Science.gov

Sample records for differentially expressed gene

  1. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  2. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  3. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  4. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  5. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  6. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  7. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  8. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  9. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  10. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  11. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  12. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  13. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  14. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  15. Integration of amplified differential gene expression (ADGE) and DNA microarray.

    PubMed

    Chen, Zhijian J; Gaté, Laurent; Davis, Warren; Ile, Kristina E; Tew, Kenneth D

    2002-12-01

    Amplified Differential Gene Expression (ADGE) provides a new concept that the ratios of differentially expressed genes are magnified before detection in order to improve both sensitivity and accuracy. This technology is now implemented with integration of DNA reassociation and PCR. The ADGE technique can be used either as a stand-alone method or in series with DNA microarray. ADGE is used in sample preprocessing and DNA microarray is used as a displaying system in the series combination. These two techniques are mutually synergistic: the quadratic magnification of ratios of differential gene expression achieved by ADGE improves the detection sensitivity and accuracy; the PCR amplification of templates enhances the signal intensity and reduces the requirement for large amounts of starting material; the high throughput for DNA microarray is maintained.

  16. Differentially expressed genes in giant cell tumor of bone.

    PubMed

    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula

    2011-04-01

    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  17. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  18. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  19. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  20. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  1. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  2. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  3. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  4. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  5. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  6. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  7. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  8. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  9. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  10. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  11. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  12. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  13. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  14. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  15. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  16. Improved detection of differentially expressed genes through incorporation of gene locations.

    PubMed

    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B

    2009-09-01

    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  17. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  18. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  19. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  20. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  1. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  2. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  3. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  4. Random forests-based differential analysis of gene sets for gene expression data.

    PubMed

    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An

    2013-04-10

    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  5. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  6. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.

    PubMed

    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu

    2015-06-15

    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  7. Differential var gene expression in children with malaria and antidromic effects on host gene expression.

    PubMed

    Kalmbach, Yvonne; Rottmann, Matthias; Kombila, Maryvonne; Kremsner, Peter G; Beck, Hans-Peter; Kun, Jürgen F J

    2010-07-15

    Among 62 children with mild malaria, cerebral malaria, or severe malarial anemia, we analyzed the transcription of different var gene types. There was no difference in parasitemia level or body temperature between groups. However, a significantly different expression pattern was observed in children with cerebral malaria, compared with that in patients in the other 2 groups: children with cerebral malaria had lower expression of the upsA subtype but higher expression of the upsB and upsC subtypes. Furthermore, expression of human genes responsive to tumor necrosis factor and hypoxia correlated with distinct ups types.

  8. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  9. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J

    1989-01-01

    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  10. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.

    PubMed

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-03-04

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  11. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-01-01

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  12. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.

    PubMed

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu

    2016-11-01

    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  13. CT gene modulate differential expression of chitinase gene under variant habitats in Vibrio cholerae

    PubMed Central

    Verma, Yogendra Kumar; Verma, Mahendra Kumar

    2013-01-01

    Objective To investigate the interrelation of cholera toxin gene (CT gene) in expression of chitinase gene under different pH conditions among pathogenic and Non-pathogenic strains of Vibrio cholera (V. cholera). Methods The chitinase assay well diffusion method and calorimetric chitinase assay were performed. Further, time depended chitinase activity among pathogenic and nonpathogenic strain was evaluated with control as Escherichia coli. The expressed protein in variant environment was purified by cascade of chromatographic techniques. The partially purified protein was analyzed by SDS-PAGE in both the strain of V. cholera. Results The results have shown differential expression of chitinase gene among vibrio in time depended chitinase activity, purification of expressed protein and SDS-PAGE analysis. Conclusions From the current study, two conclusions came in picture, habitat is prime factor that regulation of chitin gene expression among many bacterial strains, second, moreover among the vibrio pathogenic strains (CT+) expression of chitinase gene is more precisely regulated by CT gene rather than external environments while in non-pathogenic strain ( CT-) completely absent.

  14. Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African-American Prostate Cancer

    DTIC Science & Technology

    2015-10-01

    RNA and annotated. In addition, we have developed SSOs to manipulate PIK3CD alternative splicing, to correct aberrant splicing leading to production...molecular mechanisms, differential gene expression, alternative RNA splicing, epigenetic alterations, clinical tumor aggressiveness 16. SECURITY...words): Prostate cancer, health disparities among racial groups, molecular mechanisms, differential gene expression, alternative RNA splicing

  15. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  16. [Alteration of isozyme gene expression during cell differentiation and oncogenesis].

    PubMed

    Yamada, K; Noguchi, T

    1995-05-01

    Rat pyruvate kinase (PK) has four isozymes, called the M1-, M2-, L-, and R-types. The M1- and M2-type isozymes of PK are produced from the PKM gene by alternative splicing, whereas the L- and R-type isozymes of PK are produced from the PKL gene by use of different tissue-specific promoters. In early development, only M2-type PK expresses in all tissues. After late morphogenesis, M1-, L-, and R-type PK express tissue-specifically. In contrast, cell proliferation such as regenerating liver and oncogenesis lead to decrease or cessation of the expression of tissue-specific PK isozymes and to stimulation of the expression of M2-type PK. These phenomena from the point of view transcriptional regulatory apparatus of the PKM and PKL gene are discussed.

  17. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  18. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya

    2015-01-01

    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  19. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.

    PubMed

    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K

    2016-03-01

    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  20. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  1. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  2. Stress response in tardigrades: differential gene expression of molecular chaperones.

    PubMed

    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O

    2010-07-01

    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  3. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  4. Reconstructing differentially co-expressed gene modules and regulatory networks of soybean cells

    PubMed Central

    2012-01-01

    Background Current experimental evidence indicates that functionally related genes show coordinated expression in order to perform their cellular functions. In this way, the cell transcriptional machinery can respond optimally to internal or external stimuli. This provides a research opportunity to identify and study co-expressed gene modules whose transcription is controlled by shared gene regulatory networks. Results We developed and integrated a set of computational methods of differential gene expression analysis, gene clustering, gene network inference, gene function prediction, and DNA motif identification to automatically identify differentially co-expressed gene modules, reconstruct their regulatory networks, and validate their correctness. We tested the methods using microarray data derived from soybean cells grown under various stress conditions. Our methods were able to identify 42 coherent gene modules within which average gene expression correlation coefficients are greater than 0.8 and reconstruct their putative regulatory networks. A total of 32 modules and their regulatory networks were further validated by the coherence of predicted gene functions and the consistency of putative transcription factor binding motifs. Approximately half of the 32 modules were partially supported by the literature, which demonstrates that the bioinformatic methods used can help elucidate the molecular responses of soybean cells upon various environmental stresses. Conclusions The bioinformatics methods and genome-wide data sources for gene expression, clustering, regulation, and function analysis were integrated seamlessly into one modular protocol to systematically analyze and infer modules and networks from only differential expression genes in soybean cells grown under stress conditions. Our approach appears to effectively reduce the complexity of the problem, and is sufficiently robust and accurate to generate a rather complete and detailed view of putative soybean

  5. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  6. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  7. Differential gene expression analysis of ovarian cancer in a population isolate.

    PubMed

    Grazio, D; Pichler, I; Fuchsberger, C; Zolezzi, F; Guarnieri, P; Heidegger, H; Scherer, A; Engl, B; Messini, S; Egarter-Vigl, E; Pramstaller, P P

    2008-01-01

    Gene expression products represent candidate biomarkers with the potential for early screening and therapy of patients with ovarian serous carcinoma. The present study, using patients that originate from the population isolate of South Tyrol, Italy, substantiates the feasibility of differential gene expression analysis in a genetically isolated population for the identification of potential markers of ovarian cancer. Gene expression profiles of fresh-frozen ovarian serous papillary carcinoma samples were analyzed and compared to normal ovarian control tissues using oligonucleotide microarrays complementary to 14,500 human genes. Supervised analysis of gene expression profiling data identified 225 genes that are down-regulated and 635 that are up-regulated in malignant compared to normal ovarian tissues. Class-prediction analysis identified 40 differentially expressed genes for further investigation as potential classifiers for ovarian cancer, including 20 novel candidates. Our findings provide a glimpse into the potential of population isolate genomics in oncological research.

  8. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  9. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  10. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia.

    PubMed

    Ge, Yubin; Dombkowski, Alan A; LaFiura, Katherine M; Tatman, Dana; Yedidi, Ravikiran S; Stout, Mark L; Buck, Steven A; Massey, Gita; Becton, David L; Weinstein, Howard J; Ravindranath, Yaddanapudi; Matherly, Larry H; Taub, Jeffrey W

    2006-02-15

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins.

  11. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia

    PubMed Central

    Ge, Yubin; Dombkowski, Alan A.; LaFiura, Katherine M.; Tatman, Dana; Yedidi, Ravikiran S.; Stout, Mark L.; Buck, Steven A.; Massey, Gita; Becton, David L.; Weinstein, Howard J.; Ravindranath, Yaddanapudi; Matherly, Larry H.; Taub, Jeffrey W.

    2006-01-01

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins. PMID:16249385

  12. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  13. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.

    PubMed

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  14. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  15. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  16. Identification of differentially expressed genes induced by beet curly top virus infection in sugarbeet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to beet curly top virus (BCTV) trait is crucial in Western USA. There is sparse public knowledge of genes regulating resistance. This research focused on gene expression profiling of resistance to the three BCTV strains: Cal/Logan (Cal), Worland (Wor), and severe. Differential gene exp...

  17. Differential expression of genes related to gain and intake in the liver of beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  18. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2011-01-01

    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  19. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  20. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    PubMed

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  1. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

    PubMed Central

    Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

  2. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    PubMed

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia.

  3. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  4. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  5. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  6. Meta-Analysis of Differential Connectivity in Gene Co-Expression Networks in Multiple Sclerosis

    PubMed Central

    Creanza, Teresa Maria; Liguori, Maria; Liuni, Sabino; Nuzziello, Nicoletta; Ancona, Nicola

    2016-01-01

    Differential gene expression analyses to investigate multiple sclerosis (MS) molecular pathogenesis cannot detect genes harboring genetic and/or epigenetic modifications that change the gene functions without affecting their expression. Differential co-expression network approaches may capture changes in functional interactions resulting from these alterations. We re-analyzed 595 mRNA arrays from publicly available datasets by studying changes in gene co-expression networks in MS and in response to interferon (IFN)-β treatment. Interestingly, MS networks show a reduced connectivity relative to the healthy condition, and the treatment activates the transcription of genes and increases their connectivity in MS patients. Importantly, the analysis of changes in gene connectivity in MS patients provides new evidence of association for genes already implicated in MS by single-nucleotide polymorphism studies and that do not show differential expression. This is the case of amiloride-sensitive cation channel 1 neuronal (ACCN1) that shows a reduced number of interacting partners in MS networks, and it is known for its role in synaptic transmission and central nervous system (CNS) development. Furthermore, our study confirms a deregulation of the vitamin D system: among the transcription factors that potentially regulate the deregulated genes, we find TCF3 and SP1 that are both involved in vitamin D3-induced p27Kip1 expression. Unveiling differential network properties allows us to gain systems-level insights into disease mechanisms and may suggest putative targets for the treatment. PMID:27314336

  7. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  8. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  9. EVE (external variance estimation) increases statistical power for detecting differentially expressed genes.

    PubMed

    Wille, Anja; Gruissem, Wilhelm; Bühlmann, Peter; Hennig, Lars

    2007-11-01

    Accurately identifying differentially expressed genes from microarray data is not a trivial task, partly because of poor variance estimates of gene expression signals. Here, after analyzing 380 replicated microarray experiments, we found that probesets have typical, distinct variances that can be estimated based on a large number of microarray experiments. These probeset-specific variances depend at least in part on the function of the probed gene: genes for ribosomal or structural proteins often have a small variance, while genes implicated in stress responses often have large variances. We used these variance estimates to develop a statistical test for differentially expressed genes called EVE (external variance estimation). The EVE algorithm performs better than the t-test and LIMMA on some real-world data, where external information from appropriate databases is available. Thus, EVE helps to maximize the information gained from a typical microarray experiment. Nonetheless, only a large number of replicates will guarantee to identify nearly all truly differentially expressed genes. However, our simulation studies suggest that even limited numbers of replicates will usually result in good coverage of strongly differentially expressed genes.

  10. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus

    PubMed Central

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-01-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus. PMID:27853123

  11. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  12. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  13. Transcriptome-Wide Differential Gene Expression in Bicyclus anynana Butterflies: Female Vision-Related Genes Are More Plastic.

    PubMed

    Macias-Muñoz, Aide; Smith, Gilbert; Monteiro, Antónia; Briscoe, Adriana D

    2016-01-01

    Vision is energetically costly to maintain. Consequently, over time many cave-adapted species downregulate the expression of vision genes or even lose their eyes and associated eye genes entirely. Alternatively, organisms that live in fluctuating environments, with different requirements for vision at different times, may evolve phenotypic plasticity for expression of vision genes. Here, we use a global transcriptomic and candidate gene approach to compare gene expression in the heads of a polyphenic butterfly. Bicyclus anynana have two seasonal forms that display sexual dimorphism and plasticity in eye morphology, and female-specific plasticity in opsin gene expression. Nonchoosy dry season females downregulate opsin expression, consistent with the high physiological cost of vision. To identify other genes associated with sexually dimorphic and seasonally plastic differences in vision, we analyzed RNA-sequencing data from whole head tissues. We identified two eye development genes (klarsicht and warts homologs) and an eye pigment biosynthesis gene (henna) differentially expressed between seasonal forms. By comparing sex-specific expression across seasonal forms, we found that klarsicht, warts, henna, and another eye development gene (domeless) were plastic in a female-specific manner. In a male-only analysis, white (w) was differentially expressed between seasonal forms. Reverse transcription polymerase chain reaction confirmed that warts and white are expressed in eyes only, whereas klarsicht, henna and domeless are expressed in both eyes and brain. We find that differential expression of eye development and eye pigment genes is associated with divergent eye phenotypes in B. anynana seasonal forms, and that there is a larger effect of season on female vision-related genes.

  14. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.

    PubMed

    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M

    2013-10-01

    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  15. A Microarray Analysis for Differential Gene Expression in the Soybean Genome Using Bioconductor and R

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper describes specific procedures for conducting quality assessment of Affymetrix GeneChip® soybean genome data and performing analyses to determine differential gene expression using the open-source R language and environment in conjunction with the open-source Bioconductor package. Procedu...

  16. Differential gene expression according to race and host plant in the pea aphid.

    PubMed

    Eyres, Isobel; Jaquiéry, Julie; Sugio, Akiko; Duvaux, Ludovic; Gharbi, Karim; Zhou, Jing-Jiang; Legeai, Fabrice; Nelson, Michaela; Simon, Jean-Christophe; Smadja, Carole M; Butlin, Roger; Ferrari, Julia

    2016-09-01

    Host-race formation in phytophagous insects is thought to provide the opportunity for local adaptation and subsequent ecological speciation. Studying gene expression differences amongst host races may help to identify phenotypes under (or resulting from) divergent selection and their genetic, molecular and physiological bases. The pea aphid (Acyrthosiphon pisum) comprises host races specializing on numerous plants in the Fabaceae and provides a unique system for examining the early stages of diversification along a gradient of genetic and associated adaptive divergence. In this study, we examine transcriptome-wide gene expression both in response to environment and across pea aphid races selected to cover the range of genetic divergence reported in this species complex. We identify changes in expression in response to host plant, indicating the importance of gene expression in aphid-plant interactions. Races can be distinguished on the basis of gene expression, and higher numbers of differentially expressed genes are apparent between more divergent races; these expression differences between host races may result from genetic drift and reproductive isolation and possibly divergent selection. Expression differences related to plant adaptation include a subset of chemosensory and salivary genes. Genes showing expression changes in response to host plant do not make up a large portion of between-race expression differences, providing confirmation of previous studies' findings that genes involved in expression differences between diverging populations or species are not necessarily those showing initial plasticity in the face of environmental change.

  17. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  18. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  19. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.

    PubMed

    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  20. Differential expression of ferritin genes in response to abiotic stresses and hormones in pear (Pyrus pyrifolia).

    PubMed

    Xi, Li; Xu, Kuanyong; Qiao, Yushan; Qu, Shenchun; Zhang, Zhen; Dai, Wenhao

    2011-10-01

    In this study, the expression patterns of four ferritin genes (PpFer1, PpFer2, PpFer3, and PpFer4) in pear were investigated using quantitative real-time PCR. Analysis of tissue-specific expression revealed higher expression level of these genes in leaves than in other tested tissues. These ferritin genes were differentially expressed in response to various abiotic stresses and hormones treatments. The expression of ferritin wasn't affected by Fe(III)-citrate treatment. Abscisic acid significantly enhanced the expression of all four ferritin genes, especially PpFer2, followed by N-benzylyminopurine, gibberellic acid, and indole-3-acetic acid. The expression peaks of PpFer1 and PpFer3 in leaves appeared at 6, 6, and 12 h, respectively, after pear plant was exposed to oxidative stress (5 mM H(2)O(2)), salt stress (200 mM NaCl), and heat stress (40°C). A significant increase in PpFer4 expression was detected at 6 h after salt stress or heat stress. The expression of ferritin genes was not altered by cold stress. These results suggested that ferritin genes might be functionally important in acclimation of pear to salt and oxidative stresses. Hormone treatments had no significant effect on expression of ferritin genes compared to abiotic stresses. This showed accumulation of ferritin genes could be operated by different transduction pathways under abiotic stresses and hormones treatments.

  1. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  2. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    PubMed Central

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  3. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  4. The Wilms’ Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation

    PubMed Central

    Kim, Jungho; Prawitt, Dirk; Bardeesy, Nabeel; Torban, Elena; Vicaner, Caroline; Goodyer, Paul; Zabel, Bernard; Pelletier, Jerry

    1999-01-01

    Gonadal differentiation is dependent upon a molecular cascade responsible for ovarian or testicular development from the bipotential gonadal ridge. Genetic analysis has implicated a number of gene products essential for this process, which include Sry, WT1, SF-1, and DAX-1. We have sought to better define the role of WT1 in this process by identifying downstream targets of WT1 during normal gonadal development. We have noticed that in the developing murine gonadal ridge, wt1 expression precedes expression of Dax-1, a nuclear receptor gene. We document here that the spatial distribution profiles of both proteins in the developing gonad overlap. We also demonstrate that WT1 can activate the Dax-1 promoter. Footprinting analysis, transient transfections, promoter mutagenesis, and mobility shift assays suggest that WT1 regulates Dax-1 via GC-rich binding sites found upstream of the Dax-1 TATA box. We show that two WT1-interacting proteins, the product of a Denys-Drash syndrome allele of wt1 and prostate apoptosis response-4 protein, inhibit WT1-mediated transactivation of Dax-1. In addition, we demonstrate that WT1 can activate the endogenous Dax-1 promoter. Our results indicate that the WT1–DAX-1 pathway is an early event in the process of mammalian sex determination. PMID:10022915

  5. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  6. Microarray analysis of differentially expressed genes engaged in fruit development between Prunus mume and Prunus armeniaca.

    PubMed

    Li, Xiaoying; Korir, Nicholas Kibet; Liu, Lili; Shangguan, Lingfei; Wang, Yuzhu; Han, Jian; Chen, Ming; Fang, Jinggui

    2012-11-15

    Microarray analysis is a technique that can be employed to provide expression profiles of single genes and new insights to elucidate the biological mechanisms responsible for fruit development. To evaluate expression of genes mostly engaged in fruit development between Prunus mume and Prunus armeniaca, we first identified differentially expressed transcripts along the entire fruit life cycle by using microarrays spotted with 10,641 ESTs collected from P. mume and other Prunus EST sequences. A total of 1418 ESTs were selected after quality control of microarray spots and analysis for differential gene expression patterns during fruit development of P. mume and P. Armeniaca. From these, 707 up-regulated and 711 down-regulated genes showing more than two-fold differences in expression level were annotated by GO based on biological processes, molecular functions and cellular components. These differentially expressed genes were found to be involved in several important pathways of carbohydrate, galactose, and starch and sucrose metabolism as well as in biosynthesis of other secondary metabolites via KEGG. This could provide detailed information on the fruit quality differences during development and ripening of these two species. With the results obtained, we provide a practical database for comprehensive understanding of molecular events during fruit development and also lay a theoretical foundation for the cloning of genes regulating in a series of important rate-limiting enzymes involved in vital metabolic pathways during fruit development.

  7. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.).

    PubMed

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M; Liu, Liwang

    2016-02-23

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish.

  8. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.)

    PubMed Central

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M.; Liu, Liwang

    2016-01-01

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish. PMID:26902837

  9. Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain

    PubMed Central

    Montoya, Julio Cesar; Fajardo, Dianora; Peña, Angela; Sánchez, Adalberto; Domínguez, Martha C; Satizábal, José María

    2014-01-01

    Background: The information of gene expression obtained from databases, have made possible the extraction and analysis of data related with several molecular processes involving not only in brain homeostasis but its disruption in some neuropathologies; principally in Down syndrome and the Alzheimer disease. Objective: To correlate the levels of transcription of 19 genes located in the Down Syndrome Critical Region (DSCR) with their expression in several substructures of normal human brain. Methods: There were obtained expression profiles of 19 DSCR genes in 42 brain substructures, from gene expression values available at the database of the human brain of the Brain Atlas of the Allen Institute for Brain Sciences", (http://human.brain-map.org/). The co-expression patterns of DSCR genes in brain were calculated by using multivariate statistical methods. Results: Highest levels of gene expression were registered at caudate nucleus, nucleus accumbens and putamen among central areas of cerebral cortex. Increased expression levels of RCAN1 that encode by a protein involved in signal transduction process of the CNS were recorded for PCP4 that participates in the binding to calmodulin and TTC3; a protein that is associated with differentiation of neurons. That previously identified brain structures play a crucial role in the learning process, in different class of memory and in motor skills. Conclusion: The precise regulation of DSCR gene expression is crucial to maintain the brain homeostasis, especially in those areas with high levels of gene expression associated with a remarkable process of learning and cognition. PMID:25767303

  10. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  11. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  12. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    PubMed Central

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  13. Identification of differentially expressed genes and their subpathways in recurrent versus primary bone giant cell tumors.

    PubMed

    Chen, Shuxin; Li, Chunquan; Wu, Bingli; Zhang, Chunlong; Liu, Cheng; Lin, Xiaoxu; Wu, Xiangqiao; Sun, Lingling; Liu, Chunpeng; Chen, Bo; Zhong, Zhigang; Xu, Liyan; Li, Enmin

    2014-09-01

    Giant cell tumor (GCT) of the bone is a benign but locally aggressive bone neoplasm with a strong tendency to develop local recurrent and metastatic disease. Thus, it provides a useful model system for the identification of biological mechanisms involved in bone tumor progression and metastasis. This study profiled 24 cases of recurrent versus primary bone GCT tissues using QuantiGene 2.0 Multiplex Arrays that included Human p53 80-Plex Panels and Human Stem Cell 80-Plex Panels. A total of 32 differentially expressed genes were identified, including the 20 most upregulated genes and the 12 most downregulated genes in recurrent GCT. The genes identified are related to cell growth, adhesion, apoptosis, signal transduction and bone formation. Furthermore, iSubpathwayMiner analyses were performed to identify significant biological pathway regions (subpathway) associated with this disease. The pathway analysis identified 11 statistically significant enriched subpathways, including pathways in cancer, p53 signaling pathway, osteoclast differentiation pathway and Wnt signaling pathway. Among these subpathways, four genes (IGF1, MDM2, STAT1 and RAC1) were presumed to play an important role in bone GCT recurrence. The differentially expressed MDM2 protein was immunohistochemically confirmed in the recurrent versus primary bone GCT tissues. This study identified differentially expressed genes and their subpathways in recurrent GCT, which may serve as potential biomarkers for the prediction of GCT recurrence.

  14. Identification of differentially expressed genes and signalling pathways in bark of Hevea brasiliensis seedlings associated with secondary laticifer differentiation using gene expression microarray.

    PubMed

    Loh, Swee Cheng; Thottathil, Gincy P; Othman, Ahmad Sofiman

    2016-10-01

    The natural rubber of Para rubber tree, Hevea brasiliensis, is the main crop involved in industrial rubber production due to its superior quality. The Hevea bark is commercially exploited to obtain latex, which is produced from the articulated secondary laticifer. The laticifer is well defined in the aspect of morphology; however, only some genes associated with its development have been reported. We successfully induced secondary laticifer in the jasmonic acid (JA)-treated and linolenic acid (LA)-treated Hevea bark but secondary laticifer is not observed in the ethephon (ET)-treated and untreated Hevea bark. In this study, we analysed 27,195 gene models using NimbleGen microarrays based on the Hevea draft genome. 491 filtered differentially expressed (FDE) transcripts that are common to both JA- and LA-treated bark samples but not ET-treated bark samples were identified. In the Eukaryotic Orthologous Group (KOG) analysis, 491 FDE transcripts belong to different functional categories that reflect the diverse processes and pathways involved in laticifer differentiation. In the Kyoto Encyclopedia of Genes and Genomes (KEGG) and KOG analysis, the profile of the FDE transcripts suggest that JA- and LA-treated bark samples have a sufficient molecular basis for secondary laticifer differentiation, especially regarding secondary metabolites metabolism. FDE genes in this category are from the cytochrome (CYP) P450 family, ATP-binding cassette (ABC) transporter family, short-chain dehydrogenase/reductase (SDR) family, or cinnamyl alcohol dehydrogenase (CAD) family. The data includes many genes involved in cell division, cell wall synthesis, and cell differentiation. The most abundant transcript in FDE list was SDR65C, reflecting its importance in laticifer differentiation. Using the Basic Local Alignment Search Tool (BLAST) as part of annotation and functional prediction, several characterised as well as uncharacterized transcription factors and genes were found in the

  15. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes.

    PubMed

    Gierz, Sarah L; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral's daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions.

  16. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes

    PubMed Central

    Gierz, Sarah L.; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral’s daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions. PMID:28293249

  17. Context Specific and Differential Gene Co-expression Networks via Bayesian Biclustering

    PubMed Central

    McDowell, Ian C.; Zhao, Shiwen; Brown, Christopher D.; Engelhardt, Barbara E.

    2016-01-01

    Identifying latent structure in high-dimensional genomic data is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes that covary in all of the samples or in only a subset of the samples. Our biclustering method, BicMix, allows overcomplete representations of the data, computational tractability, and joint modeling of unknown confounders and biological signals. Compared with related biclustering methods, BicMix recovers latent structure with higher precision across diverse simulation scenarios as compared to state-of-the-art biclustering methods. Further, we develop a principled method to recover context specific gene co-expression networks from the estimated sparse biclustering matrices. We apply BicMix to breast cancer gene expression data and to gene expression data from a cardiovascular study cohort, and we recover gene co-expression networks that are differential across ER+ and ER- samples and across male and female samples. We apply BicMix to the Genotype-Tissue Expression (GTEx) pilot data, and we find tissue specific gene networks. We validate these findings by using our tissue specific networks to identify trans-eQTLs specific to one of four primary tissues. PMID:27467526

  18. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing

    2015-01-01

    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  19. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  20. Transcriptome profiling identifies differentially expressed genes in postnatal developing pituitary gland of miniature pig.

    PubMed

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development.

  1. Transcriptome Profiling Identifies Differentially Expressed Genes in Postnatal Developing Pituitary Gland of Miniature Pig

    PubMed Central

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development. PMID:24282060

  2. Comparative Transcriptomic Analyses of Differentially Expressed Genes in Transgenic Melatonin Biosynthesis Ovine HIOMT Gene in Switchgrass

    PubMed Central

    Yuan, Shan; Guan, Cong; Liu, Sijia; Huang, Yanhua; Tian, Danyang; Cui, Xin; Zhang, Yunwei; Yang, Fuyu

    2016-01-01

    Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405, and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. Two hundred and seventy-five upregulated and 130 downregulated unigenes were detected in transgenic oHIOMT line comparing with control, including the significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3) genes, which were potentially correlated with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc.) were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc.) were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants. PMID:27877177

  3. An Orthologous Epigenetic Gene Expression Signature Derived from Differentiating Embryonic Stem Cells Identifies Regulators of Cardiogenesis.

    PubMed

    Busser, Brian W; Lin, Yongshun; Yang, Yanqin; Zhu, Jun; Chen, Guokai; Michelson, Alan M

    2015-01-01

    Here we used predictive gene expression signatures within a multi-species framework to identify the genes that underlie cardiac cell fate decisions in differentiating embryonic stem cells. We show that the overlapping orthologous mouse and human genes are the most accurate candidate cardiogenic genes as these genes identified the most conserved developmental pathways that characterize the cardiac lineage. An RNAi-based screen of the candidate genes in Drosophila uncovered numerous novel cardiogenic genes. shRNA knockdown combined with transcriptome profiling of the newly-identified transcription factors zinc finger protein 503 and zinc finger E-box binding homeobox 2 and the well-known cardiac regulatory factor NK2 homeobox 5 revealed that zinc finger E-box binding homeobox 2 activates terminal differentiation genes required for cardiomyocyte structure and function whereas zinc finger protein 503 and NK2 homeobox 5 are required for specification of the cardiac lineage. We further demonstrated that an essential role of NK2 homeobox 5 and zinc finger protein 503 in specification of the cardiac lineage is the repression of gene expression programs characteristic of alternative cell fates. Collectively, these results show that orthologous gene expression signatures can be used to identify conserved cardiogenic pathways.

  4. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  5. Differential expression of alkaline phosphatase gene in proliferating primary lymphocytes and malignant lymphoid cell lines.

    PubMed

    Latheef, S A A; Devanabanda, Mallaiah; Sankati, Swetha; Madduri, Ramanadham

    2016-02-01

    Alkaline Phosphatase (APase) activity has been shown to be enhanced specifically in mitogen stimulated B lymphocytes committed to proliferation, but not in T lymphocytes. APase gene expression was analyzed in proliferating murine and human primary lymphocytes and human malignant cell lines using reverse transcriptase and real time PCR. In mitogen stimulated murine splenic lymphocytes, enhancement of APase activity correlated well with an increase in APase gene expression. However, in mitogen stimulated murine T lymphocytes and human PBL despite a vigorous proliferative response, no increase in APase enzyme activity or gene expression was observed. A constitutive expression of APase activity concomitant with APase gene expression was observed inhuman myeloma cell line, U266 B1. However, neither enzyme activity nor gene expression of APase were observed in human T cell lymphoma, SUPT-1. The results suggest a differential expression of APase activity and its gene in proliferating primary lymphocytes of mice and humans. The specific expression of APase activity and its gene only in human myeloma cells, but not in proliferating primary B cells can be exploited as a sensitive disease marker.

  6. Identification of an IL-4-Inducible Gene Expressed in Differentiating Lymphocytes and Male Germ Cells

    PubMed Central

    Nabavi, Nasrin; Grusby, Michael J.; Finn, Patricia W.; Wolgemuth, Debra J.; Glimcher, Laurie H.

    1990-01-01

    Interleukin 4 (IL-4) is a cytokine that is involved in the differentiation of B and T lymphocytes. In this report, we describe the identification of a novel gene, N.52, which was cloned from the murine pre-B cell line R8205 grown in the presence of IL-4 for 48 hr. Although N.52 expression is detectable at low levels in unstimulated R8205 cells, the level of N.52 dramatically increases after only .4 hr exposure to IL-4 and remains at a high .level up to 48 hr. Although N.52 expression is low or absent in normal spleen B and T cells, its expression can be induced by the differentiation signals delivered by LPS in B cells and by Con A in T-cell hybrids. While N.52 mRNA is absent in all highly differentiated organs, it is detectable in stem cell harboring lymphoid tissues such as bone marrow, fetal liver, and thymus. Furthermore, N.52 mRNA is expressed at strikingly high levels in the testis, specifically in differentiating male germ cells. It is induced by differentiation signals triggered by the combination of cyclic AMP and retinoic acid in teratocarcinoma F9 cells. Taken together, these data suggest that N.52 is a developmentally regulated gene whose expression in cells of the immune and reproductive systems may be controlled by stimuli that induce differentiation. PMID:2136202

  7. Regulation of mucous differentiation and mucin gene expression in the tracheobronchial epithelium.

    PubMed

    Gray, T; Koo, J S; Nettesheim, P

    2001-03-07

    The goal of our studies is to elucidate mechanisms that control and modulate mucous differentiation and mucin gene expression in the conducting airways. We used cultures of normal human tracheobronchial epithelial (NHTBE) cells that were shown to secrete two major airway mucins, namely MUC5AC and MUC5B as well as several other secretory products. Mucous differentiation and expression of MUC2, MUC5AC, MUC5B and MUC7, but not MUCi, MUC4, and MUC8 mucin genes, were shown to be retinoic acid- (RA) or retinol-dependent. We found that RA control of mucin genes was mediated by the retinoid acid receptors RAR alpha and, to a lesser extent, by RAR gamma. Our studies also showed that other important bioregulators such as thyroid hormone (T3) and epidermal growth factor (EGF) modulate basal expression of mucin genes, interacting with RA in a concentration-dependent manner. T3, which binds to thyroid receptors (TRs) belonging to the same superfamily of steroid hormone nuclear receptors as the RARs, inhibits mucin gene expression, particularly MUC5AC. One possible mechanism of this T3 effect is downregulation of RAR proteins, which are critical for mucin gene expression. However, we also found that T3 inhibits MUC5AC transcription.EGF, which had previously been shown to stimulate mucin expression and mucin secretion in cultured rat tracheal epithelial (RTE) cells, inhibited mucin secretion in human bronchial epithelial cell cultures. This effect was EGF concentration- and time-dependent and was progressively abolished by increasing the RA concentration. Subsequent studies suggested that the inhibitory effects of high concentrations of EGF may result from selective reduction of MUC5AC expression. These studies thus point to potentially important species differences in the mechanisms regulating mucous production, and they also confirm previous findings indicating differential regulation of MUC5AC and MUC5B gene expression.

  8. HIVed, a knowledgebase for differentially expressed human genes and proteins during HIV infection, replication and latency

    PubMed Central

    Li, Chen; Ramarathinam, Sri H.; Revote, Jerico; Khoury, Georges; Song, Jiangning; Purcell, Anthony W.

    2017-01-01

    Measuring the altered gene expression level and identifying differentially expressed genes/proteins during HIV infection, replication and latency is fundamental for broadening our understanding of the mechanisms of HIV infection and T-cell dysfunction. Such studies are crucial for developing effective strategies for virus eradication from the body. Inspired by the availability and enrichment of gene expression data during HIV infection, replication and latency, in this study, we proposed a novel compendium termed HIVed (HIV expression database; http://hivlatency.erc.monash.edu/) that harbours comprehensive functional annotations of proteins, whose genes have been shown to be dysregulated during HIV infection, replication and latency using different experimental designs and measurements. We manually curated a variety of third-party databases for structural and functional annotations of the protein entries in HIVed. With the goal of benefiting HIV related research, we collected a number of biological annotations for all the entries in HIVed besides their expression profile, including basic protein information, Gene Ontology terms, secondary structure, HIV-1 interaction and pathway information. We hope this comprehensive protein-centric knowledgebase can bridge the gap between the understanding of differentially expressed genes and the functions of their protein products, facilitating the generation of novel hypotheses and treatment strategies to fight against the HIV pandemic. PMID:28358052

  9. Two different vestigial like 4 genes are differentially expressed during Xenopus laevis development.

    PubMed

    Barrionuevo, María-Guadalupe; Aybar, Manuel J; Tríbulo, Celeste

    2014-01-01

    The vestigial gene (vg) was first characterized in Drosophila and several homologues were identified in vertebrates and called vestigial like 1-4 (vgll1-4). Vgll proteins interact with the transcription factors TEF-1 and MEF-2 through a conserved region called TONDU (TDU). Vgll4s are characterized by two tandem TDU domains which differentiate them from other members of the vestigial family. In Xenopus two genes were identified as vgll4. Our bioinformatic analysis demonstrated that these two genes are paralogues and must be named differently. We designated them as vgll4 and vgll4l. In situ hybridization analysis revealed that the expression of these two genes is rather different. At gastrula stage, both were expressed in the animal pole. However, at neurula stage, vgll4 was mainly expressed in the neural plate and neural folds, while vgll4l prevailed in the neural folds and epidermis. From the advanced neurula stage onward, expression of both genes was strongly enhanced in neural tissues, anterior neural plate, migrating neural crest, optic and otic vesicles. Nevertheless, there were some differences: vgll4 presented somite expression and vgll4l was localized at the skin and notochord. Our results demonstrate that Xenopus has two orthologues of the vgll4 gene, vgll4 and vgll4l with differential expression in Xenopus embryos and they may well have different roles during development.

  10. Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development

    PubMed Central

    Chittka, A; Volff, JN; Wizenmann, A

    2009-01-01

    Background During the development of the central nervous system (CNS), patterning processes along the dorsoventral (DV) axis of the neural tube generate different neuronal subtypes. As development progresses these neurons are arranged into functional units with varying cytoarchitecture, such as laminae or nuclei for efficient relaying of information. Early in development ventral and dorsal regions are similar in size and structure. Different proliferation rates and cell migration patterns are likely to result in the formation of laminae or nuclei, eventually. However, the underlying molecular mechanisms that establish these different structural arrangements are not well understood. We undertook a differential display polymerase chain reaction (DD-PCR) screen to identify genes with distinct expression patterns between dorsal and ventral regions of the chick midbrain in order to identify genes which regulate the sculpturing of such divergent neuronal organisation. We focused on the DV axis of the early chick midbrain since mesencephalic alar plate and basal plate develop into laminae and nuclei, respectively. Results We identified 53 differentially expressed bands in our initial screen. Twenty-six of these could be assigned to specific genes and we could unambiguously show the differential expression of five of the isolated cDNAs in vivo by in situ mRNA expression analysis. Additionally, we verified differential levels of expression of a selected number of genes by using reverse transcriptase (RT) PCR method with gene-specific primers. One of these genes, QR1, has been previously cloned and we present here a detailed study of its early developmental time course and pattern of expression providing some insights into its possible function. Our phylogenetic analysis of QR1 shows that it is the chick orthologue of Sparc-like 1/Hevin/Mast9 gene in mice, rats, dogs and humans, a protein involved in cell adhesion. Conclusion This study reveals some possible networks, which

  11. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  12. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  13. Storage Temperature Alters the Expression of Differentiation-Related Genes in Cultured Oral Keratinocytes

    PubMed Central

    Utheim, Tor Paaske; Islam, Rakibul; Fostad, Ida G.; Eidet, Jon R.; Sehic, Amer; Olstad, Ole K.; Dartt, Darlene A.; Messelt, Edward B.; Griffith, May; Pasovic, Lara

    2016-01-01

    Purpose Storage of cultured human oral keratinocytes (HOK) allows for transportation of cultured transplants to eye clinics worldwide. In a previous study, one-week storage of cultured HOK was found to be superior with regard to viability and morphology at 12°C compared to 4°C and 37°C. To understand more of how storage temperature affects cell phenotype, gene expression of HOK before and after storage at 4°C, 12°C, and 37°C was assessed. Materials and Methods Cultured HOK were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium at 4°C, 12°C, and 37°C for one week. Total RNA was isolated and the gene expression profile was determined using DNA microarrays and analyzed with Partek Genomics Suite software and Ingenuity Pathway Analysis. Differentially expressed genes (fold change > 1.5 and P < 0.05) were identified by one-way ANOVA. Key genes were validated using qPCR. Results Gene expression of cultures stored at 4°C and 12°C clustered close to the unstored control cultures. Cultures stored at 37°C displayed substantial change in gene expression compared to the other groups. In comparison with 12°C, 2,981 genes were differentially expressed at 37°C. In contrast, only 67 genes were differentially expressed between the unstored control and the cells stored at 12°C. The 12°C and 37°C culture groups differed most significantly with regard to the expression of differentiation markers. The Hedgehog signaling pathway was significantly downregulated at 37°C compared to 12°C. Conclusion HOK cultures stored at 37°C showed considerably larger changes in gene expression compared to unstored cells than cultured HOK stored at 4°C and 12°C. The changes observed at 37°C consisted of differentiation of the cells towards a squamous epithelium-specific phenotype. Storing cultured ocular surface transplants at 37°C is therefore not recommended. This is particularly interesting as 37°C is the standard incubation temperature used for cell

  14. Examining smoking-induced differential gene expression changes in buccal mucosa

    PubMed Central

    2010-01-01

    Background Gene expression changes resulting from conditions such as disease, environmental stimuli, and drug use, can be monitored in the blood. However, a less invasive method of sample collection is of interest because of the discomfort and specialized personnel necessary for blood sampling especially if multiple samples are being collected. Buccal mucosa cells are easily collected and may be an alternative sample material for biomarker testing. A limited number of studies, primarily in the smoker/oral cancer literature, address this tissue's efficacy as an RNA source for expression analysis. The current study was undertaken to determine if total RNA isolated from buccal mucosa could be used as an alternative tissue source to assay relative gene expression. Methods Total RNA was isolated from swabs, reverse transcribed and amplified. The amplified cDNA was used in RT-qPCR and microarray analyses to evaluate gene expression in buccal cells. Initially, RT-qPCR was used to assess relative transcript levels of four genes from whole blood and buccal cells collected from the same seven individuals, concurrently. Second, buccal cell RNA was used for microarray-based differential gene expression studies by comparing gene expression between a group of female smokers and nonsmokers. Results An amplification protocol allowed use of less buccal cell total RNA (50 ng) than had been reported previously with human microarrays. Total RNA isolated from buccal cells was degraded but was of sufficient quality to be used with RT-qPCR to detect expression of specific genes. We report here the finding of a small number of statistically significant differentially expressed genes between smokers and nonsmokers, using buccal cells as starting material. Gene Set Enrichment Analysis confirmed that these genes had a similar expression pattern to results from another study. Conclusions Our results suggest that despite a high degree of degradation, RNA from buccal cells from cheek mucosa

  15. Differential expression of putative drug resistance genes in Mycobacterium tuberculosis clinical isolates.

    PubMed

    González-Escalante, Laura; Peñuelas-Urquides, Katia; Said-Fernández, Salvador; Silva-Ramírez, Beatriz; Bermúdez de León, Mario

    2015-12-01

    Understanding drug resistance in Mycobacterium tuberculosis requires an integrated analysis of strain lineages, mutations and gene expression. Previously, we reported the differential expression of esxG, esxH, infA, groES, rpmI, rpsA and lipF genes in a sensitive M. tuberculosis strain and in a multidrug-resistant clinical isolate. Here, we have evaluated the expression of these genes in 24 clinical isolates that belong to different lineages and have different drug resistance profiles. In vitro, growth kinetics analysis showed no difference in the growth of the clinical isolates, and thus drug resistance occurred without a fitness cost. However, a quantitative reverse transcription PCR analysis of gene expression revealed high variability among the clinical isolates, including those with similar drug resistance profiles. Due to the complexity of gene regulation pathways and the wide diversity of M. tuberculosis lineages, the use of gene expression as a molecular signature for drug resistance is not straightforward. Therefore, we recommend that the expression of M. tuberculosis genes be performed individually, and baseline expression levels should be verified among several different clinical isolates, before any further applications of these findings.

  16. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    PubMed

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  17. Analysis on differential expressed genes of ovarian tissue between high- and low-yield laying hen.

    PubMed

    Chen, Wei; Song, Ling-Jun; Zeng, Yong-Qing; Yang, Yun; Wang, Hui

    2013-01-01

    In order to elucidate molecular genetic mechanism of laying hen reproduction at the transcriptional level and the structure of significantly differential genes, the mRNA differential display and reverse northern dot-blot were used to detect the differential expression of genes in the ovary tissue of low-yield laying hens and high-yield laying hens in the present study. Sixteen 32-week-old CAU-pink laying hens divided into two groups were used and the laying performance was measured. The results showed that only the egg numbers were significantly different between the two groups; and from 15 primer pairs, a total of 336 bands were displayed of which 59 cDNA bands were found to be differentially expressed in both high-yield and low-yield laying hen. The sequence analysis indicated that the expression of such bands as H-AP5, H-P5, and H-P4 was significantly potentiated in high-yield laying hen using primer pairs AP5/HT11G, P5/HT11G and P4/HT11G and these transcripts had high homology (98%) to HoxDb, HoxCa, and HoxBa, respectively. The differentially expressed gene fragments may be relevant to the progression of the high-yield hens to the egg-laying stage. And further study is required to elucidate the molecular function to improve the productivity of laying hens.

  18. Differentially expressed genes under simulated microgravity in fruiting bodies of the fungus Pleurotus ostreatus.

    PubMed

    Miyazaki, Yasumasa; Sunagawa, Masahide; Higashibata, Akira; Ishioka, Noriaki; Babasaki, Katsuhiko; Yamazaki, Takashi

    2010-06-01

    In response to a change in the direction of gravity, morphogenetic changes of fruiting bodies of fungi are usually observed as gravitropism. Although gravitropism in higher fungi has been studied for over 100 years, there is no convincing evidence regarding the graviperception mechanism in mushrooms. To understand gravitropism in mushrooms, we isolated differentially expressed genes in Pleurotus ostreatus (oyster mushroom) fruiting bodies developed under three-dimensional clinostat-simulated microgravity. Subtractive hybridization, cDNA representational difference analysis was used for gene analysis and resulted in the isolation of 36 individual genes (17 upregulated and 19 downregulated) under clinorotation. The phenotype of fruiting bodies developed under simulated microgravity vividly depicted the gravitropism in mushrooms. Our results suggest that the differentially expressed genes responding to gravitational change are involved in several potential cellular mechanisms during fruiting body formation of P. ostreatus.

  19. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  20. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  1. Differential expression of genes and proteins associated with wool follicle cycling.

    PubMed

    Liu, Nan; Li, Hegang; Liu, Kaidong; Yu, Juanjuan; Cheng, Ming; De, Wei; Liu, Jifeng; Shi, Shuyan; He, Yanghua; Zhao, Jinshan

    2014-08-01

    Sheep are valuable resources for the wool industry. Wool growth of Aohan fine wool sheep has cycled during different seasons in 1 year. Therefore, identifying genes that control wool growth cycling might lead to ways for improving the quality and yield of fine wool. In this study, we employed Agilent sheep gene expression microarray and proteomic technology to compare the gene expression patterns of the body side skins at August and December time points in Aohan fine wool sheep (a Chinese indigenous breed). Microarray study revealed that 2,223 transcripts were differentially expressed, including 1,162 up-regulated and 1,061 down-regulated transcripts, comparing body side skin at the August time point to the December one (A/D) in Aohan fine wool sheep. Then seven differentially expressed genes were selected to validated the reliability of the gene chip data. The majority of the genes possibly related to follicle development and wool growth could be assigned into the categories including regulation of receptor binding, extracellular region, protein binding and extracellular space. Proteomic study revealed that 84 protein spots showed significant differences in expression levels. Of the 84, 63 protein spots were upregulated and 21 were downregulated in A/D. Finally, 55 protein points were determined through MALDI-TOF/MS analyses. Furthermore, the regulation mechanism of hair follicle might resemble that of fetation.

  2. Pyrophosphate Stimulates Differentiation, Matrix Gene Expression and Alkaline Phosphatase Activity in Osteoblasts

    PubMed Central

    Pujari-Palmer, Michael; Pujari-Palmer, Shiuli; Lu, Xi; Lind, Thomas; Melhus, Håkan; Engstrand, Thomas; Karlsson-Ott, Marjam; Engqvist, Hakan

    2016-01-01

    Pyrophosphate is a potent mitogen, capable of stimulating proliferation in multiple cell types, and a critical participant in bone mineralization. Pyrophosphate can also affect the resorption rate and bioactivity of orthopedic ceramics. The present study investigated whether calcium pyrophosphate affected proliferation, differentiation and gene expression in early (MC3T3 pre-osteoblast) and late stage (SAOS-2 osteosarcoma) osteoblasts. Pyrophosphate stimulated peak alkaline phosphatase activity by 50% and 150% at 100μM and 0.1μM in MC3T3, and by 40% in SAOS-2. The expression of differentiation markers collagen 1 (COL1), alkaline phosphatase (ALP), osteopontin (OPN), and osteocalcin (OCN) were increased by an average of 1.5, 2, 2 and 3 fold, by high concentrations of sodium pyrophosphate (100μM) after 7 days of exposure in MC3T3. COX-2 and ANK expression did not differ significantly from controls in either treatment group. Though both high and low concentrations of pyrophosphate stimulate ALP activity, only high concentrations (100μM) stimulated osteogenic gene expression. Pyrophosphate did not affect proliferation in either cell type. The results of this study confirm that chronic exposure to pyrophosphate exerts a physiological effect upon osteoblast differentiation and ALP activity, specifically by stimulating osteoblast differentiation markers and extracellular matrix gene expression. PMID:27701417

  3. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION

    PubMed Central

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J.; Alexander, Warren S.; Smyth, Gordon K.

    2017-01-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  4. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION.

    PubMed

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J; Alexander, Warren S; Smyth, Gordon K

    2016-06-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  5. In Vitro Study of Putative Genomic Biomarkers of Nephrotoxicity Through Differential Gene Expression Using Gentamicin.

    PubMed

    Silva, Sarah Cristina Teixeira; de Almeida, Leonardo Augusto; Soares, Stellamaris; Grossi, Marina Felipe; Valente, Anete Maria Santana; Tagliati, Carlos Alberto

    2017-04-03

    Drug-induced nephrotoxicity is one of the most frequently observed effects in long-term pharmacotherapy. The effects of nephrotoxicity are commonly discovered later due to a lack of sensitivity in in vivo methods. Therefore, researchers have tried to develop in vitro alternative methods for early identification of toxicity. In this study, LLC-PK1 cells were exposed to gentamicin through MTT and trypan blue assay. Concentrations of 4 (low), 8 (medium), and 12 (high) mM, were used to evaluate differential gene expression. A panel of genes was selected based on gene expression changes. The search for sequences of mRNA encoding proteins previously associated with kidney damage was conducted in the databases of the National Center for Biotechnology Information (USA). RNA was extracted from the cells, and RT-qPCR was performed to evaluate differential expression profiles of the selected genes. Among the eleven analyzed genes, four proved to be differentially up-regulated in cells exposed to gentamicin: HAVcr1, caspase3, ICAM-1, and EXOC6. According to this study's results, we suggest that these genes play an important role in the mechanism of in vitro neprotoxicity caused by gentamicin and can be used as early in vitro biomarkers to identify nephrotoxicity when developing safer drugs.

  6. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes.

    PubMed

    Yang, G P; Ross, D T; Kuang, W W; Brown, P O; Weigel, R J

    1999-03-15

    Comparing patterns of gene expression in cell lines and tissues has important applications in a variety of biological systems. In this study we have examined whether the emerging technology of cDNA microarrays will allow a high throughput analysis of expression of cDNA clones generated by suppression subtractive hybridization (SSH). A set of cDNA clones including 332 SSH inserts amplified by PCR was arrayed using robotic printing. The cDNA arrays were hybridized with fluorescent labeled probes prepared from RNA from ER-positive (MCF7 and T47D) and ER-negative (MDA-MB-231 and HBL-100) breast cancer cell lines. Ten clones were identified that were over-expressed by at least a factor of five in the ER-positive cell lines. Northern blot analysis confirmed over-expression of these 10 cDNAs. Sequence analysis identified four of these clones as cytokeratin 19, GATA-3, CD24 and glutathione-S-transferase mu-3. Of the remaining six cDNA clones, four clones matched EST sequences from two different genes and two clones were novel sequences. Flow cytometry and immunofluorescence confirmed that CD24 protein was over-expressed in the ER-positive cell lines. We conclude that SSH and microarray technology can be successfully applied to identify differentially expressed genes. This approach allowed the identification of differentially expressed genes without the need to obtain previously cloned cDNAs.

  7. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.

    PubMed

    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona

    2009-12-15

    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  8. Differential gene expression in the perichondrium and cartilage of the neonatal mouse temporomandibular joint

    PubMed Central

    Hinton, RJ; Serrano, M; So, S

    2009-01-01

    Objective To discover genes differentially expressed in the perichondrium of the mandibular condylar cartilage (MCC) that might enhance regenerative medicine or orthopedic therapies directed at the tissues of the temporomandibular joint Design We used targeted gene arrays (osteogenesis, stem cell) to identify genes preferentially expressed in the perichondrium (PC) and the cartilaginous (C) portions of the MCC in 2 day-old mice Results Genes with higher expression in the PC sample related to growth factor ligand-receptor interactions (FGF-13 (6.4X), FGF-18 (4X), NCAM (2X); PGDF receptors, TGF-β, and IGF-1), the Notch isoforms (especially Notch 3 and 4) and their ligands, or structural proteins/ proteoglycans (collagen XIV (21X), collagen XVIII (4X), decorin (2.5X)). Genes with higher expression in the C sample consisted mostly of known cartilage-specific genes (aggrecan (11X), procollagens X (33X), XI (14X), IX (4.5X), Sox 9 (4.4X), and Indian hedgehog (6.7X)). However, the functional or structural roles of several genes that were expressed at higher levels in the PC sample are unclear (myogenic factor 9 (9X), tooth-related genes such as tuftelin (2.5X) and dentin sialophosphoprotein (1.6X), VEGF–B (2X) and its receptors (3–4X), and sclerostin (1.7X)). Conclusions FGF, Notch, and TGF-β signaling may be important regulators of MCC proliferation and differentiation; the relatively high expression of genes such as myogenic factor 6 and VEGF–B and its receptors suggests a degree of unsuspected plasticity in PC cells. PMID:19627518

  9. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  10. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    PubMed

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms.

  11. Identification of Differentially Expressed Gene after Femoral Fracture via Microarray Profiling

    PubMed Central

    Zhong, Donggen

    2014-01-01

    We aimed to investigate differentially expressed genes (DEGs) in different stages after femoral fracture based on rat models, providing the basis for the treatment of sport-related fractures. Gene expression data GSE3298 was downloaded from Gene Expression Omnibus (GEO), including 16 chips. All femoral fracture samples were classified into earlier fracture stage and later fracture stage. Total 87 DEGs simultaneously occurred in two stages, of which 4 genes showed opposite expression tendency. Out of the 4 genes, Rest and Cst8 were hub nodes in protein-protein interaction (PPI) network. The GO (Gene Ontology) function enrichment analysis verified that nutrition supply related genes were enriched in the earlier stage and neuron growth related genes were enriched in the later stage. Calcium signaling pathway was the most significant pathway in earlier stage; in later stage, DEGs were enriched into 2 neurodevelopment-related pathways. Analysis of Pearson's correlation coefficient showed that a total of 3,300 genes were significantly associated with fracture time, none of which was overlapped with identified DEGs. This study suggested that Rest and Cst8 might act as potential indicators for fracture healing. Calcium signaling pathway and neurodevelopment-related pathways might be deeply involved in bone healing after femoral fracture. PMID:25110652

  12. RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation

    SciTech Connect

    Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph; Youssef, Rimon F.; London, Steven D.; Reddy, Sakamuri V. . E-mail: reddysv@musc.edu

    2007-01-01

    Osteoclast differentiation is tightly regulated by receptor activator of NF-{kappa}B ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity in RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity

  13. Immune- and wound-dependent differential gene expression in an ancient insect.

    PubMed

    Johnston, Paul R; Rolff, Jens

    2013-01-01

    Two of the main functions of the immune system are to control infections and to contribute to wound closure. Here we present the results of an RNAseq study of immune- and wound-response gene expression in the damselfly Coenagrion puella, a representative of the odonates, the oldest taxon of winged insects. De novo assembly of RNAseq data revealed a rich repertoire of canonical immune pathways, as known from model insects, including recognition, transduction and effector gene expression. A shared set of immune and wound repair genes were differentially expressed in both wounded and immune-challenged larvae. Moreover 3-fold more immune genes were induced only in the immune-challenged treatment. This is consistent with the notion that the immune-system reads a balance of signals related to wounding and infection and that the response is tailored accordingly.

  14. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.

    PubMed

    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo

    2013-11-01

    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  15. Differentially-Expressed Genes Associated with Faster Growth of the Pacific Abalone, Haliotis discus hannai

    PubMed Central

    Choi, Mi-Jin; Kim, Gun-Do; Kim, Jong-Myoung; Lim, Han Kyu

    2015-01-01

    The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%–3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females) encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3), vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones. PMID:26593905

  16. Differential expression profiles and pathways of genes in sugarcane leaf at elongation stage in response to drought stress

    PubMed Central

    Li, Changning; Nong, Qian; Solanki, Manoj Kumar; Liang, Qiang; Xie, Jinlan; Liu, Xiaoyan; Li, Yijie; Wang, Weizan; Yang, Litao; Li, Yangrui

    2016-01-01

    Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, a pot experiment was performed with the sugarcane variety GT21 at three water-deficit levels (mild, moderate, and severe) during the elongation stage and gene expression was analyzed using microarray technology. Physiological parameters of sugarcane showed significant alterations in response to drought stress. Based on the expression profile of 15,593 sugarcane genes, 1,501 (9.6%) genes were differentially expressed under different water-level treatments; 821 genes were upregulated and 680 genes were downregulated. A gene similarity analysis showed that approximately 62.6% of the differentially expressed genes shared homology with functional proteins. In a Gene Ontology (GO) analysis, 901 differentially expressed genes were assigned to 36 GO categories. Moreover, 325 differentially expressed genes were classified into 101 pathway categories involved in various processes, such as the biosynthesis of secondary metabolites, ribosomes, carbon metabolism, etc. In addition, some unannotated genes were detected; these may provide a basis for studies of water-deficit tolerance. The reliability of the observed expression patterns was confirmed by RT-PCR. The results of this study may help identify useful genes for improving drought tolerance in sugarcane. PMID:27170459

  17. An independent validation of a gene expression signature to differentiate malignant melanoma from benign melanocytic nevi

    PubMed Central

    Flake, Darl D.; Busam, Klaus; Cockerell, Clay; Helm, Klaus; McNiff, Jennifer; Reed, Jon; Tschen, Jaime; Kim, Jinah; Barnhill, Raymond; Elenitsas, Rosalie; Prieto, Victor G.; Nelson, Jonathan; Kimbrell, Hillary; Kolquist, Kathryn A.; Brown, Krystal L.; Warf, M. Bryan; Roa, Benjamin B.; Wenstrup, Richard J.

    2016-01-01

    BACKGROUND Recently, a 23‐gene signature was developed to produce a melanoma diagnostic score capable of differentiating malignant and benign melanocytic lesions. The primary objective of this study was to independently assess the ability of the gene signature to differentiate melanoma from benign nevi in clinically relevant lesions. METHODS A set of 1400 melanocytic lesions was selected from samples prospectively submitted for gene expression testing at a clinical laboratory. Each sample was tested and subjected to an independent histopathologic evaluation by 3 experienced dermatopathologists. A primary diagnosis (benign or malignant) was assigned to each sample, and diagnostic concordance among the 3 dermatopathologists was required for inclusion in analyses. The sensitivity and specificity of the score in differentiating benign and malignant melanocytic lesions were calculated to assess the association between the score and the pathologic diagnosis. RESULTS The gene expression signature differentiated benign nevi from malignant melanoma with a sensitivity of 91.5% and a specificity of 92.5%. CONCLUSIONS These results reflect the performance of the gene signature in a diverse array of samples encountered in routine clinical practice. Cancer 2017;123:617–628. © 2016 American Cancer Society. PMID:27768230

  18. Identification of differentially expressed genes in Chrysanthemum nankingense (Asteraceae) under heat stress by RNA Seq.

    PubMed

    Sun, Jing; Ren, Liping; Cheng, Yue; Gao, Jiaojiao; Dong, Bin; Chen, Sumei; Chen, Fadi; Jiang, Jiafu

    2014-11-15

    The RNA-Seq platform was used to characterize the high-temperature stress response of Chrysanthemum nankingense. A set of 54,668 differentially expressed unigenes was identified. After a threshold of ratio change ≥ 2 and a q-value of <0.05 were applied, the number of differentially transcribed genes was reduced to 3955, of which 765 were up-regulated and 3190 were down-regulated in response to heat stress. The differentially transcribed genes were predicted to participate in 26 biological processes, 4 cellular components, and 13 molecular functions. Among the most differentially expressed genes between the two libraries were well-recognized high-temperature responsive protein families, such as heat shock factors and heat shock proteins, various transcription factor families, and a number of RNA metabolism-related genes. Overall, the RNA-Seq analyses revealed a high degree of transcriptional complexity in early heat stress response. Some of these high-temperature responsive C. nankingense genes may prove useful in efforts to improve thermotolerance of commercial chrysanthemum.

  19. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  20. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    PubMed

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  1. Expression patterns of TEL genes in Poaceae suggest a conserved association with cell differentiation.

    PubMed

    Paquet, Nicolas; Bernadet, Marie; Morin, Halima; Traas, Jan; Dron, Michel; Charon, Celine

    2005-06-01

    Poaceae species present a conserved distichous phyllotaxy (leaf position along the stem) and share common properties with respect to leaf initiation. The goal of this work was to determine if these common traits imply common genes. Therefore, homologues of the maize TERMINAL EAR1 gene in Poaceae were studied. This gene encodes an RNA-binding motif (RRM) protein, that is suggested to regulate leaf initiation. Using degenerate primers, one unique tel (terminal ear1-like) gene from seven Poaceae members, covering almost all the phylogenetic tree of the family, was identified by PCR. These genes present a very high degree of similarity, a much conserved exon-intron structure, and the three RRMs and TEL characteristic motifs. The evolution of tel sequences in Poaceae strongly correlates with the known phylogenetic tree of this family. RT-PCR gene expression analyses show conserved tel expression in the shoot apex in all species, suggesting functional orthology between these genes. In addition, in situ hybridization experiments with specific antisense probes show tel transcript accumulation in all differentiating cells of the leaf, from the recruitment of leaf founder cells to leaf margins cells. Tel expression is not restricted to initiating leaves as it is also found in pro-vascular tissues, root meristems, and immature inflorescences. Therefore, these results suggest that TEL is not only associated with leaf initiation but more generally with cell differentiation in Poaceae.

  2. Differential gene expression in stromal cells of human giant cell tumor of bone.

    PubMed

    Wuelling, M; Delling, G; Kaiser, E

    2004-12-01

    Giant cell tumor (GCT) offers a unique model for the hematopoietic-stromal cell interaction in human bone marrow. Evidence has been presented that GCT stromal cells (GCTSCs) promote accumulation, size and activity of the giant cells. Although GCTSCs are considered the neoplastic component of GCT, little is known about their genetic basis and, to date, a tumor-specific gene expression pattern has not been characterized. Mesenchymal stem cells (MSCs) have been identified as the origin of the GCT neoplastic stromal cell. Using state of the art array technology, expression profiling was applied to enriched stromal cell populations from five different GCTs and two primary MSCs as controls. Of the 29 differentially expressed genes found, 25 showed an increased expression. Differential mRNA expression was verified by real-time polymerase chain reaction analysis of 10 selected genes, supporting the validity of cDNA arrays as a tool to identify tumor-related genes in GCTSCs. Increased expression of two oncogenes, JUN and NME2, was substantiated at the protein level, utilizing immunohistochemical evaluation of GCT sections and Western-blot analysis. Increased phosphorylation of JUN Ser-63 was also found.

  3. Differential expression of porcine TAP1 gene in the populations of pigs.

    PubMed

    Zhu, S P; Yin, X M; Sun, L; Sun, S Y; Bao, W B; Wu, S L

    2015-03-01

    Transporter associated with antigen processing (TAP) transports peptides from the cytosol into the endoplasmic reticulum (ER) for subsequent loading onto the major histocompatibility complex (MHC) class I molecules. TAP is consisted of two subunits: TAP and TAP2. Using Real-time PCR technology, this study detected tissue expression profile and analyzed the differential expression of TAP1 gene in Sutai Escherichia coli-resistant group, Yorkshire and Meishan pigs. Tissue expression profile revealed that TAP1 gene expressed in all tissues we detected, and the expression levels were high in lung, immune tissues and intestines. Through the comparation of gene expression differention in different populations, TAP1 expression level of Sutai E. coli-resistant group was significantly higher than that of Yorkshire and Meishan populations in liver, spleen, lung, kidney, thymus, lymph, duodenum and jejunum (P<0.05). Meanwhile TAP1 gene was more highly expressed in Sutai E. coli-resistant group than that of Meishan population in stomach (P<0.05). In conclusion, the upregulation of TAP1 expression level in E. coli-resistant group could be related to E. coli F18 infection. In addition, Chinese local pigs may have special immune response and genetic mechanism in resisting E. coli F18 infection which is differing from MHC I moleculars.

  4. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder

    PubMed Central

    Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Background Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively) Method With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. Results We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. Conclusion CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls. PMID:28333931

  5. Mutations in Ehrlichia chaffeensis Causing Polar Effects in Gene Expression and Differential Host Specificities.

    PubMed

    Cheng, Chuanmin; Nair, Arathy D S; Jaworski, Deborah C; Ganta, Roman R

    2015-01-01

    Ehrlichia chaffeensis, a tick-borne rickettsial, is responsible for human monocytic ehrlichiosis. In this study, we assessed E. chaffeensis insertion mutations impacting the transcription of genes near the insertion sites. We presented evidence that the mutations within the E. chaffeensis genome at four genomic locations cause polar effects in altering gene expressions. We also reported mutations causing attenuated growth in deer (the pathogen's reservoir host) and in dog (an incidental host), but not in its tick vector, Amblyomma americanum. This is the first study documenting insertion mutations in E. chaffeensis that cause polar effects in altering gene expression from the genes located upstream and downstream to insertion sites and the differential requirements of functionally active genes of the pathogen for its persistence in vertebrate and tick hosts. This study is important in furthering our knowledge on E. chaffeensis pathogenesis.

  6. Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization.

    PubMed

    Qiu, Jie; Ni, Yu-hui; Gong, Hai-xia; Fei, Li; Pan, Xiao-qin; Guo, Mei; Chen, Rong-hua; Guo, Xi-rong

    2007-01-12

    To identify differentially expressed genes between obese individuals and normal control, we have undertaken suppression subtractive hybridization (SSH). Omental adipose tissues were obtained via abdominal surgery for appendicitis in both 13 obese subjects [BMI (body mass index) >30 kg/m2] and 13 normal subjects (BMI >18 and <25 kg/m2). Following SSH, about one thousand clones were sequenced and found to derive from 426 different genes. These predominately expressed genes included genes involved in lipid metabolism, cytokines, signal transduction, GLUT4 translocation, cell cycle and growth, cytoskeleton, and others. Although more detailed analyses are necessary, it is anticipated that further study of genes identified will provide insights into their specific roles in the etiology of obesity.

  7. Interpreting Patterns of Gene Expression with Self-Organizing Maps: Methods and Application to Hematopoietic Differentiation

    NASA Astrophysics Data System (ADS)

    Tamayo, Pablo; Slonim, Donna; Mesirov, Jill; Zhu, Qing; Kitareewan, Sutisak; Dmitrovsky, Ethan; Lander, Eric S.; Golub, Todd R.

    1999-03-01

    Array technologies have made it straightforward to monitor simultaneously the expression pattern of thousands of genes. The challenge now is to interpret such massive data sets. The first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of self-organizing maps, a type of mathematical cluster analysis that is particularly well suited for recognizing and classifying features in complex, multidimensional data. The method has been implemented in a publicly available computer package, GENECLUSTER, that performs the analytical calculations and provides easy data visualization. To illustrate the value of such analysis, the approach is applied to hematopoietic differentiation in four well studied models (HL-60, U937, Jurkat, and NB4 cells). Expression patterns of some 6,000 human genes were assayed, and an online database was created. GENECLUSTER was used to organize the genes into biologically relevant clusters that suggest novel hypotheses about hematopoietic differentiation--for example, highlighting certain genes and pathways involved in "differentiation therapy" used in the treatment of acute promyelocytic leukemia.

  8. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  9. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  10. Burkholderia cenocepacia differential gene expression during host-pathogen interactions and adaptation to the host environment.

    PubMed

    O'Grady, Eoin P; Sokol, Pamela A

    2011-01-01

    Members of the Burkholderia cepacia complex (Bcc) are important in medical, biotechnological, and agricultural disciplines. These bacteria naturally occur in soil and water environments and have adapted to survive in association with plants and animals including humans. All Bcc species are opportunistic pathogens including Burkholderia cenocepacia that causes infections in cystic fibrosis and chronic granulomatous disease patients. The adaptation of B. cenocepacia to the host environment was assessed in a rat chronic respiratory infection model and compared to that of high cell-density in vitro grown cultures using transcriptomics. The distribution of genes differentially expressed on chromosomes 1, 2, and 3 was relatively proportional to the size of each genomic element, whereas the proportion of plasmid-encoded genes differentially expressed was much higher relative to its size and most genes were induced in vivo. The majority of genes encoding known virulence factors, components of types II and III secretion systems and chromosome 2-encoded type IV secretion system were similarly expressed between in vitro and in vivo environments. Lower expression in vivo was detected for genes encoding N-acyl-homoserine lactone synthase CepI, orphan LuxR homolog CepR2, zinc metalloproteases ZmpA and ZmpB, LysR-type transcriptional regulator ShvR, nematocidal protein AidA, and genes associated with flagellar motility, Flp type pilus formation, and type VI secretion. Plasmid-encoded type IV secretion genes were markedly induced in vivo. Additional genes induced in vivo included genes predicted to be involved in osmotic stress adaptation or intracellular survival, metal ion, and nutrient transport, as well as those encoding outer membrane proteins. Genes identified in this study are potentially important for virulence during host-pathogen interactions and may be associated with survival and adaptation to the host environment during chronic lung infections.

  11. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  12. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-05-11

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns.

  13. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.

    PubMed

    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric

    2006-04-01

    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  14. CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

    PubMed

    Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

    2013-10-15

    The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages.

  15. Efficiency analysis of competing tests for finding differentially expressed genes in lung adenocarcinoma.

    PubMed

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The 'best' test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  16. Efficiency Analysis of Competing Tests for Finding Differentially Expressed Genes in Lung Adenocarcinoma

    PubMed Central

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The ‘best’ test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  17. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  18. Bisphenol A modulates expression of sex differentiation genes in the self-fertilizing fish, Kryptolebias marmoratus.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Lee, Chang Joo; Yoon, Yong-Dal; Lee, Young-Mi; Lee, Jae-Seong

    2011-08-01

    Endocrine disrupting chemicals (EDCs) have been a major concern in the normal reproduction and development of aquatic organisms. In the teleost, steroid hormones are synthesized via the steroidogenesis pathway, and play a key physiological role in the regulation of gonadal sex differentiation. The protogynous hermaphroditic fish, Kryptolebias marmoratus is the only vertebrate capable of reproducing through internal self-fertilization. To uncover the effect of bisphenol A (BPA) on sex differentiation genes on transcription, we investigated the expression patterns of several sex differentiation-related genes such as dax1, dmrt1, mis, sf1, figlα, StAR and wt1 after BPA exposure with controls (E2 and TMX). In response to 17β-estradiol (E2) exposure, a testis-specific gene, dmrt1 mRNA was down-regulated in the gonad of the secondary male but the expression of the female-specific gene, dax1 mRNA was significantly elevated in the brain and gonad. A high level of StAR mRNA was detected in the brain and gonad of both hermaphrodite and secondary males, suggesting that the elevated expression of dax1 and StAR genes would be involved in E2 exposure. As expected, upon BPA exposure, the dmrt1 and MIS mRNA level decreased in both hermaphrodite and secondary males, while the female-specific gene, figlα mRNA level increased in the gonad of both genders. BPA showed an opposite mode of action on the expression of dax1 (induction, P>0.05) and sf1 mRNA (inhibition, P>0.05) in the brain and gonad against both genders. The sensitivity of dax1 to BPA on expression was relatively high in the secondary male. The wt1 mRNA was up-regulated in most tissues except in the liver of BPA-exposed secondary males. Regarding the time course study, the figlα mRNA level increased at 6 h after BPA exposure. In addition, BPA elevated the expression of StAR, dax1, and wt1 mRNA but repressed sf1 mRNA. In this paper, we demonstrated that BPA may modulate the expression of sex differentiation and

  19. Gene Expression upon Proliferation and Differentiation of Hematopoietic Cells with Ph Chromosome ex vivo

    PubMed Central

    Grineva, N.I.; Duchovenskay, E.A.; Timofeev, A.M.; Akhlynina, T.V.; Gerasimova, L.P.; Borovkova, T.V.; Schmarov, D.A.; Sarycheva, N.G.; Naydenova, N.M.; Gavrichkova, 
A.R.; Kolosova, L.Y.; Kolosheynova, T.I.; Kovaleva, L.G.

    2012-01-01

    The genesp53, mdm2, p21, c-myc,bcr/abl, bcr, bcl2, bax, and gapdh participate in the regulation of cell proliferation and differentiation, apoptosis and cell distribution for the cell cycle ex vivo in the Ph+cells of chronic myeloid leukemia containing the Ph chromosome andbcr/abloncogene. Expression of these genes correlates with regulation of cell proliferation and differentiation by alternating proliferation and maturation stages for three main Ph+cell types that occur under chronic myeloid leukemia. Thep53, p21, mdm2, and gapdh genes overexpress in active proliferating myeloid cells in the cell cycle S+ G2/M phases and when the phases are coincident with the proliferation stage. Expression of these genes decreases to a considerable level under alternation of the Ph+cell proliferation and maturation stages and whenever the expression is greatly diminished under significant neutrophil accumulation and especially under repeated alternation of the stages. In the course of neutrophil maturation, gene expression levels decrease in the range of gapdh > actin > c-myc, bcr/abl,p21 > p53 > bcl2 > bax.The expression levels of these genes in neutrophils are lower than those in myelocytes and lower by an order of magnitude than that in the cells with a prolonged proliferation stage. TheBcr/ablexpression gene under prolonged maturation and neutrophil accumulation is inhibited; however it is enhanced by 2–3 times for the proliferation stage with myelocyte accumulation. Minimalbcr/ablexpression is observed under overexpression ofp53, mdm2, p21, c-myc,as well as under cell maximum at the S and G2/M phases. Bcr/abloverexpression is observed under low expression of thep53, p21, mdm2genes. In the Ph+ cells with a high P/D efficiency index (5–20), overexpression of the genes in the range ofbcr> gapdh>bcr/abl, as well as a decreased expression of thep53, bcl2, mdm2, p21<< gapdh genes is observed for Ph+cells from the CML blast crisis and CML acceleration phase. Low control of

  20. Identification of differentially expressed genes involved in transient regeneration of the neonatal C57BL/6J mouse heart by digital gene expression profiling.

    PubMed

    Liu, Ming; Zhu, Jin-Gai; Yu, Zhang-Bin; Song, Gui-Xian; Shen, Ya-Hui; Liu, Yao-Qiu; Zhu, Chun; Qian, Ling-Mei

    2014-06-01

    Accumulating evidence has revealed that the mammalian heart possesses a measurable capacity for renewal. Neonatal mice retain a regenerative capacity over a short time-frame (≤6 days), but this capacity is lost by 7 days of age. In the present study, differential gene expression profiling of mouse cardiac tissue was performed to further elucidate the mechanisms underlying this process. The global gene expression patterns of the neonatal C57BL/6J mouse heart were examined at three key time-points (1, 6 and 7 days old) using digital gene expression analysis. In the distribution of total clean tags, high-expression tags (>100 copies) were found to be predominant, whereas low expression tags (<5 copies) occupied the majority of distinct tag distributions. In total, 306 differentially expressed genes (DEGs) were detected in cardiac tissue, with the expression levels of 115 genes upregulated and those of 191 genes downregulated in 7-day-old mice compared with expression levels in 1- and 6-day-old mice, respectively. The expression levels of five DEGs were confirmed using quantitative polymerase chain reaction. Gene ontology analysis revealed a large proportion of DEGs distributed throughout the cell, and these DEGs were associated with binding as well as catalytic, hydrolase, transferase and molecular transducer activities. Furthermore, these genes were involved in cellular, metabolic and developmental processes, as well as biological regulation and signaling pathways. Pathway analysis identified the oxidative phosphorylation pathway to be the process most significantly putatively affected by the differential expression of these genes. These data provide the basis for future analysis of the gene expression patterns that regulate the molecular mechanism of cardiac regeneration.

  1. Differential expression of genes during aflatoxin B1-induced hepatocarcinogenesis in tree shrews

    PubMed Central

    Li, Yuan; Wan, Da-Fang; Su, Jian-Jia; Cao, Ji; Ou, Chao; Qiu, Xiao-Kun; Ban, Ke-Chen; Yang, Chun; Qin, Liu-Liang; Luo, Dan; Yue, Hui-Fen; Zhang, Li-Sheng; Gu, Jian-Ren

    2004-01-01

    AIM: Through exploring the regulation of gene expression during hepatocarcinogenesis induced by aflatoxin B1 (AFB1), to find out the responsible genes for hepatocellular carcinoma (HCC) and to further understand the underlying molecular mechanism. METHODS: Tree shrews (Tupaia belangeri chinensis) were treated with or without AFB1 for about 90 weeks. Liver biopsies were performed regularly during the animal experiment. Eight shares of total RNA were respectively isolated from 2 HCC tissues, 2 HCC-surrounding non-cancerous liver tissues, 2 biopsied tissues at the early stage (30th week) of the experiment from the same animals as above, 1 mixed sample of three liver tissues biopsied at the beginning (0th week) of the experiment, and another 1 mixed sample of two liver tissues from the untreated control animals biopsied at the 90th week of the experiment. The samples were then tested with the method of AtlasTM cDNA microarray assay. The levels of gene expression in these tissues taken at different time points during hepatocarcinogenesis were compared. RESULTS: The profiles of differently expressed genes were quite different in different ways of comparison. At the same period of hepatocarcinogenesis, the genes in the same function group usually had the same tendency for up- or down-regulation. Among the checked 588 genes that were known to be related to human cancer, 89 genes (15.1%) were recognized as “important genes” because they showed frequent changes in different ways of comparison. The differentially expressed genes during hepatocarcinogenesis could be classified into four categories: genes up-regulated in HCC tissue, genes with similar expressing levels in both HCC and HCC-surrounding liver tissues which were higher than that in the tissues prior to the development of HCC, genes down-regulated in HCC tissue, and genes up-regulated prior to the development of HCC but down-regulated after the development of HCC. CONCLUSION: A considerable number of genes could

  2. DNA Methylation Profiling Reveals Correlation of Differential Methylation Patterns with Gene Expression in Human Epilepsy.

    PubMed

    Wang, Liang; Fu, Xinwei; Peng, Xi; Xiao, Zheng; Li, Zhonggui; Chen, Guojun; Wang, Xuefeng

    2016-05-01

    DNA methylation plays important roles in regulating gene expression and has been reported to be related with epilepsy. This study aimed to define differential DNA methylation patterns in drug-refractory epilepsy patients and to investigate the role of DNA methylation in human epilepsy. We performed DNA methylation profiling in brain tissues from epileptic and control patients via methylated-cytosine DNA immunoprecipitation microarray chip. Differentially methylated loci were validated by bisulfite sequencing PCR, and the messenger RNA (mRNA) levels of candidate genes were evaluated by reverse transcriptase PCR. We found 224 genes that showed differential DNA methylation between epileptic patients and controls. Among the seven candidate genes, three genes (TUBB2B, ATPGD1, and HTR6) showed relative transcriptional regulation by DNA methylation. TUBB2B and ATPGD1 exhibited hypermethylation and decreased mRNA levels, whereas HTR6 displayed hypomethylation and increased mRNA levels in the epileptic samples. Our findings suggest that certain genes become differentially regulated by DNA methylation in human epilepsy.

  3. Identification of Differentially Expressed Genes Relevant to Corm Formation in Sagittaria trifolia

    PubMed Central

    Xu, Xiaoyong; Hussain, Javeed; Yin, Jingjing; Zhang, Yi; Li, Liangjun; Chen, Xuehao

    2013-01-01

    Sagittaria trifolia is a good model of wetland plants to elucidate the formation of corm. However, few studies have been conducted to uncover the complexity of gene expression involved in corm formation. In this study, high-throughput tag-sequencing based on Solexa Genome Analyzer Platform was applied to monitor the changes in gene expression with three libraries of differentially expressed genes (DEGs) (C1 library: stolon stage, C2 library: initial swelling stage and C3 library: swelling stage) during corm formation in Sagittaria trifolia. Approximately 6.0 million tags were sequenced, and 5854021, 5983454, and 5761079 clean tags including 138319, 116804, and 101739 distinct tags were obtained after removal of low quality tags from each library, respectively. About 46% distinct tags were unambiguous tags mapping to the reference genes, and 33% were unambiguous tag-mapped genes. Totally, 20575, 19807, and 18438 were annotated in C1, C2, and C3 libraries, respectively, after mapping their functions in existing databases. In addition, we found that profiling of gene expression in C1/C2 and C2/C3 libraries were different among most of the selected 20 DEGs. Most DEGs in C1/C2 libraries were relevant to hormone synthesis and response; energy metabolism and stress response, while most of the genes in C2/C3 libraries were involved in carbohydrate metabolism. All up-regulated transcriptional factors and 16 important genes relevant to corm formation in three libraries were also identified. To further analyze the expression of 9 genes, from the results of tag-sequencing, qRT-PCR was applied. In summary, this study provides a comprehensive understanding of gene expression, during the formation of corm in Sagittaria trifolia. PMID:23359383

  4. Differential Gene Expression Profiling of Enriched Human Spermatogonia after Short- and Long-Term Culture

    PubMed Central

    Conrad, Sabine; Azizi, Hossein; Hatami, Maryam; Kubista, Mikael; Bonin, Michael; Hennenlotter, Jörg; Renninger, Markus; Skutella, Thomas

    2014-01-01

    This study aimed to provide a molecular signature for enriched adult human stem/progenitor spermatogonia during short-term (<2 weeks) and long-term culture (up to more than 14 months) in comparison to human testicular fibroblasts and human embryonic stem cells. Human spermatogonia were isolated by CD49f magnetic activated cell sorting and collagen−/laminin+ matrix binding from primary testis cultures obtained from ten adult men. For transcriptomic analysis, single spermatogonia-like cells were collected based on their morphology and dimensions using a micromanipulation system from the enriched germ cell cultures. Immunocytochemical, RT-PCR and microarray analyses revealed that the analyzed populations of cells were distinct at the molecular level. The germ- and pluripotency-associated genes and genes of differentiation/spermatogenesis pathway were highly expressed in enriched short-term cultured spermatogonia. After long-term culture, a proportion of cells retained and aggravated the “spermatogonial” gene expression profile with the expression of germ and pluripotency-associated genes, while in the majority of long-term cultured cells this molecular profile, typical for the differentiation pathway, was reduced and more genes related to the extracellular matrix production and attachment were expressed. The approach we provide here to study the molecular status of in vitro cultured spermatogonia may be important to optimize the culture conditions and to evaluate the germ cell plasticity in the future. PMID:24738045

  5. A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion

    PubMed Central

    Murata, Makoto; Warren, Edus H.; Riddell, Stanley R.

    2003-01-01

    Minor histocompatibility antigens (minor H antigens) are targets of graft-versus-host disease and graft-versus-leukemia responses after allogeneic human leukocyte antigen identical hematopoietic stem cell transplantation. Only a few human minor H antigens have been molecularly characterized and in all cases, amino acid differences between homologous donor and recipient proteins due to nucleotide polymorphisms in the respective genes were responsible for immunogenicity. Here, we have used cDNA expression cloning to identify a novel human minor H antigen encoded by UGT2B17, an autosomal gene in the multigene UDP-glycosyltransferase 2 family that is selectively expressed in liver, intestine, and antigen-presenting cells. In contrast to previously defined human minor H antigens, UGT2B17 is immunogenic because of differential expression of the protein in donor and recipient cells as a consequence of a homozygous gene deletion in the donor. Deletion of individual members of large gene families is a common form of genetic variation in the population and our results provide the first evidence that differential protein expression as a consequence of gene deletion is a mechanism for generating minor H antigens in humans. PMID:12743171

  6. Identification of differentially expressed genes in Mongolian sheep ovaries by suppression subtractive hybridization.

    PubMed

    He, Xiaolong; Li, Bei; Wang, Feng; Tian, Chunying; Rong, Weiheng; Liu, Yongbin

    2012-07-01

    Fecundity is an important trait in sheep. Because it is directly related to production costs and efficiency, it has great economic impact in sheep husbandry. Because Mongolian sheep are a longstanding, indigenous breed, they are genetically related to most other breeds of sheep in China. The study of genes related to reproductive traits is essential to improving the fecundity of Mongolian sheep. In the present study, suppression subtractive hybridization (SSH) was performed using forward and reverse nested primers on cDNA libraries from ovarian tissue of single-bearing (S) and biparous (B) Mongolian sheep (MS). This yielded 768 clones. The length of the inserted fragments ranged from 150 to 1000 bp. From these, dot blot hybridization followed by sequencing and homology blast search in GenBank resolved 373 differentially expressed clones, representing 185 gene sequences (homology >85% and length >200 bp), 10 expressed sequence tags (ESTs; homology >95% and length >100 bp), and 4 unknown ESTs. The analysis of the differentially expressed gene functions allowed these genes to be categorized into seven groups: cell/body or immune defense, metabolism, transportation, nucleic acid modification, cell development, signal transduction, and cell structure. Four differentially expressed genes, a disintegrin and metalloproteinase with thrombospondin motifs 1 (ADAMTS1), inhibitor of DNA binding 3 (ID3), bone morphogenetic protein 6 (BMP6), and integrin beta 1 (ITGB1), were randomly selected and verified using relative quantitative real-time polymerase chain reaction (RQ-PCR). The expression of these genes in BMS ovaries was 30.06, 11.55, 0.82, and 1.12-fold that of SMS ovaries, respectively.

  7. Differential gene expression of CYP3A isoforms in equine liver and intestines.

    PubMed

    Tydén, E; Löfgren, M; Pegolo, S; Capolongo, F; Tjälve, H; Larsson, P

    2012-12-01

    Recently, seven CYP3A isoforms - CYP3A89, CYP3A93, CYP3A94, CYP3A95, CYP3A96, CYP3A97 and CYP129 - have been isolated from the horse genome. In this study, we have examined the hepatic and intestinal gene expression of these CYP3A isoforms using TaqMan probes. We have also studied the enzyme activity using luciferin-isopropyl acetal (LIPA) as a substrate. The results show a differential gene expression of the CYP3A isoforms in the liver and intestines in horses. In the liver, CYP3A89, CYP3A94, CYP3A96 and CYP3A97 were highly expressed, while in the intestine there were only two dominating isoforms, CYP3A93 and CYP3A96. The isoform CYP3A129 was not detected in the liver or the intestine, although this gene consists of a complete set of exons and should therefore code for a functional protein. It is possible that this gene is expressed in tissues other than the liver and intestines. In the intestine, both CYP3A96 and CYP3A93 showed the highest gene expression in the duodenum and the proximal parts of the jejunum. This correlated with a high protein expression in these tissues. Studies of the enzyme activity showed the same K(m) for the LIPA substrate in the liver and the intestine, while the maximum velocity (V(max)) in the liver was higher than in the intestine. Our finding of a differential gene expression of the CYP3A isoforms in the liver and the intestines contributes to a better understanding of drug metabolism in horses.

  8. Identification of differentially expressed genes in the livers of chronically i-As-treated hamsters.

    PubMed

    Hernández, Alba; Sampayo-Reyes, Adriana; Marcos, Ricard

    2011-08-01

    Inorganic arsenic (i-As) is a human carcinogen causing skin, lung, urinary bladder, liver and kidney tumors. Chronic exposure to this naturally occurring contaminant, mainly via drinking water, is a significant worldwide environmental health concern. To explore the molecular mechanisms of arsenic hepatic injury, a differential display polymerase chain reaction (DD-PCR) screening was undertaken to identify genes with distinct expression patterns between the liver of low i-As-exposed and control animals. Golden Syrian hamsters (5-6 weeks of age) received drinking water containing 15 mg i-As/L as sodium arsenite, or unaltered water for 18 weeks. The in vivo MN test was carried out, and the frequency of micronucleated reticulocytes (MN-RETs) was scored as a measure of exposure and As-related genotoxic/carcinogenic risk. A total of 68 differentially expressed bands were identified in our initial screen, 41 of which could be assigned to specific genes. Differential level of expression of a selected number of genes was verified using real-time RT-PCR with gene-specific primers. Arsenic-altered gene expression included genes related to stress response, cellular metabolism, cell cycle regulation, telomere maintenance, cell-cell communication and signal transduction. Significant differences of MN-RET were found between treated (8.70 ± 0.02 MN/1000RETs) and control (2.5 ± 0.70 MN/1000RETs) groups (P<0.001), demonstrating both the exposure and the i-As genotoxic/carcinogenic risk. Overall, this paper reveals some possible networks involved in hepatic arsenic-related genotoxicity, carcinogenesis and diabetogenesis. Additional studies to explore further the potential implications of each candidate gene are of especial interest. The present work opens the door to new prospects for the study of i-As mechanisms taking place in the liver under chronic settings.

  9. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  10. Transcriptomic profiling of gene expression and RNA processing during Leishmania major differentiation

    PubMed Central

    Dillon, Laura A. L.; Okrah, Kwame; Hughitt, V. Keith; Suresh, Rahul; Li, Yuan; Fernandes, Maria Cecilia; Belew, A. Trey; Corrada Bravo, Hector; Mosser, David M.; El-Sayed, Najib M.

    2015-01-01

    Protozoan parasites of the genus Leishmania are the etiological agents of leishmaniasis, a group of diseases with a worldwide incidence of 0.9–1.6 million cases per year. We used RNA-seq to conduct a high-resolution transcriptomic analysis of the global changes in gene expression and RNA processing events that occur as L. major transforms from non-infective procyclic promastigotes to infective metacyclic promastigotes. Careful statistical analysis across multiple biological replicates and the removal of batch effects provided a high quality framework for comprehensively analyzing differential gene expression and transcriptome remodeling in this pathogen as it acquires its infectivity. We also identified precise 5′ and 3′ UTR boundaries for a majority of Leishmania genes and detected widespread alternative trans-splicing and polyadenylation. An investigation of possible correlations between stage-specific preferential trans-splicing or polyadenylation sites and differentially expressed genes revealed a lack of systematic association, establishing that differences in expression levels cannot be attributed to stage-regulated alternative RNA processing. Our findings build on and improve existing expression datasets and provide a substantially more detailed view of L. major biology that will inform the field and potentially provide a stronger basis for drug discovery and vaccine development efforts. PMID:26150419

  11. Differential gene expression in fully-grown oocytes between gynogenetic and gonochoristic crucian carps.

    PubMed

    Xie, J; Wen, J J; Chen, B; Gui, J F

    2001-06-13

    Silver crucian carp (Carassius auratus gibelio) is a unique triploid bisexual species that can reproduce by gynogenesis. As all other gynogenetic animals, it keeps its chromosome integrity by inhibiting the first meiosis division (no extrusion of the first pole body). To understand the molecular events governing this reproduction mode, suppression subtractive hybridization was used to identify the genes differentially expressed in fully-grown oocytes of the gynogenetic and gonochoristic crucian carp (gyno-carp and gono-carp). From two specific subtractive cDNA libraries, the clones screened out by dot blots and virtual Northern blots were chosen to clone full-length cDNA by RACE. Four differentially expressed genes were obtained. Two are novel genes and are expressed specifically in the oocytes. The gyno-carp stores much more mRNA of cyclin A2, a new member of the fish A-type cyclin gene, in its fully-grown oocyte than in the gono-carp. The last gene is histone H2A. The histone H2As of these two closely related crucian carps are quite different in the C-terminus. Preliminary characterization of the four genes has been analyzed by nucleotide and deduced amino acid sequence and Northern analysis.

  12. Differential gene expression in seasonal sympatry: mechanisms involved in diverging life histories

    PubMed Central

    Peterson, Mark P.; Greives, Timothy J.; Atwell, Jonathan W.; Bridge, Eli S.; Ketterson, Ellen D.

    2016-01-01

    In an era of climate change, understanding the genetic and physiological mechanisms underlying flexibility in phenology and life history has gained greater importance. These mechanisms can be elucidated by comparing closely related populations that differ in key behavioural and physiological traits such as migration and timing of reproduction. We compared gene expression in two recently diverged dark-eyed Junco ( Junco hyemalis) subspecies that live in seasonal sympatry during winter and early spring, but that differ in behaviour and physiology, despite exposure to identical environmental cues. We identified 547 genes differentially expressed in blood and pectoral muscle. Genes involved in lipid transport and metabolism were highly expressed in migrant juncos, while genes involved in reproductive processes were highly expressed in resident breeders. Seasonal differences in gene expression in closely related populations residing in the same environment provide significant insights into mechanisms underlying variation in phenology and life history, and have potential implications for the role of seasonal timing differences in gene flow and reproductive isolation. PMID:26979563

  13. Differential Gene Expression in Foxtail Millet during Incompatible Interaction with Uromyces setariae-italicae

    PubMed Central

    Dong, Li; Bai, Hui; Quan, Jian Zhang; Liu, Lei; Dong, Zhi-Ping

    2015-01-01

    Foxtail millet (Setaria italica) is an important food and fodder grain crop that is grown for human consumption. Production of this species is affected by several plant diseases, such as rust. The cultivar Shilixiang has been identified as resistant to the foxtail millet rust pathogen, Uromyces setariae-italicae. In order to identify signaling pathways and genes related to the plant’s defense mechanisms against rust, the Shilixiang cultivar was used to construct a digital gene expression (DGE) library during the interaction of foxtail millet with U. setariae-italicae. In this study, we determined the most abundant differentially expressed signaling pathways of up-regulated genes in foxtail millet and identified significantly up-regulated genes. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to analyze the expression of nine selected genes, and the patterns observed agreed well with DGE analysis. Expression levels of the genes were also compared between a resistant cultivar Shilixiang and a susceptible cultivar Yugu-1, and the result indicated that expression level of Shilixiang is higher than that of Yugu-1. This study reveals the relatively comprehensive mechanisms of rust-responsive transcription in foxtail millet. PMID:25885767

  14. Effect of method of deduplication on estimation of differential gene expression using RNA-seq

    PubMed Central

    Chesnokov, Mikhail S.; Lazarevich, Natalia L.; Penin, Aleksey A.

    2017-01-01

    Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC) and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI). We also analyzed the influence of sequencing layout (single read or paired end) and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout. PMID:28321364

  15. PROX1 Gene is Differentially Expressed in Oral Cancer and Reduces Cellular Proliferation

    PubMed Central

    Rodrigues, Maria F.S.D.; de Oliveira Rodini, Camila; de Aquino Xavier, Flávia C.; Paiva, Katiúcia B.; Severino, Patrícia; Moyses, Raquel A.; López, Rossana M.; DeCicco, Rafael; Rocha, Lília A.; Carvalho, Marcos B.; Tajara, Eloiza H.; Nunes, Fabio D.

    2014-01-01

    Abstract Homeobox genes are a family of transcription factors that play a pivotal role in embryogenesis. Prospero homeobox 1 (PROX1) has been shown to function as a tumor suppressor gene or oncogene in various types of cancer, including oral squamous cell carcinoma (OSCC). We have previously identified PROX1 as a downregulated gene in OSCC. The aim of this study is to clarify the underlying mechanism by which PROX1 regulates tumorigenicity of OSCC cells. PROX1 mRNA and protein expression levels were first investigated in 40 samples of OSCC and in nontumor margins. Methylation and amplification analysis was also performed to assess the epigenetic and genetic mechanisms involved in controlling PROX1 expression. OSCC cell line SCC9 was also transfected to stably express the PROX1 gene. Next, SCC9-PROX1-overexpressing cells and controls were subjected to proliferation, differentiation, apoptosis, migration, and invasion assays in vitro. OSCC samples showed reduced PROX1 expression levels compared with nontumor margins. PROX1 amplification was associated with better overall survival. PROX1 overexpression reduces cell proliferation and downregulates cyclin D1. PROX1-overexpressing cells also exhibited reduced CK18 and CK19 expression and transcriptionally altered the expression of WISP3, GATA3, NOTCH1, and E2F1. Our results suggest that PROX1 functions as a tumor suppressor gene in oral carcinogenesis. PMID:25526434

  16. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  17. RNA sequencing reveals differentially expressed genes as potential diagnostic and prognostic indicators of gallbladder carcinoma

    PubMed Central

    Jiang, Mingming; Fang, Meng; Ji, Jun; Wang, Aihua; Wang, Mengmeng; Jiang, Xiaoqing; Gao, Chunfang

    2015-01-01

    Gallbladder carcinoma (GBC) is a rare tumor with a dismal survival rate overall. Hence, there is an urgent need for exploring more specific and sensitive biomarkers for the diagnosis and treatment of GBC. At first, amplified total RNAs from two paired GBC tumors and adjacent non-tumorous tissues (ANTTs) were subjected to RNA sequencing. 161 genes were identified differentially expressed between tumors and ANTTs. Functional enrichment analysis indicated that the up-regulated genes in tumor were primarily associated with signaling molecules and enzyme modulators, and mainly involved in cell cycles and pathways in cancer. Twelve differentially expressed genes (DEGs) were further confirmed in another independent cohort of 35 GBC patients. Expression levels of BIRC5, TK1, TNNT1 and MMP9 were found to be positively related to postoperative relapse. There was also a significant correlation between BIRC5 expression and tumor-node-metastasis (TNM) stage. Besides, we observed a positive correlation between serum CA19–9 concentration and the expression levels of TNNT1, MMP9 and CLIC3. Survival analysis revealed that GBC patients with high TK1 and MMP9 expression levels had worse prognosis. These identified DEGs might not only be promising biomarkers for GBC diagnosis and prognosis, but also expedite the discovery of novel therapeutic strategies. PMID:25970782

  18. Induction of a program gene expression during osteoblast differentiation with strontium ranelate

    SciTech Connect

    Zhu Lingling; Zaidi, Samir; Peng Yuanzhen; Zhou Hang; Moonga, Baljit S.; Blesius, Alexia; Dupin-Roger, Isabelle; Zaidi, Mone . E-mail: mone.zaidi@mssm.edu; Sun Li

    2007-04-06

    Strontium ranelate, a new agent for the treatment of osteoporosis, has been shown stimulate bone formation in various experimental models. This study examines the effect of strontium ranelate on gene expression in osteoblasts, as well as the formation of mineralized (von Kossa-positive) colony-forming unit-osteoblasts (CFU-obs). Bone marrow-derived stromal cells cultured for 21 days under differentiating conditions, when exposed to strontium ranelate, displayed a significant time- and concentration-dependent increase in the expression of the master gene, Runx2, as well as bone sialoprotein (BSP), but interestingly without effects on osteocalcin. This was associated with a significant increase in the formation of CFU-obs at day 21 of culture. In U-33 pre-osteoblastic cells, strontium ranelate significantly enhanced the expression of Runx2 and osteocalcin, but not BSP. Late, more mature osteoblastic OB-6 cells showed significant elevations in BSP and osteocalcin, but with only minimal effects on Runx2. In conclusion, strontium ranelate stimulates osteoblast differentiation, but the induction of the program of gene expression appears to be cell type-specific. The increased osteoblastic differentiation is the likely basis underlying the therapeutic bone-forming actions of strontium ranelate.

  19. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.

    PubMed

    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H

    2001-06-01

    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  20. Differential Expression of Genes Involved in Host Recognition, Attachment, and Degradation in the Mycoparasite Tolypocladium ophioglossoides

    PubMed Central

    Quandt, C. Alisha; Di, Yanming; Elser, Justin; Jaiswal, Pankaj; Spatafora, Joseph W.

    2016-01-01

    The ability of a fungus to infect novel hosts is dependent on changes in gene content, expression, or regulation. Examining gene expression under simulated host conditions can explore which genes may contribute to host jumping. Insect pathogenesis is the inferred ancestral character state for species of Tolypocladium, however several species are parasites of truffles, including Tolypocladium ophioglossoides. To identify potentially crucial genes in this interkingdom host switch, T. ophioglossoides was grown on four media conditions: media containing the inner and outer portions of its natural host (truffles of Elaphomyces), cuticles from an ancestral host (beetle), and a rich medium (Yeast Malt). Through high-throughput RNASeq of mRNA from these conditions, many differentially expressed genes were identified in the experiment. These included PTH11-related G-protein-coupled receptors (GPCRs) hypothesized to be involved in host recognition, and also found to be upregulated in insect pathogens. A divergent chitinase with a signal peptide was also found to be highly upregulated on media containing truffle tissue, suggesting an exogenous degradative activity in the presence of the truffle host. The adhesin gene, Mad1, was highly expressed on truffle media as well. A BiNGO analysis of overrepresented GO terms from genes expressed during each growth condition found that genes involved in redox reactions and transmembrane transport were the most overrepresented during T. ophioglossoides growth on truffle media, suggesting their importance in growth on fungal tissue as compared to other hosts and environments. Genes involved in secondary metabolism were most highly expressed during growth on insect tissue, suggesting that their products may not be necessary during parasitism of Elaphomyces. This study provides clues into understanding genetic mechanisms underlying the transition from insect to truffle parasitism. PMID:26801645

  1. Gene expression profile induced by BCNU in human glioma cell lines with differential MGMT expression.

    PubMed

    Bandres, Eva; Andion, Esther; Escalada, Alvaro; Honorato, Beatriz; Catalan, Victoria; Cubedo, Elena; Cordeu, Lucia; Garcia, Fermin; Zarate, Ruth; Zabalegui, Natalia; Garcia-Foncillas, Jesus

    2005-07-01

    Chemotherapy with the alkylating agent BCNU (1,3-bis (2-chloroethyl)-1-nitrosourea) is the most commonly used chemotherapeutic agent for gliomas. However, the usefulness of this agent is limited because tumor cell resistance to BCNU is frequently found in clinical brain tumor therapy. The O6-methylguanine-DNA methyltransferase protein (MGMT) reverses alkylation at the O6 position of guanine and we have reported the role of MGMT in the response of brain tumors to alkylating agents. However, the different mechanisms underlying the patterns related to MGMT remain unclear. To better understand the molecular mechanism by which BCNU exerts its effect in glioma cell lines according MGMT expression, we used microarray technology to interrogate 3800 known genes and determine the gene expression profiles altered by BCNU treatment. Our results showed that treatment with BCNU alters the expression of a diverse group of genes in a time-dependent manner. A subset of gene changes was found common in both glioma cell lines and other subset is specific of each cell line. After 24 h of BCNU treatment, up-regulation of transcription factors involved in the nucleation of both RNA polymerase II and III transcription initiation complexes was reported. Interestingly, BCNU promoted the expression of actin-dependent regulators of chromatin. Similar effects were found with higher BCNU doses in MGMT+ cell line showing a similar mechanism that in MGMT-deficient cell with standard doses. Our data suggest that human glioma cell lines treated with BCNU, independently of MGMT expression, show changes in the expression of cell cycle and survival-related genes interfering the transcription mechanisms and the chromatin regulation.

  2. Comparative analysis of differentially expressed genes in Sika deer antler at different stages.

    PubMed

    Zhao, Yu; Yao, Baojin; Zhang, Mei; Wang, Siming; Zhang, Hui; Xiao, Wei

    2013-02-01

    Deer antlers serve as useful models of rapid growth and mineralization in mammals. During the period of rapid growth, the antlers of many species of deer will elongate by more than 2 cm per day, after which the antlers gradually ossify. However, little is known about the genes that are involved in their development, particularly the molecular mechanisms responsible for rapid growth and ossification. In our previous studies, we have reported on the transcriptome analysis of deer antlers at rapid growth and ossification stages. With the aim to get a comprehensive understanding of gene expression patterns during antler growth, in the present study, we performed a rigorous algorithm to identify differentially expressed genes between two different stages (60 and 90 days) during antler growth. A total of 16,905 significantly changed transcripts were identified. Those sequences were mapped to 5,573 genes with 2,217 genes up-regulated and 3,356 genes down-regulated (60 days vs. 90 days), including ribosomal proteins, translation initiation and elongation factors, transcription factors, signaling molecules and extracellular matrix proteins. We also performed the gene ontology (GO) functional enrichment and pathway enrichment analysis of gene expression patterns with hypergeometric test and Bonferroni Correction. Both the two stages were enriched with members of GO categories and distinct pathways. Our data represent the most comprehensive sequence resource available for the deer antler and provide a basis for further research on deer antler molecular genetics and functional genomics.

  3. Differential maturation of rhythmic clock gene expression during early development in medaka (Oryzias latipes).

    PubMed

    Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela

    2014-05-01

    One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.

  4. Differential gene expression profiling of Actinobacillus pleuropneumoniae during induction of primary alveolar macrophage apoptosis in piglets.

    PubMed

    Wang, Lei; Qin, Wanhai; Ruidong, Zhai; Liu, Shiting; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P R; Lei, Liancheng

    2015-01-01

    Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is the causative agent of porcine pleuropneumonia, a disease that causes serious problems for the swine industry. Successful infection by this bacterium requires breaking the first line of defence in the lungs, the primary alveolar macrophages (PAMs). Therefore, exploring A. pleuropneumoniae-PAM interactions will provide vital groundwork for the scientific control of this infectious disease, which has been little studied up to now. In this work, PAMs were isolated from piglets and co-incubated with A. pleuropneumoniae serovar 5b strain L20 in vitro, and their interaction, PAM cell death, and differential gene expression of A. pleuropneumoniae in response to PAM cell death were observed and analysed using confocal microscopy, electron microscopy, RT-PCR, Western blot, flow cytometry and the use of a gene expression profile chip. A. pleuropneumoniae quickly adhered to and invaded PAMs, inducing apoptosis, which was confirmed using transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The highest percentage of apoptosis in cells was confirmed using flow cytometry when the cells were infected at a multiplicity of infection (MOI) of 10 and incubated for 5 h, with higher expression of activated caspase-3 as measured by Western blot. Using microarray gene chips with 2868 probes containing nearly all of the genomic sequence of A. pleuropneumoniae serotype 5b strain L20, a total of 185 bacterial genes were found to be differentially expressed (including 92 up-regulated and 93 down-regulated genes) and involved in the process of apoptosis, as compared with the expression of control bacteria cultured without PAMs in BHI medium (mean expression ratios >1.5-fold, p < 0.05). The up-regulated genes are involved in energy metabolism, gene transcription and translation, virulence related gene such as LPS, Trimeric Autotransporter Adhesin, RTX and similar genes. The down-regulated genes are

  5. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  6. Differentially Expressed Genes in Hirudo medicinalis Ganglia after Acetyl-L-Carnitine Treatment

    PubMed Central

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-l-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer’s disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism. PMID:23308261

  7. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera

    PubMed Central

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    ABSTRACT Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality. PMID:26507253

  8. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera.

    PubMed

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality.

  9. Co-localization of growth QTL with differentially expressed candidate genes in rainbow trout.

    PubMed

    Kocmarek, Andrea L; Ferguson, Moira M; Danzmann, Roy G

    2015-09-01

    We tested whether genes differentially expressed between large and small rainbow trout co-localized with familial QTL regions for body size. Eleven chromosomes, known from previous work to house QTL for weight and length in rainbow trout, were examined for QTL in half-sibling families produced in September (1 XY male and 1 XX neomale) and December (1 XY male). In previous studies, we identified 108 candidate genes for growth expressed in the liver and white muscle in a subset of the fish used in this study. These gene sequences were BLASTN aligned against the rainbow trout and stickleback genomes to determine their location (rainbow trout) and inferred location based on synteny with the stickleback genome. Across the progeny of all three males used in the study, 63.9% of the genes with differential expression appear to co-localize with the QTL regions on 6 of the 11 chromosomes tested in these males. Genes that co-localized with QTL in the mixed-sex offspring of the two XY males primarily showed up-regulation in the muscle of large fish and were related to muscle growth, metabolism, and the stress response.

  10. The Effects of Simulated Microgravity on Gene Expression in Human Bone Marrow MSC's Under Osteogenic Differentiation

    NASA Astrophysics Data System (ADS)

    Buravkova, L. B.; Gershovich, J. G.; Gershovich, P. M.; Grigoriev, A. I.

    2013-02-01

    In this work it was found that the expression level of 144 genes significantly changed in human mesenchymal stem cells during their osteogenic differentiation after 20 days of exposure to simulated microgravity: the expression of 30 genes significantly increased (from 1.7 to 11.9 fold), and 114 - decreased (from 0.2 to 0.6 fold). Most of the revealed genes were attributed to the 11 major groups corresponding to its biological role in the cells. Additional group was formed from the genes which did not belong to these categories, or did not have a description in the known databases (such as Pubmed). The greatest number of genes with altered expression was found in the group “Matrix and Adhesion", while the lowest - in the "Apoptosis and the response to external stimuli" group. These findings suggest that cultured hMSCs, placed in non-standard conditions, maintain a high level of viability, but have significantly altered functional properties which could affect their efficiency to differentiate towards osteogenic direction.

  11. Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization.

    PubMed

    Lee, Eun Hye; Kim, Ki Hong

    2011-04-06

    Miamiensis avidus, a causative agent of scuticociliatosis in cultured marine fish, can live not only in seawater as a free-living organism but also in fish as a parasite. In this study, a cDNA library of representative mRNAs more specific to parasitic phase M. avidus was generated using suppression subtractive hybridization (SSH), and 520 clones selected from the SSH library were single-run sequenced. The differential gene expression patterns were confirmed by semi-quantitative reverse-transcription PCR. Of the 510 SSH clones, 21 clones of 6 putative genes did not match sequences in the public database. The expectation values (E-values) of 117 clones encoding 9 putative genes were greater than 1 x 10(-5). The other 372 clones that met the criterion of E value <1 x 10-5 were matched to 26 known sequences in the database. Genes associated with signal transduction, cell proliferation, membrane transportation, protein translocation, and transcription regulation were preferentially expressed in parasitic phase M. avidus. The differential gene expression may be needed for the ciliates to survive in the host fish, and the corresponding proteins might be used as antigen candidates for development of scuticociliatosis vaccines.

  12. Differential expression of four soybean bZIP genes during Phakopsora pachyrhizi infection.

    PubMed

    Alves, Murilo S; Soares, Zamira G; Vidigal, Pedro M P; Barros, Everaldo G; Poddanosqui, Adriana M P; Aoyagi, Luciano N; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Fietto, Luciano G

    2015-11-01

    Asian soybean rust (ASR), caused by the obligate biotrophic fungus Phakopsora pachyrhizi, is one of most important diseases in the soybean (Glycine max (L.) Merr.) agribusiness. The identification and characterization of genes related to plant defense responses to fungal infection are essential to develop ASR-resistant plants. In this work, we describe four soybean genes, GmbZIP62, GmbZIP105, GmbZIPE1, and GmbZIPE2, which encode transcription factors containing a basic leucine zipper (bZIP) domain from two divergent classes, and that are responsive to P. pachyrhizi infection. Molecular phylogenetic analyses demonstrated that these genes encode proteins similar to bZIP factors responsive to pathogens. Yeast transactivation assays showed that only GmbZIP62 has strong transactivation activity in yeast. In addition, three of the bZIP transcription factors analyzed were also differentially expressed by plant defense hormones, and all were differentially expressed by fungal attack, indicating that these proteins might participate in response to ASR infection. The results suggested that these bZIP proteins are part of the plant defense response to P. pachyrhizi infection, by regulating the gene expression related to ASR infection responses. These bZIP genes are potential targets to obtain new soybean genotypes resistant to ASR.

  13. Expression of chondrogenic genes by undifferentiated vs. differentiated human mesenchymal stem cells using array technology.

    PubMed

    Henrionnet, Christel; Roeder, Emilie; Gillet, Romain; Galois, Laurent; Bensoussan, Danièle; Mainard, Didier; Netter, Patrick; Gillet, Pierre; Pinzano, Astrid

    2010-01-01

    This study investigated the gene expression profile of human mesenchymal stem cells seeded in collagen sponge for 28 days in three different mediums: (1) basal medium as control containing ITS alone, (2) ITS+TGF-β1 alone or (3) ITS 1% supplemented sequentially by TGF-β1 (D3-D14) followed by BMP-2 (D15-D28). Differential expression of 84 genes implicated in chondrogenic and osteogenic differentiation of MSCs was analyzed at D28 by real-time RT-PCR array technology. TGF-β1 alone down-regulated two genes, CD36 and cathepsin K. Sixteen genes were significantly up-regulated, notably type 2 and type 10 collagens, COMP and Sox9. The sequential combination of TGF-β1 and BMP-2 produced a similar profile with prominent expression of type 2 collagen and the alkaline phosphatase gene. Interestingly, in this in vitro condition, RUNX2 was not up-regulated, suggesting that the sequential combination of TGF-β1/BMP2 enhances the hypertrophic chondrogenic profile without turning towards the osteoblastic pathway.

  14. Differential gene expression in mouse spermatogonial stem cells and embryonic stem cells

    PubMed Central

    Bai, Yinshan; Feng, Meiying; Liu, Shanshan; Wei, Hengxi; Li, Li; Zhang, Xianwei; Shen, Chao; Zhang, Shouquan; Ma, Ningfang

    2016-01-01

    Mouse spermatogonial stem cells (mSSCs) may be reprogrammed to become pluripotent stem cells under in vitro culture conditions, due to epigenetic modifications, which are closely associated with the expression of transcription factors and epigenetic factors. Thus, this study was conducted to compare the gene expression of transcription factors and epigenetic factors in mSSCs and mouse embryonic stem cells (mESCs). Firstly, the freshly isolated mSSCs [mSSCs (f)] were enriched by magnetic-activated cell sorting with Thy1.2 (CD90.2) microbeads, and the typical morphological characteristics were maintained under in vitro culture conditions for over 5 months to form long-term propagated mSSCs [mSSCs (l)]. These mSSCs (l) expressed pluripotency-associated genes and were induced to differentiate into sperm. Our findings indicated that the mSSCs (l) expressed high levels of the transcription factors, Lin28 and Prmt5, and the epigenetic factors, Tet3, Parp1, Max, Tert and Trf1, in comparison with the mESCs, with the levels of Prmt5, Tet3, Parp1 and Tert significantly higher than those in the mESCs. There was no significant difference in Kdm2b expression between mSSCs (l) and mESCs. Furthermore, the gene expression of N-Myc, Dppa2, Tbx3, Nr5a2, Prmt5, Tet3, Parp1, Max, Tert and Trf1 in the mSSCs (l) was markedly higher in comparison to that in the mSSCs (f). Collectively, our results suggest that the mSSCs and the mESCs displayed differential gene expression profiles, and the mSSCs possessed the potential to acquire pluripotency based on the high expression of transcription factors and epigenetic factors. These data may provide novel insights into the reprogramming mechanism of mSSCs. PMID:27353491

  15. Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds.

    PubMed

    Toorop, Peter E; Barroco, Rosa Maria; Engler, Gilbert; Groot, Steven P C; Hilhorst, Henk W M

    2005-07-01

    Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was undetectable in the dry seed, low in dormant seed, and high under conditions that allowed completion of germination. Expression of these genes was also found to be light-regulated and to correlate with germination speed. Expression of the dormancy-associated genes ATS2 and ATS4, encoding a caleosin-like protein and a protein similar to a low-temperature-induced protein respectively, was high in the dry seed and decreased during germination. Expression of ATS2 and ATS4 was high in primary and secondary dormant seed but low in after-ripened or chilled seed. The expression of both genes was also light-regulated, but no relationship with temperature-dependent germination speed was found.

  16. Differential expression of genes of Xylella fastidiosa in xylem fluid of citrus and grapevine.

    PubMed

    Shi, Xiangyang; Bi, Jianlong; Morse, Joseph G; Toscano, Nick C; Cooksey, Donald A

    2010-03-01

    Xylella fastidiosa causes a serious Pierce's disease (PD) in grapevine. Xylella fastidiosa cells from a PD strain were grown in a pure xylem fluid of a susceptible grapevine cultivar vs. xylem fluid from citrus, which is not a host for this strain of X. fastidiosa. When grown in grapevine xylem fluid, cells of the PD strain formed clumps and biofilm formed to a greater extent than in citrus xylem fluid, although the PD strain did grow in xylem fluid of three citrus varieties. The differential expression of selected genes of a PD X. fastidiosa strain cultured in the two xylem fluids was analyzed using a DNA macroarray. Compared with citrus xylem fluid, grapevine xylem fluid stimulated the expression of X. fastidiosa genes involved in virulence regulation, such as gacA, algU, xrvA, and hsq, and also genes involved in the biogenesis of pili and twitching motility, such as fimT, pilI, pilU, and pilY1. Increased gene expression likely contributes to PD expression in grapevine, whereas citrus xylem fluid did not support or possibly suppressed the expression of these virulence genes.

  17. Differential expression of imprinted genes in normal and IUGR human placentas.

    PubMed

    Diplas, Andreas I; Lambertini, Luca; Lee, Men-Jean; Sperling, Rhoda; Lee, Yin Leng; Wetmur, James; Chen, Jia

    2009-05-16

    Genomic imprinting refers to silencing of one parental allele in the zygotes of gametes depending upon the parent of origin. Loss of imprinting (LOI) is the gain of function from the silent allele that can have a maximum effect of doubling the gene dosage. LOI may play a significant role in the etiology of intrauterine growth restriction (IUGR). Using placental tissue from ten normal and seven IUGR pregnancies, we conducted a systematic survey of the expression of a panel of 74 "putatively" imprinted genes using quantitative RT-PCR. We found that 52/74 ( approximately 70%) of the genes were expressed in human placentas. Nine of the 52 (17%) expressed genes were significantly differentially expressed between normal and IUGR placentas; five were upregulated (PHLDA2, ILK2, NNAT, CCDC86, PEG10) and four downregulated (PLAGL1, DHCR24, ZNF331, CDKAL1). We also assessed LOI profile of 14 imprinted genes in 14 normal and 24 IUGR placentas using a functional and sensitive assay developed in our laboratory. Little LOI was observed in any placentas for five of the genes (PEG10, PHLDA2, MEG3, EPS15, CD44). With the 149 heterozygosities examined, 40 (26.8%) exhibited LOI >3%. Some genes exhibited frequent LOI in placentas regardless of the disease status (IGF2, TP73, MEST, SLC22A18, PEG3), while others exhibited LOI only in IUGR placentas (PLAGL1, DLK1, H19, SNRPN). Importantly, there was no correlation between gene expression and LOI profile. Our study suggests that genomic imprinting may play a role in IUGR pathogenesis, but mechanisms other than LOI may contribute to dysregulation of imprinted genes.

  18. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  19. Identifying differentially expressed genes in cancer patients using a non-parameter Ising model.

    PubMed

    Li, Xumeng; Feltus, Frank A; Sun, Xiaoqian; Wang, James Z; Luo, Feng

    2011-10-01

    Identification of genes and pathways involved in diseases and physiological conditions is a major task in systems biology. In this study, we developed a novel non-parameter Ising model to integrate protein-protein interaction network and microarray data for identifying differentially expressed (DE) genes. We also proposed a simulated annealing algorithm to find the optimal configuration of the Ising model. The Ising model was applied to two breast cancer microarray data sets. The results showed that more cancer-related DE sub-networks and genes were identified by the Ising model than those by the Markov random field model. Furthermore, cross-validation experiments showed that DE genes identified by Ising model can improve classification performance compared with DE genes identified by Markov random field model.

  20. c-Rel Regulates Inscuteable Gene Expression during Mouse Embryonic Stem Cell Differentiation*

    PubMed Central

    Ishibashi, Riki; Kozuki, Satoshi; Kamakura, Sachiko; Sumimoto, Hideki; Toyoshima, Fumiko

    2016-01-01

    Inscuteable (Insc) regulates cell fate decisions in several types of stem cells. Although it is recognized that the expression levels of mouse INSC govern the balance between symmetric and asymmetric stem cell division, regulation of mouse Insc gene expression remains poorly understood. Here, we showed that mouse Insc expression transiently increases at an early stage of differentiation, when mouse embryonic stem (mES) cells differentiate into bipotent mesendoderm capable of producing both endoderm and mesoderm in defined culture conditions. We identified the minimum transcriptional regulatory element (354 bases) that drives mouse Insc transcription in mES cells within a region >5 kb upstream of the mouse Insc transcription start site. We found that the transcription factor reticuloendotheliosis oncogene (c-Rel) bound to the minimum element and promoted mouse Insc expression in mES cells. In addition, short interfering RNA-mediated knockdown of either mouse INSC or c-Rel protein decreased mesodermal cell populations without affecting differentiation into the mesendoderm or endoderm. Furthermore, overexpression of mouse INSC rescued the mesoderm-reduced phenotype induced by knockdown of c-Rel. We propose that regulation of mouse Insc expression by c-Rel modulates cell fate decisions during mES cell differentiation. PMID:26694615

  1. c-Rel Regulates Inscuteable Gene Expression during Mouse Embryonic Stem Cell Differentiation.

    PubMed

    Ishibashi, Riki; Kozuki, Satoshi; Kamakura, Sachiko; Sumimoto, Hideki; Toyoshima, Fumiko

    2016-02-12

    Inscuteable (Insc) regulates cell fate decisions in several types of stem cells. Although it is recognized that the expression levels of mouse INSC govern the balance between symmetric and asymmetric stem cell division, regulation of mouse Insc gene expression remains poorly understood. Here, we showed that mouse Insc expression transiently increases at an early stage of differentiation, when mouse embryonic stem (mES) cells differentiate into bipotent mesendoderm capable of producing both endoderm and mesoderm in defined culture conditions. We identified the minimum transcriptional regulatory element (354 bases) that drives mouse Insc transcription in mES cells within a region >5 kb upstream of the mouse Insc transcription start site. We found that the transcription factor reticuloendotheliosis oncogene (c-Rel) bound to the minimum element and promoted mouse Insc expression in mES cells. In addition, short interfering RNA-mediated knockdown of either mouse INSC or c-Rel protein decreased mesodermal cell populations without affecting differentiation into the mesendoderm or endoderm. Furthermore, overexpression of mouse INSC rescued the mesoderm-reduced phenotype induced by knockdown of c-Rel. We propose that regulation of mouse Insc expression by c-Rel modulates cell fate decisions during mES cell differentiation.

  2. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

    PubMed Central

    2011-01-01

    Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes

  3. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.

    PubMed

    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei

    2015-05-01

    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  4. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  5. The gene road to royalty--differential expression of hydroxylating genes in the mandibular glands of the honeybee.

    PubMed

    Malka, Osnat; Karunker, Iris; Yeheskel, Adva; Morin, Shai; Hefetz, Abraham

    2009-10-01

    The advances in honeybee sociogenomics have paved the way for the study of social communication processes at the gene level, in particular the expression of caste-specific pheromones. The queen honeybee mandibular pheromone provides an excellent model system, in that biosynthesis of the hydroxylating fatty acid caste-specific pheromone appears to be reduced to a single chemical hydroxylation step of stearic acid. Queens are typified by omega-1-hydroxylation, as opposed to the worker-typical omega-hydroxylation. We hypothesized that this bifurcation is the consequence of differential expression of caste-specific genes that code for fatty acid-hydroxylating enzymes from the cytochrome P450 (CYP) family. Bioinformatics studies disclosed two candidate proteins CYP4AA1 and CYP18A1. We thus investigated the expression of these genes in the mandibular glands of queens, and of queenright (QR) and queenless (QL) workers. The real-time PCR results revealed that CYP4AA1 (omega-hydroxylation) was expressed at high levels in both QR and QL workers, whereas in queens its expression was negligible. The expression of CYP18A1 (omega-1-hydroxylation), on the other hand, was high in the queen's glands and negligible in those of QR workers. In QL workers, however, the expression of CYP18A1 was considerably elevated and significantly greater than in QR workers. Three-dimensional structural models constructed for these enzymes demonstrate differences in the active site between CYP18A1 and CYP4AA1, in line with their differential catalytic specificity. The fact that queen pheromone plasticity can be tracked all the way to gene expression provides a new insight into the process of caste differentiation and the accompanying social communication.

  6. Gene expression profile of HIV-1 Tat expressing cells: a close interplay between proliferative and differentiation signals

    PubMed Central

    de la Fuente, Cynthia; Santiago, Francisco; Deng, Longwen; Eadie, Carolyne; Zilberman, Irene; Kehn, Kylene; Maddukuri, Anil; Baylor, Shanese; Wu, Kaili; Lee, Chee Gun; Pumfery, Anne; Kashanchi, Fatah

    2002-01-01

    Background Expression profiling holds great promise for rapid host genome functional analysis. It is plausible that host expression profiling in an infection could serve as a universal phenotype in virally infected cells. Here, we describe the effect of one of the most critical viral activators, Tat, in HIV-1 infected and Tat expressing cells. We utilized microarray analysis from uninfected, latently HIV-1 infected cells, as well as cells that express Tat, to decipher some of the cellular changes associated with this viral activator. Results Utilizing uninfected, HIV-1 latently infected cells, and Tat expressing cells, we observed that most of the cellular host genes in Tat expressing cells were down-regulated. The down-regulation in Tat expressing cells is most apparent on cellular receptors that have intrinsic receptor tyrosine kinase (RTK) activity and signal transduction members that mediate RTK function, including Ras-Raf-MEK pathway. Co-activators of transcription, such as p300/CBP and SRC-1, which mediate gene expression related to hormone receptor genes, were also found to be down-regulated. Down-regulation of receptors may allow latent HIV-1 infected cells to either hide from the immune system or avoid extracellular differentiation signals. Some of the genes that were up-regulated included co-receptors for HIV-1 entry, translation machinery, and cell cycle regulatory proteins. Conclusions We have demonstrated, through a microarray approach, that HIV-1 Tat is able to regulate many cellular genes that are involved in cell signaling, translation and ultimately control the host proliferative and differentiation signals. PMID:12069692

  7. Concentration-response analysis of differential gene expression in the zebrafish embryotoxicity test following flusilazole exposure.

    PubMed

    Hermsen, Sanne A B; Pronk, Tessa E; van den Brandhof, Evert-Jan; van der Ven, Leo T M; Piersma, Aldert H

    2012-05-01

    The zebrafish embryotoxicity test (ZET) is considered a promising alternative model in predictive toxicology. Currently, morphological assessment of the embryo is the main readout for this assay. However, implementation of transcriptomics may help to detect more subtle effects, which may increase the sensitivity and predictability of the test. In this study, we tested a concentration response of flusilazole in the ZET. After exposure for 24 h postfertilization, microarray analysis revealed a number of processes to be regulated in a concentration-dependent way. We identified development related processes, retinol metabolism and transcription, as well as processes corresponding to the antifungal mechanism of action, steroid biosynthesis, and fatty acid metabolism, to be differentially regulated. Retinol metabolism and transcription were already significantly altered at concentrations that were not inducing morphological effects. Differential expression of genes related to steroid biosynthesis and fatty acid metabolism showed a concentration response similar to morphological response. An increase in concentration was also positively associated with an increase in magnitude of expression for individual genes within functional processes. Our study shows that transcriptomics analysis in the ZET is a more sensitive readout of compound-induced effects than morphological assessment. However, the interpretation of differential gene expression in terms of predicting morphological effects is not straightforward and requires further study.

  8. Zebra fish myc family and max genes: differential expression and oncogenic activity throughout vertebrate evolution.

    PubMed Central

    Schreiber-Agus, N; Horner, J; Torres, R; Chiu, F C; DePinho, R A

    1993-01-01

    To gain insight into the role of Myc family oncoproteins and their associated protein Max in vertebrate growth and development, we sought to identify homologs in the zebra fish (Brachydanio rerio). A combination of a polymerase chain reaction-based cloning strategy and low-stringency hybridization screening allowed for the isolation of zebra fish c-, N-, and L-myc and max genes; subsequent structural characterization showed a high degree of conservation in regions that encode motifs of known functional significance. On the functional level, zebra fish Max, like its mammalian counterpart, served to suppress the transformation activity of mouse c-Myc in rat embryo fibroblasts. In addition, the zebra fish c-myc gene proved capable of cooperating with an activated H-ras to effect the malignant transformation of mammalian cells, albeit with diminished potency compared with mouse c-myc. With respect to their roles in normal developing tissues, the differential temporal and spatial patterns of steady-state mRNA expression observed for each zebra fish myc family member suggest unique functions for L-myc in early embryogenesis, for N-myc in establishment and growth of early organ systems, and for c-myc in increasingly differentiated tissues. Furthermore, significant alterations in the steady-state expression of zebra fish myc family genes concomitant with relatively constant max expression support the emerging model of regulation of Myc function in cellular growth and differentiation. Images PMID:8474440

  9. Comparative study of gene expression during the differentiation of white and brown preadipocytes

    NASA Astrophysics Data System (ADS)

    Boeuf, Stéphane

    2002-08-01

    Introduction Mammals have two types of adipose tissue: the lipid storing white adipose tissue and the brown adipose tissue characterised by its capacity for non-shivering thermogenesis. White and brown adipocytes have the same origin in mesodermal stem cells. Yet nothing is known so far about the commitment of precursor cells to the white and brown adipose lineage. Several experimental approaches indicate that they originate from the differentiation of two distinct types of precursor cells, white and brown preadipocytes. Based on this hypothesis, the aim of this study was to analyse the gene expression of white and brown preadipocytes in a systematic approach. Experimental approach The white and brown preadipocytes to compare were obtained from primary cell cultures of preadipocytes from the Djungarian dwarf hamster. Representational difference analysis was used to isolate genes potentially differentially expressed between the two cell types. The thus obtained cDNA libraries were spotted on microarrays for a large scale gene expression analysis in cultured preadipocytes and adipocytes and in tissue samples. Results 4 genes with higher expression in white preadipocytes (3 members of the complement system and a fatty acid desaturase) and 8 with higher expression in brown preadipocytes were identified. From the latter 3 coded for structural proteins (fibronectin, metargidin and a actinin 4), 3 for proteins involved in transcriptional regulation (necdin, vigilin and the small nuclear ribonucleoprotein polypeptide A) and 2 are of unknown function. Cluster analysis was applied to the gene expression data in order to characterise them and led to the identification of four major typical expression profiles: genes up-regulated during differentiation, genes down-regulated during differentiation, genes higher expressed in white preadipocytes and genes higher expressed in brown preadipocytes. Conclusion This study shows that white and brown preadipocytes can be distinguished

  10. HMGB4 is expressed by neuronal cells and affects the expression of genes involved in neural differentiation

    PubMed Central

    Rouhiainen, Ari; Zhao, Xiang; Vanttola, Päivi; Qian, Kui; Kulesskiy, Evgeny; Kuja-Panula, Juha; Gransalke, Kathleen; Grönholm, Mikaela; Unni, Emmanual; Meistrich, Marvin; Tian, Li; Auvinen, Petri; Rauvala, Heikki

    2016-01-01

    HMGB4 is a new member in the family of HMGB proteins that has been characterized in sperm cells, but little is known about its functions in somatic cells. Here we show that HMGB4 and the highly similar rat Transition Protein 4 (HMGB4L1) are expressed in neuronal cells. Both proteins had slow mobility in nucleus of living NIH-3T3 cells. They interacted with histones and their differential expression in transformed cells of the nervous system altered the post-translational modification statuses of histones in vitro. Overexpression of HMGB4 in HEK 293T cells made cells more susceptible to cell death induced by topoisomerase inhibitors in an oncology drug screening array and altered variant composition of histone H3. HMGB4 regulated over 800 genes in HEK 293T cells with a p-value ≤0.013 (n = 3) in a microarray analysis and displayed strongest association with adhesion and histone H2A –processes. In neuronal and transformed cells HMGB4 regulated the expression of an oligodendrocyte marker gene PPP1R14a and other neuronal differentiation marker genes. In conclusion, our data suggests that HMGB4 is a factor that regulates chromatin and expression of neuronal differentiation markers. PMID:27608812

  11. Sequencing and bioinformatics analysis of the differentially expressed genes in herniated discs with or without calcification

    PubMed Central

    Shao, Jia; Yu, Miao; Jiang, Liang; Wu, Fengliang; Liu, Xiaoguang

    2017-01-01

    The purpose of this study was to detect the differentially expressed genes between ossified herniated discs and herniated discs without ossification. In addition, we sought to identify a few candidate genes and pathways by using bioinformatics analysis. We analyzed 6 samples each of ossified herniated discs (experimental group) and herniated discs without ossification (control group). Purified mRNA and cDNA extracted from the samples were subjected to sequencing. The NOISeq method was used to statistically identify the differentially expressed genes (DEGs) between the 2 groups. An in-depth analysis using bioinformatics tools based on the DEGs was performed using Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, and protein-protein interaction network analysis. The top 6 DEGs were verified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 132 DEGs was detected. A total of 129 genes in the ossified group were upregulated and 3 genes were found to be downregulated as compared to the control group. The top 3 cellular components in GO ontologies analysis were extracellular matrix components. GO functions were mainly related to the glycoprotein in the cell membrane and extracellular matrix. The GO process was related to completing response to stimulus, immune reflex and defense. The top 5 KEGG enrichment pathways were associated with infection and inflammation. Three of the top 20 DEGs [sclerostin (SOST), WNT inhibitory factor 1 (WIF1) and secreted frizzled related protein 4 (SFRP4)] were related to the inhibition of the Wnt pathway. The ossified discs exhibited a higher expression of the top 6 DEGs [SOST, joining chain of multimeric IgA and IgM (IGJ; also known as JCHAIN), defensin alpha 4 (DEFA4), SFRP4, proteinase 3 (PRTN3) and cathepsin G (CTSG)], with the associated P-values of 0.045, 0.000, 0.008, 0.010, 0.015 and 0.002, respectively, as calculated by the independent sample t

  12. Discovery of differentially expressed genes in cashmere goat (Capra hircus) hair follicles by RNA sequencing.

    PubMed

    Qiao, X; Wu, J H; Wu, R B; Su, R; Li, C; Zhang, Y J; Wang, R J; Zhao, Y H; Fan, Y X; Zhang, W G; Li, J Q

    2016-09-02

    The mammalian hair follicle (HF) is a unique, highly regenerative organ with a distinct developmental cycle. Cashmere goat (Capra hircus) HFs can be divided into two categories based on structure and development time: primary and secondary follicles. To identify differentially expressed genes (DEGs) in the primary and secondary HFs of cashmere goats, the RNA sequencing of six individuals from Arbas, Inner Mongolia, was performed. A total of 617 DEGs were identified; 297 were upregulated while 320 were downregulated. Gene ontology analysis revealed that the main functions of the upregulated genes were electron transport, respiratory electron transport, mitochondrial electron transport, and gene expression. The downregulated genes were mainly involved in cell autophagy, protein complexes, neutrophil aggregation, and bacterial fungal defense reactions. According to the Kyoto Encyclopedia of Genes and Genomes database, these genes are mainly involved in the metabolism of cysteine and methionine, RNA polymerization, and the MAPK signaling pathway, and were enriched in primary follicles. A microRNA-target network revealed that secondary follicles are involved in several important biological processes, such as the synthesis of keratin-associated proteins and enzymes involved in amino acid biosynthesis. In summary, these findings will increase our understanding of the complex molecular mechanisms of HF development and cycling, and provide a basis for the further study of the genes and functions of HF development.

  13. Age-dependent Wnt gene expression in bone and during the course of osteoblast differentiation

    PubMed Central

    Rauner, Martina; Sipos, Wolfgang

    2008-01-01

    Wnt signaling is vital for osteoblast differentiation and recently has been associated with aging. Because impaired osteoblastogenesis is a cellular characteristic of age-induced bone loss, we investigated whether this process is associated with an altered expression of Wnt signaling-related proteins in bone and osteoblasts. Bone marrow cells were isolated from male C57BL/6 mice, aged 6 weeks, 6 months, and 18 months, respectively. Osteogenic differentiation was induced for 3 weeks and assessed using alizarin red staining. Gene expression of Wnt1, 3a, 4, 5a, 5b, 7b, 9b, 10b, lipoprotein receptor-related protein (LRP)-5/6, as well as dickkopf-1 (Dkk-1), sclerostin, and secreted frizzled related protein-1 (sFRP-1) was determined in bone tissue and osteoblasts on days 7, 14, and 21 by real-time RT-PCR. Osteoblast differentiation was significantly reduced in aged mice compared with young and adult mice. In bone tissue, expression levels of all genes assessed were decreased in adult and old mice, respectively, compared with young mice. Mature osteoblasts of aged compared with those of young mice showed enhanced expression of Wnt9b, LRP-6, and Dkk-1, and decreased expression of Wnt5a and 7b. In early osteoblasts, mRNA levels of Wnt1, 5a, 5b, and 7b were increased significantly in aged mice. The expression of Wnt3a, 4, LRP-5, and sclerostin was not altered in aged osteoblasts. In conclusion, osteoblastic expression of each Wnt-related protein is regulated individually by aging. The overall decreased expression of Wnt-related proteins in bone tissue of aged mice underlines the newly discovered association of Wnt signaling with aging. PMID:19424851

  14. Differential gene expression and lipid metabolism in fatty liver induced by acute ethanol treatment in mice

    SciTech Connect

    Yin Huquan; Kim, Mingoo; Kim, Ju-Han; Kong, Gu; Kang, Kyung-Sun; Kim, Hyung-Lae; Yoon, Byung-IL; Lee, Mi-Ock; Lee, Byung-Hoon

    2007-09-15

    Ethanol induces cumulative liver damage including steatosis, steatohepatitis and cirrhosis. The aim of this study is to investigate the global intrahepatic gene expression profile in the mouse liver treated with ethanol. A single oral dose of 0.5 or 5 g/kg ethanol was administered to male ICR mice, and liver samples were obtained after 6, 24 and 72 h. Histopathological evaluation showed typical fatty livers in the high-dose group at 24 h. Microarray analysis identified 28 genes as being ethanol responsive (two-way ANOVA; p < 0.05), after adjustment by the Benjamini-Hochberg multiple testing correction; these genes displayed {>=} 2-fold induction or repression. The expression of genes that are known to be involved in fatty acid synthesis was examined. The transcript for lipogenic transcription factor, sterol regulatory element (SRE)-binding factor 1 (Srebf1), was upregulated by acute ethanol exposure. Of the genes known to contain SRE or SRE-like sequences and to be regulated by SRE-binding protein 1 (SREBP1), those encoding malic enzyme (Mod1), ATP-citrate lyase (Acly), fatty acid synthase (Fasn) and stearyl-CoA desaturase (Scd1) were induced by ethanol. Quantitative real-time PCR confirmed the changes in the expression levels of the selected genes. The change in the Srebf1 mRNA level correlates well with that of the SREBP1 protein expression as well as its binding to the promoters of the target genes. The present study identifies differentially expressed genes that can be applied to the biomarkers for alcohol-binge-induced fatty liver. These results support the hypothesis by which ethanol-induced steatosis in mice is mediated by the fatty acid synthetic pathway regulated by SREBP1.

  15. Differential gene expression during thermal stress and bleaching in the Caribbean coral Montastraea faveolata.

    PubMed

    DeSalvo, M K; Voolstra, C R; Sunagawa, S; Schwarz, J A; Stillman, J H; Coffroth, M A; Szmant, A M; Medina, M

    2008-09-01

    The declining health of coral reefs worldwide is likely to intensify in response to continued anthropogenic disturbance from coastal development, pollution, and climate change. In response to these stresses, reef-building corals may exhibit bleaching, which marks the breakdown in symbiosis between coral and zooxanthellae. Mass coral bleaching due to elevated water temperature can devastate coral reefs on a large geographical scale. In order to understand the molecular and cellular basis of bleaching in corals, we have measured gene expression changes associated with thermal stress and bleaching using a complementary DNA microarray containing 1310 genes of the Caribbean coral Montastraea faveolata. In a first experiment, we identified differentially expressed genes by comparing experimentally bleached M. faveolata fragments to control non-heat-stressed fragments. In a second experiment, we identified differentially expressed genes during a time course experiment with four time points across 9 days. Results suggest that thermal stress and bleaching in M. faveolata affect the following processes: oxidative stress, Ca(2+) homeostasis, cytoskeletal organization, cell death, calcification, metabolism, protein synthesis, heat shock protein activity, and transposon activity. These results represent the first medium-scale transcriptomic study focused on revealing the cellular foundation of thermal stress-induced coral bleaching. We postulate that oxidative stress in thermal-stressed corals causes a disruption of Ca(2+) homeostasis, which in turn leads to cytoskeletal and cell adhesion changes, decreased calcification, and the initiation of cell death via apoptosis and necrosis.

  16. Differential effects of intermittent and continuous administration of parathyroid hormone on bone histomorphometry and gene expression

    NASA Technical Reports Server (NTRS)

    Lotinun, Sutada; Sibonga, Jean D.; Turner, Russell T.

    2002-01-01

    A mechanism explaining the differential skeletal effects of intermittent and continuous elevation of serum parathyroid hormone (PTH) remains elusive. Intermittent PTH increases bone formation and bone mass and is being investigated as a therapy for osteoporosis. By contrast, chronic hyperparathyroidism results in the metabolic bone disease osteitis fibrosa characterized by osteomalacia, focal bone resorption, and peritrabecular bone marrow fibrosis. Intermittent and continuous PTH have similar effects on the number of osteoblasts and bone-forming activity. Many of the beneficial as well as detrimental effects of the hormone appear to be mediated by osteoblast-derived growth factors. This hypothesis was tested using cDNA microgene arrays to compare gene expression in tibia of rats treated with continuous and pulsatile administration of PTH. These treatments result in differential expression of many genes, including growth factors. One of the genes whose steady-state mRNA levels was increased by continuous but not pulsatile administration was platelet-derived growth factor-A (PDGF-A). Administration of a PDGF-A antagonist greatly reduced bone resorption, osteomalacia, and bone marrow fibrosis in a rat model for hyperparathyroidism, suggesting that PDGF-A is a causative agent for this disease. These findings suggest that profiling changes in gene expression can help identify the metabolic pathways responsible for the skeletal responses to the hormone.

  17. Differential Gene Expression between Leaf and Rhizome in Atractylodes lancea: A Comparative Transcriptome Analysis

    PubMed Central

    Huang, Qianqian; Huang, Xiao; Deng, Juan; Liu, Hegang; Liu, Yanwen; Yu, Kun; Huang, Bisheng

    2016-01-01

    The rhizome of Atractylodes lancea is extensively used in the practice of Traditional Chinese Medicine because of its broad pharmacological activities. This study was designed to characterize the transcriptome profiling of the rhizome and leaf of Atractylodes lancea in an attempt to uncover the molecular mechanisms regulating rhizome formation and growth. Over 270 million clean reads were assembled into 92,366 unigenes, 58% of which are homologous with sequences in public protein databases (NR, Swiss-Prot, GO, and KEGG). Analysis of expression levels showed that genes involved in photosynthesis, stress response, and translation were the most abundant transcripts in the leaf, while transcripts involved in stress response, transcription regulation, translation, and metabolism were dominant in the rhizome. Tissue-specific gene analysis identified distinct gene families active in the leaf and rhizome. Differential gene expression analysis revealed a clear difference in gene expression pattern, identifying 1518 up-regulated genes and 3464 down-regulated genes in the rhizome compared with the leaf, including a series of genes related to signal transduction, primary and secondary metabolism. Transcription factor (TF) analysis identified 42 TF families, with 67 and 60 TFs up-regulated in the rhizome and leaf, respectively. A total of 104 unigenes were identified as candidates for regulating rhizome formation and development. These data offer an overview of the gene expression pattern of the rhizome and leaf and provide essential information for future studies on the molecular mechanisms of controlling rhizome formation and growth. The extensive transcriptome data generated in this study will be a valuable resource for further functional genomics studies of A. lancea. PMID:27066021

  18. Differentially expressed genes in the silk gland of silkworm (Bombyx mori) treated with TiO2 NPs.

    PubMed

    Xue, Bin; Li, Fanchi; Hu, Jingsheng; Tian, Jianghai; Li, Jinxin; Cheng, Xiaoyu; Hu, Jiahuan; Li, Bing

    2017-05-05

    Silk gland is a silkworm organ where silk proteins are synthesized and secreted. Dietary supplement of TiO2 nanoparticles (NPs) promotes silk protein synthesis in silkworms. In this study, digital gene expression (DGE) tag was used to analyze the gene expression profile of the posterior silk gland of silkworms that were fed with TiO2 NPs. In total, 5,702,823 and 6,150,719 clean tags, 55,096 and 74,715 distinct tags were detected in TiO2 NPs treated and control groups, respectively. Compared with the control, TiO2 NPs treated silkworms showed 306 differentially expressed genes, including 137 upregulated genes and 169 downregulated genes. Of these differentially expressed genes, 106 genes were related to silk protein synthesis, among which 97 genes were upregulated and 9 genes were downregulated. Pathway mapping using the Kyoto Encyclopedia of Genes and Genomes (KEGG) showed that 20 pathways were significantly enriched in TiO2 NPs treated silkworms, and the metabolic pathway-related genes were the most significantly enriched. The DGE results were verified by qRT-PCR analysis of eight differentially expressed genes. The DGE and qRT-PCR results were consistent for all three upregulated genes and three of the five downregulated genes, but the expression trends of the remaining two genes were different between qRT-PCR and DGE analysis. This study enhances our understanding of the mechanism of TiO2 NPs promoted silk protein synthesis.

  19. Stemness-Related Transcriptional Factors and Homing Gene Expression Profiles in Hepatic Differentiation and Cancer

    PubMed Central

    Toraih, Eman A; Fawzy, Manal S; El-Falouji, Abdullah I; Hamed, Elham O; Nemr, Nader A; Hussein, Mohammad H; Fadeal, Noha M Abd El

    2016-01-01

    Stem cell transcriptional signature activation is an essential event in the development of cancer. This study aimed to investigate the differential expression profiles of three pluripotency-associated genes, OCT4, NANOG and SOX2, G-protein-coupled chemokine receptor 4 (CXCR4) and the ligand CXCL2, and alpha-fetoprotein (AFP) in hepatogenic differentiated stem cells and in sera of hepatitis C virus (HCV) and HCV-induced hepatocellular carcinoma (HCC) patients. Mesenchymal stem cells derived from umbilical cord blood were differentiated using hepatogenic differentiation media. Serum specimens were collected from 96 patients (32 cirrhotic HCV, 32 early HCC and 32 late HCC) and 96 controls. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed for relative quantification of the six target genes using the Livak method. In silico network analysis was also executed to explore the pluripotency and tumorigenetic regulatory circuits in liver cancer. The expression levels of all genes declined gradually during the stages of stem cell differentiation. On univariate and multivariate analyses, NANOG, CXCR4 and AFP were significantly upregulated in late clinical stage HCC patients. In contrast, SOX2 and CXCL2 were markedly overexpressed in cirrhotic patients and could be used for clear demarcation between cirrhotic and HCC patients in our cases. In conclusion, our data highlight the potential role of the SOX2 stem cell marker and CXCL2 chemokine in liver cell degeneration and fibrogenesis in HCV-induced hepatic cirrhosis in our sample of the Egyptian population. In addition, the significant association of NANOG and CXCR4 high expression with late HCC could contribute to the acquisition of stem cell–like properties in hepatic cancer and dissemination in late stages, respectively. Taken together, our results could have potential application in HCC prognosis and treatment. PMID:27623812

  20. Differential Candida albicans lipase gene expression during alimentary tract colonization and infection.

    PubMed

    Schofield, David A; Westwater, Caroline; Warner, Thomas; Balish, Edward

    2005-03-15

    The human pathogenic fungus Candida albicans, which can reside as a benign commensal of the gut, possesses a large family of lipase encoding genes whose extracellular activity may be important for colonization and subsequent infection. The expression of the C. albicans lipase gene family (LIP1-10) was investigated using a mouse model of mucosal candidiasis during alimentary tract colonization (cecum contents) and orogastric infection. LIPs4-8 were expressed in nearly every sample prepared from the cecum contents and infected mucosal tissues (stomach, hard palate, esophagus and tongue) suggesting a maintenance function for these gene products. In contrast, LIPs1, 3, and 9, which were detected consistently in infected gastric tissues, were essentially undetectable in infected oral tissues. In addition, LIP2 was expressed consistently in cecum contents but was undetectable in infected oral tissues suggesting LIP2 may be important for alimentary tract colonization, but not oral infection. The host responded to a C. albicans infection by significantly increasing expression of the chemokines MIP-2 and KC at the site of infection. Therefore, differential LIP gene expression was observed during colonization, infection and at different infected mucosal sites.

  1. Screening of differentially expressed genes between multiple trauma patients with and without sepsis.

    PubMed

    Ji, S C; Pan, Y T; Lu, Q Y; Sun, Z Y; Liu, Y Z

    2014-03-17

    The purpose of this study was to identify critical genes associated with septic multiple trauma by comparing peripheral whole blood samples from multiple trauma patients with and without sepsis. A microarray data set was downloaded from the Gene Expression Omnibus (GEO) database. This data set included 70 samples, 36 from multiple trauma patients with sepsis and 34 from multiple trauma patients without sepsis (as a control set). The data were preprocessed, and differentially expressed genes (DEGs) were then screened for using packages of the R language. Functional analysis of DEGs was performed with DAVID. Interaction networks were then established for the most up- and down-regulated genes using HitPredict. Pathway-enrichment analysis was conducted for genes in the networks using WebGestalt. Fifty-eight DEGs were identified. The expression levels of PLAU (down-regulated) and MMP8 (up-regulated) presented the largest fold-changes, and interaction networks were established for these genes. Further analysis revealed that PLAT (plasminogen activator, tissue) and SERPINF2 (serpin peptidase inhibitor, clade F, member 2), which interact with PLAU, play important roles in the pathway of the component and coagulation cascade. We hypothesize that PLAU is a major regulator of the component and coagulation cascade, and down-regulation of PLAU results in dysfunction of the pathway, causing sepsis.

  2. An integrative study on the impact of highly differentially methylated genes on expression and cancer etiology

    PubMed Central

    2017-01-01

    DNA methylation is an important epigenetic phenomenon that plays a key role in the regulation of expression. Most of the studies on the topic of methylation’s role in cancer mechanisms include analyses based on differential methylation, with the integration of expression information as supporting evidence. In the present study, we sought to identify methylation-driven patterns by also integrating protein-protein interaction information. We performed integrative analyses of DNA methylation, expression, SNP and copy number data on paired samples from six different cancer types. As a result, we found that genes that show a methylation change larger than 32.2% may influence cancer-related genes via fewer interaction steps and with much higher percentages compared with genes showing a methylation change less than 32.2%. Additionally, we investigated whether there were shared cancer mechanisms among different cancer types. Specifically, five cancer types shared a change in AGTR1 and IGF1 genes, which implies that there may be similar underlying disease mechanisms among these cancers. Additionally, when the focus was placed on distinctly altered genes within each cancer type, we identified various cancer-specific genes that are also supported in the literature and may play crucial roles as therapeutic targets. Overall, our novel graph-based approach for identifying methylation-driven patterns will improve our understanding of the effects of methylation on cancer progression and lead to improved knowledge of cancer etiology. PMID:28178311

  3. Skeletal analysis and differential gene expression in Runx2/Osterix double heterozygous embryos.

    PubMed

    Baek, Ji-Eun; Choi, Je-Yong; Kim, Jung-Eun

    2014-08-29

    The transcription factors, Runx2 and Osterix (Osx), act downstream in the BMP2 pathway, and they are essential for osteoblast differentiation and bone formation. While Runx2 expression is normal in Osx-null mice, Osx is not expressed in Runx2-null mice, indicating that Osx acts downstream of Runx2 during bone formation. Runx2 and Osx are also independently regulated during bone formation. To define the unknown correlation between Runx2 and Osx in the regulation of bone formation, we analyzed the bone of Runx2/Osx double heterozygotes generated by mating heterozygous Runx2 and Osx mice and elucidated the differential gene expressions due to the lack of Runx2 and Osx in bone. Compared to the Runx2 and Osx heterozygous embryos, Runx2/Osx double heterozygous embryos showed reduced bone length in the humerus and femur as well as hypoplastic or complete absence of the maxillary and palatine shelf, presphenoid bone, zygomatic bone, and tympanic ring. Severe inward bending was observed in the ribs and humerus. Histological analysis showed an expanded region of hypertrophic chondrocytes and a reduced area of mineralized bones in the Runx2/Osx double heterozygous embryos. DNA microarray analysis of the calvaria of embryos allowed gene classification based on similarities in the upregulated and downregulated expression patterns. Clusters 1 and 2 include 68 downregulated genes and 18 upregulated genes, respectively, in the Runx2/Osx double heterozygous embryos. Finally, the skeletal analysis and gene expression profiles obtained by clustering may facilitate the understanding of the correlation between Runx2 and Osx in skeletal development.

  4. CoGA: An R Package to Identify Differentially Co-Expressed Gene Sets by Analyzing the Graph Spectra.

    PubMed

    Santos, Suzana de Siqueira; Galatro, Thais Fernanda de Almeida; Watanabe, Rodrigo Akira; Oba-Shinjo, Sueli Mieko; Nagahashi Marie, Suely Kazue; Fujita, André

    2015-01-01

    Gene set analysis aims to identify predefined sets of functionally related genes that are differentially expressed between two conditions. Although gene set analysis has been very successful, by incorporating biological knowledge about the gene sets and enhancing statistical power over gene-by-gene analyses, it does not take into account the correlation (association) structure among the genes. In this work, we present CoGA (Co-expression Graph Analyzer), an R package for the identification of groups of differentially associated genes between two phenotypes. The analysis is based on concepts of Information Theory applied to the spectral distributions of the gene co-expression graphs, such as the spectral entropy to measure the randomness of a graph structure and the Jensen-Shannon divergence to discriminate classes of graphs. The package also includes common measures to compare gene co-expression networks in terms of their structural properties, such as centrality, degree distribution, shortest path length, and clustering coefficient. Besides the structural analyses, CoGA also includes graphical interfaces for visual inspection of the networks, ranking of genes according to their "importance" in the network, and the standard differential expression analysis. We show by both simulation experiments and analyses of real data that the statistical tests performed by CoGA indeed control the rate of false positives and is able to identify differentially co-expressed genes that other methods failed.

  5. Ethylene-induced differential gene expression during abscission of citrus leaves

    PubMed Central

    Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel

    2008-01-01

    The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267

  6. Differential Gene Expression Analysis of the Epacromius coerulipes (Orthoptera: Acrididae) Transcriptome

    PubMed Central

    Jin, Yongling; Cong, Bin; Wang, Liyan; Gao, Yugang; Zhang, Haiyan; Dong, Hui; Lin, Zhiwei

    2016-01-01

    Epacromius coerulipes (Ivanov) is one of the most widely distributed locusts. To date, the main methods to kill locusts still rely on chemical controls, which can result in the selection of locusts with resistance to chemical pesticides. Butene-fipronil is a new pesticide that was discovered by the structural modification of fipronil. This pesticide has been used to control various agricultural pests and has become an important pesticide product to control pests that exhibit resistance to other pesticides, including locusts. To extend its useful half-life, studies of the initiation and progression of resistance to this pesticide are needed. Herein, two E. coerulipes strains, a pesticide-sensitive (PS) and a pesticide-resistant (PR) strain, were chosen to undergo de novo assembly by paired-end transcriptome Illumina sequencing. Overall, 63,033 unigenes were detected; the average gene length was 772 bp and the N50 was 1,589 bp. Among these unigenes, ∼25,132 (39.87% of the total) could be identified as known proteins in bioinformatic databases from national centers. A comparison of the PR and PS strains revealed that 2,568 genes were differentially expressed, including 1,646 and 922 genes that were up- and down-regulated, respectively. According to the Gene Ontology (GO) database, among biological processes the metabolic process group was the largest group (6,900 genes, 22.47%) and contained a high frequency of differentially expressed genes (544 genes, 27.54%). According to the Clusters of Orthologous Groups (COG) categories, 28 genes, representing 2.98% of all genes, belonged to the group of genes involved in the biosynthesis, transportation, and catabolism of secondary metabolites. The differentially expressed genes that we identified are involved in 50 metabolic pathways. Among these pathways, the metabolism pathway was the most represented. After enrichment analysis of differential gene expression pathways, six pathways—ribosome; starch, and sucrose

  7. Differential Gene Expression Analysis of the Epacromius coerulipes (Orthoptera: Acrididae) Transcriptome.

    PubMed

    Jin, Yongling; Cong, Bin; Wang, Liyan; Gao, Yugang; Zhang, Haiyan; Dong, Hui; Lin, Zhiwei

    2016-01-01

    Epacromius coerulipes (Ivanov) is one of the most widely distributed locusts. To date, the main methods to kill locusts still rely on chemical controls, which can result in the selection of locusts with resistance to chemical pesticides. Butene-fipronil is a new pesticide that was discovered by the structural modification of fipronil. This pesticide has been used to control various agricultural pests and has become an important pesticide product to control pests that exhibit resistance to other pesticides, including locusts. To extend its useful half-life, studies of the initiation and progression of resistance to this pesticide are needed. Herein, two E. coerulipes strains, a pesticide-sensitive (PS) and a pesticide-resistant (PR) strain, were chosen to undergo de novo assembly by paired-end transcriptome Illumina sequencing. Overall, 63,033 unigenes were detected; the average gene length was 772 bp and the N50 was 1,589 bp. Among these unigenes, ∼ 25,132 (39.87% of the total) could be identified as known proteins in bioinformatic databases from national centers. A comparison of the PR and PS strains revealed that 2,568 genes were differentially expressed, including 1,646 and 922 genes that were up- and down-regulated, respectively. According to the Gene Ontology (GO) database, among biological processes the metabolic process group was the largest group (6,900 genes, 22.47%) and contained a high frequency of differentially expressed genes (544 genes, 27.54%). According to the Clusters of Orthologous Groups (COG) categories, 28 genes, representing 2.98% of all genes, belonged to the group of genes involved in the biosynthesis, transportation, and catabolism of secondary metabolites. The differentially expressed genes that we identified are involved in 50 metabolic pathways. Among these pathways, the metabolism pathway was the most represented. After enrichment analysis of differential gene expression pathways, six pathways--ribosome; starch, and sucrose

  8. Aberrantly Expressed OTX Homeobox Genes Deregulate B-Cell Differentiation in Hodgkin Lymphoma

    PubMed Central

    Nagel, Stefan; Ehrentraut, Stefan; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G.; MacLeod, Roderick A. F.

    2015-01-01

    In Hodgkin lymphoma (HL) we recently reported that deregulated homeobox gene MSX1 mediates repression of the B-cell specific transcription factor ZHX2. In this study we investigated regulation of MSX1 in this B-cell malignancy. Accordingly, we analyzed expression and function of OTX homeobox genes which activate MSX1 transcription during embryonal development in the neural plate border region. Our data demonstrate that OTX1 and OTX2 are aberrantly expressed in both HL patients and cell lines. Moreover, both OTX loci are targeted by genomic gains in overexpressing cell lines. Comparative expression profiling and subsequent pathway modulations in HL cell lines indicated that aberrantly enhanced FGF2-signalling activates the expression of OTX2. Downstream analyses of OTX2 demonstrated transcriptional activation of genes encoding transcription factors MSX1, FOXC1 and ZHX1. Interestingly, examination of the physiological expression profile of ZHX1 in normal hematopoietic cells revealed elevated levels in T-cells and reduced expression in B-cells, indicating a discriminatory role in lymphopoiesis. Furthermore, two OTX-negative HL cell lines overexpressed ZHX1 in correlation with genomic amplification of its locus at chromosomal band 8q24, supporting the oncogenic potential of this gene in HL. Taken together, our data demonstrate that deregulated homeobox genes MSX1 and OTX2 respectively impact transcriptional inhibition of (B-cell specific) ZHX2 and activation of (T-cell specific) ZHX1. Thus, we show how reactivation of a specific embryonal gene regulatory network promotes disturbed B-cell differentiation in HL. PMID:26406991

  9. Pathways enrichment analysis for differentially expressed genes in squamous lung cancer.

    PubMed

    Qian, Liqiang; Luo, Qingquan; Zhao, Xiaojing; Huang, Jia

    2014-01-01

    Squamous lung cancer (SQLC) is a common type of lung cancer, but its oncogenesis mechanism is not so clear. The aim of this study was to screen the potential pathways changed in SQLC and elucidate the mechanism of it. Published microarray data of GSE3268 series was downloaded from Gene Expression Omnibus (GEO). Significance analysis of microarrays was performed using software R, and differentially expressed genes (DEGs) were harvested. The functions and pathways of DEGs were mapped in Gene Otology and KEGG pathway database, respectively. A total of 2961 genes were filtered as DEGs between normal and SQLC cells. Cell cycle and metabolism were the mainly changed functions of SQLC cells. Meanwhile genes such as MCM, RFC, FEN1, and POLD may induce SQLC through DNA replication pathway, and genes such as PTTG1, CCNB1, CDC6, and PCNA may be involved in SQLC through cell cycle pathway. It is demonstrated that pathway analysis is useful in the identification of target genes in SQLC.

  10. Nutritionally driven differential gene expression leads to heterochronic brain development in honeybee castes.

    PubMed

    Moda, Lívia Maria; Vieira, Joseana; Guimarães Freire, Anna Cláudia; Bonatti, Vanessa; Bomtorin, Ana Durvalina; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino

    2013-01-01

    The differential feeding regimes experienced by the queen and worker larvae of the honeybee Apis mellifera shape a complex endocrine response cascade that ultimately gives rise to differences in brain morphologies. Brain development analyzed at the morphological level from the third (L3) through fifth (L5) larval instars revealed an asynchrony between queens and workers. In the feeding phase of the last larval instar (L5F), two well-formed structures, pedunculi and calyces, are identifiable in the mushroom bodies of queens, both of which are not present in workers until a later phase (spinning phase, L5S). Genome-wide expression analyses and normalized transcript expression experiments monitoring specific genes revealed that this differential brain development starts earlier, during L3. Analyzing brains from L3 through L5S1 larvae, we identified 21 genes with caste-specific transcription patterns (e.g., APC-4, GlcAT-P, fax, kr-h1 and shot), which encode proteins that are potentially involved in the development of brain tissues through controlling the cell proliferation rate (APC4, kr-h1) and fasciculation (GlcAT-P, fax, and shot). Shot, whose expression is known to be required for axon extension and cell proliferation, was found to be transcribed at significantly higher levels in L4 queens compared with worker larvae. Moreover, the protein encoded by this gene was immunolocalized to the cytoplasm of cells near the antennal lobe neuropiles and proximal to the Kenyon cells in the brains of L4 queens. In conclusion, during the larval period, the brains of queens are larger and develop more rapidly than workers' brains, which represents a developmental heterochrony reflecting the effect of the differential feeding regime of the two castes on nervous system development. Furthermore, this differential development is characterized by caste-specific transcriptional profiles of a set of genes, thus pointing to a link between differential nutrition and differential

  11. Detection of differentially expressed genes in methylnitrosourea-induced rat mammary adenocarcinomas.

    PubMed

    Hu, L; Lin, L; Crist, K A; Kelloff, G J; Steele, V E; Lubet, R A; You, M; Wang, Y

    1997-01-01

    In this study, altered gene expression in five methylnitrosourea (MNU)-induced rat mammary adenocarcinomas was investigated using a newly developed competitive cDNA library screening assay. In order to detect the differentially expressed cDNA transcripts, three cDNA libraries (rat mammary, rat liver, and rat kidney) with over 18,000 clones were differentially screened with competing normal and neoplastic mammary cDNA probes. Ninety-eight clones indicated by competitive hybridization to be differentially expressed in tumors were verified by dot-blot hybridization analysis. Of these clones, 45 were found to be overexpressed while 53 were underexpressed in tumors. Forty-five of the confirmed clones were further analyzed by single-pass cDNA sequence determination. Four clones showed homology with cytochrome oxidase subunit I, polyoma virus PTA noncoding region, cytoplasmic beta-actin, and mouse secretory protein containing thrombospondin motifs. Further investigation into the potential roles of these identified genes should contribute significantly to our understanding of the molecular mechanism(s) of rat mammary tumorigenesis.

  12. Differential gene expression in human hepatocyte cell lines exposed to the antiretroviral agent zidovudine.

    PubMed

    Fang, Jia-Long; Han, Tao; Wu, Qiangen; Beland, Frederick A; Chang, Ching-Wei; Guo, Lei; Fuscoe, James C

    2014-03-01

    Zidovudine (3'-azido-3'-deoxythymidine; AZT) is the most widely used nucleoside reverse transcriptase inhibitor for the treatment of AIDS patients and prevention of mother-to-child transmission of HIV-1. Previously, we demonstrated that AZT had significantly greater growth inhibitory effects upon the human liver carcinoma cell line HepG2 as compared to the immortalized human liver cell line THLE2. We have now used gene expression profiling to determine the molecular pathways associated with toxicity in both cell lines. HepG2 cells were incubated with 0, 2, 20, or 100 μM AZT for 2 weeks; THLE2 cells were treated with 0, 50, 500, or 2,500 μM AZT, concentrations that were equi-toxic to those used in the HepG2 cells. After the treatment, total RNA was isolated and subjected to microarray analysis. Global analysis of gene expression, with a false discovery rate ≤0.01 and a fold change ≥1.5, indicated that 6- to 70-fold more genes were differentially expressed in a significant concentration-dependent manner in HepG2 cells when compared to THLE2 cells. Comparative analysis indicated that 7 % of these genes were common to both cell lines. Among the common differentially expressed genes, 70 % changed in the same direction, most of which were associated with cell death and survival, cell cycle, cell growth and proliferation, and DNA replication, recombination, and repair. As determined by the uptake of [methyl-(3)H]AZT, the intracellular levels of total AZT were approximately twofold higher in THLE2 cells than in HepG2 cells. The expression of thymidine kinase 1 (TK1) and UDP-glucuronosyltransferase 2B7 (UGT2B7) genes that regulate the metabolic activation and deactivation of AZT, respectively, was increased in HepG2 cells but decreased in THLE2 cells after treatment with AZT. This differential response in AZT metabolism was confirmed by real-time PCR, western blotting, and/or enzymatic assays. These data indicate that molecular pathways involved with cell death and

  13. Screening and identification of distant metastasis-related differentially expressed genes in human squamous cell lung carcinoma.

    PubMed

    Wang, Na; Zhou, Fachen; Xiong, Hai; Du, Sha; Ma, Jianwei; Okai, Issac; Wang, Jian; Suo, Jing; Hao, Lihong; Song, Yang; Hu, Jun; Shao, Shujuan

    2012-05-01

    Distant metastasis is one of the leading causes of lung cancer death. Detecting the early-stage molecular alternations in primary tumors, such as gene expression differences, provides a "prognostic" value to the precaution of tumor metastasis. The aim of this article is to screen and identify the metastasis-related genes in human squamous cell lung carcinoma. Primary tumor tissues of nine patients with subsequent metastasis and eight patients without metastasis were selected to perform the gene microarray experiment. GO and pathway analyses were used to determine the differentially expressed genes. Two identified genes were further validated by real-time quantitative reverse transcription polymerase chain reaction (PCR) (real-time qRT-PCR). Two hundred and thirty-eight differentially expressed genes were detected in gene chip experiment, including 51 up-regulated genes and 187 down-regulated genes. These genes were involved in several cellular processes, including cell adhesion, cell cycle regulation, and apoptosis. GO analysis showed that the differentially expressed genes participated in a wide ranging of metastasis-related processes, including extracellular region and regulation of liquid surface tension. In addition, pathway analysis demonstrated that the differentially expressed genes were enriched in pathways related to cell cycle and Wnt signaling. Real-time qRT-PCR validation experiment of LCN2 and PDZK1IP1 showed a consistent up-regulation in the metastasis group. The metastasis of human squamous cell lung carcinoma is a complex process that is regulated by multiple gene alternations on the expression levels. The 238 differentially expressed genes identified in this study presumably contain a core set of genes involved in tumor metastasis. The real-time qRT-PCR results of PDZK1IP1 and LCN2 validated the reliability of this gene microarray experiment.

  14. Differentially Expressed Genes during Contrasting Growth Stages of Artemisia annua for Artemisinin Content

    PubMed Central

    Nair, Priya; Misra, Amita; Singh, Alka; Shukla, Ashutosh K.; Gupta, Madan M.; Gupta, Anil K.; Gupta, Vikrant; Khanuja, Suman P. S.; Shasany, Ajit K.

    2013-01-01

    Artemisia annua is the source of antimalarial phytomolecule, artemisinin. It is mainly produced and stored in the glandular secretory trichomes present in the leaves of the plant. Since, the artemisinin biosynthesis steps are yet to be worked out, in this investigation a microarray chip was strategized for the first time to shortlist the differentially expressing genes at a stage of plant producing highest artemisinin compared to the stage with no artemisinin. As the target of this study was to analyze differential gene expression associated with contrasting artemisinin content in planta and a genotype having zero/negligible artemisinin content was unavailable, it was decided to compare different stages of the same genotype with contrasting artemisinin content (seedling - negligible artemisinin, mature leaf - high artemisinin). The SCAR-marked artemisinin-rich (∼1.2%) Indian variety ‘CIM-Arogya’ was used in the present study to determine optimal plant stage and leaf ontogenic level for artemisinin content. A representative EST dataset from leaf trichome at the stage of maximal artemisinin biosynthesis was established. The high utility small scale custom microarray chip of A. annua containing all the significant artemisinin biosynthesis-related genes, the established EST dataset, gene sequences isolated in-house and strategically selected candidates from the A. annua Unigene database (NCBI) was employed to compare the gene expression profiles of two stages. The expression data was validated through semiquantitative and quantitative RT-PCR followed by putative annotations through bioinformatics-based approaches. Many candidates having probable role in artemisinin metabolism were identified and described with scope for further functional characterization. PMID:23573249

  15. Concentration-dependent gene expression responses to flusilazole in embryonic stem cell differentiation cultures

    SciTech Connect

    Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Fonteyne, Liset J.J. de la; Brauers, Karen J.J.; Claessen, Sandra; Delft, Joost H. van; Kleinjans, Jos C.S.; Piersma, Aldert H.

    2011-03-01

    The murine embryonic stem cell test (EST) is designed to evaluate developmental toxicity based on compound-induced inhibition of embryonic stem cell (ESC) differentiation into cardiomyocytes. The addition of transcriptomic evaluation within the EST may result in enhanced predictability and improved characterization of the applicability domain, therefore improving usage of the EST for regulatory testing strategies. Transcriptomic analyses assessing factors critical for risk assessment (i.e. dose) are needed to determine the value of transcriptomic evaluation in the EST. Here, using the developmentally toxic compound, flusilazole, we investigated the effect of compound concentration on gene expression regulation and toxicity prediction in ESC differentiation cultures. Cultures were exposed for 24 h to multiple concentrations of flusilazole (0.54-54 {mu}M) and RNA was isolated. In addition, we sampled control cultures 0, 24, and 48 h to evaluate the transcriptomic status of the cultures across differentiation. Transcriptomic profiling identified a higher sensitivity of development-related processes as compared to cell division-related processes in flusilazole-exposed differentiation cultures. Furthermore, the sterol synthesis-related mode of action of flusilazole toxicity was detected. Principal component analysis using gene sets related to normal ESC differentiation was used to describe the dynamics of ESC differentiation, defined as the 'differentiation track'. The concentration-dependent effects on development were reflected in the significance of deviation of flusilazole-exposed cultures from this transcriptomic-based differentiation track. Thus, the detection of developmental toxicity in EST using transcriptomics was shown to be compound concentration-dependent. This study provides further insight into the possible application of transcriptomics in the EST as an improved alternative model system for developmental toxicity testing.

  16. Differential gene expression in notochord and nerve cord fate segregation in the Ciona intestinalis embryo.

    PubMed

    Kobayashi, Kenji; Yamada, Lixy; Satou, Yutaka; Satoh, Nori

    2013-09-01

    During early embryogenesis, embryonic cells gradually restrict their developmental potential and are eventually destined to give rise to one type of cells. Molecular mechanisms underlying developmental fate restriction are one of the major research subjects within developmental biology. In this article, this subject was addressed by combining blastomere isolation with microarray analysis. During the 6th cleavage of the Ciona intestinalis embryo, from the 32-cell to the 64-cell stage, four mother cells divide into daughter cells with two distinct fates, one giving rise to notochord precursor cells and the other to nerve cord precursors. Approximately 2,200 each of notochord and nerve cord precursor cells were isolated, and their mRNA expression profiles were compared by microarray. This analysis identified 106 and 68 genes, respectively, that are differentially expressed in notochord and nerve cord precursor cells. These included not only genes for transcription factors and signaling molecules but also those with generalized functions observed in many types of cells. In addition, whole-mount in situ hybridization showed dynamic spatial expression profiles of these genes during segregation of the two fates: partitioning of transcripts present in the mother cells into either type of daughter cells, and initiation of preferential gene expression in either type of cells.

  17. Spatial differentiation of gene expression in Aspergillus niger colony grown for sugar beet pulp utilization

    PubMed Central

    Benoit, Isabelle; Zhou, Miaomiao; Vivas Duarte, Alexandra; Downes, Damien J.; Todd, Richard B.; Kloezen, Wendy; Post, Harm; Heck, Albert J. R.; Maarten Altelaar, A. F.; de Vries, Ronald P.

    2015-01-01

    Degradation of plant biomass to fermentable sugars is of critical importance for the use of plant materials for biofuels. Filamentous fungi are ubiquitous organisms and major plant biomass degraders. Single colonies of some fungal species can colonize massive areas as large as five soccer stadia. During growth, the mycelium encounters heterogeneous carbon sources. Here we assessed whether substrate heterogeneity is a major determinant of spatial gene expression in colonies of Aspergillus niger. We analyzed whole-genome gene expression in five concentric zones of 5-day-old colonies utilizing sugar beet pulp as a complex carbon source. Growth, protein production and secretion occurred throughout the colony. Genes involved in carbon catabolism were expressed uniformly from the centre to the periphery whereas genes encoding plant biomass degrading enzymes and nitrate utilization were expressed differentially across the colony. A combined adaptive response of carbon-catabolism and enzyme production to locally available monosaccharides was observed. Finally, our results demonstrate that A. niger employs different enzymatic tools to adapt its metabolism as it colonizes complex environments. PMID:26314379

  18. Spatial differentiation of gene expression in Aspergillus niger colony grown for sugar beet pulp utilization.

    PubMed

    Benoit, Isabelle; Zhou, Miaomiao; Vivas Duarte, Alexandra; Downes, Damien J; Todd, Richard B; Kloezen, Wendy; Post, Harm; Heck, Albert J R; Maarten Altelaar, A F; de Vries, Ronald P

    2015-08-28

    Degradation of plant biomass to fermentable sugars is of critical importance for the use of plant materials for biofuels. Filamentous fungi are ubiquitous organisms and major plant biomass degraders. Single colonies of some fungal species can colonize massive areas as large as five soccer stadia. During growth, the mycelium encounters heterogeneous carbon sources. Here we assessed whether substrate heterogeneity is a major determinant of spatial gene expression in colonies of Aspergillus niger. We analyzed whole-genome gene expression in five concentric zones of 5-day-old colonies utilizing sugar beet pulp as a complex carbon source. Growth, protein production and secretion occurred throughout the colony. Genes involved in carbon catabolism were expressed uniformly from the centre to the periphery whereas genes encoding plant biomass degrading enzymes and nitrate utilization were expressed differentially across the colony. A combined adaptive response of carbon-catabolism and enzyme production to locally available monosaccharides was observed. Finally, our results demonstrate that A. niger employs different enzymatic tools to adapt its metabolism as it colonizes complex environments.

  19. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  20. Differential expression and alternative splicing of cell cycle genes in imatinib-treated K562 cells.

    PubMed

    Liu, Jing; Lin, Jin; Huang, Lin-Feng; Huang, Bo; Xu, Yan-Mei; Li, Jing; Wang, Yan; Zhang, Jing; Yang, Wei-Ming; Min, Qing-Hua; Wang, Xiao-Zhong

    2015-09-01

    Cancer progression often involves the disorder of the cell cycle, and a number of effective chemotherapeutic drugs have been shown to induce cell cycle arrest. The purpose of this study was to comprehensively investigate the effects of imatinib on the expression profile of cell cycle genes in the chronic myeloid leukemia (CML) K562 cell line. In addition, we also investigated alternative splicing of the cell cycle genes affected by imatinib, since an important relationship has been shown to exist between RNA splicing and cell cycle progression. Exon array analysis was performed using total RNA purified from normal and imatinib-treated K562 cells. We identified 185 differentially expressed genes and 277 alternative splicing events between the two cell groups. A detailed analysis by reverse transcription-PCR (RT-PCR) of key genes confirmed the experimental results of the exon array. These results suggested that treatment of K562 cells with imatinib shifts the expression and alternative splicing profiles of several cell cycle-related genes. Importantly, these findings may help improve imatinib treatment strategies in patients with CML and may be useful for imatinib resistance research and CML drug development.

  1. Identification of Differentially Expressed Genes Associated with Apple Fruit Ripening and Softening by Suppression Subtractive Hybridization.

    PubMed

    Zhang, Zongying; Jiang, Shenghui; Wang, Nan; Li, Min; Ji, Xiaohao; Sun, Shasha; Liu, Jingxuan; Wang, Deyun; Xu, Haifeng; Qi, Sumin; Wu, Shujing; Fei, Zhangjun; Feng, Shouqian; Chen, Xuesen

    2015-01-01

    Apple is one of the most economically important horticultural fruit crops worldwide. It is critical to gain insights into fruit ripening and softening to improve apple fruit quality and extend shelf life. In this study, forward and reverse suppression subtractive hybridization libraries were generated from 'Taishanzaoxia' apple fruits sampled around the ethylene climacteric to isolate ripening- and softening-related genes. A set of 648 unigenes were derived from sequence alignment and cluster assembly of 918 expressed sequence tags. According to gene ontology functional classification, 390 out of 443 unigenes (88%) were assigned to the biological process category, 356 unigenes (80%) were classified in the molecular function category, and 381 unigenes (86%) were allocated to the cellular component category. A total of 26 unigenes differentially expressed during fruit development period were analyzed by quantitative RT-PCR. These genes were involved in cell wall modification, anthocyanin biosynthesis, aroma production, stress response, metabolism, transcription, or were non-annotated. Some genes associated with cell wall modification, anthocyanin biosynthesis and aroma production were up-regulated and significantly correlated with ethylene production, suggesting that fruit texture, coloration and aroma may be regulated by ethylene in 'Taishanzaoxia'. Some of the identified unigenes associated with fruit ripening and softening have not been characterized in public databases. The results contribute to an improved characterization of changes in gene expression during apple fruit ripening and softening.

  2. Identification of Differentially Expressed Genes Associated with Apple Fruit Ripening and Softening by Suppression Subtractive Hybridization

    PubMed Central

    Zhang, Zongying; Jiang, Shenghui; Wang, Nan; Li, Min; Ji, Xiaohao; Sun, Shasha; Liu, Jingxuan; Wang, Deyun; Xu, Haifeng; Qi, Sumin; Wu, Shujing; Fei, Zhangjun; Feng, Shouqian; Chen, Xuesen

    2015-01-01

    Apple is one of the most economically important horticultural fruit crops worldwide. It is critical to gain insights into fruit ripening and softening to improve apple fruit quality and extend shelf life. In this study, forward and reverse suppression subtractive hybridization libraries were generated from ‘Taishanzaoxia’ apple fruits sampled around the ethylene climacteric to isolate ripening- and softening-related genes. A set of 648 unigenes were derived from sequence alignment and cluster assembly of 918 expressed sequence tags. According to gene ontology functional classification, 390 out of 443 unigenes (88%) were assigned to the biological process category, 356 unigenes (80%) were classified in the molecular function category, and 381 unigenes (86%) were allocated to the cellular component category. A total of 26 unigenes differentially expressed during fruit development period were analyzed by quantitative RT-PCR. These genes were involved in cell wall modification, anthocyanin biosynthesis, aroma production, stress response, metabolism, transcription, or were non-annotated. Some genes associated with cell wall modification, anthocyanin biosynthesis and aroma production were up-regulated and significantly correlated with ethylene production, suggesting that fruit texture, coloration and aroma may be regulated by ethylene in ‘Taishanzaoxia’. Some of the identified unigenes associated with fruit ripening and softening have not been characterized in public databases. The results contribute to an improved characterization of changes in gene expression during apple fruit ripening and softening. PMID:26719904

  3. A MyoD-generated feed-forward circuit temporally patterns gene expression during skeletal muscle differentiation

    PubMed Central

    Penn, Bennett H.; Bergstrom, Donald A.; Dilworth, F. Jeffrey; Bengal, Eyal; Tapscott, Stephen J.

    2004-01-01

    The development and differentiation of distinct cell types is achieved through the sequential expression of subsets of genes; yet, the molecular mechanisms that temporally pattern gene expression remain largely unknown. In skeletal myogenesis, gene expression is initiated by MyoD and includes the expression of specific Mef2 isoforms and activation of the p38 mitogen-activated protein kinase (MAPK) pathway. Here, we show that p38 activity facilitates MyoD and Mef2 binding at a subset of late-activated promoters, and the binding of Mef2D recruits Pol II. Most importantly, expression of late-activated genes can be shifted to the early stages of differentiation by precocious activation of p38 and expression of Mef2D, demonstrating that a MyoD-mediated feed-forward circuit temporally patterns gene expression. PMID:15466486

  4. Whole-transcriptome sequence analysis of differentially expressed genes in Phormium tenax under drought stress

    PubMed Central

    Bai, Zhen-yu; Wang, Tong; Wu, Yin-huan; Wang, Ke; Liang, Qian-yu; Pan, Yuan-zhi; Jiang, Bei-bei; Zhang, Lei; Liu, Guang-li; Jia, Yin; Liu, Qing-lin

    2017-01-01

    Phormium tenax is a kind of drought resistant garden plant with its rich and colorful leaves. To clarify the molecular mechanism of drought resistance in Phormium tenax, transcriptome was sequenced by the Illumina sequencing technology under normal and drought stress, respectively. A large number of contigs, transcripts and unigenes were obtained. Among them, only 30,814 unigenes were annotated by comparing with the protein databases. A total of 4,380 genes were differentially expressed, 2,698 of which were finally annotated under drought stress. Differentially expression analysis was also performed upon drought treatment. In KEGG pathway, the mechanism of drought resistance in Phormium tenax was explained from three aspects of metabolism and signaling of hormones, osmotic adjustment and reactive oxygen species metabolism. These results are helpful to understand the drought tolerance mechanism of Phormium tenax and will provide a precious genetic resource for drought-resistant vegetation breeding and research. PMID:28134322

  5. Murine bone cell lines as models for spaceflight induced effects on differentiation and gene expression

    NASA Astrophysics Data System (ADS)

    Lau, P.; Hellweg, C. E.; Baumstark-Khan, C.; Reitz, G.

    Critical health factors for space crews especially on long-term missions are radiation exposure and the absence of gravity DNA double strand breaks DSB are presumed to be the most deleterious DNA lesions after radiation as they disrupt both DNA strands in close proximity Besides radiation risk the absence of gravity influences the complex skeletal apparatus concerning muscle and especially bone remodelling which results from mechanical forces exerting on the body Bone is a dynamic tissue which is life-long remodelled by cells from the osteoblast and osteoclast lineage Any imbalance of this system leads to pathological conditions such as osteoporosis or osteopetrosis Osteoblastic cells play a crucial role in bone matrix synthesis and differentiate either into bone-lining cells or into osteocytes Premature terminal differentiation has been reported to be induced by a number of DNA damaging or cell stress inducing agents including ionising and ultraviolet radiation as well as treatment with mitomycin C In the present study we compare the effects of sequential differentiation by adding osteoinductive substances ss -glycerophosphate and ascorbic acid Radiation-induced premature differentiation was investigated regarding the biosynthesis of specific osteogenic marker molecules and the differentiation dependent expression of marker genes The bone cell model established in our laboratory consists of the osteocyte cell line MLO-Y4 the osteoblast cell line OCT-1 and the subclones 4 and 24 of the osteoblast cell line MC3T3-E1 expressing several

  6. Screening and identification of differentially expressed genes in goose hepatocytes exposed to free fatty acid.

    PubMed

    Pan, Zhixiong; Wang, Jiwen; Kang, Bo; Lu, Lizhi; Han, Chunchun; Tang, Hui; Li, Liang; Xu, Feng; Zhou, Zehui; Lv, Jia

    2010-12-15

    The overaccumulation of triglycerides in hepatocytes induces hepatic steatosis; however, little is known about the mechanism of goose hepatic steatosis. The aim of this study was to define an experimental model of hepatocellular steatosis with TG overaccumulation and minimal cytotoxicity, using a mixture of various proportions of oleate and palmitate free fatty acids (FFAs) to induce fat-overloading, then using suppressive subtractive hybridization and a quantitative PCR approach to identify genes with higher or lower expression levels after the treatment of cells with FFA mixtures. Overall, 502 differentially expressed clones, representing 21 novel genes and 87 known genes, were detected by SSH. Based on functional clustering, up- and down-regulated genes were mostly related to carbohydrate and lipid metabolism, enzyme activity and signal transduction. The expression of 20 selected clones involved with carbohydrate and lipid metabolism pathways was further studied by quantitative PCR. The data indicated that six clones similar to the genes ChREBP, FoxO1, apoB, IHPK2, KIF1B, and FSP27, which participate in de novo synthesis of fatty acid and secretion of very low density lipoproteins, had significantly lower expression levels in the hepatocytes treated with FFA mixtures. Meanwhile, 13 clones similar to the genes DGAT-1, ACSL1, DHRS7, PPARα, L-FABP, DGAT-2, PCK, ACSL3, CPT-1, A-FABP, PPARβ, MAT, and ALDOB had significantly higher expression levels in the hepatocytes treated with FFA mixtures. These results suggest that several metabolic pathways are altered in goose hepatocytes, which may be useful for further research into the molecular mechanism of goose hepatic steatosis.

  7. Temperature increase prevails over acidification in gene expression modulation of amastigote differentiation in Leishmania infantum

    PubMed Central

    2010-01-01

    Background The extracellular promastigote and the intracellular amastigote stages alternate in the digenetic life cycle of the trypanosomatid parasite Leishmania. Amastigotes develop inside parasitophorous vacuoles of mammalian phagocytes, where they tolerate extreme environmental conditions. Temperature increase and pH decrease are crucial factors in the multifactorial differentiation process of promastigotes to amastigotes. Although expression profiling approaches for axenic, cell culture- and lesion-derived amastigotes have already been reported, the specific influence of temperature increase and acidification of the environment on developmental regulation of genes has not been previously studied. For the first time, we have used custom L. infantum genomic DNA microarrays to compare the isolated and the combined effects of both factors on the transcriptome. Results Immunofluorescence analysis of promastigote-specific glycoprotein gp46 and expression modulation analysis of the amastigote-specific A2 gene have revealed that concomitant exposure to temperature increase and acidification leads to amastigote-like forms. The temperature-induced gene expression profile in the absence of pH variation resembles the profile obtained under combined exposure to both factors unlike that obtained for exposure to acidification alone. In fact, the subsequent fold change-based global iterative hierarchical clustering analysis supports these findings. Conclusions The specific influence of temperature and pH on the differential regulation of genes described in this study and the evidence provided by clustering analysis is consistent with the predominant role of temperature increase over extracellular pH decrease in the amastigote differentiation process, which provides new insights into Leishmania physiology. PMID:20074347

  8. Gene expression in breast muscle associated with feed efficiency in a single male broiler line using a chicken 44K oligo microarray. I. Top differentially expressed genes.

    PubMed

    Kong, B-W; Song, J J; Lee, J Y; Hargis, B M; Wing, T; Lassiter, K; Bottje, W

    2011-11-01

    Global RNA expression in breast muscle obtained from a male broiler line phenotyped for high or low feed efficiency (FE) was investigated. Pooled RNA samples (n = 6/phenotype) labeled with cyanine 3 or cyanine 5 fluorescent dyes to generate cRNA probes were hybridized on a 4 × 44K chicken oligo microarray. Local polynomial regression normalization was applied to background-corrected red and green intensities with a moderated t-statistic. Corresponding P-values were computed and adjusted for multiple testing by false discovery rate to identify differentially expressed genes. Microarray validation was carried out by comparing findings with quantitative reverse-transcription PCR. A 1.3-fold difference in gene expression was set as a cutoff value, which encompassed 20% (782 of 4,011) of the total number of genes that were differentially expressed between FE phenotypes. Using an online software program (Ingenuity Pathway Analysis), the top 10 upregulated genes identified by Ingenuity Pathway Analysis in the high-FE group were generally associated with anabolic processes. In contrast, 7 of the top 10 downregulated genes in the high-FE phenotype (upregulated in the low-FE phenotype) were associated with muscle fiber development, muscle function, and cytoskeletal organization, with the remaining 3 genes associated with self-recognition or stress-responding genes. The results from this study focusing on only the top differentially expressed genes suggest that the high-FE broiler phenotype is derived from the upregulation of genes associated with anabolic processes as well as a downregulation of genes associated with muscle fiber development, muscle function, cytoskeletal organization, and stress response.

  9. Differential gene expression profiling of mouse uterine luminal epithelium during periimplantation.

    PubMed

    Xiao, Shuo; Diao, Honglu; Zhao, Fei; Li, Rong; He, Naya; Ye, Xiaoqin

    2014-03-01

    Uterine luminal epithelium (LE) is critical for establishing uterine receptivity. Microarray analysis of gestation day 3.5 (D3.5, preimplantation) and D4.5 (postimplantation) LE from natural pregnant mice identified 382 upregulated and 245 downregulated genes in the D4.5 LE. Gene Ontology annotation grouped 186 upregulated and 103 downregulated genes into 22 and 15 enriched subcategories, respectively, in regulating DNA-dependent transcription, metabolism, cell morphology, ion transport, immune response, apoptosis, signal transduction, and so on. Signaling pathway analysis revealed 99 genes in 21 significantly changed signaling pathways, with 14 of these pathways involved in metabolism. In situ hybridization confirmed the temporal expression of 12 previously uncharacterized genes, including Atp6v0a4, Atp6v0d2, F3, Ggh, Tmprss11d, Tmprss13, Anpep, Fxyd4, Naip5, Npl, Nudt19, and Tpm1 in the periimplantation uterus. This study provides a comprehensive picture of the differentially expressed genes in the periimplantation LE to help understand the molecular mechanism of LE transformation upon establishment of uterine receptivity.

  10. Analysis of genes that are differentially expressed during the Sclerotinia sclerotiorum–Phaseolus vulgaris interaction

    PubMed Central

    Oliveira, Marília B.; de Andrade, Rosângela V.; Grossi-de-Sá, Maria F.; Petrofeza, Silvana

    2015-01-01

    The fungus Sclerotinia sclerotiorum (Lib.) de Bary, one of the most important plant pathogens, causes white mold on a wide range of crops. Crop yield can be dramatically decreased due to this disease, depending on the plant cultivar and environmental conditions. In this study, a suppression subtractive hybridization cDNA library approach was used for the identification of pathogen and plant genes that were differentially expressed during infection of the susceptible cultivar BRS Pérola of Phaseolus vulgaris L. A total of 979 unigenes (430 contigs and 549 singletons) were obtained and classified according to their functional categories. The transcriptional profile of 11 fungal genes related to pathogenicity and virulence were evaluated by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Additionally, the temporal expression profile obtained by RT-qPCR was evaluated for the following categories of plant defense-related genes: pathogenesis-related genes (PvPR1, PvPR2, and PvPR3), phenylpropanoid pathway genes (PvIsof, PvFPS1, and 4CL), and genes involved in defense and stress-related categories (PvLox, PvHiprp, PvGST, PvPod, and PvDox). Data obtained in this study provide a starting point for achieving a better understanding of the pathosystem S. sclerotiorum–P. vulgaris. PMID:26579080

  11. Differential expression of genes identified by suppression subtractive hybridization in petals of opening carnation flowers.

    PubMed

    Harada, Taro; Torii, Yuka; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2010-05-01

    Flower opening is an event accompanied by morphological changes in petals which include elongation, expansion, and outward-curving. Petal cell growth is a fundamental process that underlies such phenomena, but its molecular mechanism remains largely unknown. Suppression subtractive hybridization was performed between petals during the early elongation period (stage 1) and during the opening period (stage 5) in carnation flowers and a pair of subtraction libraries abundant in differentially expressed genes was constructed at each stage. 393 cDNA clones picked up by differential screening out of 1728 clones were sequenced and 235 different cDNA fragments were identified, among which 211 did not match any known nucleotide sequence of carnation genes in the databases. BLASTX search of nucleotide sequences revealed that putative functions of the translational products can be classified into several categories including transcription, signalling, cell wall modification, lipid metabolism, and transport. Open reading frames of 15 selected genes were successfully determined by rapid amplification of cDNA ends (RACE). Time-course analysis of these genes by real-time RT-PCR showed that transcript levels of several genes correlatively fluctuate in petals of opening carnation flowers, suggesting an association with the morphological changes by elongation or curving. Based on the results, it is suggested that the growth of carnation petals is controlled by co-ordinated gene expression during the progress of flower opening. In addition, the possible roles of some key genes in the initiation of cell growth, the construction of the cell wall and cuticle, and transport across membranes were discussed.

  12. Exploring Differentially Expressed Genes and Natural Antisense Transcripts in Sheep (Ovis aries) Skin with Different Wool Fiber Diameters by Digital Gene Expression Profiling.

    PubMed

    Yue, Yaojing; Guo, Tingting; Liu, Jianbin; Guo, Jian; Yuan, Chao; Feng, Ruilin; Niu, Chune; Sun, Xiaoping; Yang, Bohui

    2015-01-01

    Wool fiber diameter (WFD) is the most important economic trait of wool. However, the genes specifically controlling WFD remain elusive. In this study, the expression profiles of skin from two groups of Gansu Alpine merino sheep with different WFD (a super-fine wool group [FD = 18.0 ± 0.5 μm, n=3] and a fine wool group [FD=23.0 ± 0.5 μm, n=3]) were analyzed using next-generation sequencing-based digital gene expression profiling. A total of 40 significant differentially expressed genes (DEGs) were detected, including 9 up-regulated genes and 31 down-regulated genes. Further expression profile analysis of natural antisense transcripts (NATs) showed that more than 30% of the genes presented in sheep skin expression profiles had NATs. A total of 7 NATs with significant differential expression were detected, and all were down-regulated. Among of 40 DEGs, 3 DEGs (AQP8, Bos d2, and SPRR) had significant NATs which were all significantly down-regulated in the super-fine wool group. In total of DEGs and NATs were summarized as 3 main GO categories and 38 subcategories. Among the molecular functions, cellular components and biological processes categories, binding, cell part and metabolic process were the most dominant subcategories, respectively. However, no significant enrichment of GO terms was found (corrected P-value >0.05). The pathways that were significantly enriched with significant DEGs and NATs were mainly the lipoic acid metabolism, bile secretion, salivary secretion and ribosome and phenylalanine metabolism pathways (P < 0.05). The results indicated that expression of NATs and gene transcripts were correlated, suggesting a role in gene regulation. The discovery of these DEGs and NATs could facilitate enhanced selection for super-fine wool sheep through gene-assisted selection or targeted gene manipulation in the future.

  13. Despite differential gene expression profiles pediatric MDS derived mesenchymal stromal cells display functionality in vitro.

    PubMed

    Calkoen, F G J; Vervat, C; van Pel, M; de Haas, V; Vijfhuizen, L S; Eising, E; Kroes, W G M; 't Hoen, P A C; van den Heuvel-Eibrink, M M; Egeler, R M; van Tol, M J D; Ball, L M

    2015-03-01

    Pediatric myelodysplastic syndrome (MDS) is a heterogeneous disease covering a spectrum ranging from aplasia (RCC) to myeloproliferation (RAEB(t)). In adult-type MDS there is increasing evidence for abnormal function of the bone-marrow microenvironment. Here, we extensively studied the mesenchymal stromal cells (MSCs) derived from children with MDS. MSCs were expanded from the bone-marrow of 17 MDS patients (RCC: n=10 and advanced MDS: n=7) and pediatric controls (n=10). No differences were observed with respect to phenotype, differentiation capacity, immunomodulatory capacity or hematopoietic support. mRNA expression analysis by Deep-SAGE revealed increased IL-6 expression in RCC- and RAEB(t)-MDS. RCC-MDS MSC expressed increased levels of DKK3, a protein associated with decreased apoptosis. RAEB(t)-MDS revealed increased CRLF1 and decreased DAPK1 expressions. This pattern has been associated with transformation in hematopoietic malignancies. Genes reported to be differentially expressed in adult MDS-MSC did not differ between MSC of pediatric MDS and controls. An altered mRNA expression profile, associated with cell survival and malignant transformation, of MSC derived from children with MDS strengthens the hypothesis that the micro-environment is of importance in this disease. Our data support the understanding that pediatric and adult MDS are two different diseases. Further evaluation of the pathways involved might reveal additional therapy targets.

  14. Identification of genes differentially expressed by prematurely fused human sutures using a novel in vivo - in vitro approach.

    PubMed

    Coussens, Anna K; Hughes, Ian P; Wilkinson, Christopher R; Morris, C Phillip; Anderson, Peter J; Powell, Barry C; van Daal, Angela

    2008-05-01

    Craniosynostosis is the premature fusion of calvarial sutures. It results from abnormal differentiation or proliferation of cells within the osteogenic fronts of growing calvarial bones. To date, research has focused on animal models and in vitro organ and tissue culture to determine the molecular mechanisms controlling calvarial suture morphogenesis. Here, we test a new, in vivo-in vitro approach based on the hypothesis that calvarial suture cells passaged in minimal medium exhibit a stable gene expression profile similar to undifferentiated osteoblastic cells that can provide a benchmark for comparison with in vivo expression of differentiated tissue. We show that tissue-specific expression is lost after the first passage and, using cDNA microarrays, compare expression between fused suture tissue from craniosynostosis patients and in vitro de-differentiated explant cells. A large number of differentially expressed genes were identified, including novel genes WIF1, LEF1, SATB2, RARRES1, DEFA1, DMP1, PTPRZ1, and PTPRC, as well as those commonly associated with human suture morphogenesis, e.g., FGF2, MSX2, and BMP2. Two differentially expressed genes, WIF1 and FGF2, were further examined in an in vivo-in vivo comparison between unfused and prematurely fused tissue. The same pattern of differential expression was observed in each case, further validating the ability of our in vivo-in vitro approach to identify genes involved in in vivo human calvarial tissue differentiation.

  15. Molecular mechanisms underlying the differential expression of maize pyruvate, orthophosphate dikinase genes.

    PubMed Central

    Sheen, J

    1991-01-01

    I describe here the organization of maize C4 chloroplast and non-C4 cytosolic pyruvate, orthophosphate dikinase (PPDK) genes and the molecular mechanisms underlying their differential expression. The maize C4 chloroplast PPDK gene (C4ppdkZm1) appears to have been created by the addition of an exon encoding the chloroplast transit peptide at a site upstream of a cytosolic PPDK gene (cyppdkZm1). A splice acceptor sequence located in the first exon of cyppdkZm1 allows the fusion of the transit peptide to the cyppdkZm1 sequences. A second cyPPDK gene (cyppdkZm2) shares extensive homology with cyppdkZm1 in the coding region and in the 5' flanking region up to the TATA box. By a novel protoplast transient expression method, I show that the light-inducible expression of C4ppdkZm1 is controlled by two expression programs mediated through separate upstream regulatory elements that are active in leaf, but inactive in root and stem. Light-mediated C4ppdkZm1 expression in maize is apparently uncoupled from leaf development and partially associated with chloroplast development. For cyppdkZm1 expression, distinct upstream elements and a specific TATA promoter element, located in the first intron of C4ppdkZm1, are required. The low expression of cyppdkZm2 can be attributed to an absence of upstream positive elements and weak activity of the TATA promoter element. PMID:1668653

  16. Differential timing of gene expression regulation between leptocephali of the two Anguilla eel species in the Sargasso Sea.

    PubMed

    Bernatchez, Louis; St-Cyr, Jérôme; Normandeau, Eric; Maes, Gregory E; Als, Thomas D; Kalujnaia, Svetlana; Cramb, Gordon; Castonguay, Martin; Hansen, Michael M

    2011-12-01

    The unique life-history characteristics of North Atlantic catadromous eels have long intrigued evolutionary biologists, especially with respect to mechanisms that could explain their persistence as two ecologically very similar but reproductively and geographically distinct species. Differential developmental schedules during young larval stages have commonly been hypothesized to represent such a key mechanism. We performed a comparative analysis of gene expression by means of microarray experiments with American and European eel leptocephali collected in the Sargasso Sea in order to test the alternative hypotheses of (1) differential timing of gene expression regulation during early development versus (2) species-specific differences in expression of particular genes. Our results provide much stronger support for the former hypothesis since no gene showed consistent significant differences in expression levels between the two species. In contrast, 146 genes showed differential timings of expression between species, although the observed expression level differences between the species were generally small. Consequently, species-specific gene expression regulation seems to play a minor role in species differentiation. Overall, these results show that the basis of the early developmental divergence between the American and European eel is probably influenced by differences in the timing of gene expression regulation for genes involved in a large array of biological functions.

  17. Genes specifically expressed in sexually differentiated female spheroids of Volvox carteri.

    PubMed

    Aono, Naoki; Inoue, Tan; Shiraishi, Hideaki

    2005-10-01

    Volvox carteri is a multicellular green alga with only two cell types, somatic cells and reproductive cells. Phylogenetic analysis suggests that this organism has evolved from a Chlamydomonas-like unicellular ancestor along with multicellularity, cellular differentiation, and a change in the mode of sexual reproduction from isogamy to oogamy. To examine the mechanism of sexual differentiation and the evolution of oogamy, we isolated 6 different cDNA sequences specifically expressed in sexually differentiated female spheroids. The genes for the cDNAs were designated SEF1 to SEF6. The time course of accumulation of each mRNA was shown to be distinct. The expression of some of these genes was not significantly affected when the sexual inducer was removed after the induction of sexual development. Sequence analysis indicates that SEF5 and SEF6 encode pherophorin-related proteins. Of these, SEF5 has the unique structural feature of a polyproline stretch in the C-terminal domain in addition to the one found in the central region.

  18. Differential gene expression pattern in biopsies with renal allograft pyelonephritis and allograft rejection

    PubMed Central

    Oghumu, Steve; Nori, Uday; Bracewell, Anna; Zhang, Jianying; Bott, Cherri; Nadasdy, Gyongyi M.; Brodsky, Sergey V.; Pelletier, Ronald; Satoskar, Abhay R.; Nadasdy, Tibor; Satoskar, Anjali A.

    2016-01-01

    Differentiating acute pyelonephritis (APN) from acute rejection (AR) in renal allograft biopsies can sometimes be difficult because of overlapping clinical and histologic features, lack of positive urine cultures, and variable response to antibiotics. We wanted to study differential gene expression between AR and APN using biopsy tissue. Thirty-three biopsies were analyzed using NanoString multiplex platform and PCR (6 transplant baseline biopsies, 8 AR, 15 APN [8 culture positive, 7 culture negative], and 4 native pyelonephritis [NP]). Additional 22 biopsies were tested by PCR to validate the results. CXCL9, CXCL10, CXCL11, and IDO1 were the top differentially expressed genes, upregulated in AR. Lactoferrin (LTF) and CXCL1 were higher in APN and NP. No statistically significant difference in transcript levels was seen between culture-positive and culture-negative APN biopsies. Comparing the overall mRNA signature using Ingenuity pathway analysis, interferon-gamma emerged as the dominant upstream regulator in AR and allograft APN, but not in NP (which clustered separately). Our study suggests that chemokine pathways in graft APN may differ from NP and in fact resemble AR, due to a component of alloreactivity, resulting in variable response to antibiotic treatment. Therefore, cautious addition of steroids might help in resistant cases of graft APN. PMID:27352120

  19. Highly and moderately aggressive mouse ovarian cancer cell lines exhibit differential gene expression

    PubMed Central

    Zhang, Wensheng; Kale, Shubha P.; McFerrin, Harris; Davenport, Ian; Wang, Guangdi; Skripnikova, Elena; Li, Xiao-Lin; Bowen, Nathan J.; McDaniels, Leticia B; Meng, Yuan-Xiang; Polk, Paula; Liu, Yong-Yu; Zhang, Qian-Jin

    2017-01-01

    Patients with advanced epithelial ovarian cancer often experience disease recurrence after standard therapies, a critical factor in determining their five-year survival rate. Recent reports indicated that long-term or short-term survival is associated with varied gene expression of cancer cells. Thus, identification of novel prognostic biomarkers should be considered. Since the mouse genome is similar to the human genome, we explored potential prognostic biomarkers using two groups of mouse ovarian cancer cell lines (group 1: IG-10, IG-10pw, and IG-10pw/agar; group 2: IG-10 clones 2, 3, and 11) which display highly and moderately aggressive phenotypes in vivo. Mice injected with these cell lines have different survival time and rates, capacities of tumor, and ascites formations, reflecting different prognostic potentials. Using an Affymetrix Mouse Genome 430 2.0 Array, a total of 181 genes were differentially expressed (P<0.01) by at least twofold between two groups of the cell lines. Of the 181 genes, 109 and 72 genes were overexpressed in highly and moderately aggressive cell lines, respectively. Analysis of the 109 and 72 genes using Ingenuity Pathway Analysis (IPA) tool revealed two cancer-related gene networks. One was associated with the highly aggressive cell lines and affiliated with MYC gene, and another was associated with the moderately aggressive cell lines and affiliated with the androgen receptor (AR). Finally, the gene enrichment analysis indicated that the overexpressed 89 genes (out of 109 genes) in highly aggressive cell lines had a function annotation in the David database. The cancer-relevant significant gene ontology (GO) terms included Cell cycle, DNA metabolic process, and Programmed cell death. None of the genes from a set of the 72 genes overexpressed in the moderately aggressive cell lines had a function annotation in the David database. Our results suggested that the overexpressed MYC and 109 gene set represented highly aggressive ovarian

  20. Microarray analysis of differentially expressed genes regulating lipid metabolism during melanoma progression.

    PubMed

    Sumantran, Venil N; Mishra, Pratik; Sudhakar, N

    2015-04-01

    A new hallmark of cancer involves acquisition of a lipogenic phenotype which promotes tumorigenesis. Little is known about lipid metabolism in melanomas. Therefore, we used BRB (Biometrics Research Branch) class comparison tool with multivariate analysis to identify differentially expressed genes in human cutaneous melanomas, compared with benign nevi and normal skin derived from the microarray dataset (GDS1375). The methods were validated by identifying known melanoma biomarkers (CITED1, FGFR2, PTPRF, LICAM, SPP1 and PHACTR1) in our results. Eighteen genes regulating metabolism of fatty acids, lipid second messengers and gangliosides were 2-9 fold upregulated in melanomas of GDS-1375. Out of the 18 genes, 13 were confirmed by KEGG pathway analysis and 10 were also significantly upregulated in human melanoma cell lines of NCI-60 Cell Miner database. Results showed that melanomas upregulated PPARGC1A transcription factor and its target genes regulating synthesis of fatty acids (SCD) and complex lipids (FABP3 and ACSL3). Melanoma also upregulated genes which prevented lipotoxicity (CPT2 and ACOT7) and regulated lipid second messengers, such as phosphatidic acid (AGPAT-4, PLD3) and inositol triphosphate (ITPKB, ITPR3). Genes for synthesis of pro-tumorigenic GM3 and GD3 gangliosides (UGCG, HEXA, ST3GAL5 and ST8SIA1) were also upregulated in melanoma. Overall, the microarray analysis of GDS-1375 dataset indicated that melanomas can become lipogenic by upregulating genes, leading to increase in fatty acid metabolism, metabolism of specific lipid second messengers, and ganglioside synthesis.

  1. Differential gene expression in Giardia lamblia under oxidative stress: significance in eukaryotic evolution.

    PubMed

    Raj, Dibyendu; Ghosh, Esha; Mukherjee, Avik K; Nozaki, Tomoyoshi; Ganguly, Sandipan

    2014-02-10

    Giardia lamblia is a unicellular, early branching eukaryote causing giardiasis, one of the most common human enteric diseases. Giardia, a microaerophilic protozoan parasite has to build up mechanisms to protect themselves against oxidative stress within the human gut (oxygen concentration 60 μM) to establish its pathogenesis. G. lamblia is devoid of the conventional mechanisms of the oxidative stress management system, including superoxide dismutase, catalase, peroxidase, and glutathione cycling, which are present in most eukaryotes. NADH oxidase is a major component of the electron transport chain of G. lamblia, which in concurrence with disulfide reductase, protects oxygen-labile proteins such as pyruvate: ferredoxin oxidoreductase against oxidative stress by sustaining a reduced intracellular environment. It also contains the arginine dihydrolase pathway, which occurs in a number of anaerobic prokaryotes, includes substrate level phosphorylation and adequately active to make a major contribution to ATP production. To study differential gene expression under three types of oxidative stress, a Giardia genomic DNA array was constructed and hybridized with labeled cDNA of cells with or without stress. The transcriptomic data has been analyzed and further validated using real time PCR. We identified that out of 9216 genes represented on the array, more than 200 genes encoded proteins with functions in metabolism, oxidative stress management, signaling, reproduction and cell division, programmed cell death and cytoskeleton. We recognized genes modulated by at least ≥ 2 fold at a significant time point in response to oxidative stress. The study has highlighted the genes that are differentially expressed during the three experimental conditions which regulate the stress management pathway differently to achieve redox homeostasis. Identification of some unique genes in oxidative stress regulation may help in new drug designing for this common enteric parasite prone to

  2. Temporal heterogeneity in single-cell gene expression and mechanical properties during adipogenic differentiation.

    PubMed

    Labriola, Nicholas R; Darling, Eric M

    2015-04-13

    Adipose-derived stem/stromal cells (ASCs) respond heterogeneously when exposed to lineage-specific induction medium. Variable responses at the single-cell level can be observed in the production of lineage-specific metabolites, expression of mRNA transcripts, and adoption of mechanical phenotypes. Understanding the relationship between the biological and mechanical characteristics for individual ASCs is crucial for interpreting how cellular heterogeneity affects the differentiation process. The goal of the current study was to monitor the gene expression of peroxisome proliferator receptor gamma (PPARG) in adipogenically differentiating ASC populations over two weeks, while also characterizing the expression-associated mechanical properties of individual cells using atomic force microscopy (AFM). Results showed that ASC mechanical properties did not change significantly over time in either adipogenic or control medium; however, cells expressing PPARG exhibited significantly greater compliance and fluidity compared to those lacking expression in both adipogenic and control media environments. The percent of PPARG+ cells in adipogenic samples increased over time but stayed relatively constant in controls. Previous reports of a slow, gradual change in cellular mechanical properties are explained by the increase in the number of positively differentiating cells in a sample rather than being reflective of actual, single-cell mechanical property changes. Cytoskeletal remodeling was more prevalent in adipogenic samples than controls, likely driving the adoption of a more compliant mechanical phenotype and upregulation of PPARG. The combined results reinforce the importance of understanding single-cell characteristics, in the context of heterogeneity, to provide more accurate interpretations of biological phenomena such as stem cell differentiation.

  3. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.

    PubMed

    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

    2015-01-01

    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included 'response to heat', 'response to reactive oxygen species (ROS)', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  4. Methods to increase reproducibility in differential gene expression via meta-analysis

    PubMed Central

    Sweeney, Timothy E.; Haynes, Winston A.; Vallania, Francesco; Ioannidis, John P.; Khatri, Purvesh

    2017-01-01

    Findings from clinical and biological studies are often not reproducible when tested in independent cohorts. Due to the testing of a large number of hypotheses and relatively small sample sizes, results from whole-genome expression studies in particular are often not reproducible. Compared to single-study analysis, gene expression meta-analysis can improve reproducibility by integrating data from multiple studies. However, there are multiple choices in designing and carrying out a meta-analysis. Yet, clear guidelines on best practices are scarce. Here, we hypothesized that studying subsets of very large meta-analyses would allow for systematic identification of best practices to improve reproducibility. We therefore constructed three very large gene expression meta-analyses from clinical samples, and then examined meta-analyses of subsets of the datasets (all combinations of datasets with up to N/2 samples and K/2 datasets) compared to a ‘silver standard’ of differentially expressed genes found in the entire cohort. We tested three random-effects meta-analysis models using this procedure. We showed relatively greater reproducibility with more-stringent effect size thresholds with relaxed significance thresholds; relatively lower reproducibility when imposing extraneous constraints on residual heterogeneity; and an underestimation of actual false positive rate by Benjamini–Hochberg correction. In addition, multivariate regression showed that the accuracy of a meta-analysis increased significantly with more included datasets even when controlling for sample size. PMID:27634930

  5. Cassava (Manihot esculenta Krantz) genome harbors KNOX genes differentially expressed during storage root development.

    PubMed

    Guo, D; Li, H L; Tang, X; Peng, S Q

    2014-12-18

    In plants, homeodomain proteins play a critical role in regulating various aspects of plant growth and development. KNOX proteins are members of the homeodomain protein family. The KNOX transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of cassava (Manihot esculenta Krantz) has allowed a genome-wide search for M. esculenta KNOX (MeKNOX) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. In the present study, we identified 12 MeKNOX genes in the cassava genome and grouped them into two distinct subfamilies based on their domain composition and phylogenetic analysis. Furthermore, semi-quantitative reverse transcription polymerase chain reaction analysis was performed to elucidate the expression profiles of these genes in different tissues and during various stages of root development. The analysis of MeKNOX expression profiles of indicated that 12 MeKNOX genes display differential expressions either in their transcript abundance or expression patterns.

  6. Functional analysis of differentially expressed genes associated with glaucoma from DNA microarray data.

    PubMed

    Wu, Y; Zang, W D; Jiang, W

    2014-11-11

    Microarray data of astrocytes extracted from the optic nerves of donors with and without glaucoma were analyzed to screen for differentially expressed genes (DEGs). Functional exploration with bioinformatic tools was then used to understand the roles of the identified DEGs in glaucoma. Microarray data were downloaded from the Gene Expression Omnibus (GEO) database, which contains 13 astrocyte samples, 6 from healthy subjects and 7 from patients suffering from glaucoma. Data were pre-processed, and DEGs were screened out using R software packages. Interactions between DEGs were identified, and networks were built using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING). GENECODIS was utilized for the functional analysis of the DEGs, and GOTM was used for module division, for which functional annotation was conducted with the Database for Annotation, Visualization, and Integrated Discovery (DAVID). A total of 371 DEGs were identified between glaucoma-associated samples and normal samples. Three modules included in the PPID database were generated with 11, 12, and 2 significant functional annotations, including immune system processes, inflammatory responses, and synaptic vesicle endocytosis, respectively. We found that the most significantly enriched functions for each module were associated with immune function. Several genes that play interesting roles in the development of glaucoma are described; these genes may be potential biomarkers for glaucoma diagnosis or treatment.

  7. Differential gene expression patterns during embryonic development of sea urchin exposed to triclosan.

    PubMed

    Hwang, Jinik; Suh, Sung-Suk; Park, Mirye; Park, So Yun; Lee, Sukchan; Lee, Taek-Kyun

    2017-02-01

    Triclosan (TCS; 2,4,4'-trichloro-2'-hydroxydiphenyl ether) is a broad-spectrum antibacterial agent used in common industrial, personal care and household products which are eventually rinsed down the drain and discharged with wastewater effluent. It is therefore commonly found in the aquatic environment, leading to the continual exposure of aquatic organisms to TCS and the accumulation of the antimicrobial and its harmful degradation products in their bodies. Toxic effects of TCS on reproductive and developmental progression of some aquatic organisms have been suggested but the underlying molecular mechanisms have not been defined. We investigated the expression patterns of genes involved in the early development of TCS-treated sea urchin Strongylocentrotus nudus using cDNA microarrays. We observed that the predominant consequence of TCS treatment in this model system was the widespread repression of TCS-modulated genes. In particular, empty spiracles homeobox 1 (EMX-1), bone morphogenic protein, and chromosomal binding protein genes showed a significant decrease in expression in response to TCS. These results suggest that TCS can induce abnormal development of sea urchin embryos through the concomitant suppression of a number of genes that are necessary for embryonic differentiation in the blastula stage. Our data provide new insight into the crucial role of genes associated with embryonic development in response to TCS. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 426-433, 2017.

  8. Identification of differentially expressed genes in Monochamus alternatus digested with azadirachtin.

    PubMed

    Lin, Tong; Liu, Qisi; Chen, Jingxiang

    2016-09-15

    The pine sawyer beetle Monochamus alternatus Hope, a major forest insect pest, is the primary vector of the destructive forest pest pine wood nematode, Bursaphelenchus xylophilus. Azadirachtin, an active compound of neem, is biologically interesting because it represents a group of important, successful botanical pesticides. We provide insight into the molecular effects of azadirachtin on M. alternatus at the transcriptional level to provide clues about possible molecular-level targets and to establish a link between azadirachtin and insect global responses. We found that 920 and 9894 unique genes were significantly up- and down-regulated, respectively. We obtained expression patterns of the differentially expressed genes (DEGs), identifying 4247, 3488 and 7613 sequences that involved cellular components, molecular functions and biological processes, respectively, and showed that the DEGs were distributed among 50 Gene Ontology categories. The Encyclopedia of Genes and Genomes pathway enrichment analysis indicated that the DEGs were enriched in 50 pathways. Detailed gene profile knowledge of the interaction of azadirachtin with M. alternatus should facilitate the development of more effective azadirachtin-based products against M. alternatus and other target Coleoptera. These results further enhance the value of azadirachtin as a potential insecticide of biological origin, as well as for other biological applications.

  9. Identification of differentially expressed genes in Monochamus alternatus digested with azadirachtin

    PubMed Central

    Lin, Tong; Liu, Qisi; Chen, Jingxiang

    2016-01-01

    The pine sawyer beetle Monochamus alternatus Hope, a major forest insect pest, is the primary vector of the destructive forest pest pine wood nematode, Bursaphelenchus xylophilus. Azadirachtin, an active compound of neem, is biologically interesting because it represents a group of important, successful botanical pesticides. We provide insight into the molecular effects of azadirachtin on M. alternatus at the transcriptional level to provide clues about possible molecular-level targets and to establish a link between azadirachtin and insect global responses. We found that 920 and 9894 unique genes were significantly up- and down-regulated, respectively. We obtained expression patterns of the differentially expressed genes (DEGs), identifying 4247, 3488 and 7613 sequences that involved cellular components, molecular functions and biological processes, respectively, and showed that the DEGs were distributed among 50 Gene Ontology categories. The Encyclopedia of Genes and Genomes pathway enrichment analysis indicated that the DEGs were enriched in 50 pathways. Detailed gene profile knowledge of the interaction of azadirachtin with M. alternatus should facilitate the development of more effective azadirachtin-based products against M. alternatus and other target Coleoptera. These results further enhance the value of azadirachtin as a potential insecticide of biological origin, as well as for other biological applications. PMID:27629396

  10. Differential gene expression of mammalian SPO11/TOP6A homologs during meiosis.

    PubMed

    Shannon, M; Richardson, L; Christian, A; Handel, M A; Thelen, M P

    1999-12-03

    As the initiator of DNA double-strand breaks during meiosis in Saccharomyces cerevisiae, the SPO11 protein is essential for recombination. Similarity between SPO11 and archaebacterial TOP6A proteins points to evolutionary specialization of a DNA cleavage function for meiotic recombination. To determine whether this extends to mammals, we isolated and characterized mouse and human SPO11 cDNAs. Mammalian SPO11 genes were found to be expressed at high levels only in testis, wherein mouse Spo11 transcript is restricted primarily to meiotic germ cells and is maximally expressed at midpachynema. Mouse Spo11 is located near the distal end of chromosome 2, while human SPO11 is found in the homologous position of chromosome 20q13.2-13.3, a region that is amplified in some breast cancers. Sequence homology and differential expression together support a highly conserved role for SPO11 in the enzymatic cleavage of DNA that accompanies meiotic recombination.

  11. Differential gene expression during pre-symbiotic interaction between Tuber borchii Vittad. and Tilia americana L.

    PubMed

    Menotta, M; Amicucci, A; Sisti, D; Gioacchini, A M; Stocchi, V

    2004-09-01

    Ectomycorrhizal formation is a highly regulated process involving the molecular reorganization of both partners during symbiosis. An analogous molecular process also occurs during the pre-symbiotic phase, when the partners exchange molecular signals in order to position and prepare both organisms for the establishment of symbiosis. To gain insight into genetic reorganization in Tuber borchii during its interaction with its symbiotic partner Tilia americana, we set up a culture system in which the mycelium interacts with the plant, even though there is no actual physical contact between the two organisms. The selected strategies, suppressive subtractive hybridisation and reverse Northern blots, allowed us to identify, for the first time, 58 cDNA clones differentially expressed in the pre-symbiotic phase. Sequence analysis of the expressed sequence tags showed that the expressed genes are involved in several biochemical pathways: secretion and apical growth, cellular detoxification, general metabolism and both mutualistic and symbiotic features.

  12. Muscle differentiation in a colonial ascidian: organisation, gene expression and evolutionary considerations

    PubMed Central

    Degasperi, Valentina; Gasparini, Fabio; Shimeld, Sebastian M; Sinigaglia, Chiara; Burighel, Paolo; Manni, Lucia

    2009-01-01

    Background Ascidians are tunicates, the taxon recently proposed as sister group to the vertebrates. They possess a chordate-like swimming larva, which metamorphoses into a sessile adult. Several ascidian species form colonies of clonal individuals by asexual reproduction. During their life cycle, ascidians present three muscle types: striated in larval tail, striated in the heart, and unstriated in the adult body-wall. Results In the colonial ascidian Botryllus schlosseri, we investigated organisation, differentiation and gene expression of muscle beginning from early buds to adults and during zooid regression. We characterised transcripts for troponin T (BsTnT-c), adult muscle-type (BsMA2) and cytoplasmic-type (BsCA1) actins, followed by in situ hybridisation (ISH) on sections to establish the spatio-temporal expression of BsTnT-c and BsMA2 during asexual reproduction and in the larva. Moreover, we characterised actin genomic sequences, which by comparison with other metazoans revealed conserved intron patterns. Conclusion Integration of data from ISH, phalloidin staining and TEM allowed us to follow the phases of differentiation of the three muscle kinds, which differ in expression pattern of the two transcripts. Moreover, phylogenetic analyses provided evidence for the close relationship between tunicate and vertebrate muscle genes. The characteristics and plasticity of muscles in tunicates are discussed. PMID:19737381

  13. Differential expression of ribosome-inactivating protein genes during somatic embryogenesis in spinach (Spinacia oleracea).

    PubMed

    Kawade, Kensuke; Ishizaki, Takuma; Masuda, Kiyoshi

    2008-10-01

    Root segments from spinach (Spinacia oleracea L. cv. Jiromaru) seedlings form embryogenic callus (EC) that responded to exogenous GA(3) by accumulating a 31-kDa glycoprotein [BP31 or S. oleracea ribosome-inactivating protein (EC 3.2.2.22) (SoRIP1)] in association with the expression of embryogenic potential. Microsequencing of this protein revealed significant similarity with type 1 RIPs. We identified cDNAs for SoRIP1 and S. oleracea RIP2 (SoRIP2), a novel RIP having a consensus shiga/ricin toxic domain and performed a comparative analysis of the expression of SoRIPs during somatic embryogenesis. Western blotting and quantitative polymerase chain reaction analyses revealed that the expression of SoRIP1 in calli increased remarkably in association with the acquisition of embryogenic potential, although the expression in somatic embryos decreased moderately with their development. However, the expression of SoRIP2 in calli remained low and constant but increased markedly with the development of somatic embryos. Treatment of callus with GA(3) and/or ABA for 24 h, or with ABA for a longer period, failed to stimulate the expression of either gene. Immunohistochemistry showed that SoRIP1 preferentially accumulated in the proembryos and peripheral meristem of somatic embryos early in development. Appreciable expression of SoRIP2 was not detected in the callus, but intense expression was found in the epidermis of somatic embryos. These results suggest that the expression of spinach RIP genes is differentially regulated in a development-dependent fashion during somatic embryogenesis in spinach.

  14. Differential gene expression in Streptococcus pneumoniae in response to various iron sources.

    PubMed

    Gupta, R; Shah, P; Swiatlo, E

    2009-08-01

    Iron is a critical co-factor for several enzymes and is known to regulate gene expression in many pathogens. Streptococcus pneumoniae (pneumococcus) normally colonizes the upper respiratory mucosa, which is an iron-restricted environment. In contrast, during bacteremia available iron from heme and non-heme proteins potentially increases. In iron-depleted medium pneumococcal strain TIGR4 showed reduced growth, however, addition of several physiological iron sources restored growth. Gene expression of selected known and putative pneumococcal virulence factors was analyzed by quantitative RT-PCR in response to iron sources in vitro and during colonization, pneumonia, and bacteremia in a mouse model. Change in mRNA levels relative to transcription in iron-depleted medium was reported. In presence of iron sources, transcription of cps4A, zmpA, pavA, hemolysin and a putative exfoliative toxin was significantly increased, but nanB was suppressed. Hemoglobin at physiological concentration repressed ply and pspA expression. Ferritin, an acute phase protein, increased expression of an iron ABC transporter and repressed expression of a bacterial non-heme iron-containing ferritin. Transcription of cps4A, nanB, hemolysin, and a putative exfoliative toxin were significantly up-regulated during pneumonia and bacteremia, while mRNA of pavA and non-heme ferritin were expressed at higher levels during pneumonia and carriage. An iron ABC transporter was most up-regulated during bacteremia, while pspA and ply were expressed only in pneumonia. Transcription of zmpA was elevated during both pneumonia and bacteremia. These findings suggest that a subset of virulence genes in pneumococci is differentially regulated in response to the quantity and form of iron sources available in a host.

  15. Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck) for selecting differentially expressed genes related to vascular hypertrophy.

    PubMed

    Yang, Cheng-Quan; Liu, Yong-Zhong; An, Ji-Cui; Li, Shuang; Jin, Long-Fei; Zhou, Gao-Feng; Wei, Qing-Jiang; Yan, Hui-Qing; Wang, Nan-Nan; Fu, Li-Na; Liu, Xiao; Hu, Xiao-Mei; Yan, Ting-Shuai; Peng, Shu-Ang

    2013-01-01

    Corky split vein caused by boron (B) deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE) analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs) revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st) phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd) and 3(rd) phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

  16. Quantification of differentially expressed genes in Daphnia magna exposed to rubber wastewater.

    PubMed

    Jo, Hun-Je; Jung, Jinho

    2008-09-01

    In this study, differentially expressed genes (DEGs) were investigated in Daphnia magna exposed to rubber wastewater using an annealing control primer (ACP)-based polymerase chain reaction (PCR) and real-time PCR. Among three identified DEGs, two genes (DEG1 and DEG2) were up-regulated, and DEG1 expression was well-correlated to a logarithm of rubber wastewater concentration (r2=0.971, p<0.0001). In addition, DEG1 expression in D. magna exposed to rubber wastewater was strongly correlated with that of D. magna exposed to Zn (r2=0.9513, p<0.05), suggesting that the induction of DEG1 was caused by Zn, which is the dominant toxicant in rubber wastewater. In addition, DEG1 expression was more sensitive to toxicants than immobility, which is the conventional endpoint in toxicity tests using D. magna. The lowest observed effect concentrations (LOEC) determined using immobility tests were 2.5% for rubber wastewater and 1.6mgl(-1) for Zn. In contrast, a significant increase in DEG1 expression was observed at exposure concentrations of as low as 0.6% rubber wastewater and 0.2mgl(-1) Zn. These results indicate that DEG1 is a sensitive and quantitative biomarker of water and wastewater containing Zn.

  17. Genome-wide differential gene expression profiles in broiler chickens with gangrenous dermatitis.

    PubMed

    Kim, Duk Kyung; Lillehoj, Hyun S; Lee, Kyung Woo; Jang, Seung Ik; Neumann, Anthony P; Siragusa, Gregory R; Lillehoj, Erik P; Hong, Yeong Ho

    2012-12-01

    Gangrenous dermatitis (GD) is a disease of poultry characterized by necrosis of the skin and severe cellulitis of the subcutaneous tissues caused by infection with Clostridium septicum (CS) and/or Clostridium perfringens (CP) type A. While GD causes significant morbidity, mortality, and economic loss to the poultry industry, the fundamental mechanisms underlying this host-pathogen interaction are relatively unknown. This study used comparative global gene expression microarray analysis of GD-affected and clinically healthy chickens from a recent GD outbreak to glean insights into the molecular and cellular changes associated with this disease process. Histopathologic and immunohistochemical analyses confirmed extensive muscle damage and prominent leukocyte infiltration in the skin of GD-affected birds but not in healthy controls. The levels of mRNAs in the skin and underlying muscle corresponding to 952 microarray elements were altered in GD-afflicted birds compared with healthy controls, with 468 being increased and 484 decreased. From these, a subset of 386 genes was identified and used for biologic function and pathway analyses. The biologic functions that were most significantly associated with the differentially expressed genes were "inflammatory response" and "cellular growth and proliferation" classified under the categories of "disease and disorders" and "molecular and cellular functions," respectively. The biologic pathway that was most significantly associated with the differentially expressed genes was the nuclear factor-erythroid 2-related factor 2 (NRF2)-mediated oxidative stress pathway. Finally, in vitro infection of chicken macrophages with CS or CP modified the levels of mRNAs encoding interferon (IFN)-alpha, IFN-gamma, interleukin (IL)-1beta, IL-6, IL-12p40, tumor necrosis factor superfamily 15 (downregulated), IL-8, and IL-10 (upregulated), thus confirming the suppressive effect of GD on the chicken immune system.

  18. [Differential expression of genes related to bacterial wilt resistance in peanut (Arachis hypogaea L.)].

    PubMed

    Peng, Wen-Fang; Lv, Jian-Wei; Ren, Xiao-Ping; Huang, Li; Zhao, Xin-Yan; Wen, Qi-Gen; Jiang, Hui-Fang

    2011-04-01

    Peanut bacterial wilt (BW) caused by Ralstonia solanacearum is one of the most devastating diseases for peanut production in the world. It is believed that breeding and subsequent planting BW-resistant cultivars of peanut (Arachis hypogaea L.) should represent the most effective and economic means of controlling the disease. To illustrate the molecular mechanism of peanut resistant to BW, a BW-resistant cultivar, 'Yuanza 9102', and a BW-sensitive one, 'Zhonghua 12', were infected with Ralstonia solanacearum and differential expression of the genes related to BW-resistance was analyzed using complementary DNA amplified length polymorphism (cDNA-AFLP) technique. The infected 3-leaflet seedlings were followed for 48 h and root samples were taken at 0, 2, 10, 24 and 48 h after inoculation, respectively. A total of 12596 transcript-derived fragments (TDFs) were amplified with 256 primer combinations, including 709 differential expressed TDFs, which were generated from 119 primer combinations. Ninety-eight TDFs were randomly chosen for DNA sequence analysis. BLASTx analysis of the obtained sequences revealed that 40 TDFs encoded gene products associated with energy, transcription, signal transduction, defense, metabolism, cell growth, cell structure or/and protein synthesis. Analysis of the expression of four genes by qRT-PCR verified the results from cDNA-AFLP. Strikingly, one of the identified TDFs, 32-54-1, occurred for 47 times in a known BW-resistant SSH library. These results suggest that resistance to BW in peanut involves multifaceted biochemical and physiological reactions, including regulation of the genes involved in different pathways, such as defense, singal transduction, metabolism, transcription and abiotic stresses. The TDF 32-54-1 was predicted to be closely related to BW resistance in peanut.

  19. Spatial fluctuations in expression of the heterocyst differentiation regulatory gene hetR in Anabaena filaments.

    PubMed

    Corrales-Guerrero, Laura; Tal, Asaf; Arbel-Goren, Rinat; Mariscal, Vicente; Flores, Enrique; Herrero, Antonia; Stavans, Joel

    2015-04-01

    Under nitrogen deprivation, filaments of the cyanobacterium Anabaena undergo a process of development, resulting in a one-dimensional pattern of nitrogen-fixing heterocysts separated by about ten photosynthetic vegetative cells. Many aspects of gene expression before nitrogen deprivation and during the developmental process remain to be elucidated. Furthermore, the coupling of gene expression fluctuations between cells along a multicellular filament is unknown. We studied the statistics of fluctuations of gene expression of HetR, a transcription factor essential for heterocyst differentiation, both under steady-state growth in nitrogen-rich conditions and at different times following nitrogen deprivation, using a chromosomally-encoded translational hetR-gfp fusion. Statistical analysis of fluorescence at the individual cell level in wild-type and mutant filaments demonstrates that expression fluctuations of hetR in nearby cells are coupled, with a characteristic spatial range of circa two to three cells, setting the scale for cellular interactions along a filament. Correlations between cells predominantly arise from intercellular molecular transfer and less from cell division. Fluctuations after nitrogen step-down can build up on those under nitrogen-replete conditions. We found that under nitrogen-rich conditions, basal, steady-state expression of the HetR inhibitor PatS, cell-cell communication influenced by the septal protein SepJ and positive HetR auto-regulation are essential determinants of fluctuations in hetR expression and its distribution along filaments. A comparison between the expression of hetR-gfp under nitrogen-rich and nitrogen-poor conditions highlights the differences between the two HetR inhibitors PatS and HetN, as well as the differences in specificity between the septal proteins SepJ and FraC/FraD. Activation, inhibition and cell-cell communication lie at the heart of developmental processes. Our results show that proteins involved in these

  20. Differential gene expression in response to copper in Acidithiobacillus ferrooxidans strains possessing dissimilar copper resistance.

    PubMed

    Wu, Xueling; Hu, Qi; Hou, Dongmei; Miao, Bo; Liu, Xueduan

    2010-01-01

    Locus afe_0454 from Acidithiobacillus ferrooxidans (At.ferrooxidans) is annotated as related to copper resistance in The Institute for Genomic Research database. In our study, two At.ferrooxidans strains, 26(#) and DC, with different levels of copper ion resistance were isolated from acid mine drainages at two major copper mines in China, and their copper-resistance capacity was determined. The 26(#) strain had a copper-tolerance level of 0.22 mol/L, whereas the DC strain had a lower copper-tolerance level of 0.04 mol/L. The mutant 26(#) was generated from strain 26(#), and its copper-tolerance level was 0.25 mol/L. Using real-time quantitative reverse transcription polymerase chain reaction, differential expression of the afe_0454 gene during copper ion stress of these three strains was investigated. The results showed that the expression of afe_0454 was increased under copper ion stress, indicating that the afe_0454 gene is sensitive to copper levels. Furthermore, the afe_0454 gene expression ratio varied in the different copper-resistant strains. Gene expression was highest in the highest copper-resistant strain. The deduced amino acid sequence of the afe_0454 gene was 56.87% non-polar, indicating the AFE_0454 protein was hydrophobic. Searching with the AFE_0454 protein in The Institute for Genomic Research database showed that the structure of the copper resistance protein D (CopD), which transports copper ions outside of the cell, had the highest sequence identity (46%). Bioinformatics analysis showed that the AFE_0454 protein has eight transmembrane helixes and was predicted to be localized to the plasma membrane. These results strongly suggested that the AFE_0454 protein is likely a transmembrane protein and might be directly involved in copper ion resistance.

  1. Hox gene expression leads to differential hind leg development between honeybee castes.

    PubMed

    Bomtorin, Ana Durvalina; Barchuk, Angel Roberto; Moda, Livia Maria; Simoes, Zila Luz Paulino

    2012-01-01

    Beyond the physiological and behavioural, differences in appendage morphology between the workers and queens of Apis mellifera are pre-eminent. The hind legs of workers, which are highly specialized pollinators, deserve special attention. The hind tibia of worker has an expanded bristle-free region used for carrying pollen and propolis, the corbicula. In queens this structure is absent. Although the morphological differences are well characterized, the genetic inputs driving the development of this alternative morphology remain unknown. Leg phenotype determination takes place between the fourth and fifth larval instar and herein we show that the morphogenesis is completed at brown-eyed pupa. Using results from the hybridization of whole genome-based oligonucleotide arrays with RNA samples from hind leg imaginal discs of pre-pupal honeybees of both castes we present a list of 200 differentially expressed genes. Notably, there are castes preferentially expressed cuticular protein genes and members of the P450 family. We also provide results of qPCR analyses determining the developmental transcription profiles of eight selected genes, including abdominal-A, distal-less and ultrabithorax (Ubx), whose roles in leg development have been previously demonstrated in other insect models. Ubx expression in workers hind leg is approximately 25 times higher than in queens. Finally, immunohistochemistry assays show that Ubx localization during hind leg development resembles the bristles localization in the tibia/basitarsus of the adult legs in both castes. Our data strongly indicate that the development of the hind legs diphenism characteristic of this corbiculate species is driven by a set of caste-preferentially expressed genes, such as those encoding cuticular protein genes, P450 and Hox proteins, in response to the naturally different diets offered to honeybees during the larval period.

  2. Differentially expressed genes and proteins upon drought acclimation in tolerant and sensitive genotypes of Coffea canephora

    PubMed Central

    Marraccini, Pierre; Vinecky, Felipe; Alves, Gabriel S.C.; Ramos, Humberto J.O.; Elbelt, Sonia; Vieira, Natalia G.; Carneiro, Fernanda A.; Sujii, Patricia S.; Alekcevetch, Jean C.; Silva, Vânia A.; DaMatta, Fábio M.; Ferrão, Maria A.G.; Leroy, Thierry; Pot, David; Vieira, Luiz G.E.; da Silva, Felipe R.; Andrade, Alan C.

    2012-01-01

    The aim of this study was to investigate the molecular mechanisms underlying drought acclimation in coffee plants by the identification of candidate genes (CGs) using different approaches. The first approach used the data generated during the Brazilian Coffee expressed sequence tag (EST) project to select 13 CGs by an in silico analysis (electronic northern). The second approach was based on screening macroarrays spotted with plasmid DNA (coffee ESTs) with separate hybridizations using leaf cDNA probes from drought-tolerant and susceptible clones of Coffea canephora var. Conilon, grown under different water regimes. This allowed the isolation of seven additional CGs. The third approach used two-dimensional gel electrophoresis to identify proteins displaying differential accumulation in leaves of drought-tolerant and susceptible clones of C. canephora. Six of them were characterized by MALDI-TOF-MS/MS (matrix-assisted laser desorption-time of flight-tandem mass spectrometry) and the corresponding proteins were identified. Finally, additional CGs were selected from the literature, and quantitative real-time polymerase chain reaction (qPCR) was performed to analyse the expression of all identified CGs. Altogether, >40 genes presenting differential gene expression during drought acclimation were identified, some of them showing different expression profiles between drought-tolerant and susceptible clones. Based on the obtained results, it can be concluded that factors involved a complex network of responses probably involving the abscisic signalling pathway and nitric oxide are major molecular determinants that might explain the better efficiency in controlling stomata closure and transpiration displayed by drought-tolerant clones of C. canephora. PMID:22511801

  3. Differential expression of carotenoid biosynthetic pathway genes in two contrasting tomato genotypes for lycopene content.

    PubMed

    Pandurangaiah, Shilpa; Ravishankar, Kundapura V; Shivashankar, Kodthalu S; Sadashiva, Avverahally T; Pillakenchappa, Kavitha; Narayanan, Sunil Kumar

    2016-06-01

    Tomato (Solanum lycopersicum L.) is one of the model plant to study carotenoid biosynthesis. In the present study, the fruit carotenoid content were quantified at different developmental stages for two contrasting genotypes, viz. IIHR-249-1 and IIHR-2866 by UPLC. Lycopene content was high in IIHR-249-1 (19.45 mg/100 g fresh weight) compared to IIHR-2866 (1.88 mg/100 g fresh weight) at the ripe stage. qPCR was performed for genes that are involved in the carotenoid biosynthetic pathway to study the difference in lycopene content in fruits of both the genotypes. The expression of Phytoene synthase (PSY) increased by 36-fold and Phytoene desaturase (PDS) increased by 14-fold from immature green stage to ripe stage in IIHR-249-1. The expression of Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta cyclase (CYC-B) decreased gradually from the initial stage to the ripe stage in IIHR-249-1. IIHR 249-1 showed 3- and 1.8-fold decrease in gene expression for Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta-cyclase (CYC-B) .The F2 hybrids derived from IIHR-249-1 and IIHR-2866 were analysed at the ripe stage for lycopene content. The gene expression of Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta-cyclase (CYC-B) in high and low lycopene lines from F2 progenies also showed the decrease in transcript levels of both the genes in high lycopene F2 lines. We wish to suggest that the differential expression of lycopene beta-cyclases can be used in marker-assisted breeding.

  4. Diversification in the genetic architecture of gene expression and transcriptional networks in organ differentiation of Populus.

    PubMed

    Drost, Derek R; Benedict, Catherine I; Berg, Arthur; Novaes, Evandro; Novaes, Carolina R D B; Yu, Qibin; Dervinis, Christopher; Maia, Jessica M; Yap, John; Miles, Brianna; Kirst, Matias

    2010-05-04

    A fundamental goal of systems biology is to identify genetic elements that contribute to complex phenotypes and to understand how they interact in networks predictive of system response to genetic variation. Few studies in plants have developed such networks, and none have examined their conservation among functionally specialized organs. Here we used genetical genomics in an interspecific hybrid population of the model hardwood plant Populus to uncover transcriptional networks in xylem, leaves, and roots. Pleiotropic eQTL hotspots were detected and used to construct coexpression networks a posteriori, for which regulators were predicted based on cis-acting expression regulation. Networks were shown to be enriched for groups of genes that function in biologically coherent processes and for cis-acting promoter motifs with known roles in regulating common groups of genes. When contrasted among xylem, leaves, and roots, transcriptional networks were frequently conserved in composition, but almost invariably regulated by different loci. Similarly, the genetic architecture of gene expression regulation is highly diversified among plant organs, with less than one-third of genes with eQTL detected in two organs being regulated by the same locus. However, colocalization in eQTL position increases to 50% when they are detected in all three organs, suggesting conservation in the genetic regulation is a function of ubiquitous expression. Genes conserved in their genetic regulation among all organs are primarily cis regulated (approximately 92%), whereas genes with eQTL in only one organ are largely trans regulated. Trans-acting regulation may therefore be the primary driver of differentiation in function between plant organs.

  5. Identification of differentially expressed protective genes in liver of two rainbow trout strains.

    PubMed

    Rebl, Alexander; Verleih, Marieke; Korytář, Thomáš; Kühn, Carsten; Wimmers, Klaus; Köllner, Bernd; Goldammer, Tom

    2012-01-15

    Since 1975, the rainbow trout strain BORN (Germany) has been bred in brackish water from a coastal form imported from Denmark. Accompanying phenotypic monitoring of the adapted BORN trout until now revealed that this selection strain manifested a generally elevated resistance towards high stress and pathogenic challenge including lower susceptibility towards Aeromonas salmonicida infections in comparison to other trout strains in local aqua farms. We focus on the elucidation of both, genetic background and immunological basis for the increased survivorship to infections. A first comparison of gene expression profiles in liver tissue of healthy rainbow trout from the local selection strain BORN and imported trout using a GRASP 16K cDNA microarray revealed six differentially expressed genes evoking pathogen and wounding responses, LEAP2A (encoding for liver-expressed antimicrobial peptide), SERPINA1 (alpha-1 antitrypsin), FTH1 (middle subunit of ferritin), FGL2 (fibroleukin), CLEC4E (macrophage-inducible C-type lectin), and SERPINF2 (alpha-2 antiplasmin). Since the latter gene is not described in salmonid species so far, our first aim was to characterize the respective sequence in rainbow trout. Two trout SERPINF2 genes were identified, which share only 48% identical amino acid residues and a characteristic SERPIN domain. Second, we aimed to analyse the expression of those genes after temperature challenge (8 °C and 23 °C). Only FTH1 was upregulated in BORN and import trout after increase of temperature, while SERPINA1 and FGL2 were only elevated in import trout. Third, the expression of all named genes was analyzed after pathogen challenge with A. salmonicida subsp. salmonicida. As a main finding, we detected a comparably faster regeneration of LEAP2A mRNA abundance in BORN trout following bacterial infection. Ingenuity Pathways Analysis suggested a functional interplay among the mentioned factors and the pro-inflammatory cytokine TNF, whose stronger expression

  6. Comparative Genomic Analysis of Transgenic Poplar Dwarf Mutant Reveals Numerous Differentially Expressed Genes Involved in Energy Flow

    PubMed Central

    Chen, Su; Bai, Shuang; Liu, Guifeng; Li, Huiyu; Jiang, Jing

    2014-01-01

    In our previous research, the Tamarix androssowii LEA gene (Tamarix androssowii late embryogenesis abundant protein Mrna, GenBank ID: DQ663481) was transferred into Populus simonii × Populus nigra. Among the eleven transgenic lines, one exhibited a dwarf phenotype compared to the wild type and other transgenic lines, named dwf1. To uncover the mechanisms underlying this phenotype, digital gene expression libraries were produced from dwf1, wild-type, and other normal transgenic lines, XL-5 and XL-6. Gene expression profile analysis indicated that dwf1 had a unique gene expression pattern in comparison to the other two transgenic lines. Finally, a total of 1246 dwf1-unique differentially expressed genes were identified. These genes were further subjected to gene ontology and pathway analysis. Results indicated that photosynthesis and carbohydrate metabolism related genes were significantly affected. In addition, many transcription factors genes were also differentially expressed in dwf1. These various differentially expressed genes may be critical for dwarf mutant formation; thus, the findings presented here might provide insight for our understanding of the mechanisms of tree growth and development. PMID:25192286

  7. Microarray-Based Analysis of Differential Gene Expression between Infective and Noninfective Larvae of Strongyloides stercoralis

    PubMed Central

    Ramanathan, Roshan; Varma, Sudhir; Ribeiro, José M. C.; Myers, Timothy G.; Nolan, Thomas J.; Abraham, David; Lok, James B.; Nutman, Thomas B.

    2011-01-01

    Background Differences between noninfective first-stage (L1) and infective third-stage (L3i) larvae of parasitic nematode Strongyloides stercoralis at the molecular level are relatively uncharacterized. DNA microarrays were developed and utilized for this purpose. Methods and Findings Oligonucleotide hybridization probes for the array were designed to bind 3,571 putative mRNA transcripts predicted by analysis of 11,335 expressed sequence tags (ESTs) obtained as part of the Nematode EST project. RNA obtained from S. stercoralis L3i and L1 was co-hybridized to each array after labeling the individual samples with different fluorescent tags. Bioinformatic predictions of gene function were developed using a novel cDNA Annotation System software. We identified 935 differentially expressed genes (469 L3i-biased; 466 L1-biased) having two-fold expression differences or greater and microarray signals with a p value<0.01. Based on a functional analysis, L1 larvae have a larger number of genes putatively involved in transcription (p = 0.004), and L3i larvae have biased expression of putative heat shock proteins (such as hsp-90). Genes with products known to be immunoreactive in S. stercoralis-infected humans (such as SsIR and NIE) had L3i biased expression. Abundantly expressed L3i contigs of interest included S. stercoralis orthologs of cytochrome oxidase ucr 2.1 and hsp-90, which may be potential chemotherapeutic targets. The S. stercoralis ortholog of fatty acid and retinol binding protein-1, successfully used in a vaccine against Ancylostoma ceylanicum, was identified among the 25 most highly expressed L3i genes. The sperm-containing glycoprotein domain, utilized in a vaccine against the nematode Cooperia punctata, was exclusively found in L3i biased genes and may be a valuable S. stercoralis target of interest. Conclusions A new DNA microarray tool for the examination of S. stercoralis biology has been developed and provides new and valuable insights regarding

  8. Analysis of differentially expressed genes between fluoride-sensitive and fluoride-endurable individuals in midgut of silkworm, Bombyx mori.

    PubMed

    Qian, Heying; Li, Gang; He, Qingling; Zhang, Huaguang; Xu, Anying

    2016-08-15

    Fluoride tolerance is an economically important trait of silkworm. Near-isogenic lines (NILs) of the dominant endurance to fluoride (Def) gene in Bombyx mori has been constructed before. Here, we analyzed the gene expression profiles of midgut of fluoride-sensitive and fluoride-endurable individuals of Def NILs by using high-throughput Illumina sequencing technology and bioinformatics tools, and identified differentially expressed genes between these individuals. A total of 3,612,399 and 3,567,631 clean tags for the libraries of fluoride-endurable and fluoride-sensitive individuals were obtained, which corresponded to 32,933 and 43,976 distinct clean tags, respectively. Analysis of differentially expressed genes indicates that 241 genes are differentially expressed between the two libraries. Among the 241 genes, 30 are up-regulated and 211 are down-regulated in fluoride-endurable individuals. Pathway enrichment analysis demonstrates that genes related to ribosomes, pancreatic secretion, steroid biosynthesis, glutathione metabolism, steroid biosynthesis, and glycerolipid metabolism are down-regulated in fluoride-endurable individuals. qRT-PCR was conducted to confirm the results of the DGE. The present study analyzed differential expression of related genes and tried to find out whether the crucial genes were related to fluoride detoxification which might elucidate fluoride effect and provide a new way in the fluorosis research.

  9. Differential action of glucocorticoids on apolipoprotein E gene expression in macrophages and hepatocytes

    PubMed Central

    Trusca, Violeta Georgeta; Fuior, Elena Valeria; Fenyo, Ioana Madalina; Kardassis, Dimitris; Simionescu, Maya

    2017-01-01

    Apolipoprotein E (apoE) has anti-atherosclerotic properties, being involved in the transport and clearance of cholesterol-rich lipoproteins as well as in cholesterol efflux from cells. We hypothesized that glucocorticoids may exert anti-inflammatory properties by increasing the level of macrophage-derived apoE. Our data showed that glucocorticoids increased apoE expression in macrophages in vitro as well as in vivo. Dexamethasone increased ~6 fold apoE mRNA levels in cultured peritoneal macrophages and RAW 264.7 cells. Administered to C57BL/6J mice, dexamethasone induced a two-fold increase in apoE expression in peritoneal macrophages. By contrast, glucocorticoids did not influence apoE expression in hepatocytes, in vitro and in vivo. Moreover, dexamethasone enhanced apoE promoter transcriptional activity in RAW 264.7 macrophages, but not in HepG2 cells, as tested by transient transfections. Analysis of apoE proximal promoter deletion mutants, complemented by protein-DNA interaction assays demonstrated the functionality of a putative glucocorticoid receptors (GR) binding site predicted by in silico analysis in the -111/-104 region of the human apoE promoter. In hepatocytes, GR can bind to their specific site within apoE promoter but are not able to modulate the gene expression. The modulatory blockade in hepatocytes is a consequence of partial involvement of transcription factors and other signaling molecules activated through MEK1/2 and PLA2/PLC pathways. In conclusion, our study indicates that glucocorticoids (1) differentially target apoE gene expression; (2) induce a significant increase in apoE level specifically in macrophages. The local increase of apoE gene expression in macrophages at the level of the atheromatous plaque may have therapeutic implications in atherosclerosis. PMID:28355284

  10. Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.

    PubMed

    Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R

    2016-02-22

    The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.

  11. Subtractive libraries for prospecting differentially expressed genes in the soybean under water deficit

    PubMed Central

    Rodrigues, Fabiana Aparecida; Marcolino-Gomes, Juliana; de Fátima Corrêa Carvalho, Josirlei; do Nascimento, Leandro Costa; Neumaier, Norman; Farias, José Renato Bouças; Carazzolle, Marcelo Falsarella; Marcelino, Francismar Corrêa; Nepomuceno, Alexandre Lima

    2012-01-01

    Soybean has a wide range of applications in the industry and, due to its crop potential, its improvement is widely desirable. During drought conditions, soybean crops suffer significant losses in productivity. Therefore, understanding the responses of the soybean under this stress is an effective way of targeting crop improvement techniques. In this study, we employed the Suppressive Subtractive Hybridization (SSH) technique to investigate differentially expressed genes under water deficit conditions. Embrapa 48 and BR 16 soybean lines, known as drought-tolerant and -sensitive, respectively, were grown hydroponically and subjected to different short-term periods of stress by withholding the nutrient solution. Using this approach, we have identified genes expressed during the early response to water deficit in roots and leaves. These genes were compared among the lines to assess probable differences in the plant transcriptomes. In general, similar biochemical processes were predominant in both cultivars; however, there were more considerable differences between roots and leaves of Embrapa 48. Moreover, we present here a fast, clean and straightforward method to obtain drought-stressed root tissues and a large enriched collection of transcripts expressed by soybean plants under water deficit that can be useful for further studies towards the understanding of plant responses to stress. PMID:22802715

  12. Differential gene expression in the respiratory tree of the sea cucumber Apostichopus japonicus during aestivation.

    PubMed

    Zhao, Ye; Yang, Hongsheng; Storey, Kenneth B; Chen, Muyan

    2014-12-01

    Sea cucumbers, Apostichopus japonicus, experience seasonally high water temperatures during the summer months and enter aestivation to survive. Aestivation is characterized by strong metabolic rate depression which is supported by a series of strategies including reorganizing metabolic processes, suppressing cell functions, enhancing cytoprotective mechanisms, and altered gene expression. The respiratory tree tissue of the sea cucumber is an excellent material for studying aestivation, undergoing obvious atrophy during aestivation. The present study analyzed the global gene expression profile of respiratory tree tissue of A. japonicus during aestivation by constructing and screening three libraries representing key stages of aestivation: non-aestivation (NA), deep-aestivation (DA), and arousal from aestivation (AA) using RNA-seq. A total of 1240, 1184 and 303 differentially expressed genes (DEGs) were identified following the criteria of |log2 ratio|≥1 and FDR≤0.001 in comparisons of DA vs. NA, AA vs. NA and DA vs. AA. A set of respiratory tree specific DEGs was identified the first time and, in addition, common DEGs that were responsive to aestivation in both respiratory tree and intestine were identified. Functional analysis of DEGs was further performed by GO enrichment analysis and respiratory tree specific GO terms were screened out and provide interesting hints for further studies of the molecular regulation of aestivation in A. japonicus.

  13. Differentially expressed genes implicated in embryo abortion of mango identified by suppression subtractive hybridization.

    PubMed

    He, J H; Ma, F W; Chen, Y Y; Shu, H R

    2012-11-14

    Embryo abortion in mango severely damages mango production worldwide. The mechanisms by which the mango embryos abort have long been an intriguing question. We used subtractive suppression hybridization to investigate the differentially expressed genes involved in this process. We generated 2 cDNA libraries from normal seed and aborted seed embryos of mango cultivar 'Jinhuang'. One thousand five hundred and seventy-two high-quality expressed sequence tags (ESTs) were obtained, with 1092 from the normal seed tester library and 480 from the aborted seed tester library. These ESTs were assembled into 783 unigenes, including 147 contigs and 636 singletons in contigs; 297 singletons in gene ontology (GO) indicated coverage of a broad range of GO categories. Seven candidate genes from different categories were selected for semi-quantitative PCR analysis, and their possible functions in embryo abortion are discussed. These data provide new insight into the genetic regulation of embryo abortion in mango and may aid in further identification of novel genes and their functions.

  14. Fold change rank ordering statistics: a new method for detecting differentially expressed genes

    PubMed Central

    2014-01-01

    Background Different methods have been proposed for analyzing differentially expressed (DE) genes in microarray data. Methods based on statistical tests that incorporate expression level variability are used more commonly than those based on fold change (FC). However, FC based results are more reproducible and biologically relevant. Results We propose a new method based on fold change rank ordering statistics (FCROS). We exploit the variation in calculated FC levels using combinatorial pairs of biological conditions in the datasets. A statistic is associated with the ranks of the FC values for each gene, and the resulting probability is used to identify the DE genes within an error level. The FCROS method is deterministic, requires a low computational runtime and also solves the problem of multiple tests which usually arises with microarray datasets. Conclusion We compared the performance of FCROS with those of other methods using synthetic and real microarray datasets. We found that FCROS is well suited for DE gene identification from noisy datasets when compared with existing FC based methods. PMID:24423217

  15. Identification of Differentially Expressed Genes in Pelvic Organ Prolapse by RNA-Seq

    PubMed Central

    Xie, Ruoyun; Xu, Ying; Fan, Shuixiu; Song, Yanfeng

    2016-01-01

    Background Pelvic organ prolapse (POP) brings major health issues for women, affecting 40% of postmenopausal women, and directly affects bladder and bowel function, as well as quality of life. In light of the projected growth in demand for care for pelvic floor disorders, determining the etiology and progression of POP has important public health implications. Material/Methods Uterosacral ligaments (USLs) samples of POP patients and normal controls were enrolled for RNA-Seq, and functional annotation analysis and Protein-Protein interaction (PPI) networks construction were performed for differentially expressed genes (DEGs). Results A total of 81 DEGs were identified between POP and normal control, and distinctly classify all samples into normal and POP group by hierarchical clustering. Sixty-six DEGs demonstrated the same expression pattern among the POP samples with different stages. For those DEGs, canonical Wnt receptor signaling pathway was the most significantly enriched GO term (P value=3.33E-07), and neuroactive ligand-receptor interaction was the most significantly enriched pathway (P value=1.24E-03). In The PPI networks of 81 dysregulated genes, significant hub proteins contained TOP2A (Degree=54), KCNA5 (Degree=22) and PLA2G2A (Degree=19), suggesting their important role in the development of POP. Conclusions This RNA-seq analysis identified a POP signature of 81 genes, and some ECM-related genes, including COMP, NDP, and SNAI2 might participate in the pathology of POP and be applied as potential therapeutic targets. PMID:27818488

  16. Mucosal Expression of T Cell Gene Variants Is Associated with Differential Resistance to Teladorsagia circumcincta

    PubMed Central

    Wilkie, Hazel; Nicol, Louise; Gossner, Anton

    2016-01-01

    Resistance of sheep to the gastrointestinal nematode Teladorsagia circumcincta is a heritable characteristic. Control of parasite colonization and egg production is strongly linked to IgA antibody levels regulated by Th2 T cell activation within lymphoid tissue; and persistently-infected susceptible animals develop an inflammatory Th1/Th17 response within the abomasum that fails to control infection. Differential T cell polarization therefore is associated with parasite resistance and/or susceptibility and is controlled by a specific set of transcription factors and cytokine receptors. Transcript variants of these genes have been characterized in sheep, while in humans and mice different variants of the genes are associated with inflammatory diseases. RT-qPCR was used to quantify mucosal expression of the transcript variants of the sheep genes in trickle-infected animals with defined phenotypic traits. Genes that encode full-length GATA3 and IL17RB were shown to be significantly increased in resistant sheep that had controlled parasite infection. Expression levels of both were significantly negatively correlated with abomasal worm count (a parameter of susceptibility) and positively correlated with body weight (a parameter of resistance). These data show that polarized Th2 T cells within the abomasal mucosa play an important role in the maintenance of resistance. PMID:27973603

  17. Subtoxic chlorpyrifos treatment resulted in differential expression of genes implicated in neurological functions and development.

    PubMed

    Stapleton, Andrea R; Chan, Victor T

    2009-04-01

    Chlorpyrifos (CPF), a commonly used organophosphorus insecticide, induces acetylcholinesterase inhibition and cholinergic toxicity. Subtoxic exposure to CPF has long-term adverse effects on synaptic function/development and behavioral performance. To gain insight into the possible mechanism(s) of these observations, this study aims to investigate gene expression changes in the forebrain of rats treated with subtoxic CPF doses using DNA microarrays. Statistical analysis revealed that CPF treatment resulted in differential expression of 277 genes. Gene ontology and pathway analyses revealed that these genes have important roles in nervous system development and functions including axon guidance, dorso-ventral axis formation, long-term potentiation, synaptic transmission, and insulin signaling. The results of biological associated network analysis showed that Gsk3b is highly connected in several of these networks suggesting its potential role in cellular response to CPF exposure/neurotoxicity. These findings might serve as the basis for future mechanistic analysis of the long-term adverse effects of subtoxic CPF exposure.

  18. Differentially expressed genes of virulent and nonvirulent Entamoeba histolytica strains identified by suppression subtractive hybridization.

    PubMed

    Freitas, Michelle A R; Alvarenga, Ângela C; Fernandes, Helen C; Gil, Frederico F; Melo, Maria N; Pesquero, Jorge L; Gomes, Maria A

    2014-01-01

    Entamoeba histolytica is a parasite which presents capacity to degrade tissues and therefore has a pathogenic behavior. As this behavior is not shown by all strains, there have been several studies investigating molecular basis of the cytotoxicity process. Using the suppression subtractive hybridization (SSH) technique, differential gene expressions of two E. histolytica strains, one virulent (EGG) and one nonvirulent (452), have been analyzed with the purpose of isolating genes which may be involved with amoebic virulence. Nine cDNA fragments presenting high homology with E. histolytica previously sequenced genes were subtracted. Of these, four genes were confirmed by RT-PCR. Two coding for hypothetical proteins, one for a cysteine-rich protein, expressed only in the virulent strain, EGG and another one, coding for grainin 2 protein, exclusive from 452 strain. This study provided new insight into the proteins differences in the virulent and nonvirulent E. histolytica strains. We believe that further studies with these proteins may prove association of them with tissue damage, providing new perceptions to improve treatment or diagnosis of the invasive disease.

  19. Identification of Differentially Expressed Genes in Pelvic Organ Prolapse by RNA-Seq.

    PubMed

    Xie, Ruoyun; Xu, Ying; Fan, Shuixiu; Song, Yanfeng

    2016-11-07

    BACKGROUND Pelvic organ prolapse (POP) brings major health issues for women, affecting 40% of postmenopausal women, and directly affects bladder and bowel function, as well as quality of life. In light of the projected growth in demand for care for pelvic floor disorders, determining the etiology and progression of POP has important public health implications. MATERIAL AND METHODS Uterosacral ligaments (USLs) samples of POP patients and normal controls were enrolled for RNA-Seq, and functional annotation analysis and Protein-Protein interaction (PPI) networks construction were performed for differentially expressed genes (DEGs). RESULTS A total of 81 DEGs were identified between POP and normal control, and distinctly classify all samples into normal and POP group by hierarchical clustering. Sixty-six DEGs demonstrated the same expression pattern among the POP samples with different stages. For those DEGs, canonical Wnt receptor signaling pathway was the most significantly enriched GO term (P value=3.33E-07), and neuroactive ligand-receptor interaction was the most significantly enriched pathway (P value=1.24E-03). In The PPI networks of 81 dysregulated genes, significant hub proteins contained TOP2A (Degree=54), KCNA5 (Degree=22) and PLA2G2A (Degree=19), suggesting their important role in the development of POP. CONCLUSIONS This RNA-seq analysis identified a POP signature of 81 genes, and some ECM-related genes, including COMP, NDP, and SNAI2 might participate in the pathology of POP and be applied as potential therapeutic targets.

  20. Differential gene expression in human, murine, and cell line-derived macrophages upon polarization.

    PubMed

    Spiller, Kara L; Wrona, Emily A; Romero-Torres, Saly; Pallotta, Isabella; Graney, Pamela L; Witherel, Claire E; Panicker, Leelamma M; Feldman, Ricardo A; Urbanska, Aleksandra M; Santambrogio, Laura; Vunjak-Novakovic, Gordana; Freytes, Donald O

    2016-09-10

    The mechanisms by which macrophages control the inflammatory response, wound healing, biomaterial-interactions, and tissue regeneration appear to be related to their activation/differentiation states. Studies of macrophage behavior in vitro can be useful for elucidating their mechanisms of action, but it is not clear to what extent the source of macrophages affects their apparent behavior, potentially affecting interpretation of results. Although comparative studies of macrophage behavior with respect to cell source have been conducted, there has been no direct comparison of the three most commonly used cell sources: murine bone marrow, human monocytes from peripheral blood (PB), and the human leukemic monocytic cell line THP-1, across multiple macrophage phenotypes. In this study, we used multivariate discriminant analysis to compare the in vitro expression of genes commonly chosen to assess macrophage phenotype across all three sources of macrophages, as well as those derived from induced pluripotent stem cells (iPSCs), that were polarized towards four distinct phenotypes using the same differentiation protocols: M(LPS,IFN) (aka M1), M(IL4,IL13) (aka M2a), M(IL10) (aka M2c), and M(-) (aka M0) used as control. Several differences in gene expression trends were found among the sources of macrophages, especially between murine bone marrow-derived and human blood-derived M(LPS,IFN) and M(IL4,IL13) macrophages with respect to commonly used phenotype markers like CCR7 and genes associated with angiogenesis and tissue regeneration like FGF2 and MMP9. We found that the genes with the most similar patterns of expression among all sources were CXCL-10 and CXCL-11 for M(LPS,IFN) and CCL17 and CCL22 for M(IL4,IL13). Human PB-derived macrophages and human iPSC-derived macrophages showed similar gene expression patterns among the groups and genes studied here, suggesting that iPSC-derived monocytes have the potential to be used as a reliable cell source of human macrophages

  1. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    PubMed

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones.

  2. Tandem orientation of duplicated xanthine dehydrogenase genes from Arabidopsis thaliana: differential gene expression and enzyme activities.

    PubMed

    Hesberg, Christine; Hänsch, Robert; Mendel, Ralf R; Bittner, Florian

    2004-04-02

    Xanthine dehydrogenase from the plant Arabidopsis thaliana was analyzed on molecular and biochemical levels. Whereas most other organisms appear to own only one gene for xanthine dehydrogenase A. thaliana possesses two genes in tandem orientation spaced by 704 base pairs. The cDNAs as well as the proteins AtXDH1 and AtXDH2 share an overall identity of 93% and show high homologies to xanthine dehydrogenases from other organisms. Whereas AtXDH2 mRNA is expressed constitutively, alterations of AtXDH1 transcript levels were observed at various stresses like drought, salinity, cold, and natural senescence, but also after abscisic acid treatment. Transcript alteration did not mandatorily result in changes of xanthine dehydrogenase activities. Whereas salt treatment had no effect on xanthine dehydrogenase activities, cold stress caused a decrease, but desiccation and senescence caused a strong increase of activities in leaves. Because AtXDH1 presumably is the more important isoenzyme in A. thaliana it was expressed in Pichia pastoris, purified, and used for biochemical studies. AtXDH1 protein is a homodimer of about 300 kDa consisting of identical subunits of 150 kDa. Like xanthine dehydrogenases from other organisms AtXDH1 uses hypoxanthine and xanthine as main substrates and is strongly inhibited by allopurinol. AtXDH1 could be activated by the purified molybdenum cofactor sulfurase ABA3 that converts inactive desulfo-into active sulfoenzymes. Finally it was found that AtXDH1 is a strict dehydrogenase and not an oxidase, but is able to produce superoxide radicals indicating that besides purine catabolism it might also be involved in response to various stresses that require reactive oxygen species.

  3. Differential gene expressions in arbuscular mycorrhizal-colonized tomato grown under heavy metal stress.

    PubMed

    Ouziad, Fouad; Hildebrandt, Ulrich; Schmelzer, Elmon; Bothe, Hermann

    2005-06-01

    When tomato was grown in either "Breinigerberg" soil, which has a high content of Zn and of other heavy metals or in non-polluted soil enriched with up to 1 mM CdCl2, plants colonized with the arbuscular mycorrhizal fungus (AMF) Glomus intraradices grew distinctly better than non-mycorrhizal controls. An analysis of differential mRNA transcript formations was performed on several plant genes coding for products potentially involved in heavy metal tolerance. Northern blot analyses indicated that the mRNA from either roots or leaves was not differentially expressed in the case of LePCS1 (coding for phytochelatin synthase), Lemt1, Lemt3 and Lemt4 (for metallothioneins) or LeNramp2 (for a broad range heavy metal transporter) in both mycorrhizal and non-mycorrhizal plants, grown either with or without heavy metals. In contrast, Lemt2 was strongly expressed only in non-AMF-colonized roots, and only after growth in the Breinigerberg soil or in the presence of high CdCl2-concentrations. AMF colonization distinctly reduced the level of Lemt2 transcripts. This was also the case for the root specific LeNramp1 transporter, however, only after growth in the Breinigerberg soil, but not under Cd-stress. Likewise, the levels of LeNramp3 transcripts were reduced by the AMF colonization in roots, but not in leaves. Quantitative Real-Time RT-PCR-experiments performed with Lemt2, LeNramp1 and LeNramp3 largely corroborated the Northern analysis data. In situ hybridization experiments with Lemt2 and LeNramp1 showed that both genes were strongly expressed throughout the plant cells in non-colonized roots, whereas colonized roots revealed only few signals restricted to some parenchyma cells. All the data suggest that the transcript levels of some, but not all genes of the Nramp or mt family are elevated under heavy metal stress. AMF colonization results in a down-regulation of these genes, presumably due to the fact that the content of heavy metals is lower in mycorrhizal than in non

  4. Effects of Rilpivirine on Human Adipocyte Differentiation, Gene Expression, and Release of Adipokines and Cytokines

    PubMed Central

    Díaz-Delfín, Julieta; Domingo, Pere; Mateo, Maria Gracia; Gutierrez, Maria del Mar; Domingo, Joan Carles; Giralt, Marta

    2012-01-01

    Rilpivirine is a nonnucleoside reverse transcriptase inhibitor (NNRTI) recently developed as a drug of choice for initial antiretroviral treatment of HIV-1 infection. Disturbances in lipid metabolism and, ultimately, in adipose tissue distribution and function are common concerns as secondary effects of antiretroviral treatment. Efavirenz, the most commonly used NNRTI, causes mild dyslipidemic effects in patients and strongly impaired adipocyte differentiation in vitro. In this study, we provide the first demonstration of the effects of rilpivirine on human adipocyte differentiation, gene expression, and release of regulatory proteins (adipokines and cytokines) and compare them with those caused by efavirenz. Rilpivirine caused a repression of adipocyte differentiation that was associated with impaired expression of the master adipogenesis regulators peroxisome proliferator-activated receptor gamma (PPARγ), CCAAT enhancer binding protein alpha (C/EBPα), and sterol regulatory element binding transcription factor 1 (SREBP-1) and their target genes encoding lipoprotein lipase and the adipokines leptin and adiponectin. Rilpivirine also repressed adiponectin release by adipocytes, but only at high concentrations, and did not alter leptin release. Rilpivirine induced the release of proinflammatory cytokines (interleukin-6 and -8, monocyte chemoattractant protein 1 [MCP-1], plasminogen activator inhibitor type 1 [PAI-1]) only at very high concentrations (10 μM). A comparison of the effects of rilpivirine and efavirenz at the same concentration (4 μM) or even at lower concentrations of efavirenz (2 μM) showed that rilpivirine-induced impairment of adipogenesis and induction of proinflammatory cytokine expression and release were systematically milder than those of efavirenz. It is concluded that rilpivirine causes an antiadipogenic and proinflammatory response pattern, but only at high concentrations, whereas efavirenz causes similar effects at lower concentrations

  5. Analysis of differential gene expression during floral bud abortion in radish (Raphanus sativus L.).

    PubMed

    Zhang, J; Sun, X L; Zhang, L G; Hui, M X; Zhang, M K

    2013-07-24

    Radish floral bud abortion (FBA) is an adverse biological phenomenon that occurs during reproduction. Although FBA occurs frequently, its mechanism remains unknown. To elucidate the molecular mechanism underlying FBA, we detected gene expression differences between aborted and normal buds of radish using cDNA-amplified fragment length polymorphism (AFLP) and real-time polymerase chain reaction (real-time PCR). A total of 221 differentially expressed transcript-derived fragments (TDFs) were detected by 256 cDNA-AFLP primer combinations, of which 114 were upregulated and 107 were downregulated in the aborted buds. A total of 54 TDFs were cloned and sequenced. A BLAST search revealed that all TDFs have homologous sequences and 29 of these corresponded to known genes, whose functions were mainly related to metabolism, stimulus response, transcriptional regulation, and transportation. Expressions of 6 TDFs with different functions were further analyzed by real-time PCR yielding expression profiling results consistent with the cDNA-AFLP analysis. Our results indicated that radish FBA is related to abnormalities in various physiological and biochemical plant processes.

  6. Identification of differentially expressed genes in the development of osteosarcoma using RNA-seq

    PubMed Central

    Yang, Yihao; Zhang, Ya; Qu, Xin; Xia, Junfeng; Li, Dongqi; Li, Xiaojuan; Wang, Yu; He, Zewei; Li, Su; Zhou, Yonghong; Xie, Lin; Yang, Zuozhang

    2016-01-01

    Objective Osteosarcoma (OS) is a malignant bone tumor with high morbidity in young adults and adolescents. This study aimed to discover potential early diagnosis biomarkers in OS. Results In total, 111 differentially expressed genes (DEGs) were identified in primary OS compared with normal controls and 235 DEGs were identified in metastatic OS compared with primary OS. AURKB and PPP2R2B were the significantly up-regulated and down-regulated hub proteins, respectively, in the PPI protein-protein network (PPI) network of primary OS. ISG15 and BTRC were the significantly up-regulated and down-regulated hub proteins, respectively, in the network of metastatic OS. The DEGs in metastatic OS compared with primary OS were significantly enriched in the arachidonic acid metabolism, malaria, and chemokine signaling pathways. Finally, we employed quantitative real-time polymerase chain reaction (qRT-PCR) to validate the expression levels of candidate DEGs and the results indicated that our bioinformatics approach was acceptable. Materials and Methods The mRNA expression profiling of 20 subjects was obtained through high-throughput RNA-sequencing. DEGs were identified between primary OS and normal Control, and between primary OS and metastatic OS, respectively. Functional annotation and PPI networks were used to obtain insights into the functions of DEGs. qRT-PCR was performed to detect the expression levels of dysregulated genes in OS. Conclusions Our work might provide groundwork for the further exploration of tumorigenesis and metastasis mechanisms of OS. PMID:27888627

  7. Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse.

    PubMed

    Wang, P Jeremy; Page, David C; McCarrey, John R

    2005-10-01

    We have examined expression during spermatogenesis in the mouse of three Y-linked genes, 11 X-linked genes and 22 autosomal genes, all previously shown to be germ-cell-specific and expressed in premeiotic spermatogonia, plus another 21 germ-cell-specific autosomal genes that initiate expression in meiotic spermatocytes. Our data demonstrate that, like sex-linked housekeeping genes, germ-cell-specific sex-linked genes are subject to meiotic sex-chromosome inactivation (MSCI). Although all the sex-linked genes we investigated underwent MSCI, 14 of the 22 autosomal genes expressed in spermatogonia showed no decrease in expression in meiotic spermatocytes. This along with our observation that an additional 21 germ-cell-specific autosomal genes initiate or significantly up-regulate expression in spermatocytes confirms that MSCI is indeed a sex-chromosome-specific effect. Our results further demonstrate that the chromosome-wide repression imposed by MSCI is limited to meiotic spermatocytes and that postmeiotic expression of sex-linked genes is variable. Thus, 13 of the 14 sex-linked genes we examined showed some degree of postmeiotic reactivation. The extent of postmeiotic reactivation of germ-cell-specific X-linked genes did not correlate with proximity to the X inactivation center or the Xist gene locus. The implications of these findings are discussed with respect to differential gene regulation and the function of MSCI during spermatogenesis, including epigenetic programming of the future paternal genome during spermatogenesis.

  8. Identification of differentially expressed genes from multipotent epithelia at the onset of an asexual development

    PubMed Central

    Ricci, Lorenzo; Chaurasia, Ankita; Lapébie, Pascal; Dru, Philippe; Helm, Rebecca R.; Copley, Richard R.; Tiozzo, Stefano

    2016-01-01

    Organisms that have evolved alternative modes of reproduction, complementary to the sexual mode, are found across metazoans. The chordate Botryllus schlosseri is an emerging model for asexual development studies. Botryllus can rebuild its entire body from a portion of adult epithelia in a continuous and stereotyped process called blastogenesis. Anatomy and ontogenies of blastogenesis are well described, however molecular signatures triggering this developmental process are entirely unknown. We isolated tissues at the site of blastogenesis onset and from the same epithelia where this process is never triggered. We linearly amplified an ultra-low amount of mRNA (<10ng) and generated three transcriptome datasets. To provide a conservative landscape of transcripts differentially expressed between blastogenic vs. non-blastogenic epithelia we compared three different mapping and analysis strategies with a de novo assembled transcriptome and partially assembled genome as references, additionally a self-mapping strategy on the dataset. A subset of differentially expressed genes were analyzed and validated by in situ hybridization. The comparison of different analyses allowed us to isolate stringent sets of target genes, including transcripts with potential involvement in the onset of a non-embryonic developmental pathway. The results provide a good entry point to approach regenerative event in a basal chordate. PMID:27264734

  9. Differential hormonal and gene expression dynamics in two inbred sunflower lines with contrasting dormancy level.

    PubMed

    Roselló, Paula L; Vigliocco, Ana E; Andrade, Andrea M; Riera, Natalí V; Calafat, Mario; Molas, María L; Alemano, Sergio G

    2016-05-01

    Seed germination and dormancy are tightly regulated by hormone metabolism and signaling pathway. We investigated the endogenous content of abscisic acid (ABA), its catabolites, and gibberellins (GAs), as well as the expression level of certain ABA and GAs metabolic and signaling genes in embryo of dry and imbibed cypselas of inbred sunflower (Helianthus annuus L., Asteraceae) lines: B123 (dormant) and B91 (non-dormant). Under our experimental conditions, the expression of RGL2 gene might be related to the ABA peak in B123 line at 3 h of imbibition. Indeed, RGL2 transcripts are absent in dry and early embedded cypselas of the non-dormant line B91. ABA increase was accompanied by a significant ABA-Glucosyl ester (ABA-GE) and phaseic acid (PA) (two ABA catabolites) decrease in B123 line (3 h) which indicates that ABA metabolism seems to be more active in this line, and that it would be involved in the imposition and maintenance of sunflower seed dormancy, as it has been reported for many species. Finally, an increase of bioactive GAs (GA1 and GA3) occurs at 12 h of imbibition in both lines after a decrease in ABA content. This study shows the first report about the RGL2 tissue-specific gene expression in sunflower inbred lines with contrasting dormancy level. Furthermore, our results provide evidence that ABA and GAs content and differential expression of metabolism and signaling genes would be interacting in seed dormancy regulation through a mechanism of action related to embryo itself.

  10. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  11. Electrical stimulation and testosterone differentially enhance expression of regeneration-associated genes.

    PubMed

    Sharma, Nijee; Marzo, Sam J; Jones, Kathryn J; Foecking, Eileen M

    2010-05-01

    As functional recovery following peripheral nerve injury is dependent upon successful repair and regeneration, treatments that enhance different regenerative events may be advantageous. Using a rat facial nerve crush axotomy model, our lab has previously investigated the effects of a combinatorial treatment strategy, consisting of electrical stimulation (ES) of the proximal nerve stump and testosterone propionate (TP) administration. Results indicated that the two treatments differentially enhance facial nerve regenerative properties, whereby ES reduced the delay before sprout formation, TP accelerated the overall regeneration rate, and the combinatorial treatment had additive effects. To delineate the molecular mechanisms underlying such treatments, the present study investigated the effects of ES and TP on expression of specific regeneration-associated genes. Following a right facial nerve crush at the stylomastoid foramen, gonadectomized adult male rats were administered only ES, only TP, a combination of both, or left untreated. Real time RT-PCR analysis was used to assess fold changes in mRNA levels in the facial motor nucleus at 0 h, 6 h, 1 d, 2 d, 7 d, and 21 d post-axotomy. The candidate genes analyzed included two tubulin isoforms (alpha(1)-tubulin and beta(II)-tubulin), 43-kiloDalton growth-associated protein (GAP-43), brain derived neurotrophic factor (BDNF), pituitary adenylate cyclase-activating peptide (PACAP), and neuritin (candidate plasticity-related gene 15). The two treatments have differential effects on gene expression, with ES leading to early but transient upregulation and TP producing late but steady increases in mRNA levels. In comparison to individual treatments, the combinatorial treatment strategy has the most enhanced effects on the transcriptional program activated following injury.

  12. Variable sensitivity to noxious heat is mediated by differential expression of the CGRP gene

    SciTech Connect

    Chesler, Elissa J; Mogil, Jeffrey; Miermeister, Frank; Frank, Seifert; Strasburg, Kate; Zimmermann, Katharina; Reinold, Heiko; Austin, Jean; Bernardini, Nadia

    2005-01-01

    Heat sensitivity shows considerable functional variability in humans and laboratory animals, and is fundamental to inflammatory and possibly neuropathic pain. In the mouse, at least, much of this variability is genetic because inbred strains differ robustly in their behavioral sensitivity to noxious heat. These strain differences are shown here to reflect differential responsiveness of primary afferent thermal nociceptors to heat stimuli. We further present convergent behavioral and electrophysiological evidence that the variable responses to noxious heat are due to strain-dependence of CGRP expression and sensitivity. Strain differences in behavioral response to noxious heat could be abolished by peripheral injection of CGRP, blockade of cutaneous and spinal CGRP receptors, or long-term inactivation of CGRP with a CGRP-binding Spiegelmer. Linkage mapping supports the contention that the genetic variant determining variable heat pain sensitivity across mouse strains affects the expression of the Calca gene that codes for CGRP

  13. Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit.

    PubMed

    Aluru, Maneesha R; Mazourek, Michael; Landry, Laurie G; Curry, Jeanne; Jahn, Molly; O'Connell, Mary A

    2003-07-01

    The biosynthesis of capsaicinoids in the placenta of chilli fruit is modelled to require components of the fatty acid synthase (FAS) complex. Three candidate genes for subunits in this complex, Kas, Acl, and Fat, isolated based on differential expression, were characterized. Transcription of these three genes was placental-specific and RNA abundance was positively correlated with degree of pungency. Kas and Acl were mapped to linkage group 1 and Fat to linkage group 6. None of the genes is linked to the pungency locus, C, on linkage group 2. KAS accumulation was positively correlated with pungency. Western blots of placental extracts and histological sections both demonstrated that the accumulation of this enzyme was correlated with fruit pungency and KAS was immunolocalized to the expected cell layer, the placental epidermis. Enzyme activity of the recombinant form of the placental-specific KAS was confirmed using crude cell extracts. These FAS components are fruit-specific members of their respective gene families. These genes are predicted to be associated with Capsicum fruit traits, for example, capsaicinoid biosynthesis or fatty acid biosynthesis necessary for placental development.

  14. Differential expression of molybdenum transport and assimilation genes between two winter wheat cultivars (Triticum aestivum).

    PubMed

    Nie, Zhaojun; Hu, Chengxiao; Liu, Hongen; Tan, Qiling; Sun, Xuecheng

    2014-09-01

    Molybdenum (Mo) is an essential trace element for higher plants. Winter wheat cultivar 97003 has a higher Mo efficiency than 97014 under Mo-deficiency stress. Mo efficiency is related to Mo uptake, transfer and assimilation in plants. Several genes are involved in regulating Mo uptake, transfer and assimilation in plants. To obtain a better understanding of the aforementioned difference in Mo uptake, we have conducted a hydroponic trail to investigate the expression of genes related to Mo uptake, transfer and assimilation in the above two cultivars. The results indicate a closed relationship between Mo uptake and TaSultr5.1, TaSultr5.2 and TaCnx1 expression, according to a stepwise regression analysis of the time course of Mo uptake in the two cultivars. Meanwhile, expression of TaSultr5.2 in roots also showed a positive relationship with Mo uptake rates. 97003 had stronger Mo uptake than 97014 at low Mo-application rates (less than 1 μmol Mo L(-1)) due to the higher expression of TaSultr5.2, TaSultr5.1 and TaCnx1 in roots. On the contrary, Mo uptake of 97003 was weaker than 97014 at high Mo application rates (ranging from 5 to 20 μmol Mo L(-1)), which was related to significant down-regulation of TaSultr5.2 and TaCnx1 genes in roots of 97003 compared to 97014. Therefore, we speculated that the differential-expression intensities of TaSultr5.2, TaSultr5.1 and TaCnx1 could be the cause of the difference in Mo uptake between the two winter wheat cultivars at low and high Mo application levels.

  15. [Expression of CFL gene during differentiation of floral and vegetative buds in cucumber cotyledonary nodes cultured in vitro].

    PubMed

    Wang, Li-Lin; Pang, Ji-Liang; Liang, Hai-Man; Zhu, Mu-Yuan

    2004-12-01

    CFL gene, a LFY homologue, was cloned from cucumber (Cucumis sativus L.). In this paper, in situ hybridization was performed to analyze the expression pattern of CFL gene at the stage of floral and vegetative buds differentiation in cucumber cotyledonary nodes cultured in vitro. The results showed that at the stage of floral differentiation, CFL gene was strongly expressed in primordia, floral organ primordia, and each whirl of floral organs at the early stage of their formation, but weakly expressed or not expressed in floral organs after their formation (Fig. 2). At the stage of vegetative bud differentiation, CFL gene was strongly expressed in meristem, leaf primordium and young leaves, and no apparent expression signal was detected in mature tissues (Fig. 3). The results suggest that the expression of CFL gene be necessary for the differentiation and formation of floral and vegetative primordias, and it plays an important role in floral and vegetative development in cucumber. The results also indicate that CFL gene involving in mitosis initiation, mitosis controlling, and transformation of vegetative meristem to floral meristem.

  16. Pathways and genes differentially expressed in the motor cortex of patients with sporadic amyotrophic lateral sclerosis

    PubMed Central

    Lederer, Carsten W; Torrisi, Antonietta; Pantelidou, Maria; Santama, Niovi; Cavallaro, Sebastiano

    2007-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a fatal disorder caused by the progressive degeneration of motoneurons in brain and spinal cord. Despite identification of disease-linked mutations, the diversity of processes involved and the ambiguity of their relative importance in ALS pathogenesis still represent a major impediment to disease models as a basis for effective therapies. Moreover, the human motor cortex, although critical to ALS pathology and physiologically altered in most forms of the disease, has not been screened systematically for therapeutic targets. Results By whole-genome expression profiling and stringent significance tests we identify genes and gene groups de-regulated in the motor cortex of patients with sporadic ALS, and interpret the role of individual candidate genes in a framework of differentially expressed pathways. Our findings emphasize the importance of defense responses and cytoskeletal, mitochondrial and proteasomal dysfunction, reflect reduced neuronal maintenance and vesicle trafficking, and implicate impaired ion homeostasis and glycolysis in ALS pathogenesis. Additionally, we compared our dataset with publicly available data for the SALS spinal cord, and show a high correlation of changes linked to the diseased state in the SALS motor cortex. In an analogous comparison with data for the Alzheimer's disease hippocampus we demonstrate a low correlation of global changes and a moderate correlation for changes specifically linked to the SALS diseased state. Conclusion Gene and sample numbers investigated allow pathway- and gene-based analyses by established error-correction methods, drawing a molecular portrait of the ALS motor cortex that faithfully represents many known disease features and uncovers several novel aspects of ALS pathology. Contrary to expectations for a tissue under oxidative stress, nuclear-encoded mitochondrial genes are uniformly down-regulated. Moreover, the down-regulation of mitochondrial and glycolytic

  17. Longitudinal muscle gene expression patterns associated with differential intramuscular fat in cattle.

    PubMed

    Hudson, N J; Reverter, A; Greenwood, P L; Guo, B; Cafe, L M; Dalrymple, B P

    2015-04-01

    Intramuscular fat (IMF) can improve meat product quality through its impact on flavour and juiciness. High marbling cuts can command premium prices in some countries and grading systems, but there is substantial cost involved in choosing to grain feed animals in an effort to deposit more IMF. There would be value in developing methods to predict predisposition to 'marble' well. Unfortunately, the biological mechanisms underpinning marbling remain a mystery: the key adipocyte cell populations have not been defined, there are no reliable DNA markers, no known (if any) causal mutations and gene expression analyses in the main have tended to characterise increases in expression of end-point fat metabolism proteins such as the fatty acid-binding proteins. To shed light on expression-based markers of marbling potential, we contrasted LD gene expression in high IMF Wagyu cross animals with a low IMF Piedmontese cross at various time points. The expected divergence in the fat metabolism genes FABP4, THRSP, CIDEC and ACACA between the breeds occurs surprisingly late in postnatal development at about 20 months. On the other hand, divergent expression of WISP2, RAI14 and CYP4F2 was discovered in animals at or before 12 months of age, suggesting these genes may have potential as earlier predictors of marbling potential. In line with other researchers, we found intriguing links between IMF development and connective tissue remodelling. WISP2 - a novel adipokine highly expressed and secreted by adipose precursor cells and an inhibitor of the pro-fibrotic connective tissue growth factor - emerges as a particularly attractive candidate. It is relatively upregulated in high marbling Wagyu before admission to feedlotting, somewhere between 7 and 12 months. This difference is subsequently maintained until 25 months, but not thereafter. RAI14, thought to play a role in porcine adipocyte differentiation and with links to retinoic acid metabolism, has an unusual expression profile. Its

  18. DExD/H-box RNA helicase genes are differentially expressed between males and females during the critical period of male sex differentiation in channel catfish.

    PubMed

    Tian, Changxu; Tan, Suxu; Bao, Lisui; Zeng, Qifan; Liu, Shikai; Yang, Yujia; Zhong, Xiaoxiao; Liu, Zhanjiang

    2017-03-01

    DExD/H-box RNA helicases are motor proteins participating in nearly all aspects of cellular processes, especially in RNA metabolism. In this study, a total of 54 DExD/H-box RNA helicase genes including 37 DDX (DEAD-box) and 17 DHX (DEAH-box) genes were characterized in channel catfish (Ictalurus punctatus), and annotated through phylogenetic and syntenic analyses. All the catfish RNA helicases contained conserved helicase signature motifs, demonstrating that the RNA helicase gene family was highly conserved. Analysis of the relative rates of synonymous (dS) and nonsynonymous (dN) substitutions revealed that the RNA helicase genes were subjected to strong negative (purifying) selection. Meta-analysis was conducted to determine expression of the RNA helicase genes during the critical period (90-110days post-fertilization, dpf) of male gonad differentiation. At 90dpf, 24 RNA helicase genes were highly differentially expressed in the gonad tissues between the males and females; similarly, 24 and 18 RNA helicase genes were found highly differentially expressed in the gonad tissues between the males and females at 100 and 110dpf, respectively (p<0.01). In general, the vast majority of the RNA helicase genes (31) were expressed at higher levels in females than in males. In the male gonad, a set of 8 RNA helicases were expressed at a significantly higher level at 110dpf than at 90dpf. These findings suggested that RNA helicases may play important roles in sex development and differentiation in teleosts.

  19. Differential expression of toll-like receptor genes: sepsis compared with sterile inflammation 1 day before sepsis diagnosis.

    PubMed

    Lissauer, Matthew E; Johnson, Steven B; Bochicchio, Grant V; Feild, Carinda J; Cross, Alan S; Hasday, Jeffrey D; Whiteford, Craig C; Nussbaumer, William A; Towns, Michael; Scalea, Thomas M

    2009-03-01

    Toll-like receptors (TLRs) are critical components of innate immunity. This study was designed to evaluate differential expression of genes for TLR and associated signal transduction molecules in critically ill patients developing sepsis compared with those with sterile inflammation. Uninfected critically ill patients with systemic inflammatory response syndrome were prospectively followed daily for development of sepsis. They were divided into two groups and compared in a case-control manner: (a) preseptic patients (n = 45) who subsequently developed sepsis, and (b) uninfected systemic inflammatory response syndrome patients (n = 45) who remained uninfected. Whole blood RNA was collected (PAXGene tube) at study entry and 1, 2, and 3 days before clinical sepsis diagnosis (or time-matched uninfected control) and analyzed via Affymetrix Hg_U133 Plus 2.0 microarrays. Genes were considered differentially expressed if they met univariate significance controlled for multiple comparisons at P < 0.005. Differentially expressed probes were uploaded into the Database for Annotation, Visualization and Integrated Discovery. The TLR pathway (Kyoto Encyclopedia of Genes and Genomes-KEGG) significance was determined via Expression Analysis Systematic Explorer (EASE) scoring. A total of 2,974 Affymetrix probes representing 2,190 unique genes were differentially expressed 1 day before sepsis diagnosis. Thirty-six probes representing 25 genes were annotated to the TLR pathway (KEGG) via the Database for Annotation, Visualization and Integrated Discovery with an EASE score at P < 0.0004. Notable TLR genes demonstrating increased expression include TLR-4 (median, 1.43-fold change), TLR-5 (2.08-fold change), and MAPK14 (1.90-fold change). An additional 11 unique genes were manually annotated into the TLR pathway based on known relevance such as TLR-8 (1.54-fold change). The total 36 genes contained 28 showing increased expression and 8 showing decreased expression. Differential gene

  20. Identification of differentially expressed genes in HPV-positive and HPV-negative oropharyngeal squamous cell carcinomas

    PubMed Central

    Martinez, Ivan; Wang, Jun; Hobson, Kenosha F.; Ferris, Robert L.; Khan, Saleem A.

    2007-01-01

    Human papillomaviruses (HPVs) have been implicated in the pathogenesis of a subset of squamous cell carcinoma of the head and neck (SCCHN). The goal of this study was to compare the cellular gene expression profiles of HPV-positive and HPV-negative oropharyngeal carcinomas with those of the normal oral epithelium. Using Affymetrix Human U133A GeneChip, our results showed that 397 genes were differentially expressed in HPV-positive SCCHN compared to the normal oral epithelium. The up-regulated genes included those involved in cell cycle regulation (CDKN2A), cell differentiation (SFRP4) and DNA repair (RAD51AP1), while the down-regulated genes included those involved in proteolysis (PRSS3). We also found 162 differentially expressed genes in HPV-negative SCCHN compared to the normal oral mucosa. The up-regulated genes included those involved in cell proliferation (AKR1C3) and transcription regulation (SNAPC1), while down-regulated genes included those involved in apoptosis (CLU) and RNA processing (RBM3). Our studies also identified a subgroup of 59 differentially expressed genes in HPV-positive SCCHN as compared to both HPV-negative SCCHN and normal oral tissues. Such up-regulated genes included those involved in nuclear structure and meiosis (SYCP2), DNA repair (RFC5), and transcription regulation (ZNF238). Genes involved in proteolysis (KLK8) and signal transduction (CRABP2) were found to be down-regulated in HPV-positive SCCHN. The results of GeneChip experiments were validated by quantitative real-time RT-PCR analysis of a few representative genes. Our results reveal specific gene expression patterns in HPV-positive and HPV-negative oropharyngeal squamous carcinomas that may serve as potential biomarkers for the development of SCCHN. PMID:17079134

  1. Transcriptome analyses and differential gene expression in a non-model fish species with alternative mating tactics

    PubMed Central

    2014-01-01

    Background Social dominance is important for the reproductive success of males in many species. In the black-faced blenny (Tripterygion delaisi) during the reproductive season, some males change color and invest in nest making and defending a territory, whereas others do not change color and ‘sneak’ reproductions when females lay their eggs. Using RNAseq, we profiled differential gene expression between the brains of territorial males, sneaker males, and females to study the molecular signatures of male dimorphism. Results We found that more genes were differentially expressed between the two male phenotypes than between males and females, suggesting that during the reproductive period phenotypic plasticity is a more important factor in differential gene expression than sexual dimorphism. The territorial male overexpresses genes related to synaptic plasticity and the sneaker male overexpresses genes involved in differentiation and development. Conclusions Previously suggested candidate genes for social dominance in the context of alternative mating strategies seem to be predominantly species-specific. We present a list of novel genes which are differentially expressed in Tripterygion delaisi. This is the first genome-wide study for a molecular non-model species in the context of alternative mating strategies and provides essential information for further studies investigating the molecular basis of social dominance. PMID:24581002

  2. Differential expression of a subset of ribosomal protein genes in cell lines derived from human nasopharyngeal epithelium.

    PubMed

    Sim, Edmund Ui Hang; Ang, Chow Hiang; Ng, Ching Ching; Lee, Choon Weng; Narayanan, Kumaran

    2010-02-01

    Extraribosomal functions of human ribosomal proteins (RPs) include the regulation of cellular growth and differentiation, and are inferred from studies that linked congenital disorders and cancer to the deregulated expression of RP genes. We have previously shown the upregulation and downregulation of RP genes in tumors of colorectal and nasopharyngeal carcinomas (NPCs), respectively. Herein, we show that a subset of RP genes for the large ribosomal subunit is differentially expressed among cell lines derived from the human nasopharyngeal epithelium. Three such genes (RPL27, RPL37a and RPL41) were found to be significantly downregulated in all cell lines derived from NPC tissues compared with a nonmalignant nasopharyngeal epithelial cell line. The expression of RPL37a and RPL41 genes in human nasopharyngeal tissues has not been reported previously. Our findings support earlier suspicions on the existence of NPC-associated RP genes, and indicate their importance in human nasopharyngeal organogenesis.

  3. Poly(Dimethylsiloxane) (PDMS) Affects Gene Expression in PC12 Cells Differentiating into Neuronal-Like Cells

    PubMed Central

    Łopacińska, Joanna M.; Emnéus, Jenny; Dufva, Martin

    2013-01-01

    Introduction Microfluidics systems usually consist of materials like PMMA - poly(methyl methacrylate) and PDMS - poly(dimethylsiloxane) and not polystyrene (PS), which is usually used for cell culture. Cellular and molecular responses in cells grown on PS are well characterized due to decades of accumulated research. In contrast, the experience base is limited for materials used in microfludics chip fabrication. Methods The effect of different materials (PS, PMMA and perforated PMMA with a piece of PDMS underneath) on the growth and differentiation of PC12 (adrenal phaeochromocytoma) cells into neuronal-like cells was investigated using cell viability, cell cycle distribution, morphology, and gene expression analysis. Results/Conclusions After differentiation, the morphology, viability and cell cycle distribution of PC12 cells grown on PS, PMMA with and without PDMS underneath was the same. By contrast, 41 genes showed different expression for PC12 cells differentiating on PMMA as compared to on PS. In contrast, 677 genes showed different expression on PMMA with PDMS underneath as compared with PC12 cells on PS. The differentially expressed genes are involved in neuronal cell development and function. However, there were also many markers for neuronal cell development and functions that were expressed similarly in cells differentiating on PS, PMMA and PMMA with PDMS underneath. In conclusion, it was shown that PMMA has a minor impact and PDMS a major impact on gene expression in PC12 cells. PMID:23301028

  4. Tissue-Specific Venom Composition and Differential Gene Expression in Sea Anemones

    PubMed Central

    Macrander, Jason; Broe, Michael; Daly, Marymegan

    2016-01-01

    Cnidarians represent one of the few groups of venomous animals that lack a centralized venom transmission system. Instead, they are equipped with stinging capsules collectively known as nematocysts. Nematocysts vary in abundance and type across different tissues; however, the venom composition in most species remains unknown. Depending on the tissue type, the venom composition in sea anemones may be vital for predation, defense, or digestion. Using a tissue-specific RNA-seq approach, we characterize the venom assemblage in the tentacles, mesenterial filaments, and column for three species of sea anemone (Anemonia sulcata, Heteractis crispa, and Megalactis griffithsi). These taxa vary with regard to inferred venom potency, symbiont abundance, and nematocyst diversity. We show that there is significant variation in abundance of toxin-like genes across tissues and species. Although the cumulative toxin abundance for the column was consistently the lowest, contributions to the overall toxin assemblage varied considerably among tissues for different toxin types. Our gene ontology (GO) analyses also show sharp contrasts between conserved GO groups emerging from whole transcriptome analysis and tissue-specific expression among GO groups in our differential expression analysis. This study provides a framework for future characterization of tissue-specific venom and other functionally important genes in this lineage of simple bodied animals. PMID:27389690

  5. Differential Gene Expression in Five Isolates of the Clam Pathogen, Quahog Parasite Unknown (QPX).

    PubMed

    Rubin, Ewelina; Tanguy, Arnaud; Pales Espinosa, Emmanuelle; Allam, Bassem

    2017-02-07

    Quahog parasite unknown (QPX) is a thraustochytrid protist that infects the hard clam, Mercenaria mercenaria, causing significant economic losses along the northeastern coasts of North America. Previous investigations noted differences in growth dynamics and virulence in QPX cells from different geographic locations. In order to probe the molecular determinants for these variations, we investigated the transcriptomic profiles of five geographically-distinct QPX isolates using custom 15K 60-mer oligonucleotide arrays. A total of 1263 transcripts were differentially expressed (DE) among the five QPX isolates. The hierarchical clustering of gene expression profiles showed that the QPX isolates from Raritan Bay (RB, NY) and from Provincetown Harbor (MA) were more similar to each other and diverged from QPX isolates from Peconic Bay (PB, NY) and Old Plantation Creek (VA) which had more similar gene expression profiles. The most prominent difference was based on 78 transcripts coding for heat shock proteins DE between the five QPX isolates. The study generated contrasting transcriptomic profiles for QPX isolated from northern (MA) and deeper (RB, NY) locations as compared to southern (VA) and shallower (PB, NY) areas, suggesting the adaptation of the parasite to local environmental, in particular temperature, conditions. This article is protected by copyright. All rights reserved.

  6. Reward devaluation and heroin escalation is associated with differential expression of CRF signaling genes.

    PubMed

    McFalls, Ashley J; Imperio, Caesar G; Bixler, Georgina; Freeman, Willard M; Grigson, Patricia Sue; Vrana, Kent E

    2016-05-01

    One of the most damaging aspects of drug addiction is the degree to which natural rewards (family, friends, employment) are devalued in favor of seeking, obtaining and taking drugs. We have utilized an animal model of reward devaluation and heroin self-administration to explore the role of the coricotropin releasing factor (CRF) pathway. Given access to a saccharin cue followed by the opportunity to self-administer heroin, animals will parse into distinct phenotypes that suppress their saccharin intake (in favor of escalating heroin self-administration) or vice versa. We find that large saccharin suppressors (large heroin takers) demonstrate increased mRNA expression for elements of the CRF signaling pathway (CRF, CRF receptors and CRF binding protein) within the hippocampus, medial prefrontal cortex and the ventral tegmental area. Moreover, there were no gene expression changes of these components in the nucleus accumbens. Use of bisulfite conversion sequencing suggests that changes in CRF binding protein and CRF receptor gene expression may be mediated by differential promoter methylation.

  7. Microarray-based characterization of differential gene expression during vocal fold wound healing in rats.

    PubMed

    Welham, Nathan V; Ling, Changying; Dawson, John A; Kendziorski, Christina; Thibeault, Susan L; Yamashita, Masaru

    2015-03-01

    The vocal fold (VF) mucosa confers elegant biomechanical function for voice production but is susceptible to scar formation following injury. Current understanding of VF wound healing is hindered by a paucity of data and is therefore often generalized from research conducted in skin and other mucosal systems. Here, using a previously validated rat injury model, expression microarray technology and an empirical Bayes analysis approach, we generated a VF-specific transcriptome dataset to better capture the system-level complexity of wound healing in this specialized tissue. We measured differential gene expression at 3, 14 and 60 days post-injury compared to experimentally naïve controls, pursued functional enrichment analyses to refine and add greater biological definition to the previously proposed temporal phases of VF wound healing, and validated the expression and localization of a subset of previously unidentified repair- and regeneration-related genes at the protein level. Our microarray dataset is a resource for the wider research community and has the potential to stimulate new hypotheses and avenues of investigation, improve biological and mechanistic insight, and accelerate the identification of novel therapeutic targets.

  8. Using Transcriptomics to Identify Differential Gene Expression in Response to Salinity among Australian Phragmites australis Clones

    PubMed Central

    Holmes, Gareth D.; Hall, Nathan E.; Gendall, Anthony R.; Boon, Paul I.; James, Elizabeth A.

    2016-01-01

    Common Reed (Phragmites australis) is a frequent component of inland and coastal wetlands in temperate zones worldwide. Ongoing environmental changes have resulted in the decline of this species in many areas and invasive expansion in others. In the Gippsland Lakes coastal waterway system in south-eastern Australia, increasing salinity is thought to have contributed to the loss of fringing P. australis reed beds leading to increased shoreline erosion. A major goal of restoration in this waterway is to address the effect of salinity by planting a genetically diverse range of salt-tolerant P. australis plants. This has prompted an interest in examining the variation in salinity tolerance among clones and the underlying basis of this variation. Transcriptomics is an approach for identifying variation in genes and their expression levels associated with the exposure of plants to environmental stressors. In this paper we present initial results of the first comparative culm transcriptome analysis of P. australis clones. After sampling plants from sites of varied surface water salinity across the Gippsland Lakes, replicates from three clones from highly saline sites (>18 g L-1 TDS) and three from low salinity sites (<6 g L-1) were grown in containers irrigated with either fresh (<0.1 g L-1) or saline water (16 g L-1). An RNA-Seq protocol was used to generate sequence data from culm tissues from the 12 samples allowing an analysis of differential gene expression. Among the key findings, we identified several genes uniquely up- or down-regulated in clones from highly saline sites when irrigated with saline water relative to clones from low salinity sites. These included the higher relative expression levels of genes associated with photosynthesis and lignan biosynthesis indicative of a greater ability of these clones to maintain growth under saline conditions. Combined with growth data from a parallel study, our data suggests local adaptation of certain clones to salinity

  9. Using Transcriptomics to Identify Differential Gene Expression in Response to Salinity among Australian Phragmites australis Clones.

    PubMed

    Holmes, Gareth D; Hall, Nathan E; Gendall, Anthony R; Boon, Paul I; James, Elizabeth A

    2016-01-01

    Common Reed (Phragmites australis) is a frequent component of inland and coastal wetlands in temperate zones worldwide. Ongoing environmental changes have resulted in the decline of this species in many areas and invasive expansion in others. In the Gippsland Lakes coastal waterway system in south-eastern Australia, increasing salinity is thought to have contributed to the loss of fringing P. australis reed beds leading to increased shoreline erosion. A major goal of restoration in this waterway is to address the effect of salinity by planting a genetically diverse range of salt-tolerant P. australis plants. This has prompted an interest in examining the variation in salinity tolerance among clones and the underlying basis of this variation. Transcriptomics is an approach for identifying variation in genes and their expression levels associated with the exposure of plants to environmental stressors. In this paper we present initial results of the first comparative culm transcriptome analysis of P. australis clones. After sampling plants from sites of varied surface water salinity across the Gippsland Lakes, replicates from three clones from highly saline sites (>18 g L(-1) TDS) and three from low salinity sites (<6 g L(-1)) were grown in containers irrigated with either fresh (<0.1 g L(-1)) or saline water (16 g L(-1)). An RNA-Seq protocol was used to generate sequence data from culm tissues from the 12 samples allowing an analysis of differential gene expression. Among the key findings, we identified several genes uniquely up- or down-regulated in clones from highly saline sites when irrigated with saline water relative to clones from low salinity sites. These included the higher relative expression levels of genes associated with photosynthesis and lignan biosynthesis indicative of a greater ability of these clones to maintain growth under saline conditions. Combined with growth data from a parallel study, our data suggests local adaptation of certain clones to

  10. Differential gene expression in the rat hippocampus during learning of an operant conditioning task.

    PubMed

    Rapanelli, M; Frick, L R; Zanutto, B S

    2009-11-10

    Changes in transcription levels of brain-derived neurotrophic factor (BDNF), cyclic adenosine monophosphate (cAMP) response element binding (CREB), Synapsin I, Ca(2+)/calmodulin-dependent protein kinase II (CamKII), activity-regulated cytoskeleton-associated protein (Arc), c-jun and c-fos have been associated to several learning paradigms in different brain areas. In this study, we measured mRNA expression in the hippocampus by real time (RT)-PCR mRNA levels of BDNF, CREB, Synapsin I, CamKII, Arc, c-jun and c-fos, during learning and operant conditioning task. Experimental groups were as follows: control (C, the animals never left the bioterium), when the animals reached 50-65% of the expected response (Incompletely Trained, IT), when animals reached 100% of the expected response with a latency time lower than 5 s (Trained, Tr), Box Control of Incompletely Trained (BCIT), animals spent the same time as the IT in the operant conditioning box and Box Control of Trained (BCTr) animals spent the same time as the Tr in the operant conditioning box. All rats were killed at the same time by cervical dislocation 15 min after training and hippocampi were removed and processed. We found increments of mRNA levels of most genes (BDNF, CREB, Synapsin I, Arc, c-jun and c-fos) in IT and Tr groups compared to their box controls, but increments in Tr were smaller compared with IT. These results describe a differential gene expression in the rat hippocampus when the animals are learning and when animals have already learned. Taking together the results presented herein with the known functions of these genes, we propose a link between changes in gene expression in the hippocampus and different degrees of cellular activation and plasticity during learning of an operant conditioning task.

  11. Suppression subtractive hybridization reveals differentially expressed genes in supraspinous ligaments of patients with ankylosing spondylitis.

    PubMed

    Zhang, Ying; Hu, Xu; Zhang, Chao; Zhou, Yue; Chu, Tong-Wei

    2015-06-01

    Ankylosing spondylitis (AS) is a severe chronic inflammatory disease that may ultimately result in the development of a 'bamboo‑like' spine. Although the pathological changes that occur in AS have been extensively investigated, the mechanism underlying spinal fusion during AS remains elusive. Differentially expressed genes (DEGs) in paraspinal tissues from patients with AS compared with those from healthy controls were therefore investigated. Polymerase chain reaction (PCR)‑based suppression subtractive hybridization was performed using total mRNA from the supraspinal ligaments of three patients with AS and three patients with spinal fractures as controls. From this, 27 genes were identified in all of the three independent forward libraries, which were defined as DEGs associated with AS. Reverse transcription‑quantitative PCR demonstrated that six DEGs were overexpressed in the tissues from patients with AS compared with those from individuals in the control group, including those encoding transforming growth factor β types I and III receptor, vascular endothelial growth factor, matrix metalloproteinase‑3, core‑binding factor α1 and bone morphogenetic protein 2. Western blot analysis showed increased expression in all six of these proteins in the samples from patients with AS compared with those in the control groups. These findings suggested that changes in the expression of these genes and proteins are associated with the development of spinal fusion during the pathogenesis of AS. Furthermore, these genes may be novel markers of the risk of developing AS, in addition to being targets for the treatment of this disease.

  12. Differentially expressed genes and interacting pathways in bladder cancer revealed by bioinformatic analysis.

    PubMed

    Shen, Yinzhou; Wang, Xuelei; Jin, Yongchao; Lu, Jiasun; Qiu, Guangming; Wen, Xiaofei

    2014-10-01

    The goal of this study was to identify cancer-associated differentially expressed genes (DEGs), analyze their biological functions and investigate the mechanism(s) of cancer occurrence and development, which may provide a theoretical foundation for bladder cancer (BCa) therapy. We downloaded the mRNA expression profiling dataset GSE13507 from the Gene Expression Omnibus database; the dataset includes 165 BCa and 68 control samples. T‑tests were used to identify DEGs. To further study the biological functions of the identified DEGs, we performed a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Next, we built a network of potentially interacting pathways to study the synergistic relationships among DEGs. A total of 12,105 genes were identified as DEGs, of which 5,239 were upregulated and 6,866 were downregulated in BCa. The DEGs encoding activator protein 1 (AP-1), nuclear factor of activated T-cells (NFAT) proteins, nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) and interleukin (IL)-10 were revealed to participate in the significantly enriched immune pathways that were downregulated in BCa. KEGG enrichment analysis revealed 7 significantly upregulated and 47 significantly downregulated pathways enriched among the DEGs. We found a crosstalk interaction among a total of 44 pathways in the network of BCa-affected pathways. In conclusion, our results show that BCa involves dysfunctions in multiple systems. Our study is expected to pave ways for immune and inflammatory research and provide molecular insights for cancer therapy.

  13. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    PubMed

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    other in the chromosome, suggesting concomitant regulation. Proteins involved in tannin metabolism and regulation, such GacP (gallic acid permease) and TanR (tannin transcriptional regulator), were identified by differential gene expression in knockout mutants with mutations in genes from this region. This study provides insights into the highly coordinated mechanisms that enable L. plantarum to adapt to plant food fermentations.

  14. Differential Gene Expression in Liver, Gill, and Olfactory Rosettes of Coho Salmon (Oncorhynchus kisutch) After Acclimation to Salinity

    PubMed Central

    Lavado, Ramon; Bammler, Theo K.; Gallagher, Evan P.; Stapleton, Patricia L.; Beyer, Richard P.; Farin, Federico M.; Hardiman, Gary; Schlenk, Daniel

    2015-01-01

    Most Pacific salmonids undergo smoltification and transition from freshwater to saltwater, making various adjustments in metabolism, catabolism, osmotic, and ion regulation. The molecular mechanisms underlying this transition are largely unknown. In the present study, we acclimated coho salmon (Oncorhynchus kisutch) to four different salinities and assessed gene expression through microarray analysis of gills, liver, and olfactory rosettes. Gills are involved in osmotic regulation, liver plays a role in energetics, and olfactory rosettes are involved in behavior. Between all salinity treatments, liver had the highest number of differentially expressed genes at 1616, gills had 1074, and olfactory rosettes had 924, using a 1.5-fold cutoff and a false discovery rate of 0.5. Higher responsiveness of liver to metabolic changes after salinity acclimation to provide energy for other osmoregulatory tissues such as the gills may explain the differences in number of differentially expressed genes. Differentially expressed genes were tissue- and salinity-dependent. There were no known genes differentially expressed that were common to all salinity treatments and all tissues. Gene ontology term analysis revealed biological processes, molecular functions, and cellular components that were significantly affected by salinity, a majority of which were tissue-dependent. For liver, oxygen binding and transport terms were highlighted. For gills, muscle, and cytoskeleton-related terms predominated and for olfactory rosettes, immune response-related genes were accentuated. Interaction networks were examined in combination with GO terms and determined similarities between tissues for potential osmosensors, signal transduction cascades, and transcription factors. PMID:26260986

  15. Interleukin-17A Differentially Induces Inflammatory and Metabolic Gene Expression in the Adipose Tissues of Lean and Obese Mice.

    PubMed

    Qu, Yine; Zhang, Qiuyang; Ma, Siqi; Liu, Sen; Chen, Zhiquan; Mo, Zhongfu; You, Zongbing

    2016-04-07

    The functions of interleukin-17A (IL-17A) in adipose tissues and adipocytes have not been well understood. In the present study, male mice were fed with a regular diet (n = 6, lean mice) or a high-fat diet (n = 6, obese mice) for 30 weeks. Subcutaneous adipose tissue (SAT) and visceral adipose tissue (VAT) were analyzed for IL-17A levels. SAT and VAT were treated with IL-17A and analyzed for inflammatory and metabolic gene expression. Mouse 3T3-L1 pre-adipocytes were differentiated into adipocytes, followed with IL-17A treatment and analysis for inflammatory and metabolic gene expression. We found that IL-17A levels were higher in obese SAT than lean SAT; the basal expression of inflammatory and metabolic genes was different between SAT and VAT and between lean and obese adipose tissues. IL-17A differentially induced expression of inflammatory and metabolic genes, such as tumor necrosis factor α, Il-6, Il-1β, leptin, and glucose transporter 4, in adipose tissues of lean and obese mice. IL-17A also differentially induced expression of inflammatory and metabolic genes in pre-adipocytes and adipocytes, and IL-17A selectively activated signaling pathways in adipose tissues and adipocytes. These findings suggest that IL-17A differentially induces inflammatory and metabolic gene expression in the adipose tissues of lean and obese mice.

  16. Sex-biased expression of sex-differentiating genes FOXL2 and FGF9 in American alligators, alligator Mississippiensis.

    PubMed

    Janes, D E; Elsey, R M; Langan, E M; Valenzuela, N; Edwards, S V

    2013-01-01

    Across amniotes, sex-determining mechanisms exhibit great variation, yet the genes that govern sexual differentiation are largely conserved. Studies of evolution of sex-determining and sex-differentiating genes require an exhaustive characterization of functions of those genes such as FOXL2 and FGF9. FOXL2 is associated with ovarian development, and FGF9 is known to play a role in testicular organogenesis in mammals and other amniotes. As a step toward characterization of the evolutionary history of sexual development, we measured expression of FOXL2 and FGF9 across 3 developmental stages and 8 juvenile tissue types in male and female American alligators, Alligator mississippiensis. We report surprisingly high expression of FOXL2 before the stage of embryonic development when sex is determined in response to temperature, and sustained and variable expression of FGF9 in juvenile male, but not female tissue types. Novel characterization of gene expression in reptiles with temperature-dependent sex determination such as American alligators may inform the evolution of sex-determining and sex-differentiating gene networks, as they suggest alternative functions from which the genes may have been exapted. Future functional profiling of sex-differentiating genes should similarly follow other genes and other species to enable a broad comparison across sex-determining mechanisms.

  17. Robust non-linear differential equation models of gene expression evolution across Drosophila development

    PubMed Central

    2012-01-01

    Background This paper lies in the context of modeling the evolution of gene expression away from stationary states, for example in systems subject to external perturbations or during the development of an organism. We base our analysis on experimental data and proceed in a top-down approach, where we start from data on a system's transcriptome, and deduce rules and models from it without a priori knowledge. We focus here on a publicly available DNA microarray time series, representing the transcriptome of Drosophila across evolution from the embryonic to the adult stage. Results In the first step, genes were clustered on the basis of similarity of their expression profiles, measured by a translation-invariant and scale-invariant distance that proved appropriate for detecting transitions between development stages. Average profiles representing each cluster were computed and their time evolution was analyzed using coupled differential equations. A linear and several non-linear model structures involving a transcription and a degradation term were tested. The parameters were identified in three steps: determination of the strongest connections between genes, optimization of the parameters defining these connections, and elimination of the unnecessary parameters using various reduction schemes. Different solutions were compared on the basis of their abilities to reproduce the data, to keep realistic gene expression levels when extrapolated in time, to show the biologically expected robustness with respect to parameter variations, and to contain as few parameters as possible. Conclusions We showed that the linear model did very well in reproducing the data with few parameters, but was not sufficiently robust and yielded unrealistic values upon extrapolation in time. In contrast, the non-linear models all reached the latter two objectives, but some were unable to reproduce the data. A family of non-linear models, constructed from the exponential of linear combinations

  18. Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana

    PubMed Central

    Lovell, John T.; Mullen, Jack L.; Lowry, David B.; Awole, Kedija; Richards, James H.; Sen, Saunak; Verslues, Paul E.; Juenger, Thomas E.; McKay, John K.

    2015-01-01

    Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. PMID:25873386

  19. Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

    PubMed

    Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

    2015-04-01

    Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex.

  20. Identification of genes showing differential expression profile associated with growth rate in skeletal muscle tissue of Landrace weanling pig.

    PubMed

    Komatsu, Yuuta; Sukegawa, Shin; Yamashita, Mai; Katsuda, Naoki; Tong, Bin; Ohta, Takeshi; Kose, Hiroyuki; Yamada, Takahisa

    2016-06-01

    Suppression subtractive hybridization was used to identify genes showing differential expression profile associated with growth rate in skeletal muscle tissue of Landrace weanling pig. Two subtracted cDNA populations were generated from musculus longissimus muscle tissues of selected pigs with extreme expected breeding values at the age of 100 kg. Three upregulated genes (EEF1A2, TSG101 and TTN) and six downregulated genes (ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7) in pig with genetic propensity for higher growth rate were identified by sequence analysis of 12 differentially expressed clones selected by differential screening following the generation of the subtracted cDNA population. Real-time PCR analysis confirmed difference in expression profiles of the identified genes in musculus longissimus muscle tissues between the two Landrace weanling pig groups with divergent genetic propensity for growth rate. Further, differential expression of the identified genes except for the TTN was validated by Western blot analysis. Additionally, the eight genes other than the ATP5C1 colocalized with the same chromosomal positions as QTLs that have been previously identified for growth rate traits. Finally, the changes of expression predicted from gene function suggested association of upregulation of expression of the EEF1A2, TSG101 and TTN genes and downregulation of the ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7 gene expression with increased growth rate. The identified genes will provide an important insight in understanding the molecular mechanism underlying growth rate in Landrace pig breed.

  1. Analyses of differentially expressed genes after exposure to acute stress, acute ethanol, or a combination of both in mice.

    PubMed

    Baker, Jessica A; Li, Jingxin; Zhou, Diana; Yang, Ming; Cook, Melloni N; Jones, Byron C; Mulligan, Megan K; Hamre, Kristin M; Lu, Lu

    2017-02-01

    Alcohol abuse is a complex disorder, which is confounded by other factors, including stress. In the present study, we examined gene expression in the hippocampus of BXD recombinant inbred mice after exposure to ethanol (NOE), stress (RSS), and the combination of both (RSE). Mice were given an intraperitoneal (i.p.) injection of 1.8 g/kg ethanol or saline, and subsets of both groups were exposed to acute restraint stress for 15 min or controls. Gene expression in the hippocampus was examined using microarray analysis. Genes that were significantly (p < 0.05, q < 0.1) differentially expressed were further evaluated. Bioinformatic analyses were predominantly performed using tools available at GeneNetwork.org, and included gene ontology, presence of cis-regulation or polymorphisms, phenotype correlations, and principal component analyses. Comparisons of differential gene expression between groups showed little overlap. Gene Ontology demonstrated distinct biological processes in each group with the combined exposure (RSE) being unique from either the ethanol (NOE) or stress (RSS) group, suggesting that the interaction between these variables is mediated through diverse molecular pathways. This supports the hypothesis that exposure to stress alters ethanol-induced gene expression changes and that exposure to alcohol alters stress-induced gene expression changes. Behavior was profiled in all groups following treatment, and many of the differentially expressed genes are correlated with behavioral variation within experimental groups. Interestingly, in each group several genes were correlated with the same phenotype, suggesting that these genes are the potential origins of significant genetic networks. The distinct sets of differentially expressed genes within each group provide the basis for identifying molecular networks that may aid in understanding the complex interactions between stress and ethanol, and potentially provide relevant therapeutic targets. Using Ptp4

  2. Distinct gene expression responses of two anticonvulsant drugs in a novel human embryonic stem cell based neural differentiation assay protocol.

    PubMed

    Schulpen, Sjors H W; de Jong, Esther; de la Fonteyne, Liset J J; de Klerk, Arja; Piersma, Aldert H

    2015-04-01

    Hazard assessment of chemicals and pharmaceuticals is increasingly gaining from knowledge about molecular mechanisms of toxic action acquired in dedicated in vitro assays. We have developed an efficient human embryonic stem cell neural differentiation test (hESTn) that allows the study of the molecular interaction of compounds with the neural differentiation process. Within the 11-day differentiation protocol of the assay, embryonic stem cells lost their pluripotency, evidenced by the reduced expression of stem cell markers Pou5F1 and Nanog. Moreover, stem cells differentiated into neural cells, with morphologically visible neural structures together with increased expression of neural differentiation-related genes such as βIII-tubulin, Map2, Neurogin1, Mapt and Reelin. Valproic acid (VPA) and carbamazepine (CBZ) exposure during hESTn differentiation led to concentration-dependent reduced expression of βIII-tubulin, Neurogin1 and Reelin. In parallel VPA caused an increased gene expression of Map2 and Mapt which is possibly related to the neural protective effect of VPA. These findings illustrate the added value of gene expression analysis for detecting compound specific effects in hESTn. Our findings were in line with and could explain effects observed in animal studies. This study demonstrates the potential of this assay protocol for mechanistic analysis of specific compound-induced inhibition of human neural cell differentiation.

  3. Metabolomics and differential gene expression in anthocyanin chemo-varietal forms of Perilla frutescens.

    PubMed

    Yamazaki, Mami; Nakajima, Jun-ichiro; Yamanashi, Mutsuki; Sugiyama, Mitsuyo; Makita, Yukiko; Springob, Karin; Awazuhara, Motoko; Saito, Kazuki

    2003-03-01

    We have investigated metabolite profiles and gene expression in two chemo-varietal forms, red and green forms, of Perilla frutescens var. crispa. Striking difference in anthocyanin content was observed between the red and green forms. Anthocyanin, mainly malonylshisonin, was highly accumulated in the leaves of the red form but not in the green form. Less obvious differences were also observed in the stems. However, there was no remarkable difference in the contents and patterns of flavones and primary metabolites such as inorganic anions, organic anions and amino acids. These results suggest that only the regulation of anthocyanin production, but not that of other metabolites, differs in red and green forms. Microscopic observation and immunohistochemical studies indicated that the epidermal cells of leaves and stems are the sites of accumulation of anthocyanins and localization of anthocyanidin synthase protein. By differential display of mRNA from the leaves of red and green forms, we could identify several genes encoding anthocyanin-biosynthetic enzymes and presumptive regulatory proteins. The possible regulatory network leading to differential anthocyanin accumulation in a form-specific manner is discussed.

  4. [Identification and analysis of differentially expressed genes during wood formation in Chinese fir by SSH].

    PubMed

    Wang, Gui-Feng; Gao, Yan; Yang, Li-Wei; Shi, Ji-Sen

    2007-04-01

    Wood is an important raw material for the global industry with rapidly increasing demand. To isolate the differentially expressed genes in xylogenesis of Chinese fir [Cunninghamia lanceolata (Lamb.) Hook], a forward subtractive cDNA library was constructed using suppression subtractive hybridization (SSH) method, which was performed using the cDNA from the mutant Dugansha clone as the tester and the cDNA from the normal Jurong 0 clone as the driver. Six hundred and eighteen clones were obtained. Recombinants were identified using PCR with universal T7 and SP6 primers and using EcoR digestion. To further eliminate false positive, dot hybridization was used with four DIG-labeled probes (FSP, RSP, UTP, and UDP). Real-time PCR was performed to confirm the results. A total of 260 unique ESTs were obtained, 60% of the ESTs exhibiting homologies with proteins of known function fell into 4 major classes: metabolism, cell wall biogenesis and remodeling, signal transduction and stress. The systematic analysis of genes involved in wood formation in Chinese fir provides valuable insights into the molecular mechanisms involved in xylem differentiation, is important resources for forest research directed toward understanding the genetic control of wood formation and future endeavors to modify wood and fiber properties for industrial use.

  5. Impact of Enriched Environment on Murine T Cell Differentiation and Gene Expression Profile

    PubMed Central

    Rattazzi, Lorenza; Piras, Giuseppa; Brod, Samuel; Smith, Koval; Ono, Masahiro; D’Acquisto, Fulvio

    2016-01-01

    T cells are known to be plastic and to change their phenotype according to the cellular and biochemical milieu they are embedded in. In this study, we transposed this concept at a macroscopic level assessing whether changes in the environmental housing conditions of C57/BL6 mice would influence the phenotype and function of T cells. Our study shows that exposure to 2 weeks in an enriched environment (EE) does not impact the T cell repertoire in vivo and causes no changes in the early TCR-driven activation events of these cells. Surprisingly, however, T cells from enriched mice showed a unique T helper effector cell phenotype upon differentiation in vitro. This was featured by a significant reduction in their ability to produce IFN-γ and by an increased release of IL-10 and IL-17. Microarray analysis of these cells also revealed a unique gene fingerprint with key signaling pathways involved in autoimmunity being modulated. Together, our results provide first evidence for a specific effect of EE on T cell differentiation and its associated changes in gene expression profile. In addition, our study sheds new light on the possible mechanisms by which changes in environmental factors can significantly influence the immune response of the host and favor the resolution of the inflammatory response. PMID:27746779

  6. Loss of DCC gene expression during ovarian tumorigenesis: relation to tumour differentiation and progression

    PubMed Central

    Saegusa, M; Machida, D; Okayasu, I

    2000-01-01

    To clarify the possible role of DCC gene alteration in ovarian neoplasias, we immunohistochemically investigated 124 carcinomas, as well as 55 cystadenomas and 41 low malignant potential (LMP) tumours and compared the results with those for p53 protein expression, clinicopathological factors and survival. A combination of the reverse transcription polymerase chain reaction (RT-PCR) and Southern blot hybridization (SBH) for DCC mRNA levels was also carried out on 26 malignant, five LMP, eight benign and seven normal ovarian samples. Significantly decreased levels of overall DCC values in carcinomas compared with benign and LMP lesions were revealed by both immunohistochemical and RT-PCR/SBH assays. Similar findings were also noted when subdivision was into serous and mucinous categories. In carcinomas, reduction or loss of DCC expression was significantly related to the serous phenotype (serous vs non-serous, P< 0.0001), a high histological grade (grade 1 vs 2 or 3, P< 0.02) and a more advanced stage (FIGO stage I vs II/III/IV, P = 0.0083), while no association was noted with survival. Although p53 immunopositivity demonstrated significant stepwise increase from benign through to malignant lesions, there was no clear association with DCC score values. The results indicated that impaired DCC expression may play an important role in ovarian tumorigenesis. In ovarian carcinomas, the altered expression is closely linked with tumour differentiation and progression. © 2000 Cancer Research Campaign PMID:10682668

  7. Differential Gene Expression in the Meristem and during Early Fruit Growth of Pisum sativum L. Identifies Potential Targets for Breeding

    PubMed Central

    Smitha Ninan, Annu; Shah, Anish; Song, Jiancheng; Jameson, Paula E.

    2017-01-01

    For successful molecular breeding it is important to identify targets to the gene family level, and in the specific species of interest, in this case Pisum sativum L. The cytokinins have been identified as a key breeding target due to their influence on plant architecture, and on seed size and sink activity. We focused on the cytokinin biosynthetic gene family (the IPTs) and the gene family key to the destruction of cytokinins (the CKXs), as well as other gene families potentially affected by changing cytokinin levels. These included key meristem genes (WUS and BAM1) and the transporter gene families, sucrose transporters (SUTs) and amino acid permeases (AAPs). We used reverse transcription quantitative PCR (RT-qPCR) to monitor gene expression in the vegetative meristem and in pre- and post-fertilisation young pea fruits. PsWUS expression was specific to the shoot apical meristem while PsBAM1 was highly expressed in the shoot apical meristem (SAM) but was also expressed at a low level in the young fruit. Differential expression was shown between genes and within gene families for IPT, CKX, SUT, and AAP. PsCKX7 showed strong gene family member-specific expression in the SAM, and was also expressed in young pea fruits. We suggest that PsCKX7 is a potential target for downregulation via molecular breeding or gene editing. PMID:28212324

  8. Transcriptomic Analysis of Differentially Expressed Genes during Flower Organ Development in Genetic Male Sterile and Male Fertile Tagetes erecta by Digital Gene-Expression Profiling.

    PubMed

    Ai, Ye; Zhang, Qinghua; Wang, Weining; Zhang, Chunling; Cao, Zhe; Bao, Manzhu; He, Yanhong

    2016-01-01

    Tagetes erecta is an important commercial plant of Asteraceae family. The male sterile (MS) and male fertile (MF) two-type lines of T. erecta have been utilized in F1 hybrid production for many years, but no report has been made to identify the genes that specify its male sterility that is caused by homeotic conversion of floral organs. In this study, transcriptome assembly and digital gene expression profiling were performed to generate expression profiles of MS and MF plants. A cDNA library was generated from an equal mixture of RNA isolated from MS and MF flower buds (1 mm and 4 mm in diameter). Totally, 87,473,431 clean tags were obtained and assembled into 128,937 transcripts among which 65,857 unigenes were identified with an average length of 1,188 bp. About 52% of unigenes (34,176) were annotated in Nr, Nt, Pfam, KOG/COG, Swiss-Prot, KO (KEGG Ortholog database) and/or GO. Taking the above transcriptome as reference, 125 differentially expressed genes were detected in both developmental stages of MS and MF flower buds. MADS-box genes were presumed to be highly related to male sterility in T. erecta based on histological and cytological observations. Twelve MADS-box genes showed significantly different expression levels in flower buds 4 mm in diameter, whereas only one gene expressed significantly different in flower buds 1 mm in diameter between MS and MF plants. This is the first transcriptome analysis in T. erecta and will provide a valuable resource for future genomic studies, especially in flower organ development and/or differentiation.

  9. Transcriptomic Analysis of Differentially Expressed Genes during Flower Organ Development in Genetic Male Sterile and Male Fertile Tagetes erecta by Digital Gene-Expression Profiling

    PubMed Central

    Ai, Ye; Zhang, Qinghua; Wang, Weining; Zhang, Chunling; Cao, Zhe; Bao, Manzhu; He, Yanhong

    2016-01-01

    Tagetes erecta is an important commercial plant of Asteraceae family. The male sterile (MS) and male fertile (MF) two-type lines of T. erecta have been utilized in F1 hybrid production for many years, but no report has been made to identify the genes that specify its male sterility that is caused by homeotic conversion of floral organs. In this study, transcriptome assembly and digital gene expression profiling were performed to generate expression profiles of MS and MF plants. A cDNA library was generated from an equal mixture of RNA isolated from MS and MF flower buds (1 mm and 4 mm in diameter). Totally, 87,473,431 clean tags were obtained and assembled into 128,937 transcripts among which 65,857 unigenes were identified with an average length of 1,188 bp. About 52% of unigenes (34,176) were annotated in Nr, Nt, Pfam, KOG/COG, Swiss-Prot, KO (KEGG Ortholog database) and/or GO. Taking the above transcriptome as reference, 125 differentially expressed genes were detected in both developmental stages of MS and MF flower buds. MADS-box genes were presumed to be highly related to male sterility in T. erecta based on histological and cytological observations. Twelve MADS-box genes showed significantly different expression levels in flower buds 4 mm in diameter, whereas only one gene expressed significantly different in flower buds 1 mm in diameter between MS and MF plants. This is the first transcriptome analysis in T. erecta and will provide a valuable resource for future genomic studies, especially in flower organ development and/or differentiation. PMID:26939127

  10. Identification of genes differentially expressed in the phytopathogenic fungus Cercospora nicotianae between cercosporin toxin-resistant and -susceptible strains.

    PubMed

    Herrero, Sonia; Amnuaykanjanasin, Alongkorn; Daub, Margaret E

    2007-10-01

    Plant pathogens from the genus Cercospora produce cercosporin, a photoactivated fungal toxin that generates toxic reactive oxygen species. Mechanisms governing toxin auto-resistance in Cercospora spp. are poorly understood. In this work, suppressive subtractive hybridization was used to identify genes differentially expressed between the cercosporin-resistant wild-type (WT) Cercospora nicotianae and a sensitive strain lacking a transcription factor (CRG1) that regulates resistance. Out of 338 sequences recovered, 185 unique expressed sequence tags (ESTs) were obtained and classified into functional categories. The majority of genes showed predicted expression differences, and 38.5% were differentially expressed at least twofold between the WT and mutant strain. ESTs were recovered with homology to genes involved in detoxification of noxious compounds, multidrug membrane transporters and antioxidant and polyketide biosynthetic enzymes as well as to ATPases and ATP synthases. The findings suggest that CRG1 regulates genes involved in pH responses in addition to those involved in toxin resistance and biosynthesis.

  11. Differential Gene Expression Reveals Mitochondrial Dysfunction in an Imprinting Center Deletion Mouse Model of Prader-Willi Syndrome

    PubMed Central

    Fan, Weiwei; Coskun, Pinar E.; Nalbandian, Angèle; Knoblach, Susan; Resnick, James L.; Hoffman, Eric; Wallace, Douglas C.; Kimonis, Virginia E.

    2013-01-01

    Prader-Willi syndrome (PWS) is a genetic disorder caused by deficiency of imprinted gene expression from the paternal chromosome 15q11-15q13 and clinically characterized by neonatal hypotonia, short stature, cognitive impairment, hypogonadism, hyperphagia, morbid obesity and diabetes. Previous clinical studies suggest that a defect in energy metabolism may be involved in the pathogenesis of PWS. We focused our attention on the genes associated with energy metabolism and found that there were 95 and 66 mitochondrial genes differentially expressed in PWS muscle and brain, respectively. Assessment of enzyme activities of mitochondrial oxidative phosphorylation (OXPHOS) complexes in the brain, heart, liver and muscle were assessed. We found the enzyme activities of the cardiac mitochondrial complexes II+III were upregulated in the imprinting center deletion (PWS-IC) mice compared to the wild type littermates. These studies suggest that differential gene expression, especially of the mitochondrial genes may contribute to the pathophysiology of PWS. PMID:24127921

  12. Expression and phylogeny of candidate genes for sex differentiation in a primitive fish species, the Siberian sturgeon, Acipenser baerii.

    PubMed

    Berbejillo, Julio; Martinez-Bengochea, Anabel; Bedo, Gabriela; Brunet, Frédéric; Volff, Jean-Nicolas; Vizziano-Cantonnet, Denise

    2012-08-01

    The molecular mechanisms underlying testis differentiation in basal actinopterygian fish remains poorly understood. The sex differentiation period was investigated in the Siberian sturgeon, Acipenser baerii, by expression profiling of Sertoli cell transcription factors (dmrt1, sox9) that control testis differentiation in vertebrates; Leydig cell factors (cyp17a1, star) affecting androgen production; the androgen receptor (ar); a growth factor controlling testis development (igf1); and a gene coding for a gonadotropin hormone (lh). Two genes were characterised for the first time in the Siberian sturgeon (dmrt1, cyp17a1), while the others came from public databases. Sturgeon gonad development is very slow, with a late sexual differentiation time during their juvenile stage, and are still immature at 3 years of age. Immature fish showed a sex-dimorphic pattern; all the genes studied displayed a higher expression level in male gonads. We took advantage of the presence of juvenile fish with pre- and post-differentiated gonads (16 and 18 months old) to characterise them at the molecular level. The post-differentiated fish displayed a sex dimorphism of gene expression in their gonads for all genes studied, with the exception of sox9. The trends in undifferentiated fish lead us to propose that sturgeons undergoing male differentiation express high levels of Sertoli cell factors (dmrt1, sox9) and of genes involved in the production and receptivity of androgens (cyp17a1, star and ar) together with lh. Expression profiles and phylogenetic studies suggest that these genes are potential regulators of testis development in the Siberian sturgeon.

  13. Gene expression during ovarian differentiation in parasitic and non-parasitic lampreys: implications for fecundity and life history types.

    PubMed

    Spice, Erin K; Whyard, Steven; Docker, Margaret F

    2014-11-01

    Lampreys diverged from the jawed vertebrate lineage approximately 500million years ago. Lampreys undergo sex differentiation much later than most other vertebrates, and ovarian differentiation occurs several years before testicular differentiation. The genetic basis of lamprey sex differentiation is of particular interest both because of the phylogenetic importance of lampreys and because of their unusual pattern of sex differentiation. As well, differences between parasitic and non-parasitic lampreys may first become evident at ovarian differentiation. However, nothing is known about the genetic basis of ovarian differentiation in lampreys. This study examined potential differences in gene expression before, during, and after ovarian differentiation in parasitic chestnut lamprey Ichthyomyzon castaneus and non-parasitic northern brook lamprey Ichthyomyzonfossor. Eight target genes (17β-hydroxysteroid dehydrogenase, germ cell-less, estrogen receptor β, insulin-like growth factor 1 receptor, daz-associated protein 1, cytochrome c oxidase subunit III, Wilms' tumour suppressor protein 1, and dehydrocholesterol reductase 7) were examined. Northern brook lamprey displayed higher expression of cytochrome c oxidase subunit III, whereas chestnut lamprey displayed higher expression of insulin-like growth factor 1 receptor; these genes may be involved in apoptosis and oocyte growth, respectively. Presumptive male larvae had higher expression of Wilms' tumour suppressor protein 1, which may be involved in the undifferentiated gonad and/or later testicular development. Differentiated females had higher expression of 17β hydroxysteroid dehydrogenase and daz-associated protein 1, which may be involved in female development. This study is the first to identify genes that may be involved in ovarian differentiation and fecundity in lampreys.

  14. Differentially expressed genes associated with adaptation to different thermal environments in three sympatric Cuban Anolis lizards.

    PubMed

    Akashi, Hiroshi D; Cádiz Díaz, Antonio; Shigenobu, Shuji; Makino, Takashi; Kawata, Masakado

    2016-05-01

    How animals achieve evolutionary adaptation to different thermal environments is an important issue for evolutionary biology as well as for biodiversity conservation in the context of recent global warming. In Cuba, three sympatric species of Anolis lizards (Anolis allogus, A. homolechis and A. sagrei) inhabit different thermal microhabitats, thereby providing an excellent opportunity to examine how they have adapted to different environmental temperatures. Here, we performed RNA-seq on the brain, liver and skin tissues from these three species to analyse their transcriptional responses at two different temperatures. In total, we identified 400, 816 and 781 differentially expressed genes (DEGs) between the two temperatures in A. allogus, A. homolechis and A. sagrei, respectively. Only 62 of these DEGs were shared across the three species, indicating that global transcriptional responses have diverged among these species. Gene ontology (GO) analysis showed that large numbers of ribosomal protein genes were DEGs in the warm-adapted A. homolechis, suggesting that the upregulation of protein synthesis is an important physiological mechanism in the adaptation of this species to hotter environments. GO analysis also showed that GO terms associated with circadian regulation were enriched in all three species. A gene associated with circadian regulation, Nr1d1, was detected as a DEG with opposite expression patterns between the cool-adapted A. allogus and the hot-adapted A. sagrei. Because the environmental temperature fluctuates more widely in open habitats than in forests throughout the day, the circadian thermoregulation could also be important for adaptation to distinct thermal habitats.

  15. Differential gene expression analysis of 'Chili' (Pyrus bretschneideri) fruit pericarp with two types of bagging treatments.

    PubMed

    Wang, Yuling; Zhang, Xinfu; Wang, Ran; Bai, Yingxin; Liu, Chenglian; Yuan, Yongbing; Yang, Yingjie; Yang, Shaolan

    2017-01-01

    Preharvest bagging is a simple, grower-friendly and safe physical protection technique commonly applied to many fruits, and the application of different fruit bags can have various effects. To explore the molecular mechanisms underlying the fruit quality effects of different bagging treatments, digital gene expression (DGE) profiling of bagged and unbagged 'Chili' (Pyrus bretschneideri Rehd.) pear pericarp during development was performed. Relative to unbagged fruit, a total of 3022 and 769 differentially expressed genes (DEGs) were detected in the polyethylene (PE)-bagged and non-woven fabric-bagged fruit, respectively. DEGs annotated as photosynthesis-antenna proteins and photosynthesis metabolism pathway were upregulated in non-woven fabric-bagged fruit but downregulated in the PE-bagged fruit. Non-woven fabric bagging inhibited lignin synthesis in 'Chili' pear pericarp by downregulating DEGs involved in phenylpropanoid biosynthesis; consequently, the fruit lenticels in non-woven fabric-bagged fruit were smaller than those in the other treatments. The results indicate that the non-woven fabric bagging method has a positive effect on the appearance of 'Chili' pear fruit but neither of the two bagging treatments is conducive to the accumulation of soluble sugar.

  16. Global gene expression shift during the transition from early neural development to late neuronal differentiation in Drosophila melanogaster.

    PubMed

    Cantera, Rafael; Ferreiro, María José; Aransay, Ana María; Barrio, Rosa

    2014-01-01

    Regulation of transcription is one of the mechanisms involved in animal development, directing changes in patterning and cell fate specification. Large temporal data series, based on microarrays across the life cycle of the fly Drosophila melanogaster, revealed the existence of groups of genes which expression increases or decreases temporally correlated during the life cycle. These groups of genes are enriched in different biological functions. Here, instead of searching for temporal coincidence in gene expression using the entire genome expression data, we searched for temporal coincidence in gene expression only within predefined catalogues of functionally related genes and investigated whether a catalogue's expression profile can be used to generate larger catalogues, enriched in genes necessary for the same function. We analyzed the expression profiles from genes already associated with early neurodevelopment and late neurodifferentiation, at embryonic stages 16 and 17 of Drosophila life cycle. We hypothesized that during this interval we would find global downregulation of genes important for early neuronal development together with global upregulation of genes necessary for the final differentiation of neurons. Our results were consistent with this hypothesis. We then investigated if the expression profile of gene catalogues representing particular processes of neural development matched the temporal sequence along which these processes occur. The profiles of genes involved in patterning, neurogenesis, axogenesis or synaptic transmission matched the prediction, with largest transcript values at the time when the corresponding biological process takes place in the embryo. Furthermore, we obtained catalogues enriched in genes involved in temporally matching functions by performing a genome-wide systematic search for genes with their highest expression levels at the corresponding embryonic intervals. These findings imply the use of gene expression data in

  17. Co-culture with periodontal ligament stem cells enhances osteogenic gene expression in de-differentiated fat cells.

    PubMed

    Tansriratanawong, Kallapat; Tamaki, Yuichi; Ishikawa, Hiroshi; Sato, Soh

    2014-10-01

    In recent decades, de-differentiated fat cells (DFAT cells) have emerged in regenerative medicine because of their trans-differentiation capability and the fact that their characteristics are similar to bone marrow mesenchymal stem cells. Even so, there is no evidence to support the osteogenic induction using DFAT cells in periodontal regeneration and also the co-culture system. Consequently, this study sought to evaluate the DFAT cells co-culture with periodontal ligament stem cells (PDLSCs) in vitro in terms of gene expression by comparing runt-related transcription factor 2 (RUNX2) and Peroxisome proliferator-activated receptor gamma 2 (PPARγ2) genes. We isolated DFAT cells from mature adipocytes and compared proliferation with PDLSCs. After co-culture with PDLSCs, we analyzed transcriptional activity implying by DNA methylation in all adipogenic gene promoters using combined bisulfite restriction analysis. We compared gene expression in RUNX2 gene with the PPARγ2 gene using quantitative RT-PCR. After being sub-cultured, DFAT cells demonstrated morphology similar to fibroblast-like cells. At the same time, PDLSCs established all stem cell characteristics. Interestingly, the co-culture system attenuated proliferation while enhancing osteogenic gene expression in RUNX2 gene. Using the co-culture system, DFAT cells could trans-differentiate into osteogenic lineage enhancing, but conversely, their adipogenic characteristic diminished. Therefore, DFAT cells and the co-culture system might be a novel cell-based therapy for promoting osteogenic differentiation in periodontal regeneration.

  18. Probability fold change: a robust computational approach for identifying differentially expressed gene lists.

    PubMed

    Deng, Xutao; Xu, Jun; Hui, James; Wang, Charles

    2009-02-01

    Identifying genes that are differentially expressed under different experimental conditions is a fundamental task in microarray studies. However, different ranking methods generate very different gene lists, and this could profoundly impact follow-up analyses and biological interpretation. Therefore, developing improved ranking methods are critical in microarray data analysis. We developed a new algorithm, the probabilistic fold change (PFC), which ranks genes based on a confidence interval estimate of fold change. We performed extensive testing using multiple benchmark data sources including the MicroArray Quality Control (MAQC) data sets. We corroborated our observations with MAQC data sets using qRT-PCR data sets and Latin square spike-in data sets. Along with PFC, we tested six other popular ranking algorithms including Mean Fold Change (FC), SAM, t-statistic (T), Bayesian-t (BAYT), Intensity-Conditional Fold Change (CFC), and Rank Product (RP). PFC achieved reproducibility and accuracy that are consistently among the best of the seven ranking algorithms while other ranking algorithms would show weakness in some cases. Contrary to common belief, our results demonstrated that statistical accuracy will not translate to biological reproducibility and therefore both quality aspects need to be evaluated.

  19. Integrated analysis of differentially expressed genes and pathways in triple-negative breast cancer

    PubMed Central

    Peng, Cancan; Ma, Wenli; Xia, Wei; Zheng, Wenling

    2017-01-01

    Triple-negative breast cancer (TNBC) is a heterogeneous disease characterized by an aggressive phenotype and reduced survival. The aim of the present study was to investigate the molecular mechanisms involved in the carcinogenesis of TNBC and to identify novel target molecules for therapy. The differentially expressed genes (DEGs) in TNBC and normal adjacent tissue were assessed by analyzing the GSE41970 microarray data using Qlucore Omics Explorer, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes. Pathway enrichment analyses for DEGs were performed using the Database for Annotation, Visualization and Integrated Discovery online resource. A protein-protein interaction (PPI) network was constructed using Search Tool for the Retrieval of Interacting Genes, and subnetworks were analyzed by ClusterONE. The PPI network and subnetworks were visualized using Cytoscape software. A total of 121 DEGs were obtained, of which 101 were upregulated and 20 were downregulated. The upregulated DEGs were significantly enriched in 14 pathways and 83 GO biological processes, while the downregulated DEGs were significantly enriched in 18 GO biological processes. The PPI network with 118 nodes and 1,264 edges was constructed and three subnetworks were extracted from the entire network. The significant hub DEGs with high degrees were identified, including TP53, glyceraldehyde-3-phosphate dehydrogenase, cyclin D1, HRAS and proliferating cell nuclear antigen, which were predominantly enriched in the cell cycle pathway and pathways in cancer. A number of critical genes and pathways were revealed to be associated with TNBC. The present study may provide an improved understanding of the pathogenesis of TNBC and contribute to the development of therapeutic targets for TNBC. PMID:28075450

  20. Molecular Cloning and Differential Expression of the Maize Ferredoxin Gene Family 1

    PubMed Central

    Hase, Toshiharu; Kimata, Yoko; Yonekura, Keiko; Matsumura, Tomohiko; Sakakibara, Hitoshi

    1991-01-01

    In maize (Zea mays L.), four ferredoxin (Fd) isoproteins, Fd I to Fd IV, are differentially distributed in photosynthetic and nonphotosynthetic organs of young seedlings (Y Kimata, T Hase [1989] Plant Physiol 89: 1193-1197). To understand structural characteristics of the Fd isoproteins and molecular mechanism of the differential expression of their genes, we have cloned and characterized three different maize Fd cDNAs. DNA sequence analyses showed that two of the cDNAs encoded the entire precursor polypeptides of Fd I and Fd III, which were composed of 150 and 152 amino acid residues, respectively, and the other encoded a 135 amino acid precursor polypeptide of Fd not yet identified. High degrees of homologies were found in the deduced amino acid sequences of mature regions of these Fd isoproteins, but the transit peptide of Fd III differed considerably from those of other Fd isoproteins. Fd I and the unidentified Fd were encoded mainly with codons ending in C or G, but such strong codon bias was not seen in Fd III. Gene specific probes for each cDNA were used to probe Northern blots of RNA isolated from leaves, mesocotyls, and roots of maize seedlings. The gene transcripts for Fd I and the unidentified Fd were restricted to leaves and their levels increased markedly upon illumination of etiolated seedlings, whereas that for Fd III was detected in all organs and its accumulation was not light dependent. This organ specific accumulation of Fd mRNAs corresponds exactly to the distribution pattern of Fd isoproteins. ImagesFigure 1Figure 5Figure 6Figure 7Figure 8 PMID:16668188

  1. Structure, chromosome location, and expression of the human. gamma. -actin gene: Differential evolution, location, and expression of the cytoskeletal BETA- and. gamma. -actin genes

    SciTech Connect

    Erba, H.P.; Eddy, R.; Shows, T.; Kedes, L.; Gunning, P.

    1988-04-01

    The accumulation of the cytoskeletal ..beta..-and ..gamma..-actin mRNAs was determined in a variety of mouse tissues and organs. The ..beta..-iosform is always expressed in excess of the ..gamma..-isoform. However, the molar ratio of ..beta..- to ..gamma..-actin mRNA varies from 1.7 in kidney and testis to 12 in sarcomeric muscle to 114 in liver. The authors conclude that, whereas the cytoskeletal ..beta..- and ..gamma..-actins are truly coexpressed, their mRNA levels are subject to differential regulation between different cell types. The human ..gamma..-actin gene has been cloned and sequenced, and its chromosome location has been determined. The gene is located on human chromosome 17, unlike ..beta..-actin which is on chromosome 7. Thus, if these genes are also unlinked in the mouse, the coexpression of the ..beta..- and ..gamma..-actin genes in rodent tissues cannot be determined by gene linkage. Comparison of the human ..beta..- and ..gamma..-actin genes reveals that noncoding sequences in the 5'-flanking region and in intron III have been conserved since the duplication that gave rise to these two genes. In contrast, there are sequences in intron III and the 3'-untranslated region which are not present in the ..beta..-actin gene but are conserved between the human ..gamma..-actin and the Xenopus borealis type 1 actin genes. Such conserved noncoding sequences may contribute to the coexpression of ..beta..- and ..gamma..-actin or to the unique regulation and function of the ..gamma..-actin gene. Finally, the authors demonstrate that the human ..gamma..-actin gene is expressed after introduction into mouse L cells and C2 myoblasts and that, upon fusion of C2 cells to form myotubes, the human ..gamma..-actin gene is appropriately regulated.

  2. Functional Cross-Talking between Differentially Expressed and Alternatively Spliced Genes in Human Liver Cancer Cells Treated with Berberine.

    PubMed

    Sheng, Zhen; Sun, Yi; Zhu, Ruixin; Jiao, Na; Tang, Kailin; Cao, Zhiwei; Ma, Chao

    2015-01-01

    Berberine has been identified with anti-proliferative effects on various cancer cells. Many researchers have been trying to elucidate the anti-cancer mechanisms of berberine based on differentially expressed genes. However, differentially alternative splicing genes induced by berberine might also contribute to its pharmacological actions and have not been reported yet. Moreover, the potential functional cross-talking between the two sets of genes deserves further exploration. In this study, RNA-seq technology was used to detect the differentially expressed genes and differentially alternative spliced genes in BEL-7402 cancer cells induced by berberine. Functional enrichment analysis indicated that these genes were mainly enriched in the p53 and cell cycle signalling pathway. In addition, it was statistically proven that the two sets of genes were locally co-enriched along chromosomes, closely connected to each other based on protein-protein interaction and functionally similar on Gene Ontology tree. These results suggested that the two sets of genes regulated by berberine might be functionally cross-talked and jointly contribute to its cell cycle arresting effect. It has provided new clues for further researches on the pharmacological mechanisms of berberine as well as the other botanical drugs.

  3. Differential gene expression in SV40-mediated immortalization of human fibroblasts.

    PubMed

    Pardinas, J; Pang, Z; Houghton, J; Palejwala, V; Donnelly, R J; Hubbard, K; Small, M B; Ozer, H L

    1997-06-01

    Normal human diploid fibroblasts (HF) have a limited life span, undergo senescence, and rarely, if ever, spontaneously immortalize in culture. Introduction of the gene for T antigen encoded by the DNA virus SV40 extends the life span of HF and increases the frequency of immortalization; however, immortalization requires both T-dependent and T-independent functions. We previously generated independent SV40-transformed non-immortal (pre-immortal) HF cell lines from which we then obtained immortal sublines as part of a multifaceted approach to identify functions responsible for immortalization. In this study we undertook a search for cellular mRNAs which are differentially expressed upon immortalization. A lambda cDNA library was prepared from a pre-immortal SV40-transformed HF (HF-C). We screened the library with a subtracted probe enriched for sequences present in HF-C and reduced in immortal AR5 cells. A more limited screen was also employed for sequences overexpressed in AR5 using a different strategy. Alterations in the level of mRNAs in AR5 encoding functions relevant to signal transduction pathways were identified; however, most cDNAs encoded novel sequences. In an effort to clarify which of the altered mRNAs are