Science.gov

Sample records for differentially expressed gene

  1. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  2. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  3. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  4. DNA microarray analysis of genes differentially expressed in adipocyte differentiation.

    PubMed

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming

    2014-06-01

    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  5. Differential gene detection incorporating common expression patterns

    NASA Astrophysics Data System (ADS)

    Oba, Shigeyuki; Ishii, Shin

    2009-12-01

    In detection of differentially expressed (DE) genes between different groups of samples based on a high-throughput expression measurement system, we often use a classical statistical testing based on a simple assumption that the expression of a certain DE gene in one group is higher or lower in average than that in the other group. Based on this simple assumption, the theory of optimal discovery procedure (ODP) (Storey, 2005) provided an optimal thresholding function for DE gene detection. However, expression patterns of DE genes over samples may have such a structure that is not exactly consistent with group labels assigned to the samples. Appropriate treatment of such a structure can increase the detection ability. Namely, genes showing similar expression patterns to other biologically meaningful genes can be regarded as statistically more significant than those showing expression patterns independent of other genes, even if differences in mean expression levels are comparable. In this study, we propose a new statistical thresholding function based on a latent variable model incorporating expression patterns together with the ODP theory. The latent variable model assumes hidden common signals behind expression patterns over samples and the ODP theory is extended to involve the latent variables. When applied to several gene expression data matrices which include cluster structures or 'cancer outlier' structures, the newly-proposed thresholding functions showed prominently better detection performance of DE genes than the original ODP thresholding function did. We also demonstrate how the proposed methods behave through analyses of real breast cancer and lymphoma datasets.

  6. Differential gene expression during multistage carcinogenesis

    SciTech Connect

    Bowden, G.T. ); Krieg, P. )

    1991-06-01

    The use of the mouse skin multistage model of carcinogenesis has aided our understanding of critical target genes in chemical carcinogenesis. The mutagenic activation of the Harvey-ras proto-oncogene has been found to be an early event associated with the initiation of mouse skin tumors by the polycyclic aromatic hydrocarbon 7,12 dimethylbenz(a)anthracene and the pure initiator ethyl carbamate (urethane). In contrast to chemical initiation of mouse skin tumors, ionizing radiation-initiated malignant skin tumors have been shown to possess distinct non-ras transforming gene(s). Differential screening of cDNA libraries made from chemically initiated malignant skin tumors has been used to identify a number of cellular gene transcripts that are overexpressed during mouse skin tumor progression. These differentially expressed genes include {beta}-actin, ubiquitin, a hyperproliferative keratin (K6), a gene whose product is a member of a fatty acid or lipid-binding protein family, and a gene called transin or stromelysin. The overexpression of the stromelysin gene, which encodes a metalloproteinase that degrades proteins in the basement membrane, is hypothesized to play a functional role in malignant tumor cell invasion and metastasis. The authors believe that the cloning, identification, and characterization of gene sequences that are differentially expressed during tumor progression could lead to the discovery of gene products that either play functional roles in skin tumor progression or in the maintenance of various progressive tumor phenotypes.

  7. Bayesian modeling of differential gene expression.

    PubMed

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim

    2006-03-01

    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  8. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  9. Collagen gene expression during limb cartilage differentiation

    PubMed Central

    1986-01-01

    As limb mesenchymal cells differentiate into chondrocytes, they initiate the synthesis of type II collagen and cease synthesizing type I collagen. Changes in the cytoplasmic levels of type I and type II collagen mRNAs during the course of limb chondrogenesis in vivo and in vitro were examined using cloned cDNA probes. A striking increase in cytoplasmic type II collagen mRNA occurs coincident with the crucial condensation stage of chondrogenesis in vitro, in which prechondrogenic mesenchymal cells become closely juxtaposed before depositing a cartilage matrix. Thereafter, a continuous and progressive increase in the accumulation of cytoplasmic type II collagen mRNA occurs which parallels the progressive accumulation of cartilage matrix by cells. The onset of overt chondrogenesis, however, does not involve activation of the transcription of the type II collagen gene. Low levels of type II collagen mRNA are present in the cytoplasm of prechondrogenic mesenchymal cells at the earliest stages of limb development, well before the accumulation of detectable levels of type II collagen. Type I collagen gene expression during chondrogenesis is regulated, at least in part, at the translational level. Type I collagen mRNAs are present in the cytoplasm of differentiated chondrocytes, which have ceased synthesizing detectable amounts of type I collagen. PMID:3754261

  10. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  11. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  12. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  13. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  14. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  15. Pomelo II: finding differentially expressed genes.

    PubMed

    Morrissey, Edward R; Diaz-Uriarte, Ramón

    2009-07-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool.

  16. Pomelo II: finding differentially expressed genes

    PubMed Central

    Morrissey, Edward R.; Diaz-Uriarte, Ramón

    2009-01-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool. PMID:19435879

  17. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  18. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  19. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  20. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  1. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  2. Microarray analysis reveals differential gene expression in hybrid sunflower species

    PubMed Central

    LAI, ZHAO; GROSS, BRIANA L.; YIZOU; ANDREWS, JUSTEN; RIESEBERG, LOREN H.

    2008-01-01

    This paper describes the creation of a cDNA microarray for annual sunflowers and its use to elucidate patterns of gene expression in Helianthus annuus, Helianthus petiolaris, and the homoploid hybrid species Helianthus deserticola. The array comprises 3743 ESTs (expressed sequence tags) representing approximately 2897 unique genes. It has an average clone/EST identity rate of 91%, is applicable across species boundaries within the annual sunflowers, and shows patterns of gene expression that are highly reproducible according to real-time RT–PCR (reverse transcription–polymerase chain reaction) results. Overall, 12.8% of genes on the array showed statistically significant differential expression across the three species. Helianthus deserticola displayed transgressive, or extreme, expression for 58 genes, with roughly equal numbers exhibiting up- or down-regulation relative to both parental species. Transport-related proteins were strongly over-represented among the transgressively expressed genes, which makes functional sense given the extreme desert floor habitat of H. deserticola. The potential adaptive value of differential gene expression was evaluated for five genes in two populations of early generation (BC2) hybrids between the parental species grown in the H. deserticola habitat. One gene (a G protein-coupled receptor) had a significant association with fitness and maps close to a QTL controlling traits that may be adaptive in the desert habitat. PMID:16626449

  3. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  4. Meta-analysis of differentially expressed genes in ankylosing spondylitis.

    PubMed

    Lee, Y H; Song, G G

    2015-05-18

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in ankylosing spondylitis (AS). We performed a meta-analysis using the integrative meta-analysis of expression data program on publicly available microarray AS Gene Expression Omnibus (GEO) datasets. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using the Kyoto Encyclopedia of Genes and Genomes. Four GEO datasets, including 31 patients with AS and 39 controls, were available for the meta-analysis. We identified 65 genes across the studies that were consistently DE in patients with AS vs controls (23 upregulated and 42 downregulated). The upregulated gene with the largest effect size (ES; -1.2628, P = 0.020951) was integral membrane protein 2A (ITM2A), which is expressed by CD4+ T cells and plays a role in activation of T cells. The downregulated gene with the largest ES (1.2299, P = 0.040075) was mitochondrial ribosomal protein S11 (MRPS11). The most significant GO enrichment was in the respiratory electron transport chain category (P = 1.67 x 10-9). Therefore, our meta-analysis identified genes that were consistently DE as well as biological pathways associated with gene expression changes in AS.

  5. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  6. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  7. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  8. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  9. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  10. Multiple differential expression networks identify key genes in rectal cancer.

    PubMed

    Li, Ri-Heng; Zhang, Ai-Min; Li, Shuang; Li, Tian-Yang; Wang, Lian-Jing; Zhang, Hao-Ran; Li, Ping; Jia, Xiong-Jie; Zhang, Tao; Peng, Xin-Yu; Liu, Min-Di; Wang, Xu; Lang, Yan; Xue, Wei-Lan; Liu, Jing; Wang, Yan-Yan

    2016-01-01

    Rectal cancer is an important contributor to cancer mortality. The objective of this paper is to identify key genes across three phenotypes (fungating, polypoid and polypoid & small-ulcer) of rectal cancer based on multiple differential expression networks (DENs). Differential interactions and non-differential interactions were evaluated according to Spearman correlation coefficient (SCC) algorithm, and were selected to construct DENs. Topological analysis was performed for exploring hub genes in largest components of DENs. Key genes were denoted as intersections between nodes of DENs and rectal cancer associated genes from Genecards. Finally, we utilized hub genes to classify phenotypes of rectal cancer on the basis of support vector machines (SVM) methodology. We obtained 19 hub genes and total 12 common key genes of three largest components of DENs, and EGFR was the common element. The SVM results revealed that hub genes could classify phenotypes, and validated feasibility of DEN methods. We have successfully identified significant genes (such as EGFR and UBC) across fungating, polypoid and polypoid & small-ulcer phenotype of rectal cancer. They might be potential biomarkers for classification, detection and therapy of this cancer.

  11. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  12. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  13. Wilms' tumor (WT1) gene expression in rat decidual differentiation.

    PubMed

    Zhou, J; Rauscher, F J; Bondy, C

    1993-09-01

    The Wilm's tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract, where it is thought to play a role in the differentiation of these tissues. We have used immunocytochemistry and in situ hybridization to study WT1 expression in the rat uterus during normal development and pregnancy from 0 to 20 days post coitum (p.c.). WT1 mRNA was abundant in uterine stroma from juvenile rats, but was much less abundant in uterine tissue from sexually mature rats; WT1 expression is not affected by ovariectomy or by treatment with estradiol or estradiol plus progesterone. WT1 gene was highly expressed, however, in the endometrial cells of early pregnancy. On day 6 p.c. WT1 mRNA was detected in anti-mesometrial decidual cells, and WT1 immunoreactivity was concentrated in the nuclei of these cells. All cells of fully-developed deciduoma at 7-8 days p.c. demonstrated WT1 expression. WT1 was not detected in trophoblast/placental tissues but remained abundant in the decidua basalis until parturition. The expression of WT1 was compared with insulin-like growth factor-II (IGF-II) and its receptor in the decidual since it has been shown that IGF-II gene transcription is repressed by WT1 in vitro. However, no spatiotemporal correlation in the expression of these three genes was found in differentiation of the rat decidua. In summary, these data suggest a role for WT1 in decidualization, since its expression is activated during the differentiation of uterine stromal cells into decidual cells.

  14. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  15. Brief isoflurane anaesthesia affects differential gene expression, gene ontology and gene networks in rat brain.

    PubMed

    Lowes, Damon A; Galley, Helen F; Moura, Alessandro P S; Webster, Nigel R

    2017-01-15

    Much is still unknown about the mechanisms of effects of even brief anaesthesia on the brain and previous studies have simply compared differential expression profiles with and without anaesthesia. We hypothesised that network analysis, in addition to the traditional differential gene expression and ontology analysis, would enable identification of the effects of anaesthesia on interactions between genes. Rats (n=10 per group) were randomised to anaesthesia with isoflurane in oxygen or oxygen only for 15min, and 6h later brains were removed. Differential gene expression and gene ontology analysis of microarray data was performed. Standard clustering techniques and principal component analysis with Bayesian rules were used along with social network analysis methods, to quantitatively model and describe the gene networks. Anaesthesia had marked effects on genes in the brain with differential regulation of 416 probe sets by at least 2 fold. Gene ontology analysis showed 23 genes were functionally related to the anaesthesia and of these, 12 were involved with neurotransmitter release, transport and secretion. Gene network analysis revealed much greater connectivity in genes from brains from anaesthetised rats compared to controls. Other importance measures were also altered after anaesthesia; median [range] closeness centrality (shortest path) was lower in anaesthetized animals (0.07 [0-0.30]) than controls (0.39 [0.30-0.53], p<0.0001) and betweenness centrality was higher (53.85 [32.56-70.00]% compared to 5.93 [0-30.65]%, p<0.0001). Simply studying the actions of individual components does not fully describe dynamic and complex systems. Network analysis allows insight into the interactions between genes after anaesthesia and suggests future targets for investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  17. Differential gene expression in auristatin PHE-treated Cryptococcus neoformans.

    PubMed

    Woyke, Tanja; Berens, Michael E; Hoelzinger, Dominique B; Pettit, George R; Winkelmann, Günther; Pettit, Robin K

    2004-02-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 micro M) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans.

  18. Differential Gene Expression in Auristatin PHE-Treated Cryptococcus neoformans

    PubMed Central

    Woyke, Tanja; Berens, Michael E.; Hoelzinger, Dominique B.; Pettit, George R.; Winkelmann, Günther; Pettit, Robin K.

    2004-01-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 μM) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans. PMID:14742210

  19. Differential Gene Expression in HIV-Infected Individuals Following ART

    PubMed Central

    Massanella, Marta; Singhania, Akul; Beliakova-Bethell, Nadejda; Pier, Rose; Lada, Steven; White, Cory H.; Pérez-Santiago, Josué; Blanco, Julià; Richman, Douglas D.; Little, Susan J.; Woelk, Christopher H.

    2013-01-01

    Previous studies of the effect of ART on gene expression in HIV-infected individuals have identified small numbers of modulated genes. Since these studies were underpowered or cross-sectional in design, a paired analysis of peripheral blood mononuclear cells (PBMCs), isolated before and after ART, from a robust number of HIV-infected patients (N=32) was performed. Gene expression was assayed by microarray and 4,157 differentially expressed genes (DEGs) were identified following ART using multivariate permutation tests. Pathways and Gene Ontology (GO) terms over-represented for DEGs reflected the transition from a period of active virus replication before ART to one of viral suppression (e.g., repression of JAK-STAT signaling) and possible prolonged drug exposure (e.g. oxidative phosphorylation pathway) following ART. CMYC was the DEG whose product made the greatest number of interactions at the protein level in protein interaction networks (PINs), which has implications for the increased incidence of Hodgkin’s lymphoma (HL) in HIV-infected patients. The differential expression of multiple genes was confirmed by RT-qPCR including well-known drug metabolism genes (e.g., ALOX12 and CYP2S1). Targets not confirmed by RT-qPCR (i.e., GSTM2 and RPL5) were significantly confirmed by droplet digital (ddPCR), which may represent a superior method when confirming DEGs with low fold changes. In conclusion, a paired design revealed that the number of genes modulated following ART was an order of magnitude higher than previously recognized. PMID:23933117

  20. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  1. [Screening of differentially expressed genes during adipocyte differentiation by suppression subtractive hybridization technique].

    PubMed

    Yi, Xiao-qing; Xiao, Yan-feng; Yin, Chun-yan; Xu, Er-di

    2012-05-01

    To screening differentially expressed genes related to adipocyte differentiation. Total RNA extracted from the preadipocyte cell line SW872 was taken as the Driver and the total RNA from the differentiated adipocytes SW872 as the Tester. Suppression subtractive hybridization (SSH) was used to isolate the cDNA fragments of differentially expressed genes. The products of SSH were inserted into pGM-T vector to establish the subtractive library. The library was amplified through E.coli transformation and positive clones of the transformants were screened. Positive clones were sequenced. Nucleic acid similarity was subsequently analyzed by comparing with the data from GenBank. There were 135 white clones in the cDNA library, 64 positive clones were chosen randomly and sequenced and similarity search revealed 34 genes which expressed differentially in adipocyte differentiation. The subtracted cDNA library for differentially expressed in adipocyte differentiation has been successfully constructed and the interesting candidate genes related to adipocyte differentiation have been identified.

  2. Differential toxicity and venom gland gene expression in Centruroides vittatus.

    PubMed

    McElroy, Thomas; McReynolds, C Neal; Gulledge, Alyssa; Knight, Kelci R; Smith, Whitney E; Albrecht, Eric A

    2017-01-01

    Variation in venom toxicity and composition exists in many species. In this study, venom potency and venom gland gene expression was evaluated in Centruroides vittatus, size class I-II (immature) and size class IV (adults/penultimate instars) size classes. Venom toxicity was evaluated by probit analysis and returned ED50 values of 50.1 μg/g for class IV compared to 134.2 μg/g for class I-II 24 hours post injection, suggesting size class IV was 2.7 fold more potent. Next generation sequencing (NGS and qPCR were used to characterize venom gland gene expression. NGS data was assembled into 36,795 contigs, and annotated using BLASTx with UNIPROT. EdgeR analysis of the sequences showed statistically significant differential expression in transcripts associated with sodium and potassium channel modulation. Sodium channel modulator expression generally favored size class IV; in contrast, potassium channel modulators were favored in size class I-II expression. Real-time quantitative PCR of 14 venom toxin transcripts detected relative expression ratios that paralleled NGS data and identified potential family members or splice variants for several sodium channel modulators. Our data suggests ontogenetic differences in venom potency and venom related genes expression exist between size classes I-II and IV.

  3. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  4. Differentially expressed genes in metastatic advanced Egyptian bladder cancer.

    PubMed

    Zekri, Abdel-Rahman N; Hassan, Zeinab Korany; Bahnassy, Abeer A; Khaled, Hussein M; El-Rouby, Mahmoud N; Haggag, Rasha M; Abu-Taleb, Fouad M

    2015-01-01

    Bladder cancer is one of the most common cancers worldwide. Gene expression profiling using microarray technologies improves the understanding of cancer biology. The aim of this study was to determine the gene expression profile in Egyptian bladder cancer patients. Samples from 29 human bladder cancers and adjacent non-neoplastic tissues were analyzed by cDNA microarray, with hierarchical clustering and multidimensional analysis. Five hundred and sixteen genes were differentially expressed of which SOS1, HDAC2, PLXNC1, GTSE1, ULK2, IRS2, ABCA12, TOP3A, HES1, and SRP68 genes were involved in 33 different pathways. The most frequently detected genes were: SOS1 in 20 different pathways; HDAC2 in 5 different pathways; IRS2 in 3 different pathways. There were 388 down-regulated genes. PLCB2 was involved in 11 different pathways, MDM2 in 9 pathways, FZD4 in 5 pathways, p15 and FGF12 in 4 pathways, POLE2 in 3 pathways, and MCM4 and POLR2E in 2 pathways. Thirty genes showed significant differences between transitional cell cancer (TCC) and squamous cell cancer (SCC) samples. Unsupervised cluster analysis of DNA microarray data revealed a clear distinction between low and high grade tumors. In addition 26 genes showed significant differences between low and high tumor stages, including fragile histidine triad, Ras and sialyltransferase 8 (alpha) and 16 showed significant differences between low and high tumor grades, like methionine adenosyl transferase II, beta. The present study identified some genes, that can be used as molecular biomarkers or target genes in Egyptian bladder cancer patients.

  5. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  6. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  7. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  8. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes.

    PubMed

    Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori

    2015-12-23

    Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression evolution of changed-tissues DE

  9. Differential gene expression in anterior and posterior annulus fibrosus.

    PubMed

    Koerner, John D; Markova, Dessislava Z; Yadla, Sanjay; Mendelis, Joseph; Hilibrand, Alan; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg; Kepler, Christopher K

    2014-11-01

    Laboratory study. To evaluate the differential gene expression of cytokines and growth factors in anterior versus posterior annulus fibrosus (AF) intervertebral disc (IVD) specimens. Histological analysis has demonstrated regional differences in vascular and neural ingrowth in the IVD, and similar differences may exist for cytokine and growth factor expression in patients with degenerative disc disease (DDD). Regional expression of these cytokines may also be related to the pain experienced in DDD. IVD tissue was obtained from patients undergoing anterior lumbar interbody fusion surgery for back pain with radiological evidence of disc degeneration. For a control group, the discs of patients undergoing anterior lumbar discectomy for degenerative scoliosis were obtained as well. The tissue was carefully removed and separated into anterior and posterior AF. After tissue processing, an antibody array was completed to determine expression levels of 42 cytokines and growth factors. Nine discs from 7 patients with DDD and 5 discs from 2 patients with scoliosis were analyzed. In the DDD group, there were 10 cytokines and growth factors with significantly increased expression in the posterior AF versus the anterior AF ([interleukin] IL-4, IL-5, IL-6, M-CSF, MDC, tumor necrosis factor β, EGF, IGF-1, angiogenin, leptin). In the scoliosis group, only angiogenin and PDGF-BB demonstrated increased expression in the posterior AF. No cytokines or growth factors had increased expression in the anterior AF compared with posterior AF. The posterior AF expresses increased levels of cytokines and growth factors compared with the anterior AF in patients with DDD. This differential expression may be important for targeting treatment of painful IVDs. N/A.

  10. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  11. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  12. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  13. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  14. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  15. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  16. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  17. Improved detection of differentially expressed genes through incorporation of gene locations.

    PubMed

    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B

    2009-09-01

    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  18. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  19. Identification of genes differentially expressed in menstrual breakdown and repair.

    PubMed

    Paiva, Premila; Lockhart, Michelle G; Girling, Jane E; Olshansky, Moshe; Woodrow, Nicole; Marino, Jennifer L; Hickey, Martha; Rogers, Peter A W

    2016-12-01

    Does the changing molecular profile of the endometrium during menstruation correlate with the histological profile of menstruation. We identified several genes not previously associated with menstruation; on Day 2 of menstruation (early-menstruation), processes related to inflammation are predominantly up-regulated and on Day 4 (late-menstruation), the endometrium is predominantly repairing and regenerating. Menstruation is induced by progesterone withdrawal at the end of the menstrual cycle and involves endometrial tissue breakdown, regeneration and repair. Perturbations in the regulation of menstruation may result in menstrual disorders including abnormal uterine bleeding. Endometrial samples were collected by Pipelle biopsy on Days 2 (n = 9), 3 (n = 9) or 4 (n = 6) of menstruation. RNA was extracted from endometrial biopsies and analysed by genome wide expression Illumina Sentrix Human HT12 arrays. Data were analysed using 'Remove Unwanted Variation-inverse (RUV-inv)'. Ingenuity pathway analysis (IPA) and the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 were used to identify canonical pathways, upstream regulators and functional gene clusters enriched between Days 2, 3 and 4 of menstruation. Selected individual genes were validated by quantitative PCR. Overall, 1753 genes were differentially expressed in one or more comparisons. Significant canonical pathways, gene clusters and upstream regulators enriched during menstrual bleeding included those associated with immune cell trafficking, inflammation, cell cycle regulation, extracellular remodelling and the complement and coagulation cascade. We provide the first evidence for a role for glutathione-mediated detoxification (glutathione-S-transferase mu 1 and 2; GSTM1 and GSTM2) during menstruation. The largest number of differentially expressed genes was between Days 2 and 4 of menstruation (n = 1176). We identified several genes not previously associated with menstruation

  20. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  1. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  2. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  3. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  4. Divergent fructokinase genes are differentially expressed in tomato.

    PubMed Central

    Kanayama, Y; Dai, N; Granot, D; Petreikov, M; Schaffer, A; Bennett, A B

    1997-01-01

    Two cDNA clones (Frk1 and Frk2) encoding fructokinase (EC 2.7.1.4) were isolated from tomato (Lycopersicon esculentum). The Frk2 cDNA encoded a deduced protein of 328 amino acids that was more than 90% identical with a previously characterized potato (Solanum tuberosum) fructokinase. In contrast, the Frk1 cDNA encoded a deduced protein of 347 amino acids that shared only 55% amino acid identity with Frk2. Both deduced proteins possessed and ATP-binding motif and putative substrate recognition site sequences identified in bacterial fructokinases. The Frk1 cDNA was expressed in a mutant yeast (Saccharomyces cerevisiae) line, which lacks the ability to phosphorylate glucose and fructose and is unable to grow on glucose or fructose. Mutant cells expressing Frk1 were complemented to grow on fructose but not glucose, indicating that Frk1 phosphorylates fructose but not glucose, and this activity was verified in extracts of transformed yeast. The mRNA corresponding to Frk2 accumulated to high levels in young, developing tomato fruit, whereas the Frk1 mRNA accumulated to higher levels late in fruit development. The results indicate that fructokinase in tomato is encoded by two divergent genes, which exhibit a differential pattern of expression during fruit development. PMID:9112782

  5. Mining differential top-k co-expression patterns from time course comparative gene expression datasets

    PubMed Central

    2013-01-01

    Background Frequent pattern mining analysis applied on microarray dataset appears to be a promising strategy for identifying relationships between gene expression levels. Unfortunately, too many itemsets (co-expressed genes) are identified by this analysis method since it does not consider the importance of each gene within biological processes to a cellular response and does not take into account temporal properties under biological treatment-control matched conditions in a microarray dataset. Results We propose a method termed TIIM (Top-k Impactful Itemsets Miner), which only requires specifying a user-defined number k to explore the top k itemsets with the most significantly differentially co-expressed genes between 2 conditions in a time course. To give genes different weights, a table with impact degrees for each gene was constructed based on the number of neighboring genes that are differently expressed in the dataset within gene regulatory networks. Finally, the resulting top-k impactful itemsets were manually evaluated using previous literature and analyzed by a Gene Ontology enrichment method. Conclusions In this study, the proposed method was evaluated in 2 publicly available time course microarray datasets with 2 different experimental conditions. Both datasets identified potential itemsets with co-expressed genes evaluated from the literature and showed higher accuracies compared to the 2 corresponding control methods: i) performing TIIM without considering the gene expression differentiation between 2 different experimental conditions and impact degrees, and ii) performing TIIM with a constant impact degree for each gene. Our proposed method found that several new gene regulations involved in these itemsets were useful for biologists and provided further insights into the mechanisms underpinning biological processes. The Java source code and other related materials used in this study are available at

  6. Differential gene expression analysis of Paracoccidioides brasiliensis during keratinocyte infection.

    PubMed

    Peres da Silva, Roberta; Matsumoto, Marcelo Teruyuki; Braz, Jaqueline Derissi; Voltan, Aline Raquel; de Oliveira, Haroldo Cesar; Soares, Christiane Pienna; Mendes Giannini, Maria José Soares

    2011-03-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, one of the most important systemic fungal diseases in Latin America. This initiates in lung tissue and can subsequently disseminate to other tissues. Clinical manifestations range from localized forms to disseminated disease that can progress to lethality, probably depending on the relationships among the virulence of the fungus, the immune response and the ability to interact with the surface structures and invade epithelial cells and mononuclear cells of the host. It is generally regarded as a multifocal disease, with oral lesions as the prominent feature. The aim of this study was to evaluate P. brasiliensis yeast infection in normal oral keratinocytes (NOKs). The differential expression of mRNAs and proteins was also determined when the fungus was placed in contact with the cell in order to characterize differentially expressed genes and proteins during P. brasiliensis infection. After contact with NOKs, the fungus appeared to induce alterations in the cells, which showed cellular extensions and cavitations, probably resulting from changes in the actin cytoskeleton seen at 5 and 8 h after infection. Levels of protein expression were higher after reisolation of the fungus from infected NOK culture compared with culture of the fungus in medium. The analysis identified transcripts related to 19 proteins involved in different biological processes. Transcripts were found with multiple functions including induction of cytokines, protein metabolism, alternative carbon metabolism, zinc transport and the stress response during contact with NOKs. The proteins found suggested that the yeast was in a stress situation, as indicated by the presence of RDS1. Nevertheless, the yeast seemed to be proliferating and metabolically active, as shown by the presence of a proteasome, short-chain acetylator, glucosamine-6-phosphate isomerase and ADP/ATP carrier transcripts. Additionally, metabolic pathways may

  7. Differential expression and interaction of host factors augment HIV-1 gene expression in neonatal mononuclear cells

    SciTech Connect

    Sundaravaradan, Vasudha; Mehta, Roshni; Harris, David T.; Zack, Jerome A.; Ahmad, Nafees

    2010-04-25

    We have previously shown a higher level of HIV-1 replication and gene expression in neonatal (cord) blood mononuclear cells (CBMC) compared with adult blood cells (PBMC), which could be due to differential expression of host factors. We performed the gene expression profile of CBMC and PBMC and found that 8013 genes were expressed at higher levels in CBMC than PBMC and 8028 genes in PBMC than CBMC, including 1181 and 1414 genes upregulated after HIV-1 infection in CBMC and PBMC, respectively. Several transcription factors (NF-kappaB, E2F, HAT-1, TFIIE, Cdk9, Cyclin T1), signal transducers (STAT3, STAT5A) and cytokines (IL-1beta, IL-6, IL-10) were upregulated in CBMC than PBMC, which are known to influence HIV-1 replication. In addition, a repressor of HIV-1 transcription, YY1, was down regulated in CBMC than PBMC and several matrix metalloproteinase (MMP-7, -12, -14) were significantly upregulated in HIV-1 infected CBMC than PBMC. Furthermore, we show that CBMC nuclear extracts interacted with a higher extent to HIV-1 LTR cis-acting sequences, including NF-kappaB, NFAT, AP1 and NF-IL6 compared with PBMC nuclear extracts and retroviral based short hairpin RNA (shRNA) for STAT3 and IL-6 down regulated their own and HIV-1 gene expression, signifying that these factors influenced differential HIV-1 gene expression in CBMC than PBMC.

  8. Differential co-expression analysis of a microarray gene expression profiles of pulmonary adenocarcinoma.

    PubMed

    Fu, Shijie; Pan, Xufeng; Fang, Wentao

    2014-08-01

    Lung cancer severely reduces the quality of life worldwide and causes high socioeconomic burdens. However, key genes leading to the generation of pulmonary adenocarcinoma remain elusive despite intensive research efforts. The present study aimed to identify the potential associations between transcription factors (TFs) and differentially co‑expressed genes (DCGs) in the regulation of transcription in pulmonary adenocarcinoma. Gene expression profiles of pulmonary adenocarcinoma were downloaded from the Gene Expression Omnibus, and gene expression was analyzed using a computational method. A total of 37,094 differentially co‑expressed links (DCLs) and 251 DCGs were identified, which were significantly enriched in 10 pathways. The construction of the regulatory network and the analysis of the regulatory impact factors revealed eight crucial TFs in the regulatory network. These TFs regulated the expression of DCGs by promoting or inhibiting their expression. In addition, certain TFs and target genes associated with DCGs did not appear in the DCLs, which indicated that those TFs could be synergistic with other factors. This is likely to provide novel insights for research into pulmonary adenocarcinoma. In conclusion, the present study may enhance the understanding of disease mechanisms and lead to an improved diagnosis of lung cancer. However, further studies are required to confirm these observations.

  9. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  10. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  11. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  12. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  13. Random forests-based differential analysis of gene sets for gene expression data.

    PubMed

    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An

    2013-04-10

    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  14. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  15. Divergence and differential expression of soybean actin genes.

    PubMed Central

    Hightower, R C; Meagher, R B

    1985-01-01

    DNA sequence analysis as well as genomic blotting experiments using cloned soybean actin DNA sequences as probes show that large sequence heterogeneity exists among members of the soybean actin multigene family. This heterogeneity suggested that the members of this family might be diverged in function and/or regulation. Five of the six soybean actin gene family members examined are shown to be significantly more diverged from one another than members of other known actin gene families. This high level of divergence was utilized in the preparation of actin gene-specific probes in the analysis of the complexity and expression of these members of the soybean actin gene family. Hybridization studies indicate that the six soybean actin genes fall into three classes with a pair of genes in each class. These six genes account for all but two actin gene fragments detected in the soybean genome. We have compared the relative steady state mRNA levels of these classes of soybean actin genes in three organs of soybean. We find that actin genes SAc6 and SAc7 are most highly expressed accounting for 80% of all actin mRNA with respect to the six soybean actin genes examined. Actin genes SAc3 and SAc1 are expressed at intermediate and low levels respectively; and SAc2 and SAc4 are expressed at barely detectable levels. Four of the six soybean actin genes appear to be expressed at the same level in root, shoot and hypocotyl. SAc3 and SAc7 genes appear to be more highly expressed in shoot and 2,4-dichlorophenoxyacetic acid-induced hypocotyl than in root and hypocotyl.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:2410251

  16. Candidate egg case silk genes for the spider Argiope argentata from differential gene expression analyses.

    PubMed

    Chaw, R C; Arensburger, P; Clarke, T H; Ayoub, N A; Hayashi, C Y

    2016-12-01

    Orb-web weaving spiders produce a variety of task-specific silks from specialized silk glands. The genetics underlying the synthesis of specific silk types are largely unknown, and transcriptome analysis could be a powerful approach for identifying candidate genes. However, de novo assembly and expression profiling of silk glands with RNA-sequencing (RNAseq) are problematic because the few known gene transcripts for silk proteins are extremely long and highly repetitive. To identify candidate genes for tubuliform (egg case) silk synthesis by the orb-weaver Argiope argentata (Araneidae), we estimated transcript abundance using two sequencing methods: RNAseq reads from throughout the length of mRNA molecules, and 3' digital gene expression reads from the 3' region of mRNA molecules. Both analyses identified similar sets of genes as differentially expressed when comparing tubuliform and nonsilk gland tissue. However, incompletely assembled silk gene transcripts were identified as differentially expressed because of RNAseq read alignments to highly repetitive regions, confounding interpretation of RNAseq results. Homologues of egg case silk protein (ECP) genes were upregulated in tubuliform glands. This discovery is the first description of ECP homologues in an araneid. We also propose additional candidate genes involved in synthesis of tubuliform or other silk types. © 2016 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

  17. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.

    PubMed

    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu

    2015-06-15

    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  18. Differential var gene expression in children with malaria and antidromic effects on host gene expression.

    PubMed

    Kalmbach, Yvonne; Rottmann, Matthias; Kombila, Maryvonne; Kremsner, Peter G; Beck, Hans-Peter; Kun, Jürgen F J

    2010-07-15

    Among 62 children with mild malaria, cerebral malaria, or severe malarial anemia, we analyzed the transcription of different var gene types. There was no difference in parasitemia level or body temperature between groups. However, a significantly different expression pattern was observed in children with cerebral malaria, compared with that in patients in the other 2 groups: children with cerebral malaria had lower expression of the upsA subtype but higher expression of the upsB and upsC subtypes. Furthermore, expression of human genes responsive to tumor necrosis factor and hypoxia correlated with distinct ups types.

  19. A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

    PubMed Central

    Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

    2015-01-01

    In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

  20. Microarray analysis of differentially expressed genes in preeclamptic and normal placental tissues.

    PubMed

    Ma, K; Lian, Y; Zhou, S; Hu, R; Xiong, Y; Ting, P; Xiong, Y; Li, X; Wang, X

    2014-01-01

    To detect the candidate genes for preeclampsia (PE). The gene expression profiles in preeclamptic and normal placental tissues were analyzed using cDNA microarray approach and the altered expression of important genes were further confirmed by real-time RT-PCR (reverse transcription polymerase chain reaction) technique. Total RNA was extracted from placental tissues of three cases with severe PE and from three cases with normal pregnancy. After scanning, differentially expressed genes were detected by software. In two experiments (the fluorescent labels were exchanged), a total of 111 differentially expressed genes were detected. In placental tissue ofpreeclamptic pregnancy, 68 differentially expressed genes were up-regulated, and 44 differentially expressed genes were down-regulated. Of these genes, 16 highly differentially expressed genes were confirmed by real-time fluorescent quantitative RT-PCR, and the result showed that the ratio of gene expression differences was comparable to that detected by cDNA microarray. The results of bioinformatic analysis showed that encoding products of differentially expressed genes were correlated to infiltration of placenta trophoblastic cells, immunomodulatory factors, pregnancy-associated plasma protein, signal transduction pathway, and cell adhesion. Further studies on the biological function and regulating mechanism of these genes will provide new clues for better understanding of etiology and pathogenesis of PE.

  1. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  2. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J

    1989-01-01

    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  3. Screening key genes associated with congenital heart defects in Down syndrome based on differential expression network.

    PubMed

    Yu, Shan; Yi, Huani; Wang, Zhimin; Dong, Juan

    2015-01-01

    Down syndrome (DS) is the most common viable chromosomal disorder with intellectual impairment and several other developmental abnormalities. Forty to fifty percent of newborns with DS have some form of congenital heart defects (CHD). The genome of CHD in DS has already been obtained, but the underlying genomic or gene expression variation that contributes to the manifestation of a CHD in DS is still unknown. This study was aimed to analyze key genes of patients with CHD in DS. Differential expression network (DEN) approach was employed to analyze the dyeregulated genes and pathways in this study. First, the differentially expressed genes (DEGs) between CHD in DS and normal subjects were screened based on the microarray expression data. Next, the differential interactions were identified using spearman correlation coefficients of edges in different conditions. The DEN was then constructed combining both DEGs and differential interactions, and HUB genes were gained by degree centrality analysis of DEN. Meanwhile, disease genes included in the DEN were also ascertained. When analyzing gene expression values in different conditions, no DEGs were identified. While, a total of 984 gene pairs with significant differential expression were identified. Finally, the DEN was constructed only using differential edges in our study. In this network, eight HUB genes were identified, and thereinto four genes (UBC, APP, HUWE1 and SRC) were both HUB genes and disease genes. DEN approach should be taken as a useful complement to traditional differential genes methods. We provide several potential underlying biomarkers for CHD in DS.

  4. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-01-01

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  5. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.

    PubMed

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-03-04

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  6. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.

    PubMed

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu

    2016-11-01

    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  7. CT gene modulate differential expression of chitinase gene under variant habitats in Vibrio cholerae

    PubMed Central

    Verma, Yogendra Kumar; Verma, Mahendra Kumar

    2013-01-01

    Objective To investigate the interrelation of cholera toxin gene (CT gene) in expression of chitinase gene under different pH conditions among pathogenic and Non-pathogenic strains of Vibrio cholera (V. cholera). Methods The chitinase assay well diffusion method and calorimetric chitinase assay were performed. Further, time depended chitinase activity among pathogenic and nonpathogenic strain was evaluated with control as Escherichia coli. The expressed protein in variant environment was purified by cascade of chromatographic techniques. The partially purified protein was analyzed by SDS-PAGE in both the strain of V. cholera. Results The results have shown differential expression of chitinase gene among vibrio in time depended chitinase activity, purification of expressed protein and SDS-PAGE analysis. Conclusions From the current study, two conclusions came in picture, habitat is prime factor that regulation of chitin gene expression among many bacterial strains, second, moreover among the vibrio pathogenic strains (CT+) expression of chitinase gene is more precisely regulated by CT gene rather than external environments while in non-pathogenic strain ( CT-) completely absent.

  8. Differential Gene Expression in Chemically Induced Mouse Lung Adenomas1

    PubMed Central

    Yao, Ruisheng; Wang, Yian; Lubet, Ronald A; You, Ming

    2003-01-01

    Abstract Because of similarities in histopathology and tumor progression stages between mouse and human lung adenocarcinomas, the mouse lung tumor model with lung adenomas as the endpoint has been used extensively to evaluate the efficacy of putative lung cancer chemopreventive agents. In this study, a competitive cDNA library screening (CCLS) was employed to determine changes in the expression of mRNA in chemically induced lung adenomas compared with paired normal lung tissues. A total of 2555 clones having altered expression in tumors were observed following competitive hybridization between normal lung and lung adenomas after primary screening of over 160,000 clones from a mouse lung cDNA library. Among the 755 clones confirmed by dot blot hybridization, 240 clones were underexpressed, whereas 515 clones were overexpressed in tumors. Sixty-five clones with the most frequently altered expression in six individual tumors were confirmed by semiquantitative RT-PCR. When examining the 58 known genes, 39 clones had increased expression and 19 had decreased expression, whereas the 7 novel genes showed overexpression. A high percentage (>60%) of overexpressed or underexpressed genes was observed in at least two or three of the lesions. Reproducibly overexpressed genes included ERK-1, JAK-1, surfactant proteins A, B, and C, NFAT1, α-1 protease inhibitor, helix-loop-helix ubiquitous kinase (CHUK), α-adaptin, α-1 PI2, thioether S-methyltransferase, and CYP2C40. Reproducibly underexpressed genes included paroxanase, ALDH II, CC10, von Ebner salivary gland protein, and α- and β-globin. In addition, CCLS identified several novel genes or genes not previously associated with lung carcinogenesis, including a hypothetical protein (FLJ11240) and a guanine nucleotide exchange factor homologue. This study shows the efficacy of this methodology for identifying genes with altered expression. These genes may prove to be helpful in our understanding of the genetic basis of lung

  9. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  10. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  11. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    PubMed

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P < 0.005), as predicted by computer-based simulations. Conversely, RELN 5'UTR sequences boost reporter gene expression above control levels in neuronal SN56 and N2A cell lines, but 12- and 13-repeat alleles still yield 50-60% less luciferase activity compared to the more common 8- and 10-repeat alleles (P < 0.0001). RELN "long" GGC alleles significantly blunt gene expression and may, through this effect, confer vulnerability to human disorders, such as schizophrenia and autism.

  12. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  13. Quantitative set analysis for gene expression: a method to quantify gene set differential expression including gene-gene correlations.

    PubMed

    Yaari, Gur; Bolen, Christopher R; Thakar, Juilee; Kleinstein, Steven H

    2013-10-01

    Enrichment analysis of gene sets is a popular approach that provides a functional interpretation of genome-wide expression data. Existing tests are affected by inter-gene correlations, resulting in a high Type I error. The most widely used test, Gene Set Enrichment Analysis, relies on computationally intensive permutations of sample labels to generate a null distribution that preserves gene-gene correlations. A more recent approach, CAMERA, attempts to correct for these correlations by estimating a variance inflation factor directly from the data. Although these methods generate P-values for detecting gene set activity, they are unable to produce confidence intervals or allow for post hoc comparisons. We have developed a new computational framework for Quantitative Set Analysis of Gene Expression (QuSAGE). QuSAGE accounts for inter-gene correlations, improves the estimation of the variance inflation factor and, rather than evaluating the deviation from a null hypothesis with a P-value, it quantifies gene-set activity with a complete probability density function. From this probability density function, P-values and confidence intervals can be extracted and post hoc analysis can be carried out while maintaining statistical traceability. Compared with Gene Set Enrichment Analysis and CAMERA, QuSAGE exhibits better sensitivity and specificity on real data profiling the response to interferon therapy (in chronic Hepatitis C virus patients) and Influenza A virus infection. QuSAGE is available as an R package, which includes the core functions for the method as well as functions to plot and visualize the results.

  14. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya

    2015-01-01

    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  15. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.

    PubMed

    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K

    2016-03-01

    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  16. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  17. Differentially correlated genes in co-expression networks control phenotype transitions.

    PubMed

    Thomas, Lina D; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Co-expression networks are a tool widely used for analysis of "Big Data" in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as "bottlenecks" rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we showed that they play

  18. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  19. Stress response in tardigrades: differential gene expression of molecular chaperones.

    PubMed

    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O

    2010-07-01

    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  20. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  1. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells.

    PubMed

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji; Furue, Miho K

    2016-12-15

    Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines.

  2. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    PubMed

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  3. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  4. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  5. Reconstructing differentially co-expressed gene modules and regulatory networks of soybean cells

    PubMed Central

    2012-01-01

    Background Current experimental evidence indicates that functionally related genes show coordinated expression in order to perform their cellular functions. In this way, the cell transcriptional machinery can respond optimally to internal or external stimuli. This provides a research opportunity to identify and study co-expressed gene modules whose transcription is controlled by shared gene regulatory networks. Results We developed and integrated a set of computational methods of differential gene expression analysis, gene clustering, gene network inference, gene function prediction, and DNA motif identification to automatically identify differentially co-expressed gene modules, reconstruct their regulatory networks, and validate their correctness. We tested the methods using microarray data derived from soybean cells grown under various stress conditions. Our methods were able to identify 42 coherent gene modules within which average gene expression correlation coefficients are greater than 0.8 and reconstruct their putative regulatory networks. A total of 32 modules and their regulatory networks were further validated by the coherence of predicted gene functions and the consistency of putative transcription factor binding motifs. Approximately half of the 32 modules were partially supported by the literature, which demonstrates that the bioinformatic methods used can help elucidate the molecular responses of soybean cells upon various environmental stresses. Conclusions The bioinformatics methods and genome-wide data sources for gene expression, clustering, regulation, and function analysis were integrated seamlessly into one modular protocol to systematically analyze and infer modules and networks from only differential expression genes in soybean cells grown under stress conditions. Our approach appears to effectively reduce the complexity of the problem, and is sufficiently robust and accurate to generate a rather complete and detailed view of putative soybean

  6. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  7. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  8. Differential gene expression analysis of ovarian cancer in a population isolate.

    PubMed

    Grazio, D; Pichler, I; Fuchsberger, C; Zolezzi, F; Guarnieri, P; Heidegger, H; Scherer, A; Engl, B; Messini, S; Egarter-Vigl, E; Pramstaller, P P

    2008-01-01

    Gene expression products represent candidate biomarkers with the potential for early screening and therapy of patients with ovarian serous carcinoma. The present study, using patients that originate from the population isolate of South Tyrol, Italy, substantiates the feasibility of differential gene expression analysis in a genetically isolated population for the identification of potential markers of ovarian cancer. Gene expression profiles of fresh-frozen ovarian serous papillary carcinoma samples were analyzed and compared to normal ovarian control tissues using oligonucleotide microarrays complementary to 14,500 human genes. Supervised analysis of gene expression profiling data identified 225 genes that are down-regulated and 635 that are up-regulated in malignant compared to normal ovarian tissues. Class-prediction analysis identified 40 differentially expressed genes for further investigation as potential classifiers for ovarian cancer, including 20 novel candidates. Our findings provide a glimpse into the potential of population isolate genomics in oncological research.

  9. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia

    PubMed Central

    Ge, Yubin; Dombkowski, Alan A.; LaFiura, Katherine M.; Tatman, Dana; Yedidi, Ravikiran S.; Stout, Mark L.; Buck, Steven A.; Massey, Gita; Becton, David L.; Weinstein, Howard J.; Ravindranath, Yaddanapudi; Matherly, Larry H.; Taub, Jeffrey W.

    2006-01-01

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins. PMID:16249385

  10. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia.

    PubMed

    Ge, Yubin; Dombkowski, Alan A; LaFiura, Katherine M; Tatman, Dana; Yedidi, Ravikiran S; Stout, Mark L; Buck, Steven A; Massey, Gita; Becton, David L; Weinstein, Howard J; Ravindranath, Yaddanapudi; Matherly, Larry H; Taub, Jeffrey W

    2006-02-15

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins.

  11. Comprehensive DNA Methylation and Gene Expression Profiling in Differentiating Human Adipocytes.

    PubMed

    van den Dungen, Myrthe W; Murk, Albertinka J; Kok, Dieuwertje E; Steegenga, Wilma T

    2016-12-01

    Insight into the processes controlling adipogenesis is important in the battle against the obesity epidemic and its related disorders. The transcriptional regulatory cascade involved in adipocyte differentiation has been extensively studied, however, the mechanisms driving the transcription activation are still poorly understood. In this study, we explored the involvement of DNA methylation in transcriptional regulation during adipocyte differentiation of primary human mesenchymal stem cells (hMSCs). Genome-wide changes in DNA methylation were measured using the Illumina 450K BeadChip. In addition, expression of 84 adipogenic genes was determined, of which 43 genes showed significant expression changes during the differentiation process. Among these 43 differentially expressed genes, differentially methylated regions (DMRs) were detected in only three genes. By comparing genome-wide DNA methylation profiles in undifferentiated and differentiated adipocytes 793 significant DMRs were detected. Pathway analysis revealed the adipogenesis pathway as the most statistically significant, although only a small number of genes were differentially methylated. Genome-wide DNA methylation changes for single probes were most often located in intergenic regions, and underrepresented close to the transcription start site. In conclusion, DNA methylation remained relatively stable during adipocyte differentiation, implying that changes in DNA methylation are not the underlying mechanism regulating gene expression during adipocyte differentiation. J. Cell. Biochem. 117: 2707-2718, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  13. Joint analysis of differential gene expression in multiple studies using correlation motifs

    PubMed Central

    Wei, Yingying; Tenzen, Toyoaki; Ji, Hongkai

    2015-01-01

    The standard methods for detecting differential gene expression are mostly designed for analyzing a single gene expression experiment. When data from multiple related gene expression studies are available, separately analyzing each study is not ideal as it may fail to detect important genes with consistent but relatively weak differential signals in multiple studies. Jointly modeling all data allows one to borrow information across studies to improve the analysis. However, a simple concordance model, in which each gene is assumed to be differential in either all studies or none of the studies, is incapable of handling genes with study-specific differential expression. In contrast, a model that naively enumerates and analyzes all possible differential patterns across studies can deal with study-specificity and allow information pooling, but the complexity of its parameter space grows exponentially as the number of studies increases. Here, we propose a correlation motif approach to address this dilemma. This approach searches for a small number of latent probability vectors called correlation motifs to capture the major correlation patterns among multiple studies. The motifs provide the basis for sharing information among studies and genes. The approach has flexibility to handle all possible study-specific differential patterns. It improves detection of differential expression and overcomes the barrier of exponential model complexity. PMID:25143368

  14. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    PubMed

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  15. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.

    PubMed

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  16. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  17. Differential Gene Expression in the Human Brain Is Associated with Conserved, but Not Accelerated, Noncoding Sequences

    PubMed Central

    Meyer, Kyle A.; Marques-Bonet, Tomas

    2017-01-01

    Previous studies have found that genes which are differentially expressed within the developing human brain disproportionately neighbor conserved noncoding sequences (CNSs) that have an elevated substitution rate in humans and in other species. One explanation for this general association of differential expression with accelerated CNSs is that genes with pre-existing patterns of differential expression have been preferentially targeted by species-specific regulatory changes. Here we provide support for an alternative explanation: genes that neighbor a greater number of CNSs have a higher probability of differential expression and a higher probability of neighboring a CNS with lineage-specific acceleration. Thus, neighboring an accelerated element from any species signals that a gene likely neighbors many CNSs. We extend the analyses beyond the prenatal time points considered in previous studies to demonstrate that this association persists across developmental and adult periods. Examining differential expression between non-neural tissues suggests that the relationship between the number of CNSs a gene neighbors and its differential expression status may be particularly strong for expression differences among brain regions. In addition, by considering this relationship, we highlight a recently defined set of putative human-specific gain-of-function sequences that, even after adjusting for the number of CNSs neighbored by genes, shows a positive relationship with upregulation in the brain compared with other tissues examined. PMID:28204568

  18. A new set of differentially expressed signaling genes is early expressed in coffee leaf rust race II incompatible interaction.

    PubMed

    Diola, Valdir; Brito, Giovani G; Caixeta, Eveline T; Pereira, Luiz F P; Loureiro, Marcelo E

    2013-08-01

    New races of coffee rust are overcoming resistance genes available in germplasm and cultivated cultivars and bringing recently some coffee-producing countries in severe economic challenge. The objective of this study was to identify the genes that are linked to host resistance to the major coffee rust race II. In our study, we have identified and studied a segregating population that has a single monogenic resistant gene to coffee rust. Coffee leaves of parents, resistant, and susceptible genotypes of the F2 generation plants were inoculated with pathogen spores. A differential analysis was performed by combined cDNA-AFLP and bulk segregant analysis (BSA) in pooled samples collected 48 and 72 h postinoculation, increasing the selectiveness for differential gene expression. Of 108 differential expressed genes, between 33,000 gene fragments analyzed, 108 differential expressed genes were identified in resistant plants. About 20 and 22 % of these resistant-correlated genes are related to signaling and defense genes, respectively. Between signaling genes, the major subclass corresponds to receptor and resistant homolog genes, like nucleotide-binding site leucine-rich repeat (NBS-LRR), Pto-like, RLKs, Bger, and RGH1A, all not previously described in coffee rust responses. The second major subclass included kinases, where two mitogen-activated kinases (MAPK) are identified. Further gene expression analysis was performed for 21 selected genes by real-time PCR gene expression analysis at 0, 12, 24, 48, and 72 h postinoculation. The expression of genes involved in signaling and defense was higher at 24 and 72 h after inoculation, respectively. The NBS-LRR was the more differentially expressed gene between the signaling genes (four times more expressed in the resistant genotype), and thraumatin (PR5) was the more expressed between all genes (six times more expressed). Multivariate analysis reinforces the significance of the temporal separation of identified signaling and

  19. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    USDA-ARS?s Scientific Manuscript database

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  20. Global gene expression profiling reveals genes expressed differentially in cattle with high and low residual feed intake.

    PubMed

    Chen, Y; Gondro, C; Quinn, K; Herd, R M; Parnell, P F; Vanselow, B

    2011-10-01

    Feed efficiency is an economically important trait in beef production. It can be measured as residual feed intake. This is the difference between actual feed intake recorded over a test period and the expected feed intake of an animal based on its size and growth rate. DNA-based marker-assisted selection would help beef breeders to accelerate genetic improvement for feed efficiency by reducing the generation interval and would obviate the high cost of measuring residual feed intake. Although numbers of quantitative trait loci and candidate genes have been identified with the advance of molecular genetics, our understanding of the physiological mechanisms and the nature of genes underlying residual feed intake is limited. The aim of the study was to use global gene expression profiling by microarray to identify genes that are differentially expressed in cattle, using lines genetically selected for low and high residual feed intake, and to uncover candidate genes for residual feed intake. A long-oligo microarray with 24 000 probes was used to profile the liver transcriptome of 44 cattle selected for high or low residual feed intake. One hundred and sixty-one unique genes were identified as being differentially expressed between animals with high and low residual feed intake. These genes were involved in seven gene networks affecting cellular growth and proliferation, cellular assembly and organization, cell signalling, drug metabolism, protein synthesis, lipid metabolism, and carbohydrate metabolism. Analysis of functional data using a transcriptional approach allows a better understanding of the underlying biological processes involved in residual feed intake and also allows the identification of candidate genes for marker-assisted selection. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  1. Transcriptome-based gene expression profiling identifies differentially expressed genes critical for salt stress response in radish (Raphanus sativus L.).

    PubMed

    Sun, Xiaochuan; Xu, Liang; Wang, Yan; Luo, Xiaobo; Zhu, Xianwen; Kinuthia, Karanja Benard; Nie, Shanshan; Feng, Haiyang; Li, Chao; Liu, Liwang

    2016-02-01

    Transcriptome-based gene expression analysis identifies many critical salt-responsive genes in radish and facilitates further dissecting the molecular mechanism underlying salt stress response. Salt stress severely impacts plant growth and development. Radish, a moderately salt-sensitive vegetable crop, has been studied for decades towards the physiological and biochemical performances under salt stress. However, no systematic study on isolation and identification of genes involved in salt stress response has been performed in radish, and the molecular mechanism governing this process is still indistinct. Here, the RNA-Seq technique was applied to analyze the transcriptomic changes on radish roots treated with salt (200 mM NaCl) for 48 h in comparison with those cultured in normal condition. Totally 8709 differentially expressed genes (DEGs) including 3931 up- and 4778 down-regulated genes were identified. Functional annotation analysis indicated that many genes could be involved in several aspects of salt stress response including stress sensing and signal transduction, osmoregulation, ion homeostasis and ROS scavenging. The association analysis of salt-responsive genes and miRNAs exhibited that 36 miRNA-mRNA pairs had negative correlationship in expression trends. Reverse-transcription quantitative PCR (RT-qPCR) analysis revealed that the expression profiles of DEGs were in line with results from the RNA-Seq analysis. Furthermore, the putative model of DEGs and miRNA-mediated gene regulation was proposed to elucidate how radish sensed and responded to salt stress. This study represents the first comprehensive transcriptome-based gene expression profiling under salt stress in radish. The outcomes of this study could facilitate further dissecting the molecular mechanism underlying salt stress response and provide a valuable platform for further genetic improvement of salt tolerance in radish breeding programs.

  2. Live-Cell, Temporal Gene Expression Analysis of Osteogenic Differentiation in Adipose-Derived Stem Cells

    PubMed Central

    Desai, Hetal V.; Voruganti, Indu S.; Jayasuriya, Chathuraka; Chen, Qian

    2014-01-01

    Adipose-derived stem cells (ASCs) are a widely investigated type of mesenchymal stem cells with great potential for musculoskeletal regeneration. However, the use of ASCs is complicated by their cellular heterogeneity, which exists at both the population and single-cell levels. This study demonstrates a live-cell assay to investigate gene expression in ASCs undergoing osteogenesis using fluorescently tagged DNA hybridization probes called molecular beacons. A molecular beacon was designed to target the mRNA sequence for alkaline phosphatase (ALPL), a gene characteristically expressed during early osteogenesis. The percentage of cells expressing this gene in a population was monitored daily to quantify the uniformity of the differentiation process. Differentiating ASC populations were repeatedly measured in a nondestructive fashion over a 10-day period to obtain temporal gene expression data. Results showed consistent expression patterns for the investigated osteogenic genes in response to induction medium. Peak signal level, indicating when the most cells expressed ALPL at once, was observed on days 3–5. The differentiation response of sample populations was generally uniform when assessed on a well-by-well basis over time. The expression of alkaline phosphatase is consistent with previous studies of osteogenic differentiation, suggesting that molecular beacons are a viable means of monitoring the spatiotemporal gene expression of live, differentiating ASCs. PMID:24367991

  3. Differential expression of genes related to gain and intake in the liver of beef cattle

    USDA-ARS?s Scientific Manuscript database

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  4. Identification of differentially expressed genes induced by beet curly top virus infection in sugarbeet

    USDA-ARS?s Scientific Manuscript database

    Resistance to beet curly top virus (BCTV) trait is crucial in Western USA. There is sparse public knowledge of genes regulating resistance. This research focused on gene expression profiling of resistance to the three BCTV strains: Cal/Logan (Cal), Worland (Wor), and severe. Differential gene exp...

  5. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2011-01-01

    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  6. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  7. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

    PubMed Central

    Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

  8. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    PubMed

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  9. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    PubMed

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia. Copyright © 2017 the American Physiological Society.

  10. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  11. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  12. Application of community phylogenetic approaches to understand gene expression: differential exploration of venom gene space in predatory marine gastropods.

    PubMed

    Chang, Dan; Duda, Thomas F

    2014-06-05

    Predatory marine gastropods of the genus Conus exhibit substantial variation in venom composition both within and among species. Apart from mechanisms associated with extensive turnover of gene families and rapid evolution of genes that encode venom components ('conotoxins'), the evolution of distinct conotoxin expression patterns is an additional source of variation that may drive interspecific differences in the utilization of species' 'venom gene space'. To determine the evolution of expression patterns of venom genes of Conus species, we evaluated the expression of A-superfamily conotoxin genes of a set of closely related Conus species by comparing recovered transcripts of A-superfamily genes that were previously identified from the genomes of these species. We modified community phylogenetics approaches to incorporate phylogenetic history and disparity of genes and their expression profiles to determine patterns of venom gene space utilization. Less than half of the A-superfamily gene repertoire of these species is expressed, and only a few orthologous genes are coexpressed among species. Species exhibit substantially distinct expression strategies, with some expressing sets of closely related loci ('under-dispersed' expression of available genes) while others express sets of more disparate genes ('over-dispersed' expression). In addition, expressed genes show higher dN/dS values than either unexpressed or ancestral genes; this implies that expression exposes genes to selection and facilitates rapid evolution of these genes. Few recent lineage-specific gene duplicates are expressed simultaneously, suggesting that expression divergence among redundant gene copies may be established shortly after gene duplication. Our study demonstrates that venom gene space is explored differentially by Conus species, a process that effectively permits the independent and rapid evolution of venoms in these species.

  13. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  14. Transcriptome Analysis of Differentially Expressed Genes Relevant to Variegation in Peach Flowers

    PubMed Central

    Yu, Faxin; Li, Shuxian; Yin, Tongming

    2014-01-01

    Background Variegation in flower color is commonly observed in many plant species and also occurs on ornamental peaches (Prunus persica f. versicolor [Sieb.] Voss). Variegated plants are highly valuable in the floricultural market. To gain a global perspective on genes differentially expressed in variegated peach flowers, we performed large-scale transcriptome sequencing of white and red petals separately collected from a variegated peach tree. Results A total of 1,556,597 high-quality reads were obtained, with an average read length of 445 bp. The ESTs were assembled into 16,530 contigs and 42,050 singletons. The resulting unigenes covered about 60% of total predicted genes in the peach genome. These unigenes were further subjected to functional annotation and biochemical pathway analysis. Digital expression analysis identified a total of 514 genes differentially expressed between red and white flower petals. Since peach flower coloration is determined by the expression and regulation of structural genes relevant to flavonoid biosynthesis, a detailed examination detected four key structural genes, including C4H, CHS, CHI and F3H, expressed at a significantly higher level in red than in white petal. Except for the structural genes, we also detected 11 differentially expressed regulatory genes relating to flavonoid biosynthesis. Using the differentially expressed structural genes as the test objects, we validated the digital expression results by using quantitative real-time PCR, and the differential expression of C4H, CHS and F3H were confirmed. Conclusion In this study, we generated a large EST collection from flower petals of a variegated peach. By digital expression analysis, we identified an informative list of candidate genes associated with variegation in peach flowers, which offered a unique opportunity to uncover the genetic mechanisms underlying flower color variegation. PMID:24603808

  15. Meta-Analysis of Differential Connectivity in Gene Co-Expression Networks in Multiple Sclerosis

    PubMed Central

    Creanza, Teresa Maria; Liguori, Maria; Liuni, Sabino; Nuzziello, Nicoletta; Ancona, Nicola

    2016-01-01

    Differential gene expression analyses to investigate multiple sclerosis (MS) molecular pathogenesis cannot detect genes harboring genetic and/or epigenetic modifications that change the gene functions without affecting their expression. Differential co-expression network approaches may capture changes in functional interactions resulting from these alterations. We re-analyzed 595 mRNA arrays from publicly available datasets by studying changes in gene co-expression networks in MS and in response to interferon (IFN)-β treatment. Interestingly, MS networks show a reduced connectivity relative to the healthy condition, and the treatment activates the transcription of genes and increases their connectivity in MS patients. Importantly, the analysis of changes in gene connectivity in MS patients provides new evidence of association for genes already implicated in MS by single-nucleotide polymorphism studies and that do not show differential expression. This is the case of amiloride-sensitive cation channel 1 neuronal (ACCN1) that shows a reduced number of interacting partners in MS networks, and it is known for its role in synaptic transmission and central nervous system (CNS) development. Furthermore, our study confirms a deregulation of the vitamin D system: among the transcription factors that potentially regulate the deregulated genes, we find TCF3 and SP1 that are both involved in vitamin D3-induced p27Kip1 expression. Unveiling differential network properties allows us to gain systems-level insights into disease mechanisms and may suggest putative targets for the treatment. PMID:27314336

  16. Data mining in networks of differentially expressed genes during sow pregnancy.

    PubMed

    Wang, Ligang; Zhang, Longchao; Li, Yong; Li, Wen; Luo, Weizhen; Cheng, Duxue; Yan, Hua; Ma, Xiaojun; Liu, Xin; Song, Xin; Liang, Jing; Zhao, Kebin; Wang, Lixian

    2012-01-01

    Small to moderate gains in Pig fertility can mean large returns in overall efficiency, and developing methods to improve it is highly desirable. High fertility rates depend on completion of successful pregnancies. To understand the molecular signals associated with pregnancy in sows, expression profiling experiments were conducted to identify differentially expressed genes in ovary and myometrium at different pregnancy periods using the Affymetrix Porcine GeneChip(TM). A total of 974, 1800, 335 and 710 differentially expressed transcripts were identified in the myometrium during early pregnancy (EP) and late pregnancy (LP), and in the ovary during EP and LP, respectively. Self-Organizing Map (SOM) clusters indicated the differentially expressed genes belonged to 7 different functional groups. Based on BLASTX searches and Gene Ontology (GO) classifications, 129 unique genes closely related to pregnancy showed differential expression patterns. GO analysis also indicated that there were 21 different molecular function categories, 20 different biological process categories, and 8 different cellular component categories of genes differentially expressed during sow pregnancy. Gene regulatory network reconstruction provided us with an interaction model of known genes such as insulin-like growth factor 2 (IGF2) gene, estrogen receptor (ESR) gene, retinol-binding protein-4 (RBP4) gene, and several unknown candidate genes related to reproduction. Several pitch point genes were selected for association study with reproduction traits. For instance, DPPA5 g.363 T>C was found to associate with litter born weight at later parities in Beijing Black pigs significantly (p < 0.05). Overall, this study contributes to elucidating the mechanism underlying pregnancy processes, which maybe provide valuable information for pig reproduction improvement.

  17. Differentiating mechanisms of toxicity using global gene expression analysis in Saccharomyces cerevisiae.

    PubMed

    Caba, Ebru; Dickinson, Donna A; Warnes, Gregory R; Aubrecht, Jiri

    2005-08-04

    Genotoxic stress triggers a variety of biological responses including the transcriptional activation of genes regulating DNA repair, cell survival and cell death. Genomic approaches, which monitor gene expressions across large numbers of genes, can serve as a powerful tool for exploring mechanisms of toxicity. Here, using five different agents, we investigated whether the analysis of genome-wide expression profiles in Saccharomyces cerevisiae could provide insights into mechanisms of genotoxicity versus cytotoxicity. To differentiate the genotoxic stress-associated expression signatures from that of a general cytotoxic stress, we compared gene expression profiles following the treatment with DNA-reactive (cisplatin, MMS, bleomycin) and DNA non-reactive (ethanol and sodium chloride) compounds. Although each of the tested chemicals produced a distinct gene expression profile, we were able to identify a gene expression signature consisting of a relatively small number of biologically relevant genes capable of differentiating genotoxic and cytotoxic stress. The gene set includes such upregulated genes as HUG1, ECM4 and previously uncharacterized gene, YLR297W in the genotoxic and GAP1, CGR1 in the cytotoxic group. Our results indicate the potential of gene expression profile analysis for elucidating mechanism of action of genotoxic agents.

  18. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  19. Gene expression profiling data of Schizosaccharomyces pombe under nitrosative stress using differential display

    PubMed Central

    Biswas, Pranjal; Majumdar, Uddalak; Ghosh, Sanjay

    2015-01-01

    Excess production of nitric oxide (NO) and reactive nitrogen intermediates (RNIs) causes nitrosative stress on cells. Schizosaccharomyces pombe was used as a model to study nitrosative stress response. In the present data article, we have used differential display to identify the differentially expressed genes in the fission yeast under nitrosative stress conditions. We have used pure NO donor compound detaNONOate at final concentrations of 0.1 mM and 1 mM to treat the cells for 15 min alongside control before studying their gene expression profiles. At both the treated conditions, we identified genes which were commonly repressed while several genes were induced upon both 0.1 mM and 1 mM treatments. The differentially expressed genes were further analyzed in DAVID and categorized into several different pathways. PMID:26858975

  20. Extent of differential allelic expression of candidate breast cancer genes is similar in blood and breast.

    PubMed

    Maia, Ana-Teresa; Spiteri, Inmaculada; Lee, Alvin J X; O'Reilly, Martin; Jones, Linda; Caldas, Carlos; Ponder, Bruce A J

    2009-01-01

    Normal gene expression variation is thought to play a central role in inter-individual variation and susceptibility to disease. Regulatory polymorphisms in cis-acting elements result in the unequal expression of alleles. Differential allelic expression (DAE) in heterozygote individuals could be used to develop a new approach to discover regulatory breast cancer susceptibility loci. As access to large numbers of fresh breast tissue to perform such studies is difficult, a suitable surrogate test tissue must be identified for future studies. We measured differential allelic expression of 12 candidate genes possibly related to breast cancer susceptibility (BRCA1, BRCA2, C1qA, CCND3, EMSY, GPX1, GPX4, MLH3, MTHFR, NBS1, TP53 and TRXR2) in breast tissue (n = 40) and fresh blood (n = 170) of healthy individuals and EBV-transformed lymphoblastoid cells (n = 19). Differential allelic expression ratios were determined by Taqman assay. Ratio distributions were compared using t-test and Wilcoxon rank sum test, for mean ratios and variances respectively. We show that differential allelic expression is common among these 12 candidate genes and is comparable between breast and blood (fresh and transformed lymphoblasts) in a significant proportion of them. We found that eight out of nine genes with DAE in breast and fresh blood were comparable, as were 10 out of 11 genes between breast and transformed lymphoblasts. Our findings support the use of differential allelic expression in blood as a surrogate for breast tissue in future studies on predisposition to breast cancer.

  1. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  2. EVE (external variance estimation) increases statistical power for detecting differentially expressed genes.

    PubMed

    Wille, Anja; Gruissem, Wilhelm; Bühlmann, Peter; Hennig, Lars

    2007-11-01

    Accurately identifying differentially expressed genes from microarray data is not a trivial task, partly because of poor variance estimates of gene expression signals. Here, after analyzing 380 replicated microarray experiments, we found that probesets have typical, distinct variances that can be estimated based on a large number of microarray experiments. These probeset-specific variances depend at least in part on the function of the probed gene: genes for ribosomal or structural proteins often have a small variance, while genes implicated in stress responses often have large variances. We used these variance estimates to develop a statistical test for differentially expressed genes called EVE (external variance estimation). The EVE algorithm performs better than the t-test and LIMMA on some real-world data, where external information from appropriate databases is available. Thus, EVE helps to maximize the information gained from a typical microarray experiment. Nonetheless, only a large number of replicates will guarantee to identify nearly all truly differentially expressed genes. However, our simulation studies suggest that even limited numbers of replicates will usually result in good coverage of strongly differentially expressed genes.

  3. Incorporating prior biological knowledge for network-based differential gene expression analysis using differentially weighted graphical LASSO.

    PubMed

    Zuo, Yiming; Cui, Yi; Yu, Guoqiang; Li, Ruijiang; Ressom, Habtom W

    2017-02-10

    Conventional differential gene expression analysis by methods such as student's t-test, SAM, and Empirical Bayes often searches for statistically significant genes without considering the interactions among them. Network-based approaches provide a natural way to study these interactions and to investigate the rewiring interactions in disease versus control groups. In this paper, we apply weighted graphical LASSO (wgLASSO) algorithm to integrate a data-driven network model with prior biological knowledge (i.e., protein-protein interactions) for biological network inference. We propose a novel differentially weighted graphical LASSO (dwgLASSO) algorithm that builds group-specific networks and perform network-based differential gene expression analysis to select biomarker candidates by considering their topological differences between the groups. Through simulation, we showed that wgLASSO can achieve better performance in building biologically relevant networks than purely data-driven models (e.g., neighbor selection, graphical LASSO), even when only a moderate level of information is available as prior biological knowledge. We evaluated the performance of dwgLASSO for survival time prediction using two microarray breast cancer datasets previously reported by Bild et al. and van de Vijver et al. Compared with the top 10 significant genes selected by conventional differential gene expression analysis method, the top 10 significant genes selected by dwgLASSO in the dataset from Bild et al. led to a significantly improved survival time prediction in the independent dataset from van de Vijver et al. Among the 10 genes selected by dwgLASSO, UBE2S, SALL2, XBP1 and KIAA0922 have been confirmed by literature survey to be highly relevant in breast cancer biomarker discovery study. Additionally, we tested dwgLASSO on TCGA RNA-seq data acquired from patients with hepatocellular carcinoma (HCC) on tumors samples and their corresponding non-tumorous liver tissues. Improved

  4. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    PubMed

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  5. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus

    PubMed Central

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-01-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus. PMID:27853123

  6. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    PubMed

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  7. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  8. Balancing Type One and Two Errors in Multiple Testing for Differential Expression of Genes

    PubMed Central

    Gordon, Alexander; Chen, Linlin; Glazko, Galina; Yakovlev, Andrei

    2009-01-01

    A new procedure is proposed to balance type I and II errors in significance testing for differential expression of individual genes. Suppose that a collection, ℱk, of k lists of selected genes is available, each of them approximating by their content the true set of differentially expressed genes. For example, such sets can be generated by a subsampling counterpart of the delete-d-jackknife method controlling the per-comparison error rate for each subsample. A final list of candidate genes, denoted by S*, is composed in such a way that its contents be closest in some sense to all the sets thus generated. To measure “closeness” of gene lists, we introduce an asymmetric distance between sets with its asymmetry arising from a generally unequal assignment of the relative costs of type I and type II errors committed in the course of gene selection. The optimal set S* is defined as a minimizer of the average asymmetric distance from an arbitrary set S to all sets in the collection ℱk. The minimization problem can be solved explicitly, leading to a frequency criterion for the inclusion of each gene in the final set. The proposed method is tested by resampling from real microarray gene expression data with artificially introduced shifts in expression levels of pre-defined genes, thereby mimicking their differential expression. PMID:20161303

  9. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.

    PubMed

    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M

    2013-10-01

    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  10. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  11. EMDomics: a robust and powerful method for the identification of genes differentially expressed between heterogeneous classes.

    PubMed

    Nabavi, Sheida; Schmolze, Daniel; Maitituoheti, Mayinuer; Malladi, Sadhika; Beck, Andrew H

    2016-02-15

    A major goal of biomedical research is to identify molecular features associated with a biological or clinical class of interest. Differential expression analysis has long been used for this purpose; however, conventional methods perform poorly when applied to data with high within class heterogeneity. To address this challenge, we developed EMDomics, a new method that uses the Earth mover's distance to measure the overall difference between the distributions of a gene's expression in two classes of samples and uses permutations to obtain q-values for each gene. We applied EMDomics to the challenging problem of identifying genes associated with drug resistance in ovarian cancer. We also used simulated data to evaluate the performance of EMDomics, in terms of sensitivity and specificity for identifying differentially expressed gene in classes with high within class heterogeneity. In both the simulated and real biological data, EMDomics outperformed competing approaches for the identification of differentially expressed genes, and EMDomics was significantly more powerful than conventional methods for the identification of drug resistance-associated gene sets. EMDomics represents a new approach for the identification of genes differentially expressed between heterogeneous classes and has utility in a wide range of complex biomedical conditions in which sample classes show within class heterogeneity. The R package is available at http://www.bioconductor.org/packages/release/bioc/html/EMDomics.html. © The Author 2015. Published by Oxford University Press.

  12. Transcriptome-Wide Differential Gene Expression in Bicyclus anynana Butterflies: Female Vision-Related Genes Are More Plastic.

    PubMed

    Macias-Muñoz, Aide; Smith, Gilbert; Monteiro, Antónia; Briscoe, Adriana D

    2016-01-01

    Vision is energetically costly to maintain. Consequently, over time many cave-adapted species downregulate the expression of vision genes or even lose their eyes and associated eye genes entirely. Alternatively, organisms that live in fluctuating environments, with different requirements for vision at different times, may evolve phenotypic plasticity for expression of vision genes. Here, we use a global transcriptomic and candidate gene approach to compare gene expression in the heads of a polyphenic butterfly. Bicyclus anynana have two seasonal forms that display sexual dimorphism and plasticity in eye morphology, and female-specific plasticity in opsin gene expression. Nonchoosy dry season females downregulate opsin expression, consistent with the high physiological cost of vision. To identify other genes associated with sexually dimorphic and seasonally plastic differences in vision, we analyzed RNA-sequencing data from whole head tissues. We identified two eye development genes (klarsicht and warts homologs) and an eye pigment biosynthesis gene (henna) differentially expressed between seasonal forms. By comparing sex-specific expression across seasonal forms, we found that klarsicht, warts, henna, and another eye development gene (domeless) were plastic in a female-specific manner. In a male-only analysis, white (w) was differentially expressed between seasonal forms. Reverse transcription polymerase chain reaction confirmed that warts and white are expressed in eyes only, whereas klarsicht, henna and domeless are expressed in both eyes and brain. We find that differential expression of eye development and eye pigment genes is associated with divergent eye phenotypes in B. anynana seasonal forms, and that there is a larger effect of season on female vision-related genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Pdx1 level defines pancreatic gene expression pattern and cell lineage differentiation.

    PubMed

    Wang, H; Maechler, P; Ritz-Laser, B; Hagenfeldt, K A; Ishihara, H; Philippe, J; Wollheim, C B

    2001-07-06

    The absence of Pdx1 and the expression of brain-4 distinguish alpha-cells from other pancreatic endocrine cell lineages. To define the transcription factor responsible for pancreatic cell differentiation, we employed the reverse tetracycline-dependent transactivator system in INS-I cell-derived subclones INSralphabeta and INSrbeta to achieve tightly controlled and conditional expression of wild type Pdx1 or its dominant-negative mutant, as well as brain-4. INSralphabeta cells express not only insulin but also glucagon and brain-4, while INSrbeta cells express only insulin. Overexpression of Pdx1 eliminated glucagon mRNA and protein in INSralphabeta cells and promoted the expression of beta-cell-specific genes in INSrbeta cells. Induction of dominant-negative Pdx1 in INSralphabeta cells resulted in differentiation of insulin-producing beta-cells into glucagon-containing alpha-cells without altering brain4 expression. Loss of Pdx1 function alone in INSrbeta cells, which do not express endogenous brain-4 and glucagon, was also sufficient to abolish the expression of genes restricted to beta-cells and to cause alpha-cell differentiation. In contrast, induction of brain-4 in INSrbeta cells initiated detectable expression of glucagon but did not affect beta-cell-specific gene expression. In conclusion, Pdx1 confers the expression of pancreatic beta-cell-specific genes, such as genes encoding insulin, islet amyloid polypeptide, Glut2, and Nkx6.1. Pdx1 defines pancreatic cell lineage differentiation. Loss of Pdx1 function rather than expression of brain4 is a prerequisite for alpha-cell differentiation.

  14. A Microarray Analysis for Differential Gene Expression in the Soybean Genome Using Bioconductor and R

    USDA-ARS?s Scientific Manuscript database

    This paper describes specific procedures for conducting quality assessment of Affymetrix GeneChip® soybean genome data and performing analyses to determine differential gene expression using the open-source R language and environment in conjunction with the open-source Bioconductor package. Procedu...

  15. Tissue-based microarray expression of genes predictive of metastasis in uveal melanoma and differentially expressed in metastatic uveal melanoma.

    PubMed

    Demirci, Hakan; Reed, David; Elner, Victor M

    2013-10-01

    To screen the microarray expression of CDH1, ECM1, EIF1B, FXR1, HTR2B, ID2, LMCD1, LTA4H, MTUS1, RAB31, ROBO1, and SATB1 genes which are predictive of primary uveal melanoma metastasis, and NFKB2, PTPN18, MTSS1, GADD45B, SNCG, HHIP, IL12B, CDK4, RPLP0, RPS17, RPS12 genes that are differentially expressed in metastatic uveal melanoma in normal whole human blood and tissues prone to metastatic involvement by uveal melanoma. We screened the GeneNote and GNF BioGPS databases for microarray analysis of genes predictive of primary uveal melanoma metastasis and those differentially expressed in metastatic uveal melanoma in normal whole blood, liver, lung and skin. Microarray analysis showed expression of all 22 genes in normal whole blood, liver, lung and skin, which are the most common sites of metastases. In the GNF BioGPS database, data for expression of the HHIP gene in normal whole blood and skin was not complete. Microarray analysis of genes predicting systemic metastasis of uveal melanoma and genes differentially expressed in metastatic uveal melanoma may not be used as a biomarker for metastasis in whole blood, liver, lung, and skin. Their expression in tissues prone to metastasis may suggest that they play a role in tropism of uveal melanoma metastasis to these tissues.

  16. Differential gene expression according to race and host plant in the pea aphid.

    PubMed

    Eyres, Isobel; Jaquiéry, Julie; Sugio, Akiko; Duvaux, Ludovic; Gharbi, Karim; Zhou, Jing-Jiang; Legeai, Fabrice; Nelson, Michaela; Simon, Jean-Christophe; Smadja, Carole M; Butlin, Roger; Ferrari, Julia

    2016-09-01

    Host-race formation in phytophagous insects is thought to provide the opportunity for local adaptation and subsequent ecological speciation. Studying gene expression differences amongst host races may help to identify phenotypes under (or resulting from) divergent selection and their genetic, molecular and physiological bases. The pea aphid (Acyrthosiphon pisum) comprises host races specializing on numerous plants in the Fabaceae and provides a unique system for examining the early stages of diversification along a gradient of genetic and associated adaptive divergence. In this study, we examine transcriptome-wide gene expression both in response to environment and across pea aphid races selected to cover the range of genetic divergence reported in this species complex. We identify changes in expression in response to host plant, indicating the importance of gene expression in aphid-plant interactions. Races can be distinguished on the basis of gene expression, and higher numbers of differentially expressed genes are apparent between more divergent races; these expression differences between host races may result from genetic drift and reproductive isolation and possibly divergent selection. Expression differences related to plant adaptation include a subset of chemosensory and salivary genes. Genes showing expression changes in response to host plant do not make up a large portion of between-race expression differences, providing confirmation of previous studies' findings that genes involved in expression differences between diverging populations or species are not necessarily those showing initial plasticity in the face of environmental change.

  17. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  18. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  19. A Single Enhancer Regulating the Differential Expression of Duplicated Red-Sensitive Opsin Genes in Zebrafish

    PubMed Central

    Tsujimura, Taro; Hosoya, Tomohiro; Kawamura, Shoji

    2010-01-01

    A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio) have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs) in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC) clones encompassing the two genes and identified a 0.6-kb “LWS-activating region” (LAR) upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins. PMID:21187910

  20. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.

    PubMed

    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  1. Differential Gene Expression Profiling and Biological Process Analysis in Proximal Nerve Segments after Sciatic Nerve Transection

    PubMed Central

    Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h–14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective. PMID:23437294

  2. Stem Leydig cell differentiation: gene expression during development of the adult rat population of Leydig cells.

    PubMed

    Stanley, Erin L; Johnston, Daniel S; Fan, Jinjiang; Papadopoulos, Vassilios; Chen, Haolin; Ge, Ren-Shan; Zirkin, Barry R; Jelinsky, Scott A

    2011-12-01

    Leydig cells are the testosterone-producing cells in the adult male. Adult Leydig cells (ALCs) develop from stem Leydig cells (SLCs) through at least two intermediate cells, progenitor Leydig cells (PLCs) and immature Leydig cells (ILCs). Microarray gene expression was used to identify the transcriptional changes that occur with the differentiation of SLCs to PLCs and, thus, with the entry of SLCs into the Leydig cell lineage; to comprehensively examine differentiation through the development of ALCs; and to relate the pattern of gene expression in SLCs to that in a well-established stem cell, bone marrow stem cells (BSCs). We show that the pattern of gene expression by SLCs was more similar to the expression by BSCs, an established stem cell outside the male reproductive tract, than to any of the cells in the Leydig cell developmental lineage. These results indicated that the SLCs have many of the molecular characteristics of other stem cells. Pathway analysis indicated that development of Leydig cells from SLCs to PLCs was associated with decreased expression of genes related to adhesion and increased expression of genes related to steroidogenesis. Gene expression changes between PLCs and ILCs and between ILCs and ALCs were relatively minimal, suggesting that these cells are highly similar. In contrast, gene expression changes between SLCs and ALCs were quite distinct.

  3. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    PubMed Central

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  4. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  5. Fully Bayesian mixture model for differential gene expression: simulations and model checks.

    PubMed

    Lewin, Alex; Bochkina, Natalia; Richardson, Sylvia

    2007-01-01

    We present a Bayesian hierarchical model for detecting differentially expressed genes using a mixture prior on the parameters representing differential effects. We formulate an easily interpretable 3-component mixture to classify genes as over-expressed, under-expressed and non-differentially expressed, and model gene variances as exchangeable to allow for variability between genes. We show how the proportion of differentially expressed genes, and the mixture parameters, can be estimated in a fully Bayesian way, extending previous approaches where this proportion was fixed and empirically estimated. Good estimates of the false discovery rates are also obtained. Different parametric families for the mixture components can lead to quite different classifications of genes for a given data set. Using Affymetrix data from a knock out and wildtype mice experiment, we show how predictive model checks can be used to guide the choice between possible mixture priors. These checks show that extending the mixture model to allow extra variability around zero instead of the usual point mass null fits the data better. A software package for R is available.

  6. Differential expression of ferritin genes in response to abiotic stresses and hormones in pear (Pyrus pyrifolia).

    PubMed

    Xi, Li; Xu, Kuanyong; Qiao, Yushan; Qu, Shenchun; Zhang, Zhen; Dai, Wenhao

    2011-10-01

    In this study, the expression patterns of four ferritin genes (PpFer1, PpFer2, PpFer3, and PpFer4) in pear were investigated using quantitative real-time PCR. Analysis of tissue-specific expression revealed higher expression level of these genes in leaves than in other tested tissues. These ferritin genes were differentially expressed in response to various abiotic stresses and hormones treatments. The expression of ferritin wasn't affected by Fe(III)-citrate treatment. Abscisic acid significantly enhanced the expression of all four ferritin genes, especially PpFer2, followed by N-benzylyminopurine, gibberellic acid, and indole-3-acetic acid. The expression peaks of PpFer1 and PpFer3 in leaves appeared at 6, 6, and 12 h, respectively, after pear plant was exposed to oxidative stress (5 mM H(2)O(2)), salt stress (200 mM NaCl), and heat stress (40°C). A significant increase in PpFer4 expression was detected at 6 h after salt stress or heat stress. The expression of ferritin genes was not altered by cold stress. These results suggested that ferritin genes might be functionally important in acclimation of pear to salt and oxidative stresses. Hormone treatments had no significant effect on expression of ferritin genes compared to abiotic stresses. This showed accumulation of ferritin genes could be operated by different transduction pathways under abiotic stresses and hormones treatments.

  7. CEDER: Accurate detection of differentially expressed genes by combining significance of exons using RNA-Seq

    PubMed Central

    Wan, Lin; Sun, Fengzhu

    2012-01-01

    RNA-Seq is widely used in transcriptome studies, and the detection of differentially expressed genes (DEGs) between two classes of individuals, e.g. cases vs controls, using RNA-Seq is of fundamental importance. Many statistical methods for DEG detection based on RNA-Seq data have been developed and most of them are based on the read counts mapped to individual genes. On the other hand, genes are composed of exons and the distribution of reads for the different exons can be heterogeneous. We hypothesize that the detection accuracy of differentially expressed genes can be increased by analyzing individual exons within a gene and then combining the results of the exons. We therefore developed a novel program, termed CEDER, to accurately detect DGEs by combining the significance of the exons. CEDER first tests for differentially expressed exons yielding a p-value for each, and then gives a score indicating the potential for a gene to be differentially expressed by integrating the p-values of the exons in the gene. We showed that CEDER can significantly increase the accuracy of existing methods for detecting DEGs on two benchmark RNA-Seq datasets and simulated datasets. PMID:22641709

  8. [Differential expression of genes that encode glycolysis enzymes in kidney and lung cancer in humans].

    PubMed

    Oparina, N Yu; Snezhkina, A V; Sadritdinova, A F; Veselovskii, V A; Dmitriev, A A; Senchenko, V N; Mel'nikova, N V; Speranskaya, A S; Darii, M V; Stepanov, O A; Barkhatov, I M; Kudryavtseva, A V

    2013-07-01

    Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis. More than 30 enzymes are involved in glycolysis, and genes that encode them can be considered housekeeping genes due to the high conservatism and evolutionary antiquity of the process. We studied the expression of these genes in kidney papillary cancer and planocellular lung cancer via the bioinformatic analysis of transcriptome database and method of quantitative real time PCR. Quantitative analysis of mRNA level demonstrated that only a part ofgenes that encode glycolysis enzymes maintain relatively stable mRNA level, including the HK1, ADPGK, GPI, PGK1, and PKM2 genes in kidney papillary cancer and the ADPGK, ALDOA, GAPDH, PGK1, BPGM, ENO1, and PKM2 genes in planocellular lung cancer. The frequent increase in the mRNA expression of PFKP, ALDOA, and GAPDH genes in kidney cancer, as well as the GPI gene in lung cancer, were detected for the first time by real time PCR. For other genes, their differential expression was demonstrated; the cases of both a decrease and increase in the mRNA level were detected. Thus, several genes that can be used as control genes in transcriptome analysis by real time PCR in kidney and lung cancer, as well as a number of differentially expressed genes that can be potential oncomarkers, were identified.

  9. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  10. The Wilms’ Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation

    PubMed Central

    Kim, Jungho; Prawitt, Dirk; Bardeesy, Nabeel; Torban, Elena; Vicaner, Caroline; Goodyer, Paul; Zabel, Bernard; Pelletier, Jerry

    1999-01-01

    Gonadal differentiation is dependent upon a molecular cascade responsible for ovarian or testicular development from the bipotential gonadal ridge. Genetic analysis has implicated a number of gene products essential for this process, which include Sry, WT1, SF-1, and DAX-1. We have sought to better define the role of WT1 in this process by identifying downstream targets of WT1 during normal gonadal development. We have noticed that in the developing murine gonadal ridge, wt1 expression precedes expression of Dax-1, a nuclear receptor gene. We document here that the spatial distribution profiles of both proteins in the developing gonad overlap. We also demonstrate that WT1 can activate the Dax-1 promoter. Footprinting analysis, transient transfections, promoter mutagenesis, and mobility shift assays suggest that WT1 regulates Dax-1 via GC-rich binding sites found upstream of the Dax-1 TATA box. We show that two WT1-interacting proteins, the product of a Denys-Drash syndrome allele of wt1 and prostate apoptosis response-4 protein, inhibit WT1-mediated transactivation of Dax-1. In addition, we demonstrate that WT1 can activate the endogenous Dax-1 promoter. Our results indicate that the WT1–DAX-1 pathway is an early event in the process of mammalian sex determination. PMID:10022915

  11. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  12. Effects of Sample Size on Differential Gene Expression, Rank Order and Prediction Accuracy of a Gene Signature

    PubMed Central

    Stretch, Cynthia; Khan, Sheehan; Asgarian, Nasimeh; Eisner, Roman; Vaisipour, Saman; Damaraju, Sambasivarao; Graham, Kathryn; Bathe, Oliver F.; Steed, Helen; Greiner, Russell; Baracos, Vickie E.

    2013-01-01

    Top differentially expressed gene lists are often inconsistent between studies and it has been suggested that small sample sizes contribute to lack of reproducibility and poor prediction accuracy in discriminative models. We considered sex differences (69♂, 65♀) in 134 human skeletal muscle biopsies using DNA microarray. The full dataset and subsamples (n = 10 (5♂, 5♀) to n = 120 (60♂, 60♀)) thereof were used to assess the effect of sample size on the differential expression of single genes, gene rank order and prediction accuracy. Using our full dataset (n = 134), we identified 717 differentially expressed transcripts (p<0.0001) and we were able predict sex with ∼90% accuracy, both within our dataset and on external datasets. Both p-values and rank order of top differentially expressed genes became more variable using smaller subsamples. For example, at n = 10 (5♂, 5♀), no gene was considered differentially expressed at p<0.0001 and prediction accuracy was ∼50% (no better than chance). We found that sample size clearly affects microarray analysis results; small sample sizes result in unstable gene lists and poor prediction accuracy. We anticipate this will apply to other phenotypes, in addition to sex. PMID:23755224

  13. Inhibition of human primary megakaryocyte differentiation by anagrelide: a gene expression profiling analysis.

    PubMed

    Sakurai, Kazuki; Fujiwara, Tohru; Hasegawa, Shin; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Yamada-Fujiwara, Minami; Ichinohasama, Ryo; Harigae, Hideo

    2016-08-01

    Anagrelide is a treatment option for patients with essential thrombocythemia. Although the clinical efficacy of anagrelide has been established, there is limited knowledge of the molecular mechanism underlying its effect. Here, we evaluated the effect of anagrelide on primary megakaryocytic progenitors from cord blood-derived CD34-positive cells. Anagrelide treatment reduced the expression of megakaryocytic markers (CD41 and CD61). Microarray analysis was performed to characterize gene profiles altered by exposure to anagrelide. The analysis demonstrated upregulation and downregulation (>2-fold) of eight and 34 genes, respectively, in anagrelide-treated megakaryocyte progenitors. This included genes encoding prototypical megakaryocytic proteins, such as PPBP, PF4, and GP6. Gene ontology analysis of genes suppressed by anagrelide treatment revealed significant enrichment of genes involved in platelet activation and degranulation. Expression levels of transcription factors involved in megakaryocyte commitment/differentiation were further evaluated by quantitative RT-PCR, demonstrating significant downregulation of FLI1 and TAL1 in anagrelide-treated megakaryocyte progenitors. Knockdown of TAL1 in primary megakaryocyte progenitors confirmed significant downregulation of FLI1 and megakaryocytic genes. Anagrelide had no significant effect on the surface expression of erythroid markers or on the expression of transcription factors involved in erythroid commitment/differentiation. In conclusion, anagrelide suppresses megakaryocytic differentiation, partly through decreasing the expression of megakaryocytic transcription factors.

  14. Microarray analysis of differentially expressed genes engaged in fruit development between Prunus mume and Prunus armeniaca.

    PubMed

    Li, Xiaoying; Korir, Nicholas Kibet; Liu, Lili; Shangguan, Lingfei; Wang, Yuzhu; Han, Jian; Chen, Ming; Fang, Jinggui

    2012-11-15

    Microarray analysis is a technique that can be employed to provide expression profiles of single genes and new insights to elucidate the biological mechanisms responsible for fruit development. To evaluate expression of genes mostly engaged in fruit development between Prunus mume and Prunus armeniaca, we first identified differentially expressed transcripts along the entire fruit life cycle by using microarrays spotted with 10,641 ESTs collected from P. mume and other Prunus EST sequences. A total of 1418 ESTs were selected after quality control of microarray spots and analysis for differential gene expression patterns during fruit development of P. mume and P. Armeniaca. From these, 707 up-regulated and 711 down-regulated genes showing more than two-fold differences in expression level were annotated by GO based on biological processes, molecular functions and cellular components. These differentially expressed genes were found to be involved in several important pathways of carbohydrate, galactose, and starch and sucrose metabolism as well as in biosynthesis of other secondary metabolites via KEGG. This could provide detailed information on the fruit quality differences during development and ripening of these two species. With the results obtained, we provide a practical database for comprehensive understanding of molecular events during fruit development and also lay a theoretical foundation for the cloning of genes regulating in a series of important rate-limiting enzymes involved in vital metabolic pathways during fruit development. Copyright © 2012 Elsevier GmbH. All rights reserved.

  15. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.)

    PubMed Central

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M.; Liu, Liwang

    2016-01-01

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish. PMID:26902837

  16. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.).

    PubMed

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M; Liu, Liwang

    2016-02-23

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish.

  17. Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain

    PubMed Central

    Montoya, Julio Cesar; Fajardo, Dianora; Peña, Angela; Sánchez, Adalberto; Domínguez, Martha C; Satizábal, José María

    2014-01-01

    Background: The information of gene expression obtained from databases, have made possible the extraction and analysis of data related with several molecular processes involving not only in brain homeostasis but its disruption in some neuropathologies; principally in Down syndrome and the Alzheimer disease. Objective: To correlate the levels of transcription of 19 genes located in the Down Syndrome Critical Region (DSCR) with their expression in several substructures of normal human brain. Methods: There were obtained expression profiles of 19 DSCR genes in 42 brain substructures, from gene expression values available at the database of the human brain of the Brain Atlas of the Allen Institute for Brain Sciences", (http://human.brain-map.org/). The co-expression patterns of DSCR genes in brain were calculated by using multivariate statistical methods. Results: Highest levels of gene expression were registered at caudate nucleus, nucleus accumbens and putamen among central areas of cerebral cortex. Increased expression levels of RCAN1 that encode by a protein involved in signal transduction process of the CNS were recorded for PCP4 that participates in the binding to calmodulin and TTC3; a protein that is associated with differentiation of neurons. That previously identified brain structures play a crucial role in the learning process, in different class of memory and in motor skills. Conclusion: The precise regulation of DSCR gene expression is crucial to maintain the brain homeostasis, especially in those areas with high levels of gene expression associated with a remarkable process of learning and cognition. PMID:25767303

  18. Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain.

    PubMed

    Montoya, Julio Cesar; Fajardo, Dianora; Peña, Angela; Sánchez, Adalberto; Domínguez, Martha C; Satizábal, José María; García-Vallejo, Felipe

    2014-01-01

    The information of gene expression obtained from databases, have made possible the extraction and analysis of data related with several molecular processes involving not only in brain homeostasis but its disruption in some neuropathologies; principally in Down syndrome and the Alzheimer disease. To correlate the levels of transcription of 19 genes located in the Down Syndrome Critical Region (DSCR) with their expression in several substructures of normal human brain. There were obtained expression profiles of 19 DSCR genes in 42 brain substructures, from gene expression values available at the database of the human brain of the Brain Atlas of the Allen Institute for Brain Sciences", (http://human.brain-map.org/). The co-expression patterns of DSCR genes in brain were calculated by using multivariate statistical methods. Highest levels of gene expression were registered at caudate nucleus, nucleus accumbens and putamen among central areas of cerebral cortex. Increased expression levels of RCAN1 that encode by a protein involved in signal transduction process of the CNS were recorded for PCP4 that participates in the binding to calmodulin and TTC3; a protein that is associated with differentiation of neurons. That previously identified brain structures play a crucial role in the learning process, in different class of memory and in motor skills. The precise regulation of DSCR gene expression is crucial to maintain the brain homeostasis, especially in those areas with high levels of gene expression associated with a remarkable process of learning and cognition.

  19. Forced expression of Hnf4a induces hepatic gene activation through directed differentiation.

    PubMed

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Fathi, Fardin

    2016-08-05

    Embryonic stem (ES) cells are capable of unlimited self-renewal and have a diverse differentiation potential. These unique features make ES cells as an attractive source for developmental biology studies. Having the mature hepatocyte in the lab with functional activities is valuable in drug discovery studies. Overexpression of hepatocyte lineage-specific transcription factors (TFs) becomes a promising approach in pluripotent cell differentiation toward liver cells. Many studies generate transgenic ES cell lines to examine the effects of specific TFs overexpression in cell differentiation. In the present report, we have addressed whether a suspension or adherent model of differentiation is an appropriate way to study the role of Hnf4a overexpression. We generated ES cells that carried a doxycycline (Dox)-inducible Hnf4a using lentiviral vectors. The transduced cells were subjected to induced Hnf4a overexpression through both spontaneous and directed differentiation methods. Gene expression analysis showed substantially increased expression of hepatic gene markers, particularly Ttr and endogenous Hnf4a, in transduced cells differentiated by the directed approach. These results demonstrated that forced expression of TFs during directed differentiation would be an appropriate way to study relevant gene activation and the effects of overexpression in the context of hepatic differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Cryptococcus neoformans Differential Gene Expression Detected In Vitro and In Vivo with Green Fluorescent Protein

    PubMed Central

    del Poeta, Maurizio; Toffaletti, Dena L.; Rude, Thomas H.; Sparks, Sara D.; Heitman, Joseph; Perfect, John R.

    1999-01-01

    Synthetic green fluorescent protein (GFP) was used as a reporter to detect differential gene expression in the pathogenic fungus Cryptococcus neoformans. Promoters from the C. neoformans actin, GAL7, or mating-type alpha pheromone (MFα1) genes were fused to GFP, and the resulting reporter genes were used to assess gene expression in serotype A C. neoformans. Yeast cells containing an integrated pACT::GFP construct demonstrated that the actin promoter was expressed during vegetative growth on yeast extract-peptone-dextrose medium. In contrast, yeast cells containing the inducible GAL7::GFP or MFα1::GFP reporter genes expressed significant GFP activity only during growth on galactose medium or V-8 agar, respectively. These findings demonstrated that the GAL7 and MFα1 promoters from a serotype D C. neoformans strain function when introduced into a serotype A strain. Because the MFα1 promoter is induced by nutrient deprivation and the MATα locus containing the MFα1 gene has been linked with virulence, yeast cells containing the pMFα1::GFP reporter gene were analyzed for GFP expression in the central nervous system (CNS) of immunosuppressed rabbits. In fact, significant GFP expression from the MFα1::GFP reporter gene was detected after the first week of a CNS infection. These findings suggest that there are temporal, host-specific cues that regulate gene expression during infection and that the MFα1 gene is induced during the proliferative stage of a CNS infection. In conclusion, GFP can be used as an effective and sensitive reporter to monitor specific C. neoformans gene expression in vitro, and GFP reporter constructs can be used as an approach to identify a novel gene(s) or to characterize known genes whose expression is regulated during infection. PMID:10085022

  1. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  2. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  3. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    PubMed Central

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  4. Identification of differentially expressed genes and signalling pathways in bark of Hevea brasiliensis seedlings associated with secondary laticifer differentiation using gene expression microarray.

    PubMed

    Loh, Swee Cheng; Thottathil, Gincy P; Othman, Ahmad Sofiman

    2016-10-01

    The natural rubber of Para rubber tree, Hevea brasiliensis, is the main crop involved in industrial rubber production due to its superior quality. The Hevea bark is commercially exploited to obtain latex, which is produced from the articulated secondary laticifer. The laticifer is well defined in the aspect of morphology; however, only some genes associated with its development have been reported. We successfully induced secondary laticifer in the jasmonic acid (JA)-treated and linolenic acid (LA)-treated Hevea bark but secondary laticifer is not observed in the ethephon (ET)-treated and untreated Hevea bark. In this study, we analysed 27,195 gene models using NimbleGen microarrays based on the Hevea draft genome. 491 filtered differentially expressed (FDE) transcripts that are common to both JA- and LA-treated bark samples but not ET-treated bark samples were identified. In the Eukaryotic Orthologous Group (KOG) analysis, 491 FDE transcripts belong to different functional categories that reflect the diverse processes and pathways involved in laticifer differentiation. In the Kyoto Encyclopedia of Genes and Genomes (KEGG) and KOG analysis, the profile of the FDE transcripts suggest that JA- and LA-treated bark samples have a sufficient molecular basis for secondary laticifer differentiation, especially regarding secondary metabolites metabolism. FDE genes in this category are from the cytochrome (CYP) P450 family, ATP-binding cassette (ABC) transporter family, short-chain dehydrogenase/reductase (SDR) family, or cinnamyl alcohol dehydrogenase (CAD) family. The data includes many genes involved in cell division, cell wall synthesis, and cell differentiation. The most abundant transcript in FDE list was SDR65C, reflecting its importance in laticifer differentiation. Using the Basic Local Alignment Search Tool (BLAST) as part of annotation and functional prediction, several characterised as well as uncharacterized transcription factors and genes were found in the

  5. Transcriptomic analysis reveals differential gene expression in response to aluminium in common bean (Phaseolus vulgaris) genotypes

    PubMed Central

    Eticha, Dejene; Zahn, Marc; Bremer, Melanie; Yang, Zhongbao; Rangel, Andrés F.; Rao, Idupulapati M.; Horst, Walter J.

    2010-01-01

    Background and Aims Aluminium (Al) resistance in common bean is known to be due to exudation of citrate from the root after a lag phase, indicating the induction of gene transcription and protein synthesis. The aims of this study were to identify Al-induced differentially expressed genes and to analyse the expression of candidate genes conferring Al resistance in bean. Methods The suppression subtractive hybridization (SSH) method was used to identify differentially expressed genes in an Al-resistant bean genotype (‘Quimbaya’) during the induction period. Using quantitative real-time PCR the expression patterns of selected genes were compared between an Al-resistant and an Al-sensitive genotype (‘VAX 1’) treated with Al for up to 24 h. Key Results Short-term Al treatment resulted in up-regulation of stress-induced genes and down-regulation of genes involved in metabolism. However, the expressions of genes encoding enzymes involved in citrate metabolism were not significantly affected by Al. Al treatment dramatically increased the expression of common bean expressed sequence tags belonging to the citrate transporter gene family MATE (multidrug and toxin extrusion family protein) in both the Al-resistant and -sensitive genotype in close agreement with Al-induced citrate exudation. Conclusions The expression of a citrate transporter MATE gene is crucial for citrate exudation in common bean. However, although the expression of the citrate transporter is a prerequisite for citrate exudation, genotypic Al resistance in common bean particularly depends on the capacity to sustain the synthesis of citrate for maintaining the cytosolic citrate pool that enables exudation. PMID:20237115

  6. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes.

    PubMed

    Gierz, Sarah L; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral's daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions.

  7. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes

    PubMed Central

    Gierz, Sarah L.; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral’s daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions. PMID:28293249

  8. Differentiation phenotypes of pancreatic islet beta- and alpha-cells are closely related with homeotic genes and a group of differentially expressed genes.

    PubMed

    Mizusawa, Noriko; Hasegawa, Tomoko; Ohigashi, Izumi; Tanaka-Kosugi, Chisato; Harada, Nagakatsu; Itakura, Mitsuo; Yoshimoto, Katsuhiko

    2004-04-28

    To identify the genes that determine differentiation phenotypes, we compared gene expression of pancreatic islet beta- and alpha-cells, which are derived from the common precursor and secrete insulin and glucagon, respectively. The expression levels of homeotic genes including Hox genes known to determine region specificity in the antero-posterior (AP) body axis, tissue-specific homeobox genes, and other 8,734 genes were compared in a beta- and alpha-cell line of MIN6 and alpha TC1.6. The expression of homeotic genes were surveyed with reverse transcription-polymerase chain reaction (RT-PCR) using degenerate primers corresponding to invariant amino acid sequences within the homeodomain and subsequently with specific primers. Expression of Hoxc6, Hoxc9, Hoxc10, Pdx1, Cdx2, Gbx2, Pax4, and Hlxb9 genes in MIN6 was higher than those in alpha TC1.6, while expression of Hoxa2, Hoxa3, Hoxa5, Hoxa6, Hoxa7, Hoxa9, Hoxa10, Hoxa13, Hoxb3, Hoxb5, Hoxb6, Hoxb13, Hoxb8, and Brain4 genes in alpha TC1.6 was higher than those in MIN6. Out of 8,734 mouse genes screened with high-density mouse cDNA microarrays for MIN6- and alpha TC1.6-derived cDNA, 58 and 25 genes were differentially over- and under-expressed in MIN6, respectively. GLUTag, which is derived from a large bowel tumor and expresses the proglucagon gene, showed a comparatively similar expression profile to that of alpha TC1.6 in both homeotic and other genes analyzed in cDNA microarray. Our results are consistent with the interpretation that not only the tissue-specific homeotic genes, but also Hox genes are related to differentiation phenotypes of pancreatic beta- and alpha-cells rather than their regional specification of the body in vertebrates.

  9. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing

    2015-01-01

    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  10. Context Specific and Differential Gene Co-expression Networks via Bayesian Biclustering

    PubMed Central

    McDowell, Ian C.; Zhao, Shiwen; Brown, Christopher D.; Engelhardt, Barbara E.

    2016-01-01

    Identifying latent structure in high-dimensional genomic data is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes that covary in all of the samples or in only a subset of the samples. Our biclustering method, BicMix, allows overcomplete representations of the data, computational tractability, and joint modeling of unknown confounders and biological signals. Compared with related biclustering methods, BicMix recovers latent structure with higher precision across diverse simulation scenarios as compared to state-of-the-art biclustering methods. Further, we develop a principled method to recover context specific gene co-expression networks from the estimated sparse biclustering matrices. We apply BicMix to breast cancer gene expression data and to gene expression data from a cardiovascular study cohort, and we recover gene co-expression networks that are differential across ER+ and ER- samples and across male and female samples. We apply BicMix to the Genotype-Tissue Expression (GTEx) pilot data, and we find tissue specific gene networks. We validate these findings by using our tissue specific networks to identify trans-eQTLs specific to one of four primary tissues. PMID:27467526

  11. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  12. Node-based learning of differential networks from multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Zhang, Xiao-Fei; Wu, Min; Li, Xiao-Li

    2017-06-01

    Recovering gene regulatory networks and exploring the network rewiring between two different disease states are important for revealing the mechanisms behind disease progression. The advent of high-throughput experimental techniques has enabled the possibility of inferring gene regulatory networks and differential networks using computational methods. However, most of existing differential network analysis methods are designed for single-platform data analysis and assume that differences between networks are driven by individual edges. Therefore, they cannot take into account the common information shared across different data platforms and may fail in identifying driver genes that lead to the change of network. In this study, we develop a node-based multi-view differential network analysis model to simultaneously estimate multiple gene regulatory networks and their differences from multi-platform gene expression data. Our model can leverage the strength across multiple data platforms to improve the accuracy of network inference and differential network estimation. Simulation studies demonstrate that our model can obtain more accurate estimations of gene regulatory networks and differential networks than other existing state-of-the-art models. We apply our model on TCGA ovarian cancer samples to identify network rewiring associated with drug resistance. We observe from our experiments that the hub nodes of our identified differential networks include known drug resistance-related genes and potential targets that are useful to improve the treatment of drug resistant tumors. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Transcriptome Profiling Identifies Differentially Expressed Genes in Postnatal Developing Pituitary Gland of Miniature Pig

    PubMed Central

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development. PMID:24282060

  14. Transcriptome profiling identifies differentially expressed genes in postnatal developing pituitary gland of miniature pig.

    PubMed

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development.

  15. Differential co-expression analysis reveals a novel prognostic gene module in ovarian cancer.

    PubMed

    Gov, Esra; Arga, Kazim Yalcin

    2017-07-10

    Ovarian cancer is one of the most significant disease among gynecological disorders that women suffered from over the centuries. However, disease-specific and effective biomarkers were still not available, since studies have focused on individual genes associated with ovarian cancer, ignoring the interactions and associations among the gene products. Here, ovarian cancer differential co-expression networks were reconstructed via meta-analysis of gene expression data and co-expressed gene modules were identified in epithelial cells from ovarian tumor and healthy ovarian surface epithelial samples to propose ovarian cancer associated genes and their interactions. We propose a novel, highly interconnected, differentially co-expressed, and co-regulated gene module in ovarian cancer consisting of 84 prognostic genes. Furthermore, the specificity of the module to ovarian cancer was shown through analyses of datasets in nine other cancers. These observations underscore the importance of transcriptome based systems biomarkers research in deciphering the elusive pathophysiology of ovarian cancer, and here, we present reciprocal interplay between candidate ovarian cancer genes and their transcriptional regulatory dynamics. The corresponding gene module might provide new insights on ovarian cancer prognosis and treatment strategies that continue to place a significant burden on global health.

  16. Comparative Transcriptomic Analyses of Differentially Expressed Genes in Transgenic Melatonin Biosynthesis Ovine HIOMT Gene in Switchgrass

    PubMed Central

    Yuan, Shan; Guan, Cong; Liu, Sijia; Huang, Yanhua; Tian, Danyang; Cui, Xin; Zhang, Yunwei; Yang, Fuyu

    2016-01-01

    Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405, and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. Two hundred and seventy-five upregulated and 130 downregulated unigenes were detected in transgenic oHIOMT line comparing with control, including the significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3) genes, which were potentially correlated with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc.) were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc.) were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants. PMID:27877177

  17. Identifying differential networks based on multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Yan, Hong; Zhang, Xiao-Fei

    2016-12-20

    Exploring how the structure of a gene regulatory network differs between two different disease states is fundamental for understanding the biological mechanisms behind disease development and progression. Recently, with rapid advances in microarray technologies, gene expression profiles of the same patients can be collected from multiple microarray platforms. However, previous differential network analysis methods were usually developed based on a single type of platform, which could not utilize the common information shared across different platforms. In this study, we introduce a multi-view differential network analysis model to infer the differential network between two different patient groups based on gene expression profiles collected from multiple platforms. Unlike previous differential network analysis models that need to analyze each platform separately, our model can draw support from multiple data platforms to jointly estimate the differential networks and produce more accurate and reliable results. Our simulation studies demonstrate that our method consistently outperforms other available differential network analysis methods. We also applied our method to identify network rewiring associated with platinum resistance using TCGA ovarian cancer samples. The experimental results demonstrate that the hub genes in our identified differential networks on the PI3K/AKT/mTOR pathway play an important role in drug resistance.

  18. Expression of the HMGI(Y) gene products in human neuroblastic tumours correlates with differentiation status

    PubMed Central

    Giannini, G; Kim, C J; Marcotullio, L Di; Manfioletti, G; Cardinali, B; Cerignoli, F; Ristori, E; Zani, M; Frati, L; Screpanti, I; Gulino, A

    2000-01-01

    HMGI and HMGY are splicing variants of the HMGI(Y) gene and together with HMGI-C, belong to a family of DNA binding proteins involved in maintaining active chromatin conformation and in the regulation of gene transcription. The expression of the HMGI(Y) gene is maximal during embryonic development, declines in adult differentiated tissues and is reactivated in most transformed cells in vitro and in many human cancers in vivo. The HMGI(Y) genomic locus is frequently rearranged in mesenchymal tumours, suggesting a biological role for HMGI(Y) gene products in tumour biology. HMGIs are both target and modulators of retinoic acid activity. In fact, HMGI(Y) gene expression is differentially regulated by retinoic acid in retinoid-sensitive and -resistant neuroblastoma cells, while HMGI-C participates in conferring retinoic acid resistance in some neuroblastoma cells. In this paper we show that HMGI and HMGY isoforms are equally regulated by retinoic acid in neuroblastoma cell lines at both RNA and protein levels. More importantly our immunohistochemical analysis shows that, although HMGI(Y) is expressed in all neuroblastic tumours, consistently higher levels are observed in less differentiated neuroblastomas compared to more differentiated ganglioneuromas, indicating that HMGI(Y) expression should be evaluated as a potential diagnostic and prognostic marker in neuroblastic tumours. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11076660

  19. Integrative meta-analysis of differentially expressed genes in osteoarthritis using microarray technology.

    PubMed

    Wang, Xi; Ning, Yujie; Guo, Xiong

    2015-09-01

    The aim of the present study was to identify differentially expressed (DE) genes in patients with osteoarthritis (OA), and biological processes associated with changes in gene expression that occur in this disease. Using the INMEX (integrative meta‑analysis of expression data) software tool, a meta‑analysis of publicly available microarray Gene Expression Omnibus (GEO) datasets of OA was performed. Gene ontology (GO) enrichment analysis was performed in order to detect enriched functional attributes based on gene‑associated GO terms. Three GEO datasets, containing 137 patients with OA and 52 healthy controls, were included in the meta‑analysis. The analysis identified 85 genes that were consistently differentially expressed in OA (30 genes were upregulated and 55 genes were downregulated). The upregulated gene with the lowest P‑value (P=5.36E‑07) was S‑phase kinase‑associated protein 2, E3 ubiquitin protein ligase (SKP2). The downregulated gene with the lowest P‑value (P=4.42E‑09) was Proline rich 5 like (PRR5L). Among the 210 GO terms that were associated with the set of DE genes, the most significant two enrichments were observed in the GO categories of 'Immune response', with a P‑value of 0.000129438, and 'Immune effectors process', with a P‑value of 0.000288619. The current meta‑analysis identified genes that were consistently DE in OA, in addition to biological pathways associated with changes in gene expression that occur during OA, which may provide insight into the molecular mechanisms underlying the pathogenesis of this disease.

  20. An Orthologous Epigenetic Gene Expression Signature Derived from Differentiating Embryonic Stem Cells Identifies Regulators of Cardiogenesis.

    PubMed

    Busser, Brian W; Lin, Yongshun; Yang, Yanqin; Zhu, Jun; Chen, Guokai; Michelson, Alan M

    2015-01-01

    Here we used predictive gene expression signatures within a multi-species framework to identify the genes that underlie cardiac cell fate decisions in differentiating embryonic stem cells. We show that the overlapping orthologous mouse and human genes are the most accurate candidate cardiogenic genes as these genes identified the most conserved developmental pathways that characterize the cardiac lineage. An RNAi-based screen of the candidate genes in Drosophila uncovered numerous novel cardiogenic genes. shRNA knockdown combined with transcriptome profiling of the newly-identified transcription factors zinc finger protein 503 and zinc finger E-box binding homeobox 2 and the well-known cardiac regulatory factor NK2 homeobox 5 revealed that zinc finger E-box binding homeobox 2 activates terminal differentiation genes required for cardiomyocyte structure and function whereas zinc finger protein 503 and NK2 homeobox 5 are required for specification of the cardiac lineage. We further demonstrated that an essential role of NK2 homeobox 5 and zinc finger protein 503 in specification of the cardiac lineage is the repression of gene expression programs characteristic of alternative cell fates. Collectively, these results show that orthologous gene expression signatures can be used to identify conserved cardiogenic pathways.

  1. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  2. Differential expression of alkaline phosphatase gene in proliferating primary lymphocytes and malignant lymphoid cell lines.

    PubMed

    Latheef, S A A; Devanabanda, Mallaiah; Sankati, Swetha; Madduri, Ramanadham

    2016-02-01

    Alkaline Phosphatase (APase) activity has been shown to be enhanced specifically in mitogen stimulated B lymphocytes committed to proliferation, but not in T lymphocytes. APase gene expression was analyzed in proliferating murine and human primary lymphocytes and human malignant cell lines using reverse transcriptase and real time PCR. In mitogen stimulated murine splenic lymphocytes, enhancement of APase activity correlated well with an increase in APase gene expression. However, in mitogen stimulated murine T lymphocytes and human PBL despite a vigorous proliferative response, no increase in APase enzyme activity or gene expression was observed. A constitutive expression of APase activity concomitant with APase gene expression was observed inhuman myeloma cell line, U266 B1. However, neither enzyme activity nor gene expression of APase were observed in human T cell lymphoma, SUPT-1. The results suggest a differential expression of APase activity and its gene in proliferating primary lymphocytes of mice and humans. The specific expression of APase activity and its gene only in human myeloma cells, but not in proliferating primary B cells can be exploited as a sensitive disease marker.

  3. Identification of an IL-4-Inducible Gene Expressed in Differentiating Lymphocytes and Male Germ Cells

    PubMed Central

    Nabavi, Nasrin; Grusby, Michael J.; Finn, Patricia W.; Wolgemuth, Debra J.; Glimcher, Laurie H.

    1990-01-01

    Interleukin 4 (IL-4) is a cytokine that is involved in the differentiation of B and T lymphocytes. In this report, we describe the identification of a novel gene, N.52, which was cloned from the murine pre-B cell line R8205 grown in the presence of IL-4 for 48 hr. Although N.52 expression is detectable at low levels in unstimulated R8205 cells, the level of N.52 dramatically increases after only .4 hr exposure to IL-4 and remains at a high .level up to 48 hr. Although N.52 expression is low or absent in normal spleen B and T cells, its expression can be induced by the differentiation signals delivered by LPS in B cells and by Con A in T-cell hybrids. While N.52 mRNA is absent in all highly differentiated organs, it is detectable in stem cell harboring lymphoid tissues such as bone marrow, fetal liver, and thymus. Furthermore, N.52 mRNA is expressed at strikingly high levels in the testis, specifically in differentiating male germ cells. It is induced by differentiation signals triggered by the combination of cyclic AMP and retinoic acid in teratocarcinoma F9 cells. Taken together, these data suggest that N.52 is a developmentally regulated gene whose expression in cells of the immune and reproductive systems may be controlled by stimuli that induce differentiation. PMID:2136202

  4. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns

    PubMed Central

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St. John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α-ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns. PMID:28900542

  5. Regulation of mucous differentiation and mucin gene expression in the tracheobronchial epithelium.

    PubMed

    Gray, T; Koo, J S; Nettesheim, P

    2001-03-07

    The goal of our studies is to elucidate mechanisms that control and modulate mucous differentiation and mucin gene expression in the conducting airways. We used cultures of normal human tracheobronchial epithelial (NHTBE) cells that were shown to secrete two major airway mucins, namely MUC5AC and MUC5B as well as several other secretory products. Mucous differentiation and expression of MUC2, MUC5AC, MUC5B and MUC7, but not MUCi, MUC4, and MUC8 mucin genes, were shown to be retinoic acid- (RA) or retinol-dependent. We found that RA control of mucin genes was mediated by the retinoid acid receptors RAR alpha and, to a lesser extent, by RAR gamma. Our studies also showed that other important bioregulators such as thyroid hormone (T3) and epidermal growth factor (EGF) modulate basal expression of mucin genes, interacting with RA in a concentration-dependent manner. T3, which binds to thyroid receptors (TRs) belonging to the same superfamily of steroid hormone nuclear receptors as the RARs, inhibits mucin gene expression, particularly MUC5AC. One possible mechanism of this T3 effect is downregulation of RAR proteins, which are critical for mucin gene expression. However, we also found that T3 inhibits MUC5AC transcription.EGF, which had previously been shown to stimulate mucin expression and mucin secretion in cultured rat tracheal epithelial (RTE) cells, inhibited mucin secretion in human bronchial epithelial cell cultures. This effect was EGF concentration- and time-dependent and was progressively abolished by increasing the RA concentration. Subsequent studies suggested that the inhibitory effects of high concentrations of EGF may result from selective reduction of MUC5AC expression. These studies thus point to potentially important species differences in the mechanisms regulating mucous production, and they also confirm previous findings indicating differential regulation of MUC5AC and MUC5B gene expression.

  6. HIVed, a knowledgebase for differentially expressed human genes and proteins during HIV infection, replication and latency

    PubMed Central

    Li, Chen; Ramarathinam, Sri H.; Revote, Jerico; Khoury, Georges; Song, Jiangning; Purcell, Anthony W.

    2017-01-01

    Measuring the altered gene expression level and identifying differentially expressed genes/proteins during HIV infection, replication and latency is fundamental for broadening our understanding of the mechanisms of HIV infection and T-cell dysfunction. Such studies are crucial for developing effective strategies for virus eradication from the body. Inspired by the availability and enrichment of gene expression data during HIV infection, replication and latency, in this study, we proposed a novel compendium termed HIVed (HIV expression database; http://hivlatency.erc.monash.edu/) that harbours comprehensive functional annotations of proteins, whose genes have been shown to be dysregulated during HIV infection, replication and latency using different experimental designs and measurements. We manually curated a variety of third-party databases for structural and functional annotations of the protein entries in HIVed. With the goal of benefiting HIV related research, we collected a number of biological annotations for all the entries in HIVed besides their expression profile, including basic protein information, Gene Ontology terms, secondary structure, HIV-1 interaction and pathway information. We hope this comprehensive protein-centric knowledgebase can bridge the gap between the understanding of differentially expressed genes and the functions of their protein products, facilitating the generation of novel hypotheses and treatment strategies to fight against the HIV pandemic. PMID:28358052

  7. HIVed, a knowledgebase for differentially expressed human genes and proteins during HIV infection, replication and latency.

    PubMed

    Li, Chen; Ramarathinam, Sri H; Revote, Jerico; Khoury, Georges; Song, Jiangning; Purcell, Anthony W

    2017-03-30

    Measuring the altered gene expression level and identifying differentially expressed genes/proteins during HIV infection, replication and latency is fundamental for broadening our understanding of the mechanisms of HIV infection and T-cell dysfunction. Such studies are crucial for developing effective strategies for virus eradication from the body. Inspired by the availability and enrichment of gene expression data during HIV infection, replication and latency, in this study, we proposed a novel compendium termed HIVed (HIV expression database; http://hivlatency.erc.monash.edu/) that harbours comprehensive functional annotations of proteins, whose genes have been shown to be dysregulated during HIV infection, replication and latency using different experimental designs and measurements. We manually curated a variety of third-party databases for structural and functional annotations of the protein entries in HIVed. With the goal of benefiting HIV related research, we collected a number of biological annotations for all the entries in HIVed besides their expression profile, including basic protein information, Gene Ontology terms, secondary structure, HIV-1 interaction and pathway information. We hope this comprehensive protein-centric knowledgebase can bridge the gap between the understanding of differentially expressed genes and the functions of their protein products, facilitating the generation of novel hypotheses and treatment strategies to fight against the HIV pandemic.

  8. Two different vestigial like 4 genes are differentially expressed during Xenopus laevis development.

    PubMed

    Barrionuevo, María-Guadalupe; Aybar, Manuel J; Tríbulo, Celeste

    2014-01-01

    The vestigial gene (vg) was first characterized in Drosophila and several homologues were identified in vertebrates and called vestigial like 1-4 (vgll1-4). Vgll proteins interact with the transcription factors TEF-1 and MEF-2 through a conserved region called TONDU (TDU). Vgll4s are characterized by two tandem TDU domains which differentiate them from other members of the vestigial family. In Xenopus two genes were identified as vgll4. Our bioinformatic analysis demonstrated that these two genes are paralogues and must be named differently. We designated them as vgll4 and vgll4l. In situ hybridization analysis revealed that the expression of these two genes is rather different. At gastrula stage, both were expressed in the animal pole. However, at neurula stage, vgll4 was mainly expressed in the neural plate and neural folds, while vgll4l prevailed in the neural folds and epidermis. From the advanced neurula stage onward, expression of both genes was strongly enhanced in neural tissues, anterior neural plate, migrating neural crest, optic and otic vesicles. Nevertheless, there were some differences: vgll4 presented somite expression and vgll4l was localized at the skin and notochord. Our results demonstrate that Xenopus has two orthologues of the vgll4 gene, vgll4 and vgll4l with differential expression in Xenopus embryos and they may well have different roles during development.

  9. Adipose Gene Expression Prior to Weight Loss Can Differentiate and Weakly Predict Dietary Responders

    PubMed Central

    Mutch, David M.; Temanni, M. Ramzi; Henegar, Corneliu; Combes, Florence; Pelloux, Véronique; Holst, Claus; Sørensen, Thorkild I. A.; Astrup, Arne; Martinez, J. Alfredo; Saris, Wim H. M.; Viguerie, Nathalie; Langin, Dominique; Zucker, Jean-Daniel; Clément, Karine

    2007-01-01

    Background The ability to identify obese individuals who will successfully lose weight in response to dietary intervention will revolutionize disease management. Therefore, we asked whether it is possible to identify subjects who will lose weight during dietary intervention using only a single gene expression snapshot. Methodology/Principal Findings The present study involved 54 female subjects from the Nutrient-Gene Interactions in Human Obesity-Implications for Dietary Guidelines (NUGENOB) trial to determine whether subcutaneous adipose tissue gene expression could be used to predict weight loss prior to the 10-week consumption of a low-fat hypocaloric diet. Using several statistical tests revealed that the gene expression profiles of responders (8–12 kgs weight loss) could always be differentiated from non-responders (<4 kgs weight loss). We also assessed whether this differentiation was sufficient for prediction. Using a bottom-up (i.e. black-box) approach, standard class prediction algorithms were able to predict dietary responders with up to 61.1%±8.1% accuracy. Using a top-down approach (i.e. using differentially expressed genes to build a classifier) improved prediction accuracy to 80.9%±2.2%. Conclusion Adipose gene expression profiling prior to the consumption of a low-fat diet is able to differentiate responders from non-responders as well as serve as a weak predictor of subjects destined to lose weight. While the degree of prediction accuracy currently achieved with a gene expression snapshot is perhaps insufficient for clinical use, this work reveals that the comprehensive molecular signature of adipose tissue paves the way for the future of personalized nutrition. PMID:18094752

  10. Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development

    PubMed Central

    Chittka, A; Volff, JN; Wizenmann, A

    2009-01-01

    Background During the development of the central nervous system (CNS), patterning processes along the dorsoventral (DV) axis of the neural tube generate different neuronal subtypes. As development progresses these neurons are arranged into functional units with varying cytoarchitecture, such as laminae or nuclei for efficient relaying of information. Early in development ventral and dorsal regions are similar in size and structure. Different proliferation rates and cell migration patterns are likely to result in the formation of laminae or nuclei, eventually. However, the underlying molecular mechanisms that establish these different structural arrangements are not well understood. We undertook a differential display polymerase chain reaction (DD-PCR) screen to identify genes with distinct expression patterns between dorsal and ventral regions of the chick midbrain in order to identify genes which regulate the sculpturing of such divergent neuronal organisation. We focused on the DV axis of the early chick midbrain since mesencephalic alar plate and basal plate develop into laminae and nuclei, respectively. Results We identified 53 differentially expressed bands in our initial screen. Twenty-six of these could be assigned to specific genes and we could unambiguously show the differential expression of five of the isolated cDNAs in vivo by in situ mRNA expression analysis. Additionally, we verified differential levels of expression of a selected number of genes by using reverse transcriptase (RT) PCR method with gene-specific primers. One of these genes, QR1, has been previously cloned and we present here a detailed study of its early developmental time course and pattern of expression providing some insights into its possible function. Our phylogenetic analysis of QR1 shows that it is the chick orthologue of Sparc-like 1/Hevin/Mast9 gene in mice, rats, dogs and humans, a protein involved in cell adhesion. Conclusion This study reveals some possible networks, which

  11. Differential gene expression in human abdominal aortic aneurysm and aortic occlusive disease

    PubMed Central

    Moran, Corey S.; Schreurs, Charlotte; Lindeman, Jan H. N.; Walker, Philip J.; Nataatmadja, Maria; West, Malcolm; Holdt, Lesca M.; Hinterseher, Irene; Pilarsky, Christian; Golledge, Jonathan

    2015-01-01

    Abdominal aortic aneurysm (AAA) and aortic occlusive disease (AOD) represent common causes of morbidity and mortality in elderly populations which were previously believed to have common aetiologies. The aim of this study was to assess the gene expression in human AAA and AOD. We performed microarrays using aortic specimen obtained from 20 patients with small AAAs (≤ 55mm), 29 patients with large AAAs (> 55mm), 9 AOD patients, and 10 control aortic specimens obtained from organ donors. Some differentially expressed genes were validated by quantitative-PCR (qRT-PCR)/immunohistochemistry. We identified 840 and 1,014 differentially expressed genes in small and large AAAs, respectively. Immune-related pathways including cytokine-cytokine receptor interaction and T-cell-receptor signalling were upregulated in both small and large AAAs. Examples of validated genes included CTLA4 (2.01-fold upregulated in small AAA, P = 0.002), NKTR (2.37-and 2.66-fold upregulated in small and large AAA with P = 0.041 and P = 0.015, respectively), and CD8A (2.57-fold upregulated in large AAA, P = 0.004). 1,765 differentially expressed genes were identified in AOD. Pathways upregulated in AOD included metabolic and oxidative phosphorylation categories. The UCP2 gene was downregulated in AOD (3.73-fold downregulated, validated P = 0.017). In conclusion, the AAA and AOD transcriptomes were very different suggesting that AAA and AOD have distinct pathogenic mechanisms. PMID:25944698

  12. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  13. Microarray profile of differentially expressed genes in a monkey model of allergic asthma

    PubMed Central

    Zou, Jun; Young, Simon; Zhu, Feng; Gheyas, Ferdous; Skeans, Susan; Wan, Yuntao; Wang, Luquan; Ding, Wei; Billah, Motasim; McClanahan, Terri; Coffman, Robert L; Egan, Robert; Umland, Shelby

    2002-01-01

    Background Inhalation of Ascaris suum antigen by allergic monkeys causes an immediate bronchoconstriction and delayed allergic reaction, including a pulmonary inflammatory infiltrate. To identify genes involved in this process, the gene-expression pattern of allergic monkey lungs was profiled by microarrays. Monkeys were challenged by inhalation of A. suum antigen or given interleukin-4 (IL-4) treatment; lung tissue was collected at 4, 18 or 24 h after antigen challenge or 24 h after IL-4. Each challenged monkey lung was compared to a pool of normal, unchallenged monkey lungs. Results Of the approximately 40,000 cDNAs represented on the microarray, expression levels of 169 changed by more than 2.5-fold in at least one of the pairwise probe comparisons; these cDNAs encoded 149 genes, of which two thirds are known genes. The largest number of regulated genes was observed 4 h after challenge. Confirmation of differential expression in the original tissue was obtained for 95% of a set of these genes using real-time PCR. Cluster analysis revealed at least five groups of genes with unique expression patterns. One cluster contained genes for several chemokine mediators including eotaxin, PARC, MCP-1 and MCP-3. Genes involved in tissue remodeling and antioxidant responses were also identified as regulated by antigen and IL-4 or by antigen only. Conclusion This study provides a large-scale profile of gene expression in the primate lung following allergen or IL-4 challenge. It shows that microarrays, with real-time PCR, are a powerful tool for identifying and validating differentially expressed genes in a disease model. PMID:12049661

  14. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  15. DNA methylation dynamics during intestinal stem cell differentiation reveals enhancers driving gene expression in the villus

    PubMed Central

    2013-01-01

    Background DNA methylation is of pivotal importance during development. Previous genome-wide studies identified numerous differentially methylated regions upon differentiation of stem cells, many of them associated with transcriptional start sites. Results We present the first genome-wide, single-base-resolution view into DNA methylation dynamics during differentiation of a mammalian epithelial stem cell: the mouse small intestinal Lgr5+ stem cell. Very little change was observed at transcriptional start sites and our data suggest that differentiation-related genes are already primed for expression in the stem cell. Genome-wide, only 50 differentially methylated regions were identified. Almost all of these loci represent enhancers driving gene expression in the differentiated part of the small intestine. Finally, we show that binding of the transcription factor Tcf4 correlates with hypo-methylation and demonstrate that Tcf4 is one of the factors contributing to formation of differentially methylated regions. Conclusions Our results reveal limited DNA methylation dynamics during small intestine stem cell differentiation and an impact of transcription factor binding on shaping the DNA methylation landscape during differentiation of stem cells in vivo. PMID:23714178

  16. Storage Temperature Alters the Expression of Differentiation-Related Genes in Cultured Oral Keratinocytes

    PubMed Central

    Utheim, Tor Paaske; Islam, Rakibul; Fostad, Ida G.; Eidet, Jon R.; Sehic, Amer; Olstad, Ole K.; Dartt, Darlene A.; Messelt, Edward B.; Griffith, May; Pasovic, Lara

    2016-01-01

    Purpose Storage of cultured human oral keratinocytes (HOK) allows for transportation of cultured transplants to eye clinics worldwide. In a previous study, one-week storage of cultured HOK was found to be superior with regard to viability and morphology at 12°C compared to 4°C and 37°C. To understand more of how storage temperature affects cell phenotype, gene expression of HOK before and after storage at 4°C, 12°C, and 37°C was assessed. Materials and Methods Cultured HOK were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium at 4°C, 12°C, and 37°C for one week. Total RNA was isolated and the gene expression profile was determined using DNA microarrays and analyzed with Partek Genomics Suite software and Ingenuity Pathway Analysis. Differentially expressed genes (fold change > 1.5 and P < 0.05) were identified by one-way ANOVA. Key genes were validated using qPCR. Results Gene expression of cultures stored at 4°C and 12°C clustered close to the unstored control cultures. Cultures stored at 37°C displayed substantial change in gene expression compared to the other groups. In comparison with 12°C, 2,981 genes were differentially expressed at 37°C. In contrast, only 67 genes were differentially expressed between the unstored control and the cells stored at 12°C. The 12°C and 37°C culture groups differed most significantly with regard to the expression of differentiation markers. The Hedgehog signaling pathway was significantly downregulated at 37°C compared to 12°C. Conclusion HOK cultures stored at 37°C showed considerably larger changes in gene expression compared to unstored cells than cultured HOK stored at 4°C and 12°C. The changes observed at 37°C consisted of differentiation of the cells towards a squamous epithelium-specific phenotype. Storing cultured ocular surface transplants at 37°C is therefore not recommended. This is particularly interesting as 37°C is the standard incubation temperature used for cell

  17. Global Regulation of Differential Gene Expression by c-Abl/Arg Oncogenic Kinases.

    PubMed

    Dong, Qincai; Li, Chenggong; Qu, Xiuhua; Cao, Cheng; Liu, Xuan

    2017-05-30

    BACKGROUND Studies have found that c-Abl oncogenic kinases may regulate gene transcription by RNA polymerase II phosphorylation or by direct regulation of specific transcription factors or coactivators. However, the global regulation of differential gene expression by c-Abl/Arg is largely unknown. In this study, differentially expressed genes (DEGs) regulated by c-Abl/Arg were identified, and related cellular functions and associated pathways were investigated. MATERIAL AND METHODS RNA obtained from wild-type and c-Abl/Arg gene-silenced MCF-7 cells was analyzed by RNA-Seq. DEGs were identified using edgeR software and partially validated by qRT-PCR. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were used to explore the potential functions of these DEGs. RESULTS A total of 1,034 DEGs were significantly regulated by c-Abl/Arg (399 were up-regulated and 635 were down-regulated after c-Abl/Arg double knockdown). GO and KEGG analyses showed that the DEGs were primarily involved in cellular metabolic processes, neurodegenerative disease, the metabolic process and signaling pathway of cAMP, angiogenesis, and cell proliferation. CONCLUSIONS Our data collectively support the hypothesis that c-Abl/Arg regulate differential gene expression, providing new insights into the biological functions of c-Abl and Arg.

  18. Examining smoking-induced differential gene expression changes in buccal mucosa

    PubMed Central

    2010-01-01

    Background Gene expression changes resulting from conditions such as disease, environmental stimuli, and drug use, can be monitored in the blood. However, a less invasive method of sample collection is of interest because of the discomfort and specialized personnel necessary for blood sampling especially if multiple samples are being collected. Buccal mucosa cells are easily collected and may be an alternative sample material for biomarker testing. A limited number of studies, primarily in the smoker/oral cancer literature, address this tissue's efficacy as an RNA source for expression analysis. The current study was undertaken to determine if total RNA isolated from buccal mucosa could be used as an alternative tissue source to assay relative gene expression. Methods Total RNA was isolated from swabs, reverse transcribed and amplified. The amplified cDNA was used in RT-qPCR and microarray analyses to evaluate gene expression in buccal cells. Initially, RT-qPCR was used to assess relative transcript levels of four genes from whole blood and buccal cells collected from the same seven individuals, concurrently. Second, buccal cell RNA was used for microarray-based differential gene expression studies by comparing gene expression between a group of female smokers and nonsmokers. Results An amplification protocol allowed use of less buccal cell total RNA (50 ng) than had been reported previously with human microarrays. Total RNA isolated from buccal cells was degraded but was of sufficient quality to be used with RT-qPCR to detect expression of specific genes. We report here the finding of a small number of statistically significant differentially expressed genes between smokers and nonsmokers, using buccal cells as starting material. Gene Set Enrichment Analysis confirmed that these genes had a similar expression pattern to results from another study. Conclusions Our results suggest that despite a high degree of degradation, RNA from buccal cells from cheek mucosa

  19. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    PubMed

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  20. Adaptations to Endosymbiosis in a Cnidarian-Dinoflagellate Association: Differential Gene Expression and Specific Gene Duplications

    PubMed Central

    Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-01-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K–dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  1. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  2. Regulation of adipocyte differentiation and gene expression-crosstalk between TGFβ and wnt signaling pathways.

    PubMed

    Lu, Hang; Ward, Meliza G; Adeola, Olayiwola; Ajuwon, Kolapo M

    2013-09-01

    Obesity results in reduced differentiation potential of adipocytes leading to adipose tissue insulin resistance. Elevated proinflammatory cytokines from adipose tissue in obesity, such as TNFα have been implicated in the reduced adipocyte differentiation. Other mediators of reduced adipocyte differentiation include TGFβ and wnt proteins. Although some overlap exists in the signaling cascades of the wnt and TGFβ pathways it is unknown if TGFβ or wnt proteins reciprocally induce the expression of each other to maximize their biological effects in adipocytes. Therefore, we investigated the possible involvement of TGFβ signaling in wnt induced gene expression and vice versa in 3T3-L1 adipocyte. Effect of TGFβ and Wnt pathways on differentiation was studied in preadipocytes induced to differentiate in the presence of Wnt3a or TGFβ1 and their inhibitors (FZ8-CRD and SB431542, respectively). Regulation of intracellular signaling and gene expression was also studied in mature adipocytes. Our results show that both TGFβ1 and Wnt3a lead to increased accumulation of β-catenin, phosphorylation of AKT and p44/42 MAPK. However, differences were found in the pattern of gene expression induced by the two proteins suggesting that distinct, but complex, signaling pathways are activated by TGFβ and wnt proteins to independently regulate adipocyte function.

  3. Analysis on differential expressed genes of ovarian tissue between high- and low-yield laying hen.

    PubMed

    Chen, Wei; Song, Ling-Jun; Zeng, Yong-Qing; Yang, Yun; Wang, Hui

    2013-01-01

    In order to elucidate molecular genetic mechanism of laying hen reproduction at the transcriptional level and the structure of significantly differential genes, the mRNA differential display and reverse northern dot-blot were used to detect the differential expression of genes in the ovary tissue of low-yield laying hens and high-yield laying hens in the present study. Sixteen 32-week-old CAU-pink laying hens divided into two groups were used and the laying performance was measured. The results showed that only the egg numbers were significantly different between the two groups; and from 15 primer pairs, a total of 336 bands were displayed of which 59 cDNA bands were found to be differentially expressed in both high-yield and low-yield laying hen. The sequence analysis indicated that the expression of such bands as H-AP5, H-P5, and H-P4 was significantly potentiated in high-yield laying hen using primer pairs AP5/HT11G, P5/HT11G and P4/HT11G and these transcripts had high homology (98%) to HoxDb, HoxCa, and HoxBa, respectively. The differentially expressed gene fragments may be relevant to the progression of the high-yield hens to the egg-laying stage. And further study is required to elucidate the molecular function to improve the productivity of laying hens.

  4. Differential expression of putative drug resistance genes in Mycobacterium tuberculosis clinical isolates.

    PubMed

    González-Escalante, Laura; Peñuelas-Urquides, Katia; Said-Fernández, Salvador; Silva-Ramírez, Beatriz; Bermúdez de León, Mario

    2015-12-01

    Understanding drug resistance in Mycobacterium tuberculosis requires an integrated analysis of strain lineages, mutations and gene expression. Previously, we reported the differential expression of esxG, esxH, infA, groES, rpmI, rpsA and lipF genes in a sensitive M. tuberculosis strain and in a multidrug-resistant clinical isolate. Here, we have evaluated the expression of these genes in 24 clinical isolates that belong to different lineages and have different drug resistance profiles. In vitro, growth kinetics analysis showed no difference in the growth of the clinical isolates, and thus drug resistance occurred without a fitness cost. However, a quantitative reverse transcription PCR analysis of gene expression revealed high variability among the clinical isolates, including those with similar drug resistance profiles. Due to the complexity of gene regulation pathways and the wide diversity of M. tuberculosis lineages, the use of gene expression as a molecular signature for drug resistance is not straightforward. Therefore, we recommend that the expression of M. tuberculosis genes be performed individually, and baseline expression levels should be verified among several different clinical isolates, before any further applications of these findings.

  5. Differentially expressed genes under simulated microgravity in fruiting bodies of the fungus Pleurotus ostreatus.

    PubMed

    Miyazaki, Yasumasa; Sunagawa, Masahide; Higashibata, Akira; Ishioka, Noriaki; Babasaki, Katsuhiko; Yamazaki, Takashi

    2010-06-01

    In response to a change in the direction of gravity, morphogenetic changes of fruiting bodies of fungi are usually observed as gravitropism. Although gravitropism in higher fungi has been studied for over 100 years, there is no convincing evidence regarding the graviperception mechanism in mushrooms. To understand gravitropism in mushrooms, we isolated differentially expressed genes in Pleurotus ostreatus (oyster mushroom) fruiting bodies developed under three-dimensional clinostat-simulated microgravity. Subtractive hybridization, cDNA representational difference analysis was used for gene analysis and resulted in the isolation of 36 individual genes (17 upregulated and 19 downregulated) under clinorotation. The phenotype of fruiting bodies developed under simulated microgravity vividly depicted the gravitropism in mushrooms. Our results suggest that the differentially expressed genes responding to gravitational change are involved in several potential cellular mechanisms during fruiting body formation of P. ostreatus.

  6. Gene expression profiling reveals epithelial mesenchymal transition (EMT) genes can selectively differentiate eribulin sensitive breast cancer cells.

    PubMed

    Dezső, Zoltán; Oestreicher, Judith; Weaver, Amy; Santiago, Stephanie; Agoulnik, Sergei; Chow, Jesse; Oda, Yoshiya; Funahashi, Yasuhiro

    2014-01-01

    Eribulin mesylate is a synthetic macrocyclic ketone analog of the marine sponge natural product halichondrin B. Eribulin is a mechanistically unique inhibitor of microtubule dynamics. In this study, we investigated whether selective signal pathways were associated with eribulin activity compared to paclitaxel, which stabilizes microtubules, based on gene expression profiling of cell line panels of breast, endometrial, and ovarian cancer in vitro. We determined the sets of genes that were differentially altered between eribulin and paclitaxel treatment in breast, endometrial, and ovarian cancer cell line panels. Our unsupervised clustering analyses revealed that expression profiles of gene sets altered with treatments were correlated with the in vitro antiproliferative activities of the drugs. Several tubulin isotypes had significantly lower expression in cell lines treated with eribulin compared to paclitaxel. Pathway enrichment analyses of gene sets revealed that the common pathways altered between treatments in the 3 cancer panels were related to cytoskeleton remodeling and cell cycle regulation. The epithelial-mesenchymal transition (EMT) pathway was enriched in genes with significantly altered expression between the two drugs for breast and endometrial cancers, but not for ovarian cancer. Expression of genes from the EMT pathway correlated with eribulin sensitivity in breast cancer and with paclitaxel sensitivity in endometrial cancer. Alteration of expression profiles of EMT genes between sensitive and resistant cell lines allowed us to predict drug sensitivity for breast and endometrial cancers. Gene expression analysis showed that gene sets that were altered between eribulin and paclitaxel correlated with drug in vitro antiproliferative activities in breast and endometrial cancer cell line panels. Among the panels, breast cancer provided the strongest differentiation between eribulin and paclitaxel sensitivities based on gene expression. In addition, EMT

  7. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  8. Differentially expressed genes in heads and tails of Angelica sinensis diels: Focusing on ferulic acid metabolism.

    PubMed

    Yang, Jie; Li, Wei-Hong; An, Rong; Wang, Yi-Li; Xu, Yan; Chen, Jie; Wang, Xiao-Fang; Zhang, Xiao-Bo; Li, Jing; Ding, Wei-Jun

    2017-10-01

    To explore the scientific connotation of the discrepant pharmaceutical activities between the head and tail of Angelica sinensis diels (AS), an important herb extensively utilized in Chinese medicine, by the approach of transcriptome sequencing. Ten samples of AS were randomly collected in Min County, Gansu Province of China. Transcriptome sequencing of AS was accomplished in a commercial ILLumina HiSeq-2000 platform. The transcriptome of each head and tail of AS were fixed in a gene chip, and detected under the procedure of Illumina HiSeq-2000. Differentially expressed unigenes between the heads and tails of AS were selected by Shanghai Biotechnology Corporation (SBC) online analysis system, based on Gene Ontology, Kyoto Encyclopedia of Genes and Genomes and relevant bioinformatic database. Totally 63,585 unigenes were obtained from AS by high-throughput sequencing platform. Among which 3359 unigenes were identified as differentially expressed unigenes between the heads and tails of AS by SBC analysis system scanning. Of which 15 differentially expressed unigenes participate in the metabolic regulation of phenylpropanoid biosynthesis (PB) pathway and ferulic acid metabolites, in response to the distinguished pharmaceutical actions of the heads and tails of AS. Different content of ferulic acid in the heads and tails of AS is related to the differentially expressed genes, particularly involved in the PB pathway.

  9. Differential gene expression profiles of peripheral blood mononuclear cells in childhood asthma.

    PubMed

    Kong, Qian; Li, Wen-Jing; Huang, Hua-Rong; Zhong, Ying-Qiang; Fang, Jian-Pei

    2015-05-01

    Asthma is a common childhood disease with strong genetic components. This study compared whole-genome expression differences between asthmatic young children and healthy controls to identify gene signatures of childhood asthma. Total RNA extracted from peripheral blood mononuclear cells (PBMC) was subjected to microarray analysis. QRT-PCR was performed to verify the microarray results. Classification and functional characterization of differential genes were illustrated by hierarchical clustering and gene ontology analysis. Multiple logistic regression (MLR) analysis, receiver operating characteristic (ROC) curve analysis, and discriminate power were used to scan asthma-specific diagnostic markers. For fold-change>2 and p < 0.05, there were 758 named differential genes. The results of QRT-PCR confirmed successfully the array data. Hierarchical clustering divided 29 highly possible genes into seven categories and the genes in the same cluster were likely to possess similar expression patterns or functions. Gene ontology analysis presented that differential genes primarily enriched in immune response, response to stress or stimulus, and regulation of apoptosis in biological process. MLR and ROC curve analysis revealed that the combination of ADAM33, Smad7, and LIGHT possessed excellent discriminating power. The combination of ADAM33, Smad7, and LIGHT would be a reliable and useful childhood asthma model for prediction and diagnosis.

  10. Differential expression of genes and proteins associated with wool follicle cycling.

    PubMed

    Liu, Nan; Li, Hegang; Liu, Kaidong; Yu, Juanjuan; Cheng, Ming; De, Wei; Liu, Jifeng; Shi, Shuyan; He, Yanghua; Zhao, Jinshan

    2014-08-01

    Sheep are valuable resources for the wool industry. Wool growth of Aohan fine wool sheep has cycled during different seasons in 1 year. Therefore, identifying genes that control wool growth cycling might lead to ways for improving the quality and yield of fine wool. In this study, we employed Agilent sheep gene expression microarray and proteomic technology to compare the gene expression patterns of the body side skins at August and December time points in Aohan fine wool sheep (a Chinese indigenous breed). Microarray study revealed that 2,223 transcripts were differentially expressed, including 1,162 up-regulated and 1,061 down-regulated transcripts, comparing body side skin at the August time point to the December one (A/D) in Aohan fine wool sheep. Then seven differentially expressed genes were selected to validated the reliability of the gene chip data. The majority of the genes possibly related to follicle development and wool growth could be assigned into the categories including regulation of receptor binding, extracellular region, protein binding and extracellular space. Proteomic study revealed that 84 protein spots showed significant differences in expression levels. Of the 84, 63 protein spots were upregulated and 21 were downregulated in A/D. Finally, 55 protein points were determined through MALDI-TOF/MS analyses. Furthermore, the regulation mechanism of hair follicle might resemble that of fetation.

  11. Trichomonas vaginalis adherence mediates differential gene expression in human vaginal epithelial cells

    PubMed Central

    Kucknoor, Ashwini; Mundodi, Vasanthakrishna; Alderete, John F.

    2007-01-01

    Summary Trichomonas vaginalis, an ancient protist, colonizes the vaginal mucosa causing trichomonosis, a vaginitis that sometimes leads to severe health complications. Preparatory to colonization of the vagina is the adhesion to vaginal epithelial cells (VECs) by trichomonads. We hypothesized that VECs alter the gene expression to form a complex signalling cascade in response to trichomonal adherence. In order to identify the genes that are upregulated, we constructed a subtraction cDNA library after contact with parasites that is enriched for differentially expressed genes from the immortalized MS-74 VECs. Sixty cDNA clones were sequenced and to our knowledge for the first time, differentially regulated genes were identified in response to early trichomonal infection. The identified genes were found to encode functional proteins with specific functions associated with cell structure maintenance and extracellular matrix components, proinflammatory molecules and apoptosis. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) confirmed expression of selected genes. Further, cyclooxygenase 2 (COX-2) protein expression was analysed using Western blot and immunofluorescence assays. Data suggest that p38 mitogen-activated protein (MAP) kinase and tyrosine kinases play a role in COX-2 induction. Finally, T. vaginalis and Tritrichomonas foetus but not Pentatrichomonas hominis induce expression of COX-2. This is a first attempt at elucidating the basis of interaction of trichomonads with host cells and the corresponding host responses triggered by the parasites. PMID:15888089

  12. Pyrophosphate Stimulates Differentiation, Matrix Gene Expression and Alkaline Phosphatase Activity in Osteoblasts

    PubMed Central

    Pujari-Palmer, Michael; Pujari-Palmer, Shiuli; Lu, Xi; Lind, Thomas; Melhus, Håkan; Engstrand, Thomas; Karlsson-Ott, Marjam; Engqvist, Hakan

    2016-01-01

    Pyrophosphate is a potent mitogen, capable of stimulating proliferation in multiple cell types, and a critical participant in bone mineralization. Pyrophosphate can also affect the resorption rate and bioactivity of orthopedic ceramics. The present study investigated whether calcium pyrophosphate affected proliferation, differentiation and gene expression in early (MC3T3 pre-osteoblast) and late stage (SAOS-2 osteosarcoma) osteoblasts. Pyrophosphate stimulated peak alkaline phosphatase activity by 50% and 150% at 100μM and 0.1μM in MC3T3, and by 40% in SAOS-2. The expression of differentiation markers collagen 1 (COL1), alkaline phosphatase (ALP), osteopontin (OPN), and osteocalcin (OCN) were increased by an average of 1.5, 2, 2 and 3 fold, by high concentrations of sodium pyrophosphate (100μM) after 7 days of exposure in MC3T3. COX-2 and ANK expression did not differ significantly from controls in either treatment group. Though both high and low concentrations of pyrophosphate stimulate ALP activity, only high concentrations (100μM) stimulated osteogenic gene expression. Pyrophosphate did not affect proliferation in either cell type. The results of this study confirm that chronic exposure to pyrophosphate exerts a physiological effect upon osteoblast differentiation and ALP activity, specifically by stimulating osteoblast differentiation markers and extracellular matrix gene expression. PMID:27701417

  13. Differentially expressed genes in the fat body of Bombyx mori in response to phoxim insecticide.

    PubMed

    Gu, Z Y; Li, F C; Wang, B B; Xu, K Z; Ni, M; Zhang, H; Shen, W D; Li, B

    2015-01-01

    The silkworm, Bombyx mori, is an economically important insect. However, poisoning of silkworms by organophosphate pesticides causes tremendous loss to the sericulture. The fat body is the major tissue involved in detoxification and produces antimicrobial peptides and regulates hormones. In this study, a microarray system comprising 22,987 oligonucluotide 70-mer probes was employed to examine differentially expressed genes in the fat body of B. mori exposed to phoxim insecticide. The results showed that a total of 774 genes were differentially expressed upon phoxim exposure, including 500 up-regulated genes and 274 down-regulated genes. The expression levels of eight detoxification-related genes were up-regulated upon phoxim exposure, including six cytochrome P450s and two glutathione-S-transferases. It was firstly found that eight antimicrobial peptide genes were down-regulated, which might provide important references for studying the larvae of B. mori become more susceptible to microbial infections after phoxim treatment. In addition, we firstly detected the expression level of metamorphosis-related genes after phoxim exposure, which may lead to impacted reproduction. Our results may facilitate the overall understanding of the molecular mechanism of multiple pathways following exposure to phoxim insecticide in the fat body of B. mori. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Differential gene expression profiling of vocal fold polyps and Reinke's edema by complementary DNA microarray.

    PubMed

    Duflo, Suzy M; Thibeault, Susan L; Li, Wenhua; Smith, Marshall E; Schade, Goetz; Hess, Markus M

    2006-09-01

    Our purpose was to determine whether complementary DNA (cDNA) microarray analysis (MA) can establish distinct gene expression profiles for 2 phenotypically similar vocal fold lesions: Reinke's edema (RE) and polyps. Established transcript profiles can provide insight into the molecular and cellular processes involved in these diseases. Eleven RE specimens and 17 polyps were analyzed with MA for 8,745 genes. Further MA profiling was attempted within each lesion group to identify molecular markers for reflux exposure and smoking. Prediction analysis was used to predict lesion classification for 2 unclassified samples. A real-time polymerase chain reaction was performed to corroborate MA transcript levels for selected significant genes. Sixty-five genes were found to differentiate RE and polyps (p = .0088). For RE, 19 genes were differentiated for reflux exposure (p = .016). No genes were found to differentiate smokers from nonsmokers. For polyps, no genes were found to differentiate for reflux (p = .16) and smoking (p = .565). Categorization of unclassified lesions was possible with a minimum of 13 genes. We demonstrate the feasibility of benign lesion classification based on MA. Microarray analysis is useful not only for improving diagnosis and classification of such lesions, but also for potentially generating prognostic indicators and targets for therapy.

  15. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION.

    PubMed

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J; Alexander, Warren S; Smyth, Gordon K

    2016-06-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  16. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION

    PubMed Central

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J.; Alexander, Warren S.; Smyth, Gordon K.

    2017-01-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  17. In Vitro Study of Putative Genomic Biomarkers of Nephrotoxicity Through Differential Gene Expression Using Gentamicin.

    PubMed

    Silva, Sarah Cristina Teixeira; de Almeida, Leonardo Augusto; Soares, Stellamaris; Grossi, Marina Felipe; Valente, Anete Maria Santana; Tagliati, Carlos Alberto

    2017-04-03

    Drug-induced nephrotoxicity is one of the most frequently observed effects in long-term pharmacotherapy. The effects of nephrotoxicity are commonly discovered later due to a lack of sensitivity in in vivo methods. Therefore, researchers have tried to develop in vitro alternative methods for early identification of toxicity. In this study, LLC-PK1 cells were exposed to gentamicin through MTT and trypan blue assay. Concentrations of 4 (low), 8 (medium), and 12 (high) mM, were used to evaluate differential gene expression. A panel of genes was selected based on gene expression changes. The search for sequences of mRNA encoding proteins previously associated with kidney damage was conducted in the databases of the National Center for Biotechnology Information (USA). RNA was extracted from the cells, and RT-qPCR was performed to evaluate differential expression profiles of the selected genes. Among the eleven analyzed genes, four proved to be differentially up-regulated in cells exposed to gentamicin: HAVcr1, caspase3, ICAM-1, and EXOC6. According to this study's results, we suggest that these genes play an important role in the mechanism of in vitro neprotoxicity caused by gentamicin and can be used as early in vitro biomarkers to identify nephrotoxicity when developing safer drugs.

  18. GATA factors regulate proliferation, differentiation, and gene expression in small intestine of mature mice

    PubMed Central

    Beuling, Eva; Baffour-Awuah, Nana Yaa A.; Stapleton, Kelly A.; Aronson, Boaz E.; Noah, Taeko K.; Shroyer, Noah F.; Duncan, Stephen A.; Fleet, James C.; Krasinski, Stephen D.

    2012-01-01

    Background & Aims GATA transcription factors regulate genes in multiple organs to control proliferation and differentiation. GATA4 is expressed in the proximal 85% of the small intestine, where it regulates the expression of genes that are specifically expressed by absorptive enterocytes. GATA6 is co-expressed with GATA4 but is also expressed in the ileum; its function in the mature small intestine is unknown. Methods We investigated the function of GATA6 in small intestine using adult mice with inducible disruption of Gata6, or Gata6 and Gata4, specifically in the intestine. Results In ileum, deletion of Gata6 reduced in proliferation and numbers of enteroendocrine cells, increased numbers of goblet-like cells in crypts, caused loss of Paneth cells, and altered expression of genes specific to absorptive enterocytes. In contrast, in jejunum and duodenum, deletion of Gata6 increased numbers of Paneth cells. Deletion of Gata6 and Gata4 resulted jejunal and duodenal phenotype that was nearly identical to that in the ileum after deletion of Gata6 alone, demonstrating that most GATA4 functions are redundant with those of GATA6. Conclusion GATA transcription factors are required for proliferation, secretory cell differentiation, and expression of genes by absorptive enterocytes in the small intestinal epithelium. PMID:21262227

  19. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes.

    PubMed

    Yang, G P; Ross, D T; Kuang, W W; Brown, P O; Weigel, R J

    1999-03-15

    Comparing patterns of gene expression in cell lines and tissues has important applications in a variety of biological systems. In this study we have examined whether the emerging technology of cDNA microarrays will allow a high throughput analysis of expression of cDNA clones generated by suppression subtractive hybridization (SSH). A set of cDNA clones including 332 SSH inserts amplified by PCR was arrayed using robotic printing. The cDNA arrays were hybridized with fluorescent labeled probes prepared from RNA from ER-positive (MCF7 and T47D) and ER-negative (MDA-MB-231 and HBL-100) breast cancer cell lines. Ten clones were identified that were over-expressed by at least a factor of five in the ER-positive cell lines. Northern blot analysis confirmed over-expression of these 10 cDNAs. Sequence analysis identified four of these clones as cytokeratin 19, GATA-3, CD24 and glutathione-S-transferase mu-3. Of the remaining six cDNA clones, four clones matched EST sequences from two different genes and two clones were novel sequences. Flow cytometry and immunofluorescence confirmed that CD24 protein was over-expressed in the ER-positive cell lines. We conclude that SSH and microarray technology can be successfully applied to identify differentially expressed genes. This approach allowed the identification of differentially expressed genes without the need to obtain previously cloned cDNAs.

  20. Differential gene expression of fatty acid binding proteins during porcine adipogenesis.

    PubMed

    Samulin, Johanna; Berget, Ingunn; Lien, Sigbjørn; Sundvold, Hilde

    2008-10-01

    Four different subtypes of fatty acid binding proteins i.e. liver-type FABP1, heart/muscle-type FABP3, adipocyte-type FABP4 and epithelial/epidermal-type FABP5 are expressed in adipose tissue. However, only the regulatory role of FABP4 in adipogenesis has been thoroughly investigated. To increase the knowledge on possible roles of these FABP subtypes in preadipocyte differentiation, gene expression patterns were examined during adipogenesis in pig (Sus scrofa). FABP1 expression was induced in proliferating cells, whereas FABP3, FABP4 and FABP5 expression increased throughout preadipocyte differentiation. Interestingly, the FABP4 and FABP5 expression increased early in the differentiation, followed by FABP3 later in the differentiation process. This indicates a role of FABP4 and FABP5 in intracellular fatty acid transport during initiation of differentiation, whereas, FABP3 likely is involved in the transport of fatty acids during intermediate stages of adipogenesis. In this study we demonstrate that FABP3, FABP4 and FABP5 expression is correlated with that of the peroxisome proliferator-activated receptors alpha and gamma (PPARA and PPARG). Altogether, this suggests a role of FABP1 during cell proliferation, whereas a coordinated expression of FABP3, FABP4 and FABP5 together with that of PPARA, PPARG1 and PPARG2 might be critical for the metabolic regulation during porcine adipogenesis.

  1. Differential expression of stress candidate genes for thermal tolerance in the sea urchin Loxechinus albus.

    PubMed

    Vergara-Amado, Jonathan; Silva, Andrea X; Manzi, Catalina; Nespolo, Roberto F; Cárdenas, Leyla

    2017-08-01

    Marine ectotherms inhabiting intertidal and shallow subtidal environments are continuously exposed to diurnal tidal cycles and seasonal variability in temperature. These organisms have adaptive mechanisms to maintain cellular homeostasis, irrespective of thermal environmental variation. In this study, we describe the molecular responses to thermal stress in the edible sea urchin Loxechinus albus. In particular, we determined the differential expression of a set of molecular markers that have been identified as targets of stress-related responses. These include the heat shock proteins (hsp70 and hsp90), cell detoxification proteins (cytochrome P450), and osmorregulatory proteins (α and ß - Na(+)/K(+)ATPase). We exposed individuals to different temperatures; a warm treatment (18±1.0°C), a cold treatment (10±1.0°C), and a control treatment (average local temperature of 14±1.0°C) and differential expression was quantified after 2, 6, 12 and 48h of exposure. Levels of mRNA were quantified by reverse transcription-quantitative polymerase chain reaction, and the relative expression of each gene was calculated using the 18S rRNA gene as a reference, and the control treatment as a calibrator. We found that the expression levels of all studied genes increased during exposure to warmth. The largest increase in expression was observed in cytochrome p450 genes (ca. sixteen-fold); this was followed by increases in the expression of the Na(+)/K(+)ATPase (ca. eight-fold) and by the hsp (ca. six fold) genes. These results indicate that sea urchin thermal stress responses depend on differential gene-regulation, involving heat-shock, membrane potential, and detoxification genes that generate an integrated adaptive response to acute environmental changes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

    PubMed Central

    2011-01-01

    Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their

  3. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  4. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.

    PubMed

    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona

    2009-12-15

    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  5. Differential gene expression in the perichondrium and cartilage of the neonatal mouse temporomandibular joint

    PubMed Central

    Hinton, RJ; Serrano, M; So, S

    2009-01-01

    Objective To discover genes differentially expressed in the perichondrium of the mandibular condylar cartilage (MCC) that might enhance regenerative medicine or orthopedic therapies directed at the tissues of the temporomandibular joint Design We used targeted gene arrays (osteogenesis, stem cell) to identify genes preferentially expressed in the perichondrium (PC) and the cartilaginous (C) portions of the MCC in 2 day-old mice Results Genes with higher expression in the PC sample related to growth factor ligand-receptor interactions (FGF-13 (6.4X), FGF-18 (4X), NCAM (2X); PGDF receptors, TGF-β, and IGF-1), the Notch isoforms (especially Notch 3 and 4) and their ligands, or structural proteins/ proteoglycans (collagen XIV (21X), collagen XVIII (4X), decorin (2.5X)). Genes with higher expression in the C sample consisted mostly of known cartilage-specific genes (aggrecan (11X), procollagens X (33X), XI (14X), IX (4.5X), Sox 9 (4.4X), and Indian hedgehog (6.7X)). However, the functional or structural roles of several genes that were expressed at higher levels in the PC sample are unclear (myogenic factor 9 (9X), tooth-related genes such as tuftelin (2.5X) and dentin sialophosphoprotein (1.6X), VEGF–B (2X) and its receptors (3–4X), and sclerostin (1.7X)). Conclusions FGF, Notch, and TGF-β signaling may be important regulators of MCC proliferation and differentiation; the relatively high expression of genes such as myogenic factor 6 and VEGF–B and its receptors suggests a degree of unsuspected plasticity in PC cells. PMID:19627518

  6. A novel highly differentially expressed gene in wheat endosperm associated with bread quality

    PubMed Central

    Furtado, A.; Bundock, P. C.; Banks, P. M.; Fox, G.; Yin, X.; Henry, R. J.

    2015-01-01

    Analysis of gene expression in developing wheat seeds was used to identify a gene, wheat bread making (wbm), with highly differential expression (~1000 fold) in the starchy endosperm of genotypes varying in bread making quality. Several alleles differing in the 5’-upstream region (promoter) of this gene were identified, with one present only in genotypes with high levels of wbm expression. RNA-Seq analysis revealed low or no wbm expression in most genotypes but high expression (0.2-0.4% of total gene expression) in genotypes that had good bread loaf volume. The wbm gene is predicted to encode a mature protein of 48 amino acids (including four cysteine residues) not previously identified in association with wheat quality, possibly because of its small size and low frequency in the wheat gene pool. Genotypes with high wbm expression all had good bread making quality but not always good physical dough qualities. The predicted protein was sulphur rich suggesting the possibility of a contribution to bread loaf volume by supporting the crossing linking of proteins in gluten. Improved understanding of the molecular basis of differences in bread making quality may allow more rapid development of high performing genotypes with acceptable end-use properties and facilitate increased wheat production. PMID:26011437

  7. Identification of differentially expressed genes in potato associated with tuber dormancy release.

    PubMed

    Liu, Bailin; Zhang, Ning; Wen, Yikai; Si, Huaijun; Wang, Di

    2012-12-01

    Potato (Solanum tuberosum L.) tuber dormancy and sprouting is very important to potato cultivation and processing. In the present experiment, suppression subtractive hybridization was employed to identify differentially expressed genes in potato associated with tuber dormancy release. 576 random clones were selected from subtractive library and successfully sequenced. A total of 304 effective expressed sequence tags (ESTs) were obtained ultimately. The ESTs have been deposited in the EMBL\\GenBank\\DDBJ nucleotide sequence data libraries under accession numbers from JK483901 to JK484204. GO annotation showed that 45, 34 and 3 % ESTs were associated with binding, catalytic activity and signaling respectively, some of which were confirmed to be involved in plant dormancy breaking, however, 14 % of the ESTs did not show significant homology to any database proteins. A real-time quantitative PCR (RT-qPCR) analysis of the expression patterns of 14 selectable transcripts showed that 13 selected candidate genes were significantly up-regulated in the development process of tuber from dormancy to sprouting. A full length cDNA of ADP-ribosylation factor (ARF) gene was cloned and found it belonged to potato ARF1 gene. Tissue specific expression analysis showed ARF1 expression level was the highest in tuber. RT-qPCR analysis of the expression profile of ARF1 gene from potato tuber dormancy to sprouting revealed that the ARF1 gene expression was significantly increased after tuber dormancy breaking, which suggested that it probably associated with tuber dormancy and sprouting.

  8. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  9. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    PubMed

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  10. Identification of Differentially Expressed Gene after Femoral Fracture via Microarray Profiling

    PubMed Central

    Zhong, Donggen

    2014-01-01

    We aimed to investigate differentially expressed genes (DEGs) in different stages after femoral fracture based on rat models, providing the basis for the treatment of sport-related fractures. Gene expression data GSE3298 was downloaded from Gene Expression Omnibus (GEO), including 16 chips. All femoral fracture samples were classified into earlier fracture stage and later fracture stage. Total 87 DEGs simultaneously occurred in two stages, of which 4 genes showed opposite expression tendency. Out of the 4 genes, Rest and Cst8 were hub nodes in protein-protein interaction (PPI) network. The GO (Gene Ontology) function enrichment analysis verified that nutrition supply related genes were enriched in the earlier stage and neuron growth related genes were enriched in the later stage. Calcium signaling pathway was the most significant pathway in earlier stage; in later stage, DEGs were enriched into 2 neurodevelopment-related pathways. Analysis of Pearson's correlation coefficient showed that a total of 3,300 genes were significantly associated with fracture time, none of which was overlapped with identified DEGs. This study suggested that Rest and Cst8 might act as potential indicators for fracture healing. Calcium signaling pathway and neurodevelopment-related pathways might be deeply involved in bone healing after femoral fracture. PMID:25110652

  11. RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation

    SciTech Connect

    Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph; Youssef, Rimon F.; London, Steven D.; Reddy, Sakamuri V. . E-mail: reddysv@musc.edu

    2007-01-01

    Osteoclast differentiation is tightly regulated by receptor activator of NF-{kappa}B ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity in RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity

  12. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.

    PubMed

    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo

    2013-11-01

    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  13. Differentially-Expressed Genes Associated with Faster Growth of the Pacific Abalone, Haliotis discus hannai.

    PubMed

    Choi, Mi-Jin; Kim, Gun-Do; Kim, Jong-Myoung; Lim, Han Kyu

    2015-11-18

    The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%-3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females) encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3), vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones.

  14. Differentially-Expressed Genes Associated with Faster Growth of the Pacific Abalone, Haliotis discus hannai

    PubMed Central

    Choi, Mi-Jin; Kim, Gun-Do; Kim, Jong-Myoung; Lim, Han Kyu

    2015-01-01

    The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%–3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females) encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3), vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones. PMID:26593905

  15. Immune- and wound-dependent differential gene expression in an ancient insect.

    PubMed

    Johnston, Paul R; Rolff, Jens

    2013-01-01

    Two of the main functions of the immune system are to control infections and to contribute to wound closure. Here we present the results of an RNAseq study of immune- and wound-response gene expression in the damselfly Coenagrion puella, a representative of the odonates, the oldest taxon of winged insects. De novo assembly of RNAseq data revealed a rich repertoire of canonical immune pathways, as known from model insects, including recognition, transduction and effector gene expression. A shared set of immune and wound repair genes were differentially expressed in both wounded and immune-challenged larvae. Moreover 3-fold more immune genes were induced only in the immune-challenged treatment. This is consistent with the notion that the immune-system reads a balance of signals related to wounding and infection and that the response is tailored accordingly.

  16. RNA-Seq Reveals Differential Gene Expression in Staphylococcus aureus with Single-Nucleotide Resolution

    PubMed Central

    Osmundson, Joseph; Dewell, Scott; Darst, Seth A.

    2013-01-01

    Staphylococcus aureus is a gram-positive cocci and an important human commensal bacteria and pathogen. S. aureus infections are increasingly difficult to treat because of the emergence of highly resistant MRSA (methicillin-resistant S. aureus) strains. Here we present a method to study differential gene expression in S. aureus using high-throughput RNA-sequencing (RNA-seq). We used RNA-seq to examine gene expression in S. aureus RN4220 cells containing an exogenously expressed transcription factor and between two S. aureus strains (RN4220 and NCTC8325-4). We investigated the sequence and gene expression differences between RN4220 and NCTC8325-4 and used the RNA-seq data to identify S. aureus promoters suitable for in vitro analysis. We used RNA-seq to describe, on a genome wide scale, genes positively and negatively regulated by the phage encoded transcription factor gp67. RNA-seq offers the ability to study differential gene expression with single-nucleotide resolution, and is a considerable improvement over the predominant genome-wide transcriptome technologies used in S. aureus. PMID:24116120

  17. Identification of differentially expressed genes in Chrysanthemum nankingense (Asteraceae) under heat stress by RNA Seq.

    PubMed

    Sun, Jing; Ren, Liping; Cheng, Yue; Gao, Jiaojiao; Dong, Bin; Chen, Sumei; Chen, Fadi; Jiang, Jiafu

    2014-11-15

    The RNA-Seq platform was used to characterize the high-temperature stress response of Chrysanthemum nankingense. A set of 54,668 differentially expressed unigenes was identified. After a threshold of ratio change ≥ 2 and a q-value of <0.05 were applied, the number of differentially transcribed genes was reduced to 3955, of which 765 were up-regulated and 3190 were down-regulated in response to heat stress. The differentially transcribed genes were predicted to participate in 26 biological processes, 4 cellular components, and 13 molecular functions. Among the most differentially expressed genes between the two libraries were well-recognized high-temperature responsive protein families, such as heat shock factors and heat shock proteins, various transcription factor families, and a number of RNA metabolism-related genes. Overall, the RNA-Seq analyses revealed a high degree of transcriptional complexity in early heat stress response. Some of these high-temperature responsive C. nankingense genes may prove useful in efforts to improve thermotolerance of commercial chrysanthemum. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  19. An independent validation of a gene expression signature to differentiate malignant melanoma from benign melanocytic nevi

    PubMed Central

    Flake, Darl D.; Busam, Klaus; Cockerell, Clay; Helm, Klaus; McNiff, Jennifer; Reed, Jon; Tschen, Jaime; Kim, Jinah; Barnhill, Raymond; Elenitsas, Rosalie; Prieto, Victor G.; Nelson, Jonathan; Kimbrell, Hillary; Kolquist, Kathryn A.; Brown, Krystal L.; Warf, M. Bryan; Roa, Benjamin B.; Wenstrup, Richard J.

    2016-01-01

    BACKGROUND Recently, a 23‐gene signature was developed to produce a melanoma diagnostic score capable of differentiating malignant and benign melanocytic lesions. The primary objective of this study was to independently assess the ability of the gene signature to differentiate melanoma from benign nevi in clinically relevant lesions. METHODS A set of 1400 melanocytic lesions was selected from samples prospectively submitted for gene expression testing at a clinical laboratory. Each sample was tested and subjected to an independent histopathologic evaluation by 3 experienced dermatopathologists. A primary diagnosis (benign or malignant) was assigned to each sample, and diagnostic concordance among the 3 dermatopathologists was required for inclusion in analyses. The sensitivity and specificity of the score in differentiating benign and malignant melanocytic lesions were calculated to assess the association between the score and the pathologic diagnosis. RESULTS The gene expression signature differentiated benign nevi from malignant melanoma with a sensitivity of 91.5% and a specificity of 92.5%. CONCLUSIONS These results reflect the performance of the gene signature in a diverse array of samples encountered in routine clinical practice. Cancer 2017;123:617–628. © 2016 American Cancer Society. PMID:27768230

  20. Differential gene expression identified in Uigur women cervical squamous cell carcinoma by suppression subtractive hybridization.

    PubMed

    Pan, Z; Chen, S; Pan, X; Wang, Z; Han, H; Zheng, W; Wang, X; Li, F; Qu, S; Shao, R

    2010-01-01

    Cervical cancer is one of the most common gynecological cancers worldwide. Over the past decade, much progress has been made in understanding the genetic changes associated with the development and progression of cervical cancer. However, the precise mechanisms of cervical carcinogenesis in Uigur women remain unclear. To screen differential gene expression in squamous cell carcinoma (SCC) of the cervix in Uigur women, suppressive subtractive hybridization (SSH) was performed on the cervical squamous cell carcinoma and corresponding normal cervical tissues of a Uigur patient. Thus we were be able to find the genes that are related with cervical tumors of Uigur women. A total of 300 samples were subject to DNA sequencing analysis and 46 genes were found to express differentially in tumors compared with normal tissues. Of the 46 genes, 24 genes were up-regulated whereas 22 genes were down-regulated in cervical tumors. The expression profiles of 5 of the 46 genes were further confirmed in 15 other Uigur patients by semi-quantitative reverse-transcription polymerase chain reaction. Our results revealed that ACADVL, CEBPB, IFITM1 and DNAJC9 are involved in cervical carcinogenesis.

  1. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    PubMed

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  2. Expression patterns of TEL genes in Poaceae suggest a conserved association with cell differentiation.

    PubMed

    Paquet, Nicolas; Bernadet, Marie; Morin, Halima; Traas, Jan; Dron, Michel; Charon, Celine

    2005-06-01

    Poaceae species present a conserved distichous phyllotaxy (leaf position along the stem) and share common properties with respect to leaf initiation. The goal of this work was to determine if these common traits imply common genes. Therefore, homologues of the maize TERMINAL EAR1 gene in Poaceae were studied. This gene encodes an RNA-binding motif (RRM) protein, that is suggested to regulate leaf initiation. Using degenerate primers, one unique tel (terminal ear1-like) gene from seven Poaceae members, covering almost all the phylogenetic tree of the family, was identified by PCR. These genes present a very high degree of similarity, a much conserved exon-intron structure, and the three RRMs and TEL characteristic motifs. The evolution of tel sequences in Poaceae strongly correlates with the known phylogenetic tree of this family. RT-PCR gene expression analyses show conserved tel expression in the shoot apex in all species, suggesting functional orthology between these genes. In addition, in situ hybridization experiments with specific antisense probes show tel transcript accumulation in all differentiating cells of the leaf, from the recruitment of leaf founder cells to leaf margins cells. Tel expression is not restricted to initiating leaves as it is also found in pro-vascular tissues, root meristems, and immature inflorescences. Therefore, these results suggest that TEL is not only associated with leaf initiation but more generally with cell differentiation in Poaceae.

  3. Differential expression profiles and pathways of genes in sugarcane leaf at elongation stage in response to drought stress

    PubMed Central

    Li, Changning; Nong, Qian; Solanki, Manoj Kumar; Liang, Qiang; Xie, Jinlan; Liu, Xiaoyan; Li, Yijie; Wang, Weizan; Yang, Litao; Li, Yangrui

    2016-01-01

    Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, a pot experiment was performed with the sugarcane variety GT21 at three water-deficit levels (mild, moderate, and severe) during the elongation stage and gene expression was analyzed using microarray technology. Physiological parameters of sugarcane showed significant alterations in response to drought stress. Based on the expression profile of 15,593 sugarcane genes, 1,501 (9.6%) genes were differentially expressed under different water-level treatments; 821 genes were upregulated and 680 genes were downregulated. A gene similarity analysis showed that approximately 62.6% of the differentially expressed genes shared homology with functional proteins. In a Gene Ontology (GO) analysis, 901 differentially expressed genes were assigned to 36 GO categories. Moreover, 325 differentially expressed genes were classified into 101 pathway categories involved in various processes, such as the biosynthesis of secondary metabolites, ribosomes, carbon metabolism, etc. In addition, some unannotated genes were detected; these may provide a basis for studies of water-deficit tolerance. The reliability of the observed expression patterns was confirmed by RT-PCR. The results of this study may help identify useful genes for improving drought tolerance in sugarcane. PMID:27170459

  4. Differential expression of porcine TAP1 gene in the populations of pigs.

    PubMed

    Zhu, S P; Yin, X M; Sun, L; Sun, S Y; Bao, W B; Wu, S L

    2015-03-01

    Transporter associated with antigen processing (TAP) transports peptides from the cytosol into the endoplasmic reticulum (ER) for subsequent loading onto the major histocompatibility complex (MHC) class I molecules. TAP is consisted of two subunits: TAP and TAP2. Using Real-time PCR technology, this study detected tissue expression profile and analyzed the differential expression of TAP1 gene in Sutai Escherichia coli-resistant group, Yorkshire and Meishan pigs. Tissue expression profile revealed that TAP1 gene expressed in all tissues we detected, and the expression levels were high in lung, immune tissues and intestines. Through the comparation of gene expression differention in different populations, TAP1 expression level of Sutai E. coli-resistant group was significantly higher than that of Yorkshire and Meishan populations in liver, spleen, lung, kidney, thymus, lymph, duodenum and jejunum (P<0.05). Meanwhile TAP1 gene was more highly expressed in Sutai E. coli-resistant group than that of Meishan population in stomach (P<0.05). In conclusion, the upregulation of TAP1 expression level in E. coli-resistant group could be related to E. coli F18 infection. In addition, Chinese local pigs may have special immune response and genetic mechanism in resisting E. coli F18 infection which is differing from MHC I moleculars.

  5. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder.

    PubMed

    Yang, Chengqing; Hu, Guoqin; Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively). With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls.

  6. Peripheral blood gene expression signature differentiates children with autism from unaffected siblings

    PubMed Central

    Kong, SW; Shimizu-Motohashi, Y; Campbell, MG; Lee, IH; Collins, CD; Brewster, SJ; Holm, IA; Rappaport, L

    2013-01-01

    Autism spectrum disorder (ASD) is one of the most prevalent neurodevelopmental disorders with high heritability, yet a majority of genetic contribution to pathophysiology is not known. Siblings of individuals with ASD are at increased risk for ASD and autistic traits, but the genetic contribution for simplex families is estimated to be less when compared to multiplex families. To explore the genomic (dis-) similarity between proband and unaffected sibling in simplex families, we used genome-wide gene expression profiles of blood from 20 proband-unaffected sibling pairs and 18 unrelated control individuals. The global gene expression profiles of unaffected siblings were more similar to those from probands as they shared genetic and environmental background. One hundred eighty nine genes were significantly differentially expressed between proband-sib pairs (nominal p-value < 0.01) after controlling for age, sex, and family effects. Probands and siblings were distinguished into two groups by cluster analysis with these genes. Overall, unaffected siblings were equally distant from the centroid of probands and from that of unrelated controls with the differentially expressed genes. Interestingly, 5 of 20 siblings had gene expression profiles that were more similar to unrelated controls than to their matched probands. In summary, we found a set of genes that distinguished probands from the unaffected siblings, and a subgroup of unaffected siblings who were more similar to probands. The pathways that characterized probands compared to siblings using peripheral blood gene expression profiles were the up-regulation of ribosomal, spliceosomal, and mitochondrial pathways, and the down-regulation of neuroreceptor-ligand, immune response and calcium signaling pathways. Further integrative study with structural genetic variations such as de novo mutations, rare variants, and copy number variations would clarify whether these transcriptomic changes are structural or environmental

  7. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder

    PubMed Central

    Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Background Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively) Method With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. Results We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. Conclusion CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls. PMID:28333931

  8. Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization.

    PubMed

    Qiu, Jie; Ni, Yu-hui; Gong, Hai-xia; Fei, Li; Pan, Xiao-qin; Guo, Mei; Chen, Rong-hua; Guo, Xi-rong

    2007-01-12

    To identify differentially expressed genes between obese individuals and normal control, we have undertaken suppression subtractive hybridization (SSH). Omental adipose tissues were obtained via abdominal surgery for appendicitis in both 13 obese subjects [BMI (body mass index) >30 kg/m2] and 13 normal subjects (BMI >18 and <25 kg/m2). Following SSH, about one thousand clones were sequenced and found to derive from 426 different genes. These predominately expressed genes included genes involved in lipid metabolism, cytokines, signal transduction, GLUT4 translocation, cell cycle and growth, cytoskeleton, and others. Although more detailed analyses are necessary, it is anticipated that further study of genes identified will provide insights into their specific roles in the etiology of obesity.

  9. Mutations in Ehrlichia chaffeensis Causing Polar Effects in Gene Expression and Differential Host Specificities.

    PubMed

    Cheng, Chuanmin; Nair, Arathy D S; Jaworski, Deborah C; Ganta, Roman R

    2015-01-01

    Ehrlichia chaffeensis, a tick-borne rickettsial, is responsible for human monocytic ehrlichiosis. In this study, we assessed E. chaffeensis insertion mutations impacting the transcription of genes near the insertion sites. We presented evidence that the mutations within the E. chaffeensis genome at four genomic locations cause polar effects in altering gene expressions. We also reported mutations causing attenuated growth in deer (the pathogen's reservoir host) and in dog (an incidental host), but not in its tick vector, Amblyomma americanum. This is the first study documenting insertion mutations in E. chaffeensis that cause polar effects in altering gene expression from the genes located upstream and downstream to insertion sites and the differential requirements of functionally active genes of the pathogen for its persistence in vertebrate and tick hosts. This study is important in furthering our knowledge on E. chaffeensis pathogenesis.

  10. Differential expression of the UGT1A family of genes in stomach cancer tissues.

    PubMed

    Cengiz, Beyhan; Yumrutas, Onder; Bozgeyik, Esra; Borazan, Ersin; Igci, Yusuf Ziya; Bozgeyik, Ibrahim; Oztuzcu, Serdar

    2015-08-01

    Uridine 5'-diphospho-glucuronosyltransferases (UGT) are the key players in the biotransformation of drugs, xenobiotics, and endogenous compounds. Particularly, UDP-glucuronosyltransferase 1A (UGT1A) participates in a wide range of biological and pharmacological processes and plays a critical role in the conjugation of endogenous and exogenous components. Thirteen alternative splicing products were produced from UGT1A gene locus designated as UGT1A1 and UGT1A3-10. A growing amount of evidence suggests that they have important roles in the carcinogenesis which is well documented by colon, liver, pancreas, and kidney cancer studies. Here, we report differential expressions of UGT1A genes in normal and tumor tissues of stomach cancer patients. Total numbers of 49 patients were enrolled for this study, and expression analysis of UGT1A genes was evaluated by the real-time PCR method. Accordingly, UGT1A1, UGT1A8, and UGT1A10 were found to be upregulated, and UGT1A3, UGT1A5, UGT1A7, and UGT1A9 were downregulated in stomach tumors. No expression changes were observed in UGT1A4. Also, UGT1A6 transcription variants were significantly upregulated in stomach cancer tissues compared to normal stomach tissue. Additionally, UGT1A7 gene showed highest expression in both normal and tumoral tissues, and interestingly, UGT1A7 gene expression was significantly reduced in stage II patients as compared to other patients. In conclusion, UGT1A genes are differentially expressed in normal and tumoral stomach tissues and expression changes of these genes may affect the development and progression of various types of cancer including the cancer of the stomach.

  11. Interpreting Patterns of Gene Expression with Self-Organizing Maps: Methods and Application to Hematopoietic Differentiation

    NASA Astrophysics Data System (ADS)

    Tamayo, Pablo; Slonim, Donna; Mesirov, Jill; Zhu, Qing; Kitareewan, Sutisak; Dmitrovsky, Ethan; Lander, Eric S.; Golub, Todd R.

    1999-03-01

    Array technologies have made it straightforward to monitor simultaneously the expression pattern of thousands of genes. The challenge now is to interpret such massive data sets. The first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of self-organizing maps, a type of mathematical cluster analysis that is particularly well suited for recognizing and classifying features in complex, multidimensional data. The method has been implemented in a publicly available computer package, GENECLUSTER, that performs the analytical calculations and provides easy data visualization. To illustrate the value of such analysis, the approach is applied to hematopoietic differentiation in four well studied models (HL-60, U937, Jurkat, and NB4 cells). Expression patterns of some 6,000 human genes were assayed, and an online database was created. GENECLUSTER was used to organize the genes into biologically relevant clusters that suggest novel hypotheses about hematopoietic differentiation--for example, highlighting certain genes and pathways involved in "differentiation therapy" used in the treatment of acute promyelocytic leukemia.

  12. Analysis of differentially co-expressed genes based on microarray data of hepatocellular carcinoma.

    PubMed

    Wang, Y; Jiang, T; Li, Z; Lu, L; Zhang, R; Zhang, D; Wang, X; Tan, J

    2017-01-01

    Hepatocellular carcinoma (HCC) is the third leading cause of cancer related death worldwide. Although great progress in diagnosis and management of HCC have been made, the exact molecular mechanisms remain poorly understood. The study aims to identify potential biomarkers for HCC progression, mainly at transcription level. In this study, chip data GSE 29721 was utilized, which contains 10 HCC samples and 10 normal adjacent tissue samples. Differentially expressed genes (DEGs) between two sample types were selected by t-test method. Following, the differentially co-expressed genes (DCGs) and differentially co-expressed Links (DCLs) were identified by DCGL package in R with the threshold of q < 0.25. Afterwards, pathway enrichment analysis of the DCGs was carried out by DAVID. Then, DCLs were mapped to TRANSFAC database to reveal associations between relevant transcriptional factors (TFs) and their target genes. Quantitative real-time RT-PCR was performed for TFs or genes of interest. As a result, a total of 388 DCGs and 35,771 DCLs were obtained. The predominant pathways enriched by these genes were Cytokine-cytokine receptor interaction, ECM-receptor interaction and TGF-β signaling pathway. Three TF-target interactions, LEF1-NCAM1, EGR1-FN1 and FOS-MT2A were predicted. Compared with control, expressions of the TF genes EGR1, FOS and ETS2 were all up-regulated in the HCC cell line, HepG2; while LEF1 was down-regulated. Except NCAM1, all the target genes were up-regulated in HepG2. Our findings suggest these TFs and genes might play important roles in the pathogenesis of HCC and may be used as therapeutic targets for HCC management.

  13. Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei.

    PubMed

    Coram, Tristan E; Pang, Edwin C K

    2006-11-01

    Using microarray technology and a set of chickpea (Cicer arietinum L.) unigenes, grasspea (Lathyrus sativus L.) expressed sequence tags (ESTs) and lentil (Lens culinaris Med.) resistance gene analogues, the ascochyta blight (Ascochyta rabiei (Pass.) L.) resistance response was studied in four chickpea genotypes, including resistant, moderately resistant, susceptible and wild relative (Cicer echinospermum L.) genotypes. The experimental system minimized environmental effects and was conducted in reference design, in which samples from mock-inoculated controls acted as reference against post-inoculation samples. Robust data quality was achieved through the use of three biological replicates (including a dye swap), the inclusion of negative controls and strict selection criteria for differentially expressed genes, including a fold change cut-off determined by self-self hybridizations, Student's t-test and multiple testing correction (P < 0.05). Microarray observations were also validated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). The time course expression patterns of 756 microarray features resulted in the differential expression of 97 genes in at least one genotype at one time point. k-means clustering grouped the genes into clusters of similar observations for each genotype, and comparisons between A. rabiei-resistant and A. rabiei-susceptible genotypes revealed potential gene 'signatures' predictive of effective A. rabiei resistance. These genes included several pathogenesis-related proteins, SNAKIN2 antimicrobial peptide, proline-rich protein, disease resistance response protein DRRG49-C, environmental stress-inducible protein, leucine-zipper protein, polymorphic antigen membrane protein, Ca-binding protein and several unknown proteins. The potential involvement of these genes and their pathways of induction are discussed. This study represents the first large-scale gene expression profiling in chickpea, and future work will focus

  14. A new gene regulatory network model based on BP algorithm for interrogating differentially expressed genes of Sea Urchin.

    PubMed

    Liu, Longlong; Zhao, Tingting; Ma, Meng; Wang, Yan

    2016-01-01

    Computer science and mathematical theories are combined to analyze the complex interactions among genes, which are simplified to a network to establish a theoretical model for the analysis of the structure, module and dynamic properties. In contrast, traditional model of gene regulatory networks often lack an effective method for solving gene expression data because of high durational and spatial complexity. In this paper, we propose a new model for constructing gene regulatory networks using back propagation (BP) neural network based on predictive function and network topology. Combined with complex nonlinear mapping and self-learning, the BP neural network was mapped into a complex network. Network characteristics were obtained from the parameters of the average path length, average clustering coefficient, average degree, modularity, and map's density to simulate the real gene network by an artificial network. Through the statistical analysis and comparison of network parameters of Sea Urchin mRNA microarray data under different temperatures, the value of network parameters was observed. Differentially expressed Sea Urchin genes associated with temperature were determined by calculating the difference in the degree of each gene from different networks. The new model we developed is suitable to simulate gene regulatory network and has capability of determining differentially expressed genes.

  15. Expression variability of co-regulated genes differentiates Saccharomyces cerevisiae strains

    PubMed Central

    2011-01-01

    Background Saccharomyces cerevisiae (Baker's yeast) is found in diverse ecological niches and is characterized by high adaptive potential under challenging environments. In spite of recent advances on the study of yeast genome diversity, little is known about the underlying gene expression plasticity. In order to shed new light onto this biological question, we have compared transcriptome profiles of five environmental isolates, clinical and laboratorial strains at different time points of fermentation in synthetic must medium, during exponential and stationary growth phases. Results Our data unveiled diversity in both intensity and timing of gene expression. Genes involved in glucose metabolism and in the stress response elicited during fermentation were among the most variable. This gene expression diversity increased at the onset of stationary phase (diauxic shift). Environmental isolates showed lower average transcript abundance of genes involved in the stress response, assimilation of nitrogen and vitamins, and sulphur metabolism, than other strains. Nitrogen metabolism genes showed significant variation in expression among the environmental isolates. Conclusions Wild type yeast strains respond differentially to the stress imposed by nutrient depletion, ethanol accumulation and cell density increase, during fermentation of glucose in synthetic must medium. Our results support previous data showing that gene expression variability is a source of phenotypic diversity among closely related organisms. PMID:21507216

  16. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  17. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression

    PubMed Central

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree. PMID:26147807

  18. Differential gene expression and phenotypic plasticity in behavioural castes of the primitively eusocial wasp, Polistes canadensis

    PubMed Central

    Sumner, Seirian; Pereboom, Jeffrey J.M; Jordan, William C

    2005-01-01

    Understanding how a single genome can produce a variety of different phenotypes is of fundamental importance in evolutionary and developmental biology. One of the most striking examples of phenotypic plasticity is the female caste system found in eusocial insects, where variation in reproductive (queens) and non-reproductive (workers) phenotypes results in a broad spectrum of caste types, ranging from behavioural through to morphological castes. Recent advances in genomic techniques allow novel comparisons on the nature of caste phenotypes to be made at the level of the genes in organisms for which there is little genome information, facilitating new approaches in studying social evolution and behaviour. Using the paper wasp Polistes canadensis as a model system, we investigated for the first time how behavioural castes in primitively eusocial insect societies are associated with differential expression of shared genes. We found that queens and newly emerged females express gene expression patterns that are distinct from each other whilst workers generally expressed intermediate patterns, as predicted by Polistes biology. We compared caste-associated genes in P. canadensis with those expressed in adult queens and workers of more advanced eusocial societies, which represent four independent origins of eusociality. Nine genes were conserved across the four taxa, although their patterns of expression and putative functions varied. Thus, we identify several genes that are putatively of evolutionary importance in the molecular biology that underlies a number of caste systems of independent evolutionary origin. PMID:16519229

  19. Differential gene expression and phenotypic plasticity in behavioural castes of the primitively eusocial wasp, Polistes canadensis.

    PubMed

    Sumner, Seirian; Pereboom, Jeffrey J M; Jordan, William C

    2006-01-07

    Understanding how a single genome can produce a variety of different phenotypes is of fundamental importance in evolutionary and developmental biology. One of the most striking examples of phenotypic plasticity is the female caste system found in eusocial insects, where variation in reproductive (queens) and non-reproductive (workers) phenotypes results in a broad spectrum of caste types, ranging from behavioural through to morphological castes. Recent advances in genomic techniques allow novel comparisons on the nature of caste phenotypes to be made at the level of the genes in organisms for which there is little genome information, facilitating new approaches in studying social evolution and behaviour. Using the paper wasp Polistes canadensis as a model system, we investigated for the first time how behavioural castes in primitively eusocial insect societies are associated with differential expression of shared genes. We found that queens and newly emerged females express gene expression patterns that are distinct from each other whilst workers generally expressed intermediate patterns, as predicted by Polistes biology. We compared caste-associated genes in P. canadensis with those expressed in adult queens and workers of more advanced eusocial societies, which represent four independent origins of eusociality. Nine genes were conserved across the four taxa, although their patterns of expression and putative functions varied. Thus, we identify several genes that are putatively of evolutionary importance in the molecular biology that underlies a number of caste systems of independent evolutionary origin.

  20. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  1. RNA Sequencing of Sessile Serrated Colon Polyps Identifies Differentially Expressed Genes and Immunohistochemical Markers

    PubMed Central

    Delker, Don A.; Pop, Stelian; Neklason, Deborah W.; Bronner, Mary P.; Burt, Randall W.; Hagedorn, Curt H.

    2014-01-01

    Background Sessile serrated adenomas/polyps (SSA/Ps) may account for 20–30% of colon cancers. Although large SSA/Ps are generally recognized phenotypically, small (<1 cm) or dysplastic SSA/Ps are difficult to differentiate from hyperplastic or small adenomatous polyps by endoscopy and histopathology. Our aim was to define the comprehensive gene expression phenotype of SSA/Ps to better define this cancer precursor. Results RNA sequencing was performed on 5′ capped RNA from seven SSA/Ps collected from patients with the serrated polyposis syndrome (SPS) versus eight controls. Highly expressed genes were analyzed by qPCR in additional SSA/Ps, adenomas and controls. The cellular localization and level of gene products were examined by immunohistochemistry in syndromic and sporadic SSA/Ps, adenomatous and hyperplastic polyps and controls. We identified 1,294 differentially expressed annotated genes, with 106 increased ≥10-fold, in SSA/Ps compared to controls. Comparing these genes with an array dataset for adenomatous polyps identified 30 protein coding genes uniquely expressed ≥10-fold in SSA/Ps. Biological pathways altered in SSA/Ps included mucosal integrity, cell adhesion, and cell development. Marked increased expression of MUC17, the cell junction protein genes VSIG1 and GJB5, and the antiapoptotic gene REG4 were found in SSA/Ps, relative to controls and adenomas, were verified by qPCR analysis of additional SSA/Ps (n = 21) and adenomas (n = 10). Immunohistochemical staining of syndromic (n≥11) and sporadic SSA/Ps (n≥17), adenomatous (n≥13) and hyperplastic (n≥10) polyps plus controls (n≥16) identified unique expression patterns for VSIG1 and MUC17 in SSA/Ps. Conclusion A subset of genes and pathways are uniquely increased in SSA/Ps, compared to adenomatous polyps, thus supporting the concept that cancer develops by different pathways in these phenotypically distinct polyps with markedly different gene expression profiles. Immunostaining

  2. Burkholderia cenocepacia differential gene expression during host-pathogen interactions and adaptation to the host environment.

    PubMed

    O'Grady, Eoin P; Sokol, Pamela A

    2011-01-01

    Members of the Burkholderia cepacia complex (Bcc) are important in medical, biotechnological, and agricultural disciplines. These bacteria naturally occur in soil and water environments and have adapted to survive in association with plants and animals including humans. All Bcc species are opportunistic pathogens including Burkholderia cenocepacia that causes infections in cystic fibrosis and chronic granulomatous disease patients. The adaptation of B. cenocepacia to the host environment was assessed in a rat chronic respiratory infection model and compared to that of high cell-density in vitro grown cultures using transcriptomics. The distribution of genes differentially expressed on chromosomes 1, 2, and 3 was relatively proportional to the size of each genomic element, whereas the proportion of plasmid-encoded genes differentially expressed was much higher relative to its size and most genes were induced in vivo. The majority of genes encoding known virulence factors, components of types II and III secretion systems and chromosome 2-encoded type IV secretion system were similarly expressed between in vitro and in vivo environments. Lower expression in vivo was detected for genes encoding N-acyl-homoserine lactone synthase CepI, orphan LuxR homolog CepR2, zinc metalloproteases ZmpA and ZmpB, LysR-type transcriptional regulator ShvR, nematocidal protein AidA, and genes associated with flagellar motility, Flp type pilus formation, and type VI secretion. Plasmid-encoded type IV secretion genes were markedly induced in vivo. Additional genes induced in vivo included genes predicted to be involved in osmotic stress adaptation or intracellular survival, metal ion, and nutrient transport, as well as those encoding outer membrane proteins. Genes identified in this study are potentially important for virulence during host-pathogen interactions and may be associated with survival and adaptation to the host environment during chronic lung infections.

  3. Meta-analysis of differentially expressed genes in primary Sjogren's syndrome by using microarray.

    PubMed

    Song, Gwan Gyu; Kim, Jae-Hoon; Seo, Young Ho; Choi, Sung Jae; Ji, Jong Dae; Lee, Young Ho

    2014-01-01

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in primary Sjogren's syndrome (pSS). We performed a meta-analysis using the INMEX program (integrative meta-analysis of expression data) of publicly available microarray GEO datasets of pSS. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using Kyoto Encyclopedia of Genes and Genomes (KEGG). Three GEO datasets including 37 cases and 33 controls were available for the meta-analysis. We identified 179 genes across the studies which were consistently DE in pSS (146 up-regulated and 33 down-regulated). The up-regulated gene with the largest effect size (ES) (ES = -2.4228) was SELL (selectin L), whose product is required for the binding and subsequent rolling of leucocytes on endothelial cells to facilitate their migration into secondary lymphoid organs and inflammation sites. The most significant enrichment was in the immune response GO category (P = 2.52 × 10(-25)). The most significant pathway in our KEGG analysis was Epstein-Barr virus infection (P = 9.91 × 10(-06)). Our meta-analysis demonstrated genes that were consistently DE and biological pathways associated with gene expression changes with pSS. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  4. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-05-11

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns.

  5. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  6. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.

    PubMed

    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric

    2006-04-01

    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  7. CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

    PubMed

    Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

    2013-10-15

    The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Efficiency Analysis of Competing Tests for Finding Differentially Expressed Genes in Lung Adenocarcinoma

    PubMed Central

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The ‘best’ test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  9. Efficiency analysis of competing tests for finding differentially expressed genes in lung adenocarcinoma.

    PubMed

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The 'best' test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  10. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  11. Bisphenol A modulates expression of sex differentiation genes in the self-fertilizing fish, Kryptolebias marmoratus.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Lee, Chang Joo; Yoon, Yong-Dal; Lee, Young-Mi; Lee, Jae-Seong

    2011-08-01

    Endocrine disrupting chemicals (EDCs) have been a major concern in the normal reproduction and development of aquatic organisms. In the teleost, steroid hormones are synthesized via the steroidogenesis pathway, and play a key physiological role in the regulation of gonadal sex differentiation. The protogynous hermaphroditic fish, Kryptolebias marmoratus is the only vertebrate capable of reproducing through internal self-fertilization. To uncover the effect of bisphenol A (BPA) on sex differentiation genes on transcription, we investigated the expression patterns of several sex differentiation-related genes such as dax1, dmrt1, mis, sf1, figlα, StAR and wt1 after BPA exposure with controls (E2 and TMX). In response to 17β-estradiol (E2) exposure, a testis-specific gene, dmrt1 mRNA was down-regulated in the gonad of the secondary male but the expression of the female-specific gene, dax1 mRNA was significantly elevated in the brain and gonad. A high level of StAR mRNA was detected in the brain and gonad of both hermaphrodite and secondary males, suggesting that the elevated expression of dax1 and StAR genes would be involved in E2 exposure. As expected, upon BPA exposure, the dmrt1 and MIS mRNA level decreased in both hermaphrodite and secondary males, while the female-specific gene, figlα mRNA level increased in the gonad of both genders. BPA showed an opposite mode of action on the expression of dax1 (induction, P>0.05) and sf1 mRNA (inhibition, P>0.05) in the brain and gonad against both genders. The sensitivity of dax1 to BPA on expression was relatively high in the secondary male. The wt1 mRNA was up-regulated in most tissues except in the liver of BPA-exposed secondary males. Regarding the time course study, the figlα mRNA level increased at 6 h after BPA exposure. In addition, BPA elevated the expression of StAR, dax1, and wt1 mRNA but repressed sf1 mRNA. In this paper, we demonstrated that BPA may modulate the expression of sex differentiation and

  12. Gene Expression upon Proliferation and Differentiation of Hematopoietic Cells with Ph Chromosome ex vivo

    PubMed Central

    Grineva, N.I.; Duchovenskay, E.A.; Timofeev, A.M.; Akhlynina, T.V.; Gerasimova, L.P.; Borovkova, T.V.; Schmarov, D.A.; Sarycheva, N.G.; Naydenova, N.M.; Gavrichkova, 
A.R.; Kolosova, L.Y.; Kolosheynova, T.I.; Kovaleva, L.G.

    2012-01-01

    The genesp53, mdm2, p21, c-myc,bcr/abl, bcr, bcl2, bax, and gapdh participate in the regulation of cell proliferation and differentiation, apoptosis and cell distribution for the cell cycle ex vivo in the Ph+cells of chronic myeloid leukemia containing the Ph chromosome andbcr/abloncogene. Expression of these genes correlates with regulation of cell proliferation and differentiation by alternating proliferation and maturation stages for three main Ph+cell types that occur under chronic myeloid leukemia. Thep53, p21, mdm2, and gapdh genes overexpress in active proliferating myeloid cells in the cell cycle S+ G2/M phases and when the phases are coincident with the proliferation stage. Expression of these genes decreases to a considerable level under alternation of the Ph+cell proliferation and maturation stages and whenever the expression is greatly diminished under significant neutrophil accumulation and especially under repeated alternation of the stages. In the course of neutrophil maturation, gene expression levels decrease in the range of gapdh > actin > c-myc, bcr/abl,p21 > p53 > bcl2 > bax.The expression levels of these genes in neutrophils are lower than those in myelocytes and lower by an order of magnitude than that in the cells with a prolonged proliferation stage. TheBcr/ablexpression gene under prolonged maturation and neutrophil accumulation is inhibited; however it is enhanced by 2–3 times for the proliferation stage with myelocyte accumulation. Minimalbcr/ablexpression is observed under overexpression ofp53, mdm2, p21, c-myc,as well as under cell maximum at the S and G2/M phases. Bcr/abloverexpression is observed under low expression of thep53, p21, mdm2genes. In the Ph+ cells with a high P/D efficiency index (5–20), overexpression of the genes in the range ofbcr> gapdh>bcr/abl, as well as a decreased expression of thep53, bcl2, mdm2, p21<< gapdh genes is observed for Ph+cells from the CML blast crisis and CML acceleration phase. Low control of

  13. Identification of differentially expressed genes involved in transient regeneration of the neonatal C57BL/6J mouse heart by digital gene expression profiling.

    PubMed

    Liu, Ming; Zhu, Jin-Gai; Yu, Zhang-Bin; Song, Gui-Xian; Shen, Ya-Hui; Liu, Yao-Qiu; Zhu, Chun; Qian, Ling-Mei

    2014-06-01

    Accumulating evidence has revealed that the mammalian heart possesses a measurable capacity for renewal. Neonatal mice retain a regenerative capacity over a short time-frame (≤6 days), but this capacity is lost by 7 days of age. In the present study, differential gene expression profiling of mouse cardiac tissue was performed to further elucidate the mechanisms underlying this process. The global gene expression patterns of the neonatal C57BL/6J mouse heart were examined at three key time-points (1, 6 and 7 days old) using digital gene expression analysis. In the distribution of total clean tags, high-expression tags (>100 copies) were found to be predominant, whereas low expression tags (<5 copies) occupied the majority of distinct tag distributions. In total, 306 differentially expressed genes (DEGs) were detected in cardiac tissue, with the expression levels of 115 genes upregulated and those of 191 genes downregulated in 7-day-old mice compared with expression levels in 1- and 6-day-old mice, respectively. The expression levels of five DEGs were confirmed using quantitative polymerase chain reaction. Gene ontology analysis revealed a large proportion of DEGs distributed throughout the cell, and these DEGs were associated with binding as well as catalytic, hydrolase, transferase and molecular transducer activities. Furthermore, these genes were involved in cellular, metabolic and developmental processes, as well as biological regulation and signaling pathways. Pathway analysis identified the oxidative phosphorylation pathway to be the process most significantly putatively affected by the differential expression of these genes. These data provide the basis for future analysis of the gene expression patterns that regulate the molecular mechanism of cardiac regeneration.

  14. Differential expression of genes during aflatoxin B1-induced hepatocarcinogenesis in tree shrews

    PubMed Central

    Li, Yuan; Wan, Da-Fang; Su, Jian-Jia; Cao, Ji; Ou, Chao; Qiu, Xiao-Kun; Ban, Ke-Chen; Yang, Chun; Qin, Liu-Liang; Luo, Dan; Yue, Hui-Fen; Zhang, Li-Sheng; Gu, Jian-Ren

    2004-01-01

    AIM: Through exploring the regulation of gene expression during hepatocarcinogenesis induced by aflatoxin B1 (AFB1), to find out the responsible genes for hepatocellular carcinoma (HCC) and to further understand the underlying molecular mechanism. METHODS: Tree shrews (Tupaia belangeri chinensis) were treated with or without AFB1 for about 90 weeks. Liver biopsies were performed regularly during the animal experiment. Eight shares of total RNA were respectively isolated from 2 HCC tissues, 2 HCC-surrounding non-cancerous liver tissues, 2 biopsied tissues at the early stage (30th week) of the experiment from the same animals as above, 1 mixed sample of three liver tissues biopsied at the beginning (0th week) of the experiment, and another 1 mixed sample of two liver tissues from the untreated control animals biopsied at the 90th week of the experiment. The samples were then tested with the method of AtlasTM cDNA microarray assay. The levels of gene expression in these tissues taken at different time points during hepatocarcinogenesis were compared. RESULTS: The profiles of differently expressed genes were quite different in different ways of comparison. At the same period of hepatocarcinogenesis, the genes in the same function group usually had the same tendency for up- or down-regulation. Among the checked 588 genes that were known to be related to human cancer, 89 genes (15.1%) were recognized as “important genes” because they showed frequent changes in different ways of comparison. The differentially expressed genes during hepatocarcinogenesis could be classified into four categories: genes up-regulated in HCC tissue, genes with similar expressing levels in both HCC and HCC-surrounding liver tissues which were higher than that in the tissues prior to the development of HCC, genes down-regulated in HCC tissue, and genes up-regulated prior to the development of HCC but down-regulated after the development of HCC. CONCLUSION: A considerable number of genes could

  15. DNA Methylation Profiling Reveals Correlation of Differential Methylation Patterns with Gene Expression in Human Epilepsy.

    PubMed

    Wang, Liang; Fu, Xinwei; Peng, Xi; Xiao, Zheng; Li, Zhonggui; Chen, Guojun; Wang, Xuefeng

    2016-05-01

    DNA methylation plays important roles in regulating gene expression and has been reported to be related with epilepsy. This study aimed to define differential DNA methylation patterns in drug-refractory epilepsy patients and to investigate the role of DNA methylation in human epilepsy. We performed DNA methylation profiling in brain tissues from epileptic and control patients via methylated-cytosine DNA immunoprecipitation microarray chip. Differentially methylated loci were validated by bisulfite sequencing PCR, and the messenger RNA (mRNA) levels of candidate genes were evaluated by reverse transcriptase PCR. We found 224 genes that showed differential DNA methylation between epileptic patients and controls. Among the seven candidate genes, three genes (TUBB2B, ATPGD1, and HTR6) showed relative transcriptional regulation by DNA methylation. TUBB2B and ATPGD1 exhibited hypermethylation and decreased mRNA levels, whereas HTR6 displayed hypomethylation and increased mRNA levels in the epileptic samples. Our findings suggest that certain genes become differentially regulated by DNA methylation in human epilepsy.

  16. Xyloglucan endotransglucosylase/hydrolase genes in cucumber (Cucumis sativus) - differential expression during somatic embryogenesis.

    PubMed

    Malinowski, Robert; Filipecki, Marcin; Tagashira, Norikazu; Wiśniewska, Anita; Gaj, Paweł; Plader, Wojciech; Malepszy, Stefan

    2004-04-01

    Defined changes in the cell wall directed by many proteins accompany every morphogenetic process in plants. Xyloglucan endotransglucosylase/hydrolase proteins (XTH; EC 2.4.1.207) have the potential to modify the hemicellulose matrix within the cell wall. Cs-XTH1 and Cs-XTH3 genes, which encode XTH proteins, were found among numerous genes that are differentially expressed after the induction of cucumber somatic embryogenesis. The expression of these genes increased during somatic embryogenesis. The Cs-XTH1 gene was localized on the second chromosome near the centromere region, whereas Cs-XTH3 was found in the middle of the fifth chromosome's longer arm. Northern blot hybridization showed that both genes were preferentially expressed in roots. We also observed higher accumulation of both transcripts in somatic embryos than in the proembryogenic mass. The localization of mRNA by in situ hybridization revealed that the Cs-XTH1 transcripts were largely accumulated in the presumptive cotyledon primordia of somatic embryos. The XTH gene family consists of a number of genes with a high degree of structural similarity. Screening a cucumber genomic library has identified other members of this gene family. The intron/exon structure, sequence similarities and the close chromosomal distance between some members suggest their common evolutionary origin. The involvement of XTH-related genes in somatic embryo formation is discussed.

  17. Differential Expression of the S-Adenosyl-l-Methionine Synthase Genes during Pea Development1

    PubMed Central

    Gómez-Gómez, Lourdes; Carrasco, Pedro

    1998-01-01

    Two genes coding for S-adenosyl-l-methionine synthase (SAMS, EC 2.5.1.6) were previously isolated from pea (Pisum sativum) ovaries. Both SAMS genes were highly homologous throughout their coding regions but showed a certain degree of sequence divergence within the 5′ and the 3′ untranslated regions. These regions have been used as gene-specific probes to analyze the differential expression of SAMS1 and SAMS2 genes in pea plants. The ribonuclease protection assay revealed different expression patterns for each individual gene. SAMS1 was strongly expressed in nearly all tissues, especially in roots. SAMS2 expression was weaker, reaching its highest level at the apex. Following pollination, SAMS1 was specifically up-regulated, whereas SAMS2 was expressed constitutively. The up-regulation of SAMS1 during ovary development was also observed in unpollinated ovaries treated with auxins. In unpollinated ovaries an increase in SAMS1 expression was observed as a consequence of ethylene production associated with the emasculation process. In senescing ovaries both SAMS1 and SAMS2 genes showed increased expression. Ethylene treatment of unpollinated ovaries led to an increase in the SAMS1 mRNA level. However, SAMS2 expression remained unchangeable after ethylene treatment, indicating that SAMS2 induction during ovary senescence was not ethylene dependent. SAMS mRNAs were localized by in situ hybridization at the endocarp of developing fruits and in the ovules of senescing ovaries. Our results indicate that the transcriptional regulation of SAMS genes is developmentally controlled in a specific way for each gene. PMID:9625692

  18. Identification of Differentially Expressed Genes Relevant to Corm Formation in Sagittaria trifolia

    PubMed Central

    Xu, Xiaoyong; Hussain, Javeed; Yin, Jingjing; Zhang, Yi; Li, Liangjun; Chen, Xuehao

    2013-01-01

    Sagittaria trifolia is a good model of wetland plants to elucidate the formation of corm. However, few studies have been conducted to uncover the complexity of gene expression involved in corm formation. In this study, high-throughput tag-sequencing based on Solexa Genome Analyzer Platform was applied to monitor the changes in gene expression with three libraries of differentially expressed genes (DEGs) (C1 library: stolon stage, C2 library: initial swelling stage and C3 library: swelling stage) during corm formation in Sagittaria trifolia. Approximately 6.0 million tags were sequenced, and 5854021, 5983454, and 5761079 clean tags including 138319, 116804, and 101739 distinct tags were obtained after removal of low quality tags from each library, respectively. About 46% distinct tags were unambiguous tags mapping to the reference genes, and 33% were unambiguous tag-mapped genes. Totally, 20575, 19807, and 18438 were annotated in C1, C2, and C3 libraries, respectively, after mapping their functions in existing databases. In addition, we found that profiling of gene expression in C1/C2 and C2/C3 libraries were different among most of the selected 20 DEGs. Most DEGs in C1/C2 libraries were relevant to hormone synthesis and response; energy metabolism and stress response, while most of the genes in C2/C3 libraries were involved in carbohydrate metabolism. All up-regulated transcriptional factors and 16 important genes relevant to corm formation in three libraries were also identified. To further analyze the expression of 9 genes, from the results of tag-sequencing, qRT-PCR was applied. In summary, this study provides a comprehensive understanding of gene expression, during the formation of corm in Sagittaria trifolia. PMID:23359383

  19. Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)

    PubMed Central

    Cao, Heping; Zhang, Lin; Tan, Xiaofeng; Long, Hongxu; Shockey, Jay M.

    2014-01-01

    Triacylglycerols (TAG) are the major molecules of energy storage in eukaryotes. TAG are packed in subcellular structures called oil bodies or lipid droplets. Oleosins (OLE) are the major proteins in plant oil bodies. Multiple isoforms of OLE are present in plants such as tung tree (Vernicia fordii), whose seeds are rich in novel TAG with a wide range of industrial applications. The objectives of this study were to identify OLE genes, classify OLE proteins and analyze OLE gene expression in tung trees. We identified five tung tree OLE genes coding for small hydrophobic proteins. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that the five tung OLE genes represented the five OLE subfamilies and all contained the “proline knot” motif (PX5SPX3P) shared among 65 OLE from 19 tree species, including the sequenced genomes of Prunus persica (peach), Populus trichocarpa (poplar), Ricinus communis (castor bean), Theobroma cacao (cacao) and Vitis vinifera (grapevine). Tung OLE1, OLE2 and OLE3 belong to the S type and OLE4 and OLE5 belong to the SM type of Arabidopsis OLE. TaqMan and SYBR Green qPCR methods were used to study the differential expression of OLE genes in tung tree tissues. Expression results demonstrated that 1) All five OLE genes were expressed in developing tung seeds, leaves and flowers; 2) OLE mRNA levels were much higher in seeds than leaves or flowers; 3) OLE1, OLE2 and OLE3 genes were expressed in tung seeds at much higher levels than OLE4 and OLE5 genes; 4) OLE mRNA levels rapidly increased during seed development; and 5) OLE gene expression was well-coordinated with tung oil accumulation in the seeds. These results suggest that tung OLE genes 1–3 probably play major roles in tung oil accumulation and/or oil body development. Therefore, they might be preferred targets for tung oil engineering in transgenic plants. PMID:24516650

  20. Differential Gene Expression Profiling of Enriched Human Spermatogonia after Short- and Long-Term Culture

    PubMed Central

    Conrad, Sabine; Azizi, Hossein; Hatami, Maryam; Kubista, Mikael; Bonin, Michael; Hennenlotter, Jörg; Renninger, Markus; Skutella, Thomas

    2014-01-01

    This study aimed to provide a molecular signature for enriched adult human stem/progenitor spermatogonia during short-term (<2 weeks) and long-term culture (up to more than 14 months) in comparison to human testicular fibroblasts and human embryonic stem cells. Human spermatogonia were isolated by CD49f magnetic activated cell sorting and collagen−/laminin+ matrix binding from primary testis cultures obtained from ten adult men. For transcriptomic analysis, single spermatogonia-like cells were collected based on their morphology and dimensions using a micromanipulation system from the enriched germ cell cultures. Immunocytochemical, RT-PCR and microarray analyses revealed that the analyzed populations of cells were distinct at the molecular level. The germ- and pluripotency-associated genes and genes of differentiation/spermatogenesis pathway were highly expressed in enriched short-term cultured spermatogonia. After long-term culture, a proportion of cells retained and aggravated the “spermatogonial” gene expression profile with the expression of germ and pluripotency-associated genes, while in the majority of long-term cultured cells this molecular profile, typical for the differentiation pathway, was reduced and more genes related to the extracellular matrix production and attachment were expressed. The approach we provide here to study the molecular status of in vitro cultured spermatogonia may be important to optimize the culture conditions and to evaluate the germ cell plasticity in the future. PMID:24738045

  1. A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion

    PubMed Central

    Murata, Makoto; Warren, Edus H.; Riddell, Stanley R.

    2003-01-01

    Minor histocompatibility antigens (minor H antigens) are targets of graft-versus-host disease and graft-versus-leukemia responses after allogeneic human leukocyte antigen identical hematopoietic stem cell transplantation. Only a few human minor H antigens have been molecularly characterized and in all cases, amino acid differences between homologous donor and recipient proteins due to nucleotide polymorphisms in the respective genes were responsible for immunogenicity. Here, we have used cDNA expression cloning to identify a novel human minor H antigen encoded by UGT2B17, an autosomal gene in the multigene UDP-glycosyltransferase 2 family that is selectively expressed in liver, intestine, and antigen-presenting cells. In contrast to previously defined human minor H antigens, UGT2B17 is immunogenic because of differential expression of the protein in donor and recipient cells as a consequence of a homozygous gene deletion in the donor. Deletion of individual members of large gene families is a common form of genetic variation in the population and our results provide the first evidence that differential protein expression as a consequence of gene deletion is a mechanism for generating minor H antigens in humans. PMID:12743171

  2. Identification of differentially expressed genes in Mongolian sheep ovaries by suppression subtractive hybridization.

    PubMed

    He, Xiaolong; Li, Bei; Wang, Feng; Tian, Chunying; Rong, Weiheng; Liu, Yongbin

    2012-07-01

    Fecundity is an important trait in sheep. Because it is directly related to production costs and efficiency, it has great economic impact in sheep husbandry. Because Mongolian sheep are a longstanding, indigenous breed, they are genetically related to most other breeds of sheep in China. The study of genes related to reproductive traits is essential to improving the fecundity of Mongolian sheep. In the present study, suppression subtractive hybridization (SSH) was performed using forward and reverse nested primers on cDNA libraries from ovarian tissue of single-bearing (S) and biparous (B) Mongolian sheep (MS). This yielded 768 clones. The length of the inserted fragments ranged from 150 to 1000 bp. From these, dot blot hybridization followed by sequencing and homology blast search in GenBank resolved 373 differentially expressed clones, representing 185 gene sequences (homology >85% and length >200 bp), 10 expressed sequence tags (ESTs; homology >95% and length >100 bp), and 4 unknown ESTs. The analysis of the differentially expressed gene functions allowed these genes to be categorized into seven groups: cell/body or immune defense, metabolism, transportation, nucleic acid modification, cell development, signal transduction, and cell structure. Four differentially expressed genes, a disintegrin and metalloproteinase with thrombospondin motifs 1 (ADAMTS1), inhibitor of DNA binding 3 (ID3), bone morphogenetic protein 6 (BMP6), and integrin beta 1 (ITGB1), were randomly selected and verified using relative quantitative real-time polymerase chain reaction (RQ-PCR). The expression of these genes in BMS ovaries was 30.06, 11.55, 0.82, and 1.12-fold that of SMS ovaries, respectively.

  3. Differential gene expression during the moult cycle of Antarctic krill (Euphausia superba).

    PubMed

    Seear, Paul J; Tarling, Geraint A; Burns, Gavin; Goodall-Copestake, William P; Gaten, Edward; Ozkaya, Ozge; Rosato, Ezio

    2010-10-19

    All crustaceans periodically moult to renew their exoskeleton. In krill this involves partial digestion and resorption of the old exoskeleton and synthesis of new cuticle. Molecular events that underlie the moult cycle are poorly understood in calcifying crustaceans and even less so in non-calcifying organisms such as krill. To address this we constructed an Antarctic krill cDNA microarray in order to generate gene expression profiles across the moult cycle and identify possible activation pathways. A total of 26 different cuticle genes were identified that showed differential gene expression across the moult cycle. Almost all cuticle genes were up regulated during premoult and down regulated during late intermoult. There were a number of transcripts with significant sequence homology to genes potentially involved in the synthesis, breakdown and resorption of chitin. During early premoult glutamine synthetase, a gene involved in generating an amino acid used in the synthesis of glucosamine, a constituent of chitin, was up regulated more than twofold. Mannosyltransferase 1, a member of the glycosyltransferase family of enzymes that includes chitin synthase was also up regulated during early premoult. Transcripts homologous to a β-N-acetylglucosaminidase (β-NAGase) precursor were expressed at a higher level during late intermoult (prior to apolysis) than during premoult. This observation coincided with the up regulation during late intermoult, of a coatomer subunit epsilon involved in the production of vesicles that maybe used to transport the β-NAGase precursors into the exuvial cleft. Trypsin, known to activate the β-NAGase precursor, was up regulated more than fourfold during premoult. The up regulation of a predicted oligopeptide transporter during premoult may allow the transport of chitin breakdown products across the newly synthesised epi- and exocuticle layers. We have identified many genes differentially expressed across the moult cycle of krill that

  4. Identification of differentially expressed genes in the livers of chronically i-As-treated hamsters.

    PubMed

    Hernández, Alba; Sampayo-Reyes, Adriana; Marcos, Ricard

    2011-08-01

    Inorganic arsenic (i-As) is a human carcinogen causing skin, lung, urinary bladder, liver and kidney tumors. Chronic exposure to this naturally occurring contaminant, mainly via drinking water, is a significant worldwide environmental health concern. To explore the molecular mechanisms of arsenic hepatic injury, a differential display polymerase chain reaction (DD-PCR) screening was undertaken to identify genes with distinct expression patterns between the liver of low i-As-exposed and control animals. Golden Syrian hamsters (5-6 weeks of age) received drinking water containing 15 mg i-As/L as sodium arsenite, or unaltered water for 18 weeks. The in vivo MN test was carried out, and the frequency of micronucleated reticulocytes (MN-RETs) was scored as a measure of exposure and As-related genotoxic/carcinogenic risk. A total of 68 differentially expressed bands were identified in our initial screen, 41 of which could be assigned to specific genes. Differential level of expression of a selected number of genes was verified using real-time RT-PCR with gene-specific primers. Arsenic-altered gene expression included genes related to stress response, cellular metabolism, cell cycle regulation, telomere maintenance, cell-cell communication and signal transduction. Significant differences of MN-RET were found between treated (8.70 ± 0.02 MN/1000RETs) and control (2.5 ± 0.70 MN/1000RETs) groups (P<0.001), demonstrating both the exposure and the i-As genotoxic/carcinogenic risk. Overall, this paper reveals some possible networks involved in hepatic arsenic-related genotoxicity, carcinogenesis and diabetogenesis. Additional studies to explore further the potential implications of each candidate gene are of especial interest. The present work opens the door to new prospects for the study of i-As mechanisms taking place in the liver under chronic settings.

  5. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  6. Transcriptomic profiling of gene expression and RNA processing during Leishmania major differentiation

    PubMed Central

    Dillon, Laura A. L.; Okrah, Kwame; Hughitt, V. Keith; Suresh, Rahul; Li, Yuan; Fernandes, Maria Cecilia; Belew, A. Trey; Corrada Bravo, Hector; Mosser, David M.; El-Sayed, Najib M.

    2015-01-01

    Protozoan parasites of the genus Leishmania are the etiological agents of leishmaniasis, a group of diseases with a worldwide incidence of 0.9–1.6 million cases per year. We used RNA-seq to conduct a high-resolution transcriptomic analysis of the global changes in gene expression and RNA processing events that occur as L. major transforms from non-infective procyclic promastigotes to infective metacyclic promastigotes. Careful statistical analysis across multiple biological replicates and the removal of batch effects provided a high quality framework for comprehensively analyzing differential gene expression and transcriptome remodeling in this pathogen as it acquires its infectivity. We also identified precise 5′ and 3′ UTR boundaries for a majority of Leishmania genes and detected widespread alternative trans-splicing and polyadenylation. An investigation of possible correlations between stage-specific preferential trans-splicing or polyadenylation sites and differentially expressed genes revealed a lack of systematic association, establishing that differences in expression levels cannot be attributed to stage-regulated alternative RNA processing. Our findings build on and improve existing expression datasets and provide a substantially more detailed view of L. major biology that will inform the field and potentially provide a stronger basis for drug discovery and vaccine development efforts. PMID:26150419

  7. Differential gene expression of CYP3A isoforms in equine liver and intestines.

    PubMed

    Tydén, E; Löfgren, M; Pegolo, S; Capolongo, F; Tjälve, H; Larsson, P

    2012-12-01

    Recently, seven CYP3A isoforms - CYP3A89, CYP3A93, CYP3A94, CYP3A95, CYP3A96, CYP3A97 and CYP129 - have been isolated from the horse genome. In this study, we have examined the hepatic and intestinal gene expression of these CYP3A isoforms using TaqMan probes. We have also studied the enzyme activity using luciferin-isopropyl acetal (LIPA) as a substrate. The results show a differential gene expression of the CYP3A isoforms in the liver and intestines in horses. In the liver, CYP3A89, CYP3A94, CYP3A96 and CYP3A97 were highly expressed, while in the intestine there were only two dominating isoforms, CYP3A93 and CYP3A96. The isoform CYP3A129 was not detected in the liver or the intestine, although this gene consists of a complete set of exons and should therefore code for a functional protein. It is possible that this gene is expressed in tissues other than the liver and intestines. In the intestine, both CYP3A96 and CYP3A93 showed the highest gene expression in the duodenum and the proximal parts of the jejunum. This correlated with a high protein expression in these tissues. Studies of the enzyme activity showed the same K(m) for the LIPA substrate in the liver and the intestine, while the maximum velocity (V(max)) in the liver was higher than in the intestine. Our finding of a differential gene expression of the CYP3A isoforms in the liver and the intestines contributes to a better understanding of drug metabolism in horses. © 2012 Blackwell Publishing Ltd.

  8. Differential gene expression in fully-grown oocytes between gynogenetic and gonochoristic crucian carps.

    PubMed

    Xie, J; Wen, J J; Chen, B; Gui, J F

    2001-06-13

    Silver crucian carp (Carassius auratus gibelio) is a unique triploid bisexual species that can reproduce by gynogenesis. As all other gynogenetic animals, it keeps its chromosome integrity by inhibiting the first meiosis division (no extrusion of the first pole body). To understand the molecular events governing this reproduction mode, suppression subtractive hybridization was used to identify the genes differentially expressed in fully-grown oocytes of the gynogenetic and gonochoristic crucian carp (gyno-carp and gono-carp). From two specific subtractive cDNA libraries, the clones screened out by dot blots and virtual Northern blots were chosen to clone full-length cDNA by RACE. Four differentially expressed genes were obtained. Two are novel genes and are expressed specifically in the oocytes. The gyno-carp stores much more mRNA of cyclin A2, a new member of the fish A-type cyclin gene, in its fully-grown oocyte than in the gono-carp. The last gene is histone H2A. The histone H2As of these two closely related crucian carps are quite different in the C-terminus. Preliminary characterization of the four genes has been analyzed by nucleotide and deduced amino acid sequence and Northern analysis.

  9. RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation

    PubMed Central

    Kuvardina, Olga N.; Herglotz, Julia; Kolodziej, Stephan; Kohrs, Nicole; Herkt, Stefanie; Wojcik, Bartosch; Oellerich, Thomas; Corso, Jasmin; Behrens, Kira; Kumar, Ashok; Hussong, Helge; Urlaub, Henning; Koch, Joachim; Serve, Hubert; Bonig, Halvard; Stocking, Carol; Rieger, Michael A.

    2015-01-01

    The activity of antagonizing transcription factors represents a mechanistic paradigm of bidirectional lineage–fate control during hematopoiesis. At the megakaryocytic/erythroid bifurcation, the crossantagonism of krueppel-like factor 1 (KLF1) and friend leukemia integration 1 (FLI1) has such a decisive role. However, how this antagonism is resolved during lineage specification is poorly understood. We found that runt-related transcription factor 1 (RUNX1) inhibits erythroid differentiation of murine megakaryocytic/erythroid progenitors and primary human CD34+ progenitor cells. We show that RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation by epigenetic repression of the erythroid master regulator KLF1. RUNX1 binding to the KLF1 locus is increased during megakaryocytic differentiation and counterbalances the activating role of T-cell acute lymphocytic leukemia 1 (TAL1). We found that corepressor recruitment by RUNX1 contributes to a block of the KLF1-dependent erythroid gene expression program. Our data indicate that the repressive function of RUNX1 influences the balance between erythroid and megakaryocytic differentiation by shifting the balance between KLF1 and FLI1 in the direction of FLI1. Taken together, we show that RUNX1 is a key player within a network of transcription factors that represses the erythroid gene expression program. PMID:25911237

  10. Differential Gene Expression in Foxtail Millet during Incompatible Interaction with Uromyces setariae-italicae

    PubMed Central

    Dong, Li; Bai, Hui; Quan, Jian Zhang; Liu, Lei; Dong, Zhi-Ping

    2015-01-01

    Foxtail millet (Setaria italica) is an important food and fodder grain crop that is grown for human consumption. Production of this species is affected by several plant diseases, such as rust. The cultivar Shilixiang has been identified as resistant to the foxtail millet rust pathogen, Uromyces setariae-italicae. In order to identify signaling pathways and genes related to the plant’s defense mechanisms against rust, the Shilixiang cultivar was used to construct a digital gene expression (DGE) library during the interaction of foxtail millet with U. setariae-italicae. In this study, we determined the most abundant differentially expressed signaling pathways of up-regulated genes in foxtail millet and identified significantly up-regulated genes. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to analyze the expression of nine selected genes, and the patterns observed agreed well with DGE analysis. Expression levels of the genes were also compared between a resistant cultivar Shilixiang and a susceptible cultivar Yugu-1, and the result indicated that expression level of Shilixiang is higher than that of Yugu-1. This study reveals the relatively comprehensive mechanisms of rust-responsive transcription in foxtail millet. PMID:25885767

  11. Differential gene expression in seasonal sympatry: mechanisms involved in diverging life histories

    PubMed Central

    Peterson, Mark P.; Greives, Timothy J.; Atwell, Jonathan W.; Bridge, Eli S.; Ketterson, Ellen D.

    2016-01-01

    In an era of climate change, understanding the genetic and physiological mechanisms underlying flexibility in phenology and life history has gained greater importance. These mechanisms can be elucidated by comparing closely related populations that differ in key behavioural and physiological traits such as migration and timing of reproduction. We compared gene expression in two recently diverged dark-eyed Junco ( Junco hyemalis) subspecies that live in seasonal sympatry during winter and early spring, but that differ in behaviour and physiology, despite exposure to identical environmental cues. We identified 547 genes differentially expressed in blood and pectoral muscle. Genes involved in lipid transport and metabolism were highly expressed in migrant juncos, while genes involved in reproductive processes were highly expressed in resident breeders. Seasonal differences in gene expression in closely related populations residing in the same environment provide significant insights into mechanisms underlying variation in phenology and life history, and have potential implications for the role of seasonal timing differences in gene flow and reproductive isolation. PMID:26979563

  12. Differential gene expression in seasonal sympatry: mechanisms involved in diverging life histories.

    PubMed

    Fudickar, Adam M; Peterson, Mark P; Greives, Timothy J; Atwell, Jonathan W; Bridge, Eli S; Ketterson, Ellen D

    2016-03-01

    In an era of climate change, understanding the genetic and physiological mechanisms underlying flexibility in phenology and life history has gained greater importance. These mechanisms can be elucidated by comparing closely related populations that differ in key behavioural and physiological traits such as migration and timing of reproduction. We compared gene expression in two recently diverged dark-eyed Junco ( Junco hyemalis) subspecies that live in seasonal sympatry during winter and early spring, but that differ in behaviour and physiology, despite exposure to identical environmental cues. We identified 547 genes differentially expressed in blood and pectoral muscle. Genes involved in lipid transport and metabolism were highly expressed in migrant juncos, while genes involved in reproductive processes were highly expressed in resident breeders. Seasonal differences in gene expression in closely related populations residing in the same environment provide significant insights into mechanisms underlying variation in phenology and life history, and have potential implications for the role of seasonal timing differences in gene flow and reproductive isolation. © 2016 The Author(s).

  13. Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

    PubMed

    Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

    2013-08-01

    Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

  14. Scotin: A new p63 target gene expressed during epidermal differentiation

    SciTech Connect

    Zocchi, Loredana; Codispoti, Andrea; Lane, David P.; Melino, Gerry Terrinoni, Alessandro

    2008-03-07

    p63, a member of the p53 family, is transcribed from two different promoters giving rise to two different proteins: TAp63 that contains the N-terminal transactivation domain and {delta}N that lacks this domain. In this article we describe a new target gene Scotin induced by TAp63 during epithelial differentiation. This gene was previously isolated as a p53-inducible proapoptotic gene and the protein is located in the endoplasmic reticulum and in the nuclear membrane. Scotin expression is induced in response to endoplasmic reticulum (ER) stress in a p53 dependent or independent manner. We detected Scotin upregulation in primary keratinocyte cell lines committed to differentiate. In this paper we also show that Scotin is expressed in the supra basal layer of the epidermis in parallel with TAp63, but not {delta}Np63 expression. We conclude that Scotin is a new p63 target gene induced during epithelial differentiation, a complex process that also involves ER stress induction.

  15. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  16. PROX1 gene is differentially expressed in oral cancer and reduces cellular proliferation.

    PubMed

    Rodrigues, Maria F S D; de Oliveira Rodini, Camila; de Aquino Xavier, Flávia C; Paiva, Katiúcia B; Severino, Patrícia; Moyses, Raquel A; López, Rossana M; DeCicco, Rafael; Rocha, Lília A; Carvalho, Marcos B; Tajara, Eloiza H; Nunes, Fabio D

    2014-12-01

    Homeobox genes are a family of transcription factors that play a pivotal role in embryogenesis. Prospero homeobox 1 (PROX1) has been shown to function as a tumor suppressor gene or oncogene in various types of cancer, including oral squamous cell carcinoma (OSCC). We have previously identified PROX1 as a downregulated gene in OSCC. The aim of this study is to clarify the underlying mechanism by which PROX1 regulates tumorigenicity of OSCC cells. PROX1 mRNA and protein expression levels were first investigated in 40 samples of OSCC and in nontumor margins. Methylation and amplification analysis was also performed to assess the epigenetic and genetic mechanisms involved in controlling PROX1 expression. OSCC cell line SCC9 was also transfected to stably express the PROX1 gene. Next, SCC9-PROX1-overexpressing cells and controls were subjected to proliferation, differentiation, apoptosis, migration, and invasion assays in vitro. OSCC samples showed reduced PROX1 expression levels compared with nontumor margins. PROX1 amplification was associated with better overall survival. PROX1 overexpression reduces cell proliferation and downregulates cyclin D1. PROX1-overexpressing cells also exhibited reduced CK18 and CK19 expression and transcriptionally altered the expression of WISP3, GATA3, NOTCH1, and E2F1. Our results suggest that PROX1 functions as a tumor suppressor gene in oral carcinogenesis.

  17. Effect of method of deduplication on estimation of differential gene expression using RNA-seq

    PubMed Central

    Chesnokov, Mikhail S.; Lazarevich, Natalia L.; Penin, Aleksey A.

    2017-01-01

    Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC) and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI). We also analyzed the influence of sequencing layout (single read or paired end) and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout. PMID:28321364

  18. PROX1 Gene is Differentially Expressed in Oral Cancer and Reduces Cellular Proliferation

    PubMed Central

    Rodrigues, Maria F.S.D.; de Oliveira Rodini, Camila; de Aquino Xavier, Flávia C.; Paiva, Katiúcia B.; Severino, Patrícia; Moyses, Raquel A.; López, Rossana M.; DeCicco, Rafael; Rocha, Lília A.; Carvalho, Marcos B.; Tajara, Eloiza H.; Nunes, Fabio D.

    2014-01-01

    Abstract Homeobox genes are a family of transcription factors that play a pivotal role in embryogenesis. Prospero homeobox 1 (PROX1) has been shown to function as a tumor suppressor gene or oncogene in various types of cancer, including oral squamous cell carcinoma (OSCC). We have previously identified PROX1 as a downregulated gene in OSCC. The aim of this study is to clarify the underlying mechanism by which PROX1 regulates tumorigenicity of OSCC cells. PROX1 mRNA and protein expression levels were first investigated in 40 samples of OSCC and in nontumor margins. Methylation and amplification analysis was also performed to assess the epigenetic and genetic mechanisms involved in controlling PROX1 expression. OSCC cell line SCC9 was also transfected to stably express the PROX1 gene. Next, SCC9-PROX1-overexpressing cells and controls were subjected to proliferation, differentiation, apoptosis, migration, and invasion assays in vitro. OSCC samples showed reduced PROX1 expression levels compared with nontumor margins. PROX1 amplification was associated with better overall survival. PROX1 overexpression reduces cell proliferation and downregulates cyclin D1. PROX1-overexpressing cells also exhibited reduced CK18 and CK19 expression and transcriptionally altered the expression of WISP3, GATA3, NOTCH1, and E2F1. Our results suggest that PROX1 functions as a tumor suppressor gene in oral carcinogenesis. PMID:25526434

  19. RNA sequencing reveals differentially expressed genes as potential diagnostic and prognostic indicators of gallbladder carcinoma

    PubMed Central

    Jiang, Mingming; Fang, Meng; Ji, Jun; Wang, Aihua; Wang, Mengmeng; Jiang, Xiaoqing; Gao, Chunfang

    2015-01-01

    Gallbladder carcinoma (GBC) is a rare tumor with a dismal survival rate overall. Hence, there is an urgent need for exploring more specific and sensitive biomarkers for the diagnosis and treatment of GBC. At first, amplified total RNAs from two paired GBC tumors and adjacent non-tumorous tissues (ANTTs) were subjected to RNA sequencing. 161 genes were identified differentially expressed between tumors and ANTTs. Functional enrichment analysis indicated that the up-regulated genes in tumor were primarily associated with signaling molecules and enzyme modulators, and mainly involved in cell cycles and pathways in cancer. Twelve differentially expressed genes (DEGs) were further confirmed in another independent cohort of 35 GBC patients. Expression levels of BIRC5, TK1, TNNT1 and MMP9 were found to be positively related to postoperative relapse. There was also a significant correlation between BIRC5 expression and tumor-node-metastasis (TNM) stage. Besides, we observed a positive correlation between serum CA19–9 concentration and the expression levels of TNNT1, MMP9 and CLIC3. Survival analysis revealed that GBC patients with high TK1 and MMP9 expression levels had worse prognosis. These identified DEGs might not only be promising biomarkers for GBC diagnosis and prognosis, but also expedite the discovery of novel therapeutic strategies. PMID:25970782

  20. Gene expression profile induced by BCNU in human glioma cell lines with differential MGMT expression.

    PubMed

    Bandres, Eva; Andion, Esther; Escalada, Alvaro; Honorato, Beatriz; Catalan, Victoria; Cubedo, Elena; Cordeu, Lucia; Garcia, Fermin; Zarate, Ruth; Zabalegui, Natalia; Garcia-Foncillas, Jesus

    2005-07-01

    Chemotherapy with the alkylating agent BCNU (1,3-bis (2-chloroethyl)-1-nitrosourea) is the most commonly used chemotherapeutic agent for gliomas. However, the usefulness of this agent is limited because tumor cell resistance to BCNU is frequently found in clinical brain tumor therapy. The O6-methylguanine-DNA methyltransferase protein (MGMT) reverses alkylation at the O6 position of guanine and we have reported the role of MGMT in the response of brain tumors to alkylating agents. However, the different mechanisms underlying the patterns related to MGMT remain unclear. To better understand the molecular mechanism by which BCNU exerts its effect in glioma cell lines according MGMT expression, we used microarray technology to interrogate 3800 known genes and determine the gene expression profiles altered by BCNU treatment. Our results showed that treatment with BCNU alters the expression of a diverse group of genes in a time-dependent manner. A subset of gene changes was found common in both glioma cell lines and other subset is specific of each cell line. After 24 h of BCNU treatment, up-regulation of transcription factors involved in the nucleation of both RNA polymerase II and III transcription initiation complexes was reported. Interestingly, BCNU promoted the expression of actin-dependent regulators of chromatin. Similar effects were found with higher BCNU doses in MGMT+ cell line showing a similar mechanism that in MGMT-deficient cell with standard doses. Our data suggest that human glioma cell lines treated with BCNU, independently of MGMT expression, show changes in the expression of cell cycle and survival-related genes interfering the transcription mechanisms and the chromatin regulation.

  1. Induction of a program gene expression during osteoblast differentiation with strontium ranelate

    SciTech Connect

    Zhu Lingling; Zaidi, Samir; Peng Yuanzhen; Zhou Hang; Moonga, Baljit S.; Blesius, Alexia; Dupin-Roger, Isabelle; Zaidi, Mone . E-mail: mone.zaidi@mssm.edu; Sun Li

    2007-04-06

    Strontium ranelate, a new agent for the treatment of osteoporosis, has been shown stimulate bone formation in various experimental models. This study examines the effect of strontium ranelate on gene expression in osteoblasts, as well as the formation of mineralized (von Kossa-positive) colony-forming unit-osteoblasts (CFU-obs). Bone marrow-derived stromal cells cultured for 21 days under differentiating conditions, when exposed to strontium ranelate, displayed a significant time- and concentration-dependent increase in the expression of the master gene, Runx2, as well as bone sialoprotein (BSP), but interestingly without effects on osteocalcin. This was associated with a significant increase in the formation of CFU-obs at day 21 of culture. In U-33 pre-osteoblastic cells, strontium ranelate significantly enhanced the expression of Runx2 and osteocalcin, but not BSP. Late, more mature osteoblastic OB-6 cells showed significant elevations in BSP and osteocalcin, but with only minimal effects on Runx2. In conclusion, strontium ranelate stimulates osteoblast differentiation, but the induction of the program of gene expression appears to be cell type-specific. The increased osteoblastic differentiation is the likely basis underlying the therapeutic bone-forming actions of strontium ranelate.

  2. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.

    PubMed

    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H

    2001-06-01

    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  3. Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum

    PubMed Central

    2011-01-01

    Background Both Gossypium hirsutum and G. barbadense probably originated from a common ancestor, but they have very different agronomic and fiber quality characters. Here we selected 17 fiber development-related genes to study their structures, tree topologies, chromosomal location and expression patterns to better understand the interspecific divergence of fiber development genes in the two cultivated tetraploid species. Results The sequence and structure of 70.59% genes were conserved with the same exon length and numbers in different species, while 29.41% genes showed diversity. There were 15 genes showing independent evolution between the A- and D-subgenomes after polyploid formation, while two evolved via different degrees of colonization. Chromosomal location showed that 22 duplicate genes were located in which at least one fiber quality QTL was detected. The molecular evolutionary rates suggested that the D-subgenome of the allotetraploid underwent rapid evolutionary differentiation, and selection had acted at the tetraploid level. Expression profiles at fiber initiation and early elongation showed that the transcripts levels of most genes were higher in Hai7124 than in TM-1. During the primary-secondary transition period, expression of most genes peaked earlier in TM-1 than in Hai7124. Homeolog expression profile showed that A-subgenome, or the combination of A- and D-subgenomes, played critical roles in fiber quality divergence of G. hirsutum and G. barbadense. However, the expression of D-subgenome alone also played an important role. Conclusion Integrating analysis of the structure and expression to fiber development genes, suggests selective breeding for certain desirable fiber qualities played an important role in divergence of G. hirsutum and G. barbadense. PMID:21349199

  4. Differential Expression of Genes Involved in Host Recognition, Attachment, and Degradation in the Mycoparasite Tolypocladium ophioglossoides

    PubMed Central

    Quandt, C. Alisha; Di, Yanming; Elser, Justin; Jaiswal, Pankaj; Spatafora, Joseph W.

    2016-01-01

    The ability of a fungus to infect novel hosts is dependent on changes in gene content, expression, or regulation. Examining gene expression under simulated host conditions can explore which genes may contribute to host jumping. Insect pathogenesis is the inferred ancestral character state for species of Tolypocladium, however several species are parasites of truffles, including Tolypocladium ophioglossoides. To identify potentially crucial genes in this interkingdom host switch, T. ophioglossoides was grown on four media conditions: media containing the inner and outer portions of its natural host (truffles of Elaphomyces), cuticles from an ancestral host (beetle), and a rich medium (Yeast Malt). Through high-throughput RNASeq of mRNA from these conditions, many differentially expressed genes were identified in the experiment. These included PTH11-related G-protein-coupled receptors (GPCRs) hypothesized to be involved in host recognition, and also found to be upregulated in insect pathogens. A divergent chitinase with a signal peptide was also found to be highly upregulated on media containing truffle tissue, suggesting an exogenous degradative activity in the presence of the truffle host. The adhesin gene, Mad1, was highly expressed on truffle media as well. A BiNGO analysis of overrepresented GO terms from genes expressed during each growth condition found that genes involved in redox reactions and transmembrane transport were the most overrepresented during T. ophioglossoides growth on truffle media, suggesting their importance in growth on fungal tissue as compared to other hosts and environments. Genes involved in secondary metabolism were most highly expressed during growth on insect tissue, suggesting that their products may not be necessary during parasitism of Elaphomyces. This study provides clues into understanding genetic mechanisms underlying the transition from insect to truffle parasitism. PMID:26801645

  5. Clustering gene expression data based on predicted differential effects of GV interaction.

    PubMed

    Pan, Hai-Yan; Zhu, Jun; Han, Dan-Fu

    2005-02-01

    Microarray has become a popular biotechnology in biological and medical research. However, systematic and stochastic variabilities in microarray data are expected and unavoidable, resulting in the problem that the raw measurements have inherent "noise" within microarray experiments. Currently, logarithmic ratios are usually analyzed by various clustering methods directly, which may introduce bias interpretation in identifying groups of genes or samples. In this paper, a statistical method based on mixed model approaches was proposed for microarray data cluster analysis. The underlying rationale of this method is to partition the observed total gene expression level into various variations caused by different factors using an ANOVA model, and to predict the differential effects of GV (gene by variety) interaction using the adjusted unbiased prediction (AUP) method. The predicted GV interaction effects can then be used as the inputs of cluster analysis. We illustrated the application of our method with a gene expression dataset and elucidated the utility of our approach using an external validation.

  6. The characteristic direction: a geometrical approach to identify differentially expressed genes.

    PubMed

    Clark, Neil R; Hu, Kevin S; Feldmann, Axel S; Kou, Yan; Chen, Edward Y; Duan, Qiaonan; Ma'ayan, Avi

    2014-03-21

    Identifying differentially expressed genes (DEG) is a fundamental step in studies that perform genome wide expression profiling. Typically, DEG are identified by univariate approaches such as Significance Analysis of Microarrays (SAM) or Linear Models for Microarray Data (LIMMA) for processing cDNA microarrays, and differential gene expression analysis based on the negative binomial distribution (DESeq) or Empirical analysis of Digital Gene Expression data in R (edgeR) for RNA-seq profiling. Here we present a new geometrical multivariate approach to identify DEG called the Characteristic Direction. We demonstrate that the Characteristic Direction method is significantly more sensitive than existing methods for identifying DEG in the context of transcription factor (TF) and drug perturbation responses over a large number of microarray experiments. We also benchmarked the Characteristic Direction method using synthetic data, as well as RNA-Seq data. A large collection of microarray expression data from TF perturbations (73 experiments) and drug perturbations (130 experiments) extracted from the Gene Expression Omnibus (GEO), as well as an RNA-Seq study that profiled genome-wide gene expression and STAT3 DNA binding in two subtypes of diffuse large B-cell Lymphoma, were used for benchmarking the method using real data. ChIP-Seq data identifying DNA binding sites of the perturbed TFs, as well as known drug targets of the perturbing drugs, were used as prior knowledge silver-standard for validation. In all cases the Characteristic Direction DEG calling method outperformed other methods. We find that when drugs are applied to cells in various contexts, the proteins that interact with the drug-targets are differentially expressed and more of the corresponding genes are discovered by the Characteristic Direction method. In addition, we show that the Characteristic Direction conceptualization can be used to perform improved gene set enrichment analyses when compared with

  7. Comparative analysis of differentially expressed genes in Sika deer antler at different stages.

    PubMed

    Zhao, Yu; Yao, Baojin; Zhang, Mei; Wang, Siming; Zhang, Hui; Xiao, Wei

    2013-02-01

    Deer antlers serve as useful models of rapid growth and mineralization in mammals. During the period of rapid growth, the antlers of many species of deer will elongate by more than 2 cm per day, after which the antlers gradually ossify. However, little is known about the genes that are involved in their development, particularly the molecular mechanisms responsible for rapid growth and ossification. In our previous studies, we have reported on the transcriptome analysis of deer antlers at rapid growth and ossification stages. With the aim to get a comprehensive understanding of gene expression patterns during antler growth, in the present study, we performed a rigorous algorithm to identify differentially expressed genes between two different stages (60 and 90 days) during antler growth. A total of 16,905 significantly changed transcripts were identified. Those sequences were mapped to 5,573 genes with 2,217 genes up-regulated and 3,356 genes down-regulated (60 days vs. 90 days), including ribosomal proteins, translation initiation and elongation factors, transcription factors, signaling molecules and extracellular matrix proteins. We also performed the gene ontology (GO) functional enrichment and pathway enrichment analysis of gene expression patterns with hypergeometric test and Bonferroni Correction. Both the two stages were enriched with members of GO categories and distinct pathways. Our data represent the most comprehensive sequence resource available for the deer antler and provide a basis for further research on deer antler molecular genetics and functional genomics.

  8. Differential maturation of rhythmic clock gene expression during early development in medaka (Oryzias latipes).

    PubMed

    Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela

    2014-05-01

    One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.

  9. De novo assembly of a tadpole shrimp (Triops newberryi) transcriptome and preliminary differential gene expression analysis.

    PubMed

    Horn, Rebekah L; Ramaraj, Thiruvarangan; Devitt, Nicholas P; Schilkey, Faye D; Cowley, David E

    2017-03-01

    Next-generation sequencing techniques, such as RNA sequencing, have provided a wealth of genomic information for nonmodel species. Transcriptomic information can be used to quantify the patterns of gene expression, which can identify how environmental differences invoke organismal stress responses and provide a gauge in predicting species adaptability. In our study, we used RNA sequencing to characterize the first transcriptome from a naupliar tadpole shrimp (Triops newberryi) to identify the genes expressed during the early life history stages and which could be important for future genomic studies. RNA was extracted from naupliar T. newberryi that were reared in a laboratory-controlled setting and in two different water types, a native and a non-native condition. A total of six replicates, three per condition, were sequenced with the Illumina Hi-Seq 2000 achieving 365 M 50-nt reads. High-quality reads were produced and de novo assembly was used to construct a T. newberryi transcriptome that was approximately 24.8 M base pairs. More than 10 000 peptides were predicted from the assembly, and genes were sorted into gene ontology categories. The use of different water conditions allowed for a preliminary differential gene expression analysis in order to compare the changes in gene expression between conditions. There were 299 differentially expressed genes between water conditions that might serve as a focal point for future genomic studies of Triops acclimation to different environments. The Triops transcriptome could serve as vital genomic information for additional studies on Branchiopod crustaceans. © 2016 John Wiley & Sons Ltd.

  10. Effects of sequence variation on differential allelic transcription factor occupancy and gene expression

    PubMed Central

    Reddy, Timothy E.; Gertz, Jason; Pauli, Florencia; Kucera, Katerina S.; Varley, Katherine E.; Newberry, Kimberly M.; Marinov, Georgi K.; Mortazavi, Ali; Williams, Brian A.; Song, Lingyun; Crawford, Gregory E.; Wold, Barbara; Willard, Huntington F.; Myers, Richard M.

    2012-01-01

    A complex interplay between transcription factors (TFs) and the genome regulates transcription. However, connecting variation in genome sequence with variation in TF binding and gene expression is challenging due to environmental differences between individuals and cell types. To address this problem, we measured genome-wide differential allelic occupancy of 24 TFs and EP300 in a human lymphoblastoid cell line GM12878. Overall, 5% of human TF binding sites have an allelic imbalance in occupancy. At many sites, TFs clustered in TF-binding hubs on the same homolog in especially open chromatin. While genetic variation in core TF binding motifs generally resulted in large allelic differences in TF occupancy, most allelic differences in occupancy were subtle and associated with disruption of weak or noncanonical motifs. We also measured genome-wide differential allelic expression of genes with and without heterozygous exonic variants in the same cells. We found that genes with differential allelic expression were overall less expressed both in GM12878 cells and in unrelated human cell lines. Comparing TF occupancy with expression, we found strong association between allelic occupancy and expression within 100 bp of transcription start sites (TSSs), and weak association up to 100 kb from TSSs. Sites of differential allelic occupancy were significantly enriched for variants associated with disease, particularly autoimmune disease, suggesting that allelic differences in TF occupancy give functional insights into intergenic variants associated with disease. Our results have the potential to increase the power and interpretability of association studies by targeting functional intergenic variants in addition to protein coding sequences. PMID:22300769

  11. Differential gene expression profiling of Actinobacillus pleuropneumoniae during induction of primary alveolar macrophage apoptosis in piglets.

    PubMed

    Wang, Lei; Qin, Wanhai; Ruidong, Zhai; Liu, Shiting; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P R; Lei, Liancheng

    2015-01-01

    Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is the causative agent of porcine pleuropneumonia, a disease that causes serious problems for the swine industry. Successful infection by this bacterium requires breaking the first line of defence in the lungs, the primary alveolar macrophages (PAMs). Therefore, exploring A. pleuropneumoniae-PAM interactions will provide vital groundwork for the scientific control of this infectious disease, which has been little studied up to now. In this work, PAMs were isolated from piglets and co-incubated with A. pleuropneumoniae serovar 5b strain L20 in vitro, and their interaction, PAM cell death, and differential gene expression of A. pleuropneumoniae in response to PAM cell death were observed and analysed using confocal microscopy, electron microscopy, RT-PCR, Western blot, flow cytometry and the use of a gene expression profile chip. A. pleuropneumoniae quickly adhered to and invaded PAMs, inducing apoptosis, which was confirmed using transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The highest percentage of apoptosis in cells was confirmed using flow cytometry when the cells were infected at a multiplicity of infection (MOI) of 10 and incubated for 5 h, with higher expression of activated caspase-3 as measured by Western blot. Using microarray gene chips with 2868 probes containing nearly all of the genomic sequence of A. pleuropneumoniae serotype 5b strain L20, a total of 185 bacterial genes were found to be differentially expressed (including 92 up-regulated and 93 down-regulated genes) and involved in the process of apoptosis, as compared with the expression of control bacteria cultured without PAMs in BHI medium (mean expression ratios >1.5-fold, p < 0.05). The up-regulated genes are involved in energy metabolism, gene transcription and translation, virulence related gene such as LPS, Trimeric Autotransporter Adhesin, RTX and similar genes. The down-regulated genes are

  12. The Impact of RNA-seq Alignment Pipeline on Detection of Differentially Expressed Genes.

    PubMed

    Yang, Cheng; Wu, Po-Yen; Phan, John H; Wang, May D

    2014-12-01

    RNA-seq data analysis pipelines are generally composed of sequence alignment, expression quantification, expression normalization, and differentially expressed gene (DEG) detection. Each step has numerous specific tools or algorithms, so we cannot explore all combinatorial pipelines and provide a comprehensive comparison of pipeline performance. To understand the mechanism of RNA-seq data analysis pipelines and provide some useful information for pipeline selection, we believe it is necessary to analyze the interactions among pipeline components. In this paper, by combining different alignment algorithms with the same quantification, normalization, and DEG detection tools, we construct nine RNA-seq pipelines to analyze the impact of RNA-seq alignment on downstream applications of gene expression estimates. Specifically, we find moderate linear correlation between the number of DEGs detected and the percentage of reads aligned with zero mismatch.

  13. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  14. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera

    PubMed Central

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    ABSTRACT Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality. PMID:26507253

  15. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera.

    PubMed

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality.

  16. Towards a molecular definition of worker sterility: differential gene expression and reproductive plasticity in honey bees

    PubMed Central

    Thompson, G J; Kucharski, R; Maleszka, R; Oldroyd, B P

    2006-01-01

    We show that differences in the reproductive development of honey bee workers are associated with locus-specific changes to abundance of messenger RNA. Using a cross-fostering field experiment to control for differences related to age and environment, we compared the gene expression profiles of functionally sterile workers (wild-type) and those from a mutant strain in which workers are reproductively active (anarchist). Among the set of three genes that are significantly differentially expressed are two major royal jelly proteins that are up-regulated in wild-type heads. This discovery is consistent with sterile workers synthesizing royal jelly as food for developing brood. Likewise, the relative underexpression of these two royal jellies in anarchist workers is consistent with these workers’ characteristic avoidance of alloparental behaviour, in favour of selfish egg-laying. Overall, there is a trend for the most differentially expressed genes to be up-regulated in wild-type workers. This pattern suggests that functional sterility in honey bee workers may generally involve the expression of a suite of genes that effectively ‘switch’ ovaries off, and that selfish reproduction in honey bee workers, though rare, is the default developmental pathway that results when ovary activation is not suppressed. PMID:17069629

  17. Differentially expressed genes in Hirudo medicinalis ganglia after acetyl-L-carnitine treatment.

    PubMed

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-L-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer's disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism.

  18. Differentially Expressed Genes in Hirudo medicinalis Ganglia after Acetyl-L-Carnitine Treatment

    PubMed Central

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-l-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer’s disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism. PMID:23308261

  19. The Effects of Simulated Microgravity on Gene Expression in Human Bone Marrow MSC's Under Osteogenic Differentiation

    NASA Astrophysics Data System (ADS)

    Buravkova, L. B.; Gershovich, J. G.; Gershovich, P. M.; Grigoriev, A. I.

    2013-02-01

    In this work it was found that the expression level of 144 genes significantly changed in human mesenchymal stem cells during their osteogenic differentiation after 20 days of exposure to simulated microgravity: the expression of 30 genes significantly increased (from 1.7 to 11.9 fold), and 114 - decreased (from 0.2 to 0.6 fold). Most of the revealed genes were attributed to the 11 major groups corresponding to its biological role in the cells. Additional group was formed from the genes which did not belong to these categories, or did not have a description in the known databases (such as Pubmed). The greatest number of genes with altered expression was found in the group “Matrix and Adhesion", while the lowest - in the "Apoptosis and the response to external stimuli" group. These findings suggest that cultured hMSCs, placed in non-standard conditions, maintain a high level of viability, but have significantly altered functional properties which could affect their efficiency to differentiate towards osteogenic direction.

  20. Co-localization of growth QTL with differentially expressed candidate genes in rainbow trout.

    PubMed

    Kocmarek, Andrea L; Ferguson, Moira M; Danzmann, Roy G

    2015-09-01

    We tested whether genes differentially expressed between large and small rainbow trout co-localized with familial QTL regions for body size. Eleven chromosomes, known from previous work to house QTL for weight and length in rainbow trout, were examined for QTL in half-sibling families produced in September (1 XY male and 1 XX neomale) and December (1 XY male). In previous studies, we identified 108 candidate genes for growth expressed in the liver and white muscle in a subset of the fish used in this study. These gene sequences were BLASTN aligned against the rainbow trout and stickleback genomes to determine their location (rainbow trout) and inferred location based on synteny with the stickleback genome. Across the progeny of all three males used in the study, 63.9% of the genes with differential expression appear to co-localize with the QTL regions on 6 of the 11 chromosomes tested in these males. Genes that co-localized with QTL in the mixed-sex offspring of the two XY males primarily showed up-regulation in the muscle of large fish and were related to muscle growth, metabolism, and the stress response.

  1. Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization.

    PubMed

    Lee, Eun Hye; Kim, Ki Hong

    2011-04-06

    Miamiensis avidus, a causative agent of scuticociliatosis in cultured marine fish, can live not only in seawater as a free-living organism but also in fish as a parasite. In this study, a cDNA library of representative mRNAs more specific to parasitic phase M. avidus was generated using suppression subtractive hybridization (SSH), and 520 clones selected from the SSH library were single-run sequenced. The differential gene expression patterns were confirmed by semi-quantitative reverse-transcription PCR. Of the 510 SSH clones, 21 clones of 6 putative genes did not match sequences in the public database. The expectation values (E-values) of 117 clones encoding 9 putative genes were greater than 1 x 10(-5). The other 372 clones that met the criterion of E value <1 x 10-5 were matched to 26 known sequences in the database. Genes associated with signal transduction, cell proliferation, membrane transportation, protein translocation, and transcription regulation were preferentially expressed in parasitic phase M. avidus. The differential gene expression may be needed for the ciliates to survive in the host fish, and the corresponding proteins might be used as antigen candidates for development of scuticociliatosis vaccines.

  2. Differential expression of four soybean bZIP genes during Phakopsora pachyrhizi infection.

    PubMed

    Alves, Murilo S; Soares, Zamira G; Vidigal, Pedro M P; Barros, Everaldo G; Poddanosqui, Adriana M P; Aoyagi, Luciano N; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Fietto, Luciano G

    2015-11-01

    Asian soybean rust (ASR), caused by the obligate biotrophic fungus Phakopsora pachyrhizi, is one of most important diseases in the soybean (Glycine max (L.) Merr.) agribusiness. The identification and characterization of genes related to plant defense responses to fungal infection are essential to develop ASR-resistant plants. In this work, we describe four soybean genes, GmbZIP62, GmbZIP105, GmbZIPE1, and GmbZIPE2, which encode transcription factors containing a basic leucine zipper (bZIP) domain from two divergent classes, and that are responsive to P. pachyrhizi infection. Molecular phylogenetic analyses demonstrated that these genes encode proteins similar to bZIP factors responsive to pathogens. Yeast transactivation assays showed that only GmbZIP62 has strong transactivation activity in yeast. In addition, three of the bZIP transcription factors analyzed were also differentially expressed by plant defense hormones, and all were differentially expressed by fungal attack, indicating that these proteins might participate in response to ASR infection. The results suggested that these bZIP proteins are part of the plant defense response to P. pachyrhizi infection, by regulating the gene expression related to ASR infection responses. These bZIP genes are potential targets to obtain new soybean genotypes resistant to ASR.

  3. Expression of chondrogenic genes by undifferentiated vs. differentiated human mesenchymal stem cells using array technology.

    PubMed

    Henrionnet, Christel; Roeder, Emilie; Gillet, Romain; Galois, Laurent; Bensoussan, Danièle; Mainard, Didier; Netter, Patrick; Gillet, Pierre; Pinzano, Astrid

    2010-01-01

    This study investigated the gene expression profile of human mesenchymal stem cells seeded in collagen sponge for 28 days in three different mediums: (1) basal medium as control containing ITS alone, (2) ITS+TGF-β1 alone or (3) ITS 1% supplemented sequentially by TGF-β1 (D3-D14) followed by BMP-2 (D15-D28). Differential expression of 84 genes implicated in chondrogenic and osteogenic differentiation of MSCs was analyzed at D28 by real-time RT-PCR array technology. TGF-β1 alone down-regulated two genes, CD36 and cathepsin K. Sixteen genes were significantly up-regulated, notably type 2 and type 10 collagens, COMP and Sox9. The sequential combination of TGF-β1 and BMP-2 produced a similar profile with prominent expression of type 2 collagen and the alkaline phosphatase gene. Interestingly, in this in vitro condition, RUNX2 was not up-regulated, suggesting that the sequential combination of TGF-β1/BMP2 enhances the hypertrophic chondrogenic profile without turning towards the osteoblastic pathway.

  4. [Screening and bioinformatics analysis of differentially expressed genes in hyperplastic scar].

    PubMed

    Hu, Yanghong; Hu, Yangliu; Liu, Dewu; Yu, Jianxing; Liu, Deming

    2014-06-01

    To screen differentially expressed genes in hyperplastic scar to explore the pathogenesis of hyperplastic scar and identify new therapeutic targets. Three pairs of surgical specimens of hyperplastic scar and adjacent normal skin tissues were collected to investigate the differentially expressed genes in hyperplastic scar using Agilent gene oligonucletide microarray and clustering analysis. DAVID Bioinformatics Resources 6.7 was used for GO analysis and pathway analysis. Distinctly different gene expression profiles were found between hyperplastic scar tissues and normal skin tissues. Compared with normal skin tissue, hyperplastic scar tissues showed 3142 up-regulated and 2984 down-regulated genes by two folds and 28 up-regulated and 44 down-regulated genes by 5 folds after repeating the experiment once; after repeating the experiment twice, 3004 genes were found up-regulated and 3038 down-regulated by 2 folds and 25 up-regulated and 38 down-regulated by 5 folds in hyperplastic scars. In all the 3 specimens, 1920 genes were up-regulated and 1912 down-regulated by 2 folds and 18 up-regulated and 29 down-regulated by 5 folds. The dysregulated genes in hyperplastic scar were involved in cell cycles, cell proliferation, immune response and cell adhesion (CDKN1C, CDKN2A, CTNNA3, COL6A3, and HOXB4) and in signaling pathway of focal adhesion, TGF-beta signaling pathway, p53 signaling pathway, cell cycle, and tumor-associated pathways (TGFβ1, CDKN1C, CDKN2A, CDC14A , ITGB6, and EGF).

  5. Differential gene expression in mouse spermatogonial stem cells and embryonic stem cells

    PubMed Central

    Bai, Yinshan; Feng, Meiying; Liu, Shanshan; Wei, Hengxi; Li, Li; Zhang, Xianwei; Shen, Chao; Zhang, Shouquan; Ma, Ningfang

    2016-01-01

    Mouse spermatogonial stem cells (mSSCs) may be reprogrammed to become pluripotent stem cells under in vitro culture conditions, due to epigenetic modifications, which are closely associated with the expression of transcription factors and epigenetic factors. Thus, this study was conducted to compare the gene expression of transcription factors and epigenetic factors in mSSCs and mouse embryonic stem cells (mESCs). Firstly, the freshly isolated mSSCs [mSSCs (f)] were enriched by magnetic-activated cell sorting with Thy1.2 (CD90.2) microbeads, and the typical morphological characteristics were maintained under in vitro culture conditions for over 5 months to form long-term propagated mSSCs [mSSCs (l)]. These mSSCs (l) expressed pluripotency-associated genes and were induced to differentiate into sperm. Our findings indicated that the mSSCs (l) expressed high levels of the transcription factors, Lin28 and Prmt5, and the epigenetic factors, Tet3, Parp1, Max, Tert and Trf1, in comparison with the mESCs, with the levels of Prmt5, Tet3, Parp1 and Tert significantly higher than those in the mESCs. There was no significant difference in Kdm2b expression between mSSCs (l) and mESCs. Furthermore, the gene expression of N-Myc, Dppa2, Tbx3, Nr5a2, Prmt5, Tet3, Parp1, Max, Tert and Trf1 in the mSSCs (l) was markedly higher in comparison to that in the mSSCs (f). Collectively, our results suggest that the mSSCs and the mESCs displayed differential gene expression profiles, and the mSSCs possessed the potential to acquire pluripotency based on the high expression of transcription factors and epigenetic factors. These data may provide novel insights into the reprogramming mechanism of mSSCs. PMID:27353491

  6. Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds.

    PubMed

    Toorop, Peter E; Barroco, Rosa Maria; Engler, Gilbert; Groot, Steven P C; Hilhorst, Henk W M

    2005-07-01

    Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was undetectable in the dry seed, low in dormant seed, and high under conditions that allowed completion of germination. Expression of these genes was also found to be light-regulated and to correlate with germination speed. Expression of the dormancy-associated genes ATS2 and ATS4, encoding a caleosin-like protein and a protein similar to a low-temperature-induced protein respectively, was high in the dry seed and decreased during germination. Expression of ATS2 and ATS4 was high in primary and secondary dormant seed but low in after-ripened or chilled seed. The expression of both genes was also light-regulated, but no relationship with temperature-dependent germination speed was found.

  7. Differential expression of genes of Xylella fastidiosa in xylem fluid of citrus and grapevine.

    PubMed

    Shi, Xiangyang; Bi, Jianlong; Morse, Joseph G; Toscano, Nick C; Cooksey, Donald A

    2010-03-01

    Xylella fastidiosa causes a serious Pierce's disease (PD) in grapevine. Xylella fastidiosa cells from a PD strain were grown in a pure xylem fluid of a susceptible grapevine cultivar vs. xylem fluid from citrus, which is not a host for this strain of X. fastidiosa. When grown in grapevine xylem fluid, cells of the PD strain formed clumps and biofilm formed to a greater extent than in citrus xylem fluid, although the PD strain did grow in xylem fluid of three citrus varieties. The differential expression of selected genes of a PD X. fastidiosa strain cultured in the two xylem fluids was analyzed using a DNA macroarray. Compared with citrus xylem fluid, grapevine xylem fluid stimulated the expression of X. fastidiosa genes involved in virulence regulation, such as gacA, algU, xrvA, and hsq, and also genes involved in the biogenesis of pili and twitching motility, such as fimT, pilI, pilU, and pilY1. Increased gene expression likely contributes to PD expression in grapevine, whereas citrus xylem fluid did not support or possibly suppressed the expression of these virulence genes.

  8. Investigatory and analytical approaches to differential gene expression profiling in mantle cell lymphoma.

    PubMed

    Zhu, Ying; Hollmén, Jaakko; Räty, Riikka; Aalto, Yan; Nagy, Balint; Elonen, Erkki; Kere, Juha; Mannila, Heikki; Franssila, Kaarle; Knuutila, Sakari

    2002-12-01

    Mantle cell lymphoma (MCL) is a non-Hodgkin's lymphoma of B-cell lineage. The blastoid variant of MCL, characterized by high mitotic rate, is clinically more aggressive than common MCL. We used the cDNA array technology to examine the gene expression profiles of both blastoid variant and common MCL. The data was analysed by regression analysis, principal component analysis and the naive Bayes' classifier. Eight genes were identified as differentially deregulated between the two groups. Oncogenes CMYC, BCL2 and PIM1 were upregulated more frequently in the blastoid variant than in common MCL. This implied that the gp130-mediated signal transducer and activator of transcription 3 (STAT3) signalling pathway was involved in the blastoid variant transformation of MCL. Other differentially deregulated genes were TOP1, CD23, CD45, CD70 and NFATC. By using the eight differentially deregulated genes, we created a classifier to distinguish the blastoid variant from common MCL with high accuracy. We also identified 18 genes that were deregulated in both groups. Among them, BCL1, CALLA/CD10 and GRN were suggested to be oncogenes. The products of RGS1, RGS2, ANX2 and CD44H were suggested to promote tumour metastasis. CD66D was suggested to be a tumour suppressor gene.

  9. Hydrogen peroxide induces adaptive response and differential gene expression in human embryo lung fibroblast cells.

    PubMed

    Wei, Qinzhi; Huang, Haiyan; Yang, Linqing; Yuan, Jianhui; Yang, Xiaohua; Liu, Yungang; Zhuang, Zhixiong

    2014-04-01

    Hydrogen peroxide (H2 O2 ), a substance involved in cellular oxidative stress, has been observed to induce an adaptive response, which is characterized by a protection against the toxic effect of H2 O2 at higher concentrations. However, the molecular mechanism for the adaptive response remains unclear. In particular, the existing reports on H2 O2 -induced adaptive response are limited to animal cells and human tumor cells, and relatively normal human cells have never been observed for an adaptive response to H2 O2 . In this study, a human embryo lung fibroblast (MRC-5) cell line was used to model an adaptive response to H2 O2 , and the relevant differential gene expressions by using fluoro mRNA differential display RT-PCR. The results showed significant suppression of cytotoxicity of H2 O2 (1100 μM, 1 h) after pretreatment of the cells with H2 O2 at lower concentrations (0.088-8.8 μM, 24 h), as indicated by cell survival, lactate dehydrogenase release, and the rate of apoptotic cells. Totally 60 mRNA components were differentially expressed compared to untreated cells, and five of them (sizing 400-600 bp) which demonstrated the greatest increase in expression were cloned and sequenced. They showed identity with known genes, such as BCL-2, eIF3S5, NDUFS4, and RPS10. Real time RT-PCR analysis of the five genes displayed a pattern of differential expression consistent with that by the last method. These five genes may be involved in the induction of adaptive response by H2 O2 in human cells, at least in this particular cell type. Copyright © 2012 Wiley Periodicals, Inc.

  10. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  11. Structural changes and differentially expressed genes in Pseudomonas aeruginosa exposed to meropenem-ciprofloxacin combination.

    PubMed

    Siqueira, Vera Lúcia Dias; Cardoso, Rosilene Fressatti; Caleffi-Ferracioli, Katiany Rizzieri; Scodro, Regiane Bertin de Lima; Fernandez, Maria Aparecida; Fiorini, Adriana; Ueda-Nakamura, Tania; Dias-Filho, Benedito Prado; Nakamura, Celso Vataru

    2014-07-01

    The effect of a meropenem-ciprofloxacin combination (MCC) on the susceptibility of multidrug-resistant (MDR) Pseudomonas aeruginosa (MRPA) clinical isolates was determined using checkerboard and time-kill curve techniques. Structural changes and differential gene expression that resulted from the synergistic action of the MCC against one of the P. aeruginosa isolates (1071-MRPA]) were evaluated using electron microscopy and representational difference analysis (RDA), respectively. The differentially expressed, SOS response-associated, and resistance-associated genes in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC were monitored by quantitative PCR. The MCC was synergistic against 25% and 40.6% of MDR P. aeruginosa isolates as shown by the checkerboard and time-kill curves, respectively. The morphological and structural changes that resulted from the synergistic action of the MCC against 1071-MRPA were a summation of the effects observed with each antimicrobial alone. One exception included outer membrane vesicles, which were seen in a greater amount upon ciprofloxacin exposure but were significantly inhibited upon MCC exposure. Cell wall- and DNA repair-associated genes were differentially expressed in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC. However, some of the RDA-detected, resistance-associated, and SOS response-associated genes were expressed at significantly lower levels in 1071-MRPA exposed to the MCC. The MCC may be an alternative for the treatment of MDR P. aeruginosa. The effect of this antimicrobial combination may be not only the result of a summation of the effects of meropenem and ciprofloxacin but also a result of differential action that likely inhibits protective mechanisms in the bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Structural Changes and Differentially Expressed Genes in Pseudomonas aeruginosa Exposed to Meropenem-Ciprofloxacin Combination

    PubMed Central

    Siqueira, Vera Lúcia Dias; Cardoso, Rosilene Fressatti; Caleffi-Ferracioli, Katiany Rizzieri; de Lima Scodro, Regiane Bertin; Fernandez, Maria Aparecida; Fiorini, Adriana; Ueda-Nakamura, Tania; Dias-Filho, Benedito Prado

    2014-01-01

    The effect of a meropenem-ciprofloxacin combination (MCC) on the susceptibility of multidrug-resistant (MDR) Pseudomonas aeruginosa (MRPA) clinical isolates was determined using checkerboard and time-kill curve techniques. Structural changes and differential gene expression that resulted from the synergistic action of the MCC against one of the P. aeruginosa isolates (1071-MRPA]) were evaluated using electron microscopy and representational difference analysis (RDA), respectively. The differentially expressed, SOS response-associated, and resistance-associated genes in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC were monitored by quantitative PCR. The MCC was synergistic against 25% and 40.6% of MDR P. aeruginosa isolates as shown by the checkerboard and time-kill curves, respectively. The morphological and structural changes that resulted from the synergistic action of the MCC against 1071-MRPA were a summation of the effects observed with each antimicrobial alone. One exception included outer membrane vesicles, which were seen in a greater amount upon ciprofloxacin exposure but were significantly inhibited upon MCC exposure. Cell wall- and DNA repair-associated genes were differentially expressed in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC. However, some of the RDA-detected, resistance-associated, and SOS response-associated genes were expressed at significantly lower levels in 1071-MRPA exposed to the MCC. The MCC may be an alternative for the treatment of MDR P. aeruginosa. The effect of this antimicrobial combination may be not only the result of a summation of the effects of meropenem and ciprofloxacin but also a result of differential action that likely inhibits protective mechanisms in the bacteria. PMID:24798291

  13. Differential expression of imprinted genes in normal and IUGR human placentas.

    PubMed

    Diplas, Andreas I; Lambertini, Luca; Lee, Men-Jean; Sperling, Rhoda; Lee, Yin Leng; Wetmur, James; Chen, Jia

    2009-05-16

    Genomic imprinting refers to silencing of one parental allele in the zygotes of gametes depending upon the parent of origin. Loss of imprinting (LOI) is the gain of function from the silent allele that can have a maximum effect of doubling the gene dosage. LOI may play a significant role in the etiology of intrauterine growth restriction (IUGR). Using placental tissue from ten normal and seven IUGR pregnancies, we conducted a systematic survey of the expression of a panel of 74 "putatively" imprinted genes using quantitative RT-PCR. We found that 52/74 ( approximately 70%) of the genes were expressed in human placentas. Nine of the 52 (17%) expressed genes were significantly differentially expressed between normal and IUGR placentas; five were upregulated (PHLDA2, ILK2, NNAT, CCDC86, PEG10) and four downregulated (PLAGL1, DHCR24, ZNF331, CDKAL1). We also assessed LOI profile of 14 imprinted genes in 14 normal and 24 IUGR placentas using a functional and sensitive assay developed in our laboratory. Little LOI was observed in any placentas for five of the genes (PEG10, PHLDA2, MEG3, EPS15, CD44). With the 149 heterozygosities examined, 40 (26.8%) exhibited LOI >3%. Some genes exhibited frequent LOI in placentas regardless of the disease status (IGF2, TP73, MEST, SLC22A18, PEG3), while others exhibited LOI only in IUGR placentas (PLAGL1, DLK1, H19, SNRPN). Importantly, there was no correlation between gene expression and LOI profile. Our study suggests that genomic imprinting may play a role in IUGR pathogenesis, but mechanisms other than LOI may contribute to dysregulation of imprinted genes.

  14. Comparative transcriptional analysis reveals differential gene expression between Sand Daffodil tissues.

    PubMed

    De Felice, Bruna; Manfellotto, Francesco; D'Alessandro, Raffaella; De Castro, Olga; Di Maio, Antonietta; Trifuoggi, Marco

    2013-12-01

    Sand Daffodil (Pancratium maritimum) is a world-wide endangered Amayllidaceae species and represents an important anti-cancer medicinal resource due to alkaloids production. Despite its increasing pharmaceutical importance, there are not molecular resources that can be utilized toward improving genetic traits. In our research, the suppression subtractive hybridization (SSH) method conducted to generate large-scale expressed sequence tags (EST), was designed to identify gene candidates related to the morphological and physiological differences between the two tissues, leaves and bulbs, since lycorine, the main anti-cancer compound, is there synthesized. We focused on identification of transcripts in different tissues from Sand Daffodil using PCR-based suppression SSH to identify genes involved in global pathway control. Sequencing of 2,000 differentially screened clones from the SSH libraries resulted in 136 unigenes. Functional annotation and gene ontology analysis of up-regulated EST libraries showed several known biosynthetic genes and novel transcripts that may be involved in signaling, cellular transport, or metabolism. Real time RT-PCR analysis of a set of 8 candidate genes further confirmed the differential gene expression.

  15. Differentially expressed genes after viral haemorrhagic septicaemia virus infection in olive flounder (Paralichthys olivaceus).

    PubMed

    Hwang, Jee Youn; Kwon, Mun-Gyeong; Seo, Jung Soo; Do, Jung Wan; Park, Myoung-Ae; Jung, Sung-Hee; Ahn, Sang Jung

    2016-09-25

    A strain of viral haemorrhagic septicaemia virus (VHSV) was isolated from cultured olive flounder (Paralichthys olivaceus) during epizootics in South Korean. This strain showed high mortality to olive flounder in in vivo challenge experiment. The complete genomic RNA sequences were determined and phylogenetic analysis of the amino acid sequences of glycoprotein revealed that this isolate was grouped into genotype IVa of genus Novirhabdovirus. Expression profile of genes in olive flounder was analyzed at day 1 and day3 after infection with this VHSV isolate by using cDNA microarray containing olive flounder 13K cDNA clones. Microarray analysis revealed 785 up-regulated genes and 641 down-regulated genes by at least two-fold in virus-infected fish compared to healthy control groups. Among 785 up-regulated genes, we identified seven immune response-associated genes, including the interferon (IFN)-induced 56-kDa protein (IFI56), suppressor of cytokine signaling 1 (SOCS1), interleukin 8 (IL-8), cluster of differentiation 83 (CD83), α-globin (HBA), VHSV-induced protein-6 (VHSV6), and cluster of differentiation antigen 9 (CD9). Our results confirm previous reports that even virulent strain of VHSV induces expression of genes involved in protective immunity against VHSV. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Identifying differentially expressed genes in cancer patients using a non-parameter Ising model.

    PubMed

    Li, Xumeng; Feltus, Frank A; Sun, Xiaoqian; Wang, James Z; Luo, Feng

    2011-10-01

    Identification of genes and pathways involved in diseases and physiological conditions is a major task in systems biology. In this study, we developed a novel non-parameter Ising model to integrate protein-protein interaction network and microarray data for identifying differentially expressed (DE) genes. We also proposed a simulated annealing algorithm to find the optimal configuration of the Ising model. The Ising model was applied to two breast cancer microarray data sets. The results showed that more cancer-related DE sub-networks and genes were identified by the Ising model than those by the Markov random field model. Furthermore, cross-validation experiments showed that DE genes identified by Ising model can improve classification performance compared with DE genes identified by Markov random field model.

  17. c-Rel Regulates Inscuteable Gene Expression during Mouse Embryonic Stem Cell Differentiation*

    PubMed Central

    Ishibashi, Riki; Kozuki, Satoshi; Kamakura, Sachiko; Sumimoto, Hideki; Toyoshima, Fumiko

    2016-01-01

    Inscuteable (Insc) regulates cell fate decisions in several types of stem cells. Although it is recognized that the expression levels of mouse INSC govern the balance between symmetric and asymmetric stem cell division, regulation of mouse Insc gene expression remains poorly understood. Here, we showed that mouse Insc expression transiently increases at an early stage of differentiation, when mouse embryonic stem (mES) cells differentiate into bipotent mesendoderm capable of producing both endoderm and mesoderm in defined culture conditions. We identified the minimum transcriptional regulatory element (354 bases) that drives mouse Insc transcription in mES cells within a region >5 kb upstream of the mouse Insc transcription start site. We found that the transcription factor reticuloendotheliosis oncogene (c-Rel) bound to the minimum element and promoted mouse Insc expression in mES cells. In addition, short interfering RNA-mediated knockdown of either mouse INSC or c-Rel protein decreased mesodermal cell populations without affecting differentiation into the mesendoderm or endoderm. Furthermore, overexpression of mouse INSC rescued the mesoderm-reduced phenotype induced by knockdown of c-Rel. We propose that regulation of mouse Insc expression by c-Rel modulates cell fate decisions during mES cell differentiation. PMID:26694615

  18. c-Rel Regulates Inscuteable Gene Expression during Mouse Embryonic Stem Cell Differentiation.

    PubMed

    Ishibashi, Riki; Kozuki, Satoshi; Kamakura, Sachiko; Sumimoto, Hideki; Toyoshima, Fumiko

    2016-02-12

    Inscuteable (Insc) regulates cell fate decisions in several types of stem cells. Although it is recognized that the expression levels of mouse INSC govern the balance between symmetric and asymmetric stem cell division, regulation of mouse Insc gene expression remains poorly understood. Here, we showed that mouse Insc expression transiently increases at an early stage of differentiation, when mouse embryonic stem (mES) cells differentiate into bipotent mesendoderm capable of producing both endoderm and mesoderm in defined culture conditions. We identified the minimum transcriptional regulatory element (354 bases) that drives mouse Insc transcription in mES cells within a region >5 kb upstream of the mouse Insc transcription start site. We found that the transcription factor reticuloendotheliosis oncogene (c-Rel) bound to the minimum element and promoted mouse Insc expression in mES cells. In addition, short interfering RNA-mediated knockdown of either mouse INSC or c-Rel protein decreased mesodermal cell populations without affecting differentiation into the mesendoderm or endoderm. Furthermore, overexpression of mouse INSC rescued the mesoderm-reduced phenotype induced by knockdown of c-Rel. We propose that regulation of mouse Insc expression by c-Rel modulates cell fate decisions during mES cell differentiation.

  19. Gene expression profiling of pluripotency and differentiation-related markers in cat oocytes and preimplantation embryos.

    PubMed

    Filliers, Muriel; Goossens, Karen; Van Soom, Ann; Merlo, Barbara; Pope, Charles Earle; de Rooster, Hilde; Smits, Katrien; Vandaele, Leen; Peelman, Luc J

    2012-01-01

    During mammalian preimplantation development, two successive differentiation events lead to the establishment of three committed lineages with separate fates: the trophectoderm, the primitive endoderm and the pluripotent epiblast. In the mouse embryo, the molecular mechanisms underlying these two cell fate decisions have been studied extensively, leading to the identification of lineage-specific transcription factors. Species-specific differences in expression patterns of key regulatory genes have been reported, raising questions regarding their role in different species. The aim of the present study was to characterise the gene expression patterns of pluripotency (OCT4, SOX2, NANOG) and differentiation (CDX2, GATA6)-related markers during feline early development using reverse transcription-quantitative polymerase chain reaction. In addition, we assessed the impact of in vitro development on gene expression by comparing transcript levels of the genes investigated between in vitro and in vivo blastocysts. To normalise quantitative data within different preimplantation embryo stages, we first validated a set of stable reference genes. Transcript levels of all genes investigated were present and changed over the course of preimplantation development; a highly significant embryo-stage effect on gene expression was observed. Transcript levels of OCT4 were significantly reduced in in vitro blastocysts compared with their in vivo counterparts. None of the other genes investigated showed altered expression under in vitro conditions. The different gene expression patterns of OCT4, SOX2, CDX2 and GATA6 in cat embryos resembled those described in mouse embryos, indicative of a preserved role for these genes during early segregation. However, because of the absence of any upregulation of NANOG transcription levels after embryonic genome activation, it is unlikely that NANOG is a key regular of lineage segregation. Such results support the hypothesis that the behaviour of

  20. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

    PubMed Central

    2011-01-01

    Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes

  1. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  2. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.

    PubMed

    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei

    2015-05-01

    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  3. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer's Disease Affected Brain Regions.

    PubMed

    Puthiyedth, Nisha; Riveros, Carlos; Berretta, Regina; Moscato, Pablo

    2016-01-01

    Alzheimer's disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD. In addition, we identified

  4. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  5. The gene road to royalty--differential expression of hydroxylating genes in the mandibular glands of the honeybee.

    PubMed

    Malka, Osnat; Karunker, Iris; Yeheskel, Adva; Morin, Shai; Hefetz, Abraham

    2009-10-01

    The advances in honeybee sociogenomics have paved the way for the study of social communication processes at the gene level, in particular the expression of caste-specific pheromones. The queen honeybee mandibular pheromone provides an excellent model system, in that biosynthesis of the hydroxylating fatty acid caste-specific pheromone appears to be reduced to a single chemical hydroxylation step of stearic acid. Queens are typified by omega-1-hydroxylation, as opposed to the worker-typical omega-hydroxylation. We hypothesized that this bifurcation is the consequence of differential expression of caste-specific genes that code for fatty acid-hydroxylating enzymes from the cytochrome P450 (CYP) family. Bioinformatics studies disclosed two candidate proteins CYP4AA1 and CYP18A1. We thus investigated the expression of these genes in the mandibular glands of queens, and of queenright (QR) and queenless (QL) workers. The real-time PCR results revealed that CYP4AA1 (omega-hydroxylation) was expressed at high levels in both QR and QL workers, whereas in queens its expression was negligible. The expression of CYP18A1 (omega-1-hydroxylation), on the other hand, was high in the queen's glands and negligible in those of QR workers. In QL workers, however, the expression of CYP18A1 was considerably elevated and significantly greater than in QR workers. Three-dimensional structural models constructed for these enzymes demonstrate differences in the active site between CYP18A1 and CYP4AA1, in line with their differential catalytic specificity. The fact that queen pheromone plasticity can be tracked all the way to gene expression provides a new insight into the process of caste differentiation and the accompanying social communication.

  6. Gene expression profile of HIV-1 Tat expressing cells: a close interplay between proliferative and differentiation signals

    PubMed Central

    de la Fuente, Cynthia; Santiago, Francisco; Deng, Longwen; Eadie, Carolyne; Zilberman, Irene; Kehn, Kylene; Maddukuri, Anil; Baylor, Shanese; Wu, Kaili; Lee, Chee Gun; Pumfery, Anne; Kashanchi, Fatah

    2002-01-01

    Background Expression profiling holds great promise for rapid host genome functional analysis. It is plausible that host expression profiling in an infection could serve as a universal phenotype in virally infected cells. Here, we describe the effect of one of the most critical viral activators, Tat, in HIV-1 infected and Tat expressing cells. We utilized microarray analysis from uninfected, latently HIV-1 infected cells, as well as cells that express Tat, to decipher some of the cellular changes associated with this viral activator. Results Utilizing uninfected, HIV-1 latently infected cells, and Tat expressing cells, we observed that most of the cellular host genes in Tat expressing cells were down-regulated. The down-regulation in Tat expressing cells is most apparent on cellular receptors that have intrinsic receptor tyrosine kinase (RTK) activity and signal transduction members that mediate RTK function, including Ras-Raf-MEK pathway. Co-activators of transcription, such as p300/CBP and SRC-1, which mediate gene expression related to hormone receptor genes, were also found to be down-regulated. Down-regulation of receptors may allow latent HIV-1 infected cells to either hide from the immune system or avoid extracellular differentiation signals. Some of the genes that were up-regulated included co-receptors for HIV-1 entry, translation machinery, and cell cycle regulatory proteins. Conclusions We have demonstrated, through a microarray approach, that HIV-1 Tat is able to regulate many cellular genes that are involved in cell signaling, translation and ultimately control the host proliferative and differentiation signals. PMID:12069692

  7. Improved detection of differentially expressed genes in microarray experiments through multiple scanning and image integration

    PubMed Central

    Romualdi, Chiara; Trevisan, Silvia; Celegato, Barbara; Costa, Germano; Lanfranchi, Gerolamo

    2003-01-01

    The variability of results in microarray technology is in part due to the fact that independent scans of a single hybridised microarray give spot images that are not quite the same. To solve this problem and turn it to our advantage, we introduced the approach of multiple scanning and of image integration of microarrays. To this end, we have developed specific software that creates a virtual image that statistically summarises a series of consecutive scans of a microarray. We provide evidence that the use of multiple imaging (i) enhances the detection of differentially expressed genes; (ii) increases the image homogeneity; and (iii) reveals false-positive results such as differentially expressed genes that are detected by a single scan but not confirmed by successive scanning replicates. The increase in the final number of differentially expressed genes detected in a microarray experiment with this approach is remarkable; 50% more for microarrays hybridised with targets labelled by reverse transcriptase, and 200% more for microarrays developed with the tyramide signal amplification (TSA) technique. The results have been confirmed by semi-quantitative RT–PCR tests. PMID:14627839

  8. Zebra fish myc family and max genes: differential expression and oncogenic activity throughout vertebrate evolution.

    PubMed Central

    Schreiber-Agus, N; Horner, J; Torres, R; Chiu, F C; DePinho, R A

    1993-01-01

    To gain insight into the role of Myc family oncoproteins and their associated protein Max in vertebrate growth and development, we sought to identify homologs in the zebra fish (Brachydanio rerio). A combination of a polymerase chain reaction-based cloning strategy and low-stringency hybridization screening allowed for the isolation of zebra fish c-, N-, and L-myc and max genes; subsequent structural characterization showed a high degree of conservation in regions that encode motifs of known functional significance. On the functional level, zebra fish Max, like its mammalian counterpart, served to suppress the transformation activity of mouse c-Myc in rat embryo fibroblasts. In addition, the zebra fish c-myc gene proved capable of cooperating with an activated H-ras to effect the malignant transformation of mammalian cells, albeit with diminished potency compared with mouse c-myc. With respect to their roles in normal developing tissues, the differential temporal and spatial patterns of steady-state mRNA expression observed for each zebra fish myc family member suggest unique functions for L-myc in early embryogenesis, for N-myc in establishment and growth of early organ systems, and for c-myc in increasingly differentiated tissues. Furthermore, significant alterations in the steady-state expression of zebra fish myc family genes concomitant with relatively constant max expression support the emerging model of regulation of Myc function in cellular growth and differentiation. Images PMID:8474440

  9. Concentration-response analysis of differential gene expression in the zebrafish embryotoxicity test following flusilazole exposure.

    PubMed

    Hermsen, Sanne A B; Pronk, Tessa E; van den Brandhof, Evert-Jan; van der Ven, Leo T M; Piersma, Aldert H

    2012-05-01

    The zebrafish embryotoxicity test (ZET) is considered a promising alternative model in predictive toxicology. Currently, morphological assessment of the embryo is the main readout for this assay. However, implementation of transcriptomics may help to detect more subtle effects, which may increase the sensitivity and predictability of the test. In this study, we tested a concentration response of flusilazole in the ZET. After exposure for 24 h postfertilization, microarray analysis revealed a number of processes to be regulated in a concentration-dependent way. We identified development related processes, retinol metabolism and transcription, as well as processes corresponding to the antifungal mechanism of action, steroid biosynthesis, and fatty acid metabolism, to be differentially regulated. Retinol metabolism and transcription were already significantly altered at concentrations that were not inducing morphological effects. Differential expression of genes related to steroid biosynthesis and fatty acid metabolism showed a concentration response similar to morphological response. An increase in concentration was also positively associated with an increase in magnitude of expression for individual genes within functional processes. Our study shows that transcriptomics analysis in the ZET is a more sensitive readout of compound-induced effects than morphological assessment. However, the interpretation of differential gene expression in terms of predicting morphological effects is not straightforward and requires further study.

  10. Differential expression of putative adhesin genes of Actinobacillus suis grown in in vivo-like conditions.

    PubMed

    Bujold, Adina R; Labrie, Josée; Jacques, Mario; MacInnes, Janet I

    2016-11-15

    Actinobacillus suis is an opportunistic pathogen that resides in the tonsils of the soft palate of swine. Unknown stimuli can cause this organism to invade the host, resulting in septicaemia and sequelae including death. To better understand its pathogenesis, the expression of several adhesin genes was evaluated by semi-quantitative real-time PCR in A. suis grown in conditions that mimic the host environment, including different nutrient and oxygen levels, exponential and stationary phases of growth, and in the presence of the stress hormone epinephrine. Fifty micromolar epinephrine did not affect the growth rate or expression of A. suis adhesin genes, but there was a significant growth phase effect for many genes. Most adhesin genes were also differentially expressed during anoxic static growth or aerobic growth, and in this study, all genes were differentially expressed in either exponential or stationary phase. Based on the time*treatment interactions observed in the anoxic study, a model of persistence of A. suis in the host environment in biofilm and planktonic states is proposed. Biofilm dynamics were further studied using wild type and isogenic mutants of the type IVb pilin (Δ flp1), the OmpA outer membrane protein (ΔompA), and the fibronectin-binding (ΔcomE1) genes. Disruption of these adhesin genes affected the early stages of biofilm formation, but in most cases, biofilm formation of the mutant strains was similar to that of the wild type by 24h of incubation. We postulate that other adhesins may have overlapping functions that can compensate for those of the missing adhesins. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Comparative study of gene expression during the differentiation of white and brown preadipocytes

    NASA Astrophysics Data System (ADS)

    Boeuf, Stéphane

    2002-08-01

    Introduction Mammals have two types of adipose tissue: the lipid storing white adipose tissue and the brown adipose tissue characterised by its capacity for non-shivering thermogenesis. White and brown adipocytes have the same origin in mesodermal stem cells. Yet nothing is known so far about the commitment of precursor cells to the white and brown adipose lineage. Several experimental approaches indicate that they originate from the differentiation of two distinct types of precursor cells, white and brown preadipocytes. Based on this hypothesis, the aim of this study was to analyse the gene expression of white and brown preadipocytes in a systematic approach. Experimental approach The white and brown preadipocytes to compare were obtained from primary cell cultures of preadipocytes from the Djungarian dwarf hamster. Representational difference analysis was used to isolate genes potentially differentially expressed between the two cell types. The thus obtained cDNA libraries were spotted on microarrays for a large scale gene expression analysis in cultured preadipocytes and adipocytes and in tissue samples. Results 4 genes with higher expression in white preadipocytes (3 members of the complement system and a fatty acid desaturase) and 8 with higher expression in brown preadipocytes were identified. From the latter 3 coded for structural proteins (fibronectin, metargidin and a actinin 4), 3 for proteins involved in transcriptional regulation (necdin, vigilin and the small nuclear ribonucleoprotein polypeptide A) and 2 are of unknown function. Cluster analysis was applied to the gene expression data in order to characterise them and led to the identification of four major typical expression profiles: genes up-regulated during differentiation, genes down-regulated during differentiation, genes higher expressed in white preadipocytes and genes higher expressed in brown preadipocytes. Conclusion This study shows that white and brown preadipocytes can be distinguished

  12. A testis-specific gene within a widely expressed gene: Contrasting evolutionary patterns of two differentially expressed mammalian proteins encoded by a single gene, CAMK4.

    PubMed

    Padhi, Abinash; Ma, Li

    2015-12-01

    Understanding the patterns of genetic variations within fertility-related genes and the evolutionary forces that shape such variations is crucial in predicting the fitness landscapes of subsequent generations. This study reports distinct evolutionary features of two differentially expressed mammalian proteins [CaMKIV (Ca(2+) /calmodulin-dependent protein kinase IV) and CaS (calspermin)] that are encoded by a single gene, CAMK4. The multifunctional CaMKIV, which is expressed in multiple tissues including testis and ovary, is evolving at a relatively low rate (0.46-0.64 × 10(-9) nucleotide substitutions/site/year), whereas the testis-specific CaS gene, which is predominantly expressed in post-meiotic cells, evolves at least three to four times faster (1.48-1.98 × 10(-9) substitutions/site/year). Concomitantly, maximum-likelihood-based selection analyses revealed that the ubiquitously expressed CaMKIV is constrained by intense purifying selection and, therefore, remained functionally highly conserved throughout the mammalian evolution, whereas the testis-specific CaS gene is under strong positive selection. The substitution rates of different mammalian lineages within both genes are positively correlated with GC content, indicating the possible influence of GC-biased gene conversion on the estimated substitution rates. The observation of such unusually high GC content of the CaS gene (≈74%), particularly in the lineage that comprises the bovine species, suggests the possible role of GC-biased gene conversion in the evolution of CaS that mimics positive selection.

  13. HMGB4 is expressed by neuronal cells and affects the expression of genes involved in neural differentiation

    PubMed Central

    Rouhiainen, Ari; Zhao, Xiang; Vanttola, Päivi; Qian, Kui; Kulesskiy, Evgeny; Kuja-Panula, Juha; Gransalke, Kathleen; Grönholm, Mikaela; Unni, Emmanual; Meistrich, Marvin; Tian, Li; Auvinen, Petri; Rauvala, Heikki

    2016-01-01

    HMGB4 is a new member in the family of HMGB proteins that has been characterized in sperm cells, but little is known about its functions in somatic cells. Here we show that HMGB4 and the highly similar rat Transition Protein 4 (HMGB4L1) are expressed in neuronal cells. Both proteins had slow mobility in nucleus of living NIH-3T3 cells. They interacted with histones and their differential expression in transformed cells of the nervous system altered the post-translational modification statuses of histones in vitro. Overexpression of HMGB4 in HEK 293T cells made cells more susceptible to cell death induced by topoisomerase inhibitors in an oncology drug screening array and altered variant composition of histone H3. HMGB4 regulated over 800 genes in HEK 293T cells with a p-value ≤0.013 (n = 3) in a microarray analysis and displayed strongest association with adhesion and histone H2A –processes. In neuronal and transformed cells HMGB4 regulated the expression of an oligodendrocyte marker gene PPP1R14a and other neuronal differentiation marker genes. In conclusion, our data suggests that HMGB4 is a factor that regulates chromatin and expression of neuronal differentiation markers. PMID:27608812

  14. Differentially expressed genes identified by cross-species microarray in the blind cavefish Astyanax.

    PubMed

    Strickler, Allen G; Jeffery, William R

    2009-03-01

    Changes in gene expression were examined by microarray analysis during development of the eyed surface dwelling (surface fish) and blind cave-dwelling (cavefish) forms of the teleost Astyanax mexicanus De Filippi, 1853. The cross-species microarray used surface and cavefish RNA hybridized to a DNA chip prepared from a closely related species, the zebrafish Danio rerio Hamilton, 1822. We identified a total of 67 differentially expressed probe sets at three days post-fertilization: six upregulated and 61 downregulated in cavefish relative to surface fish. Many of these genes function either in eye development and/or maintenance, or in programmed cell death. The upregulated probe set showing the highest mean fold change was similar to the human ubiquitin specific protease 53 gene. The downregulated probe sets showing some of the highest fold changes corresponded to genes with roles in eye development, including those encoding gamma crystallins, the guanine nucleotide binding proteins Gnat1 and Gant2, a BarH-like homeodomain transcription factor, and rhodopsin. Downregulation of gamma-crystallin and rhodopsin was confirmed by in situ hybridization and immunostaining with specific antibodies. Additional downregulated genes encode molecules that inhibit or activate programmed cell death. The results suggest that cross-species microarray can be used for identifying differentially expressed genes in cavefish, that many of these genes might be involved in eye degeneration via apoptotic processes, and that more genes are downregulated than upregulated in cavefish, consistent with the predominance of morphological losses over gains during regressive evolution. © 2009 ISZS, Blackwell Publishing and IOZ/CAS.

  15. Sequencing and bioinformatics analysis of the differentially expressed genes in herniated discs with or without calcification

    PubMed Central

    Shao, Jia; Yu, Miao; Jiang, Liang; Wu, Fengliang; Liu, Xiaoguang

    2017-01-01

    The purpose of this study was to detect the differentially expressed genes between ossified herniated discs and herniated discs without ossification. In addition, we sought to identify a few candidate genes and pathways by using bioinformatics analysis. We analyzed 6 samples each of ossified herniated discs (experimental group) and herniated discs without ossification (control group). Purified mRNA and cDNA extracted from the samples were subjected to sequencing. The NOISeq method was used to statistically identify the differentially expressed genes (DEGs) between the 2 groups. An in-depth analysis using bioinformatics tools based on the DEGs was performed using Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, and protein-protein interaction network analysis. The top 6 DEGs were verified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 132 DEGs was detected. A total of 129 genes in the ossified group were upregulated and 3 genes were found to be downregulated as compared to the control group. The top 3 cellular components in GO ontologies analysis were extracellular matrix components. GO functions were mainly related to the glycoprotein in the cell membrane and extracellular matrix. The GO process was related to completing response to stimulus, immune reflex and defense. The top 5 KEGG enrichment pathways were associated with infection and inflammation. Three of the top 20 DEGs [sclerostin (SOST), WNT inhibitory factor 1 (WIF1) and secreted frizzled related protein 4 (SFRP4)] were related to the inhibition of the Wnt pathway. The ossified discs exhibited a higher expression of the top 6 DEGs [SOST, joining chain of multimeric IgA and IgM (IGJ; also known as JCHAIN), defensin alpha 4 (DEFA4), SFRP4, proteinase 3 (PRTN3) and cathepsin G (CTSG)], with the associated P-values of 0.045, 0.000, 0.008, 0.010, 0.015 and 0.002, respectively, as calculated by the independent sample t

  16. Discovery of differentially expressed genes in cashmere goat (Capra hircus) hair follicles by RNA sequencing.

    PubMed

    Qiao, X; Wu, J H; Wu, R B; Su, R; Li, C; Zhang, Y J; Wang, R J; Zhao, Y H; Fan, Y X; Zhang, W G; Li, J Q

    2016-09-02

    The mammalian hair follicle (HF) is a unique, highly regenerative organ with a distinct developmental cycle. Cashmere goat (Capra hircus) HFs can be divided into two categories based on structure and development time: primary and secondary follicles. To identify differentially expressed genes (DEGs) in the primary and secondary HFs of cashmere goats, the RNA sequencing of six individuals from Arbas, Inner Mongolia, was performed. A total of 617 DEGs were identified; 297 were upregulated while 320 were downregulated. Gene ontology analysis revealed that the main functions of the upregulated genes were electron transport, respiratory electron transport, mitochondrial electron transport, and gene expression. The downregulated genes were mainly involved in cell autophagy, protein complexes, neutrophil aggregation, and bacterial fungal defense reactions. According to the Kyoto Encyclopedia of Genes and Genomes database, these genes are mainly involved in the metabolism of cysteine and methionine, RNA polymerization, and the MAPK signaling pathway, and were enriched in primary follicles. A microRNA-target network revealed that secondary follicles are involved in several important biological processes, such as the synthesis of keratin-associated proteins and enzymes involved in amino acid biosynthesis. In summary, these findings will increase our understanding of the complex molecular mechanisms of HF development and cycling, and provide a basis for the further study of the genes and functions of HF development.

  17. Age-dependent Wnt gene expression in bone and during the course of osteoblast differentiation

    PubMed Central

    Rauner, Martina; Sipos, Wolfgang

    2008-01-01

    Wnt signaling is vital for osteoblast differentiation and recently has been associated with aging. Because impaired osteoblastogenesis is a cellular characteristic of age-induced bone loss, we investigated whether this process is associated with an altered expression of Wnt signaling-related proteins in bone and osteoblasts. Bone marrow cells were isolated from male C57BL/6 mice, aged 6 weeks, 6 months, and 18 months, respectively. Osteogenic differentiation was induced for 3 weeks and assessed using alizarin red staining. Gene expression of Wnt1, 3a, 4, 5a, 5b, 7b, 9b, 10b, lipoprotein receptor-related protein (LRP)-5/6, as well as dickkopf-1 (Dkk-1), sclerostin, and secreted frizzled related protein-1 (sFRP-1) was determined in bone tissue and osteoblasts on days 7, 14, and 21 by real-time RT-PCR. Osteoblast differentiation was significantly reduced in aged mice compared with young and adult mice. In bone tissue, expression levels of all genes assessed were decreased in adult and old mice, respectively, compared with young mice. Mature osteoblasts of aged compared with those of young mice showed enhanced expression of Wnt9b, LRP-6, and Dkk-1, and decreased expression of Wnt5a and 7b. In early osteoblasts, mRNA levels of Wnt1, 5a, 5b, and 7b were increased significantly in aged mice. The expression of Wnt3a, 4, LRP-5, and sclerostin was not altered in aged osteoblasts. In conclusion, osteoblastic expression of each Wnt-related protein is regulated individually by aging. The overall decreased expression of Wnt-related proteins in bone tissue of aged mice underlines the newly discovered association of Wnt signaling with aging. PMID:19424851

  18. Fetal Mesenchymal Stromal Cells Differentiating towards Chondrocytes Acquire a Gene Expression Profile Resembling Human Growth Plate Cartilage

    PubMed Central

    Leijten, Jeroen C. H.; Decker, Eva; Sticht, Carsten; van Houwelingen, Johannes C.; Goeman, Jelle J.; Kleijburg, Carin; Scherjon, Sicco A.; Gretz, Norbert; Wit, Jan Maarten; Rappold, Gudrun; Post, Janine N.; Karperien, Marcel

    2012-01-01

    We used human fetal bone marrow-derived mesenchymal stromal cells (hfMSCs) differentiating towards chondrocytes as an alternative model for the human growth plate (GP). Our aims were to study gene expression patterns associated with chondrogenic differentiation to assess whether chondrocytes derived from hfMSCs are a suitable model for studying the development and maturation of the GP. hfMSCs efficiently formed hyaline cartilage in a pellet culture in the presence of TGFβ3 and BMP6. Microarray and principal component analysis were applied to study gene expression profiles during chondrogenic differentiation. A set of 232 genes was found to correlate with in vitro cartilage formation. Several identified genes are known to be involved in cartilage formation and validate the robustness of the differentiating hfMSC model. KEGG pathway analysis using the 232 genes revealed 9 significant signaling pathways correlated with cartilage formation. To determine the progression of growth plate cartilage formation, we compared the gene expression profile of differentiating hfMSCs with previously established expression profiles of epiphyseal GP cartilage. As differentiation towards chondrocytes proceeds, hfMSCs gradually obtain a gene expression profile resembling epiphyseal GP cartilage. We visualized the differences in gene expression profiles as protein interaction clusters and identified many protein clusters that are activated during the early chondrogenic differentiation of hfMSCs showing the potential of this system to study GP development. PMID:23144774