Science.gov

Sample records for differentially expressed mitochondrial

  1. Differential Gene Expression Reveals Mitochondrial Dysfunction in an Imprinting Center Deletion Mouse Model of Prader-Willi Syndrome

    PubMed Central

    Fan, Weiwei; Coskun, Pinar E.; Nalbandian, Angèle; Knoblach, Susan; Resnick, James L.; Hoffman, Eric; Wallace, Douglas C.; Kimonis, Virginia E.

    2013-01-01

    Prader-Willi syndrome (PWS) is a genetic disorder caused by deficiency of imprinted gene expression from the paternal chromosome 15q11-15q13 and clinically characterized by neonatal hypotonia, short stature, cognitive impairment, hypogonadism, hyperphagia, morbid obesity and diabetes. Previous clinical studies suggest that a defect in energy metabolism may be involved in the pathogenesis of PWS. We focused our attention on the genes associated with energy metabolism and found that there were 95 and 66 mitochondrial genes differentially expressed in PWS muscle and brain, respectively. Assessment of enzyme activities of mitochondrial oxidative phosphorylation (OXPHOS) complexes in the brain, heart, liver and muscle were assessed. We found the enzyme activities of the cardiac mitochondrial complexes II+III were upregulated in the imprinting center deletion (PWS-IC) mice compared to the wild type littermates. These studies suggest that differential gene expression, especially of the mitochondrial genes may contribute to the pathophysiology of PWS. PMID:24127921

  2. Aging Reduces an ERRalpha-Directed Mitochondrial Glutaminase Expression Suppressing Glutamine Anaplerosis and Osteogenic Differentiation of Mesenchymal Stem Cells.

    PubMed

    Huang, Tongling; Liu, Renzhong; Fu, Xuekun; Yao, Dongsheng; Yang, Meng; Liu, Qingli; Lu, William W; Wu, Chuanyue; Guan, Min

    2017-02-01

    Aging deteriorates osteogenic capacity of mesenchymal stem/stromal cells (MSCs), contributing to imbalanced bone remodeling and osteoporosis. Glutaminase (Gls) catabolizes glutamine into glutamate at the first step of mitochondrial glutamine (Gln)-dependent anaplerosis which is essential for MSCs upon osteogenic differentiation. Estrogen-related receptor α (ERRα) regulates genes required for mitochondrial function. Here, we found that ERRα and Gls are upregulated by osteogenic induction in human MSCs (hMSCs). In contrast, osteogenic differentiation capacity and glutamine consumption of MSCs, as well as ERRα, Gls and osteogenic marker genes are significantly reduced with age. We demonstrated that ERRα binds to response elements on Gls promoter and affects glutamine anaplerosis through transcriptional induction of Gls. Conversely, mTOR inhibitor rapamycin, ERRα inverse agonist compound 29 or Gls inhibitor BPTES leads to reduced Gln anaplerosis and deteriorated osteogenic differentiation of hMSCs. Importantly, overexpression of ERRα or Gls restored impairment by these inhibitors. Finally, we proved that compensated ERRα or Gls expression indeed potentiated Gln anaplerosis and osteogenic capability of elderly mice MSCs in vitro. Together, we establish that Gls is a novel ERRα target gene and ERRα/Gls signaling pathway plays an important role in osteogenic differentiation of MSCs, providing new sights into novel regenerative therapeutics development. Our findings suggest that restoring age-related mitochondrial Gln-dependent anaplerosis may be beneficial for degenerative bone disorders such as osteoporosis. Stem Cells 2017;35:411-424.

  3. Differentially expressed miRNAs in sepsis-induced acute kidney injury target oxidative stress and mitochondrial dysfunction pathways

    PubMed Central

    Ge, Qin-Min; Huang, Chun-Mei; Zhu, Xiang-Yang; Bian, Fan; Pan, Shu-Ming

    2017-01-01

    Objective To identify specific miRNAs involved in sepsis-induced AKI and to explore their targeting pathways. Methods The expression profiles of miRNAs in serum from patients with sepsis-induced AKI (n = 6), sepsis-non AKI (n = 6), and healthy volunteers (n = 3) were investigated by microarray assay and validated by quantitative PCR (qPCR). The targets of the differentially expressed miRNAs were predicted by Target Scan, mirbase and Miranda. Then the significant functions and involvement in signaling pathways of gene ontology (GO) and KEGG pathways were analyzed. Furthermore, eight miRNAs were randomly selected out of the differentially expressed miRNAs for further testing by qPCR. Results qPCR analysis confirmed that the expressions levels of hsa-miR-23a-3p, hsa-miR-4456, hsa-miR-142-5p, hsa-miR-22-3p and hsa-miR-191-5p were significantly lower in patients with sepsis compared with the healthy volunteers, while hsa-miR-4270, hsa-miR-4321, hsa-miR-3165 were higher in the sepsis patients. Statistically, miR-4321; miR-4270 were significantly upregulated in the sepsis-induced AKI compared with sepsis-non AKI, while only miR-4321 significantly overexpressed in the sepsis groups compared with control groups. GO analysis showed that biological processes regulated by the predicted target genes included diverse terms. They were related to kidney development, regulation of nitrogen compound metabolic process, regulation of cellular metabolic process, cellular response to oxidative stress, mitochondrial outer membrane permeabilization, etc. Pathway analysis showed that several significant pathways of the predicted target genes related to oxidative stress. miR-4321 was involved in regulating AKT1, mTOR and NOX5 expression while miR-4270 was involved in regulating PPARGC1A, AKT3, NOX5, PIK3C3, WNT1 expression. Function and pathway analysis highlighted the possible involvement of miRNA-deregulated mRNAs in oxidative stress and mitochondrial dysfunction. Conclusion This study

  4. Transient expression of βC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions

    PubMed Central

    2010-01-01

    Background Geminiviruses are emerging plant pathogens that infect a wide variety of crops including cotton, cassava, vegetables, ornamental plants and cereals. The geminivirus disease complex consists of monopartite begomoviruses that require betasatellites for the expression of disease symptoms. These complexes are widespread throughout the Old World and cause economically important diseases on several crops. A single protein encoded by betasatellites, termed βC1, is a suppressor of gene silencing, inducer of disease symptoms and is possibly involved in virus movement. Studies of the interaction of βC1 with hosts can provide useful insight into virus-host interactions and aid in the development of novel control strategies. We have used the differential display technique to isolate host genes which are differentially regulated upon transient expression of the βC1 protein of chili leaf curl betasatellite (ChLCB) in Nicotiana tabacum. Results Through differential display analysis, eight genes were isolated from Nicotiana tabacum, at two and four days after infitration with βC1 of ChLCB, expressed under the control of the Cauliflower mosaic virus 35S promoter. Cloning and sequence analysis of differentially amplified products suggested that these genes were involved in ATP synthesis, and acted as electron carriers for respiration and photosynthesis processes. These differentially expressed genes (DEGs) play an important role in plant growth and development, cell protection, defence processes, replication mechanisms and detoxification responses. Kegg orthology based annotation system analysis of these DEGs demonstrated that one of the genes, coding for polynucleotide nucleotidyl transferase, is involved in purine and pyrimidine metabolic pathways and is an RNA binding protein which is involved in RNA degradation. Conclusion βC1 differentially regulated genes are mostly involved in chloroplast and mitochondrial functions. βC1 also increases the expression of those

  5. Differential expression on mitochondrial tryparedoxin peroxidase (mTcTXNPx) in Trypanosoma cruzi after ferrocenyl diamine hydrochlorides treatments.

    PubMed

    Kohatsu, Andréa A N; Silva, Flávia A J; Francisco, Acácio I; Rimoldi, Aline; Silva, Marco T A; Vargas, Maria D; Rosa, João A da; Cicarelli, Regina M B

    Resistance to benznidazole in certain strains of Trypanosoma cruzi may be caused by the increased production of enzymes that act on the oxidative metabolism, such as mitochondrial tryparedoxin peroxidase which catalyses the reduction of peroxides. This work presents cytotoxicity assays performed with ferrocenyl diamine hydrochlorides in six different strains of T. cruzi epimastigote forms (Y, Bolivia, SI1, SI8, QMII, and SIGR3). The last four strains have been recently isolated from triatominae and mammalian host (domestic cat). The expression of mitochondrial tryparedoxin peroxidase was analyzed by the Western blotting technique using polyclonal antibody anti mitochondrial tryparedoxin peroxidase obtained from a rabbit immunized with the mitochondrial tryparedoxin peroxidase recombinant protein. All the tested ferrocenyl diamine hydrochlorides were more cytotoxic than benznidazole. The expression of the 25.5kDa polypeptide of mitochondrial tryparedoxin peroxidase did not increase in strains that were more resistant to the ferrocenyl compounds (SI8 and SIGR3). In addition, a 58kDa polypeptide was also recognized in all strains. Ferrocenyl diamine hydrochlorides showed trypanocidal activity and the expression of 25.5kDa mitochondrial tryparedoxin peroxidase is not necessarily increased in some T. cruzi strains. Most likely, other mechanisms, in addition to the over expression of this antioxidative enzyme, should be involved in the escape of parasites from cytotoxic oxidant agents.

  6. RNA sequencing reveals differential expression of mitochondrial and oxidation reduction genes in the long-lived naked mole-rat when compared to mice.

    PubMed

    Yu, Chuanfei; Li, Yang; Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G; Coen, Clive W; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M

    2011-01-01

    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics.

  7. Bottom-up proteomics suggests an association between differential expression of mitochondrial proteins and chronic fatigue syndrome.

    PubMed

    Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L

    2016-09-27

    Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments.

  8. Genes Related to Mitochondrial Functions, Protein Degradation, and Chromatin Folding Are Differentially Expressed in Lymphomonocytes of Rett Syndrome Patients

    PubMed Central

    Leoni, Guido; Cervellati, Franco; Canali, Raffaella; Cortelazzo, Alessio; De Felice, Claudio; Ciccoli, Lucia; Hayek, Joussef

    2013-01-01

    Rett syndrome (RTT) is mainly caused by mutations in the X-linked methyl-CpG binding protein (MeCP2) gene. By binding to methylated promoters on CpG islands, MeCP2 protein is able to modulate several genes and important cellular pathways. Therefore, mutations in MeCP2 can seriously affect the cellular phenotype. Today, the pathways that MeCP2 mutations are able to affect in RTT are not clear yet. The aim of our study was to investigate the gene expression profiles in peripheral blood lymphomonocytes (PBMC) isolated from RTT patients to try to evidence new genes and new pathways that are involved in RTT pathophysiology. LIMMA (Linear Models for MicroArray) and SAM (Significance Analysis of Microarrays) analyses on microarray data from 12 RTT patients and 7 control subjects identified 482 genes modulated in RTT, of which 430 were upregulated and 52 were downregulated. Functional clustering of a total of 146 genes in RTT identified key biological pathways related to mitochondrial function and organization, cellular ubiquitination and proteosome degradation, RNA processing, and chromatin folding. Our microarray data reveal an overexpression of genes involved in ATP synthesis suggesting altered energy requirement that parallels with increased activities of protein degradation. In conclusion, these findings suggest that mitochondrial-ATP-proteasome functions are likely to be involved in RTT clinical features. PMID:24453408

  9. Bottom-up proteomics suggests an association between differential expression of mitochondrial proteins and chronic fatigue syndrome

    PubMed Central

    Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L

    2016-01-01

    Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments. PMID:27676445

  10. Differential expression of citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans in response to developmental status and carbon sources.

    PubMed

    Min, In Sook; Bang, Ji Young; Seo, Soon Won; Lee, Cheong Ho; Maeng, Pil Jae

    2010-04-01

    As an extension of our previous studies on the mitochondrial citrate synthase of Aspergillus nidulans and cloning of its coding gene (citA), we analyzed differential expression of citA in response to the progress of development and change of carbon source. The cDNA consisted of 1,700 nucleotides and was predicted to encode a 474-amino acid protein. By comparing the cDNA sequence with the corresponding genomic sequence, we confirmed that citA gene contains 7 introns and that its transcription starts at position -26 (26-nucleotide upstream from the initiation codon). Four putative CreA binding motifs and three putative stress-response elements (STREs) were found within the 1.45-kb citA promoter region. The mode of citA expression was examined by both Northern blot and confocal microscopy using green fluorescent protein (sGFP) as a vital reporter. During vegetative growth and asexual development, the expression of citA was ubiquitous throughout the whole fungal body including mycelia and conidiophores. During sexual development, the expression of citA was quite strong in cleistothecial shells, but significantly weak in the content of cleistothecia including ascospores. Acetate showed a strong inductive effect on citA expression, which is subjected to carbon catabolite repression (CCR) caused by glucose. The recombinant fusion protein CitA(40)::sGFP (sGFP containing the 40-amino acid N-terminal segment of CitA) was localized into mitochondria, which supports that a mitochondrial targeting signal is included within the 40-amino acid N-terminal segment of CitA.

  11. Differential expression of cardiac muscle mitochondrial matrix proteins in broilers from ascites-resistant and susceptible lines.

    PubMed

    Cisar, C R; Balog, J M; Anthony, N B; Donoghue, A M

    2005-05-01

    Ascites is a metabolic disorder of modern broilers that is distinguished by cardiopulmonary insufficiency in the face of intense oxygen demands of rapidly growing tissues. Broilers with ascites exhibit sustained elevation of pulmonary arterial pressure and right ventricular hypertrophy, the end result of which is heart failure. It has been shown that mitochondrial function is impaired in broilers with ascites. In the current study, mitochondrial matrix protein levels were compared between ascites-resistant line broilers and ascites-susceptible line broilers with and without ascites using two-dimensional (2-D) gel electrophoresis. One hundred seventy-two protein spots were detected on the gels, and 9 of the spots were present at different levels in the 4 groups of broilers. These 9 protein spots were selected for identification by mass spectrometry. Two of the spots were found to contain single mitochondrial matrix proteins. Both mitochondrial matrix proteins, the dihydrolipoamide succinyltransferase component of the 2-oxoglutarate dehydrogenase complex and the alpha-subunit of mitochondrial trifunctional enzyme, were present at higher levels in ascites-resistant line broilers with ascites in the present study. The elevated levels of 2 key proteins in aerobic metabolism in ascites-resistant line broilers with ascites observed in the present study suggests that the mitochondria of broilers with this disease may respond inappropriately to hypoxia.

  12. Regulation of mitochondrial gene expression, the epigenetic enigma.

    PubMed

    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G

    2017-03-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  13. Mitochondrial DNA replication during differentiation of murine embryonic stem cells.

    PubMed

    Facucho-Oliveira, Joao M; Alderson, Jon; Spikings, Emma C; Egginton, Stuart; St John, Justin C

    2007-11-15

    Oxidative phosphorylation (OXPHOS), the intracellular process that generates the majority of the ATP of a cell through the electron-transfer chain, is highly dependent on proteins encoded by the mitochondrial genome (mtDNA). MtDNA replication is regulated by the nuclear-encoded mitochondrial transcription factor A (TFAM) and the mitochondrial-specific DNA polymerase gamma, which consists of a catalytic (POLG) and an accessory (POLG2) subunit. Differentiation of pluripotent embryonic stem cells (ESCs) into specific cell types requires expansion of discrete populations of mitochondria and mtDNA replication to meet the specific metabolic requirements of the cell. We determined by real-time PCR that expression of pluripotent markers is reduced before the upregulation of Polg, Polg2 and Tfam in spontaneously differentiating R1 murine (m)ESCs, along with transient increases in mtDNA copy number. In D3 mESCs, the initial transient increase did not take place. However, precursors of neuronal and cardiomyocyte differentiation were positive for both POLG and TFAM. Similar-stage ESCs also showed active mtDNA replication, identified by 5-bromo-2'-deoxy-uridine labelling, as mtDNA copy number increased. Retinoic-acid-induced differentiation resulted in more consistent patterns of replication and upregulation of Polg, Polg2 and Tfam, whereas siRNA knockdown demonstrated that steady-state expression of POLG is essential for maintaining pluripotency.

  14. Mitochondrial respiration regulates adipogenic differentiation of human mesenchymal stem cells.

    PubMed

    Zhang, Yanmin; Marsboom, Glenn; Toth, Peter T; Rehman, Jalees

    2013-01-01

    Human mesenchymal stem cells (MSCs) are adult multipotent stem cells which can be isolated from bone marrow, adipose tissue as well as other tissues and have the capacity to differentiate into a variety of mesenchymal cell types such as adipocytes, osteoblasts and chondrocytes. Differentiation of stem cells into mature cell types is guided by growth factors and hormones, but recent studies suggest that metabolic shifts occur during differentiation and can modulate the differentiation process. We therefore investigated mitochondrial biogenesis, mitochondrial respiration and the mitochondrial membrane potential during adipogenic differentiation of human MSCs. In addition, we inhibited mitochondrial function to assess its effects on adipogenic differentiation. Our data show that mitochondrial biogenesis and oxygen consumption increase markedly during adipogenic differentiation, and that reducing mitochondrial respiration by hypoxia or by inhibition of the mitochondrial electron transport chain significantly suppresses adipogenic differentiation. Furthermore, we used a novel approach to suppress mitochondrial activity using a specific siRNA-based knockdown of the mitochondrial transcription factor A (TFAM), which also resulted in an inhibition of adipogenic differentiation. Taken together, our data demonstrates that increased mitochondrial activity is a prerequisite for MSC differentiation into adipocytes. These findings suggest that metabolic modulation of adult stem cells can maintain stem cell pluripotency or direct adult stem cell differentiation.

  15. Mitochondrial DNA Damage and its Consequences for Mitochondrial Gene Expression

    PubMed Central

    Cline, Susan D.

    2012-01-01

    How mitochondria process DNA damage and whether a change in the steady-state level of mitochondrial DNA damage (mtDNA) contributes to mitochondrial dysfunction are questions that fuel burgeoning areas of research into aging and disease pathogenesis. Over the past decade, researchers have identified and measured various forms of endogenous and environmental mtDNA damage and have elucidated mtDNA repair pathways. Interestingly, mitochondria do not appear to contain the full range of DNA repair mechanisms that operate in the nucleus, although mtDNA contains types of damage that are targets of each nuclear DNA repair pathway. The reduced repair capacity may, in part, explain the high mutation frequency of the mitochondrial chromosome. Since mtDNA replication is dependent on transcription, mtDNA damage may alter mitochondrial gene expression at three levels: by causing DNA polymerase γ nucleotide incorporation errors leading to mutations, by interfering with the priming of mtDNA replication by the mitochondrial RNA polymerase, or by inducing transcriptional mutagenesis or premature transcript termination. This review summarizes our current knowledge of mtDNA damage, its repair, and its effects on mtDNA integrity and gene expression. PMID:22728831

  16. Changes, and the Relevance Thereof, in Mitochondrial Morphology during Differentiation into Endothelial Cells

    PubMed Central

    Shin, Ji Won; Park, So Hee; Kang, Yun Gyeong; Wu, Yanru; Choi, Hyun Ju

    2016-01-01

    The roles of mitochondria in various physiological functions of vascular endothelial cells have been investigated extensively. Morphological studies in relation to physiological functions have been performed. However, there have been few reports of morphological investigations related to stem cell differentiation. This was the first morphological study of mitochondria in relation to endothelial differentiation and focused on quantitative analysis of changes in mitochondrial morphology, number, area, and length during differentiation of human mesenchymal stem cells (hMSCs) into endothelial-like cells. To induce differentiation, we engaged vascular endothelial growth factors and flow-induced shear stress. Cells were classified according to the expression of von Willebrand factor as hMSCs, differentiating cells, and almost fully differentiated cells. Based on imaging analysis, we investigated changes in mitochondrial number, area, and length. In addition, mitochondrial networks were quantified on a single-mitochondrion basis by introducing a branch form factor. The data indicated that the mitochondrial number, area per cell, and length were decreased with differentiation. The mitochondrial morphology became simpler with progression of differentiation. These findings could be explained in view of energy level during differentiation; a higher level of energy is needed during differentiation, with larger numbers of mitochondria with branches. Application of this method to differentiation into other lineages will explain the energy levels required to control stem cell differentiation. PMID:27517609

  17. Mitochondrial and Metabolic Gene Expression in the Aged Rat Heart

    PubMed Central

    Barton, Gregory P.; Sepe, Joseph J.; McKiernan, Susan H.; Aiken, Judd M.; Diffee, Gary M.

    2016-01-01

    Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function, and AMP-activated protein kinase (AMPK) activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo), Old (33 mo), and old exercise trained (Old + EXE) (34 mo) FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05) expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α), peroxisome proliferator activated receptor alpha (PPARα), and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity, and mitochondrial function in the heart. PMID:27601998

  18. Effects of silica and titanium oxide particles on a human neural stem cell line: morphology, mitochondrial activity, and gene expression of differentiation markers.

    PubMed

    Fujioka, Kouki; Hanada, Sanshiro; Inoue, Yuriko; Sato, Keisuke; Hirakuri, Kenji; Shiraishi, Kouichi; Kanaya, Fumihide; Ikeda, Keiichi; Usui, Ritsuko; Yamamoto, Kenji; Kim, Seung U; Manome, Yoshinobu

    2014-07-02

    Several in vivo studies suggest that nanoparticles (smaller than 100 nm) have the ability to reach the brain tissue. Moreover, some nanoparticles can penetrate into the brains of murine fetuses through the placenta by intravenous administration to pregnant mice. However, it is not clear whether the penetrated nanoparticles affect neurogenesis or brain function. To evaluate its effects on neural stem cells, we assayed a human neural stem cell (hNSCs) line exposed in vitro to three types of silica particles (30 nm, 70 nm, and <44 µm) and two types of titanium oxide particles (80 nm and < 44 µm). Our results show that hNSCs aggregated and exhibited abnormal morphology when exposed to the particles at concentrations = 0.1 mg/mL for 7 days. Moreover, all the particles affected the gene expression of Nestin (stem cell marker) and neurofilament heavy polypeptide (NF-H, neuron marker) at 0.1 mg/mL. In contrast, only 30-nm silica particles at 1.0 mg/mL significantly reduced mitochondrial activity. Notably, 30-nm silica particles exhibited acute membrane permeability at concentrations =62.5 µg/mL in 24 h. Although these concentrations are higher than the expected concentrations of nanoparticles in the brain from in vivo experiments in a short period, these thresholds may indicate the potential toxicity of accumulated particles for long-term usage or continuous exposure.

  19. Mitochondria in mesenchymal stem cell biology and cell therapy: From cellular differentiation to mitochondrial transfer.

    PubMed

    Hsu, Yi-Chao; Wu, Yu-Ting; Yu, Ting-Hsien; Wei, Yau-Huei

    2016-04-01

    Mesenchymal stem cells (MSCs) are characterized to have the capacity of self-renewal and the potential to differentiate into mesoderm, ectoderm-like and endoderm-like cells. MSCs hold great promise for cell therapies due to their multipotency in vitro and therapeutic advantage of hypo-immunogenicity and lower tumorigenicity. Moreover, it has been shown that MSCs can serve as a vehicle to transfer mitochondria into cells after cell transplantation. Mitochondria produce most of the energy through oxidative phosphorylation in differentiated cells. It has been increasingly clear that the switch of energy supply from glycolysis to aerobic metabolism is essential for successful differentiation of MSCs. Post-translational modifications of proteins have been established to regulate mitochondrial function and metabolic shift during MSCs differentiation. In this article, we review and provide an integrated view on the roles of different protein kinases and sirtuins in the maintenance and differentiation of MSCs. Importantly, we provide evidence to suggest that alteration in the expression of Sirt3 and Sirt5 and relative changes in the acylation levels of mitochondrial proteins might be involved in the activation of mitochondrial function and adipogenic differentiation of adipose-derived MSCs. We summarize their roles in the regulation of mitochondrial biogenesis and metabolism, oxidative responses and differentiation of MSCs. On the other hand, we discuss recent advances in the study of mitochondrial dynamics and mitochondrial transfer as well as their roles in the differentiation and therapeutic application of MSCs to improve cell function in vitro and in animal models. Accumulating evidence has substantiated that the therapeutic potential of MSCs is conferred not only by cell replacement and paracrine effects but also by transferring mitochondria into injured tissues or cells to modulate the cellular metabolism in situ. Therefore, elucidation of the underlying mechanisms

  20. Expression of polyalanine stretches induces mitochondrial dysfunction.

    PubMed

    Toriumi, Kazuya; Oma, Yoko; Kino, Yoshihiro; Futai, Eugene; Sasagawa, Noboru; Ishiura, Shoichi

    2008-05-15

    In recent years, several novel types of disorders have been characterized, including what have been termed polyalanine diseases, in which patients have expanded triplet repeats in specific genes, resulting in the translation of aberrantly elongated polyalanine stretches. In this study, we showed that yellow fluorescent protein (YFP)-fused elongated polyalanine stretches localized exclusively to the cytoplasm and formed aggregates. Additionally, the polyalanine stretches themselves were toxic. We sought to identify proteins that bound directly to the polyalanine stretches, as factors that might be involved in triggering cell death. Many mitochondrial proteins were identified as polyalanine-binding proteins. We showed that one of the identified proteins, succinate dehydrogenase subunit A, was decreased in the mitochondria of cells expressing polyalanine stretches; as a result, succinate oxidative activity was decreased. Furthermore, the polyalanine stretches also associated directly with mitochondria. This suggests that polya-lanine stretches might directly induce cell death. Additionally, the mitochondrial membrane potential was reduced in cells expressing polyalanine stretches. We propose a novel mechanism by which polyalanine stretches may cause cytotoxicity through mitochondrial dysfunction. This may be a common mechanism underlying the pathogenesis of all polyalanine diseases.

  1. Dynamic Regulation of Genes Involved in Mitochondrial DNA Replication and Transcription during Mouse Brown Fat Cell Differentiation and Recruitment

    PubMed Central

    Murholm, Maria; Dixen, Karen; Qvortrup, Klaus; Hansen, Lillian H. L.; Amri, Ez-Zoubir; Madsen, Lise; Barbatelli, Giorgio; Quistorff, Bjørn; Hansen, Jacob B.

    2009-01-01

    Background Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1) and a remarkably higher mitochondrial abundance in brown adipocytes. Methodology/Principal Findings Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white and brown fat, brown adipose tissue fractions and in selected adipose tissues during cold exposure. We find a massive induction of the majority of such genes during brown adipocyte differentiation and recruitment, e.g. of the mitochondrial transcription factors A (Tfam) and B2 (Tfb2m), whereas only a subset of the same genes were induced during white adipose conversion. In addition, PR domain containing 16 (PRDM16) was found to be expressed at substantially higher levels in brown compared to white pre-adipocytes and adipocytes. We demonstrate that forced expression of Tfam but not Tfb2m in brown adipocyte precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. Conclusions/Significance Using both in vitro and in vivo model systems of white and brown fat cell differentiation, we report a detailed characterisation of gene expression linked to mitochondrial biogenesis and function. We find significant differences in differentiating white and brown adipocytes, which might explain the notable increase in mitochondrial content observed during brown adipose conversion. In addition, our data support a key role of PRDM16 in triggering brown adipocyte differentiation, including mitochondrial biogenesis and expression of UCP1

  2. Alternative NF-κB Regulates RANKL-induced Osteoclast Differentiation and Mitochondrial Biogenesis via Independent Mechanisms

    PubMed Central

    Zeng, Rong; Faccio, Roberta; Novack, Deborah V

    2016-01-01

    Mitochondrial biogenesis, the generation of new mitochondrial DNA and proteins, has been linked to osteoclast (OC) differentiation and function. In this study we used mice with mutations in key alternative NF-κB pathway proteins, RelB and NIK, to dissect the complex relationship between mitochondrial biogenesis and osteoclastogenesis. OC precursors lacking either NIK or RelB, RANKL were unable to increase mitochondrial DNA or OxPhos protein expression, associated with lower oxygen consumption rates. Transgenic OC precursors expressing constitutively active NIK showed normal RANKL-induced mitochondrial biogenesis (OxPhos expression and mitochondria copy number) compared to controls, but larger mitochondrial dimensions and increased oxygen consumption rates, suggesting increased mitochondrial function. To deduce the mechanism for mitochondrial biogenesis defects in NIK- and RelB-deficient precursors, we examined expression of genes known to control this process. PGC-1β (Ppargc1b) expression, but not PGC-1α, PPRC1 or ERRα, was significantly reduced in RelB−/− and NIK−/− OCs. Because PGC-1β has been reported to positively regulate both mitochondrial biogenesis and differentiation in OCs, we retrovirally overexpressed PGC-1β in RelB−/− cells, but surprisingly found that it did not affect differentiation, nor restore RANKL-induced mitochondrial biogenesis. To determine whether the blockade in osteoclastogenesis in RelB-deficient cells precludes mitochondrial biogenesis, we rescued RelB−/− differentiation via overexpression of NFATc1. Mitochondrial parameters in neither WT nor RelB-deficient cultures were affected by NFATc1 overexpression, and bone resorption in RelB −/− was not restored. Furthermore, NFATc1 co-overexpression with PGC-1β, while allowing OC differentiation, did not rescue mitochondrial biogenesis or bone resorption in RelB−/− OCs, by CTX-I levels. Thus, our results indicate that the alternative NF-κB pathway plays dual, but

  3. Differential Expression Analysis for Pathways

    PubMed Central

    Haynes, Winston A.; Higdon, Roger; Stanberry, Larissa; Collins, Dwayne; Kolker, Eugene

    2013-01-01

    Life science technologies generate a deluge of data that hold the keys to unlocking the secrets of important biological functions and disease mechanisms. We present DEAP, Differential Expression Analysis for Pathways, which capitalizes on information about biological pathways to identify important regulatory patterns from differential expression data. DEAP makes significant improvements over existing approaches by including information about pathway structure and discovering the most differentially expressed portion of the pathway. On simulated data, DEAP significantly outperformed traditional methods: with high differential expression, DEAP increased power by two orders of magnitude; with very low differential expression, DEAP doubled the power. DEAP performance was illustrated on two different gene and protein expression studies. DEAP discovered fourteen important pathways related to chronic obstructive pulmonary disease and interferon treatment that existing approaches omitted. On the interferon study, DEAP guided focus towards a four protein path within the 26 protein Notch signalling pathway. PMID:23516350

  4. Mitochondrial aerobic respiration is activated during hair follicle stem cell differentiation, and its dysfunction retards hair regeneration

    PubMed Central

    Tang, Yan; Luo, Binping; Deng, Zhili; Wang, Ben; Liu, Fangfen; Li, Jinmao; Shi, Wei; Xie, Hongfu; Hu, Xingwang

    2016-01-01

    Background. Emerging research revealed the essential role of mitochondria in regulating stem/progenitor cell differentiation of neural progenitor cells, mesenchymal stem cells and other stem cells through reactive oxygen species (ROS), Notch or other signaling pathway. Inhibition of mitochondrial protein synthesis results in hair loss upon injury. However, alteration of mitochondrial morphology and metabolic function during hair follicle stem cells (HFSCs) differentiation and how they affect hair regeneration has not been elaborated upon. Methods. We compared the difference in mitochondrial morphology and activity between telogen bulge cells and anagen matrix cells. Expression levels of mitochondrial ROS and superoxide dismutase 2 (SOD2) were measured to evaluate redox balance. In addition, the level of pyruvate dehydrogenase kinase (PDK) and pyruvate dehydrogenase (PDH) were estimated to present the change in energetic metabolism during differentiation. To explore the effect of the mitochondrial metabolism on regulating hair regeneration, hair growth was observed after application of a mitochondrial respiratory inhibitor upon hair plucking. Results. During HFSCs differentiation, mitochondria became elongated with more abundant organized cristae and showed higher activity in differentiated cells. SOD2 was enhanced for redox balance with relatively stable ROS levels in differentiated cells. PDK increased in HFSCs while differentiated cells showed enhanced PDH, indicating that respiration switched from glycolysis to oxidative phosphorylation during differentiation. Inhibiting mitochondrial respiration in differentiated hair follicle cells upon hair plucking repressed hair regeneration in vivo. Conclusions. Upon HFSCs differentiation, mitochondria are elongated with more abundant cristae and show higher activity, accompanying with activated aerobic respiration in differentiated cells for higher energy supply. Also, dysfunction of mitochondrial respiration delays hair

  5. Defining a Model for Mitochondrial Function in mESC Differentiation

    EPA Science Inventory

    Defining a Model for Mitochondrial Function in mESC DifferentiationDefining a Model for Mitochondrial Function in mESC Differentiation Differentiating embryonic stem cells (ESCs) undergo mitochondrial maturation leading to a switch from a system dependent upon glycolysis to a re...

  6. Proinflammatory cytokines differentially regulate adipocyte mitochondrial metabolism, oxidative stress, and dynamics

    PubMed Central

    Hahn, Wendy S.; Kuzmicic, Jovan; Burrill, Joel S.; Donoghue, Margaret A.; Foncea, Rocio; Jensen, Michael D.; Lavandero, Sergio; Arriaga, Edgar A.

    2014-01-01

    Proinflammatory cytokines differentially regulate adipocyte mitochondrial metabolism, oxidative stress, and dynamics. Macrophage infiltration of adipose tissue and the chronic low-grade production of inflammatory cytokines have been mechanistically linked to the development of insulin resistance, the forerunner of type 2 diabetes mellitus. In this study, we evaluated the chronic effects of TNFα, IL-6, and IL-1β on adipocyte mitochondrial metabolism and morphology using the 3T3-L1 model cell system. TNFα treatment of cultured adipocytes led to significant changes in mitochondrial bioenergetics, including increased proton leak, decreased ΔΨm, increased basal respiration, and decreased ATP turnover. In contrast, although IL-6 and IL-1β decreased maximal respiratory capacity, they had no effect on ΔΨm and varied effects on ATP turnover, proton leak, or basal respiration. Only TNFα treatment of 3T3-L1 cells led to an increase in oxidative stress (as measured by superoxide anion production and protein carbonylation) and C16 ceramide synthesis. Treatment of 3T3-L1 adipocytes with cytokines led to decreased mRNA expression of key transcription factors and control proteins implicated in mitochondrial biogenesis, including PGC-1α and eNOS as well as deceased expression of COX IV and Cyt C. Whereas each cytokine led to effects on expression of mitochondrial markers, TNFα exclusively led to mitochondrial fragmentation and decreased the total level of OPA1 while increasing OPA1 cleavage, without expression of levels of mitofusin 2, DRP-1, or mitofilin being affected. In summary, these results indicate that inflammatory cytokines have unique and specialized effects on adipocyte metabolism, but each leads to decreased mitochondrial function and a reprogramming of fat cell biology. PMID:24595304

  7. The Differential DRP1 Phosphorylation and Mitochondrial Dynamics in the Regional Specific Astroglial Death Induced by Status Epilepticus

    PubMed Central

    Ko, Ah-Reum; Hyun, Hye-Won; Min, Su-Ji; Kim, Ji-Eun

    2016-01-01

    The response and susceptibility to astroglial degenerations are relevant to the distinctive properties of astrocytes in a hemodynamic-independent manner following status epilepticus (SE). Since impaired mitochondrial fission plays an important role in mitosis, apoptosis and programmed necrosis, we investigated whether the unique pattern of mitochondrial dynamics is involved in the characteristics of astroglial death induced by SE. In the present study, SE induced astroglial apoptosis in the molecular layer of the dentate gyrus, accompanied by decreased mitochondrial length. In contrast, clasmatodendritic (autophagic) astrocytes in the CA1 region showed mitochondrial elongation induced by SE. Mdivi-1 (an inhibitor of mitochondrial fission) effectively attenuated astroglial apoptosis, but WY14643 (an enhancer of mitochondrial fission) aggravated it. In addition, Mdivi-1 accelerated clasmatodendritic changes in astrocytes. These regional specific mitochondrial dynamics in astrocytes were closely correlated with dynamin-related protein 1 (DRP1; a mitochondrial fission protein) phosphorylation, not optic atrophy 1 (OPA1; a mitochondrial fusion protein) expression. To the best of our knowledge, the present data demonstrate for the first time the novel role of DRP1-mediated mitochondrial fission in astroglial loss. Thus, the present findings suggest that the differential astroglial mitochondrial dynamics may participate in the distinct characteristics of astroglial death induced by SE. PMID:27242436

  8. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly.

    PubMed

    Shan, Yuxi; Cortopassi, Gino

    2016-01-01

    Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with the gene Hspa9/Mortalin in multiple ways: the HSPA9 locus maps to 5q31.2 that is frequently deleted in human MDS; mutant Hspa9 causes zebrafish MDS; and Hspa9 knockdown mice have decreased hematopoiesis. We show here that HSPA9 functions in mitochondrial ISC biogenesis, and is required for erythroid differentiation. HSPA9 interacts with and stabilizes the mitochondrial ISC biogenesis proteins frataxin, Nfs1, ISCU, and Nfu. MDS-causing mutations in HSPA9 protein change its interactions with ISC biogenesis proteins. Depletion of HSPA9 decreases aconitase activity, which requires an ISC at its active site, but not that of the non-ISC requiring malate dehydrogenase, and increases IRP1 binding activity. In erythroid cell lines, Hspa9 depletion inhibited erythroid differentiation, post-transcriptionally regulating the expression of Alas2 and FeCH, as expected through known ISC control of the IRE response elements in these genes. By contrast, the Alas2 open reading frame rescued the Hspa9-dependent defect in erythroid differentiation, but not when uncoupled from its 5'-IRE sequence. Thus, Hspa9 depletion causes a mitochondrial ISC deficit, altering IRP1-IRE binding and FeCH stability, which consequently inhibits Alas2 translation, heme synthesis, and erythroid differentiation, i.e.: Hspa9->ISC->IRP/IRE->Alas2->heme synthesis->erythroid differentiation. Thus Hspa9 regulates erythroid differentiation through ISC cluster assembly, providing a pathophysiological mechanism for an MDS subtype characterized by HSPA9 haploinsufficiency, and suggests hemin and other pharmacological stimulators of ISC synthesis as potential routes to therapy.

  9. A Flavonoid Compound Promotes Neuronal Differentiation of Embryonic Stem Cells via PPAR-β Modulating Mitochondrial Energy Metabolism

    PubMed Central

    Mei, Yu-qin; Pan, Zong-fu; Chen, Wen-teng; Xu, Min-hua; Zhu, Dan-yan; Yu, Yong-ping; Lou, Yi-jia

    2016-01-01

    Relatively little is known regarding mitochondrial metabolism in neuronal differentiation of embryonic stem (ES) cells. By using a small molecule, present research has investigated the pattern of cellular energy metabolism in neural progenitor cells derived from mouse ES cells. Flavonoid compound 4a faithfully facilitated ES cells to differentiate into neurons morphologically and functionally. The expression and localization of peroxisome proliferator-activated receptors (PPARs) were examined in neural progenitor cells. PPAR-β expression showed robust upregulation compared to solvent control. Treatment with PPAR-β agonist L165041 alone or together with compound 4a significantly promoted neuronal differentiation, while antagonist GSK0660 blocked the neurogenesis-promoting effect of compound 4a. Consistently, knockdown of PPAR-β in ES cells abolished compound 4a-induced neuronal differentiation. Interestingly, we found that mitochondrial fusion protein Mfn2 was also abolished by sh-PPAR-β, resulting in abnormal mitochondrial Ca2+ ([Ca2+]M) transients as well as impaired mitochondrial bioenergetics. In conclusion, we demonstrated that by modulating mitochondrial energy metabolism through Mfn2 and mitochondrial Ca2+, PPAR-β took an important role in neuronal differentiation induced by flavonoid compound 4a. PMID:27315062

  10. Differentiation of Human Neural Stem Cells into Motor Neurons Stimulates Mitochondrial Biogenesis and Decreases Glycolytic Flux

    PubMed Central

    Keeney, Paula M.

    2015-01-01

    Differentiation of human pluripotent stem cells (hPSCs) in vitro offers a way to study cell types that are not accessible in living patients. Previous research suggests that hPSCs generate ATP through anaerobic glycolysis, in contrast to mitochondrial oxidative phosphorylation (OXPHOS) in somatic cells; however, specialized cell types have not been assessed. To test if mitobiogenesis is increased during motor neuron differentiation, we differentiated human embryonic stem cell (hESC)- and induced pluripotent stem cell-derived human neural stem cells (hNSCs) into motor neurons. After 21 days of motor neuron differentiation, cells increased mRNA and protein levels of genes expressed by postmitotic spinal motor neurons. Electrophysiological analysis revealed voltage-gated currents characteristic of excitable cells and action potential formation. Quantitative PCR revealed an increase in peroxisome proliferator-activated receptor gamma coactivator 1-α (PGC-1α), an upstream regulator of transcription factors involved in mitobiogenesis, and several of its downstream targets in hESC-derived cultures. This correlated with an increase in protein expression of respiratory subunits, but no increase in protein reflecting mitochondrial mass in either cell type. Respiration analysis revealed a decrease in glycolytic flux in both cell types on day 21 (D21), suggesting a switch from glycolysis to OXPHOS. Collectively, our findings suggest that mitochondrial biogenesis, but not mitochondrial mass, is increased during differentiation of hNSCs into motor neurons. These findings help us to understand human motor neuron mitobiogenesis, a process impaired in amyotrophic lateral sclerosis, a neurodegenerative disease characterized by death of motor neurons in the brain and spinal cord. PMID:25892363

  11. Moderate superoxide production is an early promoter of mitochondrial biogenesis in differentiating N2a neuroblastoma cells.

    PubMed

    Valero, T; Moschopoulou, G; Mayor-Lopez, L; Kintzios, S

    2012-12-01

    Reactive oxygen species (ROS) have been widely considered as harmful for cell development and as promoters of cell aging by increasing oxidative stress. However, ROS have an important role in cell signaling and they have been demonstrated to be beneficial by triggering hormetic signals, which could protect the organism from later insults. In the present study, N2a murine neuroblastoma cells were used as a paradigm of cell-specific (neural) differentiation partly mediated by ROS. Differentiation was triggered by the established treatments of serum starvation, forskolin or dibutyryl cyclic AMP. A marked differentiation, expressed as the development of neurites, was detected by fixation and staining with coomassie brilliant blue after 48 h treatment. This was accompanied by an increase in mitochondrial mass detected by mitotracker green staining, an increased expression of the peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1-alpha (PGC-1α) and succinate dehydrogenase activity as detected by MTT. In line with these results, an increase in free radicals, specifically superoxide anion, was detected in differentiating cells by flow cytometry. Superoxide scavenging by MnTBAP and MAPK inhibition by PD98059 partially reversed differentiation and mitochondrial biogenesis. In this way, we demonstrated that mitochondrial biogenesis and differentiation are mediated by superoxide and MAPK cues. Our data suggest that differentiation and mitochondrial biogenesis in N2a cells are part of a hormetic response which is triggered by a modest increase of superoxide anion concentration within the mitochondria.

  12. Increased mitochondrial function downstream from KDM5A histone demethylase rescues differentiation in pRB-deficient cells

    PubMed Central

    Váraljai, Renáta; Islam, Abul B.M.M.K.; Beshiri, Michael L.; Rehman, Jalees; Lopez-Bigas, Nuria; Benevolenskaya, Elizaveta V.

    2015-01-01

    The retinoblastoma tumor suppressor protein pRb restricts cell growth through inhibition of cell cycle progression. Increasing evidence suggests that pRb also promotes differentiation, but the mechanisms are poorly understood, and the key question remains as to how differentiation in tumor cells can be enhanced in order to diminish their aggressive potential. Previously, we identified the histone demethylase KDM5A (lysine [K]-specific demethylase 5A), which demethylates histone H3 on Lys4 (H3K4), as a pRB-interacting protein counteracting pRB's role in promoting differentiation. Here we show that loss of Kdm5a restores differentiation through increasing mitochondrial respiration. This metabolic effect is both necessary and sufficient to induce the expression of a network of cell type-specific signaling and structural genes. Importantly, the regulatory functions of pRB in the cell cycle and differentiation are distinct because although restoring differentiation requires intact mitochondrial function, it does not necessitate cell cycle exit. Cells lacking Rb1 exhibit defective mitochondria and decreased oxygen consumption. Kdm5a is a direct repressor of metabolic regulatory genes, thus explaining the compensatory role of Kdm5a deletion in restoring mitochondrial function and differentiation. Significantly, activation of mitochondrial function by the mitochondrial biogenesis regulator Pgc-1α (peroxisome proliferator-activated receptor γ-coactivator 1α; also called PPARGC1A) a coactivator of the Kdm5a target genes, is sufficient to override the differentiation block. Overexpression of Pgc-1α, like KDM5A deletion, inhibits cell growth in RB-negative human cancer cell lines. The rescue of differentiation by loss of KDM5A or by activation of mitochondrial biogenesis reveals the switch to oxidative phosphorylation as an essential step in restoring differentiation and a less aggressive cancer phenotype. PMID:26314709

  13. Decreased Mitochondrial OGG1 Expression is Linked to Mitochondrial Defects and Delayed Hepatoma Cell Growth

    PubMed Central

    Lee, Young-Kyoung; Youn, Hwang-Guem; Wang, Hee-Jung; Yoon, Gyesoon

    2013-01-01

    Many solid tumor cells exhibit mitochondrial respiratory impairment; however, the mechanisms of such impairment in cancer development remain unclear. Here, we demonstrate that SNU human hepatoma cells with declined mitochondrial respiratory activity showed decreased expression of mitochondrial 8-oxoguanine DNA glycosylase/lyase (mtOGG1), a mitochondrial DNA repair enzyme; similar results were obtained with human hepatocellular carcinoma tissues. Among several OGG1-2 variants with a mitochondrial- targeting sequence (OGG1-2a, -2b, -2c, -2d, and -2e), OGG1-2a was the major mitochondrial isoform in all examined hepatoma cells. Interestingly, hepatoma cells with low mtOGG1 levels showed delayed cell growth and increased intracellular reactive oxygen species (ROS) levels. Knockdown of OGG1-2 isoforms in Chang-L cells, which have active mitochondrial respiration with high mtOGG1 levels, significantly decreased cellular respiration and cell growth, and increased intracellular ROS. Overexpression of OGG1-2a in SNU423 cells, which have low mtOGG1 levels, effectively recovered cellular respiration and cell growth activities, and decreased intracellular ROS. Taken together, our results suggest that mtOGG1 plays an important role in maintaining mitochondrial respiration, thereby contributing to cell growth of hepatoma cells. PMID:23677377

  14. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  15. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  16. Depletion of mitoferrins leads to mitochondrial dysfunction and impairment of adipogenic differentiation in 3T3-L1 preadipocytes.

    PubMed

    Chen, Y-C; Wu, Y-T; Wei, Y-H

    2015-01-01

    Dysregulation of iron homeostasis is a potential risk factor for type 2 diabetes mellitus (T2DM) and insulin resistance. Iron transported into mitochondria by mitoferrins is mainly utilized for the biosynthesis of iron-sulfur clusters, heme, and other cofactors. Recent studies revealed that mitochondrial dysfunction leads to impaired adipogenesis and insulin insensitivity in adipocytes. However, it is unknown whether mitochondrial iron import and iron status affect the biogenesis and function of mitochondria during adipogenic differentiation. In this study, we used double knockdown of mitoferrin 1 and mitoferrin 2 (Mfrn1/2) to investigate the role of mitochondrial iron homeostasis in mitochondrial bioenergetic function and adipogenic differentiation. The results showed that depletion of Mfrn1/2 in 3T3-L1 preadipocytes impaired the biosynthesis of iron-sulfur proteins in mitochondria due to a decrease in mitochondrial iron content. This was associated with a decrease in mitochondrial oxygen consumption rate and intracellular ATP level in adipocytes with Mfrn1/2 knockdown. Remarkably, Mfrn1/2 deficiency reduced the expression of adipogenic genes and lipid production during adipogenic differentiation. Moreover, insulin-induced glucose uptake and Akt phosphorylation at the Ser473 residue were decreased concurrently in adipocytes differentiated from 3T3-L1 preadipocytes after knockdown of Mfrn1/2. These findings suggest that dysregulation of mitochondrial iron metabolism elicited by knockdown of Mfrn1/2 results in mitochondrial dysfunction, which culminates in the compromise of differentiation and insulin insensitivity of adipocytes. This scenario may explain the recent findings that iron deficiency or alterations in iron metabolism are associated with the pathogenesis of T2DM.

  17. Unequal and genotype-dependent expression of mitochondrial genes in larvae of the pacific oyster Crassostrea gigas.

    PubMed

    Curole, Jason P; Meyer, Eli; Manahan, Donal T; Hedgecock, Dennis

    2010-04-01

    Mitochondria are essential for regulation of energy metabolism, but little is known about patterns of mitochondrial genome expression in invertebrates. To explore the association of mitochondrial expression with differential growth of Crassostrea gigas, the Pacific oyster, we crossed two inbred lines to produce inbred and hybrid larvae, which grew at different rates under the same environmental conditions. Using high-throughput cloning and sequencing methods, we identified 1.1 million expressed sequence tags from the mitochondrial genome, 96.7% of which were perfect matches to genes targeted by the method. Expression varied significantly among genes, ranging over nearly four orders of magnitude, from mt:lRNA, which constituted 21% of all transcripts, to mt:CoII, which constituted less than 0.02% of all transcripts. Variable expression of genes coding for subunits of macromolecular complexes (e.g., mt:CoI and mt:CoII) implies that stoichiometry in these complexes must be regulated post-transcriptionally. Surprisingly, the mitochondrial transcriptome contained non-coding transcripts, which may play a role in the regulation of mitochondrial function. Finally, mitochondrial expression depended strongly on maternal factors and nuclear-cytoplasmic interactions, which may explain previously observed growth differences between reciprocal hybrids. Differences in mitochondrial gene expression could provide a biochemical index for the metabolic basis of genetically determined differences in larval growth.

  18. Classical and Novel TSPO Ligands for the Mitochondrial TSPO Can Modulate Nuclear Gene Expression: Implications for Mitochondrial Retrograde Signaling.

    PubMed

    Yasin, Nasra; Veenman, Leo; Singh, Sukhdev; Azrad, Maya; Bode, Julia; Vainshtein, Alex; Caballero, Beatriz; Marek, Ilan; Gavish, Moshe

    2017-04-07

    It is known that knockdown of the mitochondrial 18 kDa translocator protein (TSPO) as well as TSPO ligands modulate various functions, including functions related to cancer. To study the ability of TSPO to regulate gene expression regarding such functions, we applied microarray analysis of gene expression to U118MG glioblastoma cells. Within 15 min, the classical TSPO ligand PK 11195 induced changes in expression of immediate early genes and transcription factors. These changes also included gene products that are part of the canonical pathway serving to modulate general gene expression. These changes are in accord with real-time, reverse transcriptase (RT) PCR. At the time points of 15, 30, 45, and 60 min, as well as 3 and 24 h of PK 11195 exposure, the functions associated with the changes in gene expression in these glioblastoma cells covered well known TSPO functions. These functions included cell viability, proliferation, differentiation, adhesion, migration, tumorigenesis, and angiogenesis. This was corroborated microscopically for cell migration, cell accumulation, adhesion, and neuronal differentiation. Changes in gene expression at 24 h of PK 11195 exposure were related to downregulation of tumorigenesis and upregulation of programmed cell death. In the vehicle treated as well as PK 11195 exposed cell cultures, our triple labeling showed intense TSPO labeling in the mitochondria but no TSPO signal in the cell nuclei. Thus, mitochondrial TSPO appears to be part of the mitochondria-to-nucleus signaling pathway for modulation of nuclear gene expression. The novel TSPO ligand 2-Cl-MGV-1 appeared to be very specific regarding modulation of gene expression of immediate early genes and transcription factors.

  19. Gemini surfactants mediate efficient mitochondrial gene delivery and expression.

    PubMed

    Cardoso, Ana M; Morais, Catarina M; Cruz, A Rita; Cardoso, Ana L; Silva, Sandra G; do Vale, M Luísa; Marques, Eduardo F; Pedroso de Lima, Maria C; Jurado, Amália S

    2015-03-02

    Gene delivery targeting mitochondria has the potential to transform the therapeutic landscape of mitochondrial genetic diseases. Taking advantage of the nonuniversal genetic code used by mitochondria, a plasmid DNA construct able to be specifically expressed in these organelles was designed by including a codon, which codes for an amino acid only if read by the mitochondrial ribosomes. In the present work, gemini surfactants were shown to successfully deliver plasmid DNA to mitochondria. Gemini surfactant-based DNA complexes were taken up by cells through a variety of routes, including endocytic pathways, and showed propensity for inducing membrane destabilization under acidic conditions, thus facilitating cytoplasmic release of DNA. Furthermore, the complexes interacted extensively with lipid membrane models mimicking the composition of the mitochondrial membrane, which predicts a favored interaction of the complexes with mitochondria in the intracellular environment. This work unravels new possibilities for gene therapy toward mitochondrial diseases.

  20. Differential Aminoacylase Expression in Neuroblastoma

    PubMed Central

    Long, Patrick M.; Stradecki, Holly M.; Minturn, Jane E.; Wesley, Umadevi V.; Jaworski, Diane M.

    2012-01-01

    Neuroblastoma, a cancer of the sympathetic nervous system, is the most common extracranial solid tumor in children. MYCN amplification and increased BDNF/TrkB signaling are features of high-risk tumors; yet, only ~25% of malignant tumors display these features. Thus, the identification of additional biomarkers and therapeutic targets is essential. Since aminoacylase 1 (ACY1), an amino acid deacetylase, is a putative tumor suppressor in small cell lung and renal cell carcinomas, we investigated whether it or the other family members aspartoacylase (ASPA, aminoacylase 2) or aminoacylase 3 (ACY3) could serve a similar function in neuroblastoma. Aminoacylase expression was examined in TrkB-positive, MYCN-amplified (SMS-KCNR and SK-N-BE) and TrkB-negative, non-MYCN amplified (SK-N-AS, SK-N-SH, SH-SY5Y, and SH-EP) neuroblastoma cell lines. Each aminoacylase exhibited distinct spatial localization (i.e., cytosolic ACY1, membrane-associated ASPA, and nuclear ACY3). When SK-N-SH cells were treated with neural differentiation agents (e.g., retinoic acid, cAMP) in media containing 10% serum ACY1 was the only aminoacylase whose expression was up-regulated. ASPA was primarily expressed in SH-EP cells of a glial sublineage. ACY3 was more highly expressed in the TrkB-positive, MYCN-amplified lines. All three aminoacylases were expressed in normal human adrenal gland, a common site of neuroblastoma origin, but only ACY1 and ACY3 displayed detectable expression in primary neuroblastoma tumor. Bioinformatics data mining of Kaplan-Meier survival revealed that high ACY3 expression is correlated with poor prognosis; while, low expression of ACY1 or ASPA is correlated with poor prognosis. These data suggest that aminoacylase expression is dysregulated in neuroblastoma. PMID:21128244

  1. Bioenergetics and mitochondrial transmembrane potential during differentiation of cultured osteoblasts

    NASA Technical Reports Server (NTRS)

    Komarova, S. V.; Ataullakhanov, F. I.; Globus, R. K.

    2000-01-01

    To evaluate the relationship between osteoblast differentiation and bioenergetics, cultured primary osteoblasts from fetal rat calvaria were grown in medium supplemented with ascorbate to induce differentiation. Before ascorbate treatment, the rate of glucose consumption was 320 nmol. h(-1). 10(6) cells(-1), respiration was 40 nmol. h(-1). 10(6) cells(-1), and the ratio of lactate production to glucose consumption was approximately 2, indicating that glycolysis was the main energy source for immature osteoblasts. Ascorbate treatment for 14 days led to a fourfold increase in respiration, a threefold increase in ATP production, and a fivefold increase in ATP content compared with that shown in immature cells. Confocal imaging of mitochondria stained with a transmembrane potential-sensitive vital dye showed that mature cells possessed abundant amounts of high-transmembrane-potential mitochondria, which were concentrated near the culture medium-facing surface. Acute treatment of mature osteoblasts with metabolic inhibitors showed that the rate of glycolysis rose to maintain the cellular energy supply constant. Thus progressive differentiation coincided with changes in cellular metabolism and mitochondrial activity, which are likely to play key roles in osteoblast function.

  2. AK2 deficiency compromises the mitochondrial energy metabolism required for differentiation of human neutrophil and lymphoid lineages

    PubMed Central

    Six, E; Lagresle-Peyrou, C; Susini, S; De Chappedelaine, C; Sigrist, N; Sadek, H; Chouteau, M; Cagnard, N; Fontenay, M; Hermine, O; Chomienne, C; Reynier, P; Fischer, A; André-Schmutz, I; Gueguen, N; Cavazzana, M

    2015-01-01

    Reticular dysgenesis is a human severe combined immunodeficiency that is primarily characterized by profound neutropenia and lymphopenia. The condition is caused by mutations in the adenylate kinase 2 (AK2) gene, resulting in the loss of mitochondrial AK2 protein expression. AK2 regulates the homeostasis of mitochondrial adenine nucleotides (ADP, ATP and AMP) by catalyzing the transfer of high-energy phosphate. Our present results demonstrate that AK2-knocked-down progenitor cells have poor proliferative and survival capacities and are blocked in their differentiation toward lymphoid and granulocyte lineages. We also observed that AK2 deficiency impaired mitochondrial function in general and oxidative phosphorylation in particular – showing that AK2 is critical in the control of energy metabolism. Loss of AK2 disrupts this regulation and leads to a profound block in lymphoid and myeloid cell differentiation. PMID:26270350

  3. Interferon-stimulated gene ISG12b1 inhibits adipogenic differentiation and mitochondrial biogenesis in 3T3-L1 cells.

    PubMed

    Li, Bing; Shin, Jonghyun; Lee, Kichoon

    2009-03-01

    Microarray analysis was performed to find a new group of genes or pathways that might be important in adipocyte development and metabolism. Among them, a mouse interferon-stimulated gene 12b1 (ISG12b1) is expressed at a 400-fold higher level in adipocytes compared with stromal-vascular cells. It is predominantly expressed in adipose tissue among other tissues we tested. Developmentally, ISG12b1 mRNA expression was initially inhibited followed by a dramatic induction during both in vivo and in vitro adipogenic differentiation. Adenovirus-mediated overexpression of ISG12b1 inhibited adipogenic differentiation in 3T3-L1 cells as shown by decreased lipid staining with Oil-Red-O and reduction in adipogenic marker proteins including peroxisome proliferator-activated receptor-gamma (PPARgamma), and CCAAT/enhancer-binding protein-alpha (C/EBPalpha). Our bioinformatics analysis for the predicted localization of ISG12b1 protein suggested the mitochondrial localization, which was confirmed by the colocalization of hemagglutinin-tagged ISG12b1 protein with mitochondrial marker MitoTracker. In addition, ISG12b1 protein was exclusively detected in protein extract from the fractionated mitochondria by Western blot analysis. Furthermore, overexpression of ISG12b1 in adipocytes reduced mitochondrial DNA content and gene expression of mitochondrial transcription factor A (mtTFA), nuclear respiratory factor 1 (NRF1), and cytochrome oxidase II, suggesting an inhibitory role of ISG12b1 in mitochondrial biogenesis and function. Activation of mitochondrial biogenesis and function by treatment with PPARgamma and PPARalpha agonists in 3T3-L1 cells and cold exposure in mice induced mitochondrial transcription factors and reduced ISG12 expression. These data demonstrated that mitochondrial-localized ISG12b1 protein inhibits adipocyte differentiation and mitochondrial biogenesis and function, implying the important role of mitochondrial function in adipocyte development and associated

  4. Differentiation State-Specific Mitochondrial Dynamic Regulatory Networks Are Revealed by Global Transcriptional Analysis of the Developing Chicken Lens

    PubMed Central

    Chauss, Daniel; Basu, Subhasree; Rajakaruna, Suren; Ma, Zhiwei; Gau, Victoria; Anastas, Sara; Brennan, Lisa A.; Hejtmancik, J. Fielding; Menko, A. Sue; Kantorow, Marc

    2014-01-01

    The mature eye lens contains a surface layer of epithelial cells called the lens epithelium that requires a functional mitochondrial population to maintain the homeostasis and transparency of the entire lens. The lens epithelium overlies a core of terminally differentiated fiber cells that must degrade their mitochondria to achieve lens transparency. These distinct mitochondrial populations make the lens a useful model system to identify those genes that regulate the balance between mitochondrial homeostasis and elimination. Here we used an RNA sequencing and bioinformatics approach to identify the transcript levels of all genes expressed by distinct regions of the lens epithelium and maturing fiber cells of the embryonic Gallus gallus (chicken) lens. Our analysis detected more than 15,000 unique transcripts expressed by the embryonic chicken lens. Of these, more than 3000 transcripts exhibited significant differences in expression between lens epithelial cells and fiber cells. Multiple transcripts coding for separate mitochondrial homeostatic and degradation mechanisms were identified to exhibit preferred patterns of expression in lens epithelial cells that require mitochondria relative to lens fiber cells that require mitochondrial elimination. These included differences in the expression levels of metabolic (DUT, PDK1, SNPH), autophagy (ATG3, ATG4B, BECN1, FYCO1, WIPI1), and mitophagy (BNIP3L/NIX, BNIP3, PARK2, p62/SQSTM1) transcripts between lens epithelial cells and lens fiber cells. These data provide a comprehensive window into all genes transcribed by the lens and those mitochondrial regulatory and degradation pathways that function to maintain mitochondrial populations in the lens epithelium and to eliminate mitochondria in maturing lens fiber cells. PMID:24928582

  5. The Impact of Mitochondrial Complex Inhibition on mESC Differentiation

    EPA Science Inventory

    The Impact of Mitochondrial Complex Inhibition on mESC Differentiation JE Royland, SH Warren, S Jeffay, MR Hoopes, HP Nichols, ES Hunter U.S. Environmental Protection Agency, Integrated Systems Toxicology Division, Research Triangle Park, NC The importance of mitochondrial funct...

  6. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  7. Ancient Out-of-Africa Mitochondrial DNA Variants Associate with Distinct Mitochondrial Gene Expression Patterns

    PubMed Central

    Mishmar, Dan

    2016-01-01

    Mitochondrial DNA (mtDNA) variants have been traditionally used as markers to trace ancient population migrations. Although experiments relying on model organisms and cytoplasmic hybrids, as well as disease association studies, have served to underline the functionality of certain mtDNA SNPs, only little is known of the regulatory impact of ancient mtDNA variants, especially in terms of gene expression. By analyzing RNA-seq data of 454 lymphoblast cell lines from the 1000 Genomes Project, we found that mtDNA variants defining the most common African genetic background, the L haplogroup, exhibit a distinct overall mtDNA gene expression pattern, which was independent of mtDNA copy numbers. Secondly, intra-population analysis revealed subtle, yet significant, expression differences in four tRNA genes. Strikingly, the more prominent African mtDNA gene expression pattern best correlated with the expression of nuclear DNA-encoded RNA-binding proteins, and with SNPs within the mitochondrial RNA-binding proteins PTCD1 and MRPS7. Our results thus support the concept of an ancient regulatory transition of mtDNA-encoded genes as humans left Africa to populate the rest of the world. PMID:27812116

  8. The effects of mitochondrial genotype on hypoxic survival and gene expression in a hybrid population of the killifish, Fundulus heteroclitus.

    PubMed

    Flight, Patrick A; Nacci, Diane; Champlin, Denise; Whitehead, Andrew; Rand, David M

    2011-11-01

    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study, we draw on a population of the teleost fish, Fundulus heteroclitus, where functionally distinct subspecies hybridize, likely as a result of past glacial events. We had two specific aims: (i) to determine the effect of mtDNA genotype on survivorship of male and female fish under hypoxic stress and (ii) to determine the effect of hypoxic stress, sex and mtDNA genotype on gene expression. We found an unexpected and highly significant effect of sex on survivorship under hypoxic conditions, but no significant effect of mtDNA genotype. Gene expression analyses revealed hundreds of transcripts differentially regulated by sex and hypoxia. Mitochondrial transcripts and other predicted pathways were among those influenced by hypoxic stress, and a transcript corresponding to the mtDNA control region was the most highly suppressed transcript under the conditions of hypoxia. An RT-PCR experiment on the control region was consistent with microarray results. Effects of mtDNA sequence variation on genome expression were limited; however, a potentially important epistasis between mtDNA sequence and expression of a nuclear-encoded mitochondrial translation protein was discovered. Overall, these results confirm that mitochondrial regulation is a major component of hypoxia tolerance and further suggest that purifying selection has been the predominant selective force on mitochondrial genomes in these two subspecies.

  9. The canonical intrinsic mitochondrial death pathway has a non-apoptotic role in signaling lens cell differentiation.

    PubMed

    Weber, Gregory F; Menko, A Sue

    2005-06-10

    The mitochondrial cell death pathway is known for its role in signaling apoptosis. Here, we describe a novel function for the mitochondrial cell death pathway in signaling initiation of differentiation in the developing lens. Most remarkably, we induced lens cell differentiation by short-term exposure of lens epithelial cells to the apoptogen staurosporine. Activation of apoptosis-related pathways induced lens epithelial cells to express differentiation-specific markers and to undergo morphogenetic changes that led to formation of the lens-like structures known as lentoids. The fact that multiple stages of differentiation are expressed at a single stage of development in the embryonic lens made it possible to precisely determine the timing of expression of proteins associated with the apoptotic pathway. We discovered that there was high expression in the lens equatorial epithelium (the region of the lens in which differentiation is initiated) of pro-apoptotic molecules such as Bax and Bcl-x(S) and release of cytochrome c from mitochondria. Furthermore, we found significant caspase-3-like activity in the equatorial epithelium, yet this activity was far lower than that associated with lens cell apoptosis. These apoptotic pathways are likely regulated by the concurrent expression of prosurvival molecules, including Bcl-2 and Bcl-x(L); phosphorylation of Bad; and high expression of inhibitor of apoptosis proteins chicken IAP1, IAP3, and survivin. This finding suggests that prosurvival pathways allow pro-apoptotic molecules to function as molecular switches in the differentiation process without tipping the balance toward apoptosis. We call this process apoptosis-related Bcl-2- and caspase-dependent (ABC) differentiation.

  10. Permeability transition pore-mediated mitochondrial superoxide flashes regulate cortical neural progenitor differentiation.

    PubMed

    Hou, Yan; Mattson, Mark P; Cheng, Aiwu

    2013-01-01

    In the process of neurogenesis, neural progenitor cells (NPCs) cease dividing and differentiate into postmitotic neurons that grow dendrites and an axon, become excitable, and establish synapses with other neurons. Mitochondrial biogenesis and aerobic metabolism provide energy substrates required to support the differentiation, growth and synaptic activity of neurons. Mitochondria may also serve signaling functions and, in this regard, it was recently reported that mitochondria can generate rapid bursts of superoxide (superoxide flashes), the frequency of which changes in response to environmental conditions and signals including oxygen levels and Ca(2+) fluxes. Here we show that the frequency of mitochondrial superoxide flashes increases as embryonic cerebral cortical neurons differentiate from NPCs, and provide evidence that the superoxide flashes serve a signaling function that is critical for the differentiation process. The superoxide flashes are mediated by mitochondrial permeability transition pore (mPTP) opening, and pharmacological inhibition of the mPTP suppresses neuronal differentiation. Moreover, superoxide flashes and neuronal differentiation are inhibited by scavenging of mitochondrial superoxide. Conversely, manipulations that increase superoxide flash frequency accelerate neuronal differentiation. Our findings reveal a regulatory role for mitochondrial superoxide flashes, mediated by mPTP opening, in neuronal differentiation.

  11. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-07-15

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  12. Mitochondrial-related gene expression changes are sensitive to agonal-pH state: implications for brain disorders

    PubMed Central

    Vawter, MP; Tomita, H; Meng, F; Bolstad, B; Li, J; Evans, S; Choudary, P; Atz, M; Shao, L; Neal, C; Walsh, DM; Burmeister, M; Speed, T; Myers, R; Jones, EG; Watson, SJ; Akil, H; Bunney, WE

    2010-01-01

    Mitochondrial defects in gene expression have been implicated in the pathophysiology of bipolar disorder and schizophrenia. We have now contrasted control brains with low pH versus high pH and showed that 28% of genes in mitochondrial-related pathways meet criteria for differential expression. A majority of genes in the mitochondrial, chaperone and proteasome pathways of nuclear DNA-encoded gene expression were decreased with decreased brain pH, whereas a majority of genes in the apoptotic and reactive oxygen stress pathways showed an increased gene expression with a decreased brain pH. There was a significant increase in mitochondrial DNA copy number and mitochondrial DNA gene expression with increased agonal duration. To minimize effects of agonal-pH state on mood disorder comparisons, two classic approaches were used, removing all subjects with low pH and agonal factors from analysis, or grouping low and high pH as a separate variable. Three groups of potential candidate genes emerged that may be mood disorder related: (a) genes that showed no sensitivity to pH but were differentially expressed in bipolar disorder or major depressive disorder; (b) genes that were altered by agonal-pH in one direction but altered in mood disorder in the opposite direction to agonal-pH and (c) genes with agonal-pH sensitivity that displayed the same direction of changes in mood disorder. Genes from these categories such as NR4A1 and HSPA2 were confirmed with Q-PCR. The interpretation of postmortem brain studies involving broad mitochondrial gene expression and related pathway alterations must be monitored against the strong effect of agonal-pH state. Genes with the least sensitivity to agonal-pH could present a starting point for candidate gene search in neuropsychiatric disorders. PMID:16636682

  13. Gene Expression in a Drosophila Model of Mitochondrial Disease

    PubMed Central

    Fernández-Ayala, Daniel J. M.; Chen, Shanjun; Kemppainen, Esko; O'Dell, Kevin M. C.; Jacobs, Howard T.

    2010-01-01

    Background A point mutation in the Drosophila gene technical knockout (tko), encoding mitoribosomal protein S12, was previously shown to cause a phenotype of respiratory chain deficiency, developmental delay, and neurological abnormalities similar to those presented in many human mitochondrial disorders, as well as defective courtship behavior. Methodology/Principal Findings Here, we describe a transcriptome-wide analysis of gene expression in tko25t mutant flies that revealed systematic and compensatory changes in the expression of genes connected with metabolism, including up-regulation of lactate dehydrogenase and of many genes involved in the catabolism of fats and proteins, and various anaplerotic pathways. Gut-specific enzymes involved in the primary mobilization of dietary fats and proteins, as well as a number of transport functions, were also strongly up-regulated, consistent with the idea that oxidative phosphorylation OXPHOS dysfunction is perceived physiologically as a starvation for particular biomolecules. In addition, many stress-response genes were induced. Other changes may reflect a signature of developmental delay, notably a down-regulation of genes connected with reproduction, including gametogenesis, as well as courtship behavior in males; logically this represents a programmed response to a mitochondrially generated starvation signal. The underlying signalling pathway, if conserved, could influence many physiological processes in response to nutritional stress, although any such pathway involved remains unidentified. Conclusions/Significance These studies indicate that general and organ-specific metabolism is transformed in response to mitochondrial dysfunction, including digestive and absorptive functions, and give important clues as to how novel therapeutic strategies for mitochondrial disorders might be developed. PMID:20066047

  14. Transgene expression of Drosophila melanogaster nucleoside kinase reverses mitochondrial thymidine kinase 2 deficiency.

    PubMed

    Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A; Kuiper, Raoul V; Curbo, Sophie; Karlsson, Anna

    2013-02-15

    A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK(+/-) transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK(+/-)TK2(-/-) mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK(+/-)TK2(-/-) mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency.

  15. Bcmimp1, a Botrytis cinerea Gene Transiently Expressed in planta, Encodes a Mitochondrial Protein

    PubMed Central

    Benito-Pescador, David; Santander, Daniela; Arranz, M.; Díaz-Mínguez, José M.; Eslava, Arturo P.; van Kan, Jan A. L.; Benito, Ernesto P.

    2016-01-01

    Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of reactive oxygen species, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor. PMID:26952144

  16. A conserved MADS-box phosphorylation motif regulates differentiation and mitochondrial function in skeletal, cardiac, and smooth muscle cells.

    PubMed

    Mughal, W; Nguyen, L; Pustylnik, S; da Silva Rosa, S C; Piotrowski, S; Chapman, D; Du, M; Alli, N S; Grigull, J; Halayko, A J; Aliani, M; Topham, M K; Epand, R M; Hatch, G M; Pereira, T J; Kereliuk, S; McDermott, J C; Rampitsch, C; Dolinsky, V W; Gordon, J W

    2015-10-29

    Exposure to metabolic disease during fetal development alters cellular differentiation and perturbs metabolic homeostasis, but the underlying molecular regulators of this phenomenon in muscle cells are not completely understood. To address this, we undertook a computational approach to identify cooperating partners of the myocyte enhancer factor-2 (MEF2) family of transcription factors, known regulators of muscle differentiation and metabolic function. We demonstrate that MEF2 and the serum response factor (SRF) collaboratively regulate the expression of numerous muscle-specific genes, including microRNA-133a (miR-133a). Using tandem mass spectrometry techniques, we identify a conserved phosphorylation motif within the MEF2 and SRF Mcm1 Agamous Deficiens SRF (MADS)-box that regulates miR-133a expression and mitochondrial function in response to a lipotoxic signal. Furthermore, reconstitution of MEF2 function by expression of a neutralizing mutation in this identified phosphorylation motif restores miR-133a expression and mitochondrial membrane potential during lipotoxicity. Mechanistically, we demonstrate that miR-133a regulates mitochondrial function through translational inhibition of a mitophagy and cell death modulating protein, called Nix. Finally, we show that rodents exposed to gestational diabetes during fetal development display muscle diacylglycerol accumulation, concurrent with insulin resistance, reduced miR-133a, and elevated Nix expression, as young adult rats. Given the diverse roles of miR-133a and Nix in regulating mitochondrial function, and proliferation in certain cancers, dysregulation of this genetic pathway may have broad implications involving insulin resistance, cardiovascular disease, and cancer biology.

  17. FoxO1 interacts with transcription factor EB and differentially regulates mitochondrial uncoupling proteins via autophagy in adipocytes

    PubMed Central

    Liu, Longhua; Tao, Zhipeng; Zheng, Louise D; Brooke, Joseph P; Smith, Cayleen M; Liu, Dongmin; Long, Yun Chau; Cheng, Zhiyong

    2016-01-01

    Mitochondrial uncoupling proteins (UCPs) are inducible and play an important role in metabolic and redox homeostasis. Recent studies have suggested that FoxO1 controls mitochondrial biogenesis and morphology, but it remains largely unknown how FoxO1 may regulate mitochondrial UCPs. Here we show that FoxO1 interacted with transcription factor EB (Tfeb), a key regulator of autophagosome and lysosome, and mediated the expression of UCP1, UCP2 and UCP3 differentially via autophagy in adipocytes. UCP1 was down-regulated but UCP2 and UCP3 were upregulated during adipocyte differentiation, which was associated with increased Tfeb and autophagy activity. However, inhibition of FoxO1 suppressed Tfeb and autophagy, attenuating UCP2 and UCP3 but increasing UCP1 expression. Pharmacological blockade of autophagy recapitulated the effects of FoxO1 inhibition on UCPs. Chromatin immunoprecipitation assay demonstrated that FoxO1 interacted with Tfeb by directly binding to its promoter, and silencing FoxO1 led to drastic decrease in Tfeb transcript and protein levels. These data provide the first line of evidence that FoxO1 interacts with Tfeb to regulate autophagy and UCP expression in adipocytes. Dysregulation of FoxO1→autophagy→UCP pathway may account for metabolic changes in obesity. PMID:27777789

  18. Mitophagy is required for mitochondrial biogenesis and myogenic differentiation of C2C12 myoblasts.

    PubMed

    Sin, Jon; Andres, Allen M; Taylor, David J R; Weston, Thomas; Hiraumi, Yoshimi; Stotland, Aleksandr; Kim, Brandon J; Huang, Chengqun; Doran, Kelly S; Gottlieb, Roberta A

    2016-01-01

    Myogenesis is a crucial process governing skeletal muscle development and homeostasis. Differentiation of primitive myoblasts into mature myotubes requires a metabolic switch to support the increased energetic demand of contractile muscle. Skeletal myoblasts specifically shift from a highly glycolytic state to relying predominantly on oxidative phosphorylation (OXPHOS) upon differentiation. We have found that this phenomenon requires dramatic remodeling of the mitochondrial network involving both mitochondrial clearance and biogenesis. During early myogenic differentiation, autophagy is robustly upregulated and this coincides with DNM1L/DRP1 (dynamin 1-like)-mediated fragmentation and subsequent removal of mitochondria via SQSTM1 (sequestosome 1)-mediated mitophagy. Mitochondria are then repopulated via PPARGC1A/PGC-1α (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha)-mediated biogenesis. Mitochondrial fusion protein OPA1 (optic atrophy 1 [autosomal dominant]) is then briskly upregulated, resulting in the reformation of mitochondrial networks. The final product is a myotube replete with new mitochondria. Respirometry reveals that the constituents of these newly established mitochondrial networks are better primed for OXPHOS and are more tightly coupled than those in myoblasts. Additionally, we have found that suppressing autophagy with various inhibitors during differentiation interferes with myogenic differentiation. Together these data highlight the integral role of autophagy and mitophagy in myogenic differentiation.

  19. Mitochondrial respiratory gene expression is suppressed in many cancers

    PubMed Central

    Reznik, Ed; Wang, Qingguo; La, Konnor; Schultz, Nikolaus; Sander, Chris

    2017-01-01

    The fundamental metabolic decision of a cell, the balance between respiration and fermentation, rests in part on expression of the mitochondrial genome (mtDNA) and coordination with expression of the nuclear genome (nuDNA). Previously we described mtDNA copy number depletion across many solid tumor types (Reznik et al., 2016). Here, we use orthogonal RNA-sequencing data to quantify mtDNA expression (mtRNA), and report analogously lower expression of mtRNA in tumors (relative to normal tissue) across a majority of cancer types. Several cancers exhibit a trio of mutually consistent evidence suggesting a drop in respiratory activity: depletion of mtDNA copy number, decreases in mtRNA levels, and decreases in expression of nuDNA-encoded respiratory proteins. Intriguingly, a minority of cancer types exhibit a drop in mtDNA expression but an increase in nuDNA expression of respiratory proteins, with unknown implications for respiratory activity. Our results indicate suppression of respiratory gene expression across many cancer types. DOI: http://dx.doi.org/10.7554/eLife.21592.001 PMID:28099114

  20. Mitochondrial and Nuclear Genomic Responses to Loss of LRPPRC Expression*

    PubMed Central

    Gohil, Vishal M.; Nilsson, Roland; Belcher-Timme, Casey A.; Luo, Biao; Root, David E.; Mootha, Vamsi K.

    2010-01-01

    Rapid advances in genotyping and sequencing technology have dramatically accelerated the discovery of genes underlying human disease. Elucidating the function of such genes and understanding their role in pathogenesis, however, remain challenging. Here, we introduce a genomic strategy to characterize such genes functionally, and we apply it to LRPPRC, a poorly studied gene that is mutated in Leigh syndrome, French-Canadian type (LSFC). We utilize RNA interference to engineer an allelic series of cellular models in which LRPPRC has been stably silenced to different levels of knockdown efficiency. We then combine genome-wide expression profiling with gene set enrichment analysis to identify cellular responses that correlate with the loss of LRPPRC. Using this strategy, we discovered a specific role for LRPPRC in the expression of all mitochondrial DNA-encoded mRNAs, but not the rRNAs, providing mechanistic insights into the enzymatic defects observed in the disease. Our analysis shows that nuclear genes encoding mitochondrial proteins are not collectively affected by the loss of LRPPRC. We do observe altered expression of genes related to hexose metabolism, prostaglandin synthesis, and glycosphingolipid biology that may either play an adaptive role in cell survival or contribute to pathogenesis. The combination of genetic perturbation, genomic profiling, and pathway analysis represents a generic strategy for understanding disease pathogenesis. PMID:20220140

  1. Modulation of mitochondrial gene expression in pulmonary epithelial cells exposed to oxidants.

    PubMed Central

    Janssen, Y M; Driscoll, K E; Timblin, C R; Hassenbein, D; Mossman, B T

    1998-01-01

    Oxidants are important in the regulation of signal transduction and gene expression. Multiple classes of genes are transcriptionally activated by oxidants and are implicated in different phenotypic responses. In the present study, we performed differential mRNA display to elucidate genes that are induced or repressed after exposure of rat lung epithelial (RLE) cells to H2O2 or crocidolite asbestos, a pathogenic mineral that generates oxidants. After 8 or 24 hr of exposure, RNA was extracted, reverse transcribed, and amplified by polymerase chain reaction with degenerate primers to visualize alterations in gene expression. The seven clones obtained were sequenced and encoded the mitochondrial genes, NADH dehydrogenase subunits ND5 and ND6, and 16S ribosomal RNA. Evaluation of their expression by Northern blot analysis revealed increased expression of 16S rRNA after 1 or 2 hr of exposure to H2O2. At later time periods (4 and 24 hr), mRNA levels of 16S rRNA and NADH dehydrogenase were decreased in H2O2-treated RLE cells when compared to sham controls. Crocidolite asbestos caused increases in 16S rRNA levels after 8 hr of exposure, whereas after 24 hr of exposure to asbestos, 16S rRNA levels were decreased in comparison to sham controls. In addition to these oxidants, the nitric oxide generator spermine NONOate caused similar decreases in NADH dehydrogenase mRNA levels after 4 hr of exposure. The present data and previous studies demonstrated that all oxidants examined resulted in apoptosis in RLE cells during the time frame where alterations of mitochondrial gene expression were observed. As the mitochondrion is a major organelle that controls apoptosis, alterations in expression of mitochondrial genes may be involved in the regulation of apoptosis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9788897

  2. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure.

    PubMed

    Al Kaddissi, Simone; Legeay, Alexia; Elia, Antonia Concetta; Gonzalez, Patrice; Floriani, Magali; Cavalie, Isabelle; Massabuau, Jean-Charles; Gilbin, Rodolphe; Simon, Olivier

    2014-08-01

    The present study investigates cadmium effects on the transcription of mitochondrial genes of Procambarus clarkii after acute (0.05, 0.5, and 5 mg Cd/L; 4-10 days) and chronic exposures (10 μg Cd/L; 30-60 days). Transcriptional responses of cox1, atp6, and 12S using quantitative real-time RT-PCR were assessed in gills and hepatopancreas. Additionally, the expression levels of genes involved in detoxification and/or oxidative stress responses [mt, sod(Mn)] and enzymatic activities of antioxidants (SOD, CAT, GPX, and GST) were analyzed. The histopathological effects in hepatopancreas of crayfish were evaluated by light microscopy. Relationships between endpoints at different levels of biological organization and Cd bioaccumulation were also examined. Cd induced high levels of bioaccumulation, which was followed by mitochondrial dysfunction and histological alterations in both experiments. Moreover, perturbations in the defence mechanisms against oxidative stress tended to increase with time. Results also showed that molecular responses can vary depending on the intensity and duration of the chemical stress applied to the organisms and that the study of mt gene expression levels seemed to be the best tool to assess Cd intoxication.

  3. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  4. Expression of 16 Nitrogenase Proteins within the Plant Mitochondrial Matrix.

    PubMed

    Allen, Robert S; Tilbrook, Kimberley; Warden, Andrew C; Campbell, Peter C; Rolland, Vivien; Singh, Surinder P; Wood, Craig C

    2017-01-01

    The industrial production and use of nitrogenous fertilizer involves significant environmental and economic costs. Strategies to reduce fertilizer dependency are required to address the world's increasing demand for sustainable food, fibers, and biofuels. Biological nitrogen fixation, a process unique to diazatrophic bacteria, is catalyzed by the nitrogenase complex, and reconstituting this function in plant cells is an ambitious biotechnological strategy to reduce fertilizer use. Here we establish that the full array of biosynthetic and catalytic nitrogenase (Nif) proteins from the diazotroph Klebsiella pneumoniae can be individually expressed as mitochondrial targeting peptide (MTP)-Nif fusions in Nicotiana benthamiana. We show that these are correctly targeted to the plant mitochondrial matrix, a subcellular location with biochemical and genetic characteristics potentially supportive of nitrogenase function. Although Nif proteins B, D, E, F, H, J, K, M, N, Q, S, U, V, X, Y, and Z were all detectable by Western blot analysis, the NifD catalytic component was the least abundant. To address this problem, a translational fusion between NifD and NifK was designed based on the crystal structure of the nitrogenase MoFe protein heterodimer. This fusion protein enabled equimolar NifD:NifK stoichiometry and improved NifD expression levels in plants. Finally, four MTP-Nif fusion proteins (B, S, H, Y) were successfully co-expressed, demonstrating that multiple components of nitrogenase can be targeted to plant mitochondria. These results establish the feasibility of reconstituting the complete componentry for nitrogenase in plant cells, within an intracellular environment that could support the conversion of nitrogen gas into ammonia.

  5. Expression of 16 Nitrogenase Proteins within the Plant Mitochondrial Matrix

    PubMed Central

    Allen, Robert S.; Tilbrook, Kimberley; Warden, Andrew C.; Campbell, Peter C.; Rolland, Vivien; Singh, Surinder P.; Wood, Craig C.

    2017-01-01

    The industrial production and use of nitrogenous fertilizer involves significant environmental and economic costs. Strategies to reduce fertilizer dependency are required to address the world's increasing demand for sustainable food, fibers, and biofuels. Biological nitrogen fixation, a process unique to diazatrophic bacteria, is catalyzed by the nitrogenase complex, and reconstituting this function in plant cells is an ambitious biotechnological strategy to reduce fertilizer use. Here we establish that the full array of biosynthetic and catalytic nitrogenase (Nif) proteins from the diazotroph Klebsiella pneumoniae can be individually expressed as mitochondrial targeting peptide (MTP)-Nif fusions in Nicotiana benthamiana. We show that these are correctly targeted to the plant mitochondrial matrix, a subcellular location with biochemical and genetic characteristics potentially supportive of nitrogenase function. Although Nif proteins B, D, E, F, H, J, K, M, N, Q, S, U, V, X, Y, and Z were all detectable by Western blot analysis, the NifD catalytic component was the least abundant. To address this problem, a translational fusion between NifD and NifK was designed based on the crystal structure of the nitrogenase MoFe protein heterodimer. This fusion protein enabled equimolar NifD:NifK stoichiometry and improved NifD expression levels in plants. Finally, four MTP-Nif fusion proteins (B, S, H, Y) were successfully co-expressed, demonstrating that multiple components of nitrogenase can be targeted to plant mitochondria. These results establish the feasibility of reconstituting the complete componentry for nitrogenase in plant cells, within an intracellular environment that could support the conversion of nitrogen gas into ammonia. PMID:28316608

  6. Acute and chronic mitochondrial respiratory chain deficiency differentially regulate lysosomal biogenesis

    PubMed Central

    Fernández-Mosquera, Lorena; Diogo, Cátia V.; Yambire, King Faisal; Santos, Gabriela L.; Luna Sánchez, Marta; Bénit, Paule; Rustin, Pierre; Lopez, Luis Carlos; Milosevic, Ira; Raimundo, Nuno

    2017-01-01

    Mitochondria are key cellular signaling platforms, affecting fundamental processes such as cell proliferation, differentiation and death. However, it remains unclear how mitochondrial signaling affects other organelles, particularly lysosomes. Here, we demonstrate that mitochondrial respiratory chain (RC) impairments elicit a stress signaling pathway that regulates lysosomal biogenesis via the microphtalmia transcription factor family. Interestingly, the effect of mitochondrial stress over lysosomal biogenesis depends on the timeframe of the stress elicited: while RC inhibition with rotenone or uncoupling with CCCP initially triggers lysosomal biogenesis, the effect peaks after few hours and returns to baseline. Long-term RC inhibition by long-term treatment with rotenone, or patient mutations in fibroblasts and in a mouse model result in repression of lysosomal biogenesis. The induction of lysosomal biogenesis by short-term mitochondrial stress is dependent on TFEB and MITF, requires AMPK signaling and is independent of calcineurin signaling. These results reveal an integrated view of how mitochondrial signaling affects lysosomes, which is essential to fully comprehend the consequences of mitochondrial malfunction, particularly in the context of mitochondrial diseases. PMID:28345620

  7. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  8. Low-dose ionizing radiation induces mitochondrial fusion and increases expression of mitochondrial complexes I and III in hippocampal neurons

    PubMed Central

    Chang, Chuang-Rung; Kao, Mou-Chieh; Chen, Kuan-Wei; Chiu, Shih-Che; Hsu, Ming-Ling; Hsiang, I-Chou; Chen, Yu-Jen; Chen, Linyi

    2015-01-01

    High energy ionizing radiation can cause DNA damage and cell death. During clinical radiation therapy, the radiation dose could range from 15 to 60 Gy depending on targets. While 2 Gy radiation has been shown to cause cancer cell death, studies also suggest a protective potential by low dose radiation. In this study, we examined the effect of 0.2-2 Gy radiation on hippocampal neurons. Low dose 0.2 Gy radiation treatment increased the levels of MTT. Since hippocampal neurons are post-mitotic, this result reveals a possibility that 0.2 Gy irradiation may increase mitochondrial activity to cope with stimuli. Maintaining neural plasticity is an energy-demanding process that requires high efficient mitochondrial function. We thus hypothesized that low dose radiation may regulate mitochondrial dynamics and function to ensure survival of neurons. Our results showed that five days after 0.2 Gy irradiation, no obvious changes on neuronal survival, neuronal synapses, membrane potential of mitochondria, reactive oxygen species levels, and mitochondrial DNA copy numbers. Interestingly, 0.2 Gy irradiation promoted the mitochondria fusion, resulting in part from the increased level of a mitochondrial fusion protein, Mfn2, and inhibition of Drp1 fission protein trafficking to the mitochondria. Accompanying with the increased mitochondrial fusion, the expressions of complexes I and III of the electron transport chain were also increased. These findings suggest that, hippocampal neurons undergo increased mitochondrial fusion to modulate cellular activity as an adaptive mechanism in response to low dose radiation. PMID:26415228

  9. Low-dose ionizing radiation induces mitochondrial fusion and increases expression of mitochondrial complexes I and III in hippocampal neurons.

    PubMed

    Chien, Ling; Chen, Wun-Ke; Liu, Szu-Ting; Chang, Chuang-Rung; Kao, Mou-Chieh; Chen, Kuan-Wei; Chiu, Shih-Che; Hsu, Ming-Ling; Hsiang, I-Chou; Chen, Yu-Jen; Chen, Linyi

    2015-10-13

    High energy ionizing radiation can cause DNA damage and cell death. During clinical radiation therapy, the radiation dose could range from 15 to 60 Gy depending on targets. While 2 Gy radiation has been shown to cause cancer cell death, studies also suggest a protective potential by low dose radiation. In this study, we examined the effect of 0.2-2 Gy radiation on hippocampal neurons. Low dose 0.2 Gy radiation treatment increased the levels of MTT. Since hippocampal neurons are post-mitotic, this result reveals a possibility that 0.2 Gy irradiation may increase mitochondrial activity to cope with stimuli. Maintaining neural plasticity is an energy-demanding process that requires high efficient mitochondrial function. We thus hypothesized that low dose radiation may regulate mitochondrial dynamics and function to ensure survival of neurons. Our results showed that five days after 0.2 Gy irradiation, no obvious changes on neuronal survival, neuronal synapses, membrane potential of mitochondria, reactive oxygen species levels, and mitochondrial DNA copy numbers. Interestingly, 0.2 Gy irradiation promoted the mitochondria fusion, resulting in part from the increased level of a mitochondrial fusion protein, Mfn2, and inhibition of Drp1 fission protein trafficking to the mitochondria. Accompanying with the increased mitochondrial fusion, the expressions of complexes I and III of the electron transport chain were also increased. These findings suggest that, hippocampal neurons undergo increased mitochondrial fusion to modulate cellular activity as an adaptive mechanism in response to low dose radiation.

  10. Optimized allotopic expression of the human mitochondrial ND4 prevents blindness in a rat model of mitochondrial dysfunction.

    PubMed

    Ellouze, Sami; Augustin, Sébastien; Bouaita, Aicha; Bonnet, Crystel; Simonutti, Manuel; Forster, Valérie; Picaud, Serge; Sahel, Jose-Alain; Corral-Debrinski, Marisol

    2008-09-01

    Mitochondrial diseases due to mutations in mitochondrial DNA can no longer be ignored in most medical areas. With prevalence certainly higher than one in 6000, they probably represent the most common form of metabolic disorders. Despite progress in identification of their molecular mechanisms, little has been done with regard to therapy. We have recently optimized the allotopic expression for the mitochondrial genes ATP6, ND1, and ND4 and obtained a complete and long-lasting rescue of mitochondrial dysfunction in the human fibroblasts in which these genes were mutated. However, biosafety and benefit to mitochondrial function must be validated in animal models prior to clinical applications. To create an animal model of Leber Hereditary Optic Neuropathy (LHON), we introduced the human ND4 gene harboring the G11778A mutation, responsible of 60% of LHON cases, to rat eyes by in vivo electroporation. The treatment induced the degeneration of retinal ganglion cells (RGCs), which were 40% less abundant in treated eyes than in control eyes. This deleterious effect was also confirmed in primary cell culture, in which both RGC survival and neurite outgrowth were compromised. Importantly, RGC loss was clearly associated with a decline in visual performance. A subsequent electroporation with wild-type ND4 prevented both RGC loss and the impairment of visual function. Hence, these data provide the proof-of-principle that optimized allotopic expression can be an effective treatment for LHON, and they open the way to clinical studies on other devastating mitochondrial disorders.

  11. Optimized Allotopic Expression of the Human Mitochondrial ND4 Prevents Blindness in a Rat Model of Mitochondrial Dysfunction

    PubMed Central

    Ellouze, Sami; Augustin, Sébastien; Bouaita, Aicha; Bonnet, Crystel; Simonutti, Manuel; Forster, Valérie; Picaud, Serge; Sahel, Jose-Alain; Corral-Debrinski, Marisol

    2008-01-01

    Mitochondrial diseases due to mutations in mitochondrial DNA can no longer be ignored in most medical areas. With prevalence certainly higher than one in 6000, they probably represent the most common form of metabolic disorders. Despite progress in identification of their molecular mechanisms, little has been done with regard to therapy. We have recently optimized the allotopic expression for the mitochondrial genes ATP6, ND1, and ND4 and obtained a complete and long-lasting rescue of mitochondrial dysfunction in the human fibroblasts in which these genes were mutated. However, biosafety and benefit to mitochondrial function must be validated in animal models prior to clinical applications. To create an animal model of Leber Hereditary Optic Neuropathy (LHON), we introduced the human ND4 gene harboring the G11778A mutation, responsible of 60% of LHON cases, to rat eyes by in vivo electroporation. The treatment induced the degeneration of retinal ganglion cells (RGCs), which were 40% less abundant in treated eyes than in control eyes. This deleterious effect was also confirmed in primary cell culture, in which both RGC survival and neurite outgrowth were compromised. Importantly, RGC loss was clearly associated with a decline in visual performance. A subsequent electroporation with wild-type ND4 prevented both RGC loss and the impairment of visual function. Hence, these data provide the proof-of-principle that optimized allotopic expression can be an effective treatment for LHON, and they open the way to clinical studies on other devastating mitochondrial disorders. PMID:18771762

  12. Dietary fatty acids affect mitochondrial phospholipid compositions and mitochondrial gene expression of rainbow trout liver at different ages.

    PubMed

    Almaida-Pagán, P F; De Santis, C; Rubio-Mejía, O L; Tocher, D R

    2015-01-01

    Mitochondria are among the first responders to various stressors that challenge the homeostasis of cells and organisms. Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL), particularly cardiolipin (CL), and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, liver mitochondrial membrane PL compositions, lipid peroxidation, and mtDNA gene expression were analyzed in rainbow trout fed three diets with the same base formulation but with lipid supplied either by fish oil (FO), rapeseed oil (RO), or high DHA oil (DHA) during 6 weeks. Specifically, two feeding trials were performed using fish from the same population of two ages (1 and 3 years), and PL class compositions of liver mitochondria, fatty acid composition of individual PL classes, TBARS content, and mtDNA expression were determined. Dietary fatty acid composition strongly affected mitochondrial membrane composition from trout liver but observed changes did not fully reflect the diet, particularly when it contained high DHA. The changes were PL specific, CL being particularly resistant to changes in DHA. Some significant differences observed in expression of mtDNA with diet may suggest long-term dietary effects in mitochondrial gene expression which could affect electron transport chain function. All the changes were influenced by fish age, which could be related to the different growth rates observed between 1- and 3-year-old trout but that could also indicate age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  13. Expression and putative role of mitochondrial transport proteins in cancer.

    PubMed

    Lytovchenko, Oleksandr; Kunji, Edmund R S

    2017-03-22

    Cancer cells undergo major changes in energy and biosynthetic metabolism. One of them is the Warburg effect, in which pyruvate is used for fermentation rather for oxidative phosphorylation. Another major one is their increased reliance on glutamine, which helps to replenish the pool of Krebs cycle metabolites used for other purposes, such as amino acid or lipid biosynthesis. Mitochondria are central to these alterations, as the biochemical pathways linking these processes run through these organelles. Two membranes, an outer and inner membrane, surround mitochondria, the latter being impermeable to most organic compounds. Therefore, a large number of transport proteins are needed to link the biochemical pathways of the cytosol and mitochondrial matrix. Since the transport steps are relatively slow, it is expected that many of these transport steps are altered when cells become cancerous. In this review, changes in expression and regulation of these transport proteins are discussed as well as the role of the transported substrates.

  14. Analysis of Mitochondrial Function and Localisation during Human Embryonic Stem Cell Differentiation In Vitro

    PubMed Central

    Prowse, Andrew B. J.; Chong, Fenny; Elliott, David A.; Elefanty, Andrew G.; Stanley, Edouard G.; Gray, Peter P.; Munro, Trent P.; Osborne, Geoffrey W.

    2012-01-01

    Human embryonic stem cell (hESC) derivatives show promise as viable cell therapy options for multiple disorders in different tissues. Recent advances in stem cell biology have lead to the reliable production and detailed molecular characterisation of a range of cell-types. However, the role of mitochondria during differentiation has yet to be fully elucidated. Mitochondria mediate a cells response to altered energy requirements (e.g. cardiomyocyte contraction) and, as such, the mitochondrial phenotype is likely to change during the dynamic process of hESC differentiation. We demonstrate that manipulating mitochondrial biogenesis alters mesendoderm commitment. To investigate mitochondrial localisation during early lineage specification of hESCs we developed a mitochondrial reporter line, KMEL2, in which sequences encoding the green fluorescent protein (GFP) are targeted to the mitochondria. Differentiation of KMEL2 lines into the three germ layers showed that the mitochondria in these differentiated progeny are GFP positive. Therefore, KMEL2 hESCs facilitate the study of mitochondria in a range of cell types and, importantly, permit real-time analysis of mitochondria via the GFP tag. PMID:23284940

  15. Differential Mitochondrial Adaptation in Primary Vascular Smooth Muscle Cells from a Diabetic Rat Model

    PubMed Central

    Keller, Amy C.; Knaub, Leslie A.; McClatchey, P. Mason; Connon, Chelsea A.; Bouchard, Ron; Miller, Matthew W.; Geary, Kate E.; Walker, Lori A.; Klemm, Dwight J.; Reusch, Jane E. B.

    2016-01-01

    Diabetes affects more than 330 million people worldwide and causes elevated cardiovascular disease risk. Mitochondria are critical for vascular function, generate cellular reactive oxygen species (ROS), and are perturbed by diabetes, representing a novel target for therapeutics. We hypothesized that adaptive mitochondrial plasticity in response to nutrient stress would be impaired in diabetes cellular physiology via a nitric oxide synthase- (NOS-) mediated decrease in mitochondrial function. Primary smooth muscle cells (SMCs) from aorta of the nonobese, insulin resistant rat diabetes model Goto-Kakizaki (GK) and the Wistar control rat were exposed to high glucose (25 mM). At baseline, significantly greater nitric oxide evolution, ROS production, and respiratory control ratio (RCR) were observed in GK SMCs. Upon exposure to high glucose, expression of phosphorylated eNOS, uncoupled respiration, and expression of mitochondrial complexes I, II, III, and V were significantly decreased in GK SMCs (p < 0.05). Mitochondrial superoxide increased with high glucose in Wistar SMCs (p < 0.05) with no change in the GK beyond elevated baseline concentrations. Baseline comparisons show persistent metabolic perturbations in a diabetes phenotype. Overall, nutrient stress in GK SMCs caused a persistent decline in eNOS and mitochondrial function and disrupted mitochondrial plasticity, illustrating eNOS and mitochondria as potential therapeutic targets. PMID:27034743

  16. Differential Mitochondrial Adaptation in Primary Vascular Smooth Muscle Cells from a Diabetic Rat Model.

    PubMed

    Keller, Amy C; Knaub, Leslie A; McClatchey, P Mason; Connon, Chelsea A; Bouchard, Ron; Miller, Matthew W; Geary, Kate E; Walker, Lori A; Klemm, Dwight J; Reusch, Jane E B

    2016-01-01

    Diabetes affects more than 330 million people worldwide and causes elevated cardiovascular disease risk. Mitochondria are critical for vascular function, generate cellular reactive oxygen species (ROS), and are perturbed by diabetes, representing a novel target for therapeutics. We hypothesized that adaptive mitochondrial plasticity in response to nutrient stress would be impaired in diabetes cellular physiology via a nitric oxide synthase- (NOS-) mediated decrease in mitochondrial function. Primary smooth muscle cells (SMCs) from aorta of the nonobese, insulin resistant rat diabetes model Goto-Kakizaki (GK) and the Wistar control rat were exposed to high glucose (25 mM). At baseline, significantly greater nitric oxide evolution, ROS production, and respiratory control ratio (RCR) were observed in GK SMCs. Upon exposure to high glucose, expression of phosphorylated eNOS, uncoupled respiration, and expression of mitochondrial complexes I, II, III, and V were significantly decreased in GK SMCs (p < 0.05). Mitochondrial superoxide increased with high glucose in Wistar SMCs (p < 0.05) with no change in the GK beyond elevated baseline concentrations. Baseline comparisons show persistent metabolic perturbations in a diabetes phenotype. Overall, nutrient stress in GK SMCs caused a persistent decline in eNOS and mitochondrial function and disrupted mitochondrial plasticity, illustrating eNOS and mitochondria as potential therapeutic targets.

  17. Differential effects of wild-type and A53T mutant isoform of alpha-synuclein on the mitochondrial proteome of differentiated SH-SY5Y cells.

    PubMed

    Pennington, Kyla; Peng, Jianhe; Hung, Chao-Chun; Banks, Rosamonde E; Robinson, Philip A

    2010-05-07

    Increased levels of wild-type (WT) alpha-synuclein (alpha-syn) and mutant A53T alpha-syn are associated with Parkinson's disease (PD), a disease linked to abnormal mitochondrial function. This study compared mitochondria prepared from differentiated SH-SY5Y cells overexpressing WT or A53T alpha-syn with control cells, using 2-D difference in-gel electrophoresis. Statistical analysis was carried out primarily using ANOVA (p < 0.01; Host:WT:A53T) and subsequently using independent t tests (host vs WT, host vs A53T). Of the protein spots found to be differentially expressed (n = 71; p < 0.01, >1.8/<-1.8 fold change), 63 proteins were identified by LC-MS/MS, with the majority (77%) significantly altered in WT samples only. Twenty-three proteins known to be integral components of the mitochondria were abnormally expressed including those with roles in ATP synthesis, oxidoreduction, motor activity, carbohydrate metabolism, protein transcription, and protein folding. Thirteen forms of cytoskeletal proteins were also found to be overexpressed in the mitochondrial preparations from WT alpha-syn cells, suggesting an increased interaction of mitochondria with the cytoskeletal network. Altered levels of four mitochondrial proteins (HSPA9 (mortalin), NDUFS1, DLAT, ATP5A1) were confirmed using Western blot analysis. Furthermore, a significant reduction in OXPHOS 1 activity was observed in the WT alpha-syn cells, suggesting that there are functional consequences of the observed altered protein expression changes in the mitochondria.

  18. Differential submitochondrial localization of PINK1 as a molecular switch for mediating distinct mitochondrial signaling pathways.

    PubMed

    Fallaize, Dana; Chin, Lih-Shen; Li, Lian

    2015-12-01

    Mutations in mitochondrial kinase PINK1 cause Parkinson disease (PD), but the submitochondrial site(s) of PINK1 action remains unclear. Here, we report that three-dimensional structured illumination microscopy (3D-SIM) enables super-resolution imaging of protein submitochondrial localization. Dual-color 3D-SIM imaging analysis revealed that PINK1 resides in the cristae membrane and intracristae space but not on the outer mitochondrial membrane (OMM) of healthy mitochondria. Under normal physiological conditions, PINK1 colocalizes with its substrate TRAP1 in the cristae membrane and intracristae space. In response to mitochondrial depolarization, PINK1, but not TRAP1, translocates to the OMM. The PINK1 translocation to the OMM of depolarized mitochondria is independent of new protein synthesis and requires combined action of PINK1 transmembrane domain and C-terminal region. We found that mitochondrial depolarization-induced PINK1 OMM translocation is required for recruitment of parkin to the OMM of damaged mitochondria. Our findings suggest that differential submitochondrial localization of PINK1 serves as a molecular switch for mediating two distinct mitochondrial signaling pathways in maintenance of mitochondrial homeostasis. Furthermore, our study provides evidence for the involvement of deregulated PINK1 submitochondrial localization in PD pathogenesis.

  19. Introducing Knowledge into Differential Expression Analysis

    PubMed Central

    Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin

    2010-01-01

    Abstract Gene expression measurements allow determining sets of up- or down-regulated, or unchanged genes in a particular experimental condition. Additional biological knowledge can suggest examples of genes from one of these sets. For instance, known target genes of a transcriptional activator are expected, but are not certain to go down after this activator is knocked out. Available differential expression analysis tools do not take such imprecise examples into account. Here we put forward a novel partially supervised mixture modeling methodology for differential expression analysis. Our approach, guided by imprecise examples, clusters expression data into differentially expressed and unchanged genes. The partially supervised methodology is implemented by two methods: a newly introduced belief-based mixture modeling, and soft-label mixture modeling, a method proved efficient in other applications. We investigate on synthetic data the input example settings favorable for each method. In our tests, both belief-based and soft-label methods prove their advantage over semi-supervised mixture modeling in correcting for erroneous examples. We also compare them to alternative differential expression analysis approaches, showing that incorporation of knowledge yields better performance. We present a broad range of knowledge sources and data to which our partially supervised methodology can be applied. First, we determine targets of Ste12 based on yeast knockout data, guided by a Ste12 DNA-binding experiment. Second, we distinguish miR-1 from miR-124 targets in human by clustering expression data under transfection experiments of both microRNAs, using their computationally predicted targets as examples. Finally, we utilize literature knowledge to improve clustering of time-course expression profiles. PMID:20726790

  20. TrxR2 deficiencies promote chondrogenic differentiation and induce apoptosis of chondrocytes through mitochondrial reactive oxygen species.

    PubMed

    Yan, Jidong; Xu, Jing; Fei, Yao; Jiang, Congshan; Zhu, Wenhua; Han, Yan; Lu, Shemin

    2016-05-15

    Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of

  1. Cigarette smoke decreases mitochondrial porin expression and steroidogenesis

    SciTech Connect

    Bose, Mahuya; Whittal, Randy M.; Gairola, C. Gary; Bose, Himangshu S.

    2008-03-01

    Steroidogenic acute regulatory protein (StAR) facilitates the movement of cholesterol from the outer to inner mitochondrial membrane for steroidogenesis. Here, we investigated the effect of cigarette smoke (CS) on steroidogenesis using adrenal mitochondria isolated from mice chronically exposed to CS. Steroidogenesis was decreased approximately 78% in CS-exposed mitochondria, as measured by synthesis of the steroid hormone precursor pregnenolone. This effect was accompanied by decreased mitochondrial import of {sup 35}S-StAR. Further characterization of the imported {sup 35}S-StAR by native gradient PAGE revealed the presence of a high molecular weight complex in both control and CS-exposed groups. Following density gradient fractionation of {sup 35}S-StAR that had been extracted from control mitochondria, precursor StAR could be found in fractions 2-6 and smaller-sized StAR complexes in fractions 6-13. In the CS-exposed group, the appearance of precursor shifted from fraction 1-6 and the smaller complexes in fractions 6-9 disappeared. Mass spectrometric analysis revealed that the {sup 35}S-StAR-associated protein complex was composed of several resident matrix proteins as well as the OMM resident, VDAC. VDAC expression was greatly reduced by CS, and blockage of VDAC with Koenig's polyanion decreased pregnenolone synthesis in isolated mitochondria. Taken together, these results suggest that VDAC may participate in steroidogenesis by promoting StAR interaction with the OMM and that CS may inhibit steroidogenesis by reducing VDAC-StAR interactions.

  2. Quantitative Changes in Gimap3 and Gimap5 Expression Modify Mitochondrial DNA Segregation in Mice

    PubMed Central

    Jokinen, Riikka; Lahtinen, Taina; Marttinen, Paula; Myöhänen, Maarit; Ruotsalainen, Pilvi; Yeung, Nicolas; Shvetsova, Antonina; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Öhman, Tiina; Nyman, Tuula A.; Weiler, Hartmut; Battersby, Brendan J.

    2015-01-01

    Mammalian mitochondrial DNA (mtDNA) is a high-copy maternally inherited genome essential for aerobic energy metabolism. Mutations in mtDNA can lead to heteroplasmy, the co-occurence of two different mtDNA variants in the same cell, which can segregate in a tissue-specific manner affecting the onset and severity of mitochondrial dysfunction. To investigate mechanisms regulating mtDNA segregation we use a heteroplasmic mouse model with two polymorphic neutral mtDNA haplotypes (NZB and BALB) that displays tissue-specific and age-dependent selection for mtDNA haplotypes. In the hematopoietic compartment there is selection for the BALB mtDNA haplotype, a phenotype that can be modified by allelic variants of Gimap3. Gimap3 is a tail-anchored member of the GTPase of the immunity-associated protein (Gimap) family of protein scaffolds important for leukocyte development and survival. Here we show how the expression of two murine Gimap3 alleles from Mus musculus domesticus and M. m. castaneus differentially affect mtDNA segregation. The castaneus allele has incorporated a uORF (upstream open reading frame) in-frame with the Gimap3 mRNA that impairs translation and imparts a negative effect on the steady-state protein abundance. We found that quantitative changes in the expression of Gimap3 and the paralogue Gimap5, which encodes a lysosomal protein, affect mtDNA segregation in the mouse hematopoietic tissues. We also show that Gimap3 localizes to the endoplasmic reticulum and not mitochondria as previously reported. Collectively these data show that the abundance of protein scaffolds on the endoplasmic reticulum and lysosomes are important to the segregation of the mitochondrial genome in the mouse hematopoietic compartment. PMID:25808953

  3. Sirtuin 3 is required for osteogenic differentiation through maintenance of PGC-1ɑ-SOD2-mediated regulation of mitochondrial function

    PubMed Central

    Ding, Yong; Yang, Hongmei; Wang, Yucai; Chen, Jun; Ji, Zhenwei; Sun, Honghui

    2017-01-01

    Osteogenic differentiation is crucial for the maintenance of bone homeostasis. Sirtuin 3 (SIRT3), a member of sirtuins family, functions as a critical deacetylase that regulates many key proteins. In the current study, we aimed to clarify the role of SIRT3 in osteogenic differentiation and the possible mechanisms, using mouse pre-osteoblastic MC3T3-E1 cells. Expression of SIRT3 was substantially increased in differentiated MC3T3-E1 cells. Knock down of SIRT3 significantly decreased alkaline phosphatase (ALP) staining, and mRNA expression of runt-related transcription factor 2 (Runx2) and collagen type I ɑ 1 (Col1ɑ1), and osteocalcin in differentiated MC3T3-E1 cells. Overexpression of wild type but not mutant SIRT3 could reverse SIRT3 knockdown-resulted decrease of ALP staining. Complex I, II, III, IV, and V activities, oxygen consumption and mitochondrial membrane potential were significantly decreased by SIRT3 knockdown. Moreover, SIRT3 knockdown reduced mitochondrial density, increased mitochondrial size and decreased the expression of NRF1 and TFAM. Knock down of SIRT3 decreased mRNA and protein expression of SOD2 and increased ROS level. Overexpression of SOD2 significantly suppressed SIRT3 knockdown-induced decrease of mitochondrial function and osteogenic differentiation. SIRT3 knockdown resulted in a significant decrease of PGC-1ɑ protein expression but not mRNA expression. Overexpression of wild type but not mutant SIRT3 could reverse SIRT3 knockdown-resulted decrease of PGC-1ɑ protein expression. Moreover, we detected a direct interaction between SIRT3 and PGC-1ɑ and SIRT3 knockdown reduced SIRT3 and PGC-1ɑ interaction, resulting in a reduction of PGC-1ɑ protein stability and PGC-1ɑ-binding in the promoters of SOD2. Overexpression of PGC-1ɑ blocked SIRT3 knockdown-induced decrease of SOD2 expression, increase of ROS level, and decrease of mitochondrial function and biogenesis, leading to improvement of osteogenesis. Overall, the data provide a

  4. Differentiation of mitochondrial DNA and Y chromosomes in Russian populations.

    PubMed

    Malyarchuk, Boris; Derenko, Miroslava; Grzybowski, Tomasz; Lunkina, Arina; Czarny, Jakub; Rychkov, Serge; Morozova, Irina; Denisova, Galina; Miścicka-Sliwka, Danuta

    2004-12-01

    The genetic composition of the Russian population was investigated by analyzing both mitochondrial DNA (mtDNA) and Y-chromosome loci polymorphisms that allow for the different components of a population gene pool to be studied, depending on the mode of DNA marker inheritance. mtDNA sequence variation was examined by using hypervariable segment I (HVSI) sequencing and restriction analysis of the haplogroup-specific sites in 325 individuals representing 5 Russian populations from the European part of Russia. The Y-chromosome variation was investigated in 338 individuals from 8 Russian populations (including 5 populations analyzed for mtDNA variation) using 12 binary markers. For both uniparental systems most of the observed haplogroups fell into major West Eurasian haplogroups (97.9% and 99.7% for mtDNA and Y-chromosome haplogroups, respectively). Multidimensional scaling analysis based on pairwise F(ST) values between mtDNA HVSI sequences in Russians compared to other European populations revealed a considerable heterogeneity of Russian populations; populations from the southern and western parts of Russia are separated from eastern and northern populations. Meanwhile, the multidimensional scaling analysis based on Y-chromosome haplogroup F(ST) values demonstrates that the Russian gene pool is close to central-eastern European populations, with a much higher similarity to the Baltic and Finno-Ugric male pools from northern European Russia. This discrepancy in the depth of penetration of mtDNA and Y-chromosome lineages characteristic for the most southwestern Russian populations into the east and north of eastern Europe appears to indicate that Russian colonization of the northeastern territories might have been accomplished mainly by males rather than by females.

  5. Mitochondrial and lipogenic effects of vitamin D on differentiating and proliferating human keratinocytes.

    PubMed

    Consiglio, Marco; Viano, Marta; Casarin, Stefania; Castagnoli, Carlotta; Pescarmona, Gianpiero; Silvagno, Francesca

    2015-10-01

    Even in cells that are resistant to the differentiating effects of vitamin D, the activated vitamin D receptor (VDR) can downregulate the mitochondrial respiratory chain and sustain cell growth through enhancing the activity of biosynthetic pathways. The aim of this study was to investigate whether vitamin D is effective also in modulating mitochondria and biosynthetic metabolism of differentiating cells. We compared the effect of vitamin D on two cellular models: the primary human keratinocytes, differentiating and sensitive to the genomic action of VDR, and the human keratinocyte cell line HaCaT, characterized by a rapid growth and resistance to vitamin D. We analysed the nuclear translocation and features of VDR, the effects of vitamin D on mitochondrial transcription and the consequences on lipid biosynthetic fate. We found that the negative modulation of respiratory chain is a general mechanism of action of vitamin D, but at high doses, the HaCaT cells became resistant to mitochondrial effects by upregulating the catabolic enzyme CYP24 hydroxylase. In differentiating keratinocytes, vitamin D treatment promoted intracellular lipid deposition, likewise the inhibitor of respiratory chain stigmatellin, whereas in proliferating HaCaT, this biosynthetic pathway was not inducible by the hormone. By linking the results on respiratory chain and lipid accumulation, we conclude that vitamin D, by suppressing respiratory chain transcription in all keratinocytes, is able to support both the proliferation and the specialized metabolism of differentiating cells. Through mitochondrial control, vitamin D can have an essential role in all the metabolic phenotypes occurring in healthy and diseased skin.

  6. Mitochondrial Matrix Ca2+ Accumulation Regulates Cytosolic NAD+/NADH Metabolism, Protein Acetylation, and Sirtuin Expression

    PubMed Central

    Marcu, Raluca; Wiczer, Brian M.; Neeley, Christopher K.

    2014-01-01

    Mitochondrial calcium uptake stimulates bioenergetics and drives energy production in metabolic tissue. It is unknown how a calcium-mediated acceleration in matrix bioenergetics would influence cellular metabolism in glycolytic cells that do not require mitochondria for ATP production. Using primary human endothelial cells (ECs), we discovered that repetitive cytosolic calcium signals (oscillations) chronically loaded into the mitochondrial matrix. Mitochondrial calcium loading in turn stimulated bioenergetics and a persistent elevation in NADH. Rather than serving as an impetus for mitochondrial ATP generation, matrix NADH rapidly transmitted to the cytosol to influence the activity and expression of cytosolic sirtuins, resulting in global changes in protein acetylation. In endothelial cells, the mitochondrion-driven reduction in both the cytosolic and mitochondrial NAD+/NADH ratio stimulated a compensatory increase in SIRT1 protein levels that had an anti-inflammatory effect. Our studies reveal the physiologic importance of mitochondrial bioenergetics in the metabolic regulation of sirtuins and cytosolic signaling cascades. PMID:24865966

  7. A mitochondrial sirtuin, SIRT3, regulates muscle differentiation and metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    SIRT3 is a member of the sirtuin family of NAD-dependent deacetylases and is localized to the mitochondria. SIRT3 is highly expressed in brown adipose tissue, heart, muscle, and metabolically active tissue enriched with mitochondria. Recent reports found that SIRT3 is able to deacetylate and regula...

  8. Differential contribution of the mitochondrial translation pathway to the survival of diffuse large B-cell lymphoma subsets.

    PubMed

    Norberg, Erik; Lako, Ana; Chen, Pei-Hsuan; Stanley, Illana A; Zhou, Feng; Ficarro, Scott B; Chapuy, Bjoern; Chen, Linfeng; Rodig, Scott; Shin, Donghyuk; Choi, Dong Wook; Lee, Sangho; Shipp, Margaret A; Marto, Jarrod A; Danial, Nika N

    2017-02-01

    Diffuse large B-cell lymphomas (DLBCLs) are a highly heterogeneous group of tumors in which subsets share molecular features revealed by gene expression profiles and metabolic fingerprints. While B-cell receptor (BCR)-dependent DLBCLs are glycolytic, OxPhos-DLBCLs rely on mitochondrial energy transduction and nutrient utilization pathways that provide pro-survival benefits independent of BCR signaling. Integral to these metabolic distinctions is elevated mitochondrial electron transport chain (ETC) activity in OxPhos-DLBCLs compared with BCR-DLBCLs, which is linked to greater protein abundance of ETC components. To gain insights into molecular determinants of the selective increase in ETC activity and dependence on mitochondrial energy metabolism in OxPhos-DLBCLs, we examined the mitochondrial translation pathway in charge of the synthesis of mitochondrial DNA encoded ETC subunits. Quantitative mass spectrometry identified increased expression of mitochondrial translation factors in OxPhos-DLBCL as compared with the BCR subtype. Biochemical and functional assays indicate that the mitochondrial translation pathway is required for increased ETC activity and mitochondrial energy reserves in OxPhos-DLBCL. Importantly, molecular depletion of several mitochondrial translation proteins using RNA interference or pharmacological perturbation of the mitochondrial translation pathway with the FDA-approved inhibitor tigecycline (Tigecyl) is selectively toxic to OxPhos-DLBCL cell lines and primary tumors. These findings provide additional molecular insights into the metabolic characteristics of OxPhos-DLBCLs, and mark the mitochondrial translation pathway as a potential therapeutic target in these tumors.

  9. Proteomic analysis of increased Parkin expression and its interactants provides evidence for a role in modulation of mitochondrial function.

    PubMed

    Davison, Eleanor J; Pennington, Kyla; Hung, Chao-Chun; Peng, Jianhe; Rafiq, Rumana; Ostareck-Lederer, Antje; Ostareck, Dirk H; Ardley, Helen C; Banks, Rosamonde E; Robinson, Philip A

    2009-09-01

    Parkin is an ubiquitin-protein ligase (E3), mutations of which cause juvenile onset - autosomal recessive Parkinson's disease, and result in reduced enzymic activity. In contrast, increased levels are protective against mitochondrial dysfunction and neurodegeneration, the mechanism of which is largely unknown. In this study, 2-DE and MS proteomic techniques were utilised to investigate the effects of increased Parkin levels on protein expression in whole cell lysates using in an inducible Parkin expression system in HEK293 cells, and also to isolate potential interactants of Parkin using tandem affinity purification and MS. Nine proteins were significantly differentially expressed (+/-2-fold change; p<0.05) using 2-DE analysis. MS revealed the identity of these proteins to be ACAT2, HNRNPK, HSPD1, PGK1, PRDX6, VCL, VIM, TPI1, and IMPDH2. The first seven of these were reduced in expression. Western blot analysis confirmed the reduction in one of these proteins (HNRNPK), and that its levels were dependent on 26S proteasomal activity. Tandem affinity purification/MS revealed 14 potential interactants of Parkin; CKB, DBT, HSPD1, HSPA9, LRPPRC, NDUFS2, PRDX6, SLC25A5, TPI1, UCHL1, UQCRC1, VCL, YWHAZ, YWHAE. Nine of these are directly involved in mitochondrial energy metabolism and glycolysis; four were also identified in the 2-DE study (HSP60, PRDX6, TPI1, and VCL). This study provides further evidence for a role for Parkin in regulating mitochondrial activity within cells.

  10. Maternal obesity programs mitochondrial and lipid metabolism gene expression in infant umbilical vein endothelial cells

    PubMed Central

    Ramos Costa, Suzana Maria; Isganaitis, Elvira; Matthews, Tucker; Hughes, Katelyn; Daher, Grace; Dreyfuss, Jonathan M.; Pontes da Silva, Giselia Alves; Patti, Mary-Elizabeth

    2016-01-01

    Background/Objectives Maternal obesity increases risk for childhood obesity, but molecular mechanisms are not well understood. We hypothesized that primary umbilical vein endothelial cells (HUVEC) from infants of overweight and obese mothers would harbor transcriptional patterns reflecting offspring obesity risk. Subjects/Methods In this observational cohort study, we recruited 13 lean (pre-pregnancy BMI <25.0 kg/m2) and 24 overweight-obese (‘ov-ob’, BMI ≥25.0 kg/m2) women. We isolated primary HUVEC, and analyzed both gene expression (Primeview, Affymetrix) and cord blood levels of hormones and adipokines. Results 142 transcripts were differentially expressed in HUVEC from infants of overweight-obese mothers (false discovery rate, FDR <0.05). Pathway analysis revealed that genes involved in mitochondrial and lipid metabolism were negatively correlated with maternal BMI (FDR <0.05). To test whether these transcriptomic patterns were associated with distinct nutrient exposures in the setting of maternal obesity, we analyzed the cord blood lipidome and noted significant increases in levels of total free fatty acids (lean: 95.5 ± 37.1 ug/ml, ov-ob: 124.1 ± 46.0 ug/ml, P=0.049), palmitate (lean: 34.5 ± 12.7 ug/ml, ov-ob: 46.3 ± 18.4 ug/ml, P=0.03) and stearate (lean: 20.8 ± 8.2 ug/ml, ov-ob: 29.7 ± 17.2 ug/ml, P=0.04), in infants of overweight-obese mothers. Conclusion Prenatal exposure to maternal obesity alters HUVEC expression of genes involved in mitochondrial and lipid metabolism, potentially reflecting developmentally-programmed differences in oxidative and lipid metabolism. PMID:27531045

  11. Gene Expression Profiling Specifies Chemokine, Mitochondrial and Lipid Metabolism Signatures in Leprosy

    PubMed Central

    Guerreiro, Luana Tatiana Albuquerque; Robottom-Ferreira, Anna Beatriz; Ribeiro-Alves, Marcelo; Toledo-Pinto, Thiago Gomes; Rosa Brito, Tiana; Rosa, Patrícia Sammarco; Sandoval, Felipe Galvan; Jardim, Márcia Rodrigues; Antunes, Sérgio Gomes; Shannon, Edward J.; Sarno, Euzenir Nunes; Pessolani, Maria Cristina Vidal; Williams, Diana Lynn; Moraes, Milton Ozório

    2013-01-01

    Herein, we performed microarray experiments in Schwann cells infected with live M. leprae and identified novel differentially expressed genes (DEG) in M. leprae infected cells. Also, we selected candidate genes associated or implicated with leprosy in genetic studies and biological experiments. Forty-seven genes were selected for validation in two independent types of samples by multiplex qPCR. First, an in vitro model using THP-1 cells was infected with live Mycobacterium leprae and M. bovis bacillus Calmette-Guérin (BCG). In a second situation, mRNA obtained from nerve biopsies from patients with leprosy or other peripheral neuropathies was tested. We detected DEGs that discriminate M. bovis BCG from M. leprae infection. Specific signatures of susceptible responses after M. leprae infection when compared to BCG lead to repression of genes, including CCL2, CCL3, IL8 and SOD2. The same 47-gene set was screened in nerve biopsies, which corroborated the down-regulation of CCL2 and CCL3 in leprosy, but also evidenced the down-regulation of genes involved in mitochondrial metabolism, and the up-regulation of genes involved in lipid metabolism and ubiquitination. Finally, a gene expression signature from DEG was identified in patients confirmed of having leprosy. A classification tree was able to ascertain 80% of the cases as leprosy or non-leprous peripheral neuropathy based on the expression of only LDLR and CCL4. A general immune and mitochondrial hypo-responsive state occurs in response to M. leprae infection. Also, the most important genes and pathways have been highlighted providing new tools for early diagnosis and treatment of leprosy. PMID:23798993

  12. Increasing levels of cardiolipin differentially influence packing of phospholipids found in the mitochondrial inner membrane.

    PubMed

    Zeczycki, Tonya N; Whelan, Jarrett; Hayden, William Tyler; Brown, David A; Shaikh, Saame Raza

    2014-07-18

    It is essential to understand the role of cardiolipin (CL) in mitochondrial membrane organization given that changes in CL levels contribute to mitochondrial dysfunction in type II diabetes, ischemia-reperfusion injury, heart failure, breast cancer, and aging. Specifically, there are contradictory data on how CL influences the molecular packing of membrane phospholipids. Therefore, we determined how increasing levels of heart CL impacted molecular packing in large unilamellar vesicles, modeling heterogeneous lipid mixtures found within the mitochondrial inner membrane, using merocyanine (MC540) fluorescence. We broadly categorized lipid vesicles of equal mass as loosely packed, intermediate, and highly packed based on peak MC540 fluorescence intensity. CL had opposite effects on loosely versus highly packed vesicles. Exposure of loosely packed vesicles to increasing levels of CL dose-dependently increased membrane packing. In contrast, increasing amounts of CL in highly packed vesicles decreased the packing in a dose-dependent manner. In vesicles that were categorized as intermediate packing, CL had either no effect or decreased packing at select doses in a dose-independent manner. Altogether, the results aid in resolving some of the discrepant data by demonstrating that CL displays differential effects on membrane packing depending on the composition of the lipid environment. This has implications for mitochondrial protein activity in response to changing CL levels in microdomains of varying composition.

  13. Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

    PubMed Central

    Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

    2015-01-01

    Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

  14. Synthesis of mitochondrial uncoupling protein in brown adipocytes differentiated in cell culture

    SciTech Connect

    Kopecky, J.; Baudysova, M.; Zanotti, F.; Janikova, D.; Pavelka, S.; Houstek, J. )

    1990-12-25

    In order to characterize the biogenesis of unique thermogenic mitochondria of brown adipose tissue, differentiation of precursor cells isolated from mouse brown adipose tissue was studied in cell culture. Synthesis of mitochondrial uncoupling protein (UCP), F1-ATPase, and cytochrome oxidase was examined by L-(35S)methionine labeling and immunoblotting. For the first time, synthesis of physiological amounts of the UCP, a key and tissue-specific component of thermogenic mitochondria, was observed in cultures at about confluence (day 6), indicating that a complete differentiation of brown adipocytes was achieved in vitro. In postconfluent cells (day 8) the content of UCP decreased rapidly, in contrast to some other mitochondrial proteins (beta subunit of F1-ATPase, cytochrome oxidase). In these cells, it was possible, by using norepinephrine, to induce specifically the synthesis of the UCP but not of F1-ATPase or cytochrome oxidase. The maximal response was observed at 0.1 microM norepinephrine and the synthesis of UCP remained activated for at least 24 h. Detailed analysis revealed a major role of the beta-adrenergic receptors and elevated intracellular concentration of cAMP in stimulation of UCP synthesis. A quantitative recovery of the newly synthesized UCP in the mitochondrial fraction indicated completed biogenesis of functionally competent thermogenic mitochondria.

  15. Abundant mitochondrial genome diversity, population differentiation and convergent evolution in pines.

    PubMed Central

    Wu, J; Krutovskii, K V; Strauss, S H

    1998-01-01

    We examined mitochondrial DNA polymorphisms via the analysis of restriction fragment length polymorphisms in three closely related species of pines from western North America: knobcone (Pinus attenuata Lemm.), Monterey (P. radiata D. Don), and bishop (P. muricata D. Don). A total of 343 trees derived from 13 populations were analyzed using 13 homologous mitochondrial gene probes amplified from three species by polymerase chain reaction. Twenty-eight distinct mitochondrial DNA haplotypes were detected and no common haplotypes were found among the species. All three species showed limited variability within populations, but strong differentiation among populations. Based on haplotype frequencies, genetic diversity within populations (HS) averaged 0.22, and population differentiation (GST and theta) exceeded 0.78. Analysis of molecular variance also revealed that >90% of the variation resided among populations. For the purposes of genetic conservation and breeding programs, species and populations could be readily distinguished by unique haplotypes, often using the combination of only a few probes. Neighbor-joining phenograms, however, strongly disagreed with those based on allozymes, chloroplast DNA, and morphological traits. Thus, despite its diagnostic haplotypes, the genome appears to evolve via the rearrangement of multiple, convergent subgenomic domains. PMID:9832536

  16. The mitochondrial aspartate/glutamate carrier isoform 1 gene expression is regulated by CREB in neuronal cells

    PubMed Central

    Menga, Alessio; Iacobazzi, Vito; Infantino, Vittoria; Avantaggiati, Maria Laura; Palmieri, Ferdinando

    2015-01-01

    The aspartate/glutamate carrier isoform 1 is an essential mitochondrial transporter that exchanges intramitochondrial aspartate and cytosolic glutamate across the inner mitochondrial membrane. It is expressed in brain, heart and muscle and is involved in important biological processes, including myelination. However, the signals that regulate the expression of this transporter are still largely unknown. In this study we first identify a CREB binding site within the aspartate/glutamate carrier gene promoter that acts as a strong enhancer element in neuronal SH-SY5Y cells. This element is regulated by active, phosphorylated CREB protein and by signal pathways that modify the activity of CREB itself and, most noticeably, by intracellular Ca2+ levels. Specifically, aspartate/glutamate carrier gene expression is induced via CREB by forskolin while it is inhibited by the PKA inhibitor, H89. Furthermore, the CREB-induced activation of gene expression is increased by thapsigargin, which enhances cytosolic Ca2+, while it is inhibited by BAPTA-AM that reduces cytosolic Ca2+ or by STO-609, which inhibits CaMK-IV phosphorylation. We further show that CREB-dependent regulation of aspartate/glutamate carrier gene expression occurs in neuronal cells in response to pathological (inflammation) and physiological (differentiation) conditions. Since this carrier is necessary for neuronal functions and is involved in myelinogenesis, our results highlight that targeting of CREB activity and Ca2+ might be therapeutically exploited to increase aspartate/glutamate carrier gene expression in neurodegenerative diseases. PMID:25597433

  17. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  18. Electrical stimulation of neonatal cardiomyocytes results in the sequential activation of nuclear genes governing mitochondrial proliferation and differentiation

    PubMed Central

    Xia, Yang; Buja, L. Maximilian; Scarpulla, Richard C.; McMillin, Jeanie B.

    1997-01-01

    Electrical stimulation of neonatal cardiac myocytes produces hypertrophy and cellular maturation with increased mitochondrial content and activity. To investigate the patterns of gene expression associated with these processes, cardiac myocytes were stimulated for varying times up to 72 hr in serum-free culture. The mRNA contents for genes associated with transcriptional activation [c-fos, c-jun, JunB, nuclear respiratory factor 1 (NRF-1)], mitochondrial proliferation [cytochrome c (Cyt c), cytochrome oxidase], and mitochondrial differentiation [carnitine palmitoyltransferase I (CPT-I) isoforms] were measured. The results establish a temporal pattern of mRNA induction beginning with c-fos (0.25–3 hr) and followed sequentially by c-jun (0.5–3 hr), JunB (0.5–6 hr), NRF-1 (1–12 hr), Cyt c (12–72 hr), and muscle-specific CPT-I (48–72 hr). Induction of the latter was accompanied by a marked decrease in the liver-specific CPT-I mRNA, thus supporting the developmental fidelity of this pattern of gene regulation. Consistent with a transcriptional mechanism, electrical stimulation increased c-fos, β-myosin heavy chain, and Cyt c promoter activities. These increases coincided with a rise in their respective endogenous gene transcripts. NRF-1, cAMP response element, and Sp-1 site mutations within the Cyt c promoter reduced luciferase expression in both stimulated and nonstimulated myocytes. Mutations in the NRF-1 and CRE sites inhibited the induction by electrical stimulation (5-fold and 2-fold, respectively) whereas mutation of the Sp-1 site maintained or increased the fold induction. This finding is consistent with the appearance of NRF-1 and fos/jun mRNAs prior to that of Cyt c and suggests that induction of these transcription factors is a prerequisite for the transcriptional activation of Cyt c expression. These results support a regulatory role for NRF-1 and possibly AP-1 in the initiation of mitochondrial proliferation. PMID:9326621

  19. [Evolution of the mitochondrial DNA and its expression system--comparison between animal and plant kingdom].

    PubMed

    Piechota, Janusz; Jańska, Hanna

    2008-01-01

    The information about features of the Eukaryotic cells is maintained not only in the nucleus, but also in the extranuclear genomes localized in mitochondria and chloroplasts. Comparison between plant and animal mitochondrial genomes allows to perceive two extremely distinct evolution strategies. Animals clearly tend to reduce the size of the mitochondrial genome to the minimum. In accordance with this, the simplification in decoding of genetic information present in the genome is observed. On the contrary, plant mitochondrial genomes tend to increase their size. Accumulation of extraordinary solutions for maintaining and expression of genetic information present in the genome is the second distinctive feature of plant mitochondria.

  20. Diabetes and activation of peroxisome proliferator activated receptor alpha increases mitochondrial thioesterase I protein expression and activity in the heart

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mitochondrial thioesterase-I (MTE-I) catalyzes the de-esterification of fattyacyl-CoAs to fatty acid anions in the mitochondrial matrix, which are extruded to the cytosol, thus preventing the accumulation of toxic mitochondrial fattyacyl-CoAs. MTE-I mRNA expression in the heart is regulated by perox...

  1. Treatment of human astrocytoma U87 cells with silicon dioxide nanoparticles lowers their survival and alters their expression of mitochondrial and cell signaling proteins.

    PubMed

    Lai, James C K; Ananthakrishnan, Gayathri; Jandhyam, Sirisha; Dukhande, Vikas V; Bhushan, Alok; Gokhale, Mugdha; Daniels, Christopher K; Leung, Solomon W

    2010-10-05

    Recent evidence suggests silicon dioxide micro- and nanoparticles induce cytotoxic effects on lung cells. Thus, there is an increasing concern regarding their potential health hazard. Nevertheless, the putative toxicity of nanoparticles in mammalian cells has not yet been systematically investigated. We previously noted that several metallic oxide nanoparticles exert differential cytotoxic effects on human neural and nonneural cells. Therefore, we hypothesized that silicon dioxide nanoparticles induce cytotoxicity in U87 cells by lowering their survival by decreasing cell survival signaling and disturbing mitochondrial function. To investigate this hypothesis, we determined the activities of the key mitochondrial enzymes, citrate synthase and malate dehydrogenase, in astrocytoma U87 cells treated with silicon dioxide nanoparticles. In addition, we studied the expression of the mitochondrial DNA-encoded proteins, cytochrome C oxidase II and nicotinamide adenine dinucleotide (NADPH) dehydrogenase subunit 6, and cell signaling pathway protein extracellular signal-regulated kinase (ERK) and phosphorylated ERK in treated U87 cells. The activated form of ERK controls cell growth, differentiation, and proliferation. In parallel, we determined survival of U87 cells after treating them with various concentrations of silicon dioxide nanoparticles. Our results indicated that treatment with silicon dioxide nanoparticles induced decreases in U87 cell survival in a dose-related manner. The activities of citrate synthase and malate dehydrogenase in treated U87 cells were increased, possibly due to an energetic compensation in surviving cells. However, the expression of mitochondrial DNA-encoded cytochrome C oxidase subunit II and NADH dehydrogenase subunit 6 and the cell signaling protein ERK and phosphorylated ERK were altered in the treated U87 cells, suggesting that silicon dioxide nanoparticles induced disruption of mitochondrial DNA-encoded protein expression, leading to

  2. Distinct Splice Variants of Dynamin-related Protein 1 Differentially Utilize Mitochondrial Fission Factor as an Effector of Cooperative GTPase Activity.

    PubMed

    Macdonald, Patrick J; Francy, Christopher A; Stepanyants, Natalia; Lehman, Lance; Baglio, Anthony; Mears, Jason A; Qi, Xin; Ramachandran, Rajesh

    2016-01-01

    Multiple isoforms of the mitochondrial fission GTPase dynamin-related protein 1 (Drp1) arise from the alternative splicing of its single gene-encoded pre-mRNA transcript. Among these, the longer Drp1 isoforms, expressed selectively in neurons, bear unique polypeptide sequences within their GTPase and variable domains, known as the A-insert and the B-insert, respectively. Their functions remain unresolved. A comparison of the various biochemical and biophysical properties of the neuronally expressed isoforms with that of the ubiquitously expressed, and shortest, Drp1 isoform (Drp1-short) has revealed the effect of these inserts on Drp1 function. Utilizing various biochemical, biophysical, and cellular approaches, we find that the A- and B-inserts distinctly alter the oligomerization propensity of Drp1 in solution as well as the preferred curvature of helical Drp1 self-assembly on membranes. Consequently, these sequences also suppress Drp1 cooperative GTPase activity. Mitochondrial fission factor (Mff), a tail-anchored membrane protein of the mitochondrial outer membrane that recruits Drp1 to sites of ensuing fission, differentially stimulates the disparate Drp1 isoforms and alleviates the autoinhibitory effect imposed by these sequences on Drp1 function. Moreover, the differential stimulatory effects of Mff on Drp1 isoforms are dependent on the mitochondrial lipid, cardiolipin (CL). Although Mff stimulation of the intrinsically cooperative Drp1-short isoform is relatively modest, CL-independent, and even counter-productive at high CL concentrations, Mff stimulation of the much less cooperative longest Drp1 isoform (Drp1-long) is robust and occurs synergistically with increasing CL content. Thus, membrane-anchored Mff differentially regulates various Drp1 isoforms by functioning as an allosteric effector of cooperative GTPase activity.

  3. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer

    NASA Astrophysics Data System (ADS)

    Nilsson, Roland; Jain, Mohit; Madhusudhan, Nikhil; Sheppard, Nina Gustafsson; Strittmatter, Laura; Kampf, Caroline; Huang, Jenny; Asplund, Anna; Mootha, Vamsi K.

    2014-01-01

    Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta-analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses.

  4. Differentiating between monozygotic twins through next-generation mitochondrial genome sequencing.

    PubMed

    Wang, Zheng; Zhu, Ruxin; Zhang, Suhua; Bian, Yinnan; Lu, Daru; Li, Chengtao

    2015-12-01

    Monozygotic (MZ) twins, considered to be genetically identical, cannot be distinguished from one another by standard forensic DNA testing. A recent study employed whole genome sequencing to identify extremely rare mutations and reported that mutation analysis could be used to differentiate between MZ twins. Compared with nuclear DNA, mitochondrial DNA (mtDNA) has higher mutation rates; therefore, minor differences theoretically exist in MZ twins' mitochondrial genome (mtGenome). However, conventional Sanger-type sequencing (STS) is neither amenable to, nor feasible for, the detection of low-level sequence variants. The recent introduction of massively parallel sequencing (MPS) has the capability to sequence many targeted regions of multiple samples simultaneously with desirable depth of coverage. Thus, the aim of this study was to assess whether full mtGenome sequencing analysis can be used to differentiate between MZ twins. Ten sets of MZ twins provided blood samples that underwent extraction, quantification, mtDNA enrichment, library preparation, and ultra-deep sequencing. Point heteroplasmies were observed in eight sets of MZ twins, and a single nucleotide variant (nt15301) was detected in five sets of MZ twins. Thus, this study demonstrates that ultra-deep mtGenome sequencing could be used to differentiate between MZ twins.

  5. Aluminium induced oxidative stress results in decreased mitochondrial biogenesis via modulation of PGC-1α expression.

    PubMed

    Sharma, Deep Raj; Sunkaria, Aditya; Wani, Willayat Yousuf; Sharma, Reeta Kumari; Kandimalla, Ramesh J L; Bal, Amanjit; Gill, Kiran Dip

    2013-12-01

    The present investigation was carried out to elucidate a possible molecular mechanism related to the effects of aluminium-induced oxidative stress on various mitochondrial respiratory complex subunits with special emphasis on the role of Peroxisome proliferator activated receptor gamma co-activator 1α (PGC-1α) and its downstream targets i.e. Nuclear respiratory factor-1(NRF-1), Nuclear respiratory factor-2(NRF-2) and Mitochondrial transcription factor A (Tfam) in mitochondrial biogenesis. Aluminium lactate (10mg/kgb.wt./day) was administered intragastrically to rats for 12 weeks. After 12 weeks of exposure, we found an increase in ROS levels, mitochondrial DNA oxidation and decrease in citrate synthase activity in the Hippocampus (HC) and Corpus striatum (CS) regions of rat brain. On the other hand, there was a decrease in the mRNA levels of the mitochondrial encoded subunits-NADH dehydrogenase (ND) subunits i.e. ND1, ND2, ND3, Cytochrome b (Cytb), Cytochrome oxidase (COX) subunits i.e. COX1, COX3, ATP synthase (ATPase) subunit 6 along with reduced expression of nuclear encoded subunits COX4, COX5A, COX5B of Electron transport chain (ETC). Besides, a decrease in mitochondrial DNA copy number and mitochondrial content in both regions of rat brain was observed. The PGC-1α was down-regulated in aluminium treated rats along with NRF-1, NRF-2 and Tfam, which act downstream from PGC-1α in aluminium treated rats. Electron microscopy results revealed a significant increase in the mitochondrial swelling, loss of cristae, chromatin condensation and decreases in mitochondrial number in case of aluminium treated rats as compared to control. So, PGC-1α seems to be a potent target for aluminium neurotoxicity, which makes it an almost ideal target to control or limit the damage that has been associated with the defective mitochondrial function seen in neurodegenerative diseases.

  6. Aluminium induced oxidative stress results in decreased mitochondrial biogenesis via modulation of PGC-1α expression

    SciTech Connect

    Sharma, Deep Raj; Sunkaria, Aditya; Wani, Willayat Yousuf; Sharma, Reeta Kumari; Kandimalla, Ramesh J.L.; Bal, Amanjit; Gill, Kiran Dip

    2013-12-01

    The present investigation was carried out to elucidate a possible molecular mechanism related to the effects of aluminium-induced oxidative stress on various mitochondrial respiratory complex subunits with special emphasis on the role of Peroxisome proliferator activated receptor gamma co-activator 1α (PGC-1α) and its downstream targets i.e. Nuclear respiratory factor-1(NRF-1), Nuclear respiratory factor-2(NRF-2) and Mitochondrial transcription factor A (Tfam) in mitochondrial biogenesis. Aluminium lactate (10 mg/kg b.wt./day) was administered intragastrically to rats for 12 weeks. After 12 weeks of exposure, we found an increase in ROS levels, mitochondrial DNA oxidation and decrease in citrate synthase activity in the Hippocampus (HC) and Corpus striatum (CS) regions of rat brain. On the other hand, there was a decrease in the mRNA levels of the mitochondrial encoded subunits–NADH dehydrogenase (ND) subunits i.e. ND1, ND2, ND3, Cytochrome b (Cytb), Cytochrome oxidase (COX) subunits i.e. COX1, COX3, ATP synthase (ATPase) subunit 6 along with reduced expression of nuclear encoded subunits COX4, COX5A, COX5B of Electron transport chain (ETC). Besides, a decrease in mitochondrial DNA copy number and mitochondrial content in both regions of rat brain was observed. The PGC-1α was down-regulated in aluminium treated rats along with NRF-1, NRF-2 and Tfam, which act downstream from PGC-1α in aluminium treated rats. Electron microscopy results revealed a significant increase in the mitochondrial swelling, loss of cristae, chromatin condensation and decreases in mitochondrial number in case of aluminium treated rats as compared to control. So, PGC-1α seems to be a potent target for aluminium neurotoxicity, which makes it an almost ideal target to control or limit the damage that has been associated with the defective mitochondrial function seen in neurodegenerative diseases. - Highlights: • Aluminium decreases the mRNA levels of mitochondrial and nuclear encoded

  7. Global variability in gene expression and alternative splicing is modulated by mitochondrial content.

    PubMed

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J

    2015-05-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype.

  8. Global variability in gene expression and alternative splicing is modulated by mitochondrial content

    PubMed Central

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J.

    2015-01-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype. PMID:25800673

  9. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  10. MicroRNAs Regulate Cellular ATP Levels by Targeting Mitochondrial Energy Metabolism Genes during C2C12 Myoblast Differentiation

    PubMed Central

    Siengdee, Puntita; Trakooljul, Nares; Murani, Eduard; Schwerin, Manfred; Wimmers, Klaus; Ponsuksili, Siriluck

    2015-01-01

    In our previous study, we identified an miRNA regulatory network involved in energy metabolism in porcine muscle. To better understand the involvement of miRNAs in cellular ATP production and energy metabolism, here we used C2C12 myoblasts, in which ATP levels increase during differentiation, to identify miRNAs modulating these processes. ATP level, miRNA and mRNA microarray expression profiles during C2C12 differentiation into myotubes were assessed. The results suggest 14 miRNAs (miR-423-3p, miR-17, miR-130b, miR-301a/b, miR-345, miR-15a, miR-16a, miR-128, miR-615, miR-1968, miR-1a/b, and miR-194) as cellular ATP regulators targeting genes involved in mitochondrial energy metabolism (Cox4i2, Cox6a2, Ndufb7, Ndufs4, Ndufs5, and Ndufv1) during C2C12 differentiation. Among these, miR-423-3p showed a high inverse correlation with increasing ATP levels. Besides having implications in promoting cell growth and cell cycle progression, its function in cellular ATP regulation is yet unknown. Therefore, miR-423-3p was selected and validated for the function together with its potential target, Cox6a2. Overexpression of miR-423-3p in C2C12 myogenic differentiation lead to decreased cellular ATP level and decreased expression of Cox6a2 compared to the negative control. These results suggest miR-423-3p as a novel regulator of ATP/energy metabolism by targeting Cox6a2. PMID:26010876

  11. Mitochondrial content is central to nuclear gene expression: Profound implications for human health.

    PubMed

    Muir, Rebecca; Diot, Alan; Poulton, Joanna

    2016-02-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing "Mitochondrial replacement therapy" to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important.

  12. Over-expression of mitochondrial heat shock protein 70 suppresses programmed cell death in rice.

    PubMed

    Qi, Yaocheng; Wang, Hongjuan; Zou, Yu; Liu, Cheng; Liu, Yanqi; Wang, Ying; Zhang, Wei

    2011-01-03

    In this study, we identified and functionally characterized the mitochondrial heat shock protein 70 (mtHsp70). Over-expression of mtHsp70 suppressed heat- and H(2)O(2)-induced programmed cell death (PCD) in rice protoplasts, as reflected by higher cell viability, decreased DNA laddering and chromatin condensation. Mitochondrial membrane potential (Δψ(m)) after heat shock was destroyed gradually in protoplasts, but mtHsp70 over-expression showed higher Δψ(m) relative to the vector control cells, and partially inhibited cytochrome c release from mitochondria to cytosol. Heat treatment also significantly increased reactive oxygen species (ROS) generation, a phenomenon not observed in protoplasts over-expressing mtHsp70. Together, these results suggest that mtHsp70 may suppress PCD in rice protoplasts by maintaining mitochondrial Δψ(m) and inhibiting the amplification of ROS.

  13. Mitochondrial content is central to nuclear gene expression: Profound implications for human health

    PubMed Central

    Muir, Rebecca; Diot, Alan

    2016-01-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing “Mitochondrial replacement therapy” to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important. PMID:26725055

  14. Allotopic expression of ATP6 in the mouse as a transgenic model of mitochondrial disease.

    PubMed

    Dunn, David A; Pinkert, Carl A

    2015-01-01

    Progress in animal modeling of polymorphisms and mutations in mitochondrial DNA (mtDNA) is not as developed as nuclear transgenesis due to a host of cellular and physiological distinctions. mtDNA mutation modeling is of critical importance as mutations in the mitochondrial genome give rise to a variety of pathological conditions and play a contributing role in many others. Nuclear localization and transcription of mtDNA genes followed by cytoplasmic translation and transport into mitochondria (allotopic expression, AE) provide an opportunity to create in vivo modeling of a targeted mutation in mitochondrial genes and has been suggested as a strategy for gene replacement therapy in patients harboring mitochondrial DNA mutations. Here, we use our AE approach to transgenic mouse modeling of the pathogenic human T8993G mutation in mtATP6 as a case study for designing AE animal models.

  15. Betulinic Acid Induces Apoptosis in Differentiated PC12 Cells Via ROS-Mediated Mitochondrial Pathway.

    PubMed

    Wang, Xi; Lu, Xiaocheng; Zhu, Ronglan; Zhang, Kaixin; Li, Shuai; Chen, Zhongjun; Li, Lixin

    2017-01-25

    Betulinic acid (BA), a pentacyclic triterpene of natural origin, has been demonstrated to have varied biologic activities including anti-viral, anti-inflammatory, and anti-malarial effects; it has also been found to induce apoptosis in many types of cancer. However, little is known about the effect of BA on normal cells. In this study, the effects of BA on normal neuronal cell apoptosis and the mechanisms involved were studied using differentiated PC12 cells as a model. Treatment with 50 μM BA for 24 h apparently induced PC12 cell apoptosis. In the early stage of apoptosis, the level of intracellular reactive oxygen species (ROS) increased. Afterwards, the loss of the mitochondrial membrane potential, the release of cytochrome c and the activation of caspase-3 occurred. Treatment with antioxidants could significantly reduce BA-induced PC12 cell apoptosis. In conclusion, we report for the first time that BA induced the mitochondrial apoptotic pathway in differentiated PC12 cells through ROS.

  16. Differential mitochondrial calcium responses in different cell types detected with a mitochondrial calcium fluorescent indicator, mito-GCaMP2.

    PubMed

    Chen, Min; Wang, Yanru; Hou, Tingting; Zhang, Huiliang; Qu, Aijuan; Wang, Xianhua

    2011-10-01

    Mitochondrial calcium plays a crucial role in mitochondrial metabolism, cell calcium handling, and cell death. However, some mechanisms concerning mitochondrial calcium regulation are still unknown, especially how mitochondrial calcium couples with cytosolic calcium. In this work, we constructed a novel mitochondrial calcium fluorescent indicator (mito-GCaMP2) by genetic manipulation. Mito-GCaMP2 was imported into mitochondria with high efficiency and the fluorescent signals co-localized with that of tetramethyl rhodamine methyl ester, a mitochondrial membrane potential indicator. The mitochondrial inhibitors specifically decreased the signals of mito-GCaMP2. The apparent K(d) of mito-GCaMP2 was 195.0 nmol/L at pH 8.0 in adult rat cardiomyocytes. Furthermore, we observed that mito-GCaMP2 preferred the alkaline pH surrounding of mitochondria. In HeLa cells, we found that mitochondrial calcium ([Ca(2+)](mito)) responded to the changes of cytosolic calcium ([Ca(2+)](cyto)) induced by histamine or thapasigargin. Moreover, external Ca(2+) (100 μmol/L) directly induced an increase of [Ca(2+)](mito) in permeabilized HeLa cells. However, in rat cardiomyocytes [Ca(2+)](mito) did not respond to cytosolic calcium transients stimulated by electric pacing or caffeine. In permeabilized cardiomyocytes, 600 nmol/L free Ca(2+) repeatedly increased the fluorescent signals of mito-GCaMP2, which excluded the possibility that mito-GCaMP2 lost its function in cardiomyocytes mitochondria. These results showed that the response of mitochondrial calcium is diverse in different cell lineages and suggested that mitochondria in cardiomyocytes may have a special defense mechanism to control calcium flux.

  17. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression.

    PubMed

    Gómez-Sánchez, Rubén; Gegg, Matthew E; Bravo-San Pedro, José M; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M; González-Polo, Rosa Ana; Schapira, Anthony H V

    2014-02-01

    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection.

  18. Flower-enhanced expression of a nuclear-encoded mitochondrial respiratory protein is associated with changes in mitochondrion number.

    PubMed Central

    Huang, J; Struck, F; Matzinger, D F; Levings, C S

    1994-01-01

    The mitochondrial Rieske iron-sulfur protein is an obligatory component of the respiratory electron transport chain that is encoded by a single-copy gene in mammals and fungi. In contrast, this protein is encoded by a small gene family in dicotyledonous tobacco and monocotyledonous maize. We cloned four cDNAs from tobacco that encode the mitochondrial Rieske iron-sulfur protein. These clones, along with a previously isolated cDNA, represent five independent members of the gene family that can be divided into three subfamilies. All of these genes were derived from the two progenitor species and were expressed in amphidiploid tobacco. The proteins encoded by these five genes are probably functional because they all contain the universally conserved hexyl peptides necessary for the 2Fe-2S cluster formation. The expression of the Rieske protein gene family is differentially regulated; a 6- to 11-fold higher level of steady state transcripts was found in flowers than in leaves, stems, and roots. Members of at least two subfamilies were preferentially expressed in flowers, indicating that they share a common cis-regulatory element(s), which can respond to a flower-specific signal(s). Although approximately 10 times more transcripts occurred in flowers than in leaves, flower and leaf mitochondria contained a similar amount of the Rieske protein. Flowers, however, contained seven times more Rieske proteins than leaves. These results indicated an increase in mitochondrion number in flowers. High-energy demands during anther development might bring about an increase in mitochondrion numbers in flowers and the flower-enhanced expression of the Rieske protein gene family. Our results suggested that nuclear genes encoding mitochondrial respiratory proteins could sense and respond to changes in energy metabolism and/or changes in mitochondrion numbers. PMID:8180500

  19. Cilostazol promotes mitochondrial biogenesis in human umbilical vein endothelial cells through activating the expression of PGC-1α

    SciTech Connect

    Zuo, Luning; Li, Qiang; Sun, Bei; Xu, Zhiying; Ge, Zhiming

    2013-03-29

    Highlights: ► First time to show that cilostazol promotes the expressions of PGC-1α. ► First time to show that cilostazol stimulates mitochondrial biogenesis in HUVECs. ► PKA/CREB pathway mediates the effect of cilostazol on PGC-1α expression. ► Suggesting the roles of cilostazol in mitochondrial dysfunction related disease. -- Abstract: Mitochondrial dysfunction is frequently observed in vascular diseases. Cilostazol is a drug approved by the US Food and Drug Administration for the treatment of intermittent claudication. Cilostazol increases intracellular cyclic adenosine monophosphate (cAMP) levels through inhibition of type III phosphodiesterase. The effects of cilostazol in mitochondrial biogenesis in human umbilical vein endothelial cells (HUVECs) were investigated in this study. Cilostazol treated HUVECs displayed increased levels of ATP, mitochondrial DNA/nuclear DNA ratio, expressions of cytochrome B, and mitochondrial mass, suggesting an enhanced mitochondrial biogenesis induced by cilostazol. The promoted mitochondrial biogenesis could be abolished by Protein kinase A (PKA) specific inhibitor H-89, implying that PKA pathway played a critical role in increased mitochondrial biogenesis after cilostazol treatment. Indeed, expression levels of peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α), NRF 1 and mitochondrial transcription factor A (TFAM) were significantly increased in HUVECs after incubation with cilostazol at both mRNA levels and protein levels. Importantly, knockdown of PGC-1α could abolish cilostazol-induced mitochondrial biogenesis. Enhanced expression of p-CREB and PGC-1α induced by cilostazol could be inhibited by H-89. Moreover, the increased expression of PGC-1α induced by cilostazol could be inhibited by downregulation of CREB using CREB siRNA at both mRNA and protein levels. All the results indicated that cilostazol promoted mitochondrial biogenesis through activating the expression of PGC-1α in

  20. Axin is expressed in mitochondria and suppresses mitochondrial ATP synthesis in HeLa cells.

    PubMed

    Shin, Jee-Hye; Kim, Hyun-Wook; Rhyu, Im Joo; Kee, Sun-Ho

    2016-01-01

    Many recent studies have revealed that axin is involved in numerous cellular functions beyond the negative regulation of β-catenin-dependent Wnt signaling. Previously, an association of ectopic axin with mitochondria was observed. In an effort to investigate the relationship between axin and mitochondria, we found that axin expression suppressed cellular ATP production, which was more apparent as axin expression levels increased. Also, mitochondrial expression of axin was observed using two axin-expressing HeLa cell models: doxycycline-inducible ectopic axin expression (HeLa-axin) and axin expression enhanced by long-term treatment with XAV939 (HeLa-XAV). In biochemical analysis, axin is associated with oxidative phosphorylation (OXPHOS) complex IV and is involved in defects in the assembly of complex IV-containing supercomplexes. Functionally, axin expression reduced the activity of OXPHOS complex IV and the oxygen consumption rate (OCR), suggesting axin-mediated mitochondrial dysfunction. Subsequent studies using various inhibitors of Wnt signaling showed that the reduction in cellular ATP levels was weaker in cases of ICAT protein expression and treatment with iCRT3 or NSC668036 compared with XAV939 treatment, suggesting that XAV939 treatment affects ATP synthesis in addition to suppressing Wnt signaling activity. Axin-mediated regulation of mitochondrial function may be an additional mechanism to Wnt signaling for regulation of cell growth.

  1. Guava fruit extract and its triterpene constituents have osteoanabolic effect: Stimulation of osteoblast differentiation by activation of mitochondrial respiration via the Wnt/β-catenin signaling.

    PubMed

    Porwal, Konica; Pal, Subhashis; Dev, Kapil; China, Shyamsundar Pal; Kumar, Yogesh; Singh, Chandan; Barbhuyan, Tarun; Sinha, Neeraj; Sanyal, Sabyasachi; Trivedi, Arun Kumar; Maurya, Rakesh; Chattopadhyay, Naibedya

    2017-03-08

    The aim of this study was to evaluate the skeletal effect of guava triterpene-enriched extract (GE) in rats and identify osteogenic compounds thereof, and determine their modes of action. In growing female rats, GE at 250 mg/kg dose increased parameters of peak bone mass including femur length, bone mineral density (BMD) and biomechanical strength, suggesting that GE promoted modeling-directed bone growth. GE also stimulated bone regeneration at the site of bone injury. In adult osteopenic rats (osteopenia induced by ovariectomy, OVX) GE completely restored the lost bones at both axial and appendicular sites, suggesting a strong osteoanabolic effect. Serum metabolomics studies showed changes in several metabolites (some of which are related to bone metabolism) in OVX compared with ovary-intact control and GE treatment to OVX rats reversed those. Out of six abundantly present triterpenes in GE, ursolic acid (UA) and 2α-hydroxy ursolic acid (2α-UA) induced osteogenic differentiation in vitro as did GE by activating Wnt/β-catenin pathway assessed by phosphorylation of GSK-3β. Over-expressing of constitutively active GSK-3β (caGSK-3β) in osteoblasts abolished the differentiation-promoting effect of GE, UA and 2α-UA. All three increased both glycolysis and mitochondrial respiration but only rotenone (inhibitor of mitochondrial electron transfer) and not 2-deoxyglucose (to block glycolysis) inhibited osteoblast differentiation. In addition, caGSK-3β over-expression attenuated the enhanced mitochondrial respiration caused by GE, UA and 2α-UA. We conclude that GE has osteoanabolic effect which is contributed by UA and 2α-UA, and involve activation of canonical Wnt signaling which in turn modulates cellular energy metabolism leading to osteoblast differentiation.

  2. Screening differentially expressed genes in an amphipod (Hyalella azteca) exposed to fungicide vinclozolin by suppression subtractive hybridization.

    PubMed

    Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H

    2014-01-01

    Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.

  3. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae).

    PubMed

    Sokolova, Inna M; Sokolov, Eugene P; Ponnappa, Kavita M

    2005-07-01

    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 microg L-1 (Cd-exposed) Cd2+ on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4+respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  4. Differential proteomic profiling unveils new molecular mechanisms associated with mitochondrial complex III deficiency

    PubMed Central

    Morán, María; López-Bernardo, Elia; Cadenas, Susana; Hidalgo, Beatriz; Sánchez, Ricardo; Seneca, Sara; Arenas, Joaquín; Martín, Miguel A.; Ugalde, Cristina

    2014-01-01

    We have analyzed the cellular pathways and metabolic adaptations that take place in primary skin fibroblasts from patients with mutations in BCS1L, a major genetic cause of mitochondrial complex III enzyme deficiency. Mutant fibroblasts exhibited low oxygen consumption rates and intracellular ATP levels, indicating that the main altered molecular event probably is a limited respiration-coupled ATP production through the OXPHOS system. Two-dimensional DIGE and MALDI-TOF/TOF mass spectrometry analyses unambiguously identified 39 proteins whose expression was significantly altered in complex III-deficient fibroblasts. Extensive statistical and cluster analyses revealed a protein profile characteristic for the BCS1L mutant fibroblasts that included alterations in energy metabolism, cell signaling and gene expression regulation, cytoskeleton formation and maintenance, and intracellular stress responses. The physiological validation of the predicted functional adaptations of human cultured fibroblasts to complex III deficiency confirmed the up-regulation of glycolytic enzyme activities and the accumulation of branched-chain among other amino acids, suggesting the activation of anaerobic glycolysis and cellular catabolic states, in particular protein catabolism, together with autophagy as adaptive responses to mitochondrial respiratory chain dysfunction and ATP deficiency. Our data point to an overall metabolic and genetic reprogramming that could contribute to explain the clinical manifestations of complex III deficiency in patients. PMID:25239759

  5. Mitochondrial GPX1 silencing triggers differential photosynthesis impairment in response to salinity in rice plants.

    PubMed

    Lima-Melo, Yugo; Carvalho, Fabricio E L; Martins, Márcio O; Passaia, Gisele; Sousa, Rachel H V; Neto, Milton C Lima; Margis-Pinheiro, Márcia; Silveira, Joaquim A G

    2016-08-01

    The physiological role of plant mitochondrial glutathione peroxidases is scarcely known. This study attempted to elucidate the role of a rice mitochondrial isoform (GPX1) in photosynthesis under normal growth and salinity conditions. GPX1 knockdown rice lines (GPX1s) were tested in absence and presence of 100 mM NaCl for 6 d. Growth reduction of GPX1s line under non-stressful conditions, compared with non-transformed (NT) plants occurred in parallel to increased H2 O2 and decreased GSH contents. These changes occurred concurrently with photosynthesis impairment, particularly in Calvin cycle's reactions, since photochemical efficiency did not change. Thus, GPX1 silencing and downstream molecular/metabolic changes modulated photosynthesis differentially. In contrast, salinity induced reduction in both phases of photosynthesis, which were more impaired in silenced plants. These changes were associated with root morphology alterations but not shoot growth. Both studied lines displayed increased GPX activity but H2 O2 content did not change in response to salinity. Transformed plants exhibited lower photorespiration, water use efficiency and root growth, indicating that GPX1 could be important to salt tolerance. Growth reduction of GPX1s line might be related to photosynthesis impairment, which in turn could have involved a cross talk mechanism between mitochondria and chloroplast originated from redox changes due to GPX1 deficiency.

  6. Stress and corticosteroids regulate rat hippocampal mitochondrial DNA gene expression via the glucocorticoid receptor

    PubMed Central

    Hunter, Richard G.; Seligsohn, Ma’ayan; Rubin, Todd G.; Griffiths, Brian B.; Ozdemir, Yildirim; Pfaff, Donald W.; Datson, Nicole A.; McEwen, Bruce S.

    2016-01-01

    Glucocorticoids (GCs) are involved in stress and circadian regulation, and produce many actions via the GC receptor (GR), which is classically understood to function as a nuclear transcription factor. However, the nuclear genome is not the only genome in eukaryotic cells. The mitochondria also contain a small circular genome, the mitochondrial DNA (mtDNA), that encodes 13 polypeptides. Recent work has established that, in the brain and other systems, the GR is translocated from the cytosol to the mitochondria and that stress and corticosteroids have a direct influence on mtDNA transcription and mitochondrial physiology. To determine if stress affects mitochondrially transcribed mRNA (mtRNA) expression, we exposed adult male rats to both acute and chronic immobilization stress and examined mtRNA expression using quantitative RT-PCR. We found that acute stress had a main effect on mtRNA expression and that expression of NADH dehydrogenase 1, 3, and 6 (ND-1, ND-3, ND-6) and ATP synthase 6 (ATP-6) genes was significantly down-regulated. Chronic stress induced a significant up-regulation of ND-6 expression. Adrenalectomy abolished acute stress-induced mtRNA regulation, demonstrating GC dependence. ChIP sequencing of GR showed that corticosterone treatment induced a dose-dependent association of the GR with the control region of the mitochondrial genome. These findings demonstrate GR and stress-dependent transcriptional regulation of the mitochondrial genome in vivo and are consistent with previous work linking stress and GCs with changes in the function of brain mitochondria. PMID:27457949

  7. Increased mitochondrial ROS formation by acetaminophen in human hepatic cells is associated with gene expression changes suggesting disruption of the mitochondrial electron transport chain.

    PubMed

    Jiang, Jian; Briedé, Jacob J; Jennen, Danyel G J; Van Summeren, Anke; Saritas-Brauers, Karen; Schaart, Gert; Kleinjans, Jos C S; de Kok, Theo M C M

    2015-04-16

    Acetaminophen (APAP) overdosage results in hepatotoxicity, but the underlying molecular mechanisms are still not completely understood. In the current study, we focused on mitochondrial-specific oxidative liver injury induced by APAP exposure. Owning to genetic polymorphisms in the CYP2E1 gene or varying inducibility by xenobiotics, the CYP2E1 mRNA level and protein activity vary extensively among individuals. As CYP2E1 is a known ROS generating enzyme, we chose HepG2 to minimize CYP2E1-induced ROS formation, which will help us better understand the APAP induced mitochondrial-specific hepatotoxicity in a subpopulation with low CYP2E1 activity. HepG2 cells were exposed to a low and toxic dose (0.5 and 10mM) of APAP and analyzed at four time points for genome-wide gene expression. Mitochondria were isolated and electron spin resonance spectroscopy was performed to measure the formation of mitochondrial ROS. The yield of ATP was measured to confirm the impact of the toxic dose of APAP on cellular energy production. Our results indicate that 10mM APAP significantly influences the expression of mitochondrial protein-encoding genes in association with an increase in mitochondrial ROS formation. Additionally, 10mM APAP affects the expression of genes encoding the subunits of electron transport chain (ETC) complexes, which may alter normal mitochondrial functions by disrupting the assembly, stability, and structural integrity of ETC complexes, leading to a measurable depletion of ATP, and cell death. The expression of mitochondrium-specific antioxidant enzyme, SOD2, is reduced which may limit the ROS scavenging ability and cause imbalance of the mitochondrial ROS homeostasis. Overall, transcriptome analysis reveals the molecular processes involved in the observed APAP-induced increase of mitochondrial ROS formation and the associated APAP-induced oxidative stress.

  8. Over-expression of mitochondrial ferritin affects the JAK2/STAT5 pathway in K562 cells and causes mitochondrial iron accumulation

    PubMed Central

    Santambrogio, Paolo; Erba, Benedetta Gaia; Campanella, Alessandro; Cozzi, Anna; Causarano, Vincenza; Cremonesi, Laura; Gallì, Anna; Della Porta, Matteo Giovanni; Invernizzi, Rosangela; Levi, Sonia

    2011-01-01

    Background Mitochondrial ferritin is a nuclear encoded iron-storage protein localized in mitochondria. It has anti-oxidant properties related to its ferroxidase activity, and it is able to sequester iron avidly into the organelle. The protein has a tissue-specific pattern of expression and is also highly expressed in sideroblasts of patients affected by hereditary sideroblastic anemia and by refractory anemia with ringed sideroblasts. The present study examined whether mitochondrial ferritin has a role in the pathogenesis of these diseases. Design and Methods We analyzed the effect of mitochondrial ferritin over-expression on the JAK2/STAT5 pathway, on iron metabolism and on heme synthesis in erythroleukemic cell lines. Furthermore its effect on apoptosis was evaluated on human erythroid progenitors. Results Data revealed that a high level of mitochondrial ferritin reduced reactive oxygen species and Stat5 phosphorylation while promoting mitochondrial iron loading and cytosolic iron starvation. The decline of Stat5 phosphorylation induced a decrease of the level of anti-apoptotic Bcl-xL transcript compared to that in control cells; however, transferrin receptor 1 transcript increased due to the activation of the iron responsive element/iron regulatory protein machinery. Also, high expression of mitochondrial ferritin increased apoptosis, limited heme synthesis and promoted the formation of Perls-positive granules, identified by electron microscopy as iron granules in mitochondria. Conclusions Our results provide evidence suggesting that Stat5-dependent transcriptional regulation is displaced by strong cytosolic iron starvation status induced by mitochondrial ferritin. The protein interferes with JAK2/STAT5 pathways and with the mechanism of mitochondrial iron accumulation. PMID:21712541

  9. Photoperiod-sensitive cytoplasmic male sterility in wheat: nuclear-mitochondrial incompatibility results in differential processing of the mitochondrial orf25 gene.

    PubMed

    Ogihara, Y; Kurihara, Y; Futami, K; Tsuji, K; Murai, K

    1999-12-01

    An alloplasmic wheat line with the cytoplasm of Aegilops crassa expresses photoperiod-sensitive cytoplasmic male sterility (PCMS). Southern- and Northern-hybridization analyses showed that this line contains alterations in both the gene structure and transcription patterns of the mitochondrial gene orf25. In this study, the nucleotide sequence around the orf25 gene of Ae. crassa (CR-orf25) and common wheat (AE-orf25) was determined, and we found that the upstream region of CR-orf25 had been replaced by that of rps7 of common wheat (AE-rps7) through recombination. A novel open reading frame (orf48) is present upstream of CR-orf25. In these three genes, transcription was initiated from the consensus promoter motif of plant mitochondrial genes located in the upstream regions. Processing enzymes in Ae. crassa and common wheat cleave the respective precursor mRNAs, namely CR-orf25 and AE-rps7, at sites similar to that of the premature mitochondrial 26S rRNA. In contrast, the precursor mRNA is not effectively processed at the target sequence of CR-orf25 in the alloplasmic wheat line. Because major transcripts of the euplasmic CR-orf25 and AE-rps7 genes would result in a truncated orf48 product, one possibility is that the orf48 protein might disturb mitochondrial function at a specific stage and hence affect the expression of the PCMS trait.

  10. Differential diagnosis of Mendelian and mitochondrial disorders in patients with suspected multiple sclerosis.

    PubMed

    Weisfeld-Adams, James D; Katz Sand, Ilana B; Honce, Justin M; Lublin, Fred D

    2015-03-01

    Several single gene disorders share clinical and radiologic characteristics with multiple sclerosis and have the potential to be overlooked in the differential diagnostic evaluation of both adult and paediatric patients with multiple sclerosis. This group includes lysosomal storage disorders, various mitochondrial diseases, other neurometabolic disorders, and several other miscellaneous disorders. Recognition of a single-gene disorder as causal for a patient's 'multiple sclerosis-like' phenotype is critically important for accurate direction of patient management, and evokes broader genetic counselling implications for affected families. Here we review single gene disorders that have the potential to mimic multiple sclerosis, provide an overview of clinical and investigational characteristics of each disorder, and present guidelines for when clinicians should suspect an underlying heritable disorder that requires diagnostic confirmation in a patient with a definite or probable diagnosis of multiple sclerosis.

  11. Differential diagnosis of Mendelian and mitochondrial disorders in patients with suspected multiple sclerosis

    PubMed Central

    Katz Sand, Ilana B.; Honce, Justin M.; Lublin, Fred D.

    2015-01-01

    Several single gene disorders share clinical and radiologic characteristics with multiple sclerosis and have the potential to be overlooked in the differential diagnostic evaluation of both adult and paediatric patients with multiple sclerosis. This group includes lysosomal storage disorders, various mitochondrial diseases, other neurometabolic disorders, and several other miscellaneous disorders. Recognition of a single-gene disorder as causal for a patient’s ‘multiple sclerosis-like’ phenotype is critically important for accurate direction of patient management, and evokes broader genetic counselling implications for affected families. Here we review single gene disorders that have the potential to mimic multiple sclerosis, provide an overview of clinical and investigational characteristics of each disorder, and present guidelines for when clinicians should suspect an underlying heritable disorder that requires diagnostic confirmation in a patient with a definite or probable diagnosis of multiple sclerosis. PMID:25636970

  12. Mitochondrial differentiation in a polymorphic land snail: evidence for Pleistocene survival within the boundaries of permafrost.

    PubMed

    Haase, M; Misof, B; Wirth, T; Baminger, H; Baur, B

    2003-05-01

    The genetic differentiation of populations having colonized formerly unsuitable habitats after the Pleistocene glaciations depends to a great extent on the speed of expansion. Slow dispersers maintain their refugial diversity whereas fast dispersal leads to a reduction of diversity in the newly colonized areas. During the Pleistocene, almost the entire current range of the land snail Arianta arbustorum has repeatedly been covered with ice or been subjected to permafrost. Owing to the low potential for dispersal of land snails, slow (re)colonization of the wide range from southern refugia can be excluded. Alternatively, fast, passive dispersal from southern refugia or survival in and expansion from multiple refugia within the area subjected to permafrost may account for the current distribution. To distinguish between these scenarios we reconstructed a phylogeography based on the sequences of a fragment of the cytochrome oxidase I from 133 individuals collected at 45 localities and analysed the molecular variance. Seventy-five haplotypes were found that diverged on average at 7.52% of positions. This high degree of diversity suggests that A. arbustorum is an old species in which the population structure, isolation and the hermaphroditic nature have reduced the probability of lineage extinction. The genetic structure was highly significant with the highest variance partition found among regions. Geographic distance and mitochondrial differentiation were not congruent. Lineages had overlapping ranges. The clear genetic differentiation and the patchy pattern of haplotype distribution suggest that colonization of formerly unsuitable habitats was mainly achieved from multiple populations from within the permafrost area.

  13. Multi-focal control of mitochondrial gene expression by oncogenic MYC provides potential therapeutic targets in cancer

    PubMed Central

    Oran, Amanda R.; Adams, Clare M.; Zhang, Xiao-yong; Gennaro, Victoria J.; Pfeiffer, Harla K.; Mellert, Hestia S.; Seidel, Hans E.; Mascioli, Kirsten; Kaplan, Jordan; Gaballa, Mahmoud R.; Shen, Chen; Rigoutsos, Isidore; King, Michael P.; Cotney, Justin L.; Arnold, Jamie J.; Sharma, Suresh D.; Martinez, Ubaldo E.; Vakoc, Christopher R.; Chodosh, Lewis A.; Thompson, James E.; Bradner, James E.; Cameron, Craig E.; Shadel, Gerald S.; Eischen, Christine M.; McMahon, Steven B.

    2016-01-01

    Despite ubiquitous activation in human cancer, essential downstream effector pathways of the MYC transcription factor have been difficult to define and target. Using a structure/function-based approach, we identified the mitochondrial RNA polymerase (POLRMT) locus as a critical downstream target of MYC. The multifunctional POLRMT enzyme controls mitochondrial gene expression, a process required both for mitochondrial function and mitochondrial biogenesis. We further demonstrate that inhibition of this newly defined MYC effector pathway causes robust and selective tumor cell apoptosis, via an acute, checkpoint-like mechanism linked to aberrant electron transport chain complex assembly and mitochondrial reactive oxygen species (ROS) production. Fortuitously, MYC-dependent tumor cell death can be induced by inhibiting the mitochondrial gene expression pathway using a variety of strategies, including treatment with FDA-approved antibiotics. In vivo studies using a mouse model of Burkitt's Lymphoma provide pre-clinical evidence that these antibiotics can successfully block progression of MYC-dependent tumors. PMID:27590350

  14. SCaMC-1Like a Member of the Mitochondrial Carrier (MC) Family Preferentially Expressed in Testis and Localized in Mitochondria and Chromatoid Body

    PubMed Central

    Amigo, Ignacio; Traba, Javier; Satrústegui, Jorgina; del Arco, Araceli

    2012-01-01

    Mitochondrial carriers (MC) form a highly conserved family involved in solute transport across the inner mitochondrial membrane in eukaryotes. In mammals, ATP-Mg/Pi carriers, SCaMCs, form the most complex subgroup with four paralogs, SCaMC-1, -2, -3 and -3L, and several splicing variants. Here, we report the tissue distribution and subcellular localization of a mammalian-specific SCaMC paralog, 4930443G12Rik/SCaMC-1Like (SCaMC-1L), which displays unanticipated new features. SCaMC-1L proteins show higher amino acid substitution rates than its closest paralog SCaMC-1. In mouse, SCaMC-1L expression is restricted to male germ cells and regulated during spermatogenesis but unexpectedly its localization is not limited to mitochondrial structures. In mature spermatids SCaMC-1L is detected in the mitochondrial sheath but in previous differentiation stages appears associated to cytosolic granules which colocalize with specific markers of the chromatoid body (CB) in post-meiotic round spermatids and inter-mitochondrial cement (IMC) in spermatocytes. The origin of this atypical distribution was further investigated by transient expression in cell lines. Similarly to male germ cells, in addition to mitochondrial and cytosolic distribution, a fraction of SCaMC-1L-expressing COS-7 cells display cytosolic SCaMC-1L-aggregates which exhibit aggresomal-like features as the CB. Our results indicate that different regions of SCaMC-1L hinder its import into mitochondria and this apparently favours the formation of cytosolic aggregates in COS-7 cells. This mechanism could be also operational in male germ cells and explain the incorporation of SCaMC-1L into germinal granules. PMID:22792342

  15. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  16. Mitochondrial enzyme expression in the hippocampus in relation to Alzheimer-type pathology.

    PubMed

    Nagy, Z; Esiri, M M; LeGris, M; Matthews, P M

    1999-04-01

    Recent reports have suggested that mitochondrial dysfunction may contribute to the progression of the pathology of Alzheimer's disease (AD). However, both increases and decreases in the activity of cytochrome oxidase have been described in the hippocampi of AD patients. In this study we used immunohistochemistry and quantitative autoradiographic methods to study the expression pattern of two cytochrome oxidase subunit proteins (nuclear-encoded COX IV and mitochondrial-encoded COX I) in the hippocampus in relation to the development of AD-type pathology. We found heterogeneous expression of both COX subunits in AD with an increased expression of both subunit proteins in healthy, non-tangle-bearing, neurones but absence of both subunit proteins in tangle-bearing neurones. Levels of COX IV but not of COX I were related to the amount of hyperphosphorylated tau accumulated in the same hippocampal region but not to the amount of amyloid deposited in sporadic AD. In Down's syndrome COX I and COX IV were similarly increased in the presence of AD pathology in non-tangle-bearing neurones. However, in these cases levels of enzyme expression were correlated to the amount of amyloid accumulation but not the amount of hyperphosphorylated tau in the hippocampus. We believe that heterogeneity of expression of mitochondrial enzyme proteins between neurones may contribute to the conflicting conclusions in previous reports regarding relative levels of cytochrome oxidase activity in the hippocampus in AD. We hypothesise that the increased mitochondrial enzyme expression in healthy-appearing neurones of AD brains may represent a physiological response to increased functional demand on surviving neurones as a consequence of AD-related neuronal pathology.

  17. In Vivo Determination of Mitochondrial Function Using Luciferase-Expressing Caenorhabditis elegans: Contribution of Oxidative Phosphorylation, Glycolysis, and Fatty Acid Oxidation to Toxicant-Induced Dysfunction.

    PubMed

    Luz, Anthony L; Lagido, Cristina; Hirschey, Matthew D; Meyer, Joel N

    2016-08-01

    Mitochondria are a target of many drugs and environmental toxicants; however, how toxicant-induced mitochondrial dysfunction contributes to the progression of human disease remains poorly understood. To address this issue, in vivo assays capable of rapidly assessing mitochondrial function need to be developed. Here, using the model organism Caenorhabditis elegans, we describe how to rapidly assess the in vivo role of the electron transport chain, glycolysis, or fatty acid oxidation in energy metabolism following toxicant exposure, using a luciferase-expressing ATP reporter strain. Alterations in mitochondrial function subsequent to toxicant exposure are detected by depleting steady-state ATP levels with inhibitors of the mitochondrial electron transport chain, glycolysis, or fatty acid oxidation. Differential changes in ATP following short-term inhibitor exposure indicate toxicant-induced alterations at the site of inhibition. Because a microplate reader is the only major piece of equipment required, this is a highly accessible method for studying toxicant-induced mitochondrial dysfunction in vivo. © 2016 by John Wiley & Sons, Inc.

  18. Associations of Mitochondrial Haplogroups B4 and E with Biliary Atresia and Differential Susceptibility to Hydrophobic Bile Acid

    PubMed Central

    Tiao, Mao-Meng; Liou, Chia-Wei; Huang, Li-Tung; Wang, Pei-Wen; Lin, Tsu-Kung; Chen, Jin-Bor; Chou, Yao-Min; Huang, Ying-Hsien; Lin, Hung-Yu; Chen, Chao-Long; Chuang, Jiin-Haur

    2013-01-01

    Mitochondrial dysfunction has been implicated in the pathogenesis of biliary atresia (BA). This study aimed to determine whether a specific mitochondrial DNA haplogroup is implicated in the pathogenesis and prognosis of BA. We determined 40 mitochondrial single nucleotide polymorphisms in 15 major mitochondrial haplogroups by the use of 24-plex PCR and fluorescent beads combined with sequence-specific oligonucleotide probes in 71 patients with BA and in 200 controls in the Taiwanese population of ethnic Chinese background. The haplogroup B4 and E prevalence were significantly lower and higher respectively, in the patients with BA than in the controls (odds ratios, 0.82 [p = 0.007] and 7.36 [p = 0.032] respectively) in multivariate logistic-regression analysis. The 3-year survival rate with native liver was significantly lower in haplogroup E than the other haplogroups (P = 0.037). A cytoplasmic hybrid (cybrid) was obtained from human 143B osteosarcoma cells devoid of mtDNA (ρ0 cell) and was fused with specific mtDNA bearing E and B4 haplogroups donated by healthy Taiwanese subjects. Chenodeoxycholic acid treatment resulted in significantly lower free radical production, higher mitochondrial membrane potential, more viable cells, and fewer apoptotic cybrid B4 cells than parental 143B and cybrid E cells. Bile acid treatment resulted in a significantly greater protective mitochondrial reaction with significantly higher mitochondrial DNA copy number and mitofusin 1 and 2 concentrations in cybrid B4 and parental cells than in cybrid E cells. The results of the study suggested that the specific mitochondrial DNA haplogroups B4 and E were not only associated with lower and higher prevalence of BA respectively, in the study population, but also with differential susceptibility to hydrophobic bile acid in the cybrid harboring different haplogroups. PMID:23966875

  19. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  20. Alpha-ketoglutarate Curbs Differentiation and Induces Cell Death in Mesenchymal Stromal Precursors with Mitochondrial Dysfunction.

    PubMed

    Singh, Karmveer; Krug, Linda; Basu, Abhijit; Meyer, Patrick; Treiber, Nicolai; Vander Beken, Seppe; Wlaschek, Meinhard; Kochanek, Stefan; Bloch, Wilhelm; Geiger, Hartmut; Maity, Pallab; Scharffetter-Kochanek, Karin

    2017-04-11

    Increased concentrations of reactive oxygen species (ROS) originating from dysfunctional mitochondria contribute to diverse aging-related degenerative disorders. But so far little is known about the impact of distinct ROS on metabolism and fate of stromal precursor cells. We here demonstrate that an increase in superoxide anion radicals due to superoxide dismutase 2 (Sod2) deficiency in stromal precursor cells suppress osteogenic and adipogenic differentiation through fundamental changes in the global metabolite landscape. Our data identify impairment of the pyruvate and L-glutamine metabolism causing toxic accumulation of alpha-ketoglutarate in the Sod2 deficient and intrinsically aged stromal precursor cells as a major cause for their reduced lineage differentiation. Alpha-ketoglutarate accumulation led to enhanced nucleocytoplasmic vacuolation and chromatin condensation-mediated cell death in Sod2 deficient stromal precursor cells as a consequence of DNA damage, Hif-1α instability and reduced histone H3 (Lys27) acetylation. These findings hold promise for prevention and treatment of mitochondrial disorders commonly associated with aged individuals. This article is protected by copyright. All rights reserved.

  1. Genetic diversity and differentiation of the Ryukyu endemic frog Babina holsti as revealed by mitochondrial DNA.

    PubMed

    Tominaga, Atsushi; Matsui, Masafumi; Nakata, Katsushi

    2014-02-01

    We surveyed the genetic diversity and genetic differentiation of an endangered frog, Babina holsti, endemic to Okinawajima and Tokashikijima Islands of the Ryukyus, to elucidate its divergence history and obtain basic data for its conservation. Genetic differentiation between the two island lineages is moderate (3.1% p-distance in the cyt b gene). This result suggests that the two island lineages have been isolated between the late Pliocene and the middle Pleistocene and have never migrated between the current northern part of Okinawajima and Tokashikijima Islands, which were once connected in the late Pleistocene glacial age. On Okinawajima Island, the southernmost sample was constituted by a unique haplotype, without considerable genetic distance from haplotypes detected from northern samples. This unique haplotype composition in the southernmost sample would have resulted from the restricted gene flow between the southernmost population and the other populations in Okinawajima Island. Furthermore, the absence of genetic diversity within the southernmost sample indicates that this population has recently experienced population size reduction, possibly by predation pressure from an introduced mongoose, which is more abundant in the southern part than in the northern part of the island. Lower genetic diversity in the Tokashikijima sample implies a small effective population size for mitochondrial DNA (mtDNA) in B. holsti on the island. Immediate conservation measures should be taken for the populations from the southernmost range in Okinawajima and Tokashikijima.

  2. Morphological adaptation with no mitochondrial DNA differentiation in the coastal plain swamp sparrow

    USGS Publications Warehouse

    Greenberg, R.; Cordero, P.J.; Droege, S.; Fleischer, R.C.

    1998-01-01

    We estimated genetic differentiation between morphologically distinct tidal marsh populations of Swamp Sparrows (Melospiza georgiana nigrescens) and the more wide-spread inland populations (M. g. georgiana and M. g. ericrypta). The tidal marsh populations are consistently grayer with more extensive black markings (particularly in the crown), and their bills are larger. These differences are variously shared with other species of salt marsh birds and small mammals. We analyzed mitochondrial DNA sequences (5' end of control region, COII/tlys/ATPase8, and ND2) of Swamp Sparrows and found low levels of genetic variation and no evidence of geographic structure. These results suggest a rapid and recent geographic expansion of Swamp Sparrows from restricted Pleistocene populations. Morphological differentiation has occurred without long-term genetic isolation, suggesting that selection on the divergent traits is intense. The grayer and more melanistic plumage is probably cryptic coloration for foraging on tidal mud, which tends to be grayish as a result of the formation of iron sulfides, rather than iron oxides, under anaerobic conditions.

  3. Changes in mitochondrial function and mitochondria associated protein expression in response to 2-weeks of high intensity interval training

    PubMed Central

    Vincent, Grace; Lamon, Séverine; Gant, Nicholas; Vincent, Peter J.; MacDonald, Julia R.; Markworth, James F.; Edge, Johann A.; Hickey, Anthony J. R.

    2015-01-01

    Purpose: High-intensity short-duration interval training (HIT) stimulates functional and metabolic adaptation in skeletal muscle, but the influence of HIT on mitochondrial function remains poorly studied in humans. Mitochondrial metabolism as well as mitochondrial-associated protein expression were tested in untrained participants performing HIT over a 2-week period. Methods: Eight males performed a single-leg cycling protocol (12 × 1 min intervals at 120% peak power output, 90 s recovery, 4 days/week). Muscle biopsies (vastus lateralis) were taken pre- and post-HIT. Mitochondrial respiration in permeabilized fibers, citrate synthase (CS) activity and protein expression of peroxisome proliferator-activated receptor gamma coactivator (PGC-1α) and respiratory complex components were measured. Results: HIT training improved peak power and time to fatigue. Increases in absolute oxidative phosphorylation (OXPHOS) capacities and CS activity were observed, but not in the ratio of CCO to the electron transport system (CCO/ETS), the respiratory control ratios (RCR-1 and RCR-2) or mitochondrial-associated protein expression. Specific increases in OXPHOS flux were not apparent after normalization to CS, indicating that gross changes mainly resulted from increased mitochondrial mass. Conclusion: Over only 2 weeks HIT significantly increased mitochondrial function in skeletal muscle independently of detectable changes in mitochondrial-associated and mitogenic protein expression. PMID:25759671

  4. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  5. Bcl-2 expression in synovial fibroblasts is essential for maintaining mitochondrial homeostasis and cell viability.

    PubMed

    Perlman, H; Georganas, C; Pagliari, L J; Koch, A E; Haines, K; Pope, R M

    2000-05-15

    The regulation of proliferation and cell death is vital for homeostasis, but the mechanism that coordinately balances these events in rheumatoid arthritis (RA) remains largely unknown. In RA, the synovial lining thickens in part through increased proliferation and/or decreased synovial fibroblast cell death. Here we demonstrate that the anti-apoptotic protein, Bcl-2, is highly expressed in RA compared with osteoarthritis synovial tissues, particularly in the CD68-negative, fibroblast-like synoviocyte population. To determine the importance of endogenous Bcl-2, an adenoviral vector expressing a hammerhead ribozyme to Bcl-2 (Ad-Rbz-Bcl-2) mRNA was employed. Ad-Rbz-Bcl-2 infection resulted in reduced Bcl-2 expression and cell viability in synovial fibroblasts isolated from RA and osteoarthritis synovial tissues. In addition, Ad-Rbz-Bcl-2-induced mitochondrial permeability transition, cytochrome c release, activation of caspases 9 and 3, and DNA fragmentation. The general caspase inhibitor zVAD.fmk blocked caspase activation, poly(ADP-ribose) polymerase cleavage, and DNA fragmentation, but not loss of transmembrane potential or viability, indicating that cell death was independent of caspase activation. Ectopically expressed Bcl-xL inhibited Ad-Rbz-Bcl-2-induced mitochondrial permeability transition and apoptosis in Ad-Rbz-Bcl-2-transduced cells. Thus, forced down-regulation of Bcl-2 does not induce a compensatory mechanism to prevent loss of mitochondrial integrity and cell death in human fibroblasts.

  6. Comparative analysis of some aspects of mitochondrial metabolism in differentiated and undifferentiated neuroblastoma cells.

    PubMed

    Klepinin, Aleksandr; Chekulayev, Vladimir; Timohhina, Natalja; Shevchuk, Igor; Tepp, Kersti; Kaldma, Andrus; Koit, Andre; Saks, Valdur; Kaambre, Tuuli

    2014-02-01

    The aim of the present study is to clarify some aspects of the mechanisms of regulation of mitochondrial metabolism in neuroblastoma (NB) cells. Experiments were performed on murine Neuro-2a (N2a) cell line, and the same cells differentiated by all-trans-retinoic acid (dN2a) served as in vitro model of normal neurons. Oxygraphy and Metabolic Control Analysis (MCA) were applied to characterize the function of mitochondrial oxidative phosphorylation (OXPHOS) in NB cells. Flux control coefficients (FCCs) for components of the OXPHOS system were determined using titration studies with specific non-competitive inhibitors in the presence of exogenously added ADP. Respiration rates of undifferentiated Neuro-2a cells (uN2a) and the FCC of Complex-II in these cells were found to be considerably lower than those in dN2a cells. Our results show that NB is not an exclusively glycolytic tumor and could produce a considerable part of ATP via OXPHOS. Two important enzymes - hexokinase-2 and adenylate kinase-2 can play a role in the generation of ATP in NB cells. MCA has shown that in uN2a cells the key sites in the regulation of OXPHOS are complexes I, II and IV, whereas in dN2a cells complexes II and IV. Results obtained for the phosphate and adenine nucleotide carriers showed that in dN2a cells these carriers exerted lower control over the OXPHOS than in undifferentiated cells. The sum of FCCs for both types of NB cells was found to exceed significantly that for normal cells suggesting that in these cells the respiratory chain was somehow reorganized or assembled into large supercomplexes.

  7. The Expression of Ubiquitous Mitochondrial Creatine Kinase Is Downregulated as Prostate Cancer Progression

    PubMed Central

    Amamoto, Rie; Uchiumi, Takeshi; Yagi, Mikako; Monji, Keisuke; Song, YooHyun; Oda, Yoshinao; Shiota, Masaki; Yokomizo, Akira; Naito, Seiji; Kang, Dongchon

    2016-01-01

    Background: Mitochondria play crucial roles in cell signaling events, interorganellar communication, aging, cell proliferation and apoptosis, and mitochondrial impairment has been shown to accelerate or modulate cancer progression. Ubiquitous mitochondrial creatine kinase (uMtCK) is predominantly localized in the intermembrane space of mitochondria and catalyzes the reversible exchange of high-energy phosphate between adenosine tri-phosphate (ATP) and phosphocreatine. However, little is known about its expression and function in human prostate cancer progression. Method: We investigated the expression of uMtCK in 148 prostate carcinoma tissues and matched normal tissue by immunohistochemistry. The expression and localization of uMtCK and hexokinase II, a marker of glycolysis, were examined in prostate carcinoma cell lines using western blot and immunofluorescence. Results: MtCK expression was significantly lower in high Gleason grade carcinoma compared with normal prostate or low grade carcinoma. Western blot further revealed that uMtCK was highly expressed in LNCaP and 22Rv1 cell lines, as well as in the normal prostate cell line RWPE-1. However, uMtCK expression was almost absent in PC3 and DU145 cell lines, in correlation with absent or mutant p53 expression, respectively. In contrast, hexokinase II was overexpressed in PC3 cells. Moreover, in the low uMtCK expressing cell lines, glycolytic ATP production was increased, whereas mitochondrial ATP production was decreased. Conclusions: These data suggest that uMtCK is downregulated as prostate cancer progresses in correlation with a metabolic switch in ATP usage. PMID:26722360

  8. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  9. Plectin isoform P1b and P1d deficiencies differentially affect mitochondrial morphology and function in skeletal muscle.

    PubMed

    Winter, Lilli; Kuznetsov, Andrey V; Grimm, Michael; Zeöld, Anikó; Fischer, Irmgard; Wiche, Gerhard

    2015-08-15

    Plectin, a versatile 500-kDa cytolinker protein, is essential for muscle fiber integrity and function. The most common disease caused by mutations in the human plectin gene, epidermolysis bullosa simplex with muscular dystrophy (EBS-MD), is characterized by severe skin blistering and progressive muscular dystrophy. Besides displaying pathological desmin-positive protein aggregates and degenerative changes in the myofibrillar apparatus, skeletal muscle specimens of EBS-MD patients and plectin-deficient mice are characterized by massive mitochondrial alterations. In this study, we demonstrate that structural and functional alterations of mitochondria are a primary aftermath of plectin deficiency in muscle, contributing to myofiber degeneration. We found that in skeletal muscle of conditional plectin knockout mice (MCK-Cre/cKO), mitochondrial content was reduced, and mitochondria were aggregated in sarcoplasmic and subsarcolemmal regions and were no longer associated with Z-disks. Additionally, decreased mitochondrial citrate synthase activity, respiratory function and altered adenosine diphosphate kinetics were characteristic of plectin-deficient muscles. To analyze a mechanistic link between plectin deficiency and mitochondrial alterations, we comparatively assessed mitochondrial morphology and function in whole muscle and teased muscle fibers of wild-type, MCK-Cre/cKO and plectin isoform-specific knockout mice that were lacking just one isoform (either P1b or P1d) while expressing all others. Monitoring morphological alterations of mitochondria, an isoform P1b-specific phenotype affecting the mitochondrial fusion-fission machinery and manifesting with upregulated mitochondrial fusion-associated protein mitofusin-2 could be identified. Our results show that the depletion of distinct plectin isoforms affects mitochondrial network organization and function in different ways.

  10. Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure.

    PubMed

    Wu, San-Pin; Kao, Chung-Yang; Wang, Leiming; Creighton, Chad J; Yang, Jin; Donti, Taraka R; Harmancey, Romain; Vasquez, Hernan G; Graham, Brett H; Bellen, Hugo J; Taegtmeyer, Heinrich; Chang, Ching-Pin; Tsai, Ming-Jer; Tsai, Sophia Y

    2015-09-10

    Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP-TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy.

  11. Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

    PubMed Central

    2014-01-01

    Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

  12. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis.

    PubMed Central

    Virbasius, J V; Scarpulla, R C

    1994-01-01

    Mitochondrial transcription factor A (mtTFA), the product of a nuclear gene, stimulates transcription from the two divergent mitochondrial promoters and is likely the principal activator of mitochondrial gene expression in vertebrates. Here we establish that the proximal promoter of the human mtTFA gene is highly dependent upon recognition sites for the nuclear respiratory factors, NRF-1 and NRF-2, for activity. These factors have been previously implicated in the activation of numerous nuclear genes that contribute to mitochondrial respiratory function. The affinity-purified factors from HeLa cells specifically bind to the mtTFA NRF-1 and NRF-2 sites through guanine nucleotide contacts that are characteristic for each site. Mutations in these contacts eliminate NRF-1 and NRF-2 binding and also dramatically reduce promoter activity in transfected cells. Although both factors contribute, NRF-1 binding appears to be the major determinant of promoter function. This dependence on NRF-1 activation is confirmed by in vitro transcription using highly purified recombinant proteins that display the same binding specificities as the HeLa cell factors. The activation of the mtTFA promoter by both NRF-1 and NRF-2 therefore provides a link between the expression of nuclear and mitochondrial genes and suggests a mechanism for their coordinate regulation during organelle biogenesis. Images PMID:8108407

  13. Expression Profiling of Mitochondrial Voltage-Dependent Anion Channel-1 Associated Genes Predicts Recurrence-Free Survival in Human Carcinomas

    PubMed Central

    Lim, Inja; Zhou, Tong; Bang, Hyoweon

    2014-01-01

    Background Mitochondrial voltage-dependent anion channels (VDACs) play a key role in mitochondria-mediated apoptosis. Both in vivo and in vitro evidences indicate that VDACs are actively involved in tumor progression. Specifically, VDAC-1, one member of the VDAC family, was thought to be a potential anti-cancer therapeutic target. Our previous study demonstrated that the human gene VDAC1 (encoding the VDAC-1 isoform) was significantly up-regulated in lung tumor tissue compared with normal tissue. Also, we found a significant positive correlation between the gene expression of VDAC1 and histological grade in breast cancer. However, the prognostic power of VDAC1 and its associated genes in human cancers is largely unknown. Methods We systematically analyzed the expression pattern of VDAC1 and its interacting genes in breast, colon, liver, lung, pancreatic, and thyroid cancers. The genes differentially expressed between normal and tumor tissues in human carcinomas were identified. Results The expression level of VDAC1 was uniformly up-regulated in tumor tissue compared with normal tissue in breast, colon, liver, lung, pancreatic, and thyroid cancers. Forty-four VDAC1 interacting genes were identified as being commonly differentially expressed between normal and tumor tissues in human carcinomas. We designated VDAC1 and the 44 dysregulated interacting genes as the VDAC1 associated gene signature (VAG). We demonstrate that the VAG signature is a robust prognostic biomarker to predict recurrence-free survival in breast, colon, and lung cancers, and is independent of standard clinical and pathological prognostic factors. Conclusions VAG represents a promising prognostic biomarker in human cancers, which may enhance prediction accuracy in identifying patients at higher risk for recurrence. Future therapies aimed specifically at VDAC1 associated genes may lead to novel agents in the treatment of cancer. PMID:25333947

  14. Maraviroc reduces cytokine expression and secretion in human adipose cells without altering adipogenic differentiation.

    PubMed

    Díaz-Delfín, Julieta; Domingo, Pere; Giralt, Marta; Villarroya, Francesc

    2013-03-01

    Maraviroc (MVC) is a drug approved for use as part of HAART in treatment-experienced HIV-1 patients with CCR5-tropic virus. Despite the current concerns on the alterations in adipose tissue that frequently appear in HIV-infected patients under HAART, there is no information available on the effects of MVC on adipose tissue. Here we studied the effects of MVC during and after the differentiation of human adipocytes in culture, and compared the results with the effects of efavirenz (EFV). We measured the acquisition of adipocyte morphology; the gene expression levels of markers for mitochondrial toxicity, adipogenesis and inflammation; and the release of adipokines and cytokines to the medium. Additionally, we determined the effects of MVC on lipopolysaccharide (LPS)-induced pro-inflammatory cytokine expression in adipocytes. Unlike EFV-treated pre-adipocytes, MVC-treated pre-adipocytes showed no alterations in the capacity to differentiate into adipocytes and accumulated lipids normally. Consistent with this, there were no changes in the mRNA levels of PPARγ or SREBP-1c, two master regulators of adipogenesis. In addition, MVC caused a significant decrease in the gene expression and release of pro-inflammatory cytokines, whereas EFV had the opposite effect. Moreover, MVC lowered inflammation-related gene expression and inhibited the LPS-induced expression of pro-inflammatory genes in differentiated adipocytes. We conclude that MVC does not alter adipocyte differentiation but rather shows anti-inflammatory properties by inhibiting the expression and secretion of pro-inflammatory cytokines. Collectively, our results suggest that MVC may minimize adverse effects on adipose tissue development, metabolism, and inflammation, and thus could be a potentially beneficial component of antiretroviral therapy.

  15. Mitochondrial dysfunction in a transgenic mouse model expressing human amyloid precursor protein (APP) with the Arctic mutation.

    PubMed

    Rönnbäck, Annica; Pavlov, Pavel F; Mansory, Mansorah; Gonze, Prisca; Marlière, Nicolas; Winblad, Bengt; Graff, Caroline; Behbahani, Homira

    2016-02-01

    Accumulation of amyloid β-peptide (Aβ) in the brain is an important event in the pathogenesis of Alzheimer disease. We have used a transgenic mouse model expressing human amyloid precursor protein (APP) with the Arctic mutation to investigate whether Aβ deposition is correlated with mitochondrial functions in these animals. We found evidence of mitochondrial dysfunction (i.e., decreased mitochondrial membrane potential, increased production of reactive oxygen species and oxidative DNA damage) at 6 months of age, when the mice showed very mild Aβ deposition. More pronounced mitochondrial abnormalities were present in 24-month-old TgAPParc mice with more extensive Aβ pathology. This study demonstrates for the first time mitochondrial dysfunction in transgenic mice with a mutation within the Aβ peptide (the Arctic APP mutation), and confirms previous studies suggesting that mitochondrial dysfunction and oxidative stress is an early event in the pathogenesis of Alzheimer disease. This study demonstrates mitochondrial dysfunction in transgenic mice with a mutation within the amyloid beta (Aβ) peptide (the Arctic amyloid precursor protein (APP) mutation). We found evidence of mitochondrial dysfunction (i.e. decreased mitochondrial membrane potential (MMP), increased production of reactive oxygen species (ROS) and oxidative DNA damage) at 6 months of age, when very mild Aβ deposition is present in the mice. Also, the cytochrome c (COX) activity was significantly decreased in mitochondria from transgenic mice at 24 months of age.

  16. Myofibroblast differentiation and its functional properties are inhibited by nicotine and e-cigarette via mitochondrial OXPHOS complex III

    PubMed Central

    Lei, Wei; Lerner, Chad; Sundar, Isaac K.; Rahman, Irfan

    2017-01-01

    Nicotine is the major stimulant in tobacco products including e-cigarettes. Fibroblast to myofibroblast differentiation is a key process during wound healing and is dysregulated in lung diseases. The role of nicotine and e-cigarette derived nicotine on cellular functions including profibrotic response and other functional aspects is not known. We hypothesized that nicotine and e-cigarettes affect myofibroblast differentiation, gel contraction, and wound healing via mitochondria stress through nicotinic receptor-dependent mechanisms. To test the hypothesis, we exposed human lung fibroblasts with various doses of nicotine and e-cigarette condensate and determined myofibroblast differentiation, mitochondrial oxidative phosphorylation (OXPHOS), wound healing, and gel contraction at different time points. We found that both nicotine and e-cigarette inhibit myofibroblast differentiation as shown by smooth muscle actin and collagen type I, alpha 1 abundance. Nicotine and e-cigarette inhibited OXPHOS complex III accompanied by increased MitoROS, and this effect was augmented by complex III inhibitor antimycin A. These mitochondrial associated effects by nicotine resulted in inhibition of myofibroblast differentiation. These effects were associated with inhibition of wound healing and gel contraction suggesting that nicotine is responsible for dysregulated repair during injurious responses. Thus, our data suggest that nicotine causes dysregulated repair by inhibition of myofibroblast differentiation via OXPHOS pathway. PMID:28256533

  17. α-Syntrophin Modulates Myogenin Expression in Differentiating Myoblasts

    PubMed Central

    Kim, Min Jeong; Hwang, Sung Ho; Lim, Jeong A.; Froehner, Stanley C.; Adams, Marvin E.; Kim, Hye Sun

    2010-01-01

    Background α-Syntrophin is a scaffolding protein linking signaling proteins to the sarcolemmal dystrophin complex in mature muscle. However, α-syntrophin is also expressed in differentiating myoblasts during the early stages of muscle differentiation. In this study, we examined the relationship between the expression of α-syntrophin and myogenin, a key muscle regulatory factor. Methods and Findings The absence of α-syntrophin leads to reduced and delayed myogenin expression. This conclusion is based on experiments using muscle cells isolated from α-syntrophin null mice, muscle regeneration studies in α-syntrophin null mice, experiments in Sol8 cells (a cell line that expresses only low levels of α-syntrophin) and siRNA studies in differentiating C2 cells. In primary cultured myocytes isolated from α-syntrophin null mice, the level of myogenin was less than 50% that from wild type myocytes (p<0.005) 40 h after differentiation induction. In regenerating muscle, the expression of myogenin in the α-syntrophin null muscle was reduced to approximately 25% that of wild type muscle (p<0.005). Conversely, myogenin expression is enhanced in primary cultures of myoblasts isolated from a transgenic mouse over-expressing α-syntrophin and in Sol8 cells transfected with a vector to over-express α-syntrophin. Moreover, we find that myogenin mRNA is reduced in the absence of α-syntrophin and increased by α-syntrophin over-expression. Immunofluorescence microscopy shows that α-syntrophin is localized to the nuclei of differentiating myoblasts. Finally, immunoprecipitation experiments demonstrate that α-syntrophin associates with Mixed-Lineage Leukemia 5, a regulator of myogenin expression. Conclusions We conclude that α-syntrophin plays an important role in regulating myogenesis by modulating myogenin expression. PMID:21179410

  18. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  19. Expression changes in mRNAs and mitochondrial damage in lens epithelial cells with selenite.

    PubMed

    Belusko, P B; Nakajima, T; Azuma, M; Shearer, T R

    2003-10-13

    An overdose of sodium selenite induces cataracts in young rats. The mid-stage events producing the cataract include calpain-induced hydrolysis and precipitation of lens proteins. Apoptosis in lens epithelial cells has been suggested as an initial event in selenite cataracts. Expression levels of two genes associated with apoptosis were altered in lens epithelial cells from selenite-injected rats. The purpose of the present experiment was to perform a more comprehensive search for changes in expression of mRNAs in lens epithelial cells in order to more fully delineate the early events in selenite-induced cataracts. Lens epithelial cells were harvested at 1 and 2 days after a single subcutaneous injection of sodium selenite (30 mumol/kg body weight) into 12-day-old rats. Gene expression was analyzed using a commercial DNA array (Rat Genome U34A GeneChip array, Affymetrix). Of approximately 8000 genes assayed by hybridization, 13 genes were decreased and 27 genes were increased in the rat lens epithelial cells after injection of selenite. Some of the up-regulated genes included apoptosis-related genes, and a majority of the down-regulated genes were mitochondrial genes. Previously observed changes in expression of EGR-1 mRNA were also confirmed. Changes in the expression patterns of mRNAs were also confirmed by RT-PCR. To determine the mechanism for damage of lens epithelial cells (alpha TN4 cell) by culture in selenite, leakage of cytochrome c from mitochondria was measured. Selenite caused significant leakage of cytochrome c into the cytosol of alpha TN4 cells. Our data suggested that the loss of integrity of lens epithelial cells by selenite might be caused by preferential down-regulation of mitochondrial RNAs, release of cytochrome c, and impaired mitochondrial function. Up-regulation of mRNAs involved in maintenance of DNA, regulation of metabolism, and induction of apoptosis may also play roles.

  20. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  1. Marked over expression of uncoupling protein-2 in beta cells exerts minor effects on mitochondrial metabolism

    SciTech Connect

    Hals, Ingrid K.; Ogata, Hirotaka; Pettersen, Elin; Ma, Zuheng; Bjoerklund, Anneli; Skorpen, Frank; Egeberg, Kjartan Wollo; Grill, Valdemar

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer The impact of UCP-2 over expression on mitochondrial function is controversial. Black-Right-Pointing-Pointer We tested mitochondrial functions at defined levels of overexpression. Black-Right-Pointing-Pointer We find minor increases of fatty acid oxidation and uncoupling. Black-Right-Pointing-Pointer Effects were seen only at high level (fourfold) of over expression. Black-Right-Pointing-Pointer Hence it is doubtful whether these effects are of importance in diabetes. -- Abstract: Evidence is conflicting as to the impact of elevated levels of uncoupling protein-2 (UCP-2) on insulin-producing beta cells. Here we investigated effects of a fourfold induction of UCP-2 protein primarily on mitochondrial parameters and tested for replication of positive findings at a lower level of induction. We transfected INS-1 cells to obtain a tet-on inducible cell line. A 48 h exposure to 1 {mu}g/ml of doxycycline (dox) induced UCP-2 fourfold (424 {+-} 113%, mean {+-} SEM) and 0.1 {mu}g/ml twofold (178 {+-} 29%, n = 3). Fourfold induced cells displayed normal viability (MTT, apoptosis), normal cellular insulin contents and, glucose-induced insulin secretion (+27 {+-} 11%) as well as D-[U-{sup 14}C]-glucose oxidation (+5 {+-} 9% at 11 mM glucose). Oxidation of [1-{sup 14}C]-oleate was increased from 4088 to 5797 fmol/{mu}g prot/2 h at 3.3 mM glucose, p < 0.03. Oxidation of L-[{sup 14}C(U)]-glutamine was unaffected. Induction of UCP-2 did not significantly affect measures of mitochondrial membrane potential (Rhodamine 123) or mitochondrial mass (Mitotracker Green) and did not affect ATP levels. Oligomycin-inhibited oxygen consumption (a measure of mitochondrial uncoupling) was marginally increased, the effect being significant in comparison with dox-only treated cells, p < 0.05. Oxygen radicals, assessed by dichlorofluorescin diacetate, were decreased by 30%, p < 0.025. Testing for the lower level of UCP-2 induction did not reproduce any of the

  2. Transcriptome-wide co-expression analysis identifies LRRC2 as a novel mediator of mitochondrial and cardiac function

    PubMed Central

    Leleu, Marion; Rowe, Glenn C.; Palygin, Oleg; Bukowy, John D.; Kuo, Judy; Rech, Monika; Hermans-Beijnsberger, Steffie; Schaefer, Sebastian; Adami, Eleonora; Creemers, Esther E.; Heinig, Matthias; Schroen, Blanche; Arany, Zoltan; Petretto, Enrico; Geurts, Aron M.

    2017-01-01

    Mitochondrial dysfunction contributes to myriad monogenic and complex pathologies. To understand the underlying mechanisms, it is essential to define the full complement of proteins that modulate mitochondrial function. To identify such proteins, we performed a meta-analysis of publicly available gene expression data. Gene co-expression analysis of a large and heterogeneous compendium of microarray data nominated a sub-population of transcripts that whilst highly correlated with known mitochondrial protein-encoding transcripts (MPETs), are not themselves recognized as generating proteins either localized to the mitochondrion or pertinent to functions therein. To focus the analysis on a medically-important condition with a strong yet incompletely understood mitochondrial component, candidates were cross-referenced with an MPET-enriched module independently generated via genome-wide co-expression network analysis of a human heart failure gene expression dataset. The strongest uncharacterized candidate in the analysis was Leucine Rich Repeat Containing 2 (LRRC2). LRRC2 was found to be localized to the mitochondria in human cells and transcriptionally-regulated by the mitochondrial master regulator Pgc-1α. We report that Lrrc2 transcript abundance correlates with that of β-MHC, a canonical marker of cardiac hypertrophy in humans and experimentally demonstrated an elevation in Lrrc2 transcript in in vitro and in vivo rodent models of cardiac hypertrophy as well as in patients with dilated cardiomyopathy. RNAi-mediated Lrrc2 knockdown in a rat-derived cardiomyocyte cell line resulted in enhanced expression of canonical hypertrophic biomarkers as well as increased mitochondrial mass in the context of increased Pgc-1α expression. In conclusion, our meta-analysis represents a simple yet powerful springboard for the nomination of putative mitochondrially-pertinent proteins relevant to cardiac function and enabled the identification of LRRC2 as a novel mitochondrially

  3. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  4. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  5. What Is Mitochondrial DNA?

    MedlinePlus

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  6. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia.

    PubMed

    Schrans-Stassen, B H; van de Kant, H J; de Rooij, D G; van Pelt, A M

    1999-12-01

    The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16%+/-2% (mean +/- SD), in VII 45%+/-15%, in IX/X 78%+/-14% and in XII 90%+/-1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.

  7. Chlorpromazine inhibits mitochondrial apoptotic pathway via increasing expression of tissue factor.

    PubMed

    Wu, Jing; Li, Aimei; Li, Yujun; Li, Xiaoguang; Zhang, Qingmeng; Song, Wuqi; Wang, Yao; Ogutu, James O; Wang, Jindong; Li, Jianbo; Tang, Renkuan; Zhang, Fengmin

    2016-01-01

    Chlorpromazine (CPZ) is a widely used antipsychotic drug with antagonistic effect on dopamine receptors. Accumulating evidence has shown that CPZ plays a neuroprotective role in various models of toxicity and apoptosis. However, the underlying mechanism contributing to this protective effect remains unclear. Here, we evaluate the effect of CPZ on mitochondrial apoptotic pathway in the neuron system. Higher levels of B-cell lymphoma-2 (Bcl-2) and tissue factor (TF) but lower apoptotic rate were found in hippocampus of CPZ-treated schizophrenic patients compared with non-antipsychotic treated controls. Additionally, both short-term and long-term treatment of CPZ in rats could up-regulate the levels of Bcl-2 and TF with no cytotoxic effects. In the in vitro experiment, expression of Bcl-2 was up-regulated in the C6 glioma cells transfected with pEGFP-N1-TF recombinant plasmid. Furthermore, in another independent rat model of apoptosis, compared with the group administrated with alcohol only, the brains of the CPZ-pretreated rats showed lower expression of cleaved caspase-3, cytochrome c and Bax, but higher expression of Bcl-2 and TF. Our data demonstrate that CPZ exerts its neuronal protective effects through inhibiting the activation of mitochondrial apoptotic pathway by up-regulating TF expression, thus providing new insight into CPZ function and application.

  8. Systematic expression analysis of the mitochondrial complex III subunits identifies UQCRC1 as biomarker in clear cell renal cell carcinoma

    PubMed Central

    Ellinger, Jörg; Gromes, Arabella; Poss, Mirjam; Brüggemann, Maria; Schmidt, Doris; Ellinger, Nadja; Tolkach, Yuri; Dietrich, Dimo; Kristiansen, Glen; Müller, Stefan C.

    2016-01-01

    Mitochondrial dysfunction is common in cancer, and the mitochondrial electron transport chain is often affected in carcinogenesis. So far, few is known about the expression of the mitochondrial complex III (ubiquinol-cytochrome c reductase complex) subunits in clear cell renal cell carcinoma (ccRCC). In this study, the NextBio database was used to determine an expression profile of the mitochondrial complex III subunits based on published microarray studies. We observed that five out of 11 subunits of the complex III were downregulated in at least three microarray studies. The decreased mRNA expression level of UQCRFS1 and UQCRC1 in ccRCC was confirmed using PCR. Low mRNA levels UQCRC1 were also correlated with a shorter period of cancer-specific and overall survival. Furthermore, UQCRFS1 and UQCRC1 were also decreased in ccRCC on the protein level as determined using Western blotting and immunohistochemistry. UQCRC1 protein expression was also lower in ccRCC than in papillary and chromophobe subtypes. Analyzing gene expression and DNA methylation in The Cancer Genome Atlas cohort revealed an inverse correlation of gene expression and DNA methylation, suggesting that DNA hypermethylation is regulating the expression of UQCRC1 and UQCRFS1. Taken together, our data implicate that dysregulated UQCRC1 and UQCRFS1 are involved in impaired mitochondrial electron transport chain function. PMID:27845902

  9. Depletion of mitochondrial DNA by down-regulation of deoxyguanosine kinase expression in non-proliferating HeLa cells

    SciTech Connect

    Franco, Maribel; Johansson, Magnus . E-mail: magnus.johansson@ki.se; Karlsson, Anna

    2007-07-15

    Purine deoxyribonucleotides required for mitochondrial DNA replication are either imported from the cytosol or derived from phosphorylation of deoxyadenosine or deoxyguanosine catalyzed by mitochondrial deoxyguanosine kinase (DGUOK). DGUOK deficiency has been linked to mitochondrial DNA depletion syndromes suggesting an important role for this enzyme in dNTP supply. We have generated HeLa cell lines with 20-30% decreased levels of DGUOK mRNA by the expression of small interfering RNAs directed towards the DGUOK mRNA. The cells with decreased expression of the enzyme showed similar levels of mtDNA as control cells when grown exponentially in culture. However, mtDNA levels rapidly decreased in the cells when cell cycle arrest was induced by serum starvation. DNA incorporation of 9-{beta}-D-arabino-furanosylguanine (araG) was lower in the cells with decreased deoxyguanosine kinase expression, but the total rate of araG phosphorylation was increased in the cells. The increase in araG phosphorylation was shown to be due to increased expression of deoxycytidine kinase. In summary, our findings show that DGUOK is required for mitochondrial DNA replication in resting cells and that small changes in expression of this enzyme may cause mitochondrial DNA depletion. Our data also suggest that alterations in the expression level of DGUOK may induce compensatory changes in the expression of other nucleoside kinases.

  10. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.

    2015-01-01

    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor (http://bioconductor.org/). Contact: jtleek@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  11. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  12. Differentially Expressed Genes in Hirudo medicinalis Ganglia after Acetyl-L-Carnitine Treatment

    PubMed Central

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-l-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer’s disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism. PMID:23308261

  13. Differential Expression and Network Inferences through Functional Data Modeling

    PubMed Central

    Telesca, Donatello; Inoue, Lurdes Y.T.; Neira, Mauricio; Etzioni, Ruth; Gleave, Martin; Nelson, Colleen

    2010-01-01

    Time–course microarray data consist of mRNA expression from a common set of genes collected at different time points. Such data are thought to reflect underlying biological processes developing over time. In this article we propose a model that allows us to examine differential expression and gene network relationships using time course microarray data. We model each gene expression profile as a random functional transformation of the scale, amplitude and phase of a common curve. Inferences about the gene–specific amplitude parameters allow us to examine differential gene expression. Inferences about measures of functional similarity based on estimated time transformation functions allow us to examine gene networks while accounting for features of the gene expression profiles. We discuss applications to simulated data as well as to microarray data on prostate cancer progression. PMID:19053995

  14. Differential Expression of Cysteine Dioxygenase 1 in Complex Karyotype Liposarcomas

    PubMed Central

    Shaker, Mohammed; Pascarelli, Kara M; Plantinga, Matthew J; Love, Miles A; Lazar, Alexander J; Ingram, Davis R; von Mehren, Margaret; Lev, Dina; Kipling, David; Broccoli, Dominique

    2014-01-01

    Altered cysteine dioxygenase 1 (CDO1) gene expression has been observed in several cancers but has not yet been investigated in liposarcomas. The aim of this study was to evaluate CDO1 expression in a cohort of liposarcomas and to determine its association with clinicopathological features. Existing microarray data indicated variable CDO1 expression in liposarcoma subtypes. CDO1 mRNA from a larger cohort of liposarcomas was quantified by real time-PCR, and CDO1 protein expression was determined by immunohistochemistry (IHC) in more than 300 tumor specimens. Well-differentiated liposarcomas (WDLSs) had significantly higher CDO1 gene expression and protein levels than dedifferentiated liposarcomas (DDLSs) (P < 0.001). Location of the tumor was not predictive of the expression level of CDO1 mRNA in any histological subtype of liposarcoma. Recurrent tumors did not show any difference in CDO1 expression when compared to primary tumors. CDO1 expression was upregulated as human mesenchymal stem cells (hMSCs) undergo differentiation into mature adipocytes. Our results suggest that CDO1 is a marker of liposarcoma progression and adipogenic differentiation. PMID:24741338

  15. Integration of amplified differential gene expression (ADGE) and DNA microarray.

    PubMed

    Chen, Zhijian J; Gaté, Laurent; Davis, Warren; Ile, Kristina E; Tew, Kenneth D

    2002-12-01

    Amplified Differential Gene Expression (ADGE) provides a new concept that the ratios of differentially expressed genes are magnified before detection in order to improve both sensitivity and accuracy. This technology is now implemented with integration of DNA reassociation and PCR. The ADGE technique can be used either as a stand-alone method or in series with DNA microarray. ADGE is used in sample preprocessing and DNA microarray is used as a displaying system in the series combination. These two techniques are mutually synergistic: the quadratic magnification of ratios of differential gene expression achieved by ADGE improves the detection sensitivity and accuracy; the PCR amplification of templates enhances the signal intensity and reduces the requirement for large amounts of starting material; the high throughput for DNA microarray is maintained.

  16. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.

    PubMed

    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei

    2015-05-01

    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  17. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    PubMed Central

    Barrey, Eric; Mucher, Elodie; Jeansoule, Nicolas; Larcher, Thibaut; Guigand, Lydie; Herszberg, Bérénice; Chaffaux, Stéphane; Guérin, Gérard; Mata, Xavier; Benech, Philippe; Canale, Marielle; Alibert, Olivier; Maltere, Péguy; Gidrol, Xavier

    2009-01-01

    Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM). It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA) and 5 heterozygous (GA) PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p < 0.05). The following genes were up-regulated over 2 fold: IL18, CTSS, LUM, CD44, FN1, GST01. The most down-regulated genes were the following: mitochondrial tRNA, SLC2A2, PRKCα, VEGFα. Data mining analysis showed that protein synthesis, apoptosis, cellular movement, growth and proliferation were the main cellular functions significantly associated with the modulated genes (p < 0.05). Several up-regulated genes, especially IL18, revealed a severe muscular inflammation in PSSM muscles. The up-regulation of glycogen synthase kinase-3 (GSK3β) under its active form could be responsible for glycogen synthase (GYS1) inhibition and hypoxia-inducible factor

  18. Differentiation of the dragonfly genus Davidius (Odonata: Gomphidae) in Japan inferred from mitochondrial and nuclear gene genealogies.

    PubMed

    Kiyoshi, Takuya; Sota, Teiji

    2006-01-01

    To infer the differentiation of Japanese Davidius dragonflies, we investigated the genealogies of the mitochondrial cytochrome oxidase subunit I gene (COI) and the nuclear ribosomal RNA gene region encompassing 18S, ITS1, 5.8S, and ITS2 sequences for three species endemic to Japan--Davidius nanus, D. fujiama, and D. moiwanus--as well as D. lunatus from the Korean Peninsula. According to the mitochondrial and nuclear gene genealogies, D. nanus and D. moiwanus are closely related and are sister to the continental species D. lunatus, whereas D. fujiama differentiated from an ancestor of the other three species. Although the mitochondrial DNA data did not resolve the relationships between D. nanus and three D. moiwanus subspecies, the nuclear DNA data indicate the monophyly of D. moiwanus and its subspecies. The nuclear gene genealogy suggests that isolated wetlands used by larval D. moiwanus derive from the ancestral riverine habitats of D. nanus and other Davidius species. The COI sequence divergence among local populations was much greater in D. moiwanus than in D. nanus, which may be the result of differences in the dispersal ranges associated with the habitat types of these species.

  19. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  20. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  1. Expression of Molecular Differentiation Markers Does Not Correlate with Histological Differentiation Grade in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Demarez, Céline; Hubert, Catherine; Sempoux, Christine; Lemaigre, Frédéric P.

    2016-01-01

    The differentiation status of tumor cells, defined by histomorphological criteria, is a prognostic factor for survival of patients affected with intrahepatic cholangiocarcinoma (ICC). To strengthen the value of morphological differentiation criteria, we wished to correlate histopathological differentiation grade with expression of molecular biliary differentiation markers and of microRNAs previously shown to be dysregulated in ICC. We analysed a series of tumors that were histologically classified as well, moderately or poorly differentiated, and investigated the expression of cytokeratin 7, 19 and 903 (CK7, CK19, CK903), SRY-related HMG box transcription factors 4 and 9 (SOX4, SOX9), osteopontin (OPN), Hepatocyte Nuclear Factor-1 beta (HNF1β), Yes-associated protein (YAP), Epithelial cell adhesion molecule (EPCAM), Mucin 1 (MUC1) and N-cadherin (NCAD) by qRT-PCR and immunostaining, and of miR-31, miR-135b, miR-132, miR-200c, miR-221 and miR-222. Unexpectedly, except for subcellular location of SOX9 and OPN, no correlation was found between the expression levels of these molecular markers and histopathological differentiation grade. Therefore, our data point toward necessary caution when investigating the evolution and prognosis of ICC on the basis of cell differentiation criteria. PMID:27280413

  2. The Bicoid Stability Factor Controls Polyadenylation and Expression of Specific Mitochondrial mRNAs in Drosophila melanogaster

    PubMed Central

    Grönke, Sebastian; Stewart, James B.; Mourier, Arnaud; Ruzzenente, Benedetta; Kukat, Christian; Wibom, Rolf; Habermann, Bianca; Partridge, Linda; Larsson, Nils-Göran

    2011-01-01

    The bicoid stability factor (BSF) of Drosophila melanogaster has been reported to be present in the cytoplasm, where it stabilizes the maternally contributed bicoid mRNA and binds mRNAs expressed from early zygotic genes. BSF may also have other roles, as it is ubiquitously expressed and essential for survival of adult flies. We have performed immunofluorescence and cell fractionation analyses and show here that BSF is mainly a mitochondrial protein. We studied two independent RNAi knockdown fly lines and report that reduced BSF protein levels lead to a severe respiratory deficiency and delayed development at the late larvae stage. Ubiquitous knockdown of BSF results in a severe reduction of the polyadenylation tail lengths of specific mitochondrial mRNAs, accompanied by an enrichment of unprocessed polycistronic RNA intermediates. Furthermore, we observed a significant reduction in mRNA steady state levels, despite increased de novo transcription. Surprisingly, mitochondrial de novo translation is increased and abnormal mitochondrial translation products are present in knockdown flies, suggesting that BSF also has a role in coordinating the mitochondrial translation in addition to its role in mRNA maturation and stability. We thus report a novel function of BSF in flies and demonstrate that it has an important intra-mitochondrial role, which is essential for maintaining mtDNA gene expression and oxidative phosphorylation. PMID:22022283

  3. Expression Differentiation Is Constrained to Low-Expression Proteins over Ecological Timescales.

    PubMed

    Margres, Mark J; Wray, Kenneth P; Seavy, Margaret; McGivern, James J; Herrera, Nathanael D; Rokyta, Darin R

    2016-01-01

    Protein expression level is one of the strongest predictors of protein sequence evolutionary rate, with high-expression protein sequences evolving at slower rates than low-expression protein sequences largely because of constraints on protein folding and function. Expression evolutionary rates also have been shown to be negatively correlated with expression level across human and mouse orthologs over relatively long divergence times (i.e., ∼100 million years). Long-term evolutionary patterns, however, often cannot be extrapolated to microevolutionary processes (and vice versa), and whether this relationship holds for traits evolving under directional selection within a single species over ecological timescales (i.e., <5000 years) is unknown and not necessarily expected. Expression is a metabolically costly process, and the expression level of a particular protein is predicted to be a tradeoff between the benefit of its function and the costs of its expression. Selection should drive the expression level of all proteins close to values that maximize fitness, particularly for high-expression proteins because of the increased energetic cost of production. Therefore, stabilizing selection may reduce the amount of standing expression variation for high-expression proteins, and in combination with physiological constraints that may place an upper bound on the range of beneficial expression variation, these constraints could severely limit the availability of beneficial expression variants. To determine whether rapid-expression evolution was restricted to low-expression proteins owing to these constraints on highly expressed proteins over ecological timescales, we compared venom protein expression levels across mainland and island populations for three species of pit vipers. We detected significant differentiation in protein expression levels in two of the three species and found that rapid-expression differentiation was restricted to low-expression proteins. Our

  4. Characterization of unique and differentially expressed proteins in anthracnose-tolerant Florida hybrid bunch grapes.

    PubMed

    Vasanthaiah, Hemanth K N; Katam, Ramesh; Basha, Sheikh M

    2009-06-01

    Anthracnose is a major disease in Florida hybrid bunch grapes, caused by a fungus viz. Elsinoe ampelina. Florida hybrid bunch grapes are grown in southeastern USA for their superior wine characteristics. However, the effect of anthracnose on grape productivity and wine quality is a major concern to grape growers. Our research is aimed at determining biochemical basis of anthracnose tolerance in Florida hybrid bunch grape. Leaf samples were collected from the plants infected with E. ampelina at different periods and analyzed for differential protein expression using high throughput two-dimensional gel electrophoresis. Among the 32 differentially expressed leaf proteins, two were uniquely expressed in tolerant genotypes in response to E. ampelina infection. These proteins were identified as mitochondrial adenosine triphosphate synthase and glutamine synthetase, which are known to play a major role in carbohydrate metabolism and defense. Several proteins including ribulose 1-5 bisphosphate-carboxylase involved in photosynthesis were found to be suppressed in susceptible genotypes compared to tolerant genotypes following E. ampelina infection. The results indicate that the anthracnose-tolerant genotypes have the ability to up-regulate and induce new proteins upon infection to defend the invasion of the pathogen as well as maintain the normal regulatory processes.

  5. Differential Expression of CXCL12 and CXCR4 During Human Fetal Neural Progenitor Cell Differentiation

    PubMed Central

    Peng, Hui; Kolb, Ryan; Kennedy, J. E.

    2007-01-01

    Stromal cell-derived factor 1 alpha (SDF-1α, CXCL12) and its receptor CXCR4 play an important role in the central nervous system (CNS) development and adulthood by mediating cell migration, enhancing precursor cell proliferation, assisting in neuronal circuit formation, and possibly regulating migration during repair. The expression pattern of CXCR4 and CXCL12 during neurogenesis has not been thoroughly elucidated. In this study, we investigated the expression of CXCL12 and CXCR4 during neural progenitor cells (NPC) differentiation by microarray analysis and reverse transcriptase-polymerase chain reaction (RT-PCR) using human fetal NPC as a model system. The production of CXCL12 was measured by enzyme-linked immunosorbent assay (ELISA). CXCR4 expression was determined by florescence-activated cell sorting (FACS) analysis, immunocytochemical staining, and CXCR4-mediated inhibition of cyclic AMP (cAMP) accumulation. Our data demonstrated that CXCR4 expression is significantly upregulated when NPC are differentiated into neuronal precursors, whereas CXCL12 is upregulated when differentiated into astrocytes. We also provide evidence that CXCR4 localization changes as neurons mature. In neuronal precursors, CXCR4 is localized in both neuronal processes and the cell body, whereas in mature neurons, it is primarily expressed on axons and dendrites. This differential expression of CXCR4 and CXCL12 may be important for the temporal regulation of neuronal migration and circuit formation during development and possibly in adult neurogenesis and repair. PMID:18040858

  6. Differential Expression Profile of MicroRNAs during Differentiation of Cardiomyocytes Exposed to Polychlorinated Biphenyls

    PubMed Central

    Zhu, Chun; Yu, Zhang-Bin; Zhu, Jin-Gai; Hu, Xiao-Shan; Chen, Yu-Lin; Qiu, Yu-Fang; Xu, Zheng-Feng; Qian, Lin-Mei; Han, Shu-Ping

    2012-01-01

    Exposure to persistent environmental pollutants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of congenital heart defects. MicroRNAs (miRNAs) have been shown to be involved in cardiac development. The objective of this study was to investigate changes in miRNA expression profiles during the differentiation of cardiomyocytes exposed to PCBs. For that purpose, PCBs (Aroclor 1254) at a concentration of 2.5 μmol/L were added on day 0 of differentiation of P19 mouse embryonal carcinoma cells into cardiac myocytes. The relative expression of miRNA genes was determined by miRNA microarray and real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) analyses. The microarray results revealed that 45 miRNAs, of which 14 were upregulated and 31 were downregulated, were differentially expressed in P19 cells treated with PCBs compared with control cells. The miRNA expression data was validated with real-time RT-PCR. The expression of certain potential target genes (Wnt1) was found to be reduced in P19 cells treated with PCBs, whereas the expression of other potential predicted target genes (GSK3β) was increased. Our results demonstrate a critical role of miRNAs in mediating the effect of PCBs during the differentiation of P19 cells into cardiac myocytes. PMID:23443104

  7. Targeted impairment of thymidine kinase 2 expression in cells induces mitochondrial DNA depletion and reveals molecular mechanisms of compensation of mitochondrial respiratory activity

    SciTech Connect

    Villarroya, Joan; Lara, Mari-Carmen; Dorado, Beatriz; Garrido, Marta; Garcia-Arumi, Elena; Meseguer, Anna; Hirano, Michio; Vila, Maya R.

    2011-04-08

    Highlights: {yields} We impaired TK2 expression in Ost TK1{sup -} cells via siRNA-mediated interference (TK2{sup -}). {yields} TK2 impairment caused severe mitochondrial DNA (mtDNA) depletion in quiescent cells. {yields} Despite mtDNA depletion, TK2{sup -} cells show high cytochrome oxidase activity. {yields} Depletion of mtDNA occurs without imbalance in the mitochondrial dNTP pool. {yields} Nuclear-encoded ENT1, DNA-pol {gamma}, TFAM and TP gene expression is lowered in TK2{sup -} cells. -- Abstract: The mitochondrial DNA (mtDNA) depletion syndrome comprises a clinically heterogeneous group of diseases characterized by reductions of the mtDNA abundance, without associated point mutations or rearrangements. We have developed the first in vitro model to study of mtDNA depletion due to reduced mitochondrial thymidine kinase 2 gene (TK2) expression in order to understand the molecular mechanisms involved in mtDNA depletion syndrome due to TK2 mutations. Small interfering RNA targeting TK2 mRNA was used to decrease TK2 expression in Ost TK1{sup -} cells, a cell line devoid of endogenous thymidine kinase 1 (TK1). Stable TK2-deficient cell lines showed a reduction of TK2 levels close to 80%. In quiescent conditions, TK2-deficient cells showed severe mtDNA depletion, also close to 80% the control levels. However, TK2-deficient clones showed increased cytochrome c oxidase activity, higher cytochrome c oxidase subunit I transcript levels and higher subunit II protein expression respect to control cells. No alterations of the deoxynucleotide pools were found, whereas a reduction in the expression of genes involved in nucleoside/nucleotide homeostasis (human equilibrative nucleoside transporter 1, thymidine phosphorylase) and mtDNA maintenance (DNA-polymerase {gamma}, mitochondrial transcription factor A) was observed. Our findings highlight the importance of cellular compensatory mechanisms that enhance the expression of respiratory components to ensure respiratory activity

  8. Pathways and genes differentially expressed in the motor cortex of patients with sporadic amyotrophic lateral sclerosis

    PubMed Central

    Lederer, Carsten W; Torrisi, Antonietta; Pantelidou, Maria; Santama, Niovi; Cavallaro, Sebastiano

    2007-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a fatal disorder caused by the progressive degeneration of motoneurons in brain and spinal cord. Despite identification of disease-linked mutations, the diversity of processes involved and the ambiguity of their relative importance in ALS pathogenesis still represent a major impediment to disease models as a basis for effective therapies. Moreover, the human motor cortex, although critical to ALS pathology and physiologically altered in most forms of the disease, has not been screened systematically for therapeutic targets. Results By whole-genome expression profiling and stringent significance tests we identify genes and gene groups de-regulated in the motor cortex of patients with sporadic ALS, and interpret the role of individual candidate genes in a framework of differentially expressed pathways. Our findings emphasize the importance of defense responses and cytoskeletal, mitochondrial and proteasomal dysfunction, reflect reduced neuronal maintenance and vesicle trafficking, and implicate impaired ion homeostasis and glycolysis in ALS pathogenesis. Additionally, we compared our dataset with publicly available data for the SALS spinal cord, and show a high correlation of changes linked to the diseased state in the SALS motor cortex. In an analogous comparison with data for the Alzheimer's disease hippocampus we demonstrate a low correlation of global changes and a moderate correlation for changes specifically linked to the SALS diseased state. Conclusion Gene and sample numbers investigated allow pathway- and gene-based analyses by established error-correction methods, drawing a molecular portrait of the ALS motor cortex that faithfully represents many known disease features and uncovers several novel aspects of ALS pathology. Contrary to expectations for a tissue under oxidative stress, nuclear-encoded mitochondrial genes are uniformly down-regulated. Moreover, the down-regulation of mitochondrial and glycolytic

  9. Differentially-Expressed Pseudogenes in HIV-1 Infection

    PubMed Central

    Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

    2015-01-01

    Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

  10. From 'differential expression' to 'differential networking' - identification of dysfunctional regulatory networks in diseases.

    PubMed

    de la Fuente, Alberto

    2010-07-01

    Understanding diseases requires identifying the differences between healthy and affected tissues. Gene expression data have revolutionized the study of diseases by making it possible to simultaneously consider thousands of genes. The identification of disease-associated genes requires studying the genes in the context of the regulatory systems they are involved in. A major goal is to identify specific regulatory networks that are dysfunctional in a given disease state. Although we still have not reached a stage where the elucidation of differential regulatory networks is commonly feasible, recent advances have described the first steps towards this goal - the identification of differential coexpression networks. This review describes the shift from differential gene expression to differential networking and outlines how this shift will affect the study of the genetic basis of disease.

  11. The dual role of cyclin C connects stress regulated gene expression to mitochondrial dynamics

    PubMed Central

    Strich, Randy; Cooper, Katrina F.

    2014-01-01

    Following exposure to cytotoxic agents, cellular damage is first recognized by a variety of sensor mechanisms. Thenceforth, the damage signal is transduced to the nucleus to install the correct gene expression program including the induction of genes whose products either detoxify destructive compounds or repair the damage they cause. Next, the stress signal is disseminated throughout the cell to effect the appropriate changes at organelles including the mitochondria. The mitochondria represent an important signaling platform for the stress response. An initial stress response of the mitochondria is extensive fragmentation. If the damage is prodigious, the mitochondria fragment (fission) and lose their outer membrane integrity leading to the release of pro-apoptotic factors necessary for programmed cell death (PCD) execution. As this complex biological process contains many moving parts, it must be exquisitely coordinated as the ultimate decision is life or death. The conserved C-type cyclin plays an important role in executing this molecular Rubicon by coupling changes in gene expression to mitochondrial fission and PCD. Cyclin C, along with its cyclin dependent kinase partner Cdk8, associates with the RNA polymerase holoenzyme to regulate transcription. In particular, cyclin C-Cdk8 repress many stress responsive genes. To relieve this repression, cyclin C is destroyed in cells exposed to pro-oxidants and other stressors. However, prior to its destruction, cyclin C, but not Cdk8, is released from its nuclear anchor (Med13), translocates from the nucleus to the cytoplasm where it interacts with the fission machinery and is both necessary and sufficient to induce extensive mitochondria fragmentation. Furthermore, cytoplasmic cyclin C promotes PCD indicating that it mediates both mitochondrial fission and cell death pathways. This review will summarize the role cyclin C plays in regulating stress-responsive transcription. In addition, we will detail this new function

  12. Berberine Inhibits Doxorubicin-Triggered Cardiomyocyte Apoptosis via Attenuating Mitochondrial Dysfunction and Increasing Bcl-2 Expression

    PubMed Central

    Lv, Xiuxiu; Yu, Xiaohui; Wang, Yiyang; Wang, Faqiang; Li, Hongmei; Wang, Yanping; Lu, Daxiang; Qi, Renbin; Wang, Huadong

    2012-01-01

    Cardiomyocyte apoptosis is an important event in doxorubicin (DOX)-induced cardiac injury. The aim of the present study was to investigate the protection of berberine (Ber) against DOX- triggered cardiomyocyte apoptosis in neonatal rat cardiomyocytes and rats. In neonatal rat cardiomyocytes, Ber attenuated DOX-induced cellular injury and apoptosis in a dose-dependent manner. However, Ber has no significant effect on viability of MCF-7 breast cancer cells treated with DOX. Ber reduced caspase-3 and caspase-9, but not caspase-8 activity in DOX-treated cardiomyocytes. Furthermore, Ber decreased adenosine monophosphate-activated protein kinase α (AMPKα) and p53 phosphorylation at 2 h, cytosolic cytochrome c and mitochondrial Bax levels and increased Bcl-2 level at 6 h in DOX-stimulated cardiomyocytes. Pretreatment with compound C, an AMPK inhibitor, also suppressed p53 phosphorylation and apoptosis in DOX-treated cardiomyocytes. DOX stimulation for 30 min led to a loss of mitochondrial membrane potential and a rise in the AMP/ATP ratio. Ber markedly reduced DOX-induced mitochondrial membrane potential loss and an increase in the AMP/ATP ratio at 1 h and 2 h post DOX exposure. In in vivo experiments, Ber significantly improved survival, increased stroke volume and attenuated myocardial injury in DOX-challenged rats. TUNEL and Western blot assays showed that Ber not only decreased myocardial apoptosis, caspase-3 activation, AMPKα and p53 phosphorylation, but also increased Bcl-2 expression in myocardium of rats exposed to DOX for 84 h. These findings indicate that Ber attenuates DOX-induced cardiomyocyte apoptosis via protecting mitochondria, inhibiting an increase in the AMP/ATP ratio and AMPKα phosphorylation as well as elevating Bcl-2 expression, which offer a novel mechanism responsible for protection of Ber against DOX-induced cardiomyopathy. PMID:23077597

  13. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  14. Differential expression of Notch family members in astrocytomas and medulloblastomas.

    PubMed

    Xu, Peng; Yu, Shizhu; Jiang, Rongcai; Kang, Chunsheng; Wang, Guangxiu; Jiang, Hao; Pu, Peiyu

    2009-12-01

    Notch signaling pathway plays an integral role in determining cell fates in development. Growing evidence demonstrates that Notch signaling pathway has versatile effects in tumorigenesis depending on the tumor type, grade and stage. Notch signaling pathway is deregulated in some brain tumors. To examine the differential expression of Notch family members (Notch1, 2, 3, 4) in human astrocytomas and medulloblastomas, and to evaluate their roles in the development of both tumor types. Immunohistochemical staining and Western blot analysis were used to detect Notch1, 2, 3, 4 expression in tissue microarray and freshly resected tissue samples of normal brain, astrocytomas and medulloblastomas. Notch family members were not expressed or barely detectable in normal brain tissues. Notch1, 3, 4 were highly expressed but Notch2 was not expressed in astrocytomas. The percentage of immunopositive tumor cells and level of Notch1 expression was increased with tumor grade. In addition, overexpression of Notch2 was detected in medulloblastomas in contrast to low or no expression of Notch1, 3, 4. Differential expression of Notch1, 2, 3, 4 is detected in astrocytomas and medulloblastomas, that may be related to their different roles playing in the development of brain tumors.

  15. A mitochondrial complex I defect impairs cold-regulated nuclear gene expression.

    PubMed

    Lee, Byeong-ha; Lee, Hojoung; Xiong, Liming; Zhu, Jian-Kang

    2002-06-01

    To study low-temperature signaling in plants, we previously screened for cold stress response mutants using bioluminescent Arabidopsis plants that express the firefly luciferase reporter gene driven by the stress-responsive RD29A promoter. Here, we report on the characterization and cloning of one mutant, frostbite1 (fro1), which shows reduced luminescence induction by cold. fro1 plants display reduced cold induction of stress-responsive genes such as RD29A, KIN1, COR15A, and COR47. fro1 leaves have a reduced capacity for cold acclimation, appear water-soaked, leak electrolytes, and accumulate reactive oxygen species constitutively. FRO1 was isolated through positional cloning and found to encode a protein with high similarity to the 18-kD Fe-S subunit of complex I (NADH dehydrogenase, EC 1.6.5.3) in the mitochondrial electron transfer chain. Confocal imaging shows that the FRO1:green fluorescent protein fusion protein is localized in mitochondria. These results suggest that cold induction of nuclear gene expression is modulated by mitochondrial function.

  16. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  17. Differentially expressed genes in giant cell tumor of bone.

    PubMed

    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula

    2011-04-01

    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  18. Isolation of differentially expressed cDNAs during ferret tracheal development: application of differential display PCR.

    PubMed

    Sehgal, A; Presente, A; Dudus, L; Engelhardt, J F

    1996-01-01

    The technique of differential display polymerase chain reaction (DD-PCR) was used to identify cDNA sequences, which are temporally expressed during ferret tracheal airway development. Such differentially expressed cDNAs may ultimately prove to be useful markers in elucidating mechanisms of epithelial differentiation and submucosal gland development in the airway. Using two sets of oligonucleotide primers 15 differentially amplified cDNAs were isolated by comparative reverse transcriptase (RT) PCR of 6-h and 3-day postnatal tracheal poly-A mRNA. In situ hybridization was used to assess the reliability of this method and confirm the differential mRNA expression patterns of cloned cDNAs. Results of in situ hybridization analysis demonstrated that 10 of the 15 cDNA sequences gave a temporally regulated pattern of expression, which was concordant with that of the differential display. Furthermore, sequence analysis of the 15 isolated cDNAs revealed that the majority of clones were amplified from two inverted decamer primers. These findings demonstrate the lack of poly-T priming in the differential display reaction, which suggests that this method may yield substantially more information regarding the coding sequence of cloned genes. In support of this observation, 6 of the 15 cDNA sequences contained one complete open reading frame. Although the majority of cDNAs demonstrated no homology to sequence data bases at the DNA or amino acid level, clone FT-4, which demonstrated a differential expression pattern limited to 3-day tracheal time points, was composed of a 10-amino acid repeat domain that was structurally similar to neuropeptide anthoRFamide and barley D hordein seed protein. A second interesting clone, FT-3, demonstrated an infrequent pattern of expression within a subset of epithelial cells limited to early developmental time points (6 h) and was dramatically reduced by 3 days postnatally. Several additional clones with no homologies to previously cloned genes

  19. Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells

    PubMed Central

    Pohjoismäki, Jaakko L. O.; Wanrooij, Sjoerd; Hyvärinen, Anne K.; Goffart, Steffi; Holt, Ian J.; Spelbrink, Johannes N.; Jacobs, Howard T.

    2006-01-01

    Mitochondrial transcription factor A (TFAM) is an abundant mitochondrial protein of the HMG superfamily, with various putative roles in mitochondrial DNA (mtDNA) metabolism. In this study we have investigated the effects on mtDNA replication of manipulating TFAM expression in cultured human cells. Mammalian mtDNA replication intermediates (RIs) fall into two classes, whose mechanistic relationship is not properly understood. One class is characterized by extensive RNA incorporation on the lagging strand, whereas the other has the structure of products of conventional, strand-coupled replication. TFAM overexpression increased the overall abundance of RIs and shifted them substantially towards those of the conventional, strand-coupled type. The shift was most pronounced in the rDNA region and at various replication pause sites and was accompanied by a drop in the relative amount of replication-termination intermediates, a substantial reduction in mitochondrial transcripts, mtDNA decatenation and progressive copy number depletion. TFAM overexpression could be partially phenocopied by treatment of cells with dideoxycytidine, suggesting that its effects are partially attributable to a decreased rate of fork progression. TFAM knockdown also resulted in mtDNA depletion, but RIs remained mainly of the ribosubstituted type, although termination intermediates were enhanced. We propose that TFAM influences the mode of mtDNA replication via its combined effects on different aspects of mtDNA metabolism. PMID:17062618

  20. Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse

    PubMed Central

    Paul, Erin; Kielbasinski, Marissa; Sedivy, John M.; Murga-Zamalloa, Carlos; Khanna, Hemant; Klysik, Jan E.

    2009-01-01

    Supv3L1 is an evolutionarily conserved helicase that plays a critical role in the mitochondrial RNA surveillance and degradation machinery. Conditional ablation of Supv3L1 in adult mice leads to premature aging phenotypes including loss of muscle mass and adipose tissue and severe skin abnormalities. To get insights into the spatial and temporal expression of Supv3L1 in the mouse, we generated knock-in and transgenic strains in which an EGFP reporter was placed under control of the Supv3L1 native promoter. During development, expression of Supv3L1 begins at the blastocyst stage, becomes widespread and strong in all fetal tissues and cell types, and continues during postnatal growth. In mature animals reporter expression is only slightly diminished in most tissues and continues to be highly expressed in the brain, peripheral sensory organs, and testis. Together, these data confirm that Supv3L1 is an important developmentally regulated gene, which continues to be expressed in all mature tissues, particularly the rapidly proliferating cells of testes, but also in the brain and sensory organs. The transgenic mice and cell lines derived from them constitute a valuable tool for the examination of the spatial and temporal aspects of Supv3L1 promoter activity, and should facilitate future screens for small molecules that regulate Supv3L1 expression. PMID:19937380

  1. Angiostatin regulates the expression of antiangiogenic and proapoptotic pathways via targeted inhibition of mitochondrial proteins

    PubMed Central

    Lee, Tong-Young; Muschal, Stefan; Pravda, Elke A.; Folkman, Judah; Abdollahi, Amir

    2009-01-01

    Angiostatin, a proteolytic fragment of plasminogen, is a potent endogenous antiangiogenic agent. The molecular mechanisms governing angiostatin's antiangiogenic and antitumor effects are not well understood. Here, we report the identification of mitochondrial compartment as the ultimate target of angiostatin. After internalization of angiostatin into the cell, at least 2 proteins within the mitochondria bind this molecule: malate dehydrogenase, a member of Krebs cycle, and adenosine triphosphate synthase. In vitro and in vivo studies revealed differential regulation of key prosurvival and angiogenesis-related proteins in angiostatin-treated tumors and tumor-endothelium. Angiostatin induced apoptosis via down-regulation of mitochondrial BCL-2. Angiostatin treatment led to down-regulation of c-Myc and elevated levels of another key antiangiogenic protein, thrombospondin-1, reinforcing its antitumor and antiangiogenic effects. Further evidence is provided for reduced recruitment and infiltration of bone marrow–derived macrophages in angiostatin-treated tumors. The observed effects of angiostatin were restricted to the tumor site and were not observed in other major organs of the mice, indicating unique tumor specific bioavailability. Together, our data suggest mitochondria as a novel target for antiangiogenic therapy and provide mechanistic insights to the antiangiogenic and antitumor effects of angiostatin. PMID:19465692

  2. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    PubMed

    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso

    2011-04-04

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  3. Genetic variation architecture of mitochondrial genome reveals the differentiation in Korean landrace and weedy rice.

    PubMed

    Tong, Wei; He, Qiang; Park, Yong-Jin

    2017-03-03

    Mitochondrial genome variations have been detected despite the overall conservation of this gene content, which has been valuable for plant population genetics and evolutionary studies. Here, we describe mitochondrial variation architecture and our performance of a phylogenetic dissection of Korean landrace and weedy rice. A total of 4,717 variations across the mitochondrial genome were identified adjunct with 10 wild rice. Genetic diversity assessment revealed that wild rice has higher nucleotide diversity than landrace and/or weedy, and landrace rice has higher diversity than weedy rice. Genetic distance was suggestive of a high level of breeding between landrace and weedy rice, and the landrace showing a closer association with wild rice than weedy rice. Population structure and principal component analyses showed no obvious difference in the genetic backgrounds of landrace and weedy rice in mitochondrial genome level. Phylogenetic, population split, and haplotype network evaluations were suggestive of independent origins of the indica and japonica varieties. The origin of weedy rice is supposed to be more likely from cultivated rice rather than from wild rice in mitochondrial genome level.

  4. Genetic variation architecture of mitochondrial genome reveals the differentiation in Korean landrace and weedy rice

    PubMed Central

    Tong, Wei; He, Qiang; Park, Yong-Jin

    2017-01-01

    Mitochondrial genome variations have been detected despite the overall conservation of this gene content, which has been valuable for plant population genetics and evolutionary studies. Here, we describe mitochondrial variation architecture and our performance of a phylogenetic dissection of Korean landrace and weedy rice. A total of 4,717 variations across the mitochondrial genome were identified adjunct with 10 wild rice. Genetic diversity assessment revealed that wild rice has higher nucleotide diversity than landrace and/or weedy, and landrace rice has higher diversity than weedy rice. Genetic distance was suggestive of a high level of breeding between landrace and weedy rice, and the landrace showing a closer association with wild rice than weedy rice. Population structure and principal component analyses showed no obvious difference in the genetic backgrounds of landrace and weedy rice in mitochondrial genome level. Phylogenetic, population split, and haplotype network evaluations were suggestive of independent origins of the indica and japonica varieties. The origin of weedy rice is supposed to be more likely from cultivated rice rather than from wild rice in mitochondrial genome level. PMID:28256554

  5. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation

    PubMed Central

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-01-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1. PMID:25502213

  6. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation.

    PubMed

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-11-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1.

  7. Complete mitochondrial genome of Helicoverpa zea (Boddie) and expression profiles of mitochondrial-encoded genes in early and late embryos

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mitochondrial genome of the bollworm, Helicoverpa zea, was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogen...

  8. Expression of a gene encoding mitochondrial aldehyde dehydrogenase in rice increases under submerged conditions.

    PubMed

    Nakazono, M; Tsuji, H; Li, Y; Saisho, D; Arimura, S; Tsutsumi, N; Hirai, A

    2000-10-01

    It is known that alcoholic fermentation is important for survival of plants under anaerobic conditions. Acetaldehyde, one of the intermediates of alcoholic fermentation, is not only reduced by alcohol dehydrogenase but also can be oxidized by aldehyde dehydrogenase (ALDH). To determine whether ALDH plays a role in anaerobic metabolism in rice (Oryza sativa L. cv Nipponbare), we characterized a cDNA clone encoding mitochondrial ALDH from rice (Aldh2a). Analysis of sub-cellular localization of ALDH2a protein using green fluorescent protein and an in vitro ALDH assay using protein extracts from Escherichia coli cells that overexpressed ALDH2a indicated that ALDH2a functions in the oxidation of acetaldehyde in mitochondria. A Southern-blot analysis indicated that mitochondrial ALDH is encoded by at least two genes in rice. We found that the Aldh2a mRNA was present at high levels in leaves of dark-grown seedlings, mature leaf sheaths, and panicles. It is interesting that expression of the rice Aldh2a gene, unlike the expression of the tobacco (Nicotiana tabacum) Aldh2a gene, was induced in rice seedlings by submergence. Experiments with ruthenium red, which is a blocker of Ca(2+) fluxes in rice as well as maize (Zea mays), suggest that the induction of expression of Adh1 and Pdc1 by low oxygen stress is regulated by elevation of the cytosolic Ca(2+) level. However, the induction of Aldh2a gene expression may not be controlled by the cytosolic Ca(2+) level elevation. A possible involvement of ALDH2a in the submergence tolerance of rice is discussed.

  9. Unraveling the Limits of Mitochondrial Control Region to Estimate the Fine Scale Population Genetic Differentiation in Anadromous Fish Tenualosa ilisha

    PubMed Central

    Verma, Rashmi; Singh, Mahender; Kumar, Sudhir

    2016-01-01

    The mitochondrial control region has been the first choice for examining the population structure but hypervariability and homoplasy have reduced its suitability. We analysed eight populations using control region for examining the population structure of Hilsa. Although the control region analysis revealed broad structuring between the Arabian Sea and Bay of Bengal (FST  0.0441, p < 0.001) it was unable to detect structure among riverine populations. These results suggest that the markers used must be able to distinguish populations and control region has led to an underestimation of genetic differentiation among populations of Hilsa. PMID:27313951

  10. Insulin Sensitizing Pharmacology of Thiazolidinediones Correlates with Mitochondrial Gene Expression rather than Activation of PPARγ

    PubMed Central

    Bolten, Charles W.; Blanner, Patrick M.; McDonald, William G.; Staten, Nicholas R.; Mazzarella, Richard A.; Arhancet, Graciela B.; Meier, Martin F.; Weiss, David J.; Sullivan, Patrick M.; Hromockyj, Alexander E.; Kletzien, Rolf F.; Colca, Jerry R.

    2007-01-01

    Insulin sensitizing thiazolidinediones (TZDs) are generally considered to work as agonists for the nuclear receptor peroxisome proliferative activated receptor-gamma (PPARγ). However, TZDs also have acute, non-genomic metabolic effects and it is unclear which actions are responsible for the beneficial pharmacology of these compounds. We have taken advantage of an analog, based on the metabolism of pioglitazone, which has much reduced ability to activate PPARγ. This analog (PNU-91325) was compared to rosiglitazone, the most potent PPARγ activator approved for human use, in a variety of studies both in vitro and in vivo. The data demonstrate that PNU-91325 is indeed much less effective than rosiglitazone at activating PPARγ both in vitro and in vivo. In contrast, both compounds bound similarly to a mitochondrial binding site and acutely activated PI-3 kinase-directed phosphorylation of AKT, an action that was not affected by elimination of PPARγ activation. The two compounds were then compared in vivo in both normal C57 mice and diabetic KKAy mice to determine whether their pharmacology correlated with biomarkers of PPARγ activation or with the expression of other gene transcripts. As expected from previous studies, both compounds improved insulin sensitivity in the diabetic mice, and this occurred in spite of the fact that there was little increase in expression of the classic PPARγ target biomarker adipocyte binding protein-2 (aP2) with PNU-91325 under these conditions. An examination of transcriptional profiling of key target tissues from mice treated for one week with both compounds demonstrated that the relative pharmacology of the two thiazolidinediones correlated best with an increased expression of an array of mitochondrial proteins and with expression of PPARγ coactivator 1-alpha (PGC1α), the master regulator of mitochondrial biogenesis. Thus, important pharmacology of the insulin sensitizing TZDs may involve acute actions, perhaps on the

  11. Imbalanced Production of Reactive Oxygen Species and Mitochondrial Antioxidant SOD2 in Fabry Disease-Specific Human Induced Pluripotent Stem Cell-Differentiated Vascular Endothelial Cells.

    PubMed

    Tseng, Wei-Lien; Chou, Shih-Jie; Chiang, Huai-Chih; Wang, Mong-Lien; Chien, Chian-Shiu; Chen, Kuan-Hsuan; Leu, Hsin-Bang; Wang, Chien-Ying; Chang, Yuh-Lih; Liu, Yung-Yang; Jong, Yuh-Jyh; Lin, Shinn-Zong; Chiou, Shih-Hwa; Lin, Shing-Jong; Yu, Wen-Chung

    2017-03-13

    Fabry disease (FD) is an X-linked inherited lysosomal storage disease caused by α-galactosidase A (GLA) deficiency. Progressive intracellular accumulation of globotriaosylceramide (Gb3) is considered to be pathogenically responsible for the phenotype variability of FD that causes cardiovascular dysfunction; however, molecular mechanisms underlying the impairment of FD-associated cardiovascular tissues remain unclear. In this study, we reprogrammed human induced pluripotent stem cells (hiPSCs) from peripheral blood cells of patients with FD (FD-iPSCs); subsequently differentiated them into vascular endothelial-like cells (FD-ECs) expressing CD31, VE-cadherin, and vWF; and investigated their ability to form vascular tube-like structures. FD-ECs recapitulated the FD pathophysiological phenotype exhibiting intracellular Gb3 accumulation under a transmission electron microscope. Moreover, compared with healthy control iPSC-derived endothelial cells (NC-ECs), reactive oxygen species (ROS) production considerably increased in FD-ECs. Microarray analysis was performed to explore the possible mechanism underlying Gb3 accumulation-induced ROS production in FD-ECs. Our results revealed that superoxide dismutase 2 (SOD2), a mitochondrial antioxidant, was significantly downregulated in FD-ECs. Compared with NC-ECs, AMPK activity was significantly enhanced in FD-ECs. Furthermore, to investigate the role of Gb3 in these effects, human umbilical vein endothelial cells (HUVECs) were treated with Gb3. After Gb3 treatment, we observed that SOD2 expression was suppressed and AMPK activity was enhanced in a dose-dependent manner. Collectively, our results indicate that excess accumulation of Gb3 suppressed SOD2 expression, increased ROS production, enhanced AMPK activation, and finally caused vascular endothelial dysfunction. Our findings suggest that dysregulated mitochondrial ROS may be a potential target for treating FD.

  12. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  13. Expression of YY1 in Differentiated Thyroid Cancer.

    PubMed

    Arribas, Jéssica; Castellví, Josep; Marcos, Ricard; Zafón, Carles; Velázquez, Antonia

    2015-05-01

    The transcription factor Yin Yang 1 (YY1) has an important regulatory role in tumorigenesis, but its implication in thyroid cancer has not been yet investigated. In the present study, we have analyzed the expression of YY1 in differentiated thyroid cancer and assessed the association of YY1 expression with clinical features. Expression of YY1 was evaluated in human thyroid cancer cell lines, a series of matched normal/tumor thyroid tissues and in a thyroid cancer tissue microarray, using real-time PCR, Western blot, and/or immunohistochemistry. YY1 was overexpressed in thyroid cancer cells, at transcription and protein levels. A significant increase of YY1 mRNA was also observed in tumor thyroid tissues. Moreover, immunohistochemical analysis of the thyroid cancer tissue microarray revealed that both papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) present increased YY1 protein levels (48 and 19%, respectively). After stratification by the level of YY1 protein, positive YY1 expression identifies 88% of patients with PTC. The association of YY1 expression with clinicopathological features in PTC and FTC showed that YY1 expression was related with age at diagnosis. Our data indicates for the first time overexpression of YY1 in differentiated thyroid cancer, with YY1 being more frequently overexpressed in the PTC subtype.

  14. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  15. Spirulina phycocyanin induces differential protein expression and apoptosis in SKOV-3 cells.

    PubMed

    Pan, Ruowang; Lu, Rongmao; Zhang, Ying; Zhu, Mei; Zhu, Wen; Yang, Rongrong; Zhang, Enyong; Ying, Jun; Xu, Teng; Yi, Huiguang; Li, Jinsong; Shi, Mengru; Zhou, Li; Xu, Zuyuan; Li, Peizhen; Bao, Qiyu

    2015-11-01

    The present study was designed to determine the effects of phycocyanin (PC) on Human ovarian cancer SKOV-3 cells and the underlying molecular mechanisms of action. The inhibitory effects of PC on the cell proliferation were detected by MTT assay. The IC50 values of PC were 182.0μM and 133.6μM for 24h and 48h exposure, respectively. PC induced apoptosis in SKOV-3 cells was observed by electron microscopy and flow cytometry. The apoptosis rate was increased from 1.6% to 19.8% after PC exposure. The fluorescence intensity of ROS and the activities of Caspase-3, Caspase-8, and Caspase-9 were increased. Differentiated expression protein spots were selected and identified using proteomic techniques. There were 698±73 and 683±79 protein spots resolved in untreated and PC-treated cells, respectively. Forty five differential protein spots were analyzed by MALDI-TOF-MS, including mtSSB, PSME3, and nucleolin. The mRNA expression profiles determined by RT-PCR were consistent with that of the two-dimensional electrophoresis. The decreased proteins such as HSP60, nucleolin, PPase, peroxiredoxin-4 and the increased protein (mtSSB) were identified in SKOV-3 cells after PC treatment, indicating that the effects of PC on tumor cell apoptosis may be relate to multiple target proteins. And the mitochondrial pathway may be the main pathway for PC-induced apoptosis.

  16. Differential protein expression in metallothionein protection from depleted uranium-induced nephrotoxicity

    PubMed Central

    Hao, Yuhui; Huang, Jiawei; Liu, Cong; Li, Hong; Liu, Jing; Zeng, Yiping; Yang, Zhangyou; Li, Rong

    2016-01-01

    The purpose of this study was to investigate the underlying mechanism of metallothionein (MT) protection from depleted uranium (DU) using a proteomics approach to search for a DU toxicity-differential protein. MT−/− and MT+/+ mice were administrated with a single dose of DU (10 mg/kg, i.p.) or equal volume of saline. After 4 days, protein changes in kidney tissues were evaluated using a proteomics approach. A total of 13 differentially expressed proteins were identified using two-dimensional electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The validating results showed that the expression of aminoacylase-3 (ACY-3) and the mitochondrial ethylmalonic encephalopathy 1 (ETHE1) decreased significantly after DU exposure; in addition, the reduction in MT−/− mice was more significant than that in MT+/+ mice. The results also showed that exogenous ETHE1 or ACY-3 could increase the survival rate of human embryonic kidney 293 (HEK293) cells after DU exposure. A specific siRNA of ETHE1 significantly increased cell apoptosis rates after DU exposure, whereas exogenous ETHE1 significantly decreased cell apoptosis rates. In summary, ACY-3 and ETHE1 might involve in protection roles of MT. ETHE1 could be a new sensitive molecular target of DU-induced cell apoptosis. PMID:27966587

  17. Differential proteome and gene expression for testis of mice exposed to carbon ion radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Hong; Li, Hongyan

    Objective To investigate the effect and mechanism of high linear energy transfer (LET) carbon ion irradiation (CIR) on reproduction in the testis of male Swiss Webster mice, and assess the risk associated with space environment. Methods Male mice underwent whole-body irradiation with CIR (0.5, 1 and 4Gy), and matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF) analysis was used to determine the alteration in protein expression in 2-DE (two-dimensional gel electrophoresis) gels of testes caused by irradiation after 7, 14 days. Results 15 differentially expressed proteins, such as glucose-regulated protein(GRP78), aconitate hydratase-mitochondrial precursor (ACO), pyruvate kinase isozymes M1/M2 (PKM1/M2), glutathione-S-transferaseA3 (GSTA3), glutathione S-transferase Pi 1 (GSTP1), Cu/Zn super-oxide dismutase (SOD1), Peptidyl-prolyl cis-trans isomerase (Pin1) and Heat shock 70 kDa protein 4L (HSPa4L), were identified and these proteins were mainly involved in energy supply, the endoplasmic reticulum, cell proliferation, cell cycle, antioxidant capacity and mitochondrial respiration, which play important roles in the inhibition of testicular function in response to CIR. Furthermore, we confirmed the relationship between transcription of mRNA and the abundance of proteins. Conclusion The findings of the present study demonstrated that these proteins may lead to new insights into the molecular mechanism of CIR toxicity, and suggested that the gene expression response to CIR involves diverse regulatory mechanisms from transcription of mRNA to the formation of functional proteins. These data also may provide a scientific basis for protecting astronauts and space traveler’s health and safety.

  18. Differential inhibition/inactivation of mitochondrial complex I implicates its alteration in malignant cells.

    PubMed

    Ghosh, A; Bera, S; Ghosal, S; Ray, S; Basu, A; Ray, M

    2011-09-01

    Methylglyoxal strongly inhibited mitochondrial respiration of a wide variety of malignant tissues including sarcoma of mice, whereas no such significant effect was noted on mitochondrial respiration of normal tissues with the exception of cardiac cells. This inhibition by methylglyoxal was found to be at the level of mitochondrial complex I (NADH dehydrogenase) of the electron transport chain. L-Lactaldehyde, which is structurally and metabolically related to methylglyoxal, could protect against this inhibition. NADH dehydrogenase of submitochondrial particles of malignant and cardiac cells was inhibited by methylglyoxal. This enzyme of these cells was also inactivated by methylglyoxal. The possible involvement of lysine residue(s) for the activity of NADH dehydrogenase was also investigated by using lysine-specific reagents trinitrobenzenesulfonic acid (TNBS) and pyridoxal 5' phosphate (PP). Inactivation of NADH dehydrogenase by both TNBS and PP convincingly demonstrated the involvement of lysine residue(s) for the activity of the sarcoma and cardiac enzymes, whereas both TNBS and PP failed to inactivate the enzymes of skeletal muscle and liver. Together these studies demonstrate a specific effect of methylglyoxal on mitochondrial complex I of malignant cells and importantly some distinct alteration of this complex in cancer cells.

  19. Sulforaphane induces differential modulation of mitochondrial biogenesis and dynamics in normal cells and tumor cells.

    PubMed

    Negrette-Guzmán, Mario; Huerta-Yepez, Sara; Vega, Mario I; León-Contreras, Juan Carlos; Hernández-Pando, Rogelio; Medina-Campos, Omar Noel; Rodríguez, Esteban; Tapia, Edilia; Pedraza-Chaverri, José

    2017-02-01

    Antioxidant-based chemotherapy has been intensely debated. Herein, we show that sulforaphane (SFN) induced mitochondrial biogenesis followed by mitochondrial fusion in a kidney cell line commonly used in nephroprotective models. At the same concentration and exposure time, SFN induced cell death in prostate cancer cells accompanied by mitochondrial biogenesis and fragmentation. Stabilization of the nuclear factor E2-related factor-2 (Nrf2) could be associated with these effects in the tumor cell line. An increase in the peroxisome proliferator-activated receptor-γ co-activator-1α (PGC1α) level and a decrease in the hypoxia-inducible factor-1α (HIF1α) level would suggest a possible metabolic shift. The knockdown in the nuclear respiratory factor-1 (NRF1) attenuated the SFN-induced effect on prostate cancer cells demonstrating that mitochondrial biogenesis plays an important role in cell death for this kind of tumor cells. This evidence supports SFN as a potential antineoplastic agent that could inhibit tumor development and could protect normal tissues by modulating common processes.

  20. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    SciTech Connect

    Jang, Min-Kyung; Jung, Myeong Ho

    2014-11-07

    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  1. An araC-controlled bacterial cre expression system to produce DNA minicircle vectors for nuclear and mitochondrial gene therapy.

    PubMed

    Bigger, B W; Tolmachov, O; Collombet, J M; Fragkos, M; Palaszewski, I; Coutelle, C

    2001-06-22

    The presence of CpG motifs and their associated sequences in bacterial DNA causes an immunotoxic response following the delivery of these plasmid vectors into mammalian hosts. We describe a biotechnological approach to the elimination of this problem by the creation of a bacterial cre recombinase expression system, tightly controlled by the arabinose regulon. This permits the Cre-mediated and -directed excision of the entire bacterial vector sequences from plasmid constructs to create supercoiled gene expression minicircles for gene therapy. Minicircle yields using standard culture volumes are sufficient for most in vitro and in vivo applications whereas minicircle expression in vitro is significantly increased over standard plasmid transfection. By the simple expedient of removing the bacterial DNA complement, we significantly reduce the size and CpG content of these expression vectors, which should also reduce DNA-induced inflammatory responses in a dose-dependent manner. We further describe the generation of minicircle expression vectors for mammalian mitochondrial gene therapy, for which no other vector systems currently exist. The removal of bacterial vector sequences should permit appropriate transcription and correct transcriptional cleavage from the mitochondrial minicircle constructs in a mitochondrial environment and brings the realization of mitochondrial gene therapy a step closer.

  2. Studies of Hematopoietic Cell Differentiation with a Ratiometric and Reversible Sensor of Mitochondrial Reactive Oxygen Species

    PubMed Central

    Kaur, Amandeep; Jankowska, Karolina; Pilgrim, Chelsea; Fraser, Stuart T.

    2016-01-01

    Abstract Aims: Chronic elevations in cellular redox state are known to result in the onset of various pathological conditions, but transient increases in reactive oxygen species (ROS)/reactive nitrogen species (RNS) are necessary for signal transduction and various physiological functions. There is a distinct lack of reversible fluorescent tools that can aid in studying and unraveling the roles of ROS/RNS in physiology and pathology by monitoring the variations in cellular ROS levels over time. In this work, we report the development of ratiometric fluorescent sensors that reversibly respond to changes in mitochondrial redox state. Results: Photophysical studies of the developed flavin–rhodamine redox sensors, flavin–rhodamine redox sensor 1 (FRR1) and flavin–rhodamine redox sensor 2 (FRR2), confirmed the reversible response of the probes upon reduction and re-oxidation over more than five cycles. The ratiometric output of FRR1 and FRR2 remained unaltered in the presence of other possible cellular interferants (metals and pH). Microscopy studies indicated clear mitochondrial localization of both probes, and FRR2 was shown to report the time-dependent increase of mitochondrial ROS levels after lipopolysaccharide stimulation in macrophages. Moreover, it was used to study the variations in mitochondrial redox state in mouse hematopoietic cells at different stages of embryonic development and maturation. Innovation: This study provides the first ratiometric and reversible probes for ROS, targeted to the mitochondria, which reveal variations in mitochondrial ROS levels at different stages of embryonic and adult blood cell production. Conclusions: Our results suggest that with their ratiometric and reversible outputs, FRR1 and FRR2 are valuable tools for the future study of oxidative stress and its implications in physiology and pathology. Antioxid. Redox Signal. 24, 667–679. PMID:26865422

  3. Carnitine Palmitoyltransferase 1 Increases Lipolysis, UCP1 Protein Expression and Mitochondrial Activity in Brown Adipocytes

    PubMed Central

    Calderon-Dominguez, María; Sebastián, David; Fucho, Raquel; Weber, Minéia; Mir, Joan F.; García-Casarrubios, Ester; Obregón, María Jesús; Zorzano, Antonio; Valverde, Ángela M.; Serra, Dolors

    2016-01-01

    The discovery of active brown adipose tissue (BAT) in adult humans and the fact that it is reduced in obese and diabetic patients have put a spotlight on this tissue as a key player in obesity-induced metabolic disorders. BAT regulates energy expenditure through thermogenesis; therefore, harnessing its thermogenic fat-burning power is an attractive therapeutic approach. We aimed to enhance BAT thermogenesis by increasing its fatty acid oxidation (FAO) rate. Thus, we expressed carnitine palmitoyltransferase 1AM (CPT1AM), a permanently active mutant form of CPT1A (the rate-limiting enzyme in FAO), in a rat brown adipocyte (rBA) cell line through adenoviral infection. We found that CPT1AM-expressing rBA have increased FAO, lipolysis, UCP1 protein levels and mitochondrial activity. Additionally, enhanced FAO reduced the palmitate-induced increase in triglyceride content and the expression of obese and inflammatory markers. Thus, CPT1AM-expressing rBA had enhanced fat-burning capacity and improved lipid-induced derangements. This indicates that CPT1AM-mediated increase in brown adipocytes FAO may be a new approach to the treatment of obesity-induced disorders. PMID:27438137

  4. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  5. Expression of dystrophin Dp71 during PC12 cell differentiation.

    PubMed

    Cisneros, B; Rendon, A; Genty, V; Aranda, G; Marquez, F; Mornet, D; Montañez, C

    1996-08-02

    The expression of dystrophin-protein 71 (Dp71) was investigated during nerve growth factor (NGF) induced differentiation of PC12 cells. A semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assay was designed to measure Dp71 mRNA, whereas the Dp71 protein amount was evaluated by immunoblot analysis using an anti-dystrophin monoclonal antibody. Comparison with control cultures showed that Dp71 mRNA and protein levels increased in parallel with NGF treatment peaking with increments of 60% and 1.4 times, respectively. The upregulation of Dp71 expression during PC12 cells differentiation point at PC12 cells as a suitable model for studying the function of Dp71 in neuronal cells.

  6. Strontium promotes cementoblasts differentiation through inhibiting sclerostin expression in vitro.

    PubMed

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan; Hu, Min

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.

  7. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  8. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  9. HnRNPA2 is a novel histone acetyltransferase that mediates mitochondrial stress-induced nuclear gene expression

    PubMed Central

    Guha, Manti; Srinivasan, Satish; Guja, Kip; Mejia, Edison; Garcia-Diaz, Miguel; Johnson, F Brad; Ruthel, Gordon; Kaufman, Brett A; Rappaport, Eric F; Glineburg, M Rebecca; Fang, Ji-Kang; Szanto, Andres Klein; Nakagawa, Hiroshi; Basha, Jeelan; Kundu, Tapas; Avadhani, Narayan G

    2016-01-01

    Reduced mitochondrial DNA copy number, mitochondrial DNA mutations or disruption of electron transfer chain complexes induce mitochondria-to-nucleus retrograde signaling, which induces global change in nuclear gene expression ultimately contributing to various human pathologies including cancer. Recent studies suggest that these mitochondrial changes cause transcriptional reprogramming of nuclear genes although the mechanism of this cross talk remains unclear. Here, we provide evidence that mitochondria-to-nucleus retrograde signaling regulates chromatin acetylation and alters nuclear gene expression through the heterogeneous ribonucleoprotein A2 (hnRNAP2). These processes are reversed when mitochondrial DNA content is restored to near normal cell levels. We show that the mitochondrial stress-induced transcription coactivator hnRNAP2 acetylates Lys 8 of H4 through an intrinsic histone lysine acetyltransferase (KAT) activity with Arg 48 and Arg 50 of hnRNAP2 being essential for acetyl-CoA binding and acetyltransferase activity. H4K8 acetylation at the mitochondrial stress-responsive promoters by hnRNAP2 is essential for transcriptional activation. We found that the previously described mitochondria-to-nucleus retrograde signaling-mediated transformation of C2C12 cells caused an increased expression of genes involved in various oncogenic processes, which is retarded in hnRNAP2 silenced or hnRNAP2 KAT mutant cells. Taken together, these data show that altered gene expression by mitochondria-to-nucleus retrograde signaling involves a novel hnRNAP2-dependent epigenetic mechanism that may have a role in cancer and other pathologies. PMID:27990297

  10. In recurrent primary biliary cirrhosis after liver transplantation, biliary epithelial cells show increased expression of mitochondrial proteins.

    PubMed

    Sasaki, Motoko; Hsu, Maylee; Yeh, Matthew M; Nakanuma, Yasuni

    2015-10-01

    In biliary epithelial lesions in primary biliary cirrhosis (PBC), mitochondrial proteins associated with deregulated autophagy are abnormally expressed. We examined whether this could be used as a diagnostic marker for end-stage PBC and recurrent PBC after liver transplantation. We examined the expression of the mitochondrial protein pyruvate dehydrogenase complex-E2 component and cytochrome c oxidase, subunit I (CCO), the autophagy-related marker microtubule-associated protein-light chain 3 (LC3), and p62/sequestosome-1 and the senescence markers p16(Ink4a) and p21(WAF1/Cip1) in small bile ducts and bile ductules in explanted livers from patients with PBC (n = 20) in comparison with liver tissue from control patients (n = 21) and post-transplant samples including recurrent PBC and cellular rejection (n = 28). Intense granular expression of mitochondrial proteins was significantly more frequent in small bile ducts in explanted livers with PBC than in control livers (p < 0.05). Post-transplant samples comprised of three groups: group A (positive for mitochondrial proteins, n = 7), group B (positive for either autophagy-related or senescence markers but negative for mitochondrial proteins, n = 7), and group C (all negative, n = 14). All but one case of group A were clinically and histologically diagnosed as recurrent PBC. In contrast, all cases of group B were diagnosed as cellular rejection. This study suggests that the expression of mitochondrial proteins in small bile ducts may be a useful diagnostic marker for end-stage PBC and recurrent PBC after liver transplantation.

  11. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  12. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  13. Differential expression of CART in ewes with differing ovulation rates.

    PubMed

    Juengel, Jennifer L; French, Michelle C; Quirke, Laurel D; Kauff, Alexia; Smith, George W; Johnstone, Peter D

    2017-04-01

    We hypothesised that cocaine- and amphetamine-regulated transcript (CARTPT) would be differentially expressed in ewes with differing ovulation rates. Expression of mRNA for CARTPT, as well as LHCGR, FSHR, CYP19A1 and CYP17A1 was determined in antral follicles ≥1 mm in diameter collected during the follicular phase in ewes heterozygous for the Booroola and Inverdale genes (I+B+; average ovulation rate 4) and ++ contemporaries (++; average ovulation rate 1.8). In ++ ewes (n = 6), CARTPT was expressed in small follicles (1 to <3 mm diameter), where 18.8 ± 2.5% follicles expressed CARTPT CART peptide was also detected in follicular fluid of some follicles of ++ ewes. In I+B+ ewes, 5/6 ewes did not have any follicles that expressed CARTPT, and no CART peptide was detected in any follicle examined. Expression pattern of CYP19A1 differed between I+B+ and ++ ewes with an increased percentage of small and medium follicles (3 to <4.5 mm diameter) but decreased percentage of large follicles (≥4.5 mm diameter) expressing CYP19A1 in the I+B+ ewes. Many of the large follicles from the I+B+ ewes appeared non-functional and expression of LHCGR, FSHR, CYP17A1 and CYP19A1 was less than that observed in ++ ewes. Expression of FSHR and CYP17A1 was not different between groups in small and medium follicles, but LHCGR expression was approximately double in I+B+ ewes compared to that in ++ ewes. Thus, ewes with high ovulation rates had a distinct pattern of expression of CARTPT mRNA and protein compared to ewes with normal ovulation rates, providing evidence for CART being important in the regulation of ovulation rate.

  14. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  15. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation

    PubMed Central

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-01-01

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer’s disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes. PMID:27383650

  16. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation.

    PubMed

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-07-07

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer's disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes.

  17. Physical exercise in aging human skeletal muscle increases mitochondrial calcium uniporter expression levels and affects mitochondria dynamics.

    PubMed

    Zampieri, Sandra; Mammucari, Cristina; Romanello, Vanina; Barberi, Laura; Pietrangelo, Laura; Fusella, Aurora; Mosole, Simone; Gherardi, Gaia; Höfer, Christian; Löfler, Stefan; Sarabon, Nejc; Cvecka, Jan; Krenn, Matthias; Carraro, Ugo; Kern, Helmut; Protasi, Feliciano; Musarò, Antonio; Sandri, Marco; Rizzuto, Rosario

    2016-12-01

    Age-related sarcopenia is characterized by a progressive loss of muscle mass with decline in specific force, having dramatic consequences on mobility and quality of life in seniors. The etiology of sarcopenia is multifactorial and underlying mechanisms are currently not fully elucidated. Physical exercise is known to have beneficial effects on muscle trophism and force production. Alterations of mitochondrial Ca(2+) homeostasis regulated by mitochondrial calcium uniporter (MCU) have been recently shown to affect muscle trophism in vivo in mice. To understand the relevance of MCU-dependent mitochondrial Ca(2+) uptake in aging and to investigate the effect of physical exercise on MCU expression and mitochondria dynamics, we analyzed skeletal muscle biopsies from 70-year-old subjects 9 weeks trained with either neuromuscular electrical stimulation (ES) or leg press. Here, we demonstrate that improved muscle function and structure induced by both trainings are linked to increased protein levels of MCU Ultrastructural analyses by electron microscopy showed remodeling of mitochondrial apparatus in ES-trained muscles that is consistent with an adaptation to physical exercise, a response likely mediated by an increased expression of mitochondrial fusion protein OPA1. Altogether these results indicate that the ES-dependent physiological effects on skeletal muscle size and force are associated with changes in mitochondrial-related proteins involved in Ca(2+) homeostasis and mitochondrial shape. These original findings in aging human skeletal muscle confirm the data obtained in mice and propose MCU and mitochondria-related proteins as potential pharmacological targets to counteract age-related muscle loss.

  18. The 18-kDa Translocator Protein Inhibits Vascular Cell Adhesion Molecule-1 Expression via Inhibition of Mitochondrial Reactive Oxygen Species

    PubMed Central

    Joo, Hee Kyoung; Lee, Yu Ran; Kang, Gun; Choi, Sunga; Kim, Cuk-Seong; Ryoo, Sungwoo; Park, Jin Bong; Jeon, Byeong Hwa

    2015-01-01

    Translocator protein 18 kDa (TSPO) is a mitochondrial outer membrane protein and is abundantly expressed in a variety of organ and tissues. To date, the functional role of TSPO on vascular endothelial cell activation has yet to be fully elucidated. In the present study, the phorbol 12-myristate 13-acetate (PMA, 250 nM), an activator of protein kinase C (PKC), was used to induce vascular endothelial activation. Adenoviral TSPO overexpression (10–100 MOI) inhibited PMA-induced vascular cell adhesion molecule-1 (VCAM-1) and intracellular cell adhesion molecule-1 (ICAM-1) expression in a dose dependent manner. PMA-induced VCAM-1 expressions were inhibited by Mito-TEMPO (0.1–0.5 μM), a specific mitochondrial antioxidants, and cyclosporin A (1–5 μM), a mitochondrial permeability transition pore inhibitor, implying on an important role of mitochondrial reactive oxygen species (ROS) on the endothelial activation. Moreover, adenoviral TSPO overexpression inhibited mitochondrial ROS production and manganese superoxide dismutase expression. On contrasts, gene silencing of TSPO with siRNA increased PMA-induced VCAM-1 expression and mitochondrial ROS production. Midazolam (1–50 μM), TSPO ligands, inhibited PMA-induced VCAM-1 and mitochondrial ROS production in endothelial cells. These results suggest that mitochondrial TSPO can inhibit PMA-induced endothelial inflammation via suppression of VCAM-1 and mitochondrial ROS production in endothelial cells. PMID:26608360

  19. The Kunitz-protease inhibitor domain in amyloid precursor protein reduces cellular mitochondrial enzymes expression and function.

    PubMed

    Chua, Li-Min; Lim, Mei-Li; Wong, Boon-Seng

    2013-08-09

    Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) and this can be contributed by aberrant metabolic enzyme function. But, the mechanism causing this enzymatic impairment is unclear. Amyloid precursor protein (APP) is known to be alternatively spliced to produce three major isoforms in the brain (APP695, APP751, APP770). Both APP770 and APP751 contain the Kunitz Protease Inhibitory (KPI) domain, but the former also contain an extra OX-2 domain. APP695 on the other hand, lacks both domains. In AD, up-regulation of the KPI-containing APP isoforms has been reported. But the functional contribution of this elevation is unclear. In the present study, we have expressed and compared the effect of the non-KPI containing APP695 and the KPI-containing APP751 on mitochondrial function. We found that the KPI-containing APP751 significantly decreased the expression of three major mitochondrial metabolic enzymes; citrate synthase, succinate dehydrogenase and cytochrome c oxidase (COX IV). This reduction lowers the NAD(+)/NADH ratio, COX IV activity and mitochondrial membrane potential. Overall, this study demonstrated that up-regulation of the KPI-containing APP isoforms is likely to contribute to the impairment of metabolic enzymes and mitochondrial function in AD.

  20. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  1. Stoichiometric expression of mtHsp40 and mtHsp70 modulates mitochondrial morphology and cristae structure via Opa1L cleavage.

    PubMed

    Lee, Byoungchun; Ahn, Younghee; Kang, Sung-Myung; Park, Youngjin; Jeon, You-Jin; Rho, Jong M; Kim, Sung-Woo

    2015-06-15

    Deregulation of mitochondrial heat-shock protein 40 (mtHsp40) and dysfunction of mtHsp70 are associated with mitochondrial fragmentation, suggesting that mtHsp40 and mtHsp70 may play roles in modulating mitochondrial morphology. However, the mechanism of mitochondrial fragmentation induced by mtHsp40 deregulation and mtHsp70 dysfunction remains unclear. In addition, the functional link between mitochondrial morphology change upon deregulated mtHsp40/mtHsp70 and mitochondrial function has been unexplored. Our coimmunoprecipitation and protein aggregation analysis showed that both overexpression and depletion of mtHsp40 accumulated aggregated proteins in fragmented mitochondria. Moreover, mtHsp70 loss and expression of a mtHsp70 mutant lacking the client-binding domain caused mitochondrial fragmentation. Together the data suggest that the molecular ratio of mtHsp40 to mtHsp70 is important for their chaperone function and mitochondrial morphology. Whereas mitochondrial translocation of Drp1 was not altered, optic atrophy 1 (Opa1) short isoform accumulated in fragmented mitochondria, suggesting that mitochondrial fragmentation in this study results from aberration of mitochondrial inner membrane fusion. Finally, we found that fragmented mitochondria were defective in cristae development, OXPHOS, and ATP production. Taken together, our data suggest that impaired stoichiometry between mtHsp40 and mtHsp70 promotes Opa1L cleavage, leading to cristae opening, decreased OXPHOS, and triggering of mitochondrial fragmentation after reduction in their chaperone function.

  2. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  3. Hyperglycemia induces differential change in oxidative stress at gene expression and functional levels in HUVEC and HMVEC

    PubMed Central

    2013-01-01

    Background Endothelial dysfunction precedes pathogenesis of vascular complications in diabetes. In recent years, the mechanisms of endothelial dysfunction were investigated to outline strategies for its treatment. However, the therapies for dysfunctional endothelium resulted in multiple clinical trial failures and remain elusive. There is a need for defining hyperglycemia-induced endothelial dysfunction with both generic and specific dysfunctional changes in endothelial cells (EC) using a systems approach. In this study, we investigated hyperglycemia-induced endothelial dysfunction in HUVEC and HMVEC. We investigated hyperglycemia-induced functional changes (superoxide (O2‾), and hydrogen peroxide (H2O2) production and mitochondrial membrane polarization) and gene expression fingerprints of related enzymes (nitric oxide synthase, NAD(P)H oxidase, and reactive oxygen species (ROS) neutralizing enzymes) in both ECs. Method Gene expression of NOS2, NOS3, NOX4, CYBA, UCP1, CAT, TXNRD1, TXNRD2, GPX1, NOX1, SOD1, SOD2, PRDX1, 18s, and RPLP0 were measured using real-time PCR. O2‾ production was measured with dihydroethidium (DHE) fluorescence measurement. H2O2 production was measured using Amplex Red assay. Mitochondrial membrane polarization was measured using JC-10 based fluorescence measurement. Results We showed that the O2‾ levels increased similarly in both ECs with hyperglycemia. However, these endothelial cells showed significantly different underlying gene expression profile, H2O2 production and mitochondrial membrane polarization. In HUVEC, hyperglycemia increased H2O2 production, and hyperpolarized mitochondrial membrane. ROS neutralizing enzymes SOD2 and CAT gene expression were downregulated. In contrast, there was an upregulation of nitric oxide synthase and NAD(P)H oxidase and a depolarization of mitochondrial membrane in HMVEC. In addition, ROS neutralizing enzymes SOD1, GPX1, TXNRD1 and TXNRD2 gene expression were significantly upregulated in high

  4. Differential expression of antimicrobial peptides in margins of chronic wounds.

    PubMed

    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine

    2010-07-01

    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  5. The differential effects of superoxide anion, hydrogen peroxide and hydroxyl radical on cardiac mitochondrial oxidative phosphorylation.

    PubMed

    Zini, Roland; Berdeaux, Alain; Morin, Didier

    2007-10-01

    The involvement of reactive oxygen species (ROS) in cardiac ischemia-reperfusion injuries is well-established, but the deleterious effects of hydrogen peroxide (H(2)O(2)), hydroxyl radical (HO*) or superoxide anion (O(2)*(-) ) on mitochondrial function are poorly understood. Here, we report that incubation of rat heart mitochondria with each of these three species resulted in a decline of the ADP-stimulated respiratory rate but not substrate-dependent respiration. These three species reduced oxygen consumption induced by an uncoupler without alteration of the respiratory chain complexes, but did not modify mitochondrial membrane permeability. HO* slightly decreased F1F0-ATPase activity and HO* and O(2)*(-) partially inhibited the activity of adenine nucleotide translocase; H(2)O(2) failed to alter these targets. They inhibited NADH production by acting specifically on aconitase for O(2)*(-) and alpha-ketoglutarate dehydrogenase for H(2)O(2) and HO*. Our results show that O(2)*(-), H(2)O(2) and HO* act on different mitochondrial targets to alter ATP synthesis, mostly through inhibition of NADH production.

  6. Complex I assembly into supercomplexes determines differential mitochondrial ROS production in neurons and astrocytes

    PubMed Central

    Le Douce, Juliette; Logan, Angela; James, Andrew M.; Bonvento, Gilles; Murphy, Michael P.; Bolaños, Juan P.

    2016-01-01

    Neurons depend on oxidative phosphorylation for energy generation, whereas astrocytes do not, a distinctive feature that is essential for neurotransmission and neuronal survival. However, any link between these metabolic differences and the structural organization of the mitochondrial respiratory chain is unknown. Here, we investigated this issue and found that, in neurons, mitochondrial complex I is predominantly assembled into supercomplexes, whereas in astrocytes the abundance of free complex I is higher. The presence of free complex I in astrocytes correlates with the severalfold higher reactive oxygen species (ROS) production by astrocytes compared with neurons. Using a complexomics approach, we found that the complex I subunit NDUFS1 was more abundant in neurons than in astrocytes. Interestingly, NDUFS1 knockdown in neurons decreased the association of complex I into supercomplexes, leading to impaired oxygen consumption and increased mitochondrial ROS. Conversely, overexpression of NDUFS1 in astrocytes promoted complex I incorporation into supercomplexes, decreasing ROS. Thus, complex I assembly into supercomplexes regulates ROS production and may contribute to the bioenergetic differences between neurons and astrocytes. PMID:27799543

  7. Differentiating sibling species of Zeugodacus caudatus (Insecta: Tephritidae) by complete mitochondrial genome.

    PubMed

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip; Suana, I Wayan

    2016-10-01

    Zeugodacus caudatus is a pest of pumpkin flowers. It has a Palearctic and Oriental distribution. We report here the complete mitochondrial genome of the Malaysian and Indonesian samples of Z. caudatus determined by next-generation sequencing of genomic DNA and determine their taxonomic status as sibling species and phylogeny with other taxa of the genus Zeugodacus. The whole mitogenome of both samples possessed 37 genes (13 protein-coding genes-PCGs, 2 rRNA and 22 tRNA genes) and a control region. The mitogenome of the Indonesian sample (15,885 bp) was longer than that of the Malaysian sample (15,866 bp). In both samples, TΨC-loop was absent in trnF and DHU-loop was absent in trnS1. Molecular phylogeny based on 13 PCGs was concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes), with the two samples of Z. caudatus forming a sister group and the genus Zeugodacus was monophyletic. The Malaysian and Indonesian samples of Z. caudatus have a genetic distance of p = 7.8 % based on 13 PCGs and p = 7.0 % based on 15 mitochondrial genes, indicating status of sibling species. They are proposed to be accorded specific status as members of a species complex.

  8. PATHOME: an algorithm for accurately detecting differentially expressed subpathways

    PubMed Central

    Nam, S; Chang, H R; Kim, K-T; Kook, M-C; Hong, D; Kwon, C H; Jung, H R; Park, H S; Powis, G; Liang, H; Park, T; Kim, Y H

    2014-01-01

    The translation of high-throughput gene expression data into biologically meaningful information remains a bottleneck. We developed a novel computational algorithm, PATHOME, for detecting differentially expressed biological pathways. This algorithm employs straightforward statistical tests to evaluate the significance of differential expression patterns along subpathways. Applying it to gene expression data sets of gastric cancer (GC), we compared its performance with those of other leading programs. Based on a literature-driven reference set, PATHOME showed greater consistency in identifying known cancer-related pathways. For the WNT pathway uniquely identified by PATHOME, we validated its involvement in gastric carcinogenesis through experimental perturbation of both cell lines and animal models. We identified HNF4α-WNT5A regulation in the cross-talk between the AMPK metabolic pathway and the WNT signaling pathway, and further identified WNT5A as a potential therapeutic target for GC. We have demonstrated PATHOME to be a powerful tool, with improved sensitivity for identifying disease-related dysregulated pathways. PMID:24681952

  9. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  10. Effects of temperature on transcriptome and cuticular hydrocarbon expression in ecologically differentiated populations of desert Drosophila.

    PubMed

    Etges, William J; de Oliveira, Cássia C; Rajpurohit, Subhash; Gibbs, Allen G

    2017-01-01

    We assessed the effects of temperature differences on gene expression using whole-transcriptome microarrays and cuticular hydrocarbon variation in populations of cactophilic Drosophila mojavensis. Four populations from Baja California and mainland Mexico and Arizona were each reared on two different host cacti, reared to sexual maturity on laboratory media, and adults were exposed for 12 hr to 15, 25, or 35°C. Temperature differences influenced the expression of 3,294 genes, while population differences and host plants affected >2,400 each in adult flies. Enriched, functionally related groups of genes whose expression changed at high temperatures included heat response genes, as well as genes affecting chromatin structure. Gene expression differences between mainland and peninsular populations included genes involved in metabolism of secondary compounds, mitochondrial activity, and tRNA synthases. Flies reared on the ancestral host plant, pitaya agria cactus, showed upregulation of genes involved in metabolism, while flies reared on organ pipe cactus had higher expression of DNA repair and chromatin remodeling genes. Population × environment (G × E) interactions had widespread effects on the transcriptome where population × temperature interactions affected the expression of >5,000 orthologs, and there were >4,000 orthologs that showed temperature × host plant interactions. Adults exposed to 35°C had lower amounts of most cuticular hydrocarbons than those exposed to 15 or 25°C, including abundant unsaturated alkadienes. For insects adapted to different host plants and climatic regimes, our results suggest that temperature shifts associated with climate change have large and significant effects on transcriptomes of genetically differentiated natural populations.

  11. Simvastatin induces mitochondrial dysfunction and increased atrogin-1 expression in H9c2 cardiomyocytes and mice in vivo.

    PubMed

    Bonifacio, Annalisa; Mullen, Peter J; Mityko, Ileana Scurtu; Navegantes, Luiz C; Bouitbir, Jamal; Krähenbühl, Stephan

    2016-01-01

    Simvastatin is effective and well tolerated, with adverse reactions mainly affecting skeletal muscle. Important mechanisms for skeletal muscle toxicity include mitochondrial impairment and increased expression of atrogin-1. The aim was to study the mechanisms of toxicity of simvastatin on H9c2 cells (a rodent cardiomyocyte cell line) and on the heart of male C57BL/6 mice. After, exposure to 10 μmol/L simvastatin for 24 h, H9c2 cells showed impaired oxygen consumption, a reduction in the mitochondrial membrane potential and a decreased activity of several enzyme complexes of the mitochondrial electron transport chain (ETC). The cellular ATP level was also decreased, which was associated with phosphorylation of AMPK, dephosphorylation and nuclear translocation of FoxO3a as well as increased mRNA expression of atrogin-1. Markers of apoptosis were increased in simvastatin-treated H9c2 cells. Treatment of mice with 5 mg/kg/day simvastatin for 21 days was associated with a 5 % drop in heart weight as well as impaired activity of several enzyme complexes of the ETC and increased mRNA expression of atrogin-1 and of markers of apoptosis in cardiac tissue. Cardiomyocytes exposed to simvastatin in vitro or in vivo sustain mitochondrial damage, which causes AMPK activation, dephosphorylation and nuclear transformation of FoxO3a as well as increased expression of atrogin-1. Mitochondrial damage and increased atrogin-1 expression are associated with apoptosis and increased protein breakdown, which may cause myocardial atrophy.

  12. Epigenetic regulation of human buccal mucosa mitochondrial superoxide dismutase gene expression by diet.

    PubMed

    Thaler, Roman; Karlic, Heidrun; Rust, Petra; Haslberger, Alexander G

    2009-03-01

    The impact of nutrition on the epigenetic machinery has increasingly attracted interest. The aim of the present study was to demonstrate the effects of various diets on methylation and gene expression. The antioxidative enzyme mitochondrial superoxide dismutase (MnSOD) was chosen as the model system because epigenetic regulation has been previously shown in cell lines for this gene. Promoter methylation and gene expression of MnSOD in buccal swabs from three sample groups were analysed. The three groups included: (1) forty vegetarians (aged 20-30 years); (2) age-matched omnivores; (3) elderly omnivores (aged>85 years). A 3-fold increase in the expression of the MnSOD gene was associated with decreased CpG methylation of the analysed promoter region in the vegetarian group compared with the age-matched omnivores group. Expression and promoter methylation of the MnSOD gene in elderly omnivores showed no significant differences compared with younger omnivores. In accordance with previous findings in various tissues, DNA global methylation was found to be significantly higher (30 %) in buccal swabs of younger subjects (independent of the diet), than in those of elderly omnivores. In the control experiment which was designed to verify the findings of the human buccal swab studies, the Caco-2 cell line was treated with zebularine. Results of the control study showed a 6-fold increase of MnSOD expression, an approximately 40 % decreased methylation of specified CpG in the MnSOD promoter and a 50 % reduction of global DNA methylation. These results indicate that diet affects the epigenetic regulation of human MnSOD.

  13. Differential expression of GATA-3 in urothelial carcinoma variants.

    PubMed

    Liang, Yu; Heitzman, Joseph; Kamat, Ashish M; Dinney, Colin P; Czerniak, Bogdan; Guo, Charles C

    2014-07-01

    GATA binding protein 3 (GATA-3) is a novel immunohistochemical marker for urothelial carcinoma (UC); however, few studies have investigated GATA-3's role as a marker for UC variants. We used immunohistochemistry to assess GATA-3 expression in different UC variants, including micropapillary (n = 46), sarcomatoid (n = 43), small cell carcinoma (n = 22), and plasmacytoid (n = 16) variants, and we also compared GATA-3 expression in conventional bladder UC (n = 103) to that in squamous cell carcinoma (n = 14). GATA-3 expression was present in 70% (72/103) of conventional bladder UCs and highly concordant between matched primary and metastatic UCs. The GATA-3 expression levels of the micropapillary variants (57%; 26/46) and plasmacytoid variants (44%; 7/16) were not significantly different from that of conventional UC. However, the GATA-3 expression levels of the sarcomatoid variants (16%; 7/43) and small cell carcinoma variants (5%; 1/22), which only weakly expressed the protein, were significantly lower than that of conventional UC (P < .001). Only 7% of squamous cell carcinomas (1/14) expressed GATA-3, and it was also significantly lower than that of conventional UC (P < .001). GATA-3 expression was not significantly associated with tumor stage or patients' clinical outcomes. In conclusion, GATA-3 expression differed among UC variants. GATA-3 is a useful marker for confirming the urothelial origin of micropapillary and plasmacytoid UC variants but not that of sarcomatoid or small cell carcinoma variants. GATA-3 can also be used in differentiating UC from squamous cell carcinoma.

  14. Expression of T cell antigen receptor during differentiation

    SciTech Connect

    Allison, J.P.; Lanier, L.L.; Guyden, J.; Richie, E.R.

    1986-03-01

    The authors have used flow cytometry with monoclonal antibodies, radioimmuneprecipitation with a rabbit antiserum to common epitopes of the TCR, and Northern and Southern blot analysis with cloned TCR genes to study antigen receptor (TCR) expression by normal murine and human thymocytes and by primary murine thymomas. L3T4-,Lyt2- murine thymomas corresponding to the earliest stage of thymic differentiation, were found to have rearranged TCR beta genes, and to express low levels of beta transcript, but lacked alpha gene transcript and failed to express TCR on the cell surface. L3T4+,Lyt2+ thymomas were variable, but the majority were found to contain significant levels of both alpha and beta transcripts and to express TCR at the cell surface. Similarly, alpha and beta transcripts and TCR protein were detected in sorted L3T4+,Lyt2+ murine thymocytes. Using three color fluorescence, the authors determined that app. 70% of human T4+T8+ thymocytes also expressed T3, a component of the TCR complex. These data indicate that in mouse and man expression of TCR occurs in the immature, or cortical, thymic population.

  15. Neuronal expression of pathological tau accelerates oligodendrocyte progenitor cell differentiation

    PubMed Central

    Ossola, Bernardino; Zhao, Chao; Compston, Alastair; Pluchino, Stefano; Franklin, Robin J. M.

    2015-01-01

    Oligodendrocyte progenitor cell (OPC) differentiation is an important therapeutic target to promote remyelination in multiple sclerosis (MS). We previously reported hyperphosphorylated and aggregated microtubule‐associated protein tau in MS lesions, suggesting its involvement in axonal degeneration. However, the influence of pathological tau‐induced axonal damage on the potential for remyelination is unknown. Therefore, we investigated OPC differentiation in human P301S tau (P301S‐htau) transgenic mice, both in vitro and in vivo following focal demyelination. In 2‐month‐old P301S‐htau mice, which show hyperphosphorylated tau in neurons, we found atrophic axons in the spinal cord in the absence of prominent axonal degeneration. These signs of early axonal damage were associated with microgliosis and an upregulation of IL‐1β and TNFα. Following in vivo focal white matter demyelination we found that OPCs differentiated more efficiently in P301S‐htau mice than wild type (Wt) mice. We also found an increased level of myelin basic protein within the lesions, which however did not translate into increased remyelination due to higher susceptibility of P301S‐htau axons to demyelination‐induced degeneration compared to Wt axons. In vitro experiments confirmed higher differentiation capacity of OPCs from P301S‐htau mice compared with Wt mice‐derived OPCs. Because the OPCs from P301S‐htau mice do not ectopically express the transgene, and when isolated from newborn mice behave like Wt mice‐derived OPCs, we infer that their enhanced differentiation capacity must have been acquired through microenvironmental priming. Our data suggest the intriguing concept that damaged axons may signal to OPCs and promote their differentiation in the attempt at rescue by remyelination. GLIA 2016;64:457–471 PMID:26576485

  16. Cytochrome c oxidase is regulated by modulations in protein expression and mitochondrial membrane phospholipid composition in estivating African lungfish.

    PubMed

    Frick, N T; Bystriansky, J S; Ip, Y K; Chew, S F; Ballantyne, J S

    2010-03-01

    We examined some of the potential mechanisms lungfish (Protopterus dolloi) use to regulate cytochrome c oxidase (CCO), during metabolic depression. CCO activity was reduced by 67% in isolated liver mitochondria of estivating fish. This was likely accomplished, in part, by the 46% reduction in CCO subunit I protein expression in the liver. No change in the mRNA expression levels of CCO subunits I, II, III, and IV were found in the liver, suggesting CCO is under translational regulation; however, in the kidney, messenger limitation may be a factor as the expression of subunits I and II were depressed ( approximately 10-fold) during estivation, suggesting tissue-specific mechanisms of regulation. CCO is influenced by mitochondrial membrane phospholipids, particularly cardiolipin (CL). In P. dolloi, the phospholipid composition of the liver mitochondrial membrane changed during estivation, with a approximately 2.3-fold reduction in the amount of CL. Significant positive correlations were found between CCO activity and the amount of CL and phosphatidylethanolamine within the mitochondrial membrane. It appears CCO activity is regulated through multiple mechanisms in P. dolloi, and individual subunits of CCO are regulated independently, and in a tissue-specific manner. It is proposed that altering the amount of CL within the mitochondrial membrane may be a means of regulating CCO activity during metabolical depression in the African lungfish, P. dolloi.

  17. Aging-dependent alterations in gene expression and a mitochondrial signature of responsiveness to human influenza vaccination.

    PubMed

    Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C

    2015-01-01

    To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.

  18. Gene expression of key regulators of mitochondrial biogenesis is sex dependent in mice with growth hormone receptor deletion in liver

    PubMed Central

    Zawada, Ilona; Masternak, Michal M.; List, Edward O.; Stout, Michael B.; Berryman, Darlene E.; Lewinski, Andrzej; Kopchick, John J.; Bartke, Andrzej; Karbownik-Lewinska, Malgorzata; Gesing, Adam

    2015-01-01

    Mitochondrial biogenesis is an essential process for cell viability. Mice with disruption of the growth hormone receptor (GHR) gene (Ghr gene) in the liver (LiGHRKO), in contrast to long-lived mice with global deletion of the Ghr gene (GHRKO), are characterized by lack of improved insulin sensitivity and severe hepatic steatosis. Tissue-specific disruption of the GHR in liver results in a mouse model with dramatically altered GH/IGF1 axis. We have previously shown increased levels of key regulators of mitochondrial biogenesis in insulin-sensitive GHRKO mice. The aim of the present study is to assess, using real-time PCR, the gene expression of key regulators of mitochondrial biogenesis (Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2) and a marker of mitochondrial activity (CoxIV) in brains, kidneys and livers of male and female LiGHRKO and wild-type (WT) mice. There were significant differences between males and females. In the brain, expression of Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2 was lower in pooled females compared to pooled males. In the kidneys, expression of Ampk and Sirt1 was also lower in female mice. In the liver, no differences between males and females were observed. Sexual dimorphism may play an important role in regulating the biogenesis of mitochondria. PMID:25855408

  19. Gene expression of key regulators of mitochondrial biogenesis is sex dependent in mice with growth hormone receptor deletion in liver.

    PubMed

    Zawada, Ilona; Masternak, Michal M; List, Edward O; Stout, Michael B; Berryman, Darlene E; Lewinski, Andrzej; Kopchick, John J; Bartke, Andrzej; Karbownik-Lewinska, Malgorzata; Gesing, Adam

    2015-03-01

    Mitochondrial biogenesis is an essential process for cell viability. Mice with disruption of the growth hormone receptor (GHR) gene (Ghr gene) in the liver (LiGHRKO), in contrast to long-lived mice with global deletion of the Ghr gene (GHRKO), are characterized by lack of improved insulin sensitivity and severe hepatic steatosis. Tissue-specific disruption of the GHR in liver results in a mouse model with dramatically altered GH/IGF1 axis. We have previously shown increased levels of key regulators of mitochondrial biogenesis in insulin-sensitive GHRKO mice. The aim of the present study is to assess, using real-time PCR, the gene expression of key regulators of mitochondrial biogenesis (Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2) and a marker of mitochondrial activity (CoxIV) in brains, kidneys and livers of male and female LiGHRKO and wild-type (WT) mice. There were significant differences between males and females. In the brain, expression of Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2 was lower in pooled females compared to pooled males. In the kidneys, expression of Ampk and Sirt1 was also lower in female mice. In the liver, no differences between males and females were observed. Sexual dimorphism may play an important role in regulating the biogenesis of mitochondria.

  20. Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

    PubMed Central

    Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  1. Differential nuclear and mitochondrial DNA preservation in post-mortem teeth with implications for forensic and ancient DNA studies.

    PubMed

    Higgins, Denice; Rohrlach, Adam B; Kaidonis, John; Townsend, Grant; Austin, Jeremy J

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Furthermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  2. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  3. Molecular differentiation of Central European blowfly species (Diptera, Calliphoridae) using mitochondrial and nuclear genetic markers.

    PubMed

    GilArriortua, Maite; Saloña Bordas, Marta I; Köhnemann, Stephan; Pfeiffer, Heidi; de Pancorbo, Marian M

    2014-09-01

    A challenging step in medical, veterinary and forensic entomology casework is the rapid and accurate identification of insects to estimate the period of insect activity (PIA), which usually approximates the post-mortem interval (PMI). The morphological identification of insect evidence is hampered by species similarities, especially at the early larval stages. However, DNA-based species identification is more accurate and reliable. In this study, we improved the suitability and efficacy of the standard mitochondrial cytochrome c oxidase subunit I (COI) barcode region of 658 bp combined with an additional region of 616 bp of the same gene. We also tested the usefulness of other mitochondrial and nuclear loci, such as the non-coding region included in mitochondrial Cyt-b-tRNA(ser)-ND1 (495-496 bp) and the second internal transcribed spacer (ITS2) region of nuclear ribosomal DNA (rDNA) (310-337 bp). We classified a total of 54 specimens from five blowfly species belonging to three Calliphoridae genera commonly found in Central Europe: Phormia (P. regina), Calliphora (C. vicina) and Lucilia (L. sericata, L. ampullacea and L. caesar). Additionally included were the Cyt-b (307 bp) sequences for P. regina species and GenBank recorded information about the studied loci for select species. The results revealed the robustness of COI (616 bp) and ITS2 (310-337 bp) as diagnostic tools to be added to the widely established COI barcode (658 bp). Their higher discriminatory power allows for more precise and reliable identifications, even within more complex genera (Lucilia). This work also contributes new nucleotide sequences that are useful for accurate species diagnosis and new sequence data of Calliphoridae interspecific variability in the European Westphalia region (Germany).

  4. Differential susceptibility of mitochondrial complex II to inhibition by oxaloacetate in brain and heart.

    PubMed

    Stepanova, Anna; Shurubor, Yevgeniya; Valsecchi, Federica; Manfredi, Giovanni; Galkin, Alexander

    2016-09-01

    Mitochondrial Complex II is a key mitochondrial enzyme connecting the tricarboxylic acid (TCA) cycle and the electron transport chain. Studies of complex II are clinically important since new roles for this enzyme have recently emerged in cell signalling, cancer biology, immune response and neurodegeneration. Oxaloacetate (OAA) is an intermediate of the TCA cycle and at the same time is an inhibitor of complex II with high affinity (Kd~10(-8)M). Whether or not OAA inhibition of complex II is a physiologically relevant process is a significant, but still controversial topic. We found that complex II from mouse heart and brain tissue has similar affinity to OAA and that only a fraction of the enzyme in isolated mitochondrial membranes (30.2±6.0% and 56.4±5.6% in the heart and brain, respectively) is in the free, active form. Since OAA could bind to complex II during isolation, we established a novel approach to deplete OAA in the homogenates at the early stages of isolation. In heart, this treatment significantly increased the fraction of free enzyme, indicating that OAA binds to complex II during isolation. In brain the OAA-depleting system did not significantly change the amount of free enzyme, indicating that a large fraction of complex II is already in the OAA-bound inactive form. Furthermore, short-term ischemia resulted in a dramatic decline of OAA in tissues, but it did not change the amount of free complex II. Our data show that in brain OAA is an endogenous effector of complex II, potentially capable of modulating the activity of the enzyme.

  5. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  6. Sequence and expression variations in 23 genes involved in mitochondrial and non-mitochondrial apoptotic pathways and risk of oral leukoplakia and cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Singh, Richa; Mondal, Pinaki; Basu, Analabha; De Sarkar, Navonil; Majumder, Mousumi; Maiti, Guruparasad; Baral, Aradhita; Jha, Ganga Nath; Mukhopadhyay, Indranil; Panda, Chinmay; Chowdhury, Shantanu; Ghosh, Saurabh; Roychoudhury, Susanta; Roy, Bidyut

    2015-11-01

    Oral cancer is usually preceded by pre-cancerous lesion and related to tobacco abuse. Tobacco carcinogens damage DNA and cells harboring such damaged DNA normally undergo apoptotic death, but cancer cells are exceptionally resistant to apoptosis. Here we studied association between sequence and expression variations in apoptotic pathway genes and risk of oral cancer and precancer. Ninety nine tag SNPs in 23 genes, involved in mitochondrial and non-mitochondrial apoptotic pathways, were genotyped in 525 cancer and 253 leukoplakia patients and 538 healthy controls using Illumina Golden Gate assay. Six SNPs (rs1473418 at BCL2; rs1950252 at BCL2L2; rs8190315 at BID; rs511044 at CASP1; rs2227310 at CASP7 and rs13010627 at CASP10) significantly modified risk of oral cancer but SNPs only at BCL2, CASP1and CASP10 modulated risk of leukoplakia. Combination of SNPs showed a steep increase in risk of cancer with increase in "effective" number of risk alleles. In silico analysis of published data set and our unpublished RNAseq data suggest that change in expression of BID and CASP7 may have affected risk of cancer. In conclusion, three SNPs, rs1473418 in BCL2, rs1950252 in BCL2L2 and rs511044 in CASP1, are being implicated for the first time in oral cancer. Since SNPs at BCL2, CASP1 and CASP10 modulated risk of both leukoplakia and cancer, so, they should be studied in more details for possible biomarkers in transition of leukoplakia to cancer. This study also implies importance of mitochondrial apoptotic pathway gene (such as BCL2) in progression of leukoplakia to oral cancer.

  7. The Infertility of Repeat-Breeder Cows During Summer Is Associated with Decreased Mitochondrial DNA and Increased Expression of Mitochondrial and Apoptotic Genes in Oocytes.

    PubMed

    Ferreira, Roberta Machado; Chiaratti, Marcos Roberto; Macabelli, Carolina Habermann; Rodrigues, Carlos Alberto; Ferraz, Márcio Leão; Watanabe, Yeda Fumie; Smith, Lawrence Charles; Meirelles, Flávio Vieira; Baruselli, Pietro Sampaio

    2016-03-01

    Oocyte quality is known to be a major cause of infertility in repeat-breeder (RB) and heat-stressed dairy cows. However, the mechanisms by which RB oocytes become less capable of supporting embryo development remain largely unknown. Thus, the aim of this study was to investigate whether the decreased oocyte competence of RB cows (RBs) during summer is associated with an altered gene expression profile and a decrease in mitochondrial DNA (mtDNA) copy number. Therefore, oocytes collected from heifers, non-RBs in peak lactation (PLs), and RBs were used to evaluate mtDNA amounts as well as the expression levels of genes associated with the mitochondria (MT-CO1, NRF1, POLG, POLG2, PPARGC1A, and TFAM), apoptosis (BAX, BCL2, and ITM2B), and oocyte maturation (BMP15, FGF8, FGF10, FGF16, FGF17, and GDF9). The oocytes retrieved from RBs during winter contained over eight times more mtDNA than those retrieved from RBs during summer. They also contained significantly less mtDNA than oocytes retrieved from heifers and PLs during summer. Moreover, the expression of mitochondria- (NRF1, POLG, POLG2, PPARGC1A, and TFAM) and apoptosis-related (BAX and ITM2B) genes, as well as of GDF9, in RB oocytes collected during summer was significantly greater than that in oocytes collected from heifers and PLs during the same season. In oocytes from heifers and PLs, the expression levels of these genes were lower in those collected during summer compared with winter, but this difference was not observed in oocytes collected from RBs. Altogether, these data provide evidence of altered gene expression and reduced mtDNA copy number in the oocytes collected from RBs during summer. This indicates a loss of fertility in RBs during summer, which might be caused by a possible mitochondrial dysfunction associated with a greater chance of oocytes to undergo apoptosis.

  8. Altered Expression of Human Mitochondrial Branched Chain Aminotransferase in Dementia with Lewy Bodies and Vascular Dementia.

    PubMed

    Ashby, Emma L; Kierzkowska, Marta; Hull, Jonathon; Kehoe, Patrick G; Hutson, Susan M; Conway, Myra E

    2017-01-01

    Cytosolic and mitochondrial human branched chain aminotransferase (hBCATc and hBCATm, respectively) play an integral role in brain glutamate metabolism. Regional increased levels of hBCATc in the CA1 and CA4 region of Alzheimer's disease (AD) brain together with increased levels of hBCATm in frontal and temporal cortex of AD brains, suggest a role for these proteins in glutamate excitotoxicity. Glutamate toxicity is a key pathogenic feature of several neurological disorders including epilepsy associated dementia, AD, vascular dementia (VaD) and dementia with Lewy bodies (DLB). To further understand if these increases are specific to AD, the expression profiles of hBCATc and hBCATm were examined in other forms of dementia including DLB and VaD. Similar to AD, levels of hBCATm were significantly increased in the frontal and temporal cortex of VaD cases and in frontal cortex of DLB cases compared to controls, however there were no observed differences in hBCATc between groups in these areas. Moreover, multiple forms of hBCATm were observed that were particular to the disease state relative to matched controls. Real-time PCR revealed similar expression of hBCATm mRNA in frontal and temporal cortex for all cohort comparisons, whereas hBCATc mRNA expression was significantly increased in VaD cases compared to controls. Collectively our results suggest that hBCATm protein expression is significantly increased in the brains of DLB and VaD cases, similar to those reported in AD brain. These findings indicate a more global response to altered glutamate metabolism and suggest common metabolic responses that might reflect shared neurodegenerative mechanisms across several forms of dementia.

  9. Mitochondrial electron transport regulation of nuclear gene expression. Studies with the alternative oxidase gene of tobacco.

    PubMed Central

    Vanlerberghe, G C; McIntosh, L

    1994-01-01

    We have isolated a cDNA representing the tobacco (Nicotiana tabacum L. cv Bright Yellow) nuclear gene Aox1, which encodes the alternative oxidase of plant mitochondria. The clone contains the complete coding region (1059 base pairs) of a precursor protein of 353 amino acids with a calculated molecular mass of 39.8 kD. A putative transit peptide contains common signals believed to be important for import and processing of mitochondrially localized proteins. We have studied changes in Aox1 gene expression in tobacco in response to changes in cytochrome pathway activity. Inhibition of the cytochrome pathway by antimycin A resulted in a rapid and dramatic accumulation of Aox1 mRNA, whereas the level of mRNAs encoding two proteins of the cytochrome pathway did not change appreciably. This was accompanied by a dramatic increase in alternative pathway capacity and engagement in whole cells. Respiration under these conditions was unaffected by the uncoupler p-trifluoromethoxycarbonylcyanide (FCCP). When inhibition of the cytochrome pathway was relieved, levels of Aox1 mRNA returned to control levels, alternative pathway capacity and engagement declined, and respiration could once again be stimulated by FCCP. The results show that a mechanism involving changes in Aox1 gene expression exists whereby the capacity of the alternative pathway can be adjusted in response to changes in the activity of the cytochrome pathway. PMID:8058837

  10. Structure and expression of mouse mitochondrial voltage dependent anion channel genes

    SciTech Connect

    Craigen, W.J.; Lovell, R.S.; Sampson, M.J.

    1994-09-01

    Voltage dependent anion channels (VDACs) are small abundant proteins of the outer mitochondrial membrane that interact with the adenine nucleotide translocater and bind glycerol kinase and hexokinase. Kinase binding is developmentally regulated, tissue specific, and increased in various tumor cell lines. VDACs are also components of the peripheral benzodiazepine receptor and GABA{sub A} receptor. Two human VDAC cDNAs have previously been reported, and expression of these isoforms appears ubiquitous. Genomic Southern analysis suggests the presence of other as yet uncharacterised VDAC genes. To study VDAC function in a mammal more amenable to experimental manipulation, we have isolated three mouse VDAC genes by cDNA cloning from a mouse brain cDNA library. DNA sequencing of the cDNAs shows that they share 65-75% amino acid identity. Northern analysis indicates that MVDAC1 is expressed most highly in kidney, heart, and brain. Using an MVDAC3 3{prime} untranslated exon as a probe, three distinct transcripts can be detected. The gene structure for MVDAC3 and MVDAC2 has been completed and suggests that the VDAC isoforms did not arise by gene duplication and divergence. The intron/exon boundaries are not conserved between MVDAC1 and MVDAC3, and MVDAC2 appears to be encoded by a single intronless gene.

  11. Microarray data analysis for differential expression: a tutorial.

    PubMed

    Suárez, Erick; Burguete, Ana; Mclachlan, Geoffrey J

    2009-06-01

    DNA microarray is a technology that simultaneously evaluates quantitative measurements for the expression of thousands of genes. DNA microarrays have been used to assess gene expression between groups of cells of different organs or different populations. In order to understand the role and function of the genes, one needs the complete information about their mRNA transcripts and proteins. Unfortunately, exploring the protein functions is very difficult, due to their unique 3-dimentional complicated structure. To overcome this difficulty, one may concentrate on the mRNA molecules produced by the gene expression. In this paper, we describe some of the methods for preprocessing data for gene expression and for pairwise comparison from genomic experiments. Previous studies to assess the efficiency of different methods for pairwise comparisons have found little agreement in the lists of significant genes. Finally, we describe the procedures to control false discovery rates, sample size approach for these experiments, and available software for microarray data analysis. This paper is written for those professionals who are new in microarray data analysis for differential expression and want to have an overview of the specific steps or the different approaches for this sort of analysis.

  12. Expression of Transthyretin during bovine myogenic satellite cell differentiation.

    PubMed

    Pokharel, Smritee; Kamli, Majid Rasool; Mir, Bilal Ahmad; Malik, Adeel; Lee, Eun Ju; Choi, Inho

    2014-09-01

    Adult myogenesis responsible for the maintenance and repair of muscle tissue is mainly under the control of myogenic regulatory factors (MRFs) and a few other genes. Transthyretin gene (TTR), codes for a carrier protein for thyroxin (T4) and retinol binding protein bound with retinol in blood plasma, plays a critical role during the early stages of myogenesis. Herein, we investigated the relationship of TTR with other muscle-specific genes and report their expression in muscle satellite cells (MSCs), and increased messenger RNA (mRNA) and protein expression of TTR during MSCs differentiation. Silencing of TTR resulted in decreased myotube formation and decreased expression of myosin light chain (MYL2), myosin heavy chain 3 (MYH3), matrix gla protein (MGP), and voltage-dependent L type calcium channel (Cav1.1) genes. Increased mRNA expression observed in TTR and other myogenic genes with the addition of T4 decreased significantly following TTR knockdown, indicating the critical role of TTR in T4 transportation. Similarly, decreased expression of MGP and Cav1.1 following TTR knockdown signifies the dual role of TTR in controlling muscle myogenesis via regulation of T4 and calcium channel. Our computational and experimental evidences indicate that TTR has a relationship with MRFs and may act on calcium channel and related genes.

  13. Differential expression of angiogenic factors in peripheral nerve sheath tumors.

    PubMed

    Wasa, Junji; Nishida, Yoshihiro; Suzuki, Yoshitaka; Tsukushi, Satoshi; Shido, Yoji; Hosono, Kozo; Shimoyama, Yoshie; Nakamura, Shigeo; Ishiguro, Naoki

    2008-01-01

    It is difficult to differentiate some malignant peripheral nerve sheath tumors (MPNST) from benign peripheral nerve sheath tumors (BPNST) histologically, and to predict the clinical outcome of patients with MPNST. In this study, the expression of VEGF and MVD were evaluated immunohistochemically in 22 cases of MPNST, 14 of neurofibroma and 19 of schwannoma and correlation of the staining grade of VEGF or MVD and the various clinical factors were analyzed, and statistically evaluated. Levels of VEGF mRNA expression were also determined with real-time RT-PCR. Statistically higher positive staining for VEGF was observed in MPNST compared to neurofibroma (P=0.004) and schwannoma (P<0.001). Even low grade MPNST showed higher VEGF positive staining than neurofibroma. Moreover, high VEGF expression statistically correlated with the poor prognosis of the patients with MPNST (P=0.015). Although MVD in MPNST was significantly higher than that in neurofibroma (P=0.038) and schwannoma (P<0.001), MVD could not predict the prognosis of the patients with MPNST. Although VEGF mRNA expression tended to be higher in MPNST compared to neurofibroma, the difference was not significant. Levels of VEGF protein expression serve as a novel diagnostic and prognostic tools for peripheral nerve sheath tumors.

  14. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  15. Enhancing Mitochondrial Respiration Suppresses Tumor Promoter TPA-Induced PKM2 Expression and Cell Transformation in Skin Epidermal JB6 Cells

    PubMed Central

    Wittwer, Jennifer A.; Robbins, Delira; Wang, Fei; Codarin, Sarah; Shen, Xinggui; Kevil, Christopher G.; Huang, Ting-Ting; Van Remmen, Holly; Richardson, Arlan; Zhao, Yunfeng

    2016-01-01

    Differentiated cells primarily metabolize glucose for energy via the tricarboxylic acid cycle and oxidative phosphorylation, but cancer cells thrive on a different mechanism to produce energy, characterized as the Warburg effect, which describes the increased dependence on aerobic glycolysis. The M2 isoform of pyruvate kinase (PKM2), which is responsible for catalyzing the final step of aerobic glycolysis, is highly expressed in cancer cells and may contribute to the Warburg effect. However, whether PKM2 plays a contributing role during early cancer development is unclear. In our studies, we have made an attempt to elucidate the effects of varying mitochondrial respiration substrates on skin cell transformation and expression of PKM2. Tumorigenicity in murine skin epidermal JB6 P+ (promotable) cells was measured in a soft agar assay using 12-O-tetradecanoylphorbol-13-acetate (TPA) as a tumor promoter. We observed a significant reduction in cell transformation upon pretreatment with the mitochondrial respiration substrate succinate or malate/pyruvate. We observed that increased expression and activity of PKM2 in TPA-treated JB6 P+ cells and pretreatment with succinate or malate/pyruvate suppressed the effects. In addition, TPA treatment also induced PKM2 whereas PKM1 expression was suppressed in mouse skin epidermal tissues in vivo. In comparison with JB6 P+ cells, the nonpromotable JB6 P− cells showed no increase in PKM2 expression or activity upon TPA treatment. Knockdown of PKM2 using a siRNA approach significantly reduced skin cell transformation. Thus, our results suggest that PKM2 activation could be an early event and play a contributing role in skin tumorigenesis. PMID:21673231

  16. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  17. Mitochondrial biogenesis: pharmacological approaches.

    PubMed

    Valero, Teresa

    2014-01-01

    neurodevelopmental disorders. In the context of neural differentiation, Martine Uittenbogaard and Anne Chiaramello (Department of Anatomy and Regenerative Biology, George Washington University School of Medicine and Health Sciences, USA) [7] thoroughly describe the implication of mitochondrial biogenesis on neuronal differentiation, its timing, its regulation by specific signaling pathways and new potential therapeutic strategies. The maintenance of mitochondrial homeostasis is crucial for neuronal development. A mitochondrial dynamic balance is necessary between mitochondrial fusion, fission and quality control systems and mitochondrial biogenesis. Concerning the signaling pathways leading to mitochondrial biogenesis this review highlights the implication of different regulators such as AMPK, SIRT1, PGC-1α, NRF1, NRF2, Tfam, etc. on the specific case of neuronal development, providing examples of diseases in which these pathways are altered and transgenic mouse models lacking these regulators. A common hallmark of several neurodegenerative diseases (Huntington´s Disease, Alzheimer´s Disease and Parkinson´s Disease) is the impaired function or expression of PGC-1α, the master regulator of mitochondrial biogenesis. Among the promising strategies to ameliorate mitochondrial-based diseases these authors highlight the induction of PGC-1α via activation of PPAR receptors (rosiglitazone, bezafibrate) or modulating its activity by AMPK (AICAR, metformin, resveratrol) or SIRT1 (SRT1720 and several isoflavone-derived compounds). This article also presents a review of the current animal and cellular models useful to study mitochondriogenesis. Although it is known that many neurodegenerative and neurodevelopmental diseases are originated in mitochondria, the regulation of mitochondrial biogenesis has never been extensively studied. (ABSTRACT TRUNCATED)

  18. Mitochondrial DNA differentiation among geographical populations of Pronolagus rupestris, Smith's red rock rabbit (Mammalia: Lagomorpha).

    PubMed

    Matthee, C A; Robinson, T J

    1996-05-01

    Geographical genetic population structure was determined for an endemic African leporid, Smith's red rock rabbit, Pronolagus rupestris. Restriction fragment length polymorphism analysis of mitochondrial DNA from 55 specimens revealed 32 distinct material lineages for the population sampled. The data show two major genetic assemblages separated by a mean sequence divergence of 7.94 per cent (+/- 1.40 per cent) and provide little support for the continued recognition of most of the described subspecies. The south-eastern assemblage is confined to the mountain ranges comprising the Great Escarpment of South Africa, while the north-western assemblage is not so tightly constrained. With the possible exception of elevation, no readily apparent ecological or topographical barrier could be identified which delimits the two mitochondrial clades. The sequence divergence separating the south-eastern and north western P. rupestris clades is high, and approximates the interspecific sequence divergences detected between P. rupestris and other Pronolagus species. The two P. rupestris clades are parapatric for part of their distribution, and the absence of shared mtDNA lineages is consistent with the hypothesis that the two populations are reproductively isolated from each other. We provisionally interpret this to reflect the presence of two hitherto undetected biological species in what has conventionally been recognized as a single taxon, P. rupestris.

  19. Mitochondrial Genetic Differentiation of Spirlin (Actinopterigii: Cyprinidae) in the South Caspian Sea basin of Iran

    PubMed Central

    Seifali, Mahvash; Arshad, Aziz; Moghaddam, Faezeh Yazdani; Esmaeili, Hamid Reza; Kiabi, Bahram H.; Daud, Siti Khalijah; Aliabadian, Mansour

    2012-01-01

    Background Knowledge about Alburnoides remains lacking relative to many other species, resulting in a lack of a systematic position and taxonomic diagnosis. Basic biological information for Alburnoides has been constructed, and it is necessary to understand further and obtain more information about this species. Its phylogenetic relationships are still debated and no molecular data have been used to study this taxon in Iran. A holistic approach for genetic methods was adopted to analyze possible spirlin population differences at selected centers in the south Caspian Sea basin of Iran. Methods The phylogenetic relationships were determined based on 774 base pairs of the mitochondrial cytochrome b gene of 32 specimens of spirlin from nine locations in the south Caspian Sea drainage basin of Iran. The nucleotide sequences were subjected to phylogenetic analysis using the neighbor-joining, maximum parsimony, maximum likelihood, and Bayesian methods. Results The mitochondrial gene tree largely supports the existence of three major clades. The western populations (clade I) may be considered as Alburnoides eichwaldii, whereas the Talar river populations (clade II) are represented as Alburnoides sp.1 and the eastern populations (clade III) may be distinct taxa of Alburnoides sp.2. Conclusion This molecular evidence supports the hypothesis that A. bipunctatus does not exist in the south Caspian Sea basin of Iran, and that the western and eastern populations are distinct taxa. PMID:22654487

  20. Discovery of differentially expressed genes in cashmere goat (Capra hircus) hair follicles by RNA sequencing.

    PubMed

    Qiao, X; Wu, J H; Wu, R B; Su, R; Li, C; Zhang, Y J; Wang, R J; Zhao, Y H; Fan, Y X; Zhang, W G; Li, J Q

    2016-09-02

    The mammalian hair follicle (HF) is a unique, highly regenerative organ with a distinct developmental cycle. Cashmere goat (Capra hircus) HFs can be divided into two categories based on structure and development time: primary and secondary follicles. To identify differentially expressed genes (DEGs) in the primary and secondary HFs of cashmere goats, the RNA sequencing of six individuals from Arbas, Inner Mongolia, was performed. A total of 617 DEGs were identified; 297 were upregulated while 320 were downregulated. Gene ontology analysis revealed that the main functions of the upregulated genes were electron transport, respiratory electron transport, mitochondrial electron transport, and gene expression. The downregulated genes were mainly involved in cell autophagy, protein complexes, neutrophil aggregation, and bacterial fungal defense reactions. According to the Kyoto Encyclopedia of Genes and Genomes database, these genes are mainly involved in the metabolism of cysteine and methionine, RNA polymerization, and the MAPK signaling pathway, and were enriched in primary follicles. A microRNA-target network revealed that secondary follicles are involved in several important biological processes, such as the synthesis of keratin-associated proteins and enzymes involved in amino acid biosynthesis. In summary, these findings will increase our understanding of the complex molecular mechanisms of HF development and cycling, and provide a basis for the further study of the genes and functions of HF development.

  1. Expression of FADD and cFLIPL balances mitochondrial integrity and redox signaling to substantiate apoptotic cell death.

    PubMed

    Ranjan, Kishu; Pathak, Chandramani

    2016-11-01

    FADD and cFLIP both are pivotal components of death receptor signaling. The cellular signaling of apoptosis accomplished with death receptors and mitochondria follows independent pathways for cell death. FADD and cFLIP both have an important role in the regulation of apoptotic and non-apoptotic functions. Dysregulated expression of FADD and cFLIP is associated with resistance to apoptosis in cancer cells. Mitochondria are known to play critical role in maintaining cellular respiration and homeostasis in the cells as well as transduces various signals to determine the fate of cell death. However, involvement of FADD and cFLIP in regulation of mitochondrial integrity and programmed cell death signaling to define the fate of cells remains elusive. In the present study, we explored that, induced expression of FADD challenges the mitochondrial integrity and pulverizes the membrane potential by altering the expression of Bcl-2 and cytochrome c. In contrast, mutant of FADD was unable to affect the mitochondrial integrity. Interestingly, expression of FADD and cFLIP helps to balance redox potential by regulating the anti-oxidant levels. Further, we noticed that, knockdown of cFLIPL and induced expression of FADD rapidly accumulate intracellular ROS accompanied by JNK1 activation to substantiate apoptosis. Notably, the ectopic expression of cFLIPL resists the sensitivity of cancer cells against apoptosis inducers Etoposide and HA14-1. Altogether, our findings suggest that FADD and cFLIPL are important modulators of mitochondrial-associated apoptosis apart from the death receptor signaling.

  2. Mitochondrial STAT3 contributes to transformation of Barrett's epithelial cells that express oncogenic Ras in a p53-independent fashion.

    PubMed

    Yu, Chunhua; Huo, Xiaofang; Agoston, Agoston T; Zhang, Xi; Theiss, Arianne L; Cheng, Edaire; Zhang, Qiuyang; Zaika, Alexander; Pham, Thai H; Wang, David H; Lobie, Peter E; Odze, Robert D; Spechler, Stuart J; Souza, Rhonda F

    2015-08-01

    Metaplastic epithelial cells of Barrett's esophagus transformed by the combination of p53-knockdown and oncogenic Ras expression are known to activate signal transducer and activator of transcription 3 (STAT3). When phosphorylated at tyrosine 705 (Tyr705), STAT3 functions as a nuclear transcription factor that can contribute to oncogenesis. STAT3 phosphorylated at serine 727 (Ser727) localizes in mitochondria, but little is known about mitochondrial STAT3's contribution to carcinogenesis in Barrett's esophagus, which is the focus of this study. We introduced a constitutively active variant of human STAT3 (STAT3CA) into the following: 1) non-neoplastic Barrett's (BAR-T) cells; 2) BAR-T cells with p53 knockdown; and 3) BAR-T cells that express oncogenic H-Ras(G12V). STAT3CA transformed only the H-Ras(G12V)-expressing BAR-T cells (evidenced by loss of contact inhibition, formation of colonies in soft agar, and generation of tumors in immunodeficient mice), and did so in a p53-independent fashion. The transformed cells had elevated levels of both mitochondrial (Ser727) and nuclear (Tyr705) phospho-STAT3. Introduction of a STAT3CA construct with a mutated tyrosine phosphorylation site into H-Ras(G12V)-expressing Barrett's cells resulted in high levels of mitochondrial phospho-STAT3 (Ser727) with little or no nuclear phospho-STAT3 (Tyr705), and the cells still formed tumors in immunodeficient mice. Thus tyrosine phosphorylation of STAT3 is not required for tumor formation in Ras-expressing Barrett's cells. We conclude that mitochondrial STAT3 (Ser727) can contribute to oncogenesis in Barrett's cells that express oncogenic Ras. These findings suggest that agents targeting STAT3 might be useful for chemoprevention in patients with Barrett's esophagus.

  3. Transgenic expression of the deoxynucleotide carrier causes mitochondrial damage that is enhanced by NRTIs for AIDS.

    PubMed

    Lewis, William; Haase, Chad P; Miller, Yoon K; Ferguson, Brandy; Stuart, Tami; Ludaway, Tomika; McNaught, Jamie; Russ, Rodney; Steltzer, Jeffrey; Santoianni, Robert; Long, Robert; Fiermonte, Giuseppe; Palmieri, Ferdinando

    2005-08-01

    Nucleoside reverse transcriptase inhibitors (NRTIs) are antiretrovirals for AIDS with limiting mitochondrial side effects. The mitochondrial deoxynucleotide carrier (DNC) transports phosphorylated nucleosides for mitochondrial DNA replication and can transport phosphorylated NRTIs into mitochondria. Transgenic mice (TG) that exclusively overexpress DNC in the heart tested DNC's role in mitochondrial dysfunction from NRTIs. Two TG lines were created that overexpressed the human DNC gene in murine myocardium. Cardiac and mitochondrial structure and function were examined by magnetic resonance imaging, echocardiography, electrocardiography, transmission electron microscopy, and plasma lactate. Antiretroviral combinations (HAART) that contained NRTIs (stavudine (2', 3'-didehydro-2', 3'-deoxythymidine or d4T)/lamivudine/indinavir; or zidovudine (3' azido-3'-deoxythymidine or AZT)/lamivudine/indinavir; 35 days) were administered to simulate AIDS therapy. In parallel, a HAART combination without NRTIs (nevirapine/efavirenz/indinavir; 35 days) served as an NRTI-sparing, control regimen. Untreated DNC TGs exhibited normal cardiac function but abnormal mitochondrial ultrastructure. HAART that contained NRTIs caused cardiomyopathy in TGs with increased left ventricle mass and volume, heart rate variability, and worse mitochondrial ultrastructural defects. In contrast, treatment with an NRTI-sparing HAART regimen caused no cardiac changes. Data suggest the DNC is integral to mitochondrial homeostasis in vivo and may relate mechanistically to mitochondrial dysfunction in patients treated with HAART regimens that contain NRTIs.

  4. Mitochondrial maintenance failure in aging and role of sexual dimorphism

    PubMed Central

    Tower, John

    2014-01-01

    Gene expression changes during aging are partly conserved across species, and suggest that oxidative stress, inflammation and proteotoxicity result from mitochondrial malfunction and abnormal mitochondrial-nuclear signaling. Mitochondrial maintenance failure may result from trade-offs between mitochondrial turnover versus growth and reproduction, sexual antagonistic pleiotropy and genetic conflicts resulting from uni-parental mitochondrial transmission, as well as mitochondrial and nuclear mutations and loss of epigenetic regulation. Aging phenotypes and interventions are often sex-specific, indicating that both male and female sexual differentiation promote mitochondrial failure and aging. Studies in mammals and invertebrates implicate autophagy, apoptosis, AKT, PARP, p53 and FOXO in mediating sex-specific differences in stress resistance and aging. The data support a model where the genes Sxl in Drosophila, sdc-2 in C. elegans, and Xist in mammals regulate mitochondrial maintenance across generations and in aging. Several interventions that increase life span cause a mitochondrial unfolded protein response (UPRmt), and UPRmt is also observed during normal aging, indicating hormesis. The UPRmt may increase life span by stimulating mitochondrial turnover through autophagy, and/or by inhibiting the production of hormones and toxic metabolites. The data suggest that metazoan life span interventions may act through a common hormesis mechanism involving liver UPRmt, mitochondrial maintenance and sexual differentiation. PMID:25447815

  5. Mitochondrial maintenance failure in aging and role of sexual dimorphism.

    PubMed

    Tower, John

    2015-06-15

    Gene expression changes during aging are partly conserved across species, and suggest that oxidative stress, inflammation and proteotoxicity result from mitochondrial malfunction and abnormal mitochondrial-nuclear signaling. Mitochondrial maintenance failure may result from trade-offs between mitochondrial turnover versus growth and reproduction, sexual antagonistic pleiotropy and genetic conflicts resulting from uni-parental mitochondrial transmission, as well as mitochondrial and nuclear mutations and loss of epigenetic regulation. Aging phenotypes and interventions are often sex-specific, indicating that both male and female sexual differentiation promote mitochondrial failure and aging. Studies in mammals and invertebrates implicate autophagy, apoptosis, AKT, PARP, p53 and FOXO in mediating sex-specific differences in stress resistance and aging. The data support a model where the genes Sxl in Drosophila, sdc-2 in Caenorhabditis elegans, and Xist in mammals regulate mitochondrial maintenance across generations and in aging. Several interventions that increase life span cause a mitochondrial unfolded protein response (UPRmt), and UPRmt is also observed during normal aging, indicating hormesis. The UPRmt may increase life span by stimulating mitochondrial turnover through autophagy, and/or by inhibiting the production of hormones and toxic metabolites. The data suggest that metazoan life span interventions may act through a common hormesis mechanism involving liver UPRmt, mitochondrial maintenance and sexual differentiation.

  6. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  7. Mitochondrial calcium uniporter regulator 1 (MCUR1) regulates the calcium threshold for the mitochondrial permeability transition

    PubMed Central

    Artiga, Daniel J.; Abiria, Sunday A.; Clapham, David E.

    2016-01-01

    During the mitochondrial permeability transition, a large channel in the inner mitochondrial membrane opens, leading to the loss of multiple mitochondrial solutes and cell death. Key triggers include excessive reactive oxygen species and mitochondrial calcium overload, factors implicated in neuronal and cardiac pathophysiology. Examining the differential behavior of mitochondrial Ca2+ overload in Drosophila versus human cells allowed us to identify a gene, MCUR1, which, when expressed in Drosophila cells, conferred permeability transition sensitive to electrophoretic Ca2+ uptake. Conversely, inhibiting MCUR1 in mammalian cells increased the Ca2+ threshold for inducing permeability transition. The effect was specific to the permeability transition induced by Ca2+, and such resistance to overload translated into improved cell survival. Thus, MCUR1 expression regulates the Ca2+ threshold required for permeability transition. PMID:26976564

  8. Mitochondrial calcium uniporter regulator 1 (MCUR1) regulates the calcium threshold for the mitochondrial permeability transition.

    PubMed

    Chaudhuri, Dipayan; Artiga, Daniel J; Abiria, Sunday A; Clapham, David E

    2016-03-29

    During the mitochondrial permeability transition, a large channel in the inner mitochondrial membrane opens, leading to the loss of multiple mitochondrial solutes and cell death. Key triggers include excessive reactive oxygen species and mitochondrial calcium overload, factors implicated in neuronal and cardiac pathophysiology. Examining the differential behavior of mitochondrial Ca(2+) overload in Drosophila versus human cells allowed us to identify a gene, MCUR1, which, when expressed in Drosophila cells, conferred permeability transition sensitive to electrophoretic Ca(2+) uptake. Conversely, inhibiting MCUR1 in mammalian cells increased the Ca(2+) threshold for inducing permeability transition. The effect was specific to the permeability transition induced by Ca(2+), and such resistance to overload translated into improved cell survival. Thus, MCUR1 expression regulates the Ca(2+) threshold required for permeability transition.

  9. Metallothionein-I/II Knockout Mice Aggravate Mitochondrial Superoxide Production and Peroxiredoxin 3 Expression in Thyroid after Excessive Iodide Exposure

    PubMed Central

    Zhang, Na; Wang, Lingyan; Duan, Qi; Lin, Laixiang; Ahmed, Mohamed; Wang, Tingting; Yao, Xiaomei

    2015-01-01

    Purpose. We aim to figure out the effect of metallothioneins on iodide excess induced oxidative stress in the thyroid. Methods. Eight-week-old MT-I/II knockout (MT-I/II KO) mice and background-matched wild-type (WT) mice were used. Mitochondrial superoxide production and peroxiredoxin (Prx) 3 expression were measured. Results. In in vitro study, more significant increases in mitochondrial superoxide production and Prx 3 expression were detected in the MT-I/II KO groups. In in vivo study, significantly higher concentrations of urinary iodine level were detected in MT-I/II KO mice in 100 HI group. Compared to the NI group, there was no significant difference existing in serum thyroid hormones level in either groups (P > 0.05), while the mitochondrial superoxide production was significantly increased in 100 HI groups with significantly increased LDH activity and decreased relative cell viability. Compared to WT mice, more significant changes were detected in MT-I/II KO mice in 100 HI groups. No significant differences were detected between the NI group and 10 HI group in both the MT-I/II KO and WT mice groups (P > 0.05). Conclusions. Iodide excess in a thyroid without MT I/II protection may result in strong mitochondrial oxidative stress, which further leads to the damage of thyrocytes. PMID:26101557

  10. Estrogen-related receptor {alpha} is essential for the expression of antioxidant protection genes and mitochondrial function

    SciTech Connect

    Rangwala, Shamina M. . E-mail: shamina.rangwala@novartis.com; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.

    2007-05-25

    Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}. Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.

  11. Identification of the human mitochondrial S-adenosylmethionine transporter: bacterial expression, reconstitution, functional characterization and tissue distribution.

    PubMed Central

    Agrimi, G; Di Noia, M A; Marobbio, C M T; Fiermonte, G; Lasorsa, F M; Palmieri, F

    2004-01-01

    The mitochondrial carriers are a family of transport proteins that, with a few exceptions, are found in the inner membranes of mitochondria. They shuttle metabolites and cofactors through this membrane, and connect cytoplasmic functions with others in the matrix. SAM (S-adenosylmethionine) has to be transported into the mitochondria where it is converted into S-adenosylhomocysteine in methylation reactions of DNA, RNA and proteins. The transport of SAM has been investigated in rat liver mitochondria, but no protein has ever been associated with this activity. By using information derived from the phylogenetically distant yeast mitochondrial carrier for SAM and from related human expressed sequence tags, a human cDNA sequence was completed. This sequence was overexpressed in bacteria, and its product was purified, reconstituted into phospholipid vesicles and identified from its transport properties as the human mitochondrial SAM carrier (SAMC). Unlike the yeast orthologue, SAMC catalysed virtually only countertransport, exhibited a higher transport affinity for SAM and was strongly inhibited by tannic acid and Bromocresol Purple. SAMC was found to be expressed in all human tissues examined and was localized to the mitochondria. The physiological role of SAMC is probably to exchange cytosolic SAM for mitochondrial S-adenosylhomocysteine. This is the first report describing the identification and characterization of the human SAMC and its gene. PMID:14674884

  12. Learning regulatory programs that accurately predict differential expression with MEDUSA.

    PubMed

    Kundaje, Anshul; Lianoglou, Steve; Li, Xuejing; Quigley, David; Arias, Marta; Wiggins, Chris H; Zhang, Li; Leslie, Christina

    2007-12-01

    Inferring gene regulatory networks from high-throughput genomic data is one of the central problems in computational biology. In this paper, we describe a predictive modeling approach for studying regulatory networks, based on a machine learning algorithm called MEDUSA. MEDUSA integrates promoter sequence, mRNA expression, and transcription factor occupancy data to learn gene regulatory programs that predict the differential expression of target genes. Instead of using clustering or correlation of expression profiles to infer regulatory relationships, MEDUSA determines condition-specific regulators and discovers regulatory motifs that mediate the regulation of target genes. In this way, MEDUSA meaningfully models biological mechanisms of transcriptional regulation. MEDUSA solves the problem of predicting the differential (up/down) expression of target genes by using boosting, a technique from statistical learning, which helps to avoid overfitting as the algorithm searches through the high-dimensional space of potential regulators and sequence motifs. Experimental results demonstrate that MEDUSA achieves high prediction accuracy on held-out experiments (test data), that is, data not seen in training. We also present context-specific analysis of MEDUSA regulatory programs for DNA damage and hypoxia, demonstrating that MEDUSA identifies key regulators and motifs in these processes. A central challenge in the field is the difficulty of validating reverse-engineered networks in the absence of a gold standard. Our approach of learning regulatory programs provides at least a partial solution for the problem: MEDUSA's prediction accuracy on held-out data gives a concrete and statistically sound way to validate how well the algorithm performs. With MEDUSA, statistical validation becomes a prerequisite for hypothesis generation and network building rather than a secondary consideration.

  13. Over-expression of COQ10 in Saccharomyces cerevisiae inhibits mitochondrial respiration

    SciTech Connect

    Zampol, Mariana A.; Busso, Cleverson; Gomes, Fernando; Ferreira-Junior, Jose Ribamar; Tzagoloff, Alexander; Barros, Mario H.

    2010-11-05

    Research highlights: {yields} COQ10 deletion elicits a defect in mitochondrial respiration correctable by addition of coenzyme Q{sub 2}, a synthetic diffusible ubiquinone. {yields} The significance that purified Coq10p contains bound Q{sub 6} was examined by testing over-expression of Coq10p on respiration. {yields} Inhibition of CoQ function due to Coq10p excess strength our hypothesis of Coq10p function in CoQ delivery. {yields} Respiratory deficiency caused by more Coq10p was specific and restored by Q{sub 2} in mitochondria or by Coq8p in cells. {yields} Coq8p over-production on other coq mutants revealed a surprisingly higher stability of other Coq proteins. -- Abstract: COQ10 deletion in Saccharomyces cerevisiae elicits a defect in mitochondrial respiration correctable by addition of coenzyme Q{sub 2}. Rescue of respiration by Q{sub 2} is a characteristic of mutants blocked in coenzyme Q{sub 6} synthesis. Unlike Q{sub 6} deficient mutants, mitochondria of the coq10 null mutant have wild-type concentrations of Q{sub 6}. The physiological significance of earlier observations that purified Coq10p contains bound Q{sub 6} was examined in the present study by testing the in vivo effect of over-expression of Coq10p on respiration. Mitochondria with elevated levels of Coq10p display reduced respiration in the bc1 span of the electron transport chain, which can be restored with exogenous Q{sub 2}. This suggests that in vivo binding of Q{sub 6} by excess Coq10p reduces the pool of this redox carrier available for its normal function in providing electrons to the bc1 complex. This is confirmed by observing that extra Coq8p relieves the inhibitory effect of excess Coq10p. Coq8p is a putative kinase, and a high-copy suppressor of the coq10 null mutant. As shown here, when over-produced in coq mutants, Coq8p counteracts turnover of Coq3p and Coq4p subunits of the Q-biosynthetic complex. This can account for the observed rescue by COQ8 of the respiratory defect in strains

  14. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  15. Expression of the Bcl-2 family genes and complexes involved in the mitochondrial transport in prostate cancer cells.

    PubMed

    Asmarinah, Asmarinah; Paradowska-Dogan, Agnieszka; Kodariah, Ria; Tanuhardja, Budiana; Waliszewski, Przemyslaw; Mochtar, Chaidir Arif; Weidner, Wolfgang; Hinsch, Elvira

    2014-10-01

    Alteration of molecular pathways triggering apoptosis gives raise to various pathological tissue processes, such as tumorigenesis. The mitochondrial pathway is regulated by both the genes of the Bcl-2 family and the genes encoding mitochondrial transport molecules. Those proteins allow a release of cyctochrome c through the outer mitochondrial membrane. This release activates the caspase cascade resulting in death of cells. There are at least two main transport systems associated with the family of Bcl-2 proteins that are involved in transport of molecules through the outer mitochondrial membrane, i.e., the voltage dependent anion channels (VDACs) and translocases of the outer mitochondrial membrane proteins (TOMs). We investigated the expression of genes of the Bcl-2 family, i.e., pro-apoptotic Bak and Bid, and anti-apoptotic Bcl-2; VDAC gene, i.e., VDAC1, VDAC2 and VDAC3; and TOMM genes, i.e., TOMM20, TOMM22 and TOMM40. This study was performed at the mRNA and the protein level. Fourteen paraffin embedded prostate cancer tissues and five normal prostate tissues were analyzed by the quantitative PCR array and immunohistochemistry. We found a significant increase in both mRNA expression of the anti-apoptotic Bcl-2 gene and VDAC1 gene in prostate cancer tissue in comparison with their normal counterparts. Translation of the anti-apoptotic Bcl-2 and VDAC1 genes in prostate cancer tissue was slightly increased. We observed no significant differences in the mRNA expression of the pro-apoptotic Bak and Bid genes, VDAC2 or VDAC3 genes or the three TOMM genes in these tissues. The pro-apoptotic Bax protein was downtranslated significantly in secretory cells of prostate cancer as compared to normal prostate. We suggest that this protein is a good candidate as biomarker for prostate cancer.

  16. De Novo assembly of the Manila clam Ruditapes philippinarum transcriptome provides new insights into expression bias, mitochondrial doubly uniparental inheritance and sex determination.

    PubMed

    Ghiselli, Fabrizio; Milani, Liliana; Chang, Peter L; Hedgecock, Dennis; Davis, Jonathan P; Nuzhdin, Sergey V; Passamonti, Marco

    2012-02-01

    Males and females share the same genome, thus, phenotypic divergence requires differential gene expression and sex-specific regulation. Accordingly, the analysis of expression patterns is pivotal to the understanding of sex determination mechanisms. Many bivalves are stable gonochoric species, but the mechanism of gonad sexualization and the genes involved are still unknown. Moreover, during the period of sexual rest, a gonad is not present and sex cannot be determined. A mechanism associated with germ line differentiation in some bivalves, including the Manila clam Ruditapes philippinarum, is the doubly uniparental inheritance (DUI) of mitochondria, a variation of strict maternal inheritance. Two mitochondrial lineages are present, one transmitted through eggs and the other through sperm, as well as a mother-dependent sex bias of the progeny. We produced a de novo annotation of 17,186 transcripts from R. philippinarum and compared the transcriptomes of males and females and identified 1,575 genes with strong sex-specific expression and 166 sex-specific single nucleotide polymorphisms, obtaining preliminary information about genes that could be involved in sex determination. Then we compared the transcriptomes between a family producing predominantly females and a family producing predominantly males to identify candidate genes involved in regulation of sex-specific aspects of DUI system, finding a relationship between sex bias and differential expression of several ubiquitination genes. In mammalian embryos, sperm mitochondria are degraded by ubiquitination. A modification of this mechanism is hypothesized to be responsible for the retention of sperm mitochondria in male embryos of DUI species. Ubiquitination can additionally regulate gene expression, playing a role in sex determination of several animals. These data enable us to develop a model that incorporates both the DUI literature and our new findings.

  17. MicroRNA expression profiles differentiate chronic pain condition subtypes

    PubMed Central

    Ciszek, Brittney P.; Khan, Asma A.; Dang, Hong; Slade, Gary D.; Smith, Shad; Bair, Eric; Maixner, William; Zolnoun, Denniz; Nackley, Andrea G.

    2015-01-01

    Chronic pain is a significant healthcare problem, ineffectively treated due to its unclear etiology and heterogeneous clinical presentation. Emerging evidence demonstrates that microRNAs regulate the expression of pain-relevant genes, yet little is known about their role in chronic pain. Here, we evaluate the relationship between pain, psychological characteristics, plasma cytokines and whole blood microRNAs in 22 healthy controls (HC); 33 subjects with chronic pelvic pain (vestibulodynia: VBD); and 23 subjects with VBD and irritable bowel syndrome (VBD+IBS). VBD subjects were similar to HCs in self-reported pain, psychological profiles and remote bodily pain. VBD+IBS subjects reported decreased health and function; and an increase in headaches, somatization and remote bodily pain. Furthermore, VBD subjects exhibited a balance in pro- and anti-inflammatory cytokines, while VBD+IBS subjects failed to exhibit a compensatory increase in anti-inflammatory cytokines. VBD subjects differed from controls in expression of 10 microRNAs of predicted importance for pain and estrogen signaling. VBD+IBS subjects differed from controls in expression of 11 microRNAs of predicted importance for pain, cell physiology and insulin signaling. MicroRNA expression was correlated with pain-relevant phenotypes and cytokine levels. These results suggest microRNAs represent a valuable tool for differentiating VBD subtypes (localized pain with apparent peripheral neurosensory disruption versus widespread pain with a central sensory contribution) that may require different treatment approaches. PMID:26166255

  18. Differentially co-expressed genes in postmortem prefrontal cortex of individuals with alcohol use disorders: Influence on alcohol metabolism-related pathways

    PubMed Central

    Zhang, Huiping; Wang, Fan; Xu, Hongqin; Liu, Yawen; Liu, Jin; Zhao, Hongyu; Gelernter, Joel

    2014-01-01

    Chronic alcohol consumption may induce gene expression alterations in brain reward regions such as the prefrontal cortex (PFC), modulating the risk of alcohol use disorders (AUDs). Transcriptome profiles of 23 AUD cases and 23 matched controls (16 pairs of males and 7 pairs of females) in postmortem PFC were generated using Illumina’s HumanHT-12 v4 Expression BeadChip. Probe-level differentially expressed genes and gene modules in AUD subjects were identified using multiple linear regression and weighted gene co-expression network analyses. The enrichment of differentially co-expressed genes in alcohol dependence-associated genes identified by genome-wide association studies (GWAS) was examined using gene set enrichment analysis. Biological pathways overrepresented by differentially co-expressed genes were uncovered using DAVID bioinformatics resources. Three AUD-associated gene modules in males [Module 1 (561 probes mapping to 505 genes): r=0.42, Pcorrelation=0.020; Module 2 (815 probes mapping to 713 genes): r=0.41, Pcorrelation=0.020; Module 3 (1,446 probes mapping to 1,305 genes): r=−0.38, Pcorrelation=0.030] and one AUD-associated gene module in females [Module 4 (683 probes mapping to 652 genes): r=0.64, Pcorrelation=0.010] were identified. Differentially expressed genes mapped by significant expression probes (Pnominal≤0.05) clustered in Modules 1 and 2 were enriched in GWAS-identified alcohol dependence-associated genes [Module 1 (134 genes): P=0.028; Module 2 (243 genes): P=0.004]. These differentially expressed genes, including ALDH2, ALDH7A1, and ALDH9A1, are involved in cellular functions such as aldehyde detoxification, mitochondrial function, and fatty acid metabolism. Our study revealed differentially co-expressed genes in postmortem PFC of AUD subjects and demonstrated that some of these differentially co-expressed genes participate in alcohol metabolism. PMID:25073604

  19. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  20. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  1. Differential protein expression in Phalaenopsis under low temperature.

    PubMed

    Yuan, Xiu-Yun; Liang, Fang; Jiang, Su-Hua; Wan, Mo-Fei; Ma, Jie; Zhang, Xian-Yun; Cui, Bo

    2015-01-01

    A comparative proteomic analysis was carried out to explore the molecular mechanisms of responses to cold stress in Phalaenopsis after treated by low temperature (13/8 °C day/night) for 15 days. Differentially expressed proteins were examined using two-dimensional electrophoresis (2-DE) and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-TOF/MS). Among 85 differentially expressed proteins, 73 distinct proteins were identified. Comparative analysis revealed that the identified proteins mainly participate in photosynthesis, protein synthesis, folding and degradation, respiration, defense response, amino acid metabolism, energy pathway, cytoskeleton, transcription regulation, signal transduction, and seed storage protein, while the functional classification of the remaining four proteins was not determined. These data suggested that the proteins might work cooperatively to establish a new homeostasis under cold stress; 37 % of the identified cold-responsive proteins were associated with various aspects of chloroplast physiology, and 56 % of them were predicted to be located in the chloroplasts, implying that the cold stress tolerance of Phalaenopsis was achieved, at least partly, by regulation of chloroplast function. Moreover, the protein destination control, which was mediated by chaperones and proteases, plays an important role in tolerance to cold stress.

  2. Paradoxical effects of increased expression of PGC-1α on muscle mitochondrial function and insulin-stimulated muscle glucose metabolism

    PubMed Central

    Choi, Cheol Soo; Befroy, Douglas E.; Codella, Roberto; Kim, Sheene; Reznick, Richard M.; Hwang, Yu-Jin; Liu, Zhen-Xiang; Lee, Hui-Young; Distefano, Alberto; Samuel, Varman T.; Zhang, Dongyan; Cline, Gary W.; Handschin, Christoph; Lin, Jiandie; Petersen, Kitt F.; Spiegelman, Bruce M.; Shulman, Gerald I.

    2008-01-01

    Peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α has been shown to play critical roles in regulating mitochondria biogenesis, respiration, and muscle oxidative phenotype. Furthermore, reductions in the expression of PGC-1α in muscle have been implicated in the pathogenesis of type 2 diabetes. To determine the effect of increased muscle-specific PGC-1α expression on muscle mitochondrial function and glucose and lipid metabolism in vivo, we examined body composition, energy balance, and liver and muscle insulin sensitivity by hyperinsulinemic-euglycemic clamp studies and muscle energetics by using 31P magnetic resonance spectroscopy in transgenic mice. Increased expression of PGC-1α in muscle resulted in a 2.4-fold increase in mitochondrial density, which was associated with an ≈60% increase in the unidirectional rate of ATP synthesis. Surprisingly, there was no effect of increased muscle PGC-1α expression on whole-body energy expenditure, and PGC-1α transgenic mice were more prone to fat-induced insulin resistance because of decreased insulin-stimulated muscle glucose uptake. The reduced insulin-stimulated muscle glucose uptake could most likely be attributed to a relative increase in fatty acid delivery/triglyceride reesterfication, as reflected by increased expression of CD36, acyl-CoA:diacylglycerol acyltransferase1, and mitochondrial acyl-CoA:glycerol-sn-3-phosphate acyltransferase, that may have exceeded mitochondrial fatty acid oxidation, resulting in increased intracellular lipid accumulation and an increase in the membrane to cytosol diacylglycerol content. This, in turn, caused activation of PKCθ, decreased insulin signaling at the level of insulin receptor substrate-1 (IRS-1) tyrosine phosphorylation, and skeletal muscle insulin resistance. PMID:19066218

  3. Ketogenic mitochondrial 3-hydroxy 3-methylglutaryl-CoA synthase gene expression in intestine and liver of suckling rats.

    PubMed

    Serra, D; Asins, G; Hegardt, F G

    1993-03-01

    The ketogenic mitochondrial 3-hydroxy 3-methylglutaryl-coenzyme A (HMG-CoA) synthase gene is expressed in intestine of suckling rats, its mRNA levels changing with age. Intestine mitochondrial mRNA values reach maximum levels on the 12th postnatal day and then decrease smoothly. Mother's milk may influence the intestine expression, since mRNA levels at birth are very low, increasing after the first lactation. Moreover, rats weaned at either Day 18 or 21 decrease their mRNA levels dramatically and there is no expression in adult rats. Mitochondrial HMG-CoA synthase is also expressed in liver of suckling rats but the developmental pattern of mRNAs is different from that in intestine, showing the highest values at Day 3 of life. mRNA levels in liver are lower than in intestine for most of the suckling period, suggesting the physiological relevance of the intestine for the ketogenic process of the whole body. Liver mRNA levels on weaning and in adult rats are high enough to sustain hepatic ketogenesis.

  4. Differential gene expression between the biotrophic-like and saprotrophic mycelia of the witches' broom pathogen Moniliophthora perniciosa.

    PubMed

    Rincones, Johana; Scarpari, Leandra M; Carazzolle, Marcelo F; Mondego, Jorge M C; Formighieri, Eduardo F; Barau, Joan G; Costa, Gustavo G L; Carraro, Dirce M; Brentani, Helena P; Vilas-Boas, Laurival A; de Oliveira, Bruno V; Sabha, Maricene; Dias, Robson; Cascardo, Júlio M; Azevedo, Ricardo A; Meinhardt, Lyndel W; Pereira, Gonçalo A G

    2008-07-01

    Moniliophthora perniciosa is a hemibiotrophic fungus that causes witches' broom disease (WBD) in cacao. Marked dimorphism characterizes this fungus, showing a monokaryotic or biotrophic phase that causes disease symptoms and a later dikaryotic or saprotrophic phase. A combined strategy of DNA microarray, expressed sequence tag, and real-time reverse-transcriptase polymerase chain reaction analyses was employed to analyze differences between these two fungal stages in vitro. In all, 1,131 putative genes were hybridized with cDNA from different phases, resulting in 189 differentially expressed genes, and 4,595 reads were clusterized, producing 1,534 unigenes. The analysis of these genes, which represent approximately 21% of the total genes, indicates that the biotrophic-like phase undergoes carbon and nitrogen catabolite repression that correlates to the expression of phytopathogenicity genes. Moreover, downregulation of mitochondrial oxidative phosphorylation and the presence of a putative ngr1 of Saccharomyces cerevisiae could help explain its lower growth rate. In contrast, the saprotrophic mycelium expresses genes related to the metabolism of hexoses, ammonia, and oxidative phosphorylation, which could explain its faster growth. Antifungal toxins were upregulated and could prevent the colonization by competing fungi. This work significantly contributes to our understanding of the molecular mechanisms of WBD and, to our knowledge, is the first to analyze differential gene expression of the different phases of a hemibiotrophic fungus.

  5. Over-expression of the Sirt3 sirtuin Protects neuronally differentiated PC12 Cells from degeneration induced by oxidative stress and trophic withdrawal.

    PubMed

    Shulyakova, Natalya; Sidorova-Darmos, Elena; Fong, Jamie; Zhang, Guangming; Mills, Linda R; Eubanks, James H

    2014-10-31

    Sirt3 is a mitochondrial sirtuin whose deacetylase activity regulates facets of oxidative metabolic efficiency, anti-oxidative capacity, and intra-mitochondrial signaling. In this study, we tested whether the over-expression of a human Sirt3-myc transgene in differentiated PC12 cells, a model of sympathetic catecholaminergic neurons, would affect the sensitivity of these cells to oxidative stress or trophic withdrawal insults. Expression analysis revealed the Sirt3-myc product was expressed as a 45kDa pro-form, which localized primarily within the cytosol, and a 30kDa processed form that localized predominantly within mitochondria. When subjected to acute glucose deprivation or acute oxygen-glucose deprivation, differentiated PC12 cells over-expressing Sirt3-myc displayed significantly lower levels of cytotoxicity, both at the end of the insult, and at different times following media reperfusion, than cells transfected with a control plasmid. Further, Sirt3-myc over-expression also protected differentiated PC12 cells from apoptosis induced by trophic withdrawal. Collectively, these data indicate that an elevation of Sirt3 is sufficient to protect neuronal PC12 cells from cytotoxic insults, and add to the growing evidence that Sirt3 could be targeted for neuroprotective intervention.

  6. Mitochondrial Fitness, Gene Expression, and Hypoxic Stress in a Hybrid Population of the Killifish, Fundulus Heteroclitus

    EPA Science Inventory

    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study we draw on a popul...

  7. Effect of geological vicariance on mitochondrial DNA differentiation in Common Pheasant populations of the Loess Plateau and eastern China.

    PubMed

    Liu, Ying; Zhan, Xiangjiang; Wang, Ning; Chang, Jiang; Zhang, Zhengwang

    2010-05-01

    Population differentiation within species can be stimulated by various geographic and climatic factors. In this study, we analyzed the population structure of the Common Pheasant (Phasianus colchicus) in the Loess Plateau and its adjacent eastern areas (named eastern China). We sequenced mitochondrial cytochrome b and control regions of 249 samples collected from 42 populations that covered the whole Loess Plateau and eastern China. Two groups (one containing populations 1-27 and the other populations 28-42) were identified using Analysis of Molecular Variance, Spatial Analysis of Molecular Variance, median-joining network analysis and maximum-parsimony analysis. The results demonstrated that although populations were distributed continuously throughout the study area, there was clear differentiation between populations. Geographically, population differentiation was sutured along the eastern edge of the Loess Plateau. The Migration Divergence (MDIV) analysis suggested that the two groups diverged at about 0.21 million years ago, which corresponded to a period when numerous large inland paleo-lakes greatly receded across the Loess Plateau during 0.25-0.20 million years before present (Ma BP). We inferred that the rapid recession of the Loess Plateau paleo-lakes caused dramatic shifts from a relatively humid climate, to one that was significantly more arid. Such severe climate transition combined with a dry-cold starting of one of multi-cycled climate fluctuations from warm-humid to dry-cold since about 0.24-0.22 Ma BP on the Loess Plateau may have been the impetus that effectively facilitated differentiation between different pheasant populations.

  8. Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process.

    PubMed

    Marquez, F G; Cisneros, B; Garcia, F; Ceja, V; Velázquez, F; Depardón, F; Cervantes, L; Rendón, A; Mornet, D; Rosas-vargas, H; Mustre, M; Montañez, C

    2003-01-01

    Dp71 is the major product of the Duchenne muscular dystrophy gene in the brain. In order to study the function of Dp71 in the nervous system we examined the expression of Dp71 isoforms in PC12 rat pheochromocytoma cell line, a well-established system to study neuronal differentiation. We show by reverse transcriptase-polymerase chain reaction and Western blot assays that PC12 cells express two Dp71 isoforms. One isoform lacks exon 71 and the other isoform lacks exons 71 and 78 (Dp71d and Dp71f isoforms respectively). Nerve growth factor-induced neuronal differentiation of PC12 cells results in differential regulation of the expression and subcellular localization of Dp71 isoforms: a) the amount of Dp71f protein increases nine-fold in total extracts while Dp71d increases up to seven-fold in nuclear extracts; b) Dp71f relocates from the cytoplasm to neuritic processes, being prominent at varicosities and the growth cone; c) Dp71d relocates almost entirely to the nucleus and is detected to a lower extent in the cytoplasm and neuritic processes. Dp71f co-localizes with beta-dystroglycan and synaptophysin while Dp71d co-localizes with beta-dystroglycan in the nucleus. Dp71d accumulates at cell-cell contacts where Dp71f is absent. These results suggest that Dp71d and Dp71f associate with different subcellular complexes and therefore may have distinct functions in PC12 cells.

  9. Gene expression profiling for human iPS-derived motor neurons from sporadic ALS patients reveals a strong association between mitochondrial functions and neurodegeneration

    PubMed Central

    Alves, Chrystian J.; Dariolli, Rafael; Jorge, Frederico M.; Monteiro, Matheus R.; Maximino, Jessica R.; Martins, Roberto S.; Strauss, Bryan E.; Krieger, José E.; Callegaro, Dagoberto; Chadi, Gerson

    2015-01-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that leads to widespread motor neuron death, general palsy and respiratory failure. The most prevalent sporadic ALS form is not genetically inherited. Attempts to translate therapeutic strategies have failed because the described mechanisms of disease are based on animal models carrying specific gene mutations and thus do not address sporadic ALS. In order to achieve a better approach to study the human disease, human induced pluripotent stem cell (hiPSC)-differentiated motor neurons were obtained from motor nerve fibroblasts of sporadic ALS and non-ALS subjects using the STEMCCA Cre-Excisable Constitutive Polycistronic Lentivirus system and submitted to microarray analyses using a whole human genome platform. DAVID analyses of differentially expressed genes identified molecular function and biological process-related genes through Gene Ontology. REVIGO highlighted the related functions mRNA and DNA binding, GTP binding, transcription (co)-repressor activity, lipoprotein receptor binding, synapse organization, intracellular transport, mitotic cell cycle and cell death. KEGG showed pathways associated with Parkinson's disease and oxidative phosphorylation, highlighting iron homeostasis, neurotrophic functions, endosomal trafficking and ERK signaling. The analysis of most dysregulated genes and those representative of the majority of categorized genes indicates a strong association between mitochondrial function and cellular processes possibly related to motor neuron degeneration. In conclusion, iPSC-derived motor neurons from motor nerve fibroblasts of sporadic ALS patients may recapitulate key mechanisms of neurodegeneration and may offer an opportunity for translational investigation of sporadic ALS. Large gene profiling of differentiated motor neurons from sporadic ALS patients highlights mitochondrial participation in the establishment of autonomous mechanisms associated with sporadic ALS

  10. Gene expression profiling for human iPS-derived motor neurons from sporadic ALS patients reveals a strong association between mitochondrial functions and neurodegeneration.

    PubMed

    Alves, Chrystian J; Dariolli, Rafael; Jorge, Frederico M; Monteiro, Matheus R; Maximino, Jessica R; Martins, Roberto S; Strauss, Bryan E; Krieger, José E; Callegaro, Dagoberto; Chadi, Gerson

    2015-01-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that leads to widespread motor neuron death, general palsy and respiratory failure. The most prevalent sporadic ALS form is not genetically inherited. Attempts to translate therapeutic strategies have failed because the described mechanisms of disease are based on animal models carrying specific gene mutations and thus do not address sporadic ALS. In order to achieve a better approach to study the human disease, human induced pluripotent stem cell (hiPSC)-differentiated motor neurons were obtained from motor nerve fibroblasts of sporadic ALS and non-ALS subjects using the STEMCCA Cre-Excisable Constitutive Polycistronic Lentivirus system and submitted to microarray analyses using a whole human genome platform. DAVID analyses of differentially expressed genes identified molecular function and biological process-related genes through Gene Ontology. REVIGO highlighted the related functions mRNA and DNA binding, GTP binding, transcription (co)-repressor activity, lipoprotein receptor binding, synapse organization, intracellular transport, mitotic cell cycle and cell death. KEGG showed pathways associated with Parkinson's disease and oxidative phosphorylation, highlighting iron homeostasis, neurotrophic functions, endosomal trafficking and ERK signaling. The analysis of most dysregulated genes and those representative of the majority of categorized genes indicates a strong association between mitochondrial function and cellular processes possibly related to motor neuron degeneration. In conclusion, iPSC-derived motor neurons from motor nerve fibroblasts of sporadic ALS patients may recapitulate key mechanisms of neurodegeneration and may offer an opportunity for translational investigation of sporadic ALS. Large gene profiling of differentiated motor neurons from sporadic ALS patients highlights mitochondrial participation in the establishment of autonomous mechanisms associated with sporadic ALS.

  11. Early changes in costameric and mitochondrial protein expression with unloading are muscle specific.

    PubMed

    Flück, Martin; Li, Ruowei; Valdivieso, Paola; Linnehan, Richard M; Castells, Josiane; Tesch, Per; Gustafsson, Thomas

    2014-01-01

    We hypothesised that load-sensitive expression of costameric proteins, which hold the sarcomere in place and position the mitochondria, contributes to the early adaptations of antigravity muscle to unloading and would depend on muscle fibre composition and chymotrypsin activity of the proteasome. Biopsies were obtained from vastus lateralis (VL) and soleus (SOL) muscles of eight men before and after 3 days of unilateral lower limb suspension (ULLS) and subjected to fibre typing and measures for costameric (FAK and FRNK), mitochondrial (NDUFA9, SDHA, UQCRC1, UCP3, and ATP5A1), and MHCI protein and RNA content. Mean cross-sectional area (MCSA) of types I and II muscle fibres in VL and type I fibres in SOL demonstrated a trend for a reduction after ULLS (0.05 ≤ P < 0.10). FAK phosphorylation at tyrosine 397 showed a 20% reduction in VL muscle (P = 0.029). SOL muscle demonstrated a specific reduction in UCP3 content (-23%; P = 0.012). Muscle-specific effects of ULLS were identified for linear relationships between measured proteins, chymotrypsin activity and fibre MCSA. The molecular modifications in costamere turnover and energy homoeostasis identify that aspects of atrophy and fibre transformation are detectable at the protein level in weight-bearing muscles within 3 days of unloading.

  12. Cloning and expression of mitochondrial MnSOD from the small radish (Raphanus sativus L.).

    PubMed

    Kwon, Soon Il; An, Chung Sun

    2003-10-31

    A cDNA clone for a mitochondrial MnSOD was isolated from a cDNA library derived from seedlings of the small radish (Raphanus sativus L.). The cDNA clone, RsMnSOD, encoded a polypeptide with a predicted molecular mass of 25.4 kDa and calculated pI of 8.77. Its deduced amino acid sequence was 93% homologous with MnSOD of Arabidopsis. RNA gel blot analysis showed that RsMnSOD transcripts were most abundant in leaves, followed by roots and hypocotyls, whereas transcripts of RsFeSOD and RsCu/ZnSOD were not detected in roots. The hypocotyls of germinated seedlings turned green and finally red in response to white light. These color changes were accompanied by increases in RsMnSOD and RsCu/ZnSOD mRNA. In addition, RsMnSOD expression was strongly induced by osmotic stress, moderately induced by phytohormones such as ABA and IAA, and not induced by xenobiotics other than cercosporin.

  13. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  14. Protective role of amantadine in mitochondrial dysfunction and oxidative stress mediated by hepatitis C virus protein expression.

    PubMed

    Quarato, Giovanni; Scrima, Rosella; Ripoli, Maria; Agriesti, Francesca; Moradpour, Darius; Capitanio, Nazzareno; Piccoli, Claudia

    2014-06-15

    Amantadine is an antiviral and antiparkinsonian drug that has been evaluated in combination therapies against hepatitis C virus (HCV) infection. Controversial results have been reported concerning its efficacy, and its mechanism of action remains unclear. Data obtained in vitro suggested a role of amantadine in inhibiting HCV p7-mediated cation conductance. In keeping with the fact that mitochondria are responsible to ionic fluxes and that HCV infection impairs mitochondrial function, we investigated a potential role of amantadine in modulating mitochondrial function. Using a well-characterized inducible cell line expressing the full-length HCV polyprotein, we found that amantadine not only prevented but also rescued HCV protein-mediated mitochondrial dysfunction. Specifically, amantadine corrected (i) overload of mitochondrial Ca²⁺; (ii) inhibition of respiratory chain activity and oxidative phosphorylation; (iii) reduction of membrane potential; and (iv) overproduction of reactive oxygen species. The effects of amantadine were observed within 15 min following drug administration and confirmed in Huh-7.5 cells transfected with an infectious HCV genome. These effects were also observed in cells expressing subgenomic HCV constructs, indicating that they are not mediated or only in part mediated by p7. Single organelle analyzes carried out on isolated mouse liver mitochondria demonstrated that amantadine induces hyperpolarization of the membrane potential. Moreover, amantadine treatment increased the calcium threshold required to trigger mitochondrial permeability transition opening. In conclusion, these results support a role of amantadine in preserving cellular bioenergetics and redox homeostasis in HCV-infected cells and unveil an effect of the drug which might be exploited for a broader therapeutic utilization.

  15. Mitochondrial Lon is over-expressed in high-grade gliomas, and mediates hypoxic adaptation: potential role of Lon as a therapeutic target in glioma

    PubMed Central

    Di, Kaijun; Lomeli, Naomi; Wood, Spencer D.; Vanderwal, Christopher D.; Bota, Daniela A.

    2016-01-01

    Mitochondrial dysfunction is a hallmark of cancer biology. Tumor mitochondrial metabolism is characterized by an abnormal ability to function in scarce oxygen conditions through glycolysis (the Warburg effect), and accumulation of mitochondrial DNA defects are present in both hereditary neoplasia and sporadic cancers. Mitochondrial Lon is a major regulator of mitochondrial metabolism and the mitochondrial response to free radical damage, and plays an essential role in the maintenance and repair of mitochondrial DNA. Despite these critical cellular functions of Lon, very little has been reported regarding its role in glioma. Lon expression in gliomas and its relevance with patient survival was examined using published databases and human tissue sections. The effect of Lon in glioma biology was investigated through siRNA targeting Lon. We also tested the in vitro antitumor activity of Lon inhibitor, CC4, in the glioma cell lines D-54 and U-251. High Lon expression was associated with high glioma tumor grade and poor patient survival. While Lon expression was elevated in response to a variety of stimuli, Lon knockdown in glioma cell lines decreased cell viability under normal conditions, and dramatically impaired glioma cell survival under hypoxic conditions. Furthermore, the Lon inhibitor, CC4, efficiently prohibited glioma cell proliferation and synergistically enhanced the therapeutic efficacy of the chemotherapeutic agents, temozolomide (TMZ) and cisplatin. We demonstrate that Lon plays a key role in glioma cell hypoxic survival and mitochondrial respiration, and propose Lon as a promising therapeutic target in the treatment of malignant gliomas. PMID:27764809

  16. Selection of rodent species appropriate for mtDNA transfer to generate transmitochondrial mito-mice expressing mitochondrial respiration defects.

    PubMed

    Enoki, Shunkei; Shimizu, Akinori; Hayashi, Chisato; Imanishi, Hirotake; Hashizume, Osamu; Mekada, Kazuyuki; Suzuki, Hitoshi; Hashimoto, Tetsuo; Nakada, Kazuto; Hayashi, Jun-Ichi

    2014-01-01

    Previous reports have shown that transmitochondrial mito-mice with nuclear DNA from Mus musculus and mtDNA from M. spretus do not express respiration defects, whereas those with mtDNA from Rattus norvegicus cannot be generated from ES cybrids with mtDNA from R. norvegicus due to inducing significant respiration defects and resultant losing multipotency. Here, we isolated transmitochondrial cybrids with mtDNA from various rodent species classified between M. spretus and R. norvegicus, and compared the O2 consumption rates. The results showed a strong negative correlation between phylogenetic distance and reduction of O2 consumption rates, which would be due to the coevolution of nuclear and mitochondrial genomes and the resultant incompatibility between the nuclear genome from M. musculus and the mitochondrial genome from the other rodent species. These observations suggested that M. caroli was an appropriate mtDNA donor to generate transmitochondrial mito-mice with nuclear DNA from M. musculus. Then, we generated ES cybrids with M. caroli mtDNA, and found that these ES cybrids expressed respiration defects without losing multipotency and can be used to generate transmitochondrial mito-mice expressing mitochondrial disorders.

  17. Mitochondrial intermediate peptidase: Expression in Escherichia coli and improvement of its enzymatic activity detection with FRET substrates

    SciTech Connect

    Marcondes, Marcelo F.; Torquato, Ricardo J.S.; Assis, Diego M.; Juliano, Maria A.; Hayashi, Mirian A.F.; Oliveira, Vitor

    2010-01-01

    In the present study, soluble, functionally-active, recombinant human mitochondrial intermediate peptidase (hMIP), a mitochondrial metalloendoprotease, was expressed in a prokaryotic system. The hMIP fusion protein, with a poly-His-tag (6x His), was obtained by cloning the coding region of hMIP cDNA into the pET-28a expression vector, which was then used to transform Escherichia coli BL21 (DE3) pLysS. After isolation and purification of the fusion protein by affinity chromatography using Ni-Sepharose resin, the protein was purified further using ion exchange chromatography with a Hi-trap resource Q column. The recombinant hMIP was characterized by Western blotting using three distinct antibodies, circular dichroism, and enzymatic assays that used the first FRET substrates developed for MIP and a series of protease inhibitors. The successful expression of enzymatically-active hMIP in addition to the FRET substrates will contribute greatly to the determination of substrate specificity of this protease and to the development of specific inhibitors that are essential for a better understanding of the role of this protease in mitochondrial functioning.

  18. Differential pattern of integrin receptor expression in differentiated and anaplastic thyroid cancer cell lines.

    PubMed

    Hoffmann, S; Maschuw, K; Hassan, I; Reckzeh, B; Wunderlich, A; Lingelbach, S; Zielke, A

    2005-09-01

    Adhesion of tumor cells to the extracellular matrix (ECM) is a crucial step for the development of metastatic disease and is mediated by specific integrin receptor molecules (IRM). The pattern of metastatic spread differs substantially among the various histotypes of thyroid cancer (TC). However, IRM have only occasionally been characterized in TC until now. IRM expression was investigated in 10 differentiated (FTC133, 236, 238, HTC, HTC TSHr, XTC, PTC4.0/4.2, TPC1, Kat5) and two anaplastic TC cell lines (ATC, C643, Hth74), primary cultures of normal thyroid tissue (Thy1,3), and thyroid cancer specimens (TCS). Expression of 16 IRM (beta1-4, beta7, alpha1-6, alphaV, alphaIIb, alphaL, alphaM, alphaX) and of four IRM heterodimers (alpha2beta1, alpha5beta1, alphaVbeta3, alphaVbeta5), was analyzed by fluorescent-activated cell sorter (FACS) and immunohistochemical staining. Thyroid tumor cell adhesion to ECM proteins and their IRM expression in response to thyrotropin (TSH) was assessed. Follicular TC cell lines presented high levels of integrins alpha2, alpha3, alpha5, beta1, beta3 and low levels of alpha1, whereas papillary lines expressed a heterogenous pattern of IRM, dominated by alpha5 and beta1. ATC mainly displayed integrins alpha2, alpha3, alpha5, alpha6, beta1 and low levels of alpha1, alpha4 and alphaV. Integrin heterodimers correlated with monomer expression. Evaluation of TCS largely confirmed these results with few exceptions, namely alpha4, alpha6, and beta3. The ability of TC cell lines to adhere to purified ECM proteins correlated with IRM expression. TSH induced TC cell adhesion in a dose-dependent fashion, despite an unchanged array of IRM expression or level of a particular IRM. Thyroid carcinoma cell lines of different histogenetic background display profoundly different patterns of IRM expression that appear to correlate with tumor aggressiveness. In vitro adhesion to ECM proteins and IRM expression concur. Finally, TSH-stimulated adhesion of

  19. Mitochondrial-related gene expression profiles suggest an important role of PGC-1alpha in the compensatory mechanism of endemic dilated cardiomyopathy

    SciTech Connect

    He, Shu-Lan; Tan, Wu-Hong; Zhang, Zeng-Tie; Zhang, Feng; Qu, Cheng-Juan; Lei, Yan-Xia; Zhu, Yan-He; Yu, Han-Jie; Xiang, You-Zhang; and others

    2013-10-15

    Keshan disease (KD) is an endemic dilated cardiomyopathy with unclear etiology. In this study, we compared mitochondrial-related gene expression profiles of peripheral blood mononuclear cells (PBMCs) derived from 16 KD patients and 16 normal controls in KD areas. Total RNA was isolated, amplified, labeled and hybridized to Agilent human 4×44k whole genome microarrays. Mitochondrial-related genes were screened out by the Third-Generation Human Mitochondria-Focused cDNA Microarray (hMitChip3). Quantitative real-time PCR, immunohistochemical and biochemical parameters related mitochondrial metabolism were conducted to validate our microarray results. In KD samples, 34 up-regulated genes (ratios≥2.0) were detected by significance analysis of microarrays and ingenuity systems pathway analysis (IPA). The highest ranked molecular and cellular functions of the differentially regulated genes were closely related to amino acid metabolism, free radical scavenging, carbohydrate metabolism, and energy production. Using IPA, 40 significant pathways and four significant networks, involved mainly in apoptosis, mitochondrion dysfunction, and nuclear receptor signaling were identified. Based on our results, we suggest that PGC-1alpha regulated energy metabolism and anti-apoptosis might play an important role in the compensatory mechanism of KD. Our results may lead to the identification of potential diagnostic biomarkers for KD in PBMCs, and may help to understand the pathogenesis of KD. Highlights: • Thirty-four up-regulated genes were detected in KD versus health controls. • Forty pathways and four networks were detected in KD. • PGC-1alpha regulated energy metabolism and anti-apoptosis in KD.

  20. Differential effects of endurance training and creatine depletion on regional mitochondrial adaptations in rat skeletal muscle.

    PubMed Central

    Roussel, D; Lhenry, F; Ecochard, L; Sempore, B; Rouanet, J L; Favier, R

    2000-01-01

    To examine the combined effects of 2-week endurance training and 3-week feeding with beta-guanidinopropionic acid (GPA) on regional adaptability of skeletal muscle mitochondria, intermyofibrillar mitochondria (IFM) and subsarcolemmal mitochondria (SSM) were isolated from quadriceps muscles of sedentary control, trained control, sedentary GPA-fed and trained GPA-fed rats. Mitochondrial oxidative phosphorylation was assessed polarographically by using pyruvate plus malate, succinate (plus rotenone), and ascorbate plus N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD) (plus antimycin) as respiratory substrates. Assays of cytochrome c oxidase and F(1)-ATPase activities were also performed. In sedentary control rats, IFM exhibited a higher oxidative capacity than SSM, whereas F(1)-ATPase activities were similar. Training increased the oxidative phosphorylation capacity of mitochondria with both pyruvate plus malate and ascorbate plus TMPD as substrates, with no differences between IFM and SSM. In contrast, the GPA diet mainly improved the overall SSM oxidative phosphorylation capacity, irrespective of the substrate used. Finally, the superimposition of training to feeding with GPA strongly increased both oxidase and enzymic activities in SSM, whereas no cumulative effects were found in IFM mitochondria. It therefore seems that endurance training and feeding with GPA, which are both known to alter the energetic status of the muscle cell, might mediate distinct biochemical adaptations in regional skeletal muscle mitochondria. PMID:10947970

  1. Evidence for Mitochondrial Respiratory Deficiency in Rat Rhabdomyosarcoma Cells

    PubMed Central

    Jahnke, Vanessa E.; Sabido, Odile; Defour, Aurélia; Castells, Josiane; Lefai, Etienne; Roussel, Damien; Freyssenet, Damien

    2010-01-01

    Background Mitochondria can sense signals linked to variations in energy demand to regulate nuclear gene expression. This retrograde signaling pathway is presumed to be involved in the regulation of myoblast proliferation and differentiation. Rhabdomyosarcoma cells are characterized by their failure to both irreversibly exit the cell cycle and complete myogenic differentiation. However, it is currently unknown whether mitochondria are involved in the failure of rhabdomyosarcoma cells to differentiate. Methodology/Principal Findings Mitochondrial biogenesis and metabolism were studied in rat L6E9 myoblasts and R1H rhabdomyosacoma cells during the cell cycle and after 36 hours of differentiation. Using a combination of flow cytometry, polarographic and molecular analyses, we evidenced a marked decrease in the cardiolipin content of R1H cells cultured in growth and differentiation media, together with a significant increase in the content of mitochondrial biogenesis factors and mitochondrial respiratory chain proteins. Altogether, these data indicate that the mitochondrial inner membrane composition and the overall process of mitochondrial biogenesis are markedly altered in R1H cells. Importantly, the dysregulation of protein-to-cardiolipin ratio was associated with major deficiencies in both basal and maximal mitochondrial respiration rates. This deficiency in mitochondrial respiration probably contributes to the inability of R1H cells to decrease mitochondrial H2O2 level at the onset of differentiation. Conclusion/Significance A defect in the regulation of mitochondrial biogenesis and mitochondrial metabolism may thus be an epigenetic mechanism that may contribute to the tumoral behavior of R1H cells. Our data underline the importance of mitochondria in the regulation of myogenic differentiation. PMID:20072609

  2. Differential mitochondrial distribution in human pronuclear embryos leads to disproportionate inheritance between blastomeres: relationship to microtubular organization, ATP content and competence.

    PubMed

    Van Blerkom, J; Davis, P; Alexander, S

    2000-12-01

    It has been suggested that mitochondrial DNA defects that effect metabolic capacity may be a proximal cause of failures in oocyte maturation, fertilization, or early embryonic development. Here, the distribution of mitochondria was examined by scanning laser confocal microscopy in living human pronuclear oocytes and cleavage stage embryos, followed either by measurements of the net ATP content of individual blastomeres or anti-tubulin immunofluorescence to determine the relationship between mitochondrial distribution and microtubular organization. The results indicate that specific patterns of perinuclear mitochondrial aggregation and microtubular organization are related, and that asymmetrical mitochondrial distributions at the pronuclear stage can result in some proportion of blastomeres with reduced mitochondrial inheritance and diminished ATP generating capacity. While the inability to divide appears to be a development consequence for an affected blastomere, for the embryo, reduced competence may occur during cleavage if several blastomeres inherit a mitochondrial complement inadequate to support normal cellular functions. The findings provide a possible epigenetic explanation for the variable developmental ability expressed within cohorts of morphologically normal early cleavage stage human embryos obtained by in-vitro fertilization.

  3. Expression of deoxynucleotide carrier is not associated with the mitochondrial DNA depletion caused by anti-HIV dideoxynucleoside analogs and mitochondrial dNTP uptake.

    PubMed

    Lam, Wing; Chen, ChinShing; Ruan, Shuolun; Leung, Chung-Hang; Cheng, Yung-Chi

    2005-02-01

    Our previous studies suggested that the dNTP/dNDP transporter systems that exist in mitochondria for transporting dNTP/dNDP from the cytoplasm to the mitochondria for mitochondrial DNA (mtDNA) synthesis play a critical role in delayed cytotoxicity of anti-human immunodeficiency virus (HIV) dideoxynucleoside analogs in mitochondria. A protein, termed mitochondrial deoxynucleotide carrier (DNC), based on its ability to transport dNTPs in reconstituted proteoliposomes, was recently isolated. Lacking cellular information to substantiate DNC's involvement in the delayed cytotoxicity of dideoxynucleoside analogs, we expressed DNC and reconstituted it into proteoliposomes. The K(m) values for dNTPs uptake by reconstituted DNC were in the millimolar range, which is a thousandfold higher than that of the physiological level. Furthermore, we found that overexpressing DNC (wt and G177A-mutated DNC) in RKO cells did not sensitize the cells to the mtDNA depletion caused by beta-d-2',3'-dideoxycytidine (ddC), 2',3'-didehydro-2',3'-dideoxythymidine, and 2',3'-dideoxyinosine or affect the mtDNA recovery rate after ddC treatment. Mitochondria isolated from DNC-overexpressing cells did not significantly differ from that isolated from RKO cells in terms of the rate of uptake or the incorporation of dTTP into mitochondria DNA. Down-regulation of DNC expression by small interfering RNA was also ineffective in changing the action of dideoxynucleoside analogs on the mtDNA depletion and the rate of dTTP uptake into isolated mitochondria. Down-regulation of both DNC and thymidine kinase-2 also did not cause mtDNA depletion. We conclude that DNC does not play an important role in the delayed cytotoxicity (mtDNA depletion) of anti-HIV dideoxynucleoside analogs and dNTPs uptake into mitochondria.

  4. Complete Mitochondrial Genome of Helicoverpa zea (Lepidoptera: Noctuidae) and Expression Profiles of Mitochondrial-Encoded Genes in Early and Late Embryos

    PubMed Central

    Perera, Omaththage P.; Walsh, Thomas K.; Luttrell, Randall G.

    2016-01-01

    The mitochondrial genome (mitogenome) of the bollworm, Helicoverpa zea (Boddie), was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogenome (gene order and orientation) was identical to other known lepidopteran mitogenome sequences. Compared with Helicoverpa armigera (Hübner) mitogenome, there were a few differences in the lengths of gaps between genes, but the lengths of nucleotide overlaps were essentially conserved between the two species. Nucleotide composition of the H. zea mitochondrial genome was very similar to those of the related species H. armigera and Helicoverpa punctigera Wallengren. Mapping of RNA-Seq reads obtained from 2-h eggs and 48-h embryos to protein coding genes (PCG) revealed that all H. zea PCGs were processed as single mature gene transcripts except for the bicistronic atp8 + atp6 transcript. A tRNA-like sequence predicted to form a hammer-head-like secondary structure that may play a role in transcription start and mitogenome replication was identified within the control region of the H. zea mitogenome. Similar structures were also found within the control regions of several other lepidopteran species. Expression analysis revealed significant differences in levels of expression of PCGs within each developmental stage, but the pattern of variation was similar in both developmental stages analyzed in this study. Mapping of RNA-Seq reads to PCG transcripts also identified transcription termination and polyadenylation sites that differed from the sites described in other lepidopteran species. PMID:27126963

  5. High ubiquitous mitochondrial creatine kinase expression in hepatocellular carcinoma denotes a poor prognosis with highly malignant potential.

    PubMed

    Uranbileg, Baasanjav; Enooku, Kenichiro; Soroida, Yoko; Ohkawa, Ryunosuke; Kudo, Yotaro; Nakagawa, Hayato; Tateishi, Ryosuke; Yoshida, Haruhiko; Shinzawa, Seiko; Moriya, Kyoji; Ohtomo, Natsuko; Nishikawa, Takako; Inoue, Yukiko; Tomiya, Tomoaki; Kojima, Soichi; Matsuura, Tomokazu; Koike, Kazuhiko; Yatomi, Yutaka; Ikeda, Hitoshi

    2014-05-01

    We previously reported the increased serum mitochondrial creatine kinase (MtCK) activity in patients with hepatocellular carcinoma (HCC), mostly due to the increase in ubiquitous MtCK (uMtCK), and high uMtCK mRNA expression in HCC cell lines. We explored the mechanism(s) and the relevance of high uMtCK expression in HCC. In hepatitis C virus core gene transgenic mice, known to lose mitochondrial integrity in liver and subsequently develop HCC, uMtCK mRNA and protein levels were increased in HCC tissues but not in non-tumorous liver tissues. Transient overexpression of ankyrin repeat and suppressor of cytokine signaling box protein 9 (ASB9) reduced uMtCK protein levels in HCC cells, suggesting that increased uMtCK levels in HCC cells may be caused by increased gene expression and decreased protein degradation due to reduced ASB9 expression. The reduction of uMtCK expression by siRNA led to increased cell death, and reduced proliferation, migration and invasion in HCC cell lines. Then, consecutive 105 HCC patients, who underwent radiofrequency ablation with curative intent, were enrolled to analyze their prognosis. The patients with serum MtCK activity >19.4 U/L prior to the treatment had significantly shorter survival time than those with serum MtCK activity ≤ 19.4 U/L, where higher serum MtCK activity was retained as an independent risk for HCC-related death on multivariate analysis. In conclusion, high uMtCK expression in HCC may be caused by hepatocarcinogenesis per se but not by loss of mitochondrial integrity, of which ASB9 could be a negative regulator, and associated with highly malignant potential to suggest a poor prognosis.

  6. NADPH oxidase expression in active multiple sclerosis lesions in relation to oxidative tissue damage and mitochondrial injury.

    PubMed

    Fischer, Marie T; Sharma, Rakhi; Lim, Jamie L; Haider, Lukas; Frischer, Josa M; Drexhage, Joost; Mahad, Don; Bradl, Monika; van Horssen, Jack; Lassmann, Hans

    2012-03-01

    Multiple sclerosis is a chronic inflammatory disease of the central nervous system, associated with demyelination and neurodegeneration. The mechanisms of tissue injury are poorly understood, but recent data suggest that mitochondrial injury may play an important role in this process. Mitochondrial injury can be triggered by reactive oxygen and nitric oxide species, and we recently provided evidence for oxidative damage of oligodendrocytes and dystrophic axons in early stages of active multiple sclerosis lesions. In this study, we identified potential sources of reactive oxygen and nitrogen species through gene expression in carefully staged and dissected lesion areas and by immunohistochemical analysis of protein expression. Genome-wide microarrays confirmed mitochondrial injury in active multiple sclerosis lesions, which may serve as an important source of reactive oxygen species. In addition, we found differences in the gene expression levels of various nicotinamide adenine dinucleotide phosphate oxidase subunits between initial multiple sclerosis lesions and control white matter. These results were confirmed at the protein level by means of immunohistochemistry, showing upregulation of the subunits gp91phox, p22phox, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 in activated microglia in classical active as well as slowly expanding lesions. The subunits gp91phox and p22phox were constitutively expressed in microglia and were upregulated in the initial lesion. In contrast, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 expression were more restricted to the zone of initial damage or to lesions from patients with acute or early relapsing/remitting multiple sclerosis. Double labelling showed co-expression of the nicotinamide adenine dinucleotide phosphate oxidase subunits in activated microglia and

  7. NADPH oxidase expression in active multiple sclerosis lesions in relation to oxidative tissue damage and mitochondrial injury

    PubMed Central

    Fischer, Marie T.; Sharma, Rakhi; Lim, Jamie L.; Haider, Lukas; Frischer, Josa M.; Drexhage, Joost; Mahad, Don; Bradl, Monika; van Horssen, Jack

    2012-01-01

    Multiple sclerosis is a chronic inflammatory disease of the central nervous system, associated with demyelination and neurodegeneration. The mechanisms of tissue injury are poorly understood, but recent data suggest that mitochondrial injury may play an important role in this process. Mitochondrial injury can be triggered by reactive oxygen and nitric oxide species, and we recently provided evidence for oxidative damage of oligodendrocytes and dystrophic axons in early stages of active multiple sclerosis lesions. In this study, we identified potential sources of reactive oxygen and nitrogen species through gene expression in carefully staged and dissected lesion areas and by immunohistochemical analysis of protein expression. Genome-wide microarrays confirmed mitochondrial injury in active multiple sclerosis lesions, which may serve as an important source of reactive oxygen species. In addition, we found differences in the gene expression levels of various nicotinamide adenine dinucleotide phosphate oxidase subunits between initial multiple sclerosis lesions and control white matter. These results were confirmed at the protein level by means of immunohistochemistry, showing upregulation of the subunits gp91phox, p22phox, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 in activated microglia in classical active as well as slowly expanding lesions. The subunits gp91phox and p22phox were constitutively expressed in microglia and were upregulated in the initial lesion. In contrast, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 expression were more restricted to the zone of initial damage or to lesions from patients with acute or early relapsing/remitting multiple sclerosis. Double labelling showed co-expression of the nicotinamide adenine dinucleotide phosphate oxidase subunits in activated microglia and

  8. Differential proteomic and tissue expression analyses identify valuable diagnostic biomarkers of hepatocellular differentiation and hepatoid adenocarcinomas.

    PubMed

    Reis, Henning; Padden, Juliet; Ahrens, Maike; Pütter, Carolin; Bertram, Stefanie; Pott, Leona L; Reis, Anna-Carinna; Weber, Frank; Juntermanns, Benjamin; Hoffmann, Andreas-C; Eisenacher, Martin; Schlaak, Joörg F; Canbay, Ali; Meyer, Helmut E; Sitek, Barbara; Baba, Hideo A

    2015-10-01

    The exact discrimination of lesions with true hepatocellular differentiation from secondary tumours and neoplasms with hepatocellular histomorphology like hepatoid adenocarcinomas (HAC) is crucial. Therefore, we aimed to identify ancillary protein biomarkers by using complementary proteomic techniques (2D-DIGE, label-free MS). The identified candidates were immunohistochemically validated in 14 paired samples of hepatocellular carcinoma (HCC) and non-tumourous liver tissue (NT). The candidates and HepPar1/Arginase1 were afterwards tested for consistency in a large cohort of hepatocellular lesions and NT (n = 290), non-hepatocellular malignancies (n = 383) and HAC (n = 13). Eight non-redundant, differentially expressed proteins were suitable for further immunohistochemical validation and four (ABAT, BHMT, FABP1, HAOX1) for further evaluation. Sensitivity and specificity rates for HCC/HAC were as follows: HepPar1 80.2%, 94.3% / 80.2%, 46.2%; Arginase1 82%, 99.4% / 82%, 69.2%; BHMT 61.4%, 93.8% / 61.4%, 100%; ABAT 84.4%, 33.7% / 84.4%, 30.8%; FABP1 87.2%, 95% / 87.2%, 69.2%; HAOX1 95.5%, 36.3% / 95.5%, 46.2%. The best 2×/3× biomarker panels for the diagnosis of HCC consisted of Arginase1/HAOX1 and BHMT/Arginase1/HAOX1 and for HAC consisted of Arginase1/FABP1 and BHMT/Arginase1/FABP1. In summary, we successfully identified, validated and benchmarked protein biomarker candidates of hepatocellular differentiation. BHMT in particular exhibited superior diagnostic characteristics in hepatocellular lesions and specifically in HAC. BHMT is therefore a promising (panel based) biomarker candidate in the differential diagnostic process of lesions with hepatocellular aspect.

  9. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  10. CFTR activity and mitochondrial function☆

    PubMed Central

    Valdivieso, Angel Gabriel; Santa-Coloma, Tomás A.

    2013-01-01

    Cystic Fibrosis (CF) is a frequent and lethal autosomal recessive disease, caused by mutations in the gene encoding the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR). Before the discovery of the CFTR gene, several hypotheses attempted to explain the etiology of this disease, including the possible role of a chloride channel, diverse alterations in mitochondrial functions, the overexpression of the lysosomal enzyme α-glucosidase and a deficiency in the cytosolic enzyme glucose 6-phosphate dehydrogenase. Because of the diverse mitochondrial changes found, some authors proposed that the affected gene should codify for a mitochondrial protein. Later, the CFTR cloning and the demonstration of its chloride channel activity turned the mitochondrial, lysosomal and cytosolic hypotheses obsolete. However, in recent years, using new approaches, several investigators reported similar or new alterations of mitochondrial functions in Cystic Fibrosis, thus rediscovering a possible role of mitochondria in this disease. Here, we review these CFTR-driven mitochondrial defects, including differential gene expression, alterations in oxidative phosphorylation, calcium homeostasis, oxidative stress, apoptosis and innate immune response, which might explain some characteristics of the complex CF phenotype and reveals potential new targets for therapy. PMID:24024153

  11. Mitochondrial Toxin 3-Nitropropionic Acid Induces Cardiac and Neurotoxicity Differentially in Mice

    PubMed Central

    Gabrielson, Kathleen L.; Hogue, Barbara A.; Bohr, Vilhelm A.; Cardounel, A. J.; Nakajima, Waco; Kofler, Julia; Zweier, Jay L.; Rodriguez, E. Rene; Martin, Lee J.; de Souza-Pinto, Nadja C.; Bressler, Joseph

    2001-01-01

    We investigated the effects of 3-nitropropionic acid (3NPA), a previously characterized neurotoxin, in four strains of mice to better understand the molecular basis of variable host responses to this agent. Unexpectedly, we found significant cardiac toxicity that always accompanied the neurotoxicity in all strains of mice in acute and subacute/chronic toxicity testing. Caudate putamen infarction never occurred without cardiac toxicity. All mouse strains tested are sensitive to 3NPA although the C57BL/6 and BALB/c mice require more exposure than 129SVEMS and FVB/n mice. Cardiac toxicity alone was found in 50% of symptomatic mice tested and morphologically, the cardiac toxicity is characterized by diffuse swelling of cardiomyocytes and multifocal coagulative contraction band necrosis. In subacute to chronic exposure, atrial thrombosis, cardiac mineralization, cell loss, and fibrosis are combined with cardiomyocyte swelling and necrosis. Ultrastructurally, mitochondrial swelling occurs initially, followed by disruption of myofilaments. Biochemically, isolated heart mitochondria from the highly sensitive 129SVEMS mice have a significant reduction of succinate dehydrogenase activity, succinate oxygen consumption rates, and heart adenosine triphosphate after 3NPA treatment. The severity of morphological changes parallels the biochemical alterations caused by 3NPA, consistent with cardiac toxicity being a consequence of the effects of 3NPA on succinate dehydrogenase. These experiments show, for the first time, that 3NPA has important cardiotoxic effects as well as neurotoxic effects, and that cardiac toxicity possibly resulting from inhibition of the succinate dehydrogenase in heart mitochondria, contributes to the cause of death in 3NPA poisoning in acute and subacute/chronic studies in mice. PMID:11583977

  12. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  13. Role of FAST Kinase Domains 3 (FASTKD3) in Post-transcriptional Regulation of Mitochondrial Gene Expression.

    PubMed

    Boehm, Erik; Zornoza, María; Jourdain, Alexis A; Delmiro Magdalena, Aitor; García-Consuegra, Inés; Torres Merino, Rebeca; Orduña, Antonio; Martín, Miguel A; Martinou, Jean-Claude; De la Fuente, Miguel A; Simarro, María

    2016-12-09

    The Fas-activated serine/threonine kinase (FASTK) family of proteins has recently emerged as a central regulator of mitochondrial gene expression through the function of an unusual RNA-binding domain named RAP (for RNA-binding domain abundant in Apicomplexans), shared by all six members of the family. Here we describe the role of one of the less characterized members, FASTKD3, in mitochondrial RNA metabolism. First, we show that, in contrast to FASTK, FASTKD2, and FASTKD5, FASTKD3 does not localize in mitochondrial RNA granules, which are sites of processing and maturation of mtRNAs and ribosome biogenesis. Second, we generated FASTKD3 homozygous knock-out cell lines by homologous recombination and observed that the absence of FASTKD3 resulted in increased steady-state levels and half-lives of a subset of mature mitochondrial mRNAs: ND2, ND3, CYTB, COX2, and ATP8/6. No aberrant processing of RNA precursors was observed. Rescue experiments demonstrated that RAP domain is required for FASTKD3 function in mRNA stability. Besides, we describe that FASTKD3 is required for efficient COX1 mRNA translation without altering mRNA levels, which results in a decrease in the steady-state levels of COX1 protein. This finding is associated with reduced mitochondrial complex IV assembly and activity. Our observations suggest that the function of this family of proteins goes beyond RNA processing and ribosome assembly and includes RNA stability and translation regulation within mitochondria.

  14. Vitamin E and vitamin C do not reduce insulin sensitivity but inhibit mitochondrial protein expression in exercising obese rats

    PubMed Central

    Picklo, Matthew J.; Thyfault, John P.

    2016-01-01

    Controversy exists as to whether supplementation with the antioxidants vitamin E and vitamin C blocks adaptation to exercise. Exercise is a first-line means to treat obesity and its complications. While diet-induced obesity alters mitochondrial function and induces insulin resistance (IR), no data exist as to whether supplementation with vitamin E and vitamin C modify responses to exercise in pre-existing obesity. We tested the hypothesis that dietary supplementation with vitamin E (0.4 g α-tocopherol acetate/kg) and vitamin C (0.5 g/kg) blocks exercise-induced improvements on IR and mitochondrial content in obese rats maintained on a high-fat (45% fat energy (en)) diet. Diet-induced obese, sedentary rats had a 2-fold higher homeostasis model assessment of insulin resistance and larger insulin area under the curve following glucose tolerances test than rats fed a low-fat (10% fat en) diet. Exercising (12 weeks at 5 times per week in a motorized wheel) of obese rats normalized IR indices, an effect not modified by vitamin E and vitamin C. Vitamin E and vitamin C supplementation with exercise elevated mtDNA content in adipose and skeletal muscle to a greater extent (20%) than exercise alone in a depot-specific manner. On the other hand, vitamin C and vitamin E decreased exercise-induced increases in mitochondrial protein content for complex I (40%) and nicotinamide nucleotide transhydrogenase (35%) in a muscle-dependent manner. These data indicate that vitamin E and vitamin C supplementation in obese rodents does not modify exercise-induced improvements in insulin sensitivity but that changes in mitochondrial biogenesis and mitochondrial protein expression may be modified by antioxidant supplementation. PMID:25761734

  15. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  16. trans-Cinnamaldehyde stimulates mitochondrial biogenesis through PGC-1α and PPARβ/δ leading to enhanced GLUT4 expression.

    PubMed

    Gannon, Nicholas P; Schnuck, Jamie K; Mermier, Christine M; Conn, Carole A; Vaughan, Roger A

    2015-12-01

    Type 2 diabetes is characterized by insulin resistance and chronic hyperglycemia, and is increasing in incidence and severity. This work explored the effects of trans-cinnamaldehyde (CA) on carbohydrate metabolism, mitochondrial content, and related metabolic gene and protein expression in cultured myotubes treated with various concentrations of CA for up to 24 h. CA treatment increased myotube myocyte enhancer factor 2 (MEF2) along with glucose transporter 4 (GLUT4) content. CA treatment also significantly increased expression of markers of improved oxidative metabolism including 5' adenosine monophosphate-activated protein kinase (AMPK), peroxisome proliferator-activated receptor γ coactivator 1 α (PGC-1α), cytochrome c (CytC), as well as peroxisome proliferator-activated receptor α (PPARα) and PPARβ/δ. Despite increased expression of proteins associated with improved oxidative metabolism and glucose uptake, CA-treated myotubes exhibited significantly reduced oxidative metabolism compared with controlled cells. Additionally, CA treatment increased markers of glucose-mediated lipid biosynthesis without elevated PPARγ and sterol receptor element binding protein 1c (SREBP-1c) expression. The ability of CA to stimulate mitochondrial biogenesis and GLUT4 expression suggests CA may offer possible benefits for metabolic disease. However, increases in markers of fatty acid synthesis with simultaneously reduced oxidative metabolism suggest CA may have counterproductive effects for metabolic disease, warranting a need for further investigation.

  17. Differential expression of laminin receptors in human hepatocellular carcinoma

    PubMed Central

    Ozaki, I; Yamamoto, K; Mizuta, T; Kajihara, S; Fukushima, N; Setoguchi, Y; Morito, F; Sakai, T

    1998-01-01

    Background—Laminin receptors are involved in cell-extracellular matrix interactions in malignant cells that show invasion and metastasis. Hepatocellular carcinoma frequently shows early invasion into blood vessels, and intrahepatic and extrahepatic metastases. However, the role of laminin receptors in hepatocellular carcinoma is unknown. 
Aims—To examine the expression of mRNA for laminin receptors and their isoforms in hepatocellular carcinoma. 
Methods—The expression of several laminin receptors, including α1 integrin, α6 integrin and its isoforms α6A and α6B, β1 integrin and its isoforms β1A and β1B, and 32kD/67kDa laminin binding protein was examined in human hepatocellular carcinomas and non-cancerous liver tissues using the reverse transcription polymerase chain reaction. 
Results—α6 Integrin, β1 integrin, and laminin binding protein showed notably increased expression in hepatocellular carcinoma, compared with non-cancerous liver tissue, although the α1 integrin did not show a significant change. Furthermore, β1B integrin, a splicing variant of β1 integrin, was overexpressed in hepatocellular carcinoma while the β1A integrin isoform did not show significant changes between hepatocellular carcinoma and surrounding non-cancerous liver tissue. 
Conclusions—The differential upregulation of laminin receptors and their splicing isoforms was shown in hepatocellular carcinoma, suggesting that certain laminin receptors and their isoforms may be involved in the development and progression of hepatocellular carcinoma. 

 Keywords: laminin receptor; integrin α6β1; hepatocellular carcinoma PMID:9824613

  18. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  19. Acute starvation in C57BL/6J mice increases myocardial UCP2 and UCP3 protein expression levels and decreases mitochondrial bio-energetic function.

    PubMed

    Wang, Chun-Ming; Almsherqi, Zakaria A; McLachlan, Craig S; Matthews, Slade; Ramachandran, Malarmathy; Tay, Stacey Kh; Deng, Yuru

    2011-01-01

    Associations between uncoupling protein (UCP) expression and functional changes in myocardial mitochondrial bio-energetics have not been well studied during periods of starvation stress. Our aim was to study the effects of acute starvation, for 24 or 48 h, on combined cardiac mitochondrial function and UCP expression in mice. Isolated heart mitochondria from female mice starved for 48 h compared to that from mice fed revealed a significantly (p < 0.05) decreased adenosine diphosphate-to-oxygen ratio, a significantly increased proton leak and an increased GTP inhibition on palmitic acid-induced state 4 oxygen consumption (p < 0.05). These bio-energetic functional changes were associated with increases in mitochondrial UCP2 and UCP3 protein expression. In conclusion, our findings suggest that increased UCP2 and UCP3 levels may contribute to decreased myocardial mitochondrial bio-energetic function due to starvation.

  20. Identification and developmental expression of the mitochondrial phosphate transport protein gene from the spruce budworm, Choristoneura fumiferana.

    PubMed

    Feng, Q L; Ladd, T R; Retnakaran, A; Davey, K G; Palli, S R

    1998-10-01

    Phosphate transport protein (PTP) is a mitochondrial inner membrane protein responsible for the translocation of inorganic phosphate into the mitochondrial matrix. A full length cDNA clone encoding the PTP was isolated from the spruce budworm, Choristoneura fumiferana. The deduced amino acid sequence of the longest ORF of CfPTP cDNA showed high similarity with the amino acid sequences of PTPs cloned from several species. Phylogenetic tree analysis indicated that CfPTP occupied an intermediate position between vertebrates on the one side and yeast and nematodes on the other side. Studies on the developmental expression of CfPTP mRNA showed that higher levels of mRNA were present during the feeding and growing stages than during molting periods.

  1. Decreased expression of the mitochondrial matrix proteases Lon and ClpP in cells from a patient with hereditary spastic paraplegia (SPG13).

    PubMed

    Hansen, J; Corydon, T J; Palmfeldt, J; Dürr, A; Fontaine, B; Nielsen, M N; Christensen, J H; Gregersen, N; Bross, P

    2008-05-02

    The mitochondrial chaperonin heat shock protein 60 (Hsp60) assists the folding of a subset of proteins localized in mitochondria and is an essential component of the mitochondrial protein quality control system. Mutations in the HSPD1 gene that encodes Hsp60 have been identified in patients with an autosomal dominant form of hereditary spastic paraplegia (SPG13), a late-onset neurodegenerative disorder characterized by a progressive paraparesis of the lower limbs. The disease-associated Hsp60-(p.Val98Ile) protein, encoded by the c.292G>A HSPD1 allele, has reduced chaperonin activity, but how its expression affects mitochondrial functions has not been investigated. We have studied mitochondrial function and expression of genes encoding mitochondrial chaperones and proteases in a human lymphoblastoid cell line and fibroblast cells from a patient who is heterozygous for the c.292G>A HSPD1 allele. We found that both the c.292G>A RNA transcript and the corresponding Hsp60-(p.Val98Ile) protein were present at comparable levels to their wild-type counterparts in SPG13 patient cells. Compared with control cells, we found no significant cellular or mitochondrial dysfunctions in SPG13 patient cells by assessing the mitochondrial membrane potential, cell viability, and sensitivity toward oxidative stress. However, a decreased expression of the mitochondrial protein quality control proteases Lon and ClpP, both at the RNA and protein level, was demonstrated in SPG13 patient cells. We propose that decreased levels of mitochondrial proteases Lon and ClpP may allow Hsp60 substrate proteins to go through more folding attempts instead of being prematurely degraded, thereby supporting productive folding in cells with reduced Hsp60 chaperonin activity. In conclusion, our studies with SPG13 patient cells expressing the functionally impaired mutant Hsp60 chaperonin suggest that reduction of the degradative activity of the protein quality control system may represent a previously

  2. [Mitochondrial DNA genetic differentiation of the muksun Coregonus muksun (Pallas) and related Siberian species of Coregonus (Coredonidae, Salmoniformes)].

    PubMed

    Baldina, S N; Gordon, N Iu; Politov, D V

    2008-07-01

    Restriction enzyme analysis of the mitochondrial DNA (mtDNA) fragment encoding subunit 1 of the NADH dehydrogenase complex (ND-1) amplified via polymerase chain reaction (PCR) has been used to obtain data on genetic differentiation of muksun Coregonus muksun (Pallas) populations. Population polymorphism with respect to the restriction sites of 18 endonucleases has been described. It has been demonstrated that the muksun is genetically related to the pidschian C. pidschian (Gmelin), its sympatric species in Siberian waters. Analysis of the median network of mtDNA haplotypes has shown that haplotypes of muksun from various Siberian basins form a common group with haplotypes of pidschian of the Arctic Ocean basin, some frequent haplotypes been found in both forms. This raises the question as to the validity of the muksun as a species. Differences within this group of haplotypes are much smaller than those typical of species of the genus Coregonus. The possibility of a hybrid origin of the muksun from a pidschian-like ancestor and species of the cisco-peled (C. sardinella-C. peled) complex is discussed.

  3. Molecular differentiation of three closely related members of the mosquito species complex, Anopheles moucheti, by mitochondrial and ribosomal DNA polymorphism.

    PubMed

    Kengne, P; Antonio-Nkondjio, C; Awono-Ambene, H P; Simard, F; Awolola, T S; Fontenille, D

    2007-06-01

    Distinction between members of the equatorial Africa malaria vector Anopheles moucheti (Evans) s.l. (Diptera: Culicidae) has been based mainly on doubtful morphological features. To determine the level of genetic differentiation between the three morphological forms of this complex, we investigated molecular polymorphism in the gene encoding for mitochondrial cytochrome oxidase b (CytB) and in the ribosomal internal transcribed spacers (ITS1 and ITS2). The three genomic regions revealed sequence differences between the three morphological forms similar in degree to the differences shown previously for members of other anopheline species groups or complexes (genetic distance d = 0.047-0.05 for CytB, 0.084-0.166 for ITS1 and 0.03-0.05 for ITS2). Using sequence variation in the ITS1 region, we set up a diagnostic polymerase chain reaction (PCR) for rapid and reliable identification of each subspecies within the An. moucheti complex. Specimens of An. moucheti s.l. collected in Cameroon, the Democratic Republic of Congo (DRC), Uganda and Nigeria were successfully identified, demonstrating the general applicability of this technique.

  4. Characterization of the complete mitochondrial genome of Diphyllobothrium nihonkaiense (Diphyllobothriidae: Cestoda), and development of molecular markers for differentiating fish tapeworms.

    PubMed

    Kim, Kyu-Heon; Jeon, Hyeong-Kyu; Kang, Seokha; Sultana, Tahera; Kim, Gil Jung; Eom, Keeseon; Park, Joong-Ki

    2007-06-30

    We sequenced and characterized the complete mitochondrial genome of the Japanese fish tapeworm D. nihonkaiense. The genome is a circular-DNA molecule of 13607 bp (one nucleotide shorter than that of D. latum mtDNA) containing 12 protein-coding genes (lacking atp8), 22 tRNA genes and two rRNA genes. Gene order and genome content are identical to those of the other cestodes reported thus far, including its congener D. latum. The only exception is Hymenolepis diminuta in which the positions of trnS2 and trnL1 are switched. We tested a PCR-based molecular assay designed to rapidly and accurately differentiate between D. nihonkaiense and D. latum using species-specific primers based on a comparison of their mtDNA sequences. We found the PCR-based system to be very reliable and specific, and suggest that PCR-based identification methods using mtDNA sequences could contribute to the study of the epidemiology and larval ecology of Diphyllobothrium species.

  5. Genetic Diversity and Differentiation in Urban and Indigenous Populations of Mexico: Patterns of Mitochondrial DNA and Y-Chromosome Lineages.

    PubMed

    González-Sobrino, Blanca Z; Pintado-Cortina, Ana P; Sebastián-Medina, Leticia; Morales-Mandujano, Fabiola; Contreras, Alejandra V; Aguilar, Yasnaya E; Chávez-Benavides, Juan; Carrillo-Rodríguez, Aurelio; Silva-Zolezzi, Irma; Medrano-González, Luis

    2016-01-01

    Aside from the admixture between indigenous people and people from overseas, populations in Mexico changed drastically after the Spanish conquest of the sixteenth century, forming an intricate history that has been underutilized in understanding the genetic population structure of Mexicans. To infer historical processes of isolation, dispersal, and assimilation, we examined the phylogeography of mitochondrial (mt) DNA and Y-chromosome lineages in 3,026 individuals from 10 urban and nine indigenous populations by identifying single nucleotide polymorphisms. A geographic array with a predominance of Amerindian lineages was observed for mtDNA, with northern indigenous populations being divergent from the central and southern indigenous populations; urban populations showed low differentiation with isolation by distance. Y-chromosome variation distinguished urban and indigenous populations through the Amerindian haplogroup Q frequency. The MtDNA and the Y-chromosome together primarily distinguished urban and indigenous populations, with different geographic arrays for both. Gene flow across geographical distance and between the urban and indigenous realms appears to have altered the pre-Hispanic phylogeography in central and southern Mexico, mainly by displacement of women, while maintaining the indigenous isolation in the north, southeast, and Zapotec regions. Most Amerindian mtDNA diversity currently occurs in urban populations and appears to be reduced among indigenous people.

  6. Genetic variation and differentiation of Gekko gecko from different populations based on mitochondrial cytochrome b gene sequences and karyotypes.

    PubMed

    Qin, Xin-Min; Li, Hui-Min; Zeng, Zhen-Hua; Zeng, De-Long; Guan, Qing-Xin

    2012-06-01

    Black-spotted and red-spotted tokay geckos are distributed in different regions and have significant differences in morphological appearance, but have been regarded as the same species, Gekko gecko, in taxonomy. To determine whether black-spotted and red-spotted tokay geckos are genetically differentiated, we sequenced the entire mitochondrial cytochrome b gene (1147 bp) from 110 individuals of Gekko gecko collected in 11 areas including Guangxi China, Yunnan China, Vietnam, and Laos. In addition, we performed karyotypic analyses of black-spotted tokay geckos from Guangxi China and red-spotted tokay geckos from Laos. These phylogenetic analyses showed that black-spotted and red-spotted tokay geckos are divided into two branches in molecular phylogenetic trees. The average genetic distances are as follows: 0.12-0.47% among six haplotypes in the black-spotted tokay gecko group, 0.12-1.66% among five haplotypes in the red-spotted tokay gecko group, and 8.76-9.18% between the black-spotted and red-spotted tokay geckos, respectively. The karyotypic analyses showed that the karyotype formula is 2n = 38 = 8m + 2sm + 2st + 26t in red-spotted tokay geckos from Laos compared with 2n = 38 = 8m + 2sm + 28t in black-spotted tokay geckos from Guangxi China. The differences in these two kinds of karyotypes were detected on the 15th chromosome. The clear differences in genetic levels between black-spotted and red-spotted tokay geckos suggest a significant level of genetic differentiation between the two.

  7. Differential modulation of ROS signals and other mitochondrial parameters by the antioxidants MitoQ, resveratrol and curcumin in human adipocytes.

    PubMed

    Hirzel, Estelle; Lindinger, Peter W; Maseneni, Swarna; Giese, Maria; Rhein, Véronique Virginie; Eckert, Anne; Hoch, Matthias; Krähenbühl, Stephan; Eberle, Alex N

    2013-10-01

    Mitochondrial reactive oxygen species (ROS) have been demonstrated to play an important role as signaling and regulating molecules in human adipocytes. In order to evaluate the differential modulating roles of antioxidants, we treated human adipocytes differentiated from human bone marrow-derived mesenchymal stem cells with MitoQ, resveratrol and curcumin. The effects on ROS, viability, mitochondrial respiration and intracellular ATP levels were examined. MitoQ lowered both oxidizing and reducing ROS. Resveratrol decreased reducing and curcumin oxidizing radicals only. All three substances slightly decreased state III respiration immediately after addition. After 24 h of treatment, MitoQ inhibited both basal and uncoupled oxygen consumption, whereas curcumin and resveratrol had no effect. Intracellular ATP levels were not altered. This demonstrates that MitoQ, resveratrol and curcumin exert potent modulating effects on ROS signaling in human adipocyte with marginal effects on metabolic parameters.

  8. Mitochondrial biogenesis and turnover.

    PubMed

    Diaz, Francisca; Moraes, Carlos T

    2008-07-01

    Mitochondrial biogenesis is a complex process involving the coordinated expression of mitochondrial and nuclear genes, the import of the products of the latter into the organelle and turnover. The mechanisms associated with these events have been intensively studied in the last 20 years and our understanding of their details is much improved. Mitochondrial biogenesis requires the participation of calcium signaling that activates a series of calcium-dependent protein kinases that in turn activate transcription factors and coactivators such as PGC-1alpha that regulates the expression of genes coding for mitochondrial components. In addition, mitochondrial biogenesis involves the balance of mitochondrial fission-fusion. Mitochondrial malfunction or defects in any of the many pathways involved in mitochondrial biogenesis can lead to degenerative diseases and possibly play an important part in aging.

  9. Early Expression of Parkinson's Disease-Related Mitochondrial Abnormalities in PINK1 Knockout Rats.

    PubMed

    Villeneuve, Lance M; Purnell, Phillip R; Boska, Michael D; Fox, Howard S

    2016-01-01

    PTEN-induced kinase 1 (PINK1) mutations are responsible for an autosomal recessive, familial form of Parkinson's disease. PINK1 protein is a Ser/Thr kinase localized to the mitochondrial membrane and is involved in many processes including mitochondrial trafficking, mitophagy, and proteasomal function. Using a new PINK1 knockout (PINK1 KO) rat model, we found altered brain metabolomic markers using magnetic resonance spectroscopy, identified changes in mitochondrial pathways with quantitative proteomics using sequential window acquisition of all theoretical spectra (SWATH) mass spectrometry, and demonstrated mitochondrial functional alterations through measurement of oxygen consumption and acidification rates. The observed alterations included reduced creatine, decreased levels of complex I of the electron transport chain, and increased proton leak in the electron transport chain in PINK1 KO rat brains. In conjunction, these results demonstrate metabolomic and mitochondrial alterations occur during the asymptomatic phase of Parkinson's disease in this model. These results indicate both potential early diagnostic markers and therapeutic pathways that can be used in PD.

  10. Effects of rosiglitazone on global ischemia-induced hippocampal injury and expression of mitochondrial uncoupling protein 2

    SciTech Connect

    Chen, S.-D.; Wu, H.-Y.; Yang, D.-I; Lee, S.-Y.; Shaw, F.-Z.; Lin, T.-K.; Liou, C.-W.; Chuang, Y.-C. . E-mail: ycchuang@adm.cgmh.org.tw

    2006-12-08

    We investigate the effect of rosiglitazone, a ligand for peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) with anti-inflammatory and anti-oxidative actions, on hippocampal injury and its roles in mitochondrial uncoupling protein 2 (UCP2) expression caused by transient global ischemia (TGI) in rats. Increased UCP2 expression was observed in mitochondria of hippocampal CA1 2-24 h after TGI/reperfusion, with maximal expression levels at 6-18 h. Administration of rosiglitazone to hippocampus 30 min prior to the onset of TGI further enhanced mitochondrial UCP2 expression 2-6 h following TGI/reperfusion. Rats subjected to TGI/reperfusion displayed a significant increase in lipid peroxidation, based on increased malondialdehyde (MDA) levels, in hippocampal CA1 mitochondria 2-6 h after reperfusion. Rosiglitazone significantly attenuated TGI/reperfusion-induced lipid peroxidation and suppressed hippocampal CA1 neuronal death based on the surviving neuronal counts. In conclusion, our results provide correlative evidence for the 'PPAR{gamma} {sup {yields}} UCP2 {sup {yields}} neuroprotection' cascade in ischemic brain injury.

  11. Expression of a functional oxygen-labile nitrogenase component in the mitochondrial matrix of aerobically grown yeast

    PubMed Central

    López-Torrejón, Gema; Jiménez-Vicente, Emilio; Buesa, José María; Hernandez, Jose A.; Verma, Hemant K.; Rubio, Luis M.

    2016-01-01

    The extreme sensitivity of nitrogenase towards oxygen stands as a major barrier to engineer biological nitrogen fixation into cereal crops by direct nif gene transfer. Here, we use yeast as a model of eukaryotic cell and show that aerobically grown cells express active nitrogenase Fe protein when the NifH polypeptide is targeted to the mitochondrial matrix together with the NifM maturase. Co-expression of NifH and NifM with Nif-specific Fe–S cluster biosynthetic proteins NifU and NifS is not required for Fe protein activity, demonstrating NifH ability to incorporate endogenous mitochondrial Fe–S clusters. In contrast, expression of active Fe protein in the cytosol requires both anoxic growth conditions and co-expression of NifH and NifM with NifU and NifS. Our results show the convenience of using mitochondria to host nitrogenase components, thus providing instrumental technology for the grand challenge of engineering N2-fixing cereals. PMID:27126134

  12. Expression of a functional oxygen-labile nitrogenase component in the mitochondrial matrix of aerobically grown yeast.

    PubMed

    López-Torrejón, Gema; Jiménez-Vicente, Emilio; Buesa, José María; Hernandez, Jose A; Verma, Hemant K; Rubio, Luis M

    2016-04-29

    The extreme sensitivity of nitrogenase towards oxygen stands as a major barrier to engineer biological nitrogen fixation into cereal crops by direct nif gene transfer. Here, we use yeast as a model of eukaryotic cell and show that aerobically grown cells express active nitrogenase Fe protein when the NifH polypeptide is targeted to the mitochondrial matrix together with the NifM maturase. Co-expression of NifH and NifM with Nif-specific Fe-S cluster biosynthetic proteins NifU and NifS is not required for Fe protein activity, demonstrating NifH ability to incorporate endogenous mitochondrial Fe-S clusters. In contrast, expression of active Fe protein in the cytosol requires both anoxic growth conditions and co-expression of NifH and NifM with NifU and NifS. Our results show the convenience of using mitochondria to host nitrogenase components, thus providing instrumental technology for the grand challenge of engineering N2-fixing cereals.

  13. Suppression subtraction hybridization (SSH) and macroarray techniques reveal differential gene expression profiles in brain of sea bream infected with nodavirus.

    PubMed

    Dios, S; Poisa-Beiro, L; Figueras, A; Novoa, B

    2007-03-01

    Despite of the impact that viruses have on aquatic organisms, relatively little is known on how fish fight against these infections. In this work, the brain gene expression pattern of sea bream (Sparus aurata) in response to nodavirus infection was investigated. We used the suppression subtractive hybridization (SSH) method to generate a subtracted cDNA library enriched with gene transcripts differentially expressed after 1 day post-infection. Some of the ESTs from the infected tissues fell in gene categories related to stress and immune responses. For the reverse library (ESTs expressed in controls compared with infected tissues) the most abundant transcripts were of ribosomal and mitochondrial nature. Several ESTs potentially induced by virus exposure were selected for in vivo expression studies. We observed a clear difference in expression between infected and control samples for two candidate genes, ubiquitin conjugating enzyme 7 interacting protein, which seems to play an important role in apoptosis and the interferon induced protein with helicase C domain 1 (mda-5) that contributes to apoptosis and regulates the type I IFN production, a key molecule of the antiviral innate response in most organisms.

  14. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    SciTech Connect

    Jandova, Jana; Janda, Jaroslav; Sligh, James E

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  15. Differential microRNA expression is associated with androgen receptor expression in breast cancer.

    PubMed

    Shi, Yaqin; Yang, Fang; Sun, Zijia; Zhang, Wenwen; Gu, Jun; Guan, Xiaoxiang

    2017-01-01

    The androgen receptor (AR) is frequently expressed in breast cancer; however, its prognostic value remains unclear. AR expression in breast cancer has been associated with improved outcomes in estrogen receptor (ER)‑positive breast cancer compared with ER‑negative disease. Eliminating AR function in breast cancer is critically important for breast cancer progression. However, the mechanism underlying AR regulation remains poorly understood. The study of microRNAs (miRNAs) has provided important insights into the pathogenesis of hormone‑dependent cancer. To determine whether miRNAs function in the AR regulation of breast cancer, the present study performed miRNA expression profiling in AR‑positive and ‑negative breast cancer cell lines. A total of 153 miRNAs were differentially expressed in AR‑positive compared with AR‑negative breast cancer cells; 52 were upregulated and 101 were downregulated. A number of these have been extensively associated with breast cancer cell functions, including proliferation, invasion and drug‑resistance. Furthermore, through pathway enrichment analysis, signaling pathways associated with the prediction targets of the miRNAs were characterized, including the vascular endothelial growth factor and mammalian target of rapamycin signaling pathways. In conclusion, the results of the present study indicated that the expression of miRNAs may be involved in the mechanism underlying AR regulation of breast cancer, and may improve understanding of the role of AR in breast cancer.

  16. Personalized Identification of Differentially Expressed Modules in Osteosarcoma

    PubMed Central

    Liu, Xiaozhou; Li, Chengjun; Zhang, Lei; Shi, Xin; Wu, Sujia

    2017-01-01

    Background Osteosarcoma (OS), an aggressive malignant neoplasm, is the most common primary bone cancer mainly in adolescents and young adults. Differentially expressed modules tend to distinguish differences integrally. Identifying modules individually has been crucial for understanding OS mechanisms and applications of custom therapeutic decisions in the future. Material/Methods Samples came from individuals were used from control group (n=15) and OS group (n=84). Based on clique-merging, module-identification algorithm was used to identify modules from OS PPI networks. A novel approach – the individualized module aberrance score (iMAS) was performed to distinguish differences, making special use of accumulated normal samples (ANS). We performed biological process ontology to classify functionally modules. Then Support Vector Machine (SVM) was used to test distribution results of normal and OS group with screened modules. Results We identified 83 modules containing 2084 genes from PPI network in which 61 modules were significantly different. Cluster analysis of OS using the iMAS method identified 5 modules clusters. Specificity=1.00 and Sensitivity=1.00 proved the distribution outcomes of screened modules were mainly consistent with that of total data, which suggested the efficiency of 61 modules. Conclusions We conclude that a novel pipeline that identified the dysregulated modules in individuals of OS. The constructed process is expected to aid in personalized health care, which may present fruitful strategies for medical therapy. PMID:28190021

  17. Differential Expression of the Three Multicopper Oxidases from Myxococcus xanthus▿

    PubMed Central

    Sánchez-Sutil, María Celestina; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Martins, Lígia O.; Pérez, Juana; Muñoz-Dorado, José

    2007-01-01

    Myxococcus xanthus is a soil bacterium that undergoes a unique life cycle among the prokaryotes upon starvation, which includes the formation of macroscopic structures, the fruiting bodies, and the differentiation of vegetative rods into coccoid myxospores. This peculiarity offers the opportunity to study the copper response in this bacterium in two different stages. In fact, M. xanthus vegetative rods exhibit 15-fold-greater resistance against copper than developing cells. However, cells preadapted to this metal reach the same levels of resistance during both stages. Analysis of the M. xanthus genome reveals that many of the genes involved in copper resistance are redundant, three of which encode proteins of the multicopper oxidase family (MCO). Each MCO gene exhibits a different expression profile in response to external copper addition. Promoters of cuoA and cuoB respond to Cu(II) ions during growth and development; however, they show a 10-fold-increased copper sensitivity during development. The promoter of cuoC shows copper-independent induction upon starvation, but it is copper up-regulated during growth. Phenotypic analyses of deletion mutants reveal that CuoB is involved in the primary copper-adaptive response; CuoA and CuoC are necessary for the maintenance of copper tolerance; and CuoC is required for normal development. These roles seem to be carried out through cuprous oxidase activity. PMID:17483223

  18. DCGL v2.0: An R Package for Unveiling Differential Regulation from Differential Co-expression

    PubMed Central

    Liu, Bao-Hong; Zhao, Zhongming; Liu, Lei; Ma, Liang-Xiao; Li, Yi-Xue; Li, Yuan-Yuan

    2013-01-01

    Motivation Differential co-expression analysis (DCEA) has emerged in recent years as a novel, systematic investigation into gene expression data. While most DCEA studies or tools focus on the co-expression relationships among genes, some are developing a potentially more promising research domain, differential regulation analysis (DRA). In our previously proposed R package DCGL v1.0, we provided functions to facilitate basic differential co-expression analyses; however, the output from DCGL v1.0 could not be translated into differential regulation mechanisms in a straightforward manner. Results To advance from DCEA to DRA, we upgraded the DCGL package from v1.0 to v2.0. A new module named “Differential Regulation Analysis” (DRA) was designed, which consists of three major functions: DRsort, DRplot, and DRrank. DRsort selects differentially regulated genes (DRGs) and differentially regulated links (DRLs) according to the transcription factor (TF)-to-target information. DRrank prioritizes the TFs in terms of their potential relevance to the phenotype of interest. DRplot graphically visualizes differentially co-expressed links (DCLs) and/or TF-to-target links in a network context. In addition to these new modules, we streamlined the codes from v1.0. The evaluation results proved that our differential regulation analysis is able to capture the regulators relevant to the biological subject. Conclusions With ample functions to facilitate differential regulation analysis, DCGL v2.0 was upgraded from a DCEA tool to a DRA tool, which may unveil the underlying differential regulation from the observed differential co-expression. DCGL v2.0 can be applied to a wide range of gene expression data in order to systematically identify novel regulators that have not yet been documented as critical. Availability DCGL v2.0 package is available at http://cran.r-project.org/web/packages/DCGL/index.html or at our project home page http://lifecenter.sgst.cn/main/en/dcgl.jsp. PMID

  19. Effects of Eicosapentaenoic Acid and Docosahexaenoic Acid on Mitochondrial DNA Replication and PGC-1α Gene Expression in C2C12 Muscle Cells

    PubMed Central

    Lee, Mak-Soon; Shin, Yoonjin; Moon, Sohee; Kim, Seunghae; Kim, Yangha

    2016-01-01

    Mitochondrial biogenesis is a complex process requiring coordinated expression of nuclear and mitochondrial genomes. The peroxisome proliferator-activated receptor gamma co-activator 1-alpha (PGC-1α) is a key regulator of mitochondrial biogenesis, and it controls mitochondrial DNA (mtDNA) replication within diverse tissues, including muscle tissue. The aim of this study was to investigate the effects of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) on mtDNA copy number and PGC-1α promoter activity in C2C12 muscle cells. mtDNA copy number and mRNA levels of genes related to mitochondrial biogenesis such as PGC-1α, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (Tfam) were assayed by quantitative real-time PCR. The PGC-1α promoter from −970 to +412 bp was subcloned into the pGL3-basic vector, which includes a luciferase reporter gene. Both EPA and DHA significantly increased mtDNA copy number, dose and time dependently, and up-regulated mRNA levels of PGC-1α, NRF1, and Tfam. Furthermore, EPA and DHA stimulated PGC-1α promoter activity in a dose-dependent manner. These results suggest that EPA and DHA may modulate mitochondrial biogenesis, which was partially associated with increased mtDNA replication and PGC-1α gene expression in C2C12 muscle cells. PMID:28078253

  20. Effects of Eicosapentaenoic Acid and Docosahexaenoic Acid on Mitochondrial DNA Replication and PGC-1α Gene Expression in C2C12 Muscle Cells.

    PubMed

    Lee, Mak-Soon; Shin, Yoonjin; Moon, Sohee; Kim, Seunghae; Kim, Yangha

    2016-12-01

    Mitochondrial biogenesis is a complex process requiring coordinated expression of nuclear and mitochondrial genomes. The peroxisome proliferator-activated receptor gamma co-activator 1-alpha (PGC-1α) is a key regulator of mitochondrial biogenesis, and it controls mitochondrial DNA (mtDNA) replication within diverse tissues, including muscle tissue. The aim of this study was to investigate the effects of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) on mtDNA copy number and PGC-1α promoter activity in C2C12 muscle cells. mtDNA copy number and mRNA levels of genes related to mitochondrial biogenesis such as PGC-1α, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (Tfam) were assayed by quantitative real-time PCR. The PGC-1α promoter from -970 to +412 bp was subcloned into the pGL3-basic vector, which includes a luciferase reporter gene. Both EPA and DHA significantly increased mtDNA copy number, dose and time dependently, and up-regulated mRNA levels of PGC-1α, NRF1, and Tfam. Furthermore, EPA and DHA stimulated PGC-1α promoter activity in a dose-dependent manner. These results suggest that EPA and DHA may modulate mitochondrial biogenesis, which was partially associated with increased mtDNA replication and PGC-1α gene expression in C2C12 muscle cells.

  1. Metformin-induced inhibition of the mitochondrial respiratory chain increases FGF21 expression via ATF4 activation

    SciTech Connect

    Kim, Kook Hwan; Jeong, Yeon Taek; Kim, Seong Hun; Jung, Hye Seung; Park, Kyong Soo; Lee, Hae-Youn; Lee, Myung-Shik

    2013-10-11

    Highlights: •Metformin induces FGF21 expression in an AMPK independent manner. •Metformin enhances FGF21 expression by inhibiting mitochondrial complex I activity. •The PERK-eIF2α-ATF4 axis is required for metformin-induced FGF21 expression. •Metformin activates the ATF4-FGF21 axis in the liver of mouse. •Metformin increases serum FGF21 level in diabetic human subjects. -- Abstract: Fibroblast growth factor 21 (FGF21) is an endocrine hormone that exhibits anti-obesity and anti-diabetes effects. Because metformin is widely used as a glucose-lowering agent in patients with type 2 diabetes (T2D), we investigated whether metformin modulates FGF21 expression in cell lines, and in mice or human subjects. We found that metformin increased the expression and release of FGF21 in a diverse set of cell types, including rat hepatoma FaO, primary mouse hepatocytes, and mouse embryonic fibroblasts (MEFs). Intriguingly, AMP-activated protein kinase (AMPK) was dispensable for the induction of FGF21 by metformin. Mammalian target of rapamycin complex 1 (mTORC1) and peroxisome proliferator-activated receptor α (PPARα), which are additional targets of metformin, were not involved in metformin-induced FGF21 expression. Importantly, inhibition of mitochondrial complex I activity by metformin resulted in FGF21 induction through PKR-like ER kinase (PERK)-eukaryotic translation factor 2α (eIF2α)-activating transcription factor 4 (ATF4). We showed that metformin activated ATF4 and increased FGF21 expression in the livers of mice, which led to increased serum levels of FGF21. We also found that serum FGF21 level was increased in human subjects with T2D after metformin therapy for 6 months. In conclusion, our results indicate that metformin induced expression of FGF21 through an ATF4-dependent mechanism by inhibiting mitochondrial respiration independently of AMPK. Therefore, FGF21 induction by metformin might explain a portion of the beneficial metabolic effects of metformin.

  2. The tissue-specific expression and developmental regulation of two nuclear genes encoding rat mitochondrial proteins. Medium chain acyl-CoA dehydrogenase and mitochondrial malate dehydrogenase.

    PubMed

    Kelly, D P; Gordon, J I; Alpers, R; Strauss, A W

    1989-11-15

    To study the regulation of nuclear genes which encode mitochondrial enzymes involved in oxidative metabolism, absolute levels of mRNA encoding rat medium chain acyl-CoA dehydrogenase (MCAD) and rat mitochondrial malate dehydrogenase (mMDH) were determined in developing and adult male rat tissues. MCAD mRNA is expressed in a variety of adult male tissues with highest steady state levels in heart, adrenal, and skeletal muscle and lowest levels in brain, lung, and testes. In comparison, steady state levels of mMDH mRNA in adult male rat tissues were similar to those of MCAD mRNA in heart, small intestine, adrenal, and skeletal muscle but markedly different in brain, stomach, and testes. Thus, the steady-state levels of MCAD and mMDH mRNA are highest in adult tissues with high energy requirements. Dot blot analysis of RNA prepared from late fetal, suckling, and weaning rat heart, liver, and brain demonstrated the presence of MCAD and mMDH mRNA during the fetal period in all three tissues. Both MCAD and mMDH mRNA levels increased 2-2.5-fold at birth followed by a decline during the first postnatal week in heart and liver. The patterns of accumulation of these mRNAs in heart and liver during the weaning and early adult periods were also similar, although the absolute levels were significantly different. Brain MCAD mRNA levels were consistently low (less than 0.1 pg/micrograms total cellular RNA) throughout the developmental stages. However, brain mMDH mRNA levels exhibited a marked increase during the weaning period, reaching a peak concentration which is higher than the level of mMDH mRNA in heart and liver at any point during development. These results indicate that the level of expression of the nuclear genes encoding MCAD and mMDH is tissue-specific and developmentally regulated. The patterns of MCAD and mMDH mRNA accumulation parallel the changes in energy metabolism which occur during development and among adult tissues.

  3. Identification of a gene for pyruvate-insensitive mitochondrial alternative oxidase expressed in the thermogenic appendices in Arum maculatum.

    PubMed

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S; Moore, Anthony L

    2011-12-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum.

  4. Cloning, characterization, and expression of Cytochrome b ( Cytb)—a key mitochondrial gene from Prorocentrum donghaiense

    NASA Astrophysics Data System (ADS)

    Zhao, Liyuan; Mi, Tiezhu; Zhen, Yu; Yu, Zhigang

    2012-05-01

    Mitochondrial cytochrome b (Cytb), one of the few proteins encoded by the mitochondrial DNA, plays an important role in transferring electrons. As a mitochondrial gene, it has been widely used for phylogenetic analysis. Previously, a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense, which might prove useful for resolving P. donghaiense from closely related species. However, the full-length coding region has not been characterized. In this study, we used rapid amplification of cDNA ends (RACE) to obtain full-length, 1 124 bp cDNA. Cytb transcript contained a standard initiation codon ATG, but did not have a recognizable stop codon. Homology comparison showed that the P. donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species. Phylogenetic analysis placed Cytb from P. donghaiense in the clade of dinoflagellates and it clustered together strongly with that from P. minimum. Based on the full-length sequence, we inferred 32 editing events at different positions, accounting for 2.93% of the Cytb gene. 34.4% (11) of the changes were A to G, 25% (8) were T to C, and 25% (8) were C to U, with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2), respectively). The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase. The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle, and the expression of Cytb was relatively stable over the different phases. These results deepen our understanding of the structure and characteristics of Cytb in P. donghaiense, and confirmed that Cytb in P. donghaiense is a candidate reference gene for studying the expression of other genes.

  5. Adaptive expression responses in the Pol-γ null strain of S. pombe depleted of mitochondrial genome

    PubMed Central

    Chu, Zhaoqing; Li, Juntao; Eshaghi, Majid; Karuturi, R Krishna Murthy; Lin, Kui; Liu, Jianhua

    2007-01-01

    Background DNA polymerase γ(Pol-γ) has been shown to be essential for maintenance of the mitochondrial genome (mtDNA) in the petite-positive budding yeast Saccharomyces cerevisiae. Budding yeast cells lacking mitochondria exhibit a slow-growing or petite-colony phenotype. Petite strains fail to grow on non-fermentable carbon sources. However, it is not clear whether the Pol-γ is required for mtDNA maintenance in the petite-negative fission yeast Schizosaccharomyces pombe. Results We show that disruption of the nuclear gene pog1+ that encodes Pol-γ is sufficient to deplete mtDNA in S. pombe. Cells bearing pog1Δ allele require substantial growth periods to form petite colonies. Mitotracker assays indicate that pog1Δ cells are defective in mitochondrial function and EM analyses suggest that pog1Δ cells lack normal mitochondrial structures. Depletion of mtDNA in pog1Δ cells is evident from quantitative real-time PCR assays. Genome-wide expression profiles of pog1Δ and other mtDNA-less cells reveal that many genes involved in response to stimulus, energy derivation by oxidation of organic compounds, cellular carbohydrate metabolism, and energy reserve metabolism are induced. Conversely, many genes encoding proteins involved in amino acid metabolism and oxidative phosphorylation are repressed. Conclusion By showing that Pol-γ is essential for mtDNA maintenance and disruption of pog1+ alters the genome-wide expression profiles, we demonstrated that cells lacking mtDNA exhibit adaptive nuclear gene expression responses in the petite-negative S. pombe. PMID:17868468

  6. Two ovine mitochondrial DNAs harboring a fifth 75/76 bp repeat motif without altered gene expression in Northern Spain.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Cardoso, S; Palencia-Madrid, L; Juste, R A; De Pancorbo, M M

    2017-03-01

    The Basque Country is home to the Latxa sheep breed, which is divided in several varieties such as Latxa Black Face (LBKF) and Latxa Blonde Face (LBLF). Mitochondrial DNA control region analysis of 174 male sheep (97 LBKF and 77 LBLF) was performed with the objective of characterizing the maternal lineages of these two varieties that are the basis to produce the cheese with Idiazabal quality label. The percentage of unique haplotypes was 77.32% in LBKF and 67.53% in LBLF. Most of the individuals were classified into B haplogroup (98.85%), while A haplogroup was much less frequent. Two Latxa individuals (one LBKF and one LBLF), both belonging to B haplogroup, displayed an additional 75/76 bp tandem repeat motif. Only 33 other sequences with this repeat motif were found among 11 061 sheep sequences included in the GenBank database. Gene expression was analyzed in peripheral blood leukocytes since the additional 75/76 bp repeat motif falls within ETAS1, a domain with a possible function in regulation of replication and transcription. The mRNA expression from four mitochondrial genes (COI, cyt b, ND1, and ND2) was analyzed in the two individuals of this study with a fifth repeat motif and in four without it. Although lower transcription was observed when the additional 75/76 bp repeat motif was present, no statistically significant differences were observed. Therefore, the variation in the number of the 75/76 repeat motif does not seem to modify the gene expression rate in mitochondrial genes.

  7. Effects of minimally toxic levels of carbonyl cyanide P-(trifluoromethoxy) phenylhydrazone (FCCP), elucidated through differential gene expression with biochemical and morphological correlations.

    PubMed

    Kuruvilla, Sabu; Qualls, Charles W; Tyler, Ronald D; Witherspoon, Sam M; Benavides, Gina R; Yoon, Lawrence W; Dold, Karen; Brown, Roger H; Sangiah, Subbiah; Morgan, Kevin T

    2003-06-01

    Uncouplers of oxidative phosphorylation have relevance to bioenergetics and obesity. The mechanisms of action of chemical uncouplers of oxidative phosphorylation on biological systems were evaluated using differential gene expression. The transcriptional response in human rhabdomyosarcoma cell line (RD), was elucidated following treatment with carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone (FCCP), a classical uncoupling agent. Changes in mitochondrial membrane potential were used as the biological dosimeter. There was an increase in membrane depolarization with increasing concentrations of FCCP. The concentration at 75% uncoupling (20 microM) was chosen to study gene expression changes, using cDNA-based large-scale differential gene expression (LSDGE) platforms. At the above concentration, subtle light microscopic and clear gene expression changes were observed at 1, 2, and 10 h. Statistically significant transcriptional changes were largely associated with protein synthesis, cell cycle regulation, cytoskeletal proteins, energy metabolism, apoptosis, and inflammatory mediators. Bromodeoxyuridine (BrdU) and propidium iodide (PI) assays revealed cell cycle arrest to occur in the G1 and S phases. There was a significant initial decrease in the intracellular adenosine triphosphate (ATP) concentrations. The following seven genes were selected as potential molecular markers for chemical uncouplers: seryl-tRNA synthetase (Ser-tRS), glutamine-hydrolyzing asparagine synthetase (Glut-HAS), mitochondrial bifunctional methylenetetrahydrofolate dehydrogenase (Mit BMD), mitochondrial heat shock 10-kDa protein (Mit HSP 10), proliferating cyclic nuclear antigen (PCNA), cytoplasmic beta-actin (Act B), and growth arrest and DNA damage-inducible protein 153 (GADD153). Transcriptional changes of all seven genes were later confirmed with reverse transcription-polymerase chain reaction (RT-PCR). These results suggest that gene expression changes may provide a sensitive indicator

  8. Differential Binding of Mitochondrial Transcripts by MRB8170 and MRB4160 Regulates Distinct Editing Fates of Mitochondrial mRNA in Trypanosomes

    PubMed Central

    Dixit, Sameer; Müller-McNicoll, Michaela; David, Vojtěch; Zarnack, Kathi; Ule, Jernej; Hashimi, Hassan

    2017-01-01

    ABSTRACT A dozen mRNAs are edited by multiple insertions and/or deletions of uridine residues in the mitochondrion of Trypanosoma brucei. Several protein complexes have been implicated in performing this type of RNA editing, including the mitochondrial RNA-binding complex 1 (MRB1). Two paralogous novel RNA-binding proteins, MRB8170 and MRB4160, are loosely associated with the core MRB1 complex. Their roles in RNA editing and effects on target mRNAs are so far not well understood. In this study, individual-nucleotide-resolution UV-cross-linking and affinity purification (iCLAP) revealed a preferential binding of both proteins to mitochondrial mRNAs, which was positively correlated with their extent of editing. Integrating additional in vivo and in vitro data, we propose that binding of MRB8170 and/or MRB4160 onto pre-mRNA marks it for the initiation of editing and that initial binding of both proteins may facilitate the recruitment of other components of the RNA editing/processing machinery to ensure efficient editing. Surprisingly, MRB8170 also binds never-edited mRNAs, suggesting that at least this paralog has an additional role outside RNA editing to shape the mitochondrial transcriptome. PMID:28143982

  9. Mitochondrial Gene Expression Profiles and Metabolic Pathways in the Amygdala Associated with Exaggerated Fear in an Animal Model of PTSD

    PubMed Central

    Li, He; Li, Xin; Smerin, Stanley E.; Zhang, Lei; Jia, Min; Xing, Guoqiang; Su, Yan A.; Wen, Jillian; Benedek, David; Ursano, Robert

    2014-01-01

    The metabolic mechanisms underlying the development of exaggerated fear in post-traumatic stress disorder (PTSD) are not well defined. In the present study, alteration in the expression of genes associated with mitochondrial function in the amygdala of an animal model of PTSD was determined. Amygdala tissue samples were excised from 10 non-stressed control rats and 10 stressed rats, 14 days post-stress treatment. Total RNA was isolated, cDNA was synthesized, and gene expression levels were determined using a cDNA microarray. During the development of the exaggerated fear associated with PTSD, 48 genes were found to be significantly upregulated and 37 were significantly downregulated in the amygdala complex based on stringent criteria (p < 0.01). Ingenuity pathway analysis revealed up- or downregulation in the amygdala complex of four signaling networks – one associated with inflammatory and apoptotic pathways, one with immune mediators and metabolism, one with transcriptional factors, and one with chromatin remodeling. Thus, informatics of a neuronal gene array allowed us to determine the expression profile of mitochondrial genes in the amygdala complex of an animal model of PTSD. The result is a further understanding of the metabolic and neuronal signaling mechanisms associated with delayed and exaggerated fear. PMID:25295026

  10. Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report on the assembly of the 14,146 base pairs (bp) near complete mitochondrial sequencing of the legume pod borer (LPB), Maruca vitrata (Lepidoptera: Crambidae), which was used to estimate divergence and relationships within the lepidopteran lineage. Arrangement and orientation of 13 protein c...

  11. Arsenic-induced mitochondrial oxidative damage is mediated by decreased PGC-1α expression and its downstream targets in rat brain.

    PubMed

    Prakash, Chandra; Kumar, Vijay

    2016-08-25

    The present study was carried out to investigate the molecular mechanism of arsenic-induced mitochondrial oxidative damage and its relation to biogenesis in rat brain. Chronic sodium arsenite (25 ppm, orally) administration for 12 weeks decreased mitochondrial complexes activities and mRNA expression of selective complexes subunits. The expression of mitochondrial biogenesis regulator PGC-1α, and its downstream targets NRF-1, NRF-2 and Tfam were decreased significantly both at mRNA and protein levels suggesting impaired biogenesis following chronic arsenic-exposure. In addition to this, protein expression analysis also revealed activation of Bax and caspase-3, leading to translocation of cytochrome c from mitochondria to cytosol suggesting induction of apoptotic pathway under oxidative stress. This was further confirmed by electron microscopy study which depicted morphological changes in mitochondria in terms of altered nuclear and mitochondrial shape and chromatin condensation in arsenic-treated rats. The immunohistochemical studies showed both nuclear and cytosolic localization of NRF-1 and NRF-2 in arsenic-exposed rat brain further suggesting regulatory role of these transcription factors under arsenic neurotoxicity. The results of present study indicate that arsenic-induced mitochondrial oxidative damage is associated with decreased mitochondrial biogenesis in rat brain that may present as important target to reveal the mechanism for arsenic-induced neurotoxicity.

  12. Differential Expression of Genes that Control Respiration Contribute to Thermal Adaptation in Redband Trout (Oncorhynchus mykiss gairdneri)

    PubMed Central

    Garvin, Michael R.; Thorgaard, Gary H.; Narum, Shawn R.

    2015-01-01

    Organisms can adapt to local environmental conditions as a plastic response or become adapted through natural selection on genetic variation. The ability to adapt to increased water temperatures will be of paramount importance for many fish species as the climate continues to warm and water resources become limited. Because increased water temperatures will reduce the dissolved oxygen available for fish, we hypothesized that adaptation to low oxygen environments would involve improved respiration through oxidative phosphorylation (OXPHOS). To test this hypothesis, we subjected individuals from two ecologically divergent populations of inland (redband) rainbow trout (Oncorhynchus mykiss gairdneri) with historically different temperature regimes (desert and montane) and their F1 progeny to diel cycles of temperature stress and then examined gene expression data for 80 nuclear- and mitochondrial-encoded OXPHOS subunits that participate in respiration. Of the 80 transcripts, 7 showed ≥ 2-fold difference in expression levels in gill tissue from desert fish under heat stress whereas the montane fish had none and the F1 only had one differentially expressed gene. A structural analysis of the proteins encoded by those genes suggests that the response could coordinate the formation of supercomplexes and oligomers. Supercomplexes may increase the efficiency of respiration because complexes I, III, and IV are brought into close proximity and oligomerization of complex V alters the macrostructure of mitochondria to improve respiration. Significant differences in gene expression patterns in response to heat stress in a common environment indicate that the response was not due to plasticity but had a genetic basis. PMID:25943341

  13. Differential Expression of Genes that Control Respiration Contribute to Thermal Adaptation in Redband Trout (Oncorhynchus mykiss gairdneri).

    PubMed

    Garvin, Michael R; Thorgaard, Gary H; Narum, Shawn R

    2015-05-04

    Organisms can adapt to local environmental conditions as a plastic response or become adapted through natural selection on genetic variation. The ability to adapt to increased water temperatures will be of paramount importance for many fish species as the climate continues to warm and water resources become limited. Because increased water temperatures will reduce the dissolved oxygen available for fish, we hypothesized that adaptation to low oxygen environments would involve improved respiration through oxidative phosphorylation (OXPHOS). To test this hypothesis, we subjected individuals from two ecologically divergent populations of inland (redband) rainbow trout (Oncorhynchus mykiss gairdneri) with historically different temperature regimes (desert and montane) and their F1 progeny to diel cycles of temperature stress and then examined gene expression data for 80 nuclear- and mitochondrial-encoded OXPHOS subunits that participate in respiration. Of the 80 transcripts, 7 showed ≥ 2-fold difference in expression levels in gill tissue from desert fish under heat stress whereas the montane fish had none and the F1 only had one differentially expressed gene. A structural analysis of the proteins encoded by those genes suggests that the response could coordinate the formation of supercomplexes and oligomers. Supercomplexes may increase the efficiency of respiration because complexes I, III, and IV are brought into close proximity and oligomerization of complex V alters the macrostructure of mitochondria to improve respiration. Significant differences in gene expression patterns in response to heat stress in a common environment indicate that the response was not due to plasticity but had a genetic basis.

  14. Protein palmitoylation regulates osteoblast differentiation through BMP-induced osterix expression.

    PubMed

    Leong, Wai Fook; Zhou, Tielin; Lim, Gek Liang; Li, Baojie

    2009-01-01

    Osteoporosis is one of the most common diseases and can be treated by either anti-resorption drugs, anabolic drugs, or both. To search for anabolic drug targets for osteoporosis therapy, it is crucial to understand the biology of bone forming cells, osteoblasts, in terms of their proliferation, differentiation, and function. Here we found that protein palmitoylation participates in signaling pathways that control osterix expression and osteoblast differentiation. Mouse calvarial osteoblasts express most of the 24 palmitoyl transferases, with some being up-regulated during differentiation. Inhibition of protein palmitoylation, with a substrate-analog inhibitor, diminished osteoblast differentiation and mineralization, but not proliferation or survival. The decrease in differentiation capacity is associated with a reduction in osterix, but not Runx2 or Atf4. Inhibition of palmitoyl transferases had little effect in p53(-/-) osteoblasts that show accelerated differentiation due to overexpression of osterix, suggesting that osterix, at least partially, mediated the effect of inhibition of palmitoyl transferases on osteoblast differentiation. BMPs are the major driving force of osteoblast differentiation in the differentiation assays. We found that inhibition of palmitoyl transferases also compromised BMP2-induced osteoblast differentiation through down-regulating osterix induction. However, palmitoyl transferases inhibitor did not inhibit Smad1/5/8 activation. Instead, it compromised the activation of p38 MAPK, which are known positive regulators of osterix expression and differentiation. These results indicate that protein palmitoylation plays an important role in BMP-induced MAPK activation, osterix expression, and osteoblast differentiation.

  15. Mitochondrial Gene Expression Profiles Are Associated with Maternal Psychosocial Stress in Pregnancy and Infant Temperament

    PubMed Central

    Lambertini, Luca; Chen, Jia; Nomura, Yoko

    2015-01-01

    Background Gene-environment interactions mediate through the placenta and shape the fetal brain development. Between the environmental determinants of the fetal brain, maternal psychosocial stress in pregnancy has been shown to negatively influence the infant temperament development. This in turn may have adverse consequences on the infant neurodevelopment extending throughout the entire life-span. However little is known about the underlying biological mechanisms of the effects of maternal psychosocial stress in pregnancy on infant temperament. Environmental stressors such as maternal psychosocial stress in pregnancy activate the stress response cascade that in turn drives the increase in the cellular energy demand of vital organs with high metabolic rates such as, in pregnancy, the placenta. Key players of the stress response cascade are the mitochondria. Results Here, we tested the expression of all 13 protein-coding genes encoded by the mitochondria in 108 placenta samples from the Stress in Pregnancy birth cohort, a study that aims at determining the influence of in utero exposure to maternal psychosocial stress in pregnancy on infant temperament. We showed that the expression of the protein-coding mitochondrial-encoded gene MT-ND2 was positively associated with indices of maternal psychosocial stress in pregnancy including Prenatal Perceived Stress (β = 0.259; p-regression = 0.004; r2-regression = 0.120), State Anxiety (β = 0.218; p-regression = 0.003; r2-regression = 0.153), Trait Anxiety (β = 0.262; p-regression = 0.003; r2-regression = 0.129) and Pregnancy Anxiety Total (β = 0.208; p-regression = 0.010; r2-regression = 0.103). In the meantime MT-ND2 was negatively associated with the infant temperament indices of Activity Level (β = -0.257; p-regression = 0.008; r2-regression = 0.165) and Smile and Laughter (β = -0.286; p-regression = 0.036; r2-regression = 0.082). Additionally, MT-ND6 was associated with the maternal psychosocial stress in pregnancy

  16. Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African-American Prostate Cancer

    DTIC Science & Technology

    2015-10-01

    RNA and annotated. In addition, we have developed SSOs to manipulate PIK3CD alternative splicing, to correct aberrant splicing leading to production...molecular mechanisms, differential gene expression, alternative RNA splicing, epigenetic alterations, clinical tumor aggressiveness 16. SECURITY...words): Prostate cancer, health disparities among racial groups, molecular mechanisms, differential gene expression, alternative RNA splicing

  17. Differential 3-bromopyruvate inhibition of cytosolic and mitochondrial human serine hydroxymethyltransferase isoforms, key enzymes in cancer metabolic reprogramming.

    PubMed

    Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto

    2016-11-01

    The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP.

  18. High Expression of Nuclear Factor 90 (NF90) Leads to Mitochondrial Degradation in Skeletal and Cardiac Muscles

    PubMed Central

    Kakinuma, Yoshihiko; Kai, Shoko; Yagyu, Ken-ichi; Todaka, Hiroshi; Chi, Eunsup; Okada, Shoshiro; Ujihara, Takako; Morisawa, Keiko; Ono, Masafumi; Sugiyama, Yasunori; Ishida, Waka; Fukushima, Atsuki; Tsuda, Masayuki; Agata, Yasutoshi; Taniguchi, Taketoshi

    2012-01-01

    While NF90 has been known to participate in transcription, translation and microRNA biogenesis, physiological functions of this protein still remain unclear. To uncover this, we generated transgenic (Tg) mice using NF90 cDNA under the control of β-actin promoter. The NF90 Tg mice exhibited a reduction in body weight compared with wild-type mice, and a robust expression of NF90 was detected in skeletal muscle, heart and eye of the Tg mice. To evaluate the NF90 overexpression-induced physiological changes in the tissues, we performed a number of analyses including CT-analysis and hemodynamic test, revealing that the NF90 Tg mice developed skeletal muscular atrophy and heart failure. To explore causes of the abnormalities in the NF90 Tg mice, we performed histological and biochemical analyses for the skeletal and cardiac muscles of the Tg mice. Surprisingly, these analyses demonstrated that mitochondria in those muscular tissues of the Tg mice were degenerated by autophagy. To gain further insight into the cause for the mitochondrial degeneration, we identified NF90-associated factors by peptide mass fingerprinting. Of note, approximately half of the NF90-associated complexes were ribosome-related proteins. Interestingly, protein synthesis rate was significantly suppressed by high-expression of NF90. These observations suggest that NF90 would negatively regulate the function of ribosome via its interaction with the factors involved in the ribosome function. Furthermore, we found that the translations or protein stabilities of PGC-1 and NRF-1, which are critical transcription factors for expression of mitochondrial genes, were significantly depressed in the skeletal muscles of the NF90 Tg mice. Taken together, these findings suggest that the mitochondrial degeneration engaged in the skeletal muscle atrophy and the heart failure in the NF90 Tg mice may be caused by NF90-induced posttranscriptional repression of transcription factors such as PGC-1 and NRF-1 for

  19. Isolation of Mitochondrial Ribosomes.

    PubMed

    Carroll, Adam J

    2017-01-01

    Translation of mitochondrial encoded mRNAs by mitochondrial ribosomes is thought to play a major role in regulating the expression of mitochondrial proteins. However, the structure and function of plant mitochondrial ribosomes remains poorly understood. To study mitochondrial ribosomes, it is necessary to separate them from plastidic and cytosolic ribosomes that are generally present at much higher concentrations. Here, a straight forward protocol for the preparation of fractions highly enriched in mitochondrial ribosomes from plant cells is described. The method begins with purification of mitochondria followed by mitochondrial lysis and ultracentrifugation of released ribosomes through sucrose cushions and gradients. Dark-grown Arabidopsis cells were used in this example because of the ease with which good yields of pure mitochondria can be obtained from them. However, the steps for isolation of ribosomes from mitochondria could be applied to mitochondria obtained from other sources. Proteomic analyses of resulting fractions have confirmed strong enrichment of mitochondrial ribosomal proteins.

  20. Resistance of glia-like central and peripheral neural stem cells to genetically induced mitochondrial dysfunction--differential effects on neurogenesis.

    PubMed

    Díaz-Castro, Blanca; Pardal, Ricardo; García-Flores, Paula; Sobrino, Verónica; Durán, Rocío; Piruat, José I; López-Barneo, José

    2015-11-01

    Mitochondria play a central role in stem cell homeostasis. Reversible switching between aerobic and anaerobic metabolism is critical for stem cell quiescence, multipotency, and differentiation, as well as for cell reprogramming. However, the effect of mitochondrial dysfunction on neural stem cell (NSC) function is unstudied. We have generated an animal model with homozygous deletion of the succinate dehydrogenase subunit D gene restricted to cells of glial fibrillary acidic protein lineage (hGFAP-SDHD mouse). Genetic mitochondrial damage did not alter the generation, maintenance, or multipotency of glia-like central NSCs. However, differentiation to neurons and oligodendrocytes (but not to astrocytes) was impaired and, hence, hGFAP-SDHD mice showed extensive brain atrophy. Peripheral neuronal populations were normal in hGFAP-SDHD mice, thus highlighting their non-glial (non hGFAP(+)) lineage. An exception to this was the carotid body, an arterial chemoreceptor organ atrophied in hGFAP-SDHD mice. The carotid body contains glia-like adult stem cells, which, as for brain NSCs, are resistant to genetic mitochondrial damage.

  1. Resistance of glia-like central and peripheral neural stem cells to genetically induced mitochondrial dysfunction—differential effects on neurogenesis

    PubMed Central

    Díaz-Castro, Blanca; Pardal, Ricardo; García-Flores, Paula; Sobrino, Verónica; Durán, Rocío; Piruat, José I; López-Barneo, José

    2015-01-01

    Mitochondria play a central role in stem cell homeostasis. Reversible switching between aerobic and anaerobic metabolism is critical for stem cell quiescence, multipotency, and differentiation, as well as for cell reprogramming. However, the effect of mitochondrial dysfunction on neural stem cell (NSC) function is unstudied. We have generated an animal model with homozygous deletion of the succinate dehydrogenase subunit D gene restricted to cells of glial fibrillary acidic protein lineage (hGFAP-SDHD mouse). Genetic mitochondrial damage did not alter the generation, maintenance, or multipotency of glia-like central NSCs. However, differentiation to neurons and oligodendrocytes (but not to astrocytes) was impaired and, hence, hGFAP-SDHD mice showed extensive brain atrophy. Peripheral neuronal populations were normal in hGFAP-SDHD mice, thus highlighting their non-glial (non hGFAP+) lineage. An exception to this was the carotid body, an arterial chemoreceptor organ atrophied in hGFAP-SDHD mice. The carotid body contains glia-like adult stem cells, which, as for brain NSCs, are resistant to genetic mitochondrial damage. PMID:26392570

  2. Analysis of differentially expressed lncRNAs in differentiation of bone marrow stem cells into neural cells.

    PubMed

    Wu, Ai-Min; Ni, Wen-Fei; Huang, Zhe-Yu; Li, Qing-Long; Wu, Jian-Bo; Xu, Hua-Zi; Yin, Li-Hui

    2015-04-15

    Many studies have reported micro RNAs involved in the differentiation of bone marrow mesenchymal stem cells (BMSCs) into neural cells; however, the roles of long non-coding RNAs (lncRNAs) in the differentiation of BMSCs into neural cells remain poorly understood. We used microarray assays to compare the lncRNA and messenger RNA (mRNA) expression profiles in BMSCs and neural-induced BMSCs. We found a total of 24 lncRNAs and 738 mRNAs that were upregulated and 32 lncRNAs and 682 mRNAs that were downregulated in samples induced for 3h; 27 lncRNAs and 864 mRNAs that were upregulated and 37 lncRNAs and 968 mRNAs that were downregulated in 6h samples; and 23 lncRNAs and 1159 mRNAs that were upregulated or downregulated in both the 3h and 6h samples. For 23 differentially lncRNAs and 83 differentially mRNAs, 256 matched lncRNA-mRNA pairs were found. GO (Gene ontology) analysis showed that these lncRNAs were associated with biological processes, cellular components, and molecular functions. Twenty-five pathways were identified by pathway analysis. Then, RT-qPCR validation of the differentially expressed H19, Esco2, Pcdhb18, and RGD1560277 genes confirmed the microarray data. Our study revealed the expression patterns of lncRNAs in the differentiation of BMSCs into neural cells, and many lncRNAs were differentially expressed in induced BMSCs, suggesting that they may play key roles in processes of differentiation. Our findings may promote the use of BMSCs to treat neurodegenerative diseases and trauma.

  3. Effects of mycoplasma contamination on phenotypic expression of mitochondrial mutants in human cells

    SciTech Connect

    Doersen, C.J.; Stanbridge, E.J.

    1981-04-01

    HeLa cells sensitive to the mitochondrial protein synthesis inhibitors erythromycin (ERY) and chloramphenicol (CAP) and HeLa variants resistant to the effects of these drugs were purposefully infected with drug-sensitive and -resistnat mycoplasma strains. Mycoplasma hyorhinis and the ERY-resistant strain of Mycoplasma orale, MO-ERY/sup r/, did not influence the growth of HeLa and ERY-resistant ERY2301 cells in the presence or absence of ERY. M. hyorhinis also did not affect the growth of HeLa and CAP-resistant Cap-2 cells in the presence or absence of CAP. However, both HeLa and Cap-2 cells infected with the CAP-resistant strain of M. hyorhinis, MH-CAP/sup r/, were more sensitive to the cytotoxix effect of CAP. This maybe due to the glucose dependence of the cells, which was compromised by the increased utilization of glucose by MH-CAP/sup r/ in these infected cell cultures. In vitro protein synthesis by isolated mitochondria was significantly altered by mycoplasma infection of the various cell lines. A substantial number of mycoplasmas copurified with the mitochondria, resulting in up to a sevenfold increase in the incorporation of (/sup 3/H)leucine into the trichloroacetic acid-insoluble material. More importantly, the apparent drug sensitivity or resistance of mitchondrial preparations from mycoplasma-infected cells reflected the drug sensitivity or resistance of the contaminating mycoplasmas. These results illustrate the hazards in interpreting mitochondrial protein synthesis data derived from mycoplasma-infected cell lines, particularly putative mitochondrially encoded mutants resistant to inhibitors of mitochondrial protein synthesis.

  4. Heterologous expression of human carnitine palmitoyltransferase (CPT) II in yeast: A model for the molecular analysis of mitochondrial fatty acid oxidation defects

    SciTech Connect

    Cavadini, P.; Invernizzi, F.; Baratta, S.

    1994-09-01

    The CPT enzyme system, which is composed of two distinct mitochondrial membrane-bound proteins (CPT I and CPT II), provides the mechanism whereby long-chain fatty acids are transferred from the cytosol to the mitochondrial matrix to undergo {beta}-oxidation. Here, we report the development of an expression system for investigating genotype/phenotype correlations in CPT II deficiency and, potentially, other mitochondrial fatty acid oxidation defects. To explore yeast as an expression system, we introduced a cDNA encoding the entire human CPT II precursor into Saccharomyces cerevisiae. Expression was programmed by using an inducible galactose operon promoter (GAL1). Following induction, human CPT II was expressed at high levels, with activity 4- to 16-fold greater than in human fibroblasts. Levels of expression paralleled those of respiration, being higher in cells grown on a nonfermentable carbon source than in those grown on glucose. Immunoprecipitation of pulse-labeled transformed cells demonstrated that human CPT II expressed in yeast was targeted to mitochondria with correct proteolytic processing of its 25-residue mitochondrial leader sequence. Preliminary results on the expression of a number of mutant CPT II alleles associated with different clinical phenotypes demonstrated the value of this system for examining the functional consequences of disease-causing mutations and investigating genotype/phenotype correlations in patients with CPT II deficiency.

  5. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients

    PubMed Central

    Nucci, Laura A.; Santos, Sidnéia S.; Brunialti, Milena K. C.; Sharma, Narendra Kumar; Machado, Flavia R.; Assunção, Murillo; de Azevedo, Luciano C. P.

    2017-01-01

    Background and objectives Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients. Materials and methods Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0), and after 7 days (D7, N = 10) of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant. Results Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients. Conclusion Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by

  6. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  7. Regional differentiation and extensive hybridization between mitochondrial clades of the Southern Ocean giant sea spider Colossendeis megalonyx

    PubMed Central

    Dietz, Lars; Arango, Claudia P.; Dömel, Jana S.; Halanych, Kenneth M.; Harder, Avril M.; Held, Christoph; Mahon, Andrew R.; Mayer, Christoph; Melzer, Roland R.; Rouse, Greg W.; Weis, Andrea; Wilson, Nerida G.; Leese, Florian

    2015-01-01

    Assessing the enormous diversity of Southern Ocean benthic species and their evolutionary histories is a central task in the era of global climate change. Based on mitochondrial markers, it was recently suggested that the circumpolar giant sea spider Colossendeis megalonyx comprises a complex of at least six cryptic species with mostly small and non-overlapping distribution ranges. Here, we expand the sampling to include over 500 mitochondrial COI sequences of specimens from around the Antarctic. Using multiple species delimitation approaches, the number of distinct mitochondrial OTUs increased from six to 15–20 with our larger dataset. In contrast to earlier studies, many of these clades show almost circumpolar distributions. Additionally, analysis of the nuclear internal transcribed spacer region for a subset of these specimens showed incongruence between nuclear and mitochondrial results. These mito-nuclear discordances suggest that several of the divergent mitochondrial lineages can hybridize and should not be interpreted as cryptic species. Our results suggest survival of C. megalonyx during Pleistocene glaciations in multiple refugia, some of them probably located on the Antarctic shelf, and emphasize the importance of multi-gene datasets to detect the presence of cryptic species, rather than their inference based on mitochondrial data alone. PMID:26587257

  8. Differential induction of mitochondrial machinery by light intensity correlates with changes in respiratory metabolism and photorespiration in rice leaves.

    PubMed

    Huang, Shaobai; Jacoby, Richard P; Shingaki-Wells, Rachel N; Li, Lei; Millar, A Harvey

    2013-04-01

    The light responsiveness of mitochondrial function was investigated through changes in mitochondrial composition and metabolism in rice (Oryza sativa) shoots. The mitochondrial proteome and metabolite abundances under low light, (LL, 100 μmol m(-2) s(-1) ), and high light (HL, 700 μmol m(-2) s(-1) ) were measured along with information on shoot photosynthetic, respiratory and photorespiratory activity. Specific steps in mitochondrial tricarboxylic acid (TCA) cycle metabolism were decreased under HL, correlating with lower respiration rate under HL. The abundance of mitochondrial enzymes in branch chain metabolism was reduced under HL/LL, and correlated with a decrease in the abundance of a range of amino acids in the HL/LL. Mitochondrial nucleoside diphosphate kinase was increased under LL/HL treatments. Significant accumulation of glycine decarboxylase P, T subunits and serine hydroxymethyltransferase occurred in response to light. The abundance of the glycine decarboxylase (GDC) H subunit proteins was not changed by HL/LL treatments, and the abundance of GDC L subunit protein was halved under HL, indicating a change in the stoichiometry of GDC subunits, while photorespiration was fourfold higher in LL- than in HL-treated plants. Insights into these light-dependent phenomena and their importance for understanding the initiation of photorespiration in rice and adaptation of mitochondria to function in photosynthetic cells are discussed.

  9. Neuroprotective effect of asiatic acid on rotenone-induced mitochondrial dysfunction and oxidative stress-mediated apoptosis in differentiated SH-SYS5Y cells.

    PubMed

    Nataraj, Jagatheesan; Manivasagam, Thamilarasan; Justin Thenmozhi, Arokiasamy; Essa, Musthafa Mohamed

    2016-02-08

    Parkinson's disease (PD) is a chronic neurodegenerative disease, manifested due to the loss of dopaminergic neurons, which ultimately leads to impaired movement in elderly populations. The pathogenesis of PD is associated with numerous factors including oxidative stress, mitochondrial dysfunction and apoptosis. There is no effective therapy available to cure or halt the progression of this disease still now. Asiatic acid (AA) is a triterpene extracted from Centella asiatica has been reported as an antioxidant and anti-inflammatory agent, that offers neuroprotection against glutamate toxicity. Therefore, in this study, we have investigated the effect of AA in a rotenone (an inhibitor of mitochondrial complex I) induced in vitro model of PD. Following the exposure of SH-SY5Y cells to rotenone, there was a marked overproduction of ROS, mitochondrial dysfunction (as indexed by the decrease in mitochondrial membrane potential) and apoptosis (Hoechst and dual staining, comet assay; expressions of pro-apoptotic and anti-apoptotic indices). Pre-treatment with AA reversed these changes might be due to its antioxidant, mitoprotective and anti-apoptotic properties. However further extensive studies on in vivo models of PD are warranted to prove AA neuroprotective effect before entering into the clinical trial.

  10. A novel murrel Channa striatus mitochondrial manganese superoxide dismutase: gene silencing, SOD activity, superoxide anion production and expression.

    PubMed

    Arockiaraj, Jesu; Palanisamy, Rajesh; Bhatt, Prasanth; Kumaresan, Venkatesh; Gnanam, Annie J; Pasupuleti, Mukesh; Kasi, Marimuthu

    2014-12-01

    We have reported the molecular characterization including gene silencing, superoxide activity, superoxide anion production, gene expression and molecular characterization of a mitochondrial manganese superoxide dismutase (mMnSOD) from striped murrel Channa striatus (named as CsmMnSOD). The CsmMnSOD polypeptide contains 225 amino acids with a molecular weight of 25 kDa and a theoretical isoelectric point of 8.3. In the N-terminal region, CsmMnSOD carries a mitochondrial targeting sequence and a superoxide dismutases (SOD) Fe domain (28-109), and in C-terminal region, it carries another SOD Fe domain (114-220). The CsmMnSOD protein sequence shared significant similarity with its homolog of MnSOD from rock bream Oplegnathus fasciatus (96%). The phylogenetic analysis showed that the CsmMnSOD fell in the clade of fish mMnSOD group. The monomeric structure of CsmMnSOD possesses 9 α-helices (52.4%), 3 β-sheets (8.8%) and 38.8% random coils. The highest gene expression was noticed in liver, and its expression was inducted with fungal (Aphanomyces invadans) and bacterial (Aeromonas hydrophila) infections. The gene silencing results show that the fish that received dsRNA exhibited significant (P < 0.05) changes in expression when compared to their non-injected and fish physiological saline-injected controls. The SOD activity shows that the activity increases with the spread of infection and decreases once the molecule controls the pathogen. The capacity of superoxide anion production was determined by calculating the granular blood cell count during infection in murrel. It shows that the infection influenced the superoxide radical production which plays a major role in killing the pathogens. Overall, this study indicated the defense potentiality of CsmMnSOD; however, further research is necessary to explore its capability at protein level.

  11. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  12. Creatine kinase expression and creatine phosphate accumulation are developmentally regulated during differentiation of mouse and human monocytes

    PubMed Central

    1984-01-01

    We have studied the expression of creatine kinase (CK) and the accumulation of creatine phosphate during the differentiation of human and mouse peripheral blood monocytes. Mouse monocytes cultured for 24 h do not contain detectable levels of CK and creatine phosphate. However, resident tissue macrophages and inflammatory elicited macrophages obtained from the peritoneal cavities of mice have 70 and 300 mU per mg protein of CK activity and contain 3 and 6 mol of creatine phosphate per mol of ATP, respectively. The major isozyme of CK in these cells has been identified as the brain form. These findings suggest that the differentiation of monocytes into macrophages is associated with the expression of CK and the accumulation of creatine phosphate. We have found a similar pattern in human monocytes. Human blood monocytes, maintained in culture for 24 or 48 h, do not contain detectable levels of CK or creatine phosphate. Monocyte-derived macrophages (monocytes maintained in tissue cultures for 1 to 2 wk) have up to 100 mU per mg protein of CK activity and contain 0.5 mol of creatine phosphate per mol of ATP. Human macrophages express multiple isozymes of CK including the brain (BB) and possibly the mitochondrial forms of this enzyme. Thus, the expression of CK and the accumulation of creatine phosphate in human monocytes is induced by their in vitro cultivation. The induction of CK during in vitro cultivation occurs independently of the concentration of creatine in the medium. However, the size of the creatine phosphate pool varies with respect to extracellular creatine concentration. Creatine phosphate and CK are not detectable in freshly isolated human lymphocytes, polymorphonuclear leukocytes or erythrocytes, but are found in freshly isolated human platelets. PMID:6699543

  13. HNF4α Regulates Claudin-7 Protein Expression during Intestinal Epithelial Differentiation

    PubMed Central

    Farkas, Attila E.; Hilgarth, Roland S.; Capaldo, Christopher T.; Gerner-Smidt, Christian; Powell, Doris R.; Vertino, Paula M.; Koval, Michael; Parkos, Charles A.; Nusrat, Asma

    2016-01-01

    The intestinal epithelium is a dynamic barrier that maintains the distinct environments of intestinal tissue and lumen. Epithelial barrier function is defined principally by tight junctions, which, in turn, depend on the regulated expression of claudin family proteins. Claudins are expressed differentially during intestinal epithelial cell (IEC) differentiation. However, regulatory mechanisms governing claudin expression during epithelial differentiation are incompletely understood. We investigated the molecular mechanisms regulating claudin-7 during IEC differentiation. Claudin-7 expression is increased as epithelial cells differentiate along the intestinal crypt–luminal axis. By using model IECs we observed increased claudin-7 mRNA and nascent heteronuclear RNA levels during differentiation. A screen for potential regulators of the CLDN7 gene during IEC differentiation was performed using a transcription factor/DNA binding array, CLDN7 luciferase reporters, and in silico promoter analysis. We identified hepatocyte nuclear factor 4α as a regulatory factor that bound endogenous CLDN7 promoter in differentiating IECs and stimulated CLDN7 promoter activity. These findings support a role of hepatocyte nuclear factor 4α in controlling claudin-7 expression during IEC differentiation. PMID:26216285

  14. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  15. Heterogeneous lineage marker expression in naive embryonic stem cells is mostly due to spontaneous differentiation

    PubMed Central

    Nair, Gautham; Abranches, Elsa; Guedes, Ana M. V.; Henrique, Domingos; Raj, Arjun

    2015-01-01

    Populations of cultured mouse embryonic stem cells (ESCs) exhibit a subfraction of cells expressing uncharacteristically low levels of pluripotency markers such as Nanog. Yet, the extent to which individual Nanog-negative cells are differentiated, both from ESCs and from each other, remains unclear. Here, we show the transcriptome of Nanog-negative cells exhibits expression of classes of genes associated with differentiation that are not yet active in cells exposed to differentiation conditions for one day. Long non-coding RNAs, however, exhibit more changes in expression in the one-day-differentiated cells than in Nanog-negative cells. These results are consistent with the concept that Nanog-negative cells may contain subpopulations of both lineage-primed and differentiated cells. Single cell analysis showed that Nanog-negative cells display substantial and coherent heterogeneity in lineage marker expression in progressively nested subsets of cells exhibiting low levels of Nanog, then low levels of Oct4, and then a set of lineage markers, which express intensely in a small subset of these more differentiated cells. Our results suggest that the observed enrichment of lineage-specific marker gene expression in Nanog-negative cells is associated with spontaneous differentiation of a subset of these cells rather than the more random expression that may be associated with reversible lineage priming. PMID:26292941

  16. Differentially expressed cytosolic proteins in human leukemia and lymphoma cell lines correlate with lineages and functions.

    PubMed

    Gez, Swetlana; Crossett, Ben; Christopherson, Richard I

    2007-09-01

    Identification of cytosolic proteins differentially expressed between types of leukemia and lymphoma may provide a molecular basis for classification and understanding their cellular properties. Two-dimensional fluorescence difference gel electrophoresis (DIGE) and mass spectrometry have been used to identify proteins that are differentially expressed in cytosolic extracts from four human leukemia and lymphoma cell lines: HL-60 (acute promyelocytic leukemia), MEC1 (B-cell chronic lymphocytic leukemia), CCRF-CEM (T-cell acute lymphoblastic leukemia) and Raji (B-cell Burkitt's lymphoma). A total of 247 differentially expressed proteins were identified between the four cell lines. Analysis of the data by principal component analysis identified 22 protein spots (17 different protein species) differentially expressed at more than a 95% variance level between these cell lines. Several of these proteins were differentially expressed in only one cell line: HL-60 (myeloperoxidase, phosphoprotein 32 family member A, ras related protein Rab-11B, protein disulfide-isomerase, ran-specific GTPase-activating protein, nucleophosmin and S-100 calcium binding protein A4), and Raji (ezrin). Several of these proteins were differentially expressed in two cell lines: Raji and MEC1 (C-1-tetrahydrofolate synthase, elongation factor 2, alpha- and beta-tubulin, transgelin-2 and stathmin). MEC1 and CCRF-CEM (gamma-enolase), HL-60 and CCRF-CEM (ubiquitin-conjugating enzyme E2 N). The differentially expressed proteins identified in these four cell lines correlate with cellular properties and provide insights into the molecular basis of these malignancies.

  17. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in major stored-cereal pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-...

  18. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  19. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  20. Differential expression of L- and S-MAG upon cAMP stimulated differentiation in oligodendroglial cells.

    PubMed

    Erb, M; Steck, A J; Nave, K A; Schaeren-Wiemers, N

    2003-02-01

    Myelin-associated glycoprotein (MAG), an immunoglobulin-like cell signaling protein involved in axon-glial interactions, displays two intracellular C-termini as a result of alternative mRNA splicing. During brain development, the two MAG mRNAs that encode L-MAG and S-MAG differ in their relative abundance. We have investigated the differential expression of L- and S-MAG upon cAMP treatment in the oligodendroglial cell line Oli-neu, a cell line able to differentiate in vitro. We have engineered GFP and VSVG fusions by small insertions into the alternatively spliced exons of the cloned MAG gene and reintroduced them into Oli-neu cells. The individually tagged MAG isoforms were expressed under the control of the MAG promoter and regulatory region. In this system, L-MAG was the predominant isoform before the stimulation of cells with cAMP, whereas upon cAMP treatment the S-MAG isoform was predominantly expressed in cells with a high degree of morphological differentiation. We suggest that the regulation of the MAG alternative splicing and the morphological differentiation in oligodendrocytes are controlled both by the same cAMP-responsive differentiation step.

  1. Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

    SciTech Connect

    Tsukasaki, Masayuki; Yamada, Atsushi; Suzuki, Dai; Aizawa, Ryo; Miyazono, Agasa; Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro; Morimura, Naoko; Yamamoto, Matsuo; Kamijo, Ryutaro

    2011-07-15

    Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

  2. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  3. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  4. Differential expression of sirtuins in the aging rat brain

    PubMed Central

    Braidy, Nady; Poljak, Anne; Grant, Ross; Jayasena, Tharusha; Mansour, Hussein; Chan-Ling, Tailoi; Smythe, George; Sachdev, Perminder; Guillemin, Gilles J.

    2015-01-01

    Although there are seven mammalian sirtuins (SIRT1-7), little is known about their expression in the aging brain. To characterize the change(s) in mRNA and protein expression of SIRT1-7 and their associated proteins in the brain of “physiologically” aged Wistar rats. We tested mRNA and protein expression levels of rat SIRT1-7, and the levels of associated proteins in the brain using RT-PCR and western blotting. Our data shows that SIRT1 expression increases with age, concurrently with increased acetylated p53 levels in all brain regions investigated. SIRT2 and FOXO3a protein levels increased only in the occipital lobe. SIRT3-5 expression declined significantly in the hippocampus and frontal lobe, associated with increases in superoxide and fatty acid oxidation levels, and acetylated CPS-1 protein expression, and a reduction in MnSOD level. While SIRT6 expression declines significantly with age acetylated H3K9 protein expression is increased throughout the brain. SIRT7 and Pol I protein expression increased in the frontal lobe. This study identifies previously unknown roles for sirtuins in regulating cellular homeostasis and healthy aging. PMID:26005404

  5. Expression of estrogen receptor α in human breast cancer cells regulates mitochondrial oxidative stress under simulated microgravity

    NASA Astrophysics Data System (ADS)

    Zheng, Hong-xia; Tian, Wei-ming; Yan, Hong-ji; Jiang, Hua-dong; Liu, Shan-shan; Yue, Lei; Han, Fang; Wei, Li-jun; Chen, Xiong-biao; Li, Yu

    2012-05-01

    This study investigated intracellular oxidative stress and its underlying mechanisms in a rotary cell culture system used to achieve a simulated microgravity (SMG) environment. Experiments were conducted with human breast cancer cell lines MCF-7 (an estrogen receptor (ER) α positive cell line) and MDA-MB-231 (an ERα negative cell line) encapsulated in alginate/collagen carriers. After 48 h, SMG led to oxidative stress and DNA damage in the MDA-MB-231 cells but a significant increase in mitochondrial activity and minimal DNA damage in the MCF-7 cells. The activity of superoxide dismutase (SOD) significantly increased in the MCF-7 cells and decreased in MDA-MB-231 cells in the SMG environment compa