences in the onion scale color between red and yellow onions. Moreover, stress-related proteins abundantly accumulated in both LE and UE. In addition, the differential accumulation of UDP-arabinopyranose mutase 1-like protein and β-1,3-glucanase in the LE may be related to the different cell sizes between LE and UE of the two types of onion. The data derived from this study provides new insight into the differences in differentiation and developmental processes between onion epidermises. This study may also make a contribution to onion breeding, such as improving resistances and changing colors. PMID:28036352

  11. Proteomic Characterization of Differential Abundant Proteins Accumulated between Lower and Upper Epidermises of Fleshy Scales in Onion (Allium cepa L.) Bulbs.

    PubMed

    Wu, Si; Ning, Fen; Wu, Xiaolin; Wang, Wei

    2016-01-01

    The onion (Allium cepa L.) is widely planted worldwide as a valuable vegetable crop. The scales of an onion bulb are a modified type of leaf. The one-layer-cell epidermis of onion scales is commonly used as a model experimental material in botany and molecular biology. The lower epidermis (LE) and upper epidermis (UE) of onion scales display obvious differences in microscopic structure, cell differentiation and pigment synthesis; however, associated proteomic differences are unclear. LE and UE can be easily sampled as single-layer-cell tissues for comparative proteomic analysis. In this study, a proteomic approach based on 2-DE and mass spectrometry (MS) was applied to compare LE and UE of fleshy scales from yellow and red onions. We identified 47 differential abundant protein spots (representing 31 unique proteins) between LE and UE in red and yellow onions. These proteins are mainly involved in pigment synthesis, stress response, and cell division. Particularly, the differentially accumulated chalcone-flavanone isomerase and flavone O-methyltransferase 1-like in LE may result in the differences in the onion scale color between red and yellow onions. Moreover, stress-related proteins abundantly accumulated in both LE and UE. In addition, the differential accumulation of UDP-arabinopyranose mutase 1-like protein and β-1,3-glucanase in the LE may be related to the different cell sizes between LE and UE of the two types of onion. The data derived from this study provides new insight into the differences in differentiation and developmental processes between onion epidermises. This study may also make a contribution to onion breeding, such as improving resistances and changing colors.

  12. Differential expression of CART in ewes with differing ovulation rates.

    PubMed

    Juengel, Jennifer L; French, Michelle C; Quirke, Laurel D; Kauff, Alexia; Smith, George W; Johnstone, Peter D

    2017-04-01

    We hypothesised that cocaine- and amphetamine-regulated transcript (CARTPT) would be differentially expressed in ewes with differing ovulation rates. Expression of mRNA for CARTPT, as well as LHCGR, FSHR, CYP19A1 and CYP17A1 was determined in antral follicles ≥1 mm in diameter collected during the follicular phase in ewes heterozygous for the Booroola and Inverdale genes (I+B+; average ovulation rate 4) and ++ contemporaries (++; average ovulation rate 1.8). In ++ ewes (n = 6), CARTPT was expressed in small follicles (1 to <3 mm diameter), where 18.8 ± 2.5% follicles expressed CARTPT CART peptide was also detected in follicular fluid of some follicles of ++ ewes. In I+B+ ewes, 5/6 ewes did not have any follicles that expressed CARTPT, and no CART peptide was detected in any follicle examined. Expression pattern of CYP19A1 differed between I+B+ and ++ ewes with an increased percentage of small and medium follicles (3 to <4.5 mm diameter) but decreased percentage of large follicles (≥4.5 mm diameter) expressing CYP19A1 in the I+B+ ewes. Many of the large follicles from the I+B+ ewes appeared non-functional and expression of LHCGR, FSHR, CYP17A1 and CYP19A1 was less than that observed in ++ ewes. Expression of FSHR and CYP17A1 was not different between groups in small and medium follicles, but LHCGR expression was approximately double in I+B+ ewes compared to that in ++ ewes. Thus, ewes with high ovulation rates had a distinct pattern of expression of CARTPT mRNA and protein compared to ewes with normal ovulation rates, providing evidence for CART being important in the regulation of ovulation rate.

  13. Periodontal Proteomics: Wonders Never Cease!

    PubMed Central

    Grover, Harpreet Singh; Kapoor, Shalini; Saksena, Neha

    2013-01-01

    Proteins are vital parts of living organisms, as they are integral components of the physiological metabolic pathways of cells. Periodontal tissues comprise multicompartmental groups of interacting cells and matrices that provide continuous support, attachment, proprioception, and physical protection for the teeth. The proteome map, that is, complete catalogue of the matrix and cellular proteins expressed in alveolar bone, cementum, periodontal ligament, and gingiva, is to be explored for more in-depth understanding of periodontium. The ongoing research to understand the signalling pathways that allow cells to divide, differentiate, and die in controlled manner has brought us to the era of proteomics. Proteomics is defined as the study of all proteins including their relative abundance, distribution, posttranslational modifications, functions, and interactions with other macromolecules, in a given cell or organism within a given environment and at a specific stage in the cell cycle. Its application to periodontal science can be used to monitor health status, disease onset, treatment response, and outcome. Proteomics can offer answers to critical, unresolved questions such as the biological basis for the heterogeneity in gingival, alveolar bone, and cemental cell populations. PMID:24490073

  14. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  15. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation

    PubMed Central

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-01-01

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer’s disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes. PMID:27383650

  16. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation.

    PubMed

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-07-07

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer's disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes.

  17. Histone deacetylase inhibitor-induced cell death in bladder cancer is associated with chromatin modification and modifying protein expression: A proteomic approach

    PubMed Central

    LI, QINGDI QUENTIN; HAO, JIAN-JIANG; ZHANG, ZHENG; HSU, IAWEN; LIU, YI; TAO, ZHEN; LEWI, KEIDREN; METWALLI, ADAM R.; AGARWAL, PIYUSH K.

    2016-01-01

    The Cancer Genome Atlas (TCGA) project recently identified the importance of mutations in chromatin remodeling genes in human carcinomas. These findings imply that epigenetic modulators might have a therapeutic role in urothelial cancers. To exploit histone deacetylases (HDACs) as targets for cancer therapy, we investigated the HDAC inhibitors (HDACIs) romidepsin, trichostatin A, and vorinostat as potential chemotherapeutic agents for bladder cancer. We demonstrate that the three HDACIs suppressed cell growth and induced cell death in the bladder cancer cell line 5637. To identify potential mechanisms associated with the anti-proliferative and cytotoxic effects of the HDACIs, we used quantitative proteomics to determine the proteins potentially involved in these processes. Our proteome studies identified a total of 6003 unique proteins. Of these, 2472 proteins were upregulated and 2049 proteins were downregulated in response to HDACI exposure compared to the untreated controls (P<0.05). Bioinformatic analysis further revealed that those differentially expressed proteins were involved in multiple biological functions and enzyme-regulated pathways, including cell cycle progression, apoptosis, autophagy, free radical generation and DNA damage repair. HDACIs also altered the acetylation status of histones and non-histone proteins, as well as the levels of chromatin modification proteins, suggesting that HDACIs exert multiple cytotoxic actions in bladder cancer cells by inhibiting HDAC activity or altering the structure of chromatin. We conclude that HDACIs are effective in the inhibition of cell proliferation and the induction of apoptosis in the 5637 bladder cancer cells through multiple cell death-associated pathways. These observations support the notion that HDACIs provide new therapeutic options for bladder cancer treatment and thus warrant further preclinical exploration. PMID:27082124

  18. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  19. The proteomics of quiescent and nonquiescent cell differentiation in yeast stationary-phase cultures

    PubMed Central

    Davidson, George S.; Joe, Ray M.; Roy, Sushmita; Meirelles, Osorio; Allen, Chris P.; Wilson, Melissa R.; Tapia, Phillip H.; Manzanilla, Elaine E.; Dodson, Anne E.; Chakraborty, Swagata; Carter, Mark; Young, Susan; Edwards, Bruce; Sklar, Larry; Werner-Washburne, Margaret

    2011-01-01

    As yeast cultures enter stationary phase in rich, glucose-based medium, differentiation of two major subpopulations of cells, termed quiescent and nonquiescent, is observed. Differences in mRNA abundance between exponentially growing and stationary-phase cultures and quiescent and nonquiescent cells are known, but little was known about protein abundance in these cells. To measure protein abundance in exponential and stationary-phase cultures, the yeast GFP-fusion library (4159 strains) was examined during exponential and stationary phases, using high-throughput flow cytometry (HyperCyt). Approximately 5% of proteins in the library showed twofold or greater changes in median fluorescence intensity (abundance) between the two conditions. We examined 38 strains exhibiting two distinct fluorescence-intensity peaks in stationary phase and determined that the two fluorescence peaks distinguished quiescent and nonquiescent cells, the two major subpopulations of cells in stationary-phase cultures. GFP-fusion proteins in this group were more abundant in quiescent cells, and half were involved in mitochondrial function, consistent with the sixfold increase in respiration observed in quiescent cells and the relative absence of Cit1p:GFP in nonquiescent cells. Finally, examination of quiescent cell–specific GFP-fusion proteins revealed symmetry in protein accumulation in dividing quiescent and nonquiescent cells after glucose exhaustion, leading to a new model for the differentiation of these cells. PMID:21289090

  20. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  1. Differential expression of antimicrobial peptides in margins of chronic wounds.

    PubMed

    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine

    2010-07-01

    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  2. PATHOME: an algorithm for accurately detecting differentially expressed subpathways

    PubMed Central

    Nam, S; Chang, H R; Kim, K-T; Kook, M-C; Hong, D; Kwon, C H; Jung, H R; Park, H S; Powis, G; Liang, H; Park, T; Kim, Y H

    2014-01-01

    The translation of high-throughput gene expression data into biologically meaningful information remains a bottleneck. We developed a novel computational algorithm, PATHOME, for detecting differentially expressed biological pathways. This algorithm employs straightforward statistical tests to evaluate the significance of differential expression patterns along subpathways. Applying it to gene expression data sets of gastric cancer (GC), we compared its performance with those of other leading programs. Based on a literature-driven reference set, PATHOME showed greater consistency in identifying known cancer-related pathways. For the WNT pathway uniquely identified by PATHOME, we validated its involvement in gastric carcinogenesis through experimental perturbation of both cell lines and animal models. We identified HNF4α-WNT5A regulation in the cross-talk between the AMPK metabolic pathway and the WNT signaling pathway, and further identified WNT5A as a potential therapeutic target for GC. We have demonstrated PATHOME to be a powerful tool, with improved sensitivity for identifying disease-related dysregulated pathways. PMID:24681952

  3. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  4. Differential expression profile of membrane proteins in Aplysia pleural–pedal ganglia under the stress of methyl parathion.

    PubMed

    Chen, Ying-Ying; Huang, Lin; Zhang, Yong; Ke, Cai-Huan; Huang, He-Qing

    2014-03-01

    This study was aimed to analyze the alteration of membrane protein profiles in Aplysia juliana Quoy & Gaimard (A. juliana) pleural–pedal ganglia under MP exposure. Both the results of GC–MS analysis and the activity assay of acetylcholinesterase (AChE), superoxide dismutase (SOD), catalase (CAT) reveal that MP toxicological effects on Aplysia left and right pleural–pedal ganglia are different under 7 and 14 days of exposure. Therefore, Aplysia were subjected for exposure at two concentrations (1 and 2 mg/l) of MP for 7 and 14 days for membrane proteomic study. As a result, 19 and 14 protein spots were differentially expressed in A. juliana left pleural–pedal ganglia under 7 and 14 days treatment, and 20 and 14 protein spots found with differential expressions in their right ganglia under the same treatment, respectively. Several proteins with expression variations were detected from both the left and right pleural–pedal ganglia; however, most proteins have distinctive expressions, indicating different mechanisms might be involved in initiating MP toxicology in left and right ganglia. Among the total differential protein spots obtained, 29 proteins were classed as membrane proteins. These proteins are mainly involved in the metabolism process, cell redox homeostasis, signal transduction, immunology, intracellular transport and catalysis, indicating MP toxicity in mollusks seems to be complex and diverse. Some differentially expressed proteins were further confirmed by Western blotting and quantitative real-time PCR. These results might provide renovated insights to reveal the mechanism of MP-induced neurotoxicity, and the novel candidate biomarkers might have potential application for environmental evaluation of MP pollution level.

  5. Establishment of a new OSCC cell line derived from OLK and identification of malignant transformation-related proteins by differential proteomics approach

    PubMed Central

    Dong, Yan; Zhao, Qun; Ma, Xiaoyan; Ma, Guowu; Liu, Caiyun; Chen, Zhuwen; Yu, Liyuan; Liu, Xuefeng; Zhang, Yanguang; Shao, Shujuan; Xiao, Jing; Li, Jia; Zhang, Weimin; Fu, Ming; Dong, Lijia; Yang, Xiandong; Guo, Xu; Xue, Liyan; Fang, Fei; Zhan, Qimin; Zhang, Lihua

    2015-01-01

    Oral squamous cell carcinoma (OSCC) is usually preceded by the oral premalignant lesions, mainly oral leukoplakia (OLK) after repeated insults of carcinogens, tobacco. B(a)P and DMBA are key carcinogens in tobacco smoke. In the present study, for the first time we established the cancerous cell line OSCC-BD induced by B(a)P/DMBA mixture and transformed from dysplastic oral leukoplakia cell line DOK. Cell morphology, proliferation ability, migration ability, colony formation, and tumorigenicity were studied and confirmed the malignant characteristics of OSCC-BD cells. We further identified the differential proteins between DOK and OSCC-BD cells by stable isotope dimethyl labeling based quantitative proteomic method, which showed 18 proteins up-regulated and 16 proteins down-regulated with RSD < 8%. Differential proteins are mainly related to cell cycle, cell proliferation, DNA replication, RNA splicing and apoptosis. Abberant binding function, catalysis activity and transportor activity of differential proteins might contribute to the malignant transformation of OLK. Of the 34 identified differential proteins with RSD < 8%, 13 novel cancer-related proteins were reported in the present study. This study might provide a new insight into the mechanism of OLK malignant transformation and the potent biomarkers for early diagnosis, meanwhile further facilitate the application of the quantification proteomics to carcinogenesis research. PMID:26234610

  6. Proteome Analysis of Rice (Oryza sativa L.) Mutants Reveals Differentially Induced Proteins during Brown Planthopper (Nilaparvata lugens) Infestation

    PubMed Central

    Sangha, Jatinder Singh; Yolanda, H. Chen; Kaur, Jatinder; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Alanazi, Mohammed S.; Mills, Aaron; Adalla, Candida B.; Bennett, John; Prithiviraj, Balakrishnan; Jahn, Gary C.; Leung, Hei

    2013-01-01

    Although rice resistance plays an important role in controlling the brown planthopper (BPH), Nilaparvata lugens, not all varieties have the same level of protection against BPH infestation. Understanding the molecular interactions in rice defense response is an important tool to help to reveal unexplained processes that underlie rice resistance to BPH. A proteomics approach was used to explore how wild type IR64 and near-isogenic rice mutants with gain and loss of resistance to BPH respond during infestation. A total of 65 proteins were found markedly altered in wild type IR64 during BPH infestation. Fifty-two proteins associated with 11 functional categories were identified using mass spectrometry. Protein abundance was less altered at 2 and 14 days after infestation (DAI) (T1, T2, respectively), whereas higher protein levels were observed at 28 DAI (T3). This trend diminished at 34 DAI (T4). Comparative analysis of IR64 with mutants showed 22 proteins that may be potentially associated with rice resistance to the brown planthopper (BPH). Ten proteins were altered in susceptible mutant (D1131) whereas abundance of 12 proteins including S-like RNase, Glyoxalase I, EFTu1 and Salt stress root protein “RS1” was differentially changed in resistant mutant (D518). S-like RNase was found in greater quantities in D518 after BPH infestation but remained unchanged in IR64 and decreased in D1131. Taken together, this study shows a noticeable level of protein abundance in the resistant mutant D518 compared to the susceptible mutant D1131 that may be involved in rendering enhanced level of resistance against BPH. PMID:23434671

  7. Differential expression of GATA-3 in urothelial carcinoma variants.

    PubMed

    Liang, Yu; Heitzman, Joseph; Kamat, Ashish M; Dinney, Colin P; Czerniak, Bogdan; Guo, Charles C

    2014-07-01

    GATA binding protein 3 (GATA-3) is a novel immunohistochemical marker for urothelial carcinoma (UC); however, few studies have investigated GATA-3's role as a marker for UC variants. We used immunohistochemistry to assess GATA-3 expression in different UC variants, including micropapillary (n = 46), sarcomatoid (n = 43), small cell carcinoma (n = 22), and plasmacytoid (n = 16) variants, and we also compared GATA-3 expression in conventional bladder UC (n = 103) to that in squamous cell carcinoma (n = 14). GATA-3 expression was present in 70% (72/103) of conventional bladder UCs and highly concordant between matched primary and metastatic UCs. The GATA-3 expression levels of the micropapillary variants (57%; 26/46) and plasmacytoid variants (44%; 7/16) were not significantly different from that of conventional UC. However, the GATA-3 expression levels of the sarcomatoid variants (16%; 7/43) and small cell carcinoma variants (5%; 1/22), which only weakly expressed the protein, were significantly lower than that of conventional UC (P < .001). Only 7% of squamous cell carcinomas (1/14) expressed GATA-3, and it was also significantly lower than that of conventional UC (P < .001). GATA-3 expression was not significantly associated with tumor stage or patients' clinical outcomes. In conclusion, GATA-3 expression differed among UC variants. GATA-3 is a useful marker for confirming the urothelial origin of micropapillary and plasmacytoid UC variants but not that of sarcomatoid or small cell carcinoma variants. GATA-3 can also be used in differentiating UC from squamous cell carcinoma.

  8. Expression of T cell antigen receptor during differentiation

    SciTech Connect

    Allison, J.P.; Lanier, L.L.; Guyden, J.; Richie, E.R.

    1986-03-01

    The authors have used flow cytometry with monoclonal antibodies, radioimmuneprecipitation with a rabbit antiserum to common epitopes of the TCR, and Northern and Southern blot analysis with cloned TCR genes to study antigen receptor (TCR) expression by normal murine and human thymocytes and by primary murine thymomas. L3T4-,Lyt2- murine thymomas corresponding to the earliest stage of thymic differentiation, were found to have rearranged TCR beta genes, and to express low levels of beta transcript, but lacked alpha gene transcript and failed to express TCR on the cell surface. L3T4+,Lyt2+ thymomas were variable, but the majority were found to contain significant levels of both alpha and beta transcripts and to express TCR at the cell surface. Similarly, alpha and beta transcripts and TCR protein were detected in sorted L3T4+,Lyt2+ murine thymocytes. Using three color fluorescence, the authors determined that app. 70% of human T4+T8+ thymocytes also expressed T3, a component of the TCR complex. These data indicate that in mouse and man expression of TCR occurs in the immature, or cortical, thymic population.

  9. Differential proteomic profiling unveils new molecular mechanisms associated with mitochondrial complex III deficiency

    PubMed Central

    Morán, María; López-Bernardo, Elia; Cadenas, Susana; Hidalgo, Beatriz; Sánchez, Ricardo; Seneca, Sara; Arenas, Joaquín; Martín, Miguel A.; Ugalde, Cristina

    2014-01-01

    We have analyzed the cellular pathways and metabolic adaptations that take place in primary skin fibroblasts from patients with mutations in BCS1L, a major genetic cause of mitochondrial complex III enzyme deficiency. Mutant fibroblasts exhibited low oxygen consumption rates and intracellular ATP levels, indicating that the main altered molecular event probably is a limited respiration-coupled ATP production through the OXPHOS system. Two-dimensional DIGE and MALDI-TOF/TOF mass spectrometry analyses unambiguously identified 39 proteins whose expression was significantly altered in complex III-deficient fibroblasts. Extensive statistical and cluster analyses revealed a protein profile characteristic for the BCS1L mutant fibroblasts that included alterations in energy metabolism, cell signaling and gene expression regulation, cytoskeleton formation and maintenance, and intracellular stress responses. The physiological validation of the predicted functional adaptations of human cultured fibroblasts to complex III deficiency confirmed the up-regulation of glycolytic enzyme activities and the accumulation of branched-chain among other amino acids, suggesting the activation of anaerobic glycolysis and cellular catabolic states, in particular protein catabolism, together with autophagy as adaptive responses to mitochondrial respiratory chain dysfunction and ATP deficiency. Our data point to an overall metabolic and genetic reprogramming that could contribute to explain the clinical manifestations of complex III deficiency in patients. PMID:25239759

  10. A Review: Proteomics in Nasopharyngeal Carcinoma

    PubMed Central

    Chen, Ze-Tan; Liang, Zhong-Guo; Zhu, Xiao-Dong

    2015-01-01

    Although radiotherapy is generally effective in the treatment of major nasopharyngeal carcinoma (NPC), this treatment still makes approximately 20% of patients radioresistant. Therefore, the identification of blood or biopsy biomarkers that can predict the treatment response to radioresistance and that can diagnosis early stages of NPC would be highly useful to improve this situation. Proteomics is widely used in NPC for searching biomarkers and comparing differentially expressed proteins. In this review, an overview of proteomics with different samples related to NPC and common proteomics methods was made. In conclusion, identical proteins are sorted as follows: Keratin is ranked the highest followed by such proteins as annexin, heat shock protein, 14-3-3σ, nm-23 protein, cathepsin, heterogeneous nuclear ribonucleoproteins, enolase, triosephosphate isomerase, stathmin, prohibitin, and vimentin. This ranking indicates that these proteins may be NPC-related proteins and have potential value for further studies. PMID:26184160

  11. Identification of Differentially Expressed Proteins and Phosphorylated Proteins in Rice Seedlings in Response to Strigolactone Treatment

    PubMed Central

    Chen, Fangyu; Jiang, Liangrong; Zheng, Jingsheng; Huang, Rongyu; Wang, Houcong; Hong, Zonglie; Huang, Yumin

    2014-01-01

    Strigolactones (SLs) are recently identified plant hormones that inhibit shoot branching and control various aspects of plant growth, development and interaction with parasites. Previous studies have shown that plant D10 protein is a carotenoid cleavage dioxygenase that functions in SL biosynthesis. In this work, we used an allelic SL-deficient d10 mutant XJC of rice (Oryza sativa L. spp. indica) to investigate proteins that were responsive to SL treatment. When grown in darkness, d10 mutant seedlings exhibited elongated mesocotyl that could be rescued by exogenous application of SLs. Soluble protein extracts were prepared from d10 mutant seedlings grown in darkness in the presence of GR24, a synthetic SL analog. Soluble proteins were separated on two-dimensional gels and subjected to proteomic analysis. Proteins that were expressed differentially and phosphoproteins whose phosphorylation status changed in response to GR24 treatment were identified. Eight proteins were found to be induced or down-regulated by GR24, and a different set of 8 phosphoproteins were shown to change their phosphorylation intensities in the dark-grown d10 seedlings in response to GR24 treatment. Analysis of these proteins revealed that they are important enzymes of the carbohydrate and amino acid metabolic pathways and key components of the cellular energy generation machinery. These proteins may represent potential targets of the SL signaling pathway. This study provides new insight into the complex and negative regulatory mechanism by which SLs control shoot branching and plant development. PMID:24699514

  12. Identification of differentially expressed proteins in the cervical mucosa of HIV-1-resistant sex workers.

    PubMed

    Burgener, Adam; Boutilier, Julie; Wachihi, Charles; Kimani, Joshua; Carpenter, Michael; Westmacott, Garrett; Cheng, Keding; Ball, Terry B; Plummer, Francis

    2008-10-01

    Novel tools are necessary to understand mechanisms of altered susceptibility to HIV-1 infection in women of the Pumwani Sex Worker cohort, Kenya. In this cohort, more than 140 of the 2000 participants have been characterized to be relatively resistant to HIV-1 infection. Given that sexual transmission of HIV-1 occurs through mucosal surfaces such as that in the cervicovaginal environment, our hypothesis is that innate immune factors in the genital tract may play a role in HIV-1 infection resistance. Understanding this mechanism may help develop microbicides and/or vaccines against HIV-1. A quantitative proteomics technique (2D-DIGE: two-dimensional difference in-gel electrophoresis) was used to examine cervical mucosa of HIV-1 resistant women ( n = 10) for biomarkers of HIV-1 resistance. Over 15 proteins were found to be differentially expressed between HIV-1-resistant women and control groups ( n = 29), some which show a greater than 8-fold change. HIV-1-resistant women overexpressed several antiproteases, including those from the serpin B family, and also cystatin A, a known anti-HIV-1 factor. Immunoblotting for a selection of the identified proteins confirmed the DIGE volume differences. Validation of these results on a larger sample of individuals will provide further evidence these biomarkers are associated with HIV-1 resistance and could help aid in the development of effective microbicides against HIV-1.

  13. Neuronal expression of pathological tau accelerates oligodendrocyte progenitor cell differentiation

    PubMed Central

    Ossola, Bernardino; Zhao, Chao; Compston, Alastair; Pluchino, Stefano; Franklin, Robin J. M.

    2015-01-01

    Oligodendrocyte progenitor cell (OPC) differentiation is an important therapeutic target to promote remyelination in multiple sclerosis (MS). We previously reported hyperphosphorylated and aggregated microtubule‐associated protein tau in MS lesions, suggesting its involvement in axonal degeneration. However, the influence of pathological tau‐induced axonal damage on the potential for remyelination is unknown. Therefore, we investigated OPC differentiation in human P301S tau (P301S‐htau) transgenic mice, both in vitro and in vivo following focal demyelination. In 2‐month‐old P301S‐htau mice, which show hyperphosphorylated tau in neurons, we found atrophic axons in the spinal cord in the absence of prominent axonal degeneration. These signs of early axonal damage were associated with microgliosis and an upregulation of IL‐1β and TNFα. Following in vivo focal white matter demyelination we found that OPCs differentiated more efficiently in P301S‐htau mice than wild type (Wt) mice. We also found an increased level of myelin basic protein within the lesions, which however did not translate into increased remyelination due to higher susceptibility of P301S‐htau axons to demyelination‐induced degeneration compared to Wt axons. In vitro experiments confirmed higher differentiation capacity of OPCs from P301S‐htau mice compared with Wt mice‐derived OPCs. Because the OPCs from P301S‐htau mice do not ectopically express the transgene, and when isolated from newborn mice behave like Wt mice‐derived OPCs, we infer that their enhanced differentiation capacity must have been acquired through microenvironmental priming. Our data suggest the intriguing concept that damaged axons may signal to OPCs and promote their differentiation in the attempt at rescue by remyelination. GLIA 2016;64:457–471 PMID:26576485

  14. Acute Heat Stress and Reduced Nutrient Intake Alter Intestinal Proteomic Profile and Gene Expression in Pigs

    PubMed Central

    Pearce, Sarah C.; Lonergan, Steven M.; Huff-Lonergan, Elisabeth; Baumgard, Lance H.; Gabler, Nicholas K.

    2015-01-01

    Heat stress and reduced feed intake negatively affect intestinal integrity and barrier function. Our objective was to compare ileum protein profiles of pigs subjected to 12 hours of HS, thermal neutral ad libitum feed intake, or pair-fed to heat stress feed intake under thermal neutral conditions (pair-fed thermal neutral). 2D-Differential In Gel Electrophoresis and gene expression were performed. Relative abundance of 281 and 138 spots differed due to heat stress, compared to thermal neutral and pair-fed thermal neutral pigs, respectively. However, only 20 proteins were different due to feed intake (thermal neutral versus pair-fed thermal neutral). Heat stress increased mRNA expression of heat shock proteins and protein abundance of heat shock proteins 27, 70, 90-α and β were also increased. Heat stress reduced ileum abundance of several metabolic enzymes, many of which are involved in the glycolytic or TCA pathways, indicating a change in metabolic priorities. Stress response enzymes peroxiredoxin-1 and peptidyl-prolyl cis-trans isomerase A were decreased in pair-fed thermal neutral and thermal neutral pigs compared to heat stress. Heat stress increased mRNA abundance markers of ileum hypoxia. Altogether, these data show that heat stress directly alters intestinal protein and mRNA profiles largely independent of reduced feed intake. These changes may be related to the reduced intestinal integrity associated with heat stress. PMID:26575181

  15. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  16. Quantitative proteomic analysis of HER2 expression in the selection of gastric cancer patients for trastuzumab treatment

    PubMed Central

    An, E.; Ock, C.-Y.; Kim, T.-Y.; Lee, K.-H.; Han, S.-W.; Im, S.-A.; Kim, T.-Y.; Liao, W.-L.; Cecchi, F.; Blackler, A.; Thyparambil, S.; Kim, W. H.; Burrows, J.; Hembrough, T.; Catenacci, D. V. T.; Bang, Y.-J.

    2017-01-01

    Abstract Background A wide range of response rates have been reported in HER2-positive gastric cancer (GC) patients treated with trastuzumab. Other HER2-targeted therapies for GC have yet to show efficacy in clinical trials. These findings raise question about the ability of standard HER2 diagnostics to accurately distinguish between GC patients who would and would not benefit from anti-HER2 therapies. Patients and methods GC patients (n = 237), including a subset from the Trastuzumab in GC (ToGA) trial were divided into three groups based on HER2 status and history of treatment with standard chemotherapy or chemotherapy plus trastuzumab. We applied mass spectrometry-based proteomic analysis to quantify HER2 protein expression in formalin-fixed tumor samples. Using HER2 expression as a continuous variable, we defined a predictive protein level cutoff to identify which patients would benefit from trastuzumab. We compared quantitated protein level with clinical outcome and HER2 status as determined by conventional HER2 diagnostics. Results Quantitative proteomics detected a 115-fold range of HER2 protein expression among patients diagnosed as HER2 positive by standard methods. A protein level of 1825 amol/µg was predicted to determine benefit from the addition of trastuzumab to chemotherapy. Trastuzumab treated patients with HER2 protein levels above this cutoff had twice the median overall survival (OS) of their counterparts below the cutoff (35.0 versus 17.5 months, P = 0.011). Conversely, trastuzumab-treated patients with HER2 levels below the cutoff had outcomes similar to HER2-positive patients treated with chemotherapy. (Progression-free survival = 7.0 versus 6.5 months: P = 0.504; OS = 17.5 versus 12.6 months: P = 0.520). HER2 levels were not prognostic for response to chemotherapy. Conclusions Proteomic analysis of HER2 expression demonstrated a quantitative cutoff that improves selection of GC patients for trastuzumab as compared

  17. Differential extraction and enrichment of human sperm surface proteins in a proteome: identification of immunocontraceptive candidates.

    PubMed

    Shetty, J; Diekman, A B; Jayes, F C; Sherman, N E; Naaby-Hansen, S; Flickinger, C J; Herr, J C

    2001-08-01

    The objective of this study was to discover previously unknown human sperm surface proteins that may be candidate contraceptive vaccinogens. To this end, methods of concentrating human sperm proteins for microsequencing by mass spectrometry were used, which increased the likelihood of identifying surface proteins. Vectorial labeling, differential extraction and two-dimensional (2-D) gel electrophoresis were employed to identify and isolate proteins accessible at the cell surface. Percoll harvested or swim-up sperm were either solubilized directly or solubilized after surface labeling with sulfo-succinimidyl-6-(biotinamido)hexanoate (sulfo-NHS-LC-biotin). Comparisons were made of proteins extracted with four lysis buffers: (i) Celis buffer containing 9.8 M urea and 2% Igepal CA-630; (ii) 1% Triton X (TX)-100; (iii) 1.7% TX-114 followed by phase partitioning; or (iv) 1 M NaCl. Blots of proteins separated by high-resolution 2-D electrophoresis were probed with avidin and antibodies to known proteins specific for three domains: the sperm surface (SAGA-1), the acrosome (SP-10), and the cytoskeleton (alpha-tubulin). Celis buffer (45 min) extracted proteins from all three major compartments. However, a 20-s extraction in Celis buffer enriched for several proteins and enabled the identification of several novel peptides by mass spectrometry. Mild extraction with TX-100 or 1 M NaCl solubilized mainly membrane and acrosomal proteins, but not cytoskeletal proteins. Comparison of biotinylated proteins extracted by each method showed that the major vectorially labeled proteins solubilized by Celis buffer were also solubilized by TX-100, TX-114, and 1 M NaCl. Extraction with TX-114 followed by phase-partitioning significantly enriched hydrophobic surface proteins and aided resolution and isolation. Eight protein spots microsequenced following all these extraction methods proved to be novel sperm molecules.

  18. Proteomics Analysis of Alfalfa Response to Heat Stress

    PubMed Central

    Li, Weimin; Wei, Zhenwu; Qiao, Zhihong; Wu, Zinian; Cheng, Lixiang; Wang, Yuyang

    2013-01-01

    The proteome responses to heat stress have not been well understood. In this study, alfalfa (Medicago sativa L. cv. Huaiyin) seedlings were exposed to 25°C (control) and 40°C (heat stress) in growth chambers, and leaves were collected at 24, 48 and 72 h after treatment, respectively. The morphological, physiological and proteomic processes were negatively affected under heat stress. Proteins were extracted and separated by two-dimensional polyacrylamide gel electrophoresis (2-DE), and differentially expressed protein spots were identified by mass spectrometry (MS). Totally, 81 differentially expressed proteins were identified successfully by MALDI-TOF/TOF. These proteins were categorized into nine classes: including metabolism, energy, protein synthesis, protein destination/storage, transporters, intracellular traffic, cell structure, signal transduction and disease/defence. Five proteins were further analyzed for mRNA levels. The results of the proteomics analyses provide a better understanding of the molecular basis of heat-stress responses in alfalfa. PMID:24324825

  19. Three human cell types respond to multi-walled carbon nanotubes and titanium dioxide nanobelts with cell-specific transcriptomic and proteomic expression patterns

    PubMed Central

    Tilton, Susan C.; Karin, Norman J.; Tolic, Ana; Xie, Yumei; Lai, Xianyin; Hamilton, Raymond F.; Waters, Katrina M.; Holian, Andrij; Witzmann, Frank A.; Orr, Galya

    2014-01-01

    The growing use of engineered nanoparticles (NPs) in commercial and medical applications raises the urgent need for tools that can predict NP toxicity. We conducted global transcriptome and proteome analyses of three human cell types, exposed to two high aspect ratio NP types, to identify patterns of expression that might indicate high vs. low NP toxicity. Three cell types representing the most common routes of human exposure to NPs, including macrophage like (THP-1), small airway epithelial (SAE), and intestinal (Caco-2/HT29-MTX) cells, were exposed to TiO2 nanobelts (TiO2-NB; high toxicity) and multi-walled carbon nanotubes (MWCNT; low toxicity) at low (10 μg/ml) and high (100 μg/ml) concentrations for 1 and 24 h. Unique patterns of gene and protein expressions were identified for each cell type, with no differentially expressed (p<0.05, 1.5-fold change) genes or proteins overlapping across all three cell types. While unique to each cell-type, the early response was primarily independent of NP type, showing similar expression patterns in response to both TiO2-NB and MWCNT. The early response might therefore indicate a general response to insult. In contrast, the 24 h response was unique to each NP type. The most significantly (p<0.05) enriched biological processes in THP-1 cells indicated TiO2-NB regulation of pathways associated with inflammation, apoptosis, cell cycle arrest, DNA replication stress and genomic instability, while MWCNT regulated pathways indicating increased cell proliferation, DNA repair and anti-apoptosis. These two distinct sets of biological pathways might therefore underlie cellular responses to high and low NP toxicity, respectively. PMID:23659652

  20. Three Human Cell Types Respond to Multi-Walled Carbon Nanotubes and Titanium Dioxide Nanobelts with Cell-Specific Transcriptomic and Proteomic Expression Patterns.

    SciTech Connect

    Tilton, Susan C.; Karin, Norman J.; Tolic, Ana; Xie, Yumei; Lai, Xianyin; Hamilton, Raymond F.; Waters, Katrina M.; Holian, Andrij; Witzmann, Frank A.; Orr, Galya

    2014-08-01

    The growing use of engineered nanoparticles (NPs) in commercial and medical applications raises the urgent need for tools that can predict NP toxicity. Global transcriptome and proteome analyses were conducted on three human cell types, exposed to two high aspect ratio NP types, to identify patterns of expression that might indicate high versus low NP toxicity. Three cell types representing the most common routes of human exposure to NPs, including macrophage-like (THP-1), small airway epithelial and intestinal (Caco-2/HT29-MTX) cells, were exposed to TiO2 nanobelts (TiO2-NB; high toxicity) and multi-walled carbon nanotubes (MWCNT; low toxicity) at low (10 µg/mL) and high (100 µg/mL) concentrations for 1 and 24 h. Unique patterns of gene and protein expressions were identified for each cell type, with no differentially expressed (p < 0.05, 1.5-fold change) genes or proteins overlapping across all three cell types. While unique to each cell type, the early response was primarily independent of NP type, showing similar expression patterns in response to both TiO2-NB and MWCNT. The early response might, therefore, indicate a general response to insult. In contrast, the 24 h response was unique to each NP type. The most significantly (p < 0.05) enriched biological processes in THP-1 cells indicated TiO2-NB regulation of pathways associated with inflammation, apoptosis, cell cycle arrest, DNA replication stress and genomic instability, while MWCNT-regulated pathways indicated increased cell proliferation, DNA repair and anti-apoptosis. These two distinct sets of biological pathways might, therefore, underlie cellular responses to high and low NP toxicity, respectively.

  1. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  2. Microarray data analysis for differential expression: a tutorial.

    PubMed

    Suárez, Erick; Burguete, Ana; Mclachlan, Geoffrey J

    2009-06-01

    DNA microarray is a technology that simultaneously evaluates quantitative measurements for the expression of thousands of genes. DNA microarrays have been used to assess gene expression between groups of cells of different organs or different populations. In order to understand the role and function of the genes, one needs the complete information about their mRNA transcripts and proteins. Unfortunately, exploring the protein functions is very difficult, due to their unique 3-dimentional complicated structure. To overcome this difficulty, one may concentrate on the mRNA molecules produced by the gene expression. In this paper, we describe some of the methods for preprocessing data for gene expression and for pairwise comparison from genomic experiments. Previous studies to assess the efficiency of different methods for pairwise comparisons have found little agreement in the lists of significant genes. Finally, we describe the procedures to control false discovery rates, sample size approach for these experiments, and available software for microarray data analysis. This paper is written for those professionals who are new in microarray data analysis for differential expression and want to have an overview of the specific steps or the different approaches for this sort of analysis.

  3. Expression of Transthyretin during bovine myogenic satellite cell differentiation.

    PubMed

    Pokharel, Smritee; Kamli, Majid Rasool; Mir, Bilal Ahmad; Malik, Adeel; Lee, Eun Ju; Choi, Inho

    2014-09-01

    Adult myogenesis responsible for the maintenance and repair of muscle tissue is mainly under the control of myogenic regulatory factors (MRFs) and a few other genes. Transthyretin gene (TTR), codes for a carrier protein for thyroxin (T4) and retinol binding protein bound with retinol in blood plasma, plays a critical role during the early stages of myogenesis. Herein, we investigated the relationship of TTR with other muscle-specific genes and report their expression in muscle satellite cells (MSCs), and increased messenger RNA (mRNA) and protein expression of TTR during MSCs differentiation. Silencing of TTR resulted in decreased myotube formation and decreased expression of myosin light chain (MYL2), myosin heavy chain 3 (MYH3), matrix gla protein (MGP), and voltage-dependent L type calcium channel (Cav1.1) genes. Increased mRNA expression observed in TTR and other myogenic genes with the addition of T4 decreased significantly following TTR knockdown, indicating the critical role of TTR in T4 transportation. Similarly, decreased expression of MGP and Cav1.1 following TTR knockdown signifies the dual role of TTR in controlling muscle myogenesis via regulation of T4 and calcium channel. Our computational and experimental evidences indicate that TTR has a relationship with MRFs and may act on calcium channel and related genes.

  4. Differential expression of angiogenic factors in peripheral nerve sheath tumors.

    PubMed

    Wasa, Junji; Nishida, Yoshihiro; Suzuki, Yoshitaka; Tsukushi, Satoshi; Shido, Yoji; Hosono, Kozo; Shimoyama, Yoshie; Nakamura, Shigeo; Ishiguro, Naoki

    2008-01-01

    It is difficult to differentiate some malignant peripheral nerve sheath tumors (MPNST) from benign peripheral nerve sheath tumors (BPNST) histologically, and to predict the clinical outcome of patients with MPNST. In this study, the expression of VEGF and MVD were evaluated immunohistochemically in 22 cases of MPNST, 14 of neurofibroma and 19 of schwannoma and correlation of the staining grade of VEGF or MVD and the various clinical factors were analyzed, and statistically evaluated. Levels of VEGF mRNA expression were also determined with real-time RT-PCR. Statistically higher positive staining for VEGF was observed in MPNST compared to neurofibroma (P=0.004) and schwannoma (P<0.001). Even low grade MPNST showed higher VEGF positive staining than neurofibroma. Moreover, high VEGF expression statistically correlated with the poor prognosis of the patients with MPNST (P=0.015). Although MVD in MPNST was significantly higher than that in neurofibroma (P=0.038) and schwannoma (P<0.001), MVD could not predict the prognosis of the patients with MPNST. Although VEGF mRNA expression tended to be higher in MPNST compared to neurofibroma, the difference was not significant. Levels of VEGF protein expression serve as a novel diagnostic and prognostic tools for peripheral nerve sheath tumors.

  5. Wheat quality related differential expressions of albumins and globulins revealed by two-dimensional difference gel electrophoresis (2-D DIGE).

    PubMed

    Gao, Liyan; Wang, Aili; Li, Xiaohui; Dong, Kun; Wang, Ke; Appels, Rudi; Ma, Wujun; Yan, Yueming

    2009-12-01

    Comparative proteomics analysis offers a new approach to identify differential proteins among different wheat genotypes and developmental stages. In this study, the non-prolamin expression profiles during grain development of two common or bread wheat cultivars (Triticum aestivum L.), Jing 411 and Sunstate, with different quality properties were analyzed using two-dimensional difference gel electrophoresis (2-D DIGE). Five grain developmental stages during the post-anthesis period were sampled corresponding to the cumulative averages of daily temperatures ( degrees C: 156 degrees C, 250 degrees C, 354 degrees C, 447 degrees C and 749.5 degrees C). More than 400 differential protein spots detected at one or more of the developmental stages of the two cultivars were monitored, among which 230 proteins were identified by MS. Of the identified proteins, more than 85% were enzymes possessing different physiological functions. A total of 36 differential proteins were characterized between the two varieties, which are likely to be related to wheat quality attributes. About one quarter of the proteins identified expressed in multiple spots with different pIs and molecular masses, implying certain post-translational modifications (PTMs) of proteins such as phosphorylations and glycosylations. The results provide new insights into biochemical mechanisms for grain development and quality.

  6. Quantitative expression proteomics and phosphoproteomics profile of brain from PINK1 knockout mice: insights into mechanisms of familial Parkinson's disease.

    PubMed

    Triplett, Judy C; Zhang, Zhaoshu; Sultana, Rukhsana; Cai, Jian; Klein, Jon B; Büeler, Hansruedi; Butterfield, David Allan

    2015-06-01

    Parkinson's disease (PD) is an age-related, neurodegenerative motor disorder characterized by progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta and presence of α-synuclein-containing protein aggregates. Mutations in the mitochondrial Ser/Thr kinase PTEN-induced kinase 1 (PINK1) are associated with an autosomal recessive familial form of early-onset PD. Recent studies have suggested that PINK1 plays important neuroprotective roles against mitochondrial dysfunction by phosphorylating and recruiting Parkin, a cytosolic E3 ubiquitin ligase, to facilitate elimination of damaged mitochondria via autophagy-lysosomal pathways. Loss of PINK1 in cells and animals leads to various mitochondrial impairments and oxidative stress, culminating in dopaminergic neuronal death in humans. Using a 2-D polyacrylamide gel electrophoresis proteomics approach, the differences in expressed brain proteome and phosphoproteome between 6-month-old PINK1-deficient mice and wild-type mice were identified. The observed changes in the brain proteome and phosphoproteome of mice lacking PINK1 suggest that defects in signaling networks, energy metabolism, cellular proteostasis, and neuronal structure and plasticity are involved in the pathogenesis of familial PD. Mutations in PINK1 are associated with an early-onset form of Parkinson's disease (PD). This study examines changes in the proteome and phosphoproteome of the PINK1 knockout mouse brain. Alterations were noted in several key proteins associated with: increased oxidative stress, aberrant cellular signaling, altered neuronal structure, decreased synaptic plasticity, reduced neurotransmission, diminished proteostasis networks, and altered metabolism. 14-3-3ε, 14-3-3 protein epsilon; 3-PGDH, phosphoglycerate dehydrogenase; ALDOA, aldolase A; APT1, acyl-protein thioesterase 1; CaM, calmodulin; CBR3, carbonyl reductase [NADPH] 3; ENO2, gamma-enolase; HPRT, hypoxanthine-guanine phosphoribosyltransferase; HSP70

  7. Molecular characterization, expression patterns, and polymorphism of a differentially expressed porcine gene (PYGM) isolated by suppression subtractive hybridization and two-dimensional gel electrophoresis analysis.

    PubMed

    Xu, Yongjie; Yu, Wenmin; Feng, Xiaoting; Xie, Hongtao; Xiong, Yuanzhu

    2012-01-01

    Suppression subtractive hybridization was performed to detect the differences in gene expression of porcine longissimus dorsi muscles between Large White and Chinese Meishan pigs. An upregulated gene in Large White that shared high homology with human muscle glycogen phosphorylase (PYGM) was identified. The porcine PYGM gene contains an open reading frame encoding 842 amino acid residues with 26 and 283 nucleotides in the 5' and 3' untranslated regions, respectively. Tissue distribution analysis indicated that porcine PYGM mRNAs are highly expressed in all tissues. Expression pattern of PYGM was similar in the two breeds. Both breeds had the highest expression levels when 120 days old (p<0.01), and PYGM was upregulated during skeletal muscle development. A similar expression pattern of PYGM in protein level was also observed by differential proteome analysis of skeletal muscle development using two-dimensional gel electrophoresis and mass spectroscopy. The mRNA abundance of PYGM in Large White was higher than Meishan at all four stages (p<0.05). Moreover, a G/T mutation in exon 8 was identified and association analysis with meat quality traits showed that it was significantly associated with lean meat percentage (p<0.05). Our data may provide further insight into the molecular mechanisms responsible for breed-specific differences in porcine growth and meat quality.

  8. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  9. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  10. Differential proteomic responses to water stress induced by PEG in two creeping bentgrass cultivars differing in stress tolerance.

    PubMed

    Xu, Chenping; Huang, Bingru

    2010-11-15

    Protein metabolism and expression play important role in plant adaptation to water stress. The objectives of this study were to examine proteomic responses to water stress induced by polyethylene glycol (PEG) in creeping bentgrass (Agrostis stolonifera L.) leaves and to identify proteins associated with stress tolerance. Plants of two cultivars ('Penncross' and 'Penn-A4') differing in water stress tolerance were grown in sand irrigated daily with water (control) or PEG solution (osmotic potential of -0.66MPa) to induce water stress, for 28d in growth chambers. Shoot extension rate, relative water content and cell membrane stability were measured to compare drought tolerance between the two cultivars. All parameters maintained at a significantly higher level in 'Penn-A4' than in 'Penncross' under PEG treatment. After 28d of water stress, proteins were extracted from leaves and separated by difference gel electrophoresis. Among 56 stress-responsive protein spots, 46 were identified using mass spectrometry. Some proteins involved in primary nitrogen and carbon metabolism were down-regulated by PEG-induced water stress in both cultivars. The abundance of antioxidant enzyme proteins (ascorbate peroxidase, catalase and glutathione-S-transferase) increased under water stress, particularly ascorbate peroxidase in 'Penn-A4'. The abundance levels of actins, UDP-sulfoquinovose synthase and glucan exohydrolase were greater in 'Penn-A4' than in 'Penncross' under PEG treatment. Our results suggest that proteins involved in membrane synthesis, cell wall loosening, cell turgor maintenance, and antioxidant defense may play roles in perennial grass adaptation to PEG-induced water stress.

  11. Quantitative Proteomics of the Root of Transgenic Wheat Expressing TaBWPR-1.2 Genes in Response to Waterlogging.

    PubMed

    Haque, Emdadul; Abe, Fumitaka; Mori, Masahiko; Nanjo, Yohei; Komatsu, Setsuko; Oyanagi, Atsushi; Kawaguchi, Kentaro

    2014-11-04

    Once candidate genes are available, the application of genetic transformation plays a major part to study their function in plants for adaptation to respective environmental stresses, including waterlogging (WL). The introduction of stress-inducible genes into wheat remains difficult because of low transformation and plant regeneration efficiencies and expression variability and instability. Earlier, we found two cDNAs encoding WL stress-responsive wheat pathogenesis-related proteins 1.2 (TaBWPR-1.2), TaBWPR-1.2#2 and TaBWPR-1.2#13. Using microprojectile bombardment, both cDNAs were introduced into "Bobwhite". Despite low transformation efficiency, four independent T₂ homozygous lines for each gene were isolated, where transgenes were ubiquitously and variously expressed. The highest transgene expression was obtained in Ubi:TaBWPR-1.2#2 L#11a and Ubi:TaBWPR-1.2#13 L#4a. Using quantitative proteomics, the root proteins of L#11a were analyzed to explore possible physiological pathways regulated by TaBWPR-1.2 under normal and waterlogged conditions. In L#11a, the abundance of proteasome subunit alpha type-3 decreased under normal conditions, whereas that of ferredoxin precursor and elongation factor-2 increased under waterlogged conditions in comparison with normal plants. Proteomic results suggest that L#11a is one of the engineered wheat plants where TaBWPR-1.2#2 is most probably involved in proteolysis, protein synthesis and alteration in the energy pathway in root tissues via the above proteins in order to gain metabolic adjustment to WL.

  12. Quantitative Proteomics of the Root of Transgenic Wheat Expressing TaBWPR-1.2 Genes in Response to Waterlogging

    PubMed Central

    Haque, Emdadul; Abe, Fumitaka; Mori, Masahiko; Nanjo, Yohei; Komatsu, Setsuko; Oyanagi, Atsushi; Kawaguchi, Kentaro

    2014-01-01

    Once candidate genes are available, the application of genetic transformation plays a major part to study their function in plants for adaptation to respective environmental stresses, including waterlogging (WL). The introduction of stress-inducible genes into wheat remains difficult because of low transformation and plant regeneration efficiencies and expression variability and instability. Earlier, we found two cDNAs encoding WL stress-responsive wheat pathogenesis-related proteins 1.2 (TaBWPR-1.2), TaBWPR-1.2#2 and TaBWPR-1.2#13. Using microprojectile bombardment, both cDNAs were introduced into “Bobwhite”. Despite low transformation efficiency, four independent T2 homozygous lines for each gene were isolated, where transgenes were ubiquitously and variously expressed. The highest transgene expression was obtained in Ubi:TaBWPR-1.2#2 L#11a and Ubi:TaBWPR-1.2#13 L#4a. Using quantitative proteomics, the root proteins of L#11a were analyzed to explore possible physiological pathways regulated by TaBWPR-1.2 under normal and waterlogged conditions. In L#11a, the abundance of proteasome subunit alpha type-3 decreased under normal conditions, whereas that of ferredoxin precursor and elongation factor-2 increased under waterlogged conditions in comparison with normal plants. Proteomic results suggest that L#11a is one of the engineered wheat plants where TaBWPR-1.2#2 is most probably involved in proteolysis, protein synthesis and alteration in the energy pathway in root tissues via the above proteins in order to gain metabolic adjustment to WL. PMID:28250392

  13. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  14. Learning regulatory programs that accurately predict differential expression with MEDUSA.

    PubMed

    Kundaje, Anshul; Lianoglou, Steve; Li, Xuejing; Quigley, David; Arias, Marta; Wiggins, Chris H; Zhang, Li; Leslie, Christina

    2007-12-01

    Inferring gene regulatory networks from high-throughput genomic data is one of the central problems in computational biology. In this paper, we describe a predictive modeling approach for studying regulatory networks, based on a machine learning algorithm called MEDUSA. MEDUSA integrates promoter sequence, mRNA expression, and transcription factor occupancy data to learn gene regulatory programs that predict the differential expression of target genes. Instead of using clustering or correlation of expression profiles to infer regulatory relationships, MEDUSA determines condition-specific regulators and discovers regulatory motifs that mediate the regulation of target genes. In this way, MEDUSA meaningfully models biological mechanisms of transcriptional regulation. MEDUSA solves the problem of predicting the differential (up/down) expression of target genes by using boosting, a technique from statistical learning, which helps to avoid overfitting as the algorithm searches through the high-dimensional space of potential regulators and sequence motifs. Experimental results demonstrate that MEDUSA achieves high prediction accuracy on held-out experiments (test data), that is, data not seen in training. We also present context-specific analysis of MEDUSA regulatory programs for DNA damage and hypoxia, demonstrating that MEDUSA identifies key regulators and motifs in these processes. A central challenge in the field is the difficulty of validating reverse-engineered networks in the absence of a gold standard. Our approach of learning regulatory programs provides at least a partial solution for the problem: MEDUSA's prediction accuracy on held-out data gives a concrete and statistically sound way to validate how well the algorithm performs. With MEDUSA, statistical validation becomes a prerequisite for hypothesis generation and network building rather than a secondary consideration.

  15. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electr