Science.gov

Sample records for differentially expressed mitochondrial

  1. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns

    PubMed Central

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St. John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α-ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns. PMID:28900542

  2. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    PubMed

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  3. Differential Gene Expression Reveals Mitochondrial Dysfunction in an Imprinting Center Deletion Mouse Model of Prader–Willi Syndrome

    PubMed Central

    Yazdi, Puya G.; Su, Hailing; Ghimbovschi, Svetlana; Fan, Weiwei; Coskun, Pinar E.; Nalbandian, Angèle; Knoblach, Susan; Resnick, James L.; Hoffman, Eric; Wallace, Douglas C.

    2013-01-01

    Abstract Prader–Willi syndrome (PWS) is a genetic disorder caused by deficiency of imprinted gene expression from the paternal chromosome 15q11–15q13 and clinically characterized by neonatal hypotonia, short stature, cognitive impairment, hypogonadism, hyperphagia, morbid obesity, and diabetes. Previous clinical studies suggest that a defect in energy metabolism may be involved in the pathogenesis of PWS. We focused our attention on the genes associated with energy metabolism and found that there were 95 and 66 mitochondrial genes differentially expressed in PWS muscle and brain, respectively. Assessment of enzyme activities of mitochondrial oxidative phosphorylation complexes in the brain, heart, liver, and muscle were assessed. We found the enzyme activities of the cardiac mitochondrial complexes II‫III were up‐regulated in the PWS imprinting center deletion mice compared to the wild‐type littermates. These studies suggest that differential gene expression, especially of the mitochondrial genes may contribute to the pathophysiology of PWS. PMID:24127921

  4. Mitochondrial proteins differential expression during honeybee (Apis mellifera L.) queen and worker larvae caste determination.

    PubMed

    Begna, Desalegn; Fang, Yu; Feng, Mao; Li, Jianke

    2011-09-02

    Despite their similar genetic makeup, honeybee (A. mellifera) queens and workers show alternative morphologies driven by nutritional difference during the larval stage. Although much research have been done to investigate the causes of honeybee caste polymorphism, information at subcellular protein levels is limited. We analyzed queen- and worker-destined larvae mitochondrial proteome at three early developmental stages using combinations of differential centrifugation, two-dimensional electrophoresis, mass spectrometry, bioinformatics, and quantitative real time PCR. In total, 67, 69, and 97 protein spots were reproducibly identified as mitochondrial proteins at 72, 96, and 120 h, respectively. There were significant qualitative and quantitative protein expression differences between the two castes at three developmental stages. In general, the queen-destined larvae up-regulated large proportions of proteins at all of the developmental stages and, in particular, 95% at 72 h. An overwhelming majority of the queen larvae up-regulated proteins were physiometabolic-enriched proteins (metabolism of carbohydrate and energy, amino acid, and fatty acid) and involved in protein folding, and this was further verified by functional enrichment and biological interaction network analyses as a direct link with metabolic rates and cellular responses to hormones. Although wide-ranging mitochondrial proteomes participate to shape the metabolic, physiologic, and anatomic differences between the two castes at 72 h, physiometabolic-enriched proteins were found as the major modulators of the profound marking of this caste differentiation. Owing to nutritional difference, prospective queen larvae showed enhanced growth, and this was manifested through the overexpression of metabolic enzymes. Differently from similar studies targeting the causes of honeybee caste polymorphism, this subcellular level study provides an in-depth insight into mitochondrial proteins-mediated caste

  5. Determination of the differential expression of mitochondrial long non-coding RNAs as a noninvasive diagnosis of bladder cancer

    PubMed Central

    2012-01-01

    Background Bladder cancer is a significant cause of morbidity and mortality with a high recurrence rate. Early detection of bladder cancer is essential in order to remove the tumor, to preserve the organ and to avoid metastasis. The aim of this study was to analyze the differential expression of mitochondrial non-coding RNAs (sense and antisense) in cells isolated from voided urine of patients with bladder cancer as a noninvasive diagnostic assay. Methods The differential expression of the sense (SncmtRNA) and the antisense (ASncmtRNAs) transcripts in cells isolated from voided urine was determined by fluorescent in situ hybridization. The test uses a multiprobe mixture labeled with different fluorophores and takes about 1 hour to complete. We examined the expression of these transcripts in cells isolated from urine of 24 patients with bladder cancer and from 15 healthy donors. Results This study indicates that the SncmtRNA and the ASncmtRNAs are stable in cells present in urine. The test reveals that the expression pattern of the mitochondrial transcripts can discriminate between normal and tumor cells. The analysis of 24 urine samples from patients with bladder cancer revealed expression of the SncmtRNA and down-regulation of the ASncmtRNAs. Exfoliated cells recovered from the urine of healthy donors do not express these mitochondrial transcripts. This is the first report showing that the differential expression of these mitochondrial transcripts can detect tumor cells in the urine of patients with low and high grade bladder cancer. Conclusion This pilot study indicates that fluorescent in situ hybridization of cells from urine of patients with different grades of bladder cancer confirmed the tumor origin of these cells. Samples from the 24 patients with bladder cancer contain cells that express the SncmtRNA and down-regulate the ASncmtRNAs. In contrast, the hybridization of the few exfoliated cells recovered from healthy donors revealed no expression of these

  6. Aging Reduces an ERRalpha-Directed Mitochondrial Glutaminase Expression Suppressing Glutamine Anaplerosis and Osteogenic Differentiation of Mesenchymal Stem Cells.

    PubMed

    Huang, Tongling; Liu, Renzhong; Fu, Xuekun; Yao, Dongsheng; Yang, Meng; Liu, Qingli; Lu, William W; Wu, Chuanyue; Guan, Min

    2017-02-01

    Aging deteriorates osteogenic capacity of mesenchymal stem/stromal cells (MSCs), contributing to imbalanced bone remodeling and osteoporosis. Glutaminase (Gls) catabolizes glutamine into glutamate at the first step of mitochondrial glutamine (Gln)-dependent anaplerosis which is essential for MSCs upon osteogenic differentiation. Estrogen-related receptor α (ERRα) regulates genes required for mitochondrial function. Here, we found that ERRα and Gls are upregulated by osteogenic induction in human MSCs (hMSCs). In contrast, osteogenic differentiation capacity and glutamine consumption of MSCs, as well as ERRα, Gls and osteogenic marker genes are significantly reduced with age. We demonstrated that ERRα binds to response elements on Gls promoter and affects glutamine anaplerosis through transcriptional induction of Gls. Conversely, mTOR inhibitor rapamycin, ERRα inverse agonist compound 29 or Gls inhibitor BPTES leads to reduced Gln anaplerosis and deteriorated osteogenic differentiation of hMSCs. Importantly, overexpression of ERRα or Gls restored impairment by these inhibitors. Finally, we proved that compensated ERRα or Gls expression indeed potentiated Gln anaplerosis and osteogenic capability of elderly mice MSCs in vitro. Together, we establish that Gls is a novel ERRα target gene and ERRα/Gls signaling pathway plays an important role in osteogenic differentiation of MSCs, providing new sights into novel regenerative therapeutics development. Our findings suggest that restoring age-related mitochondrial Gln-dependent anaplerosis may be beneficial for degenerative bone disorders such as osteoporosis. Stem Cells 2017;35:411-424.

  7. Differential expression of mitochondrial energy metabolism profiles across the metaplasia-dysplasia-adenocarcinoma disease sequence in Barrett's oesophagus.

    PubMed

    Phelan, J J; MacCarthy, F; Feighery, R; O'Farrell, N J; Lynam-Lennon, N; Doyle, B; O'Toole, D; Ravi, N; Reynolds, J V; O'Sullivan, J

    2014-11-01

    Contemporary clinical management of Barrett's oesophagus has highlighted the lack of accurate predictive markers of disease progression to oesophageal cancer. This study aims to examine alterations in mitochondrial energy metabolism profiles across the entire disease progression sequence in Barrett's oesophagus. An in-vitro model was used to screen 84 genes associated with mitochondrial energy metabolism. Three energy metabolism genes (ATP12A, COX4I2, COX8C) were significantly altered across the in-vitro Barrett's disease sequence. In-vivo validations across the Barrett's sequence demonstrated differential expression of these genes. Tissue microarrays demonstrated significant alterations in both epithelial and stromal oxidative phosphorylation (ATP5B and Hsp60) and glycolytic (PKM2 and GAPDH) protein markers across the in-vivo Barrett's sequence. Levels of ATP5B in sequential follow up surveillance biopsy material segregated Barrett's non progressors and progressors to HGD and cancer. Utilising the Seahorse XF24 flux analyser, in-vitro Barrett's and adenocarcinoma cells exhibited altered levels of various oxidative parameters. We show for the first time that mitochondrial energy metabolism is differentially altered across the metaplasia-dysplasia-adenocarcinoma sequence and that oxidative phosphorylation profiles have predictive value in segregating Barrett's non progressors and progressors to adenocarcinoma. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Differentially expressed miRNAs in sepsis-induced acute kidney injury target oxidative stress and mitochondrial dysfunction pathways

    PubMed Central

    Ge, Qin-Min; Huang, Chun-Mei; Zhu, Xiang-Yang; Bian, Fan; Pan, Shu-Ming

    2017-01-01

    Objective To identify specific miRNAs involved in sepsis-induced AKI and to explore their targeting pathways. Methods The expression profiles of miRNAs in serum from patients with sepsis-induced AKI (n = 6), sepsis-non AKI (n = 6), and healthy volunteers (n = 3) were investigated by microarray assay and validated by quantitative PCR (qPCR). The targets of the differentially expressed miRNAs were predicted by Target Scan, mirbase and Miranda. Then the significant functions and involvement in signaling pathways of gene ontology (GO) and KEGG pathways were analyzed. Furthermore, eight miRNAs were randomly selected out of the differentially expressed miRNAs for further testing by qPCR. Results qPCR analysis confirmed that the expressions levels of hsa-miR-23a-3p, hsa-miR-4456, hsa-miR-142-5p, hsa-miR-22-3p and hsa-miR-191-5p were significantly lower in patients with sepsis compared with the healthy volunteers, while hsa-miR-4270, hsa-miR-4321, hsa-miR-3165 were higher in the sepsis patients. Statistically, miR-4321; miR-4270 were significantly upregulated in the sepsis-induced AKI compared with sepsis-non AKI, while only miR-4321 significantly overexpressed in the sepsis groups compared with control groups. GO analysis showed that biological processes regulated by the predicted target genes included diverse terms. They were related to kidney development, regulation of nitrogen compound metabolic process, regulation of cellular metabolic process, cellular response to oxidative stress, mitochondrial outer membrane permeabilization, etc. Pathway analysis showed that several significant pathways of the predicted target genes related to oxidative stress. miR-4321 was involved in regulating AKT1, mTOR and NOX5 expression while miR-4270 was involved in regulating PPARGC1A, AKT3, NOX5, PIK3C3, WNT1 expression. Function and pathway analysis highlighted the possible involvement of miRNA-deregulated mRNAs in oxidative stress and mitochondrial dysfunction. Conclusion This study

  9. Transient expression of βC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions

    PubMed Central

    2010-01-01

    Background Geminiviruses are emerging plant pathogens that infect a wide variety of crops including cotton, cassava, vegetables, ornamental plants and cereals. The geminivirus disease complex consists of monopartite begomoviruses that require betasatellites for the expression of disease symptoms. These complexes are widespread throughout the Old World and cause economically important diseases on several crops. A single protein encoded by betasatellites, termed βC1, is a suppressor of gene silencing, inducer of disease symptoms and is possibly involved in virus movement. Studies of the interaction of βC1 with hosts can provide useful insight into virus-host interactions and aid in the development of novel control strategies. We have used the differential display technique to isolate host genes which are differentially regulated upon transient expression of the βC1 protein of chili leaf curl betasatellite (ChLCB) in Nicotiana tabacum. Results Through differential display analysis, eight genes were isolated from Nicotiana tabacum, at two and four days after infitration with βC1 of ChLCB, expressed under the control of the Cauliflower mosaic virus 35S promoter. Cloning and sequence analysis of differentially amplified products suggested that these genes were involved in ATP synthesis, and acted as electron carriers for respiration and photosynthesis processes. These differentially expressed genes (DEGs) play an important role in plant growth and development, cell protection, defence processes, replication mechanisms and detoxification responses. Kegg orthology based annotation system analysis of these DEGs demonstrated that one of the genes, coding for polynucleotide nucleotidyl transferase, is involved in purine and pyrimidine metabolic pathways and is an RNA binding protein which is involved in RNA degradation. Conclusion βC1 differentially regulated genes are mostly involved in chloroplast and mitochondrial functions. βC1 also increases the expression of those

  10. Quantitative and qualitative 2D electrophoretic analysis of differentially expressed mitochondrial proteins from five mouse organs.

    PubMed

    Techritz, Sandra; Lützkendorf, Susanne; Bazant, Esther; Becker, Silke; Klose, Joachim; Schuelke, Markus

    2013-01-01

    Mitochondria fulfill many tissue-specific functions in cell metabolism. We set out to identify differences in the protein composition of mitochondria from five tissues frequently affected by mitochondrial disorders. The proteome of highly purified mitochondria from five mouse organs was separated by high-resolution 2DE. Tissue-specific spots were identified through nano-LC/ESI-MS/MS and quantified by densitometry in ten biological replicates. We identified 87 consistently deviating spots representing 48 proteins. The percentage of variant spots ranged between 4.2% and 6.0%; 21 proteins having tissue-specific isospots. Consistent tissue-specific processing/regulation was seen for carbamoyl-phosphate-synthase, aldehyde-dehydrogenase 2, ATP-synthase α-chain, and isocitrate-dehydrogenase α-subunit. Thirty tissue-specific proteins were associated with mitochondrial disorders in humans. We further identified alcohol-dehydrogenase, catalase, quinone-oxidoreductase, cyclophilin-A, and Upf0317, a potential biotin-carboxyl-carrier protein, which had not been annotated as "mitochondrial" in Gene Ontology or MitoCarta databases. Their targeting to the mitochondria was verified by transfection of full-length GFP-tagged plasmids. Given the high evolutionary conservation of mitochondrial metabolic pathways, these data further annotate the mitochondrial proteome and advance our understanding of the pathophysiology and tissue-specificity of symptoms seen in patients with mitochondrial disorders. The generation of 2D electrophoretic maps of the mitochondrial proteome using tissue specimens in the milligram range facilitates this technique for clinical applications and biomarker research. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Compromised liver mitochondrial function and complex activity in low feed efficient broilers are associated with higher oxidative stress and differential protein expression.

    PubMed

    Iqbal, M; Pumford, N R; Tang, Z X; Lassiter, K; Ojano-Dirain, C; Wing, T; Cooper, M; Bottje, W

    2005-06-01

    Variations in broiler growth and efficiency have been explained in part by differences in mitochondrial function and biochemistry in broilers. To further our knowledge in this regard, 2 experiments were carried out to determine the relationships of a) mitochondrial function and activities of various electron transport chain (ETC) complexes; b) production of H2O2, a reactive oxygen species (ROS), and its association with protein oxidation; and c) mitochondrial protein expression in liver of a single line male broilers with low or high feed efficiency (FE, n = 5 to 8 per group). Mitochondrial function and complex activities were measured polarographically and spectrophotometrically, respectively. H2O2 was measured fluorimetrically, whereas oxidized protein (carbonyls) and specific mitochondrial proteins were analyzed using Western blots. Mitochondrial function (ETC coupling) and activities of ETC complexes (I, II, III, and IV) were higher in high FE compared with low FE broilers. H2O2 and protein carbonyls were higher in the livers of low FE broilers than in high FE broilers. Whereas the expression of 4 immunoreactive proteins [NAD3 (complex I), subunit VII (complex III), cytochrome c oxidase subunits (COX) II, and COX IVb (complex IV)] were higher in low FE liver mitochondria and 2 proteins [subunit 70 (complex II) and a-ATP synthase (complex V)] were higher in high FE birds, there were no differences between groups in the expression of 18 other mitochondrial proteins. In conclusion, increases in oxidative stress in low FE broilers were caused by or may contribute to differences in mitochondrial function (ETC coupling and complex activities) or the differential expression of steady-state levels of some mitochondrial proteins in the liver. Understanding the role of oxidative stress in Low FE broilers will provide clues in understanding the cellular basis of feed efficiency.

  12. Differential expression on mitochondrial tryparedoxin peroxidase (mTcTXNPx) in Trypanosoma cruzi after ferrocenyl diamine hydrochlorides treatments.

    PubMed

    Kohatsu, Andréa A N; Silva, Flávia A J; Francisco, Acácio I; Rimoldi, Aline; Silva, Marco T A; Vargas, Maria D; Rosa, João A da; Cicarelli, Regina M B

    Resistance to benznidazole in certain strains of Trypanosoma cruzi may be caused by the increased production of enzymes that act on the oxidative metabolism, such as mitochondrial tryparedoxin peroxidase which catalyses the reduction of peroxides. This work presents cytotoxicity assays performed with ferrocenyl diamine hydrochlorides in six different strains of T. cruzi epimastigote forms (Y, Bolivia, SI1, SI8, QMII, and SIGR3). The last four strains have been recently isolated from triatominae and mammalian host (domestic cat). The expression of mitochondrial tryparedoxin peroxidase was analyzed by the Western blotting technique using polyclonal antibody anti mitochondrial tryparedoxin peroxidase obtained from a rabbit immunized with the mitochondrial tryparedoxin peroxidase recombinant protein. All the tested ferrocenyl diamine hydrochlorides were more cytotoxic than benznidazole. The expression of the 25.5kDa polypeptide of mitochondrial tryparedoxin peroxidase did not increase in strains that were more resistant to the ferrocenyl compounds (SI8 and SIGR3). In addition, a 58kDa polypeptide was also recognized in all strains. Ferrocenyl diamine hydrochlorides showed trypanocidal activity and the expression of 25.5kDa mitochondrial tryparedoxin peroxidase is not necessarily increased in some T. cruzi strains. Most likely, other mechanisms, in addition to the over expression of this antioxidative enzyme, should be involved in the escape of parasites from cytotoxic oxidant agents.

  13. RNA sequencing reveals differential expression of mitochondrial and oxidation reduction genes in the long-lived naked mole-rat when compared to mice.

    PubMed

    Yu, Chuanfei; Li, Yang; Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G; Coen, Clive W; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M

    2011-01-01

    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics.

  14. RNA Sequencing Reveals Differential Expression of Mitochondrial and Oxidation Reduction Genes in the Long-Lived Naked Mole-Rat When Compared to Mice

    PubMed Central

    Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G.; Coen, Clive W.; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M.

    2011-01-01

    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics. PMID:22073188

  15. Genes Related to Mitochondrial Functions, Protein Degradation, and Chromatin Folding Are Differentially Expressed in Lymphomonocytes of Rett Syndrome Patients

    PubMed Central

    Leoni, Guido; Cervellati, Franco; Canali, Raffaella; Cortelazzo, Alessio; De Felice, Claudio; Ciccoli, Lucia; Hayek, Joussef

    2013-01-01

    Rett syndrome (RTT) is mainly caused by mutations in the X-linked methyl-CpG binding protein (MeCP2) gene. By binding to methylated promoters on CpG islands, MeCP2 protein is able to modulate several genes and important cellular pathways. Therefore, mutations in MeCP2 can seriously affect the cellular phenotype. Today, the pathways that MeCP2 mutations are able to affect in RTT are not clear yet. The aim of our study was to investigate the gene expression profiles in peripheral blood lymphomonocytes (PBMC) isolated from RTT patients to try to evidence new genes and new pathways that are involved in RTT pathophysiology. LIMMA (Linear Models for MicroArray) and SAM (Significance Analysis of Microarrays) analyses on microarray data from 12 RTT patients and 7 control subjects identified 482 genes modulated in RTT, of which 430 were upregulated and 52 were downregulated. Functional clustering of a total of 146 genes in RTT identified key biological pathways related to mitochondrial function and organization, cellular ubiquitination and proteosome degradation, RNA processing, and chromatin folding. Our microarray data reveal an overexpression of genes involved in ATP synthesis suggesting altered energy requirement that parallels with increased activities of protein degradation. In conclusion, these findings suggest that mitochondrial-ATP-proteasome functions are likely to be involved in RTT clinical features. PMID:24453408

  16. Inhibition of Drp1-dependent mitochondrial division impairs myogenic differentiation.

    PubMed

    Kim, Boa; Kim, Ji-Seok; Yoon, Yisang; Santiago, Mayra C; Brown, Michael D; Park, Joon-Young

    2013-10-15

    Mitochondria are dynamic organelles forming a tubular network that is continuously fusing and dividing to control their morphology and functions. Recent literature has shed new light on a potential link between the dynamic behavior of mitochondria and muscle development. In this study, we investigate the role of mitochondrial fission factor dynamin-related protein 1 (Drp1) in myogenic differentiation. We found that differentiation of C2C12 myoblasts induced by serum starvation was accompanied by a gradual increase in Drp1 protein expression (to ∼350% up to 3 days) and a fast reduction of Drp1 phosphorylation at Ser-637 (to ∼30%) resulting in translocation of Drp1 protein from the cytosol to mitochondria. During differentiation, treatment of myoblasts with mitochondrial division inhibitor (mdivi-1), a specific inhibitor of Drp1 GTPase activity, caused extensive formation of elongated mitochondria, which coincided with increased apoptosis evidenced by both enhanced caspase-3 activity and increased number of terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells. Furthermore, the mdivi-1-treated myotubes (day 3 in differentiation media) showed a reduction in mitochondrial DNA content, mitochondrial mass, and membrane potential in a dose-dependent manner indicating defects in mitochondrial biogenesis during myogenic differentiation. Most interestingly, mdivi-1 treatment significantly suppressed myotube formation in both C2C12 cells and primary myoblasts. Likewise, stable overexpression of a dominant negative mutant Drp1 (K38A) dramatically reduced myogenic differentiation. These data suggest that Drp-1-dependent mitochondrial division is a necessary step for successful myogenic differentiation, and perturbation of mitochondrial dynamics hinders normal mitochondrial adaptations during muscle development. Therefore, in the present study, we report a novel physiological role of mitochondrial dynamics in myogenic differentiation.

  17. Bottom-up proteomics suggests an association between differential expression of mitochondrial proteins and chronic fatigue syndrome

    PubMed Central

    Ciregia, F; Kollipara, L; Giusti, L; Zahedi, R P; Giacomelli, C; Mazzoni, M R; Giannaccini, G; Scarpellini, P; Urbani, A; Sickmann, A; Lucacchini, A; Bazzichi, L

    2016-01-01

    Chronic fatigue syndrome (CFS) is a debilitating and complex disorder characterized by unexplained fatigue not improved by rest. An area of investigation is the likely connection of CFS with defective mitochondrial function. In a previous work, we investigated the proteomic salivary profile in a couple of monozygotic twins discordant for CFS. Following this work, we analyzed mitochondrial proteins in the same couple of twins. Nano-liquid chromatography electrospray ionization mass spectrometry (nano-LC-MS) was used to study the mitochondria extracted from platelets of the twins. Subsequently, we selected three proteins that were validated using western blot analysis in a big cohort of subjects (n=45 CFS; n=45 healthy), using whole saliva (WS). The selected proteins were as follows: aconitate hydratase (ACON), ATP synthase subunit beta (ATPB) and malate dehydrogenase (MDHM). Results for ATPB and ACON confirmed their upregulation in CFS. However, the MDHM alteration was not confirmed. Thereafter, seeing the great variability of clinical features of CFS patients, we decided to analyze the expression of our proteins after splitting patients according to clinical parameters. For each marker, the values were actually higher in the group of patients who had clinical features similar to the ill twin. In conclusion, these results suggest that our potential markers could be one of the criteria to be taken into account for helping in diagnosis. Furthermore, the identification of biomarkers present in particular subgroups of CFS patients may help in shedding light upon the complex entity of CFS. Moreover, it could help in developing tailored treatments. PMID:27676445

  18. Mitochondrial and oxidative stress genes are differentially expressed in neutrophils of sJIA patients treated with tocilizumab: a pilot microarray study.

    PubMed

    Omoyinmi, Ebun; Hamaoui, Raja; Bryant, Annette; Jiang, Mike Chao; Athigapanich, Trin; Eleftheriou, Despina; Hubank, Mike; Brogan, Paul; Woo, Patricia

    2016-02-09

    Various pathways involved in the pathogenesis of sJIA have been identified through gene expression profiling in peripheral blood mononuclear cells (PBMC), but not in neutrophils. Since neutrophils are important in tissue damage during inflammation, and are elevated as part of the acute phase response, we hypothesised that neutrophil pathways could also be important in the pathogenesis of sJIA. We therefore studied the gene profile in both PBMC and neutrophils of sJIA patients treated with tocilizumab. We studied the transcriptomes of peripheral blood mononuclear cells (PBMC) and neutrophils from eight paired samples obtained from 4 sJIA patients taken before and after treatment, selected on the basis that they achieved ACR90 responses within 12 weeks of therapy initiation with tocilizumab. RNA was extracted and gene expression profiling was performed using Affymetrix GeneChip Human Genome U133 Plus 2.0 microarray platform. A longitudinal analysis using paired t-test (p < 0.05 and FC ≥ 1.5) was applied to identify differentially expressed genes (DEGs) between the two time points followed by ingenuity pathway analysis. Gene Set Enrichment Analysis (GSEA) and quantitative real-time PCR were then performed to verify the microarray results. Gene ontology analysis in neutrophils revealed that response to tocilizumab significantly altered genes regulating mitochondrial dysfunction and oxidative stress (p = 4.6E-05). This was independently verified with GSEA, by identifying a set of oxidative genes whose expression correlated with response to tocilizumab. In PBMC, treatment of sJIA with tocilizumab appeared to affect genes in Oncostatin M signalling and B cell pathways. For the first time we demonstrate that neutrophils from sJIA patients responding to tocilizumab showed significantly different changes in gene expression. These data could highlight the importance of mitochondrial genes that modulate oxidative stress in the pathogenesis of sJIA.

  19. Differential expression of citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans in response to developmental status and carbon sources.

    PubMed

    Min, In Sook; Bang, Ji Young; Seo, Soon Won; Lee, Cheong Ho; Maeng, Pil Jae

    2010-04-01

    As an extension of our previous studies on the mitochondrial citrate synthase of Aspergillus nidulans and cloning of its coding gene (citA), we analyzed differential expression of citA in response to the progress of development and change of carbon source. The cDNA consisted of 1,700 nucleotides and was predicted to encode a 474-amino acid protein. By comparing the cDNA sequence with the corresponding genomic sequence, we confirmed that citA gene contains 7 introns and that its transcription starts at position -26 (26-nucleotide upstream from the initiation codon). Four putative CreA binding motifs and three putative stress-response elements (STREs) were found within the 1.45-kb citA promoter region. The mode of citA expression was examined by both Northern blot and confocal microscopy using green fluorescent protein (sGFP) as a vital reporter. During vegetative growth and asexual development, the expression of citA was ubiquitous throughout the whole fungal body including mycelia and conidiophores. During sexual development, the expression of citA was quite strong in cleistothecial shells, but significantly weak in the content of cleistothecia including ascospores. Acetate showed a strong inductive effect on citA expression, which is subjected to carbon catabolite repression (CCR) caused by glucose. The recombinant fusion protein CitA(40)::sGFP (sGFP containing the 40-amino acid N-terminal segment of CitA) was localized into mitochondria, which supports that a mitochondrial targeting signal is included within the 40-amino acid N-terminal segment of CitA.

  20. Unique mitochondrial localization of arginase 1 and 2 in hepatocytes of air-breathing walking catfish, Clarias batrachus and their differential expression patterns under hyper-ammonia stress.

    PubMed

    Banerjee, Bodhisattwa; Koner, Debaprasad; Lal, Priyanka; Saha, Nirmalendu

    2017-07-30

    Arginase (ARG) catalyzes the final step of ornithine-urea cycle (OUC) leading to a conversion of L-arginine to L-ornithine and urea. Several isoforms of ARG have been reported in vertebrates, out of which the two predominant isoforms are the cytosolic ARG1 and the mitochondrial ARG2. The air-breathing walking catfish (Clarias batrachus) is frequently being challenged by different environmental insults such as hyper-ammonia, dehydration and osmotic stresses in their natural habitats throughout the year. The present study investigated the active presence of ARG1 and ARG2 isoforms in hepatocytes along with unique localization of both the isoforms inside the mitochondria, and also their specific expression patterns under hyper-ammonia stress (5mM NH4Cl) in isolated hepatocytes of walking catfish. Initially, full length sequences of both arg1 and arg2 genes were obtained by RACE-PCR. Studies on molecular characterization demonstrated the presence of all the conserved amino acids required for stability and activity of binuclear metal center in both the isoforms. Phylogenetic analysis of the amino acid sequences of ARG isoforms showed a differentiation of the ARG1 and ARG2 into two distinct clusters with their respective isoforms from other species. Most interestingly, both the isoforms of ARG in hepatocytes were found to be localized inside the mitochondria as evidenced by the presence of mitochondrial target peptide (mTP) in N-terminal of the derived amino acid sequences, and exclusive localization of ARG activity in the mitochondrial fraction. This was additionally confirmed by Western blot analysis of ARGs in mitochondrial and cytosolic fractions, and by immunocytochemical analysis in isolated hepatocytes. Although the possible reasons associated with the presence of both the isoforms of ARGs inside the mitochondria is not clearly understood, perhaps this mitochondrial localization of ARG is functionally advantageous in this catfish for the synthesis of N

  1. Dynamic mitochondrial-nuclear redistribution of the immunophilin FKBP51 is regulated by the PKA signaling pathway to control gene expression during adipocyte differentiation.

    PubMed

    Toneatto, Judith; Guber, Sergio; Charó, Nancy L; Susperreguy, Sebastián; Schwartz, Jessica; Galigniana, Mario D; Piwien-Pilipuk, Graciela

    2013-12-01

    Glucocorticoids play an important role in adipogenesis through the glucocorticoid receptor (GR) that forms a heterocomplex with Hsp90•Hsp70 and one high molecular weight immunophilin, either FKBP51 or FKBP52. When 3T3-L1 preadipocytes are induced to differentiate, FKBP51 expression progressively increases, whereas FKBP52 decreases, and Hsp90, Hsp70, p23 and Cyp40 remain unchanged. Interestingly, FKBP51 rapidly translocates from mitochondria to the nucleus where it is retained upon its interaction with chromatin and the nuclear matrix. FKBP51 nuclear localization is transient, and after 48 hours it cycles back to mitochondria. Importantly, this dynamic FKBP51 mitochondrial-nuclear shuttling depends on PKA signaling, because its inhibition by PKI or knockdown of PKA-cα by siRNA, prevented FKBP51 nuclear translocation induced by IBMX. In addition, the electrophoretic pattern of migration of FKBP51 is altered by treatment of cells with PKI or knockdown of PKA-cα, suggesting that FKBP51 is a PKA substrate. In preadipocytes, FKBP51 colocalizes with PKA-cα in mitochondria. When adipogenesis is triggered, PKA-cα also moves to the nucleus colocalizing with FKBP51 mainly in the nuclear lamina. Moreover, FKBP51 and GR interaction increases when preadipocytes are induced to differentiate. GR transcriptional capacity is reduced when cells are incubated in the presence of IBMX, forskolin or dibutyryl-cAMP, compounds that induced FKBP51 nuclear translocation, but not by a specific activator of EPAC. FKBP51 knockdown facilitates adipogenesis, whereas ectopic expression of FKBP51 blocks adipogenesis. These findings indicate that the dynamic mitochondrial-nuclear shuttling of FKBP51 regulated by PKA may be key in fine-tuning the transcriptional control of GR target genes required for the acquisition of adipocyte phenotype.

  2. Differential expression of cardiac muscle mitochondrial matrix proteins in broilers from ascites-resistant and susceptible lines.

    PubMed

    Cisar, C R; Balog, J M; Anthony, N B; Donoghue, A M

    2005-05-01

    Ascites is a metabolic disorder of modern broilers that is distinguished by cardiopulmonary insufficiency in the face of intense oxygen demands of rapidly growing tissues. Broilers with ascites exhibit sustained elevation of pulmonary arterial pressure and right ventricular hypertrophy, the end result of which is heart failure. It has been shown that mitochondrial function is impaired in broilers with ascites. In the current study, mitochondrial matrix protein levels were compared between ascites-resistant line broilers and ascites-susceptible line broilers with and without ascites using two-dimensional (2-D) gel electrophoresis. One hundred seventy-two protein spots were detected on the gels, and 9 of the spots were present at different levels in the 4 groups of broilers. These 9 protein spots were selected for identification by mass spectrometry. Two of the spots were found to contain single mitochondrial matrix proteins. Both mitochondrial matrix proteins, the dihydrolipoamide succinyltransferase component of the 2-oxoglutarate dehydrogenase complex and the alpha-subunit of mitochondrial trifunctional enzyme, were present at higher levels in ascites-resistant line broilers with ascites in the present study. The elevated levels of 2 key proteins in aerobic metabolism in ascites-resistant line broilers with ascites observed in the present study suggests that the mitochondria of broilers with this disease may respond inappropriately to hypoxia.

  3. Regulation of mitochondrial gene expression, the epigenetic enigma.

    PubMed

    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G

    2017-03-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  4. Mitochondrial DNA replication during differentiation of murine embryonic stem cells.

    PubMed

    Facucho-Oliveira, Joao M; Alderson, Jon; Spikings, Emma C; Egginton, Stuart; St John, Justin C

    2007-11-15

    Oxidative phosphorylation (OXPHOS), the intracellular process that generates the majority of the ATP of a cell through the electron-transfer chain, is highly dependent on proteins encoded by the mitochondrial genome (mtDNA). MtDNA replication is regulated by the nuclear-encoded mitochondrial transcription factor A (TFAM) and the mitochondrial-specific DNA polymerase gamma, which consists of a catalytic (POLG) and an accessory (POLG2) subunit. Differentiation of pluripotent embryonic stem cells (ESCs) into specific cell types requires expansion of discrete populations of mitochondria and mtDNA replication to meet the specific metabolic requirements of the cell. We determined by real-time PCR that expression of pluripotent markers is reduced before the upregulation of Polg, Polg2 and Tfam in spontaneously differentiating R1 murine (m)ESCs, along with transient increases in mtDNA copy number. In D3 mESCs, the initial transient increase did not take place. However, precursors of neuronal and cardiomyocyte differentiation were positive for both POLG and TFAM. Similar-stage ESCs also showed active mtDNA replication, identified by 5-bromo-2'-deoxy-uridine labelling, as mtDNA copy number increased. Retinoic-acid-induced differentiation resulted in more consistent patterns of replication and upregulation of Polg, Polg2 and Tfam, whereas siRNA knockdown demonstrated that steady-state expression of POLG is essential for maintaining pluripotency.

  5. Mitochondrial respiration regulates adipogenic differentiation of human mesenchymal stem cells.

    PubMed

    Zhang, Yanmin; Marsboom, Glenn; Toth, Peter T; Rehman, Jalees

    2013-01-01

    Human mesenchymal stem cells (MSCs) are adult multipotent stem cells which can be isolated from bone marrow, adipose tissue as well as other tissues and have the capacity to differentiate into a variety of mesenchymal cell types such as adipocytes, osteoblasts and chondrocytes. Differentiation of stem cells into mature cell types is guided by growth factors and hormones, but recent studies suggest that metabolic shifts occur during differentiation and can modulate the differentiation process. We therefore investigated mitochondrial biogenesis, mitochondrial respiration and the mitochondrial membrane potential during adipogenic differentiation of human MSCs. In addition, we inhibited mitochondrial function to assess its effects on adipogenic differentiation. Our data show that mitochondrial biogenesis and oxygen consumption increase markedly during adipogenic differentiation, and that reducing mitochondrial respiration by hypoxia or by inhibition of the mitochondrial electron transport chain significantly suppresses adipogenic differentiation. Furthermore, we used a novel approach to suppress mitochondrial activity using a specific siRNA-based knockdown of the mitochondrial transcription factor A (TFAM), which also resulted in an inhibition of adipogenic differentiation. Taken together, our data demonstrates that increased mitochondrial activity is a prerequisite for MSC differentiation into adipocytes. These findings suggest that metabolic modulation of adult stem cells can maintain stem cell pluripotency or direct adult stem cell differentiation.

  6. Mitochondrial DNA Damage and its Consequences for Mitochondrial Gene Expression

    PubMed Central

    Cline, Susan D.

    2012-01-01

    How mitochondria process DNA damage and whether a change in the steady-state level of mitochondrial DNA damage (mtDNA) contributes to mitochondrial dysfunction are questions that fuel burgeoning areas of research into aging and disease pathogenesis. Over the past decade, researchers have identified and measured various forms of endogenous and environmental mtDNA damage and have elucidated mtDNA repair pathways. Interestingly, mitochondria do not appear to contain the full range of DNA repair mechanisms that operate in the nucleus, although mtDNA contains types of damage that are targets of each nuclear DNA repair pathway. The reduced repair capacity may, in part, explain the high mutation frequency of the mitochondrial chromosome. Since mtDNA replication is dependent on transcription, mtDNA damage may alter mitochondrial gene expression at three levels: by causing DNA polymerase γ nucleotide incorporation errors leading to mutations, by interfering with the priming of mtDNA replication by the mitochondrial RNA polymerase, or by inducing transcriptional mutagenesis or premature transcript termination. This review summarizes our current knowledge of mtDNA damage, its repair, and its effects on mtDNA integrity and gene expression. PMID:22728831

  7. Changes, and the Relevance Thereof, in Mitochondrial Morphology during Differentiation into Endothelial Cells

    PubMed Central

    Shin, Ji Won; Park, So Hee; Kang, Yun Gyeong; Wu, Yanru; Choi, Hyun Ju

    2016-01-01

    The roles of mitochondria in various physiological functions of vascular endothelial cells have been investigated extensively. Morphological studies in relation to physiological functions have been performed. However, there have been few reports of morphological investigations related to stem cell differentiation. This was the first morphological study of mitochondria in relation to endothelial differentiation and focused on quantitative analysis of changes in mitochondrial morphology, number, area, and length during differentiation of human mesenchymal stem cells (hMSCs) into endothelial-like cells. To induce differentiation, we engaged vascular endothelial growth factors and flow-induced shear stress. Cells were classified according to the expression of von Willebrand factor as hMSCs, differentiating cells, and almost fully differentiated cells. Based on imaging analysis, we investigated changes in mitochondrial number, area, and length. In addition, mitochondrial networks were quantified on a single-mitochondrion basis by introducing a branch form factor. The data indicated that the mitochondrial number, area per cell, and length were decreased with differentiation. The mitochondrial morphology became simpler with progression of differentiation. These findings could be explained in view of energy level during differentiation; a higher level of energy is needed during differentiation, with larger numbers of mitochondria with branches. Application of this method to differentiation into other lineages will explain the energy levels required to control stem cell differentiation. PMID:27517609

  8. Changes, and the Relevance Thereof, in Mitochondrial Morphology during Differentiation into Endothelial Cells.

    PubMed

    Shin, Ji Won; Park, So Hee; Kang, Yun Gyeong; Wu, Yanru; Choi, Hyun Ju; Shin, Jung-Woog

    2016-01-01

    The roles of mitochondria in various physiological functions of vascular endothelial cells have been investigated extensively. Morphological studies in relation to physiological functions have been performed. However, there have been few reports of morphological investigations related to stem cell differentiation. This was the first morphological study of mitochondria in relation to endothelial differentiation and focused on quantitative analysis of changes in mitochondrial morphology, number, area, and length during differentiation of human mesenchymal stem cells (hMSCs) into endothelial-like cells. To induce differentiation, we engaged vascular endothelial growth factors and flow-induced shear stress. Cells were classified according to the expression of von Willebrand factor as hMSCs, differentiating cells, and almost fully differentiated cells. Based on imaging analysis, we investigated changes in mitochondrial number, area, and length. In addition, mitochondrial networks were quantified on a single-mitochondrion basis by introducing a branch form factor. The data indicated that the mitochondrial number, area per cell, and length were decreased with differentiation. The mitochondrial morphology became simpler with progression of differentiation. These findings could be explained in view of energy level during differentiation; a higher level of energy is needed during differentiation, with larger numbers of mitochondria with branches. Application of this method to differentiation into other lineages will explain the energy levels required to control stem cell differentiation.

  9. Mitochondrial and Metabolic Gene Expression in the Aged Rat Heart

    PubMed Central

    Barton, Gregory P.; Sepe, Joseph J.; McKiernan, Susan H.; Aiken, Judd M.; Diffee, Gary M.

    2016-01-01

    Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function, and AMP-activated protein kinase (AMPK) activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo), Old (33 mo), and old exercise trained (Old + EXE) (34 mo) FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05) expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α), peroxisome proliferator activated receptor alpha (PPARα), and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity, and mitochondrial function in the heart. PMID:27601998

  10. Differential expression of genes involved with apoptosis, cell cycle, connective tissue proteins, fuel substrate utilization, inflammation and mitochondrial biogenesis in copper-deficient rat hearts: implication of a role for Nfkappab1.

    PubMed

    Klaahsen, Darcey; Ricklefs, Kristen; Medeiros, Denis M

    2007-11-01

    We hypothesized that the increase in mitochondrial proliferation in hearts from copper-deficient rats is due to an increase in expression of the transcriptional factor peroxisomal-like proliferating related coactivator 1alpha (Ppargc1a), which regulates transcriptional activity for many of the genes that encode for mitochondrial proteins. In addition to several transcriptional factors implicated in mitochondrial biogenesis, we also looked at a number of genes involved in cell cycle regulation and fuel substrate utilization. Long-Evans rats were placed on either a copper-adequate (n=4) or copper-deficient (n=4) diet 3 days post weaning and remained on the diet for 5 weeks; their copper deficiency status was confirmed using previously established assays. Custom oligo arrays spotted with genes pertinent to mitochondrial biogenesis were hybridized with cRNA probes synthesized from the collected heart tissue. Chemiluminescent array images from both groups were analyzed for gene spot intensities and differential gene expression. Our results did not demonstrate any significant increase in Ppargc1a or its implicated targets, as we had predicted. However, consistent with previous data, an up-regulation of genes that encode for collagen type 3, fibronectin and elastin were found. Interestingly, there was also a significant increase in the expression of the transcriptional factor nuclear factor kappaB1 (Nfkappab1) in the copper-deficient treatment animals, compared to the control group, and this was confirmed by real time quantitative polymerase chain reaction. The results of this study merit the further investigation of the role of reactive oxidative species with regard to Nfkappab1 in the copper deficient rat heart.

  11. A Redox-Mediated Modulation of Stem Bolting in Transgenic Nicotiana sylvestris Differentially Expressing the External Mitochondrial NADPH Dehydrogenase1[W][OA

    PubMed Central

    Liu, Yun-Jun; Nunes-Nesi, Adriano; Wallström, Sabá V.; Lager, Ida; Michalecka, Agnieszka M.; Norberg, Fredrik E.B.; Widell, Susanne; Fredlund, Kenneth M.; Fernie, Alisdair R.; Rasmusson, Allan G.

    2009-01-01

    Cytosolic NADPH can be directly oxidized by a calcium-dependent NADPH dehydrogenase, NDB1, present in the plant mitochondrial electron transport chain. However, little is known regarding the impact of modified cytosolic NADPH reduction levels on growth and metabolism. Nicotiana sylvestris plants overexpressing potato (Solanum tuberosum) NDB1 displayed early bolting, whereas sense suppression of the same gene led to delayed bolting, with consequential changes in flowering time. The phenotype was dependent on light irradiance but not linked to any change in biomass accumulation. Whereas the leaf NADPH/NADP+ ratio was unaffected, the stem NADPH/NADP+ ratio was altered following the genetic modification and strongly correlated with the bolting phenotype. Metabolic profiling of the stem showed that the NADP(H) change affected relatively few, albeit central, metabolites, including 2-oxoglutarate, glutamate, ascorbate, sugars, and hexose-phosphates. Consistent with the phenotype, the modified NDB1 level also affected the expression of putative floral meristem identity genes of the SQUAMOSA and LEAFY types. Further evidence for involvement of the NADPH redox in stem development was seen in the distinct decrease in the stem apex NADPH/NADP+ ratio during bolting. Additionally, the potato NDB1 protein was specifically detected in mitochondria, and a survey of its abundance in major organs revealed that the highest levels are found in green stems. These results thus strongly suggest that NDB1 in the mitochondrial electron transport chain can, by modifying cell redox levels, specifically affect developmental processes. PMID:19429607

  12. DRP1-dependent mitochondrial fission initiates follicle cell differentiation during Drosophila oogenesis.

    PubMed

    Mitra, Kasturi; Rikhy, Richa; Lilly, Mary; Lippincott-Schwartz, Jennifer

    2012-05-14

    Exit from the cell cycle is essential for cells to initiate a terminal differentiation program during development, but what controls this transition is incompletely understood. In this paper, we demonstrate a regulatory link between mitochondrial fission activity and cell cycle exit in follicle cell layer development during Drosophila melanogaster oogenesis. Posterior-localized clonal cells in the follicle cell layer of developing ovarioles with down-regulated expression of the major mitochondrial fission protein DRP1 had mitochondrial elements extensively fused instead of being dispersed. These cells did not exit the cell cycle. Instead, they excessively proliferated, failed to activate Notch for differentiation, and exhibited downstream developmental defects. Reintroduction of mitochondrial fission activity or inhibition of the mitochondrial fusion protein Marf-1 in posterior-localized DRP1-null clones reversed the block in Notch-dependent differentiation. When DRP1-driven mitochondrial fission activity was unopposed by fusion activity in Marf-1-depleted clones, premature cell differentiation of follicle cells occurred in mitotic stages. Thus, DRP1-dependent mitochondrial fission activity is a novel regulator of the onset of follicle cell differentiation during Drosophila oogenesis.

  13. Effects of Silica and Titanium Oxide Particles on a Human Neural Stem Cell Line: Morphology, Mitochondrial Activity, and Gene Expression of Differentiation Markers

    PubMed Central

    Fujioka, Kouki; Hanada, Sanshiro; Inoue, Yuriko; Sato, Keisuke; Hirakuri, Kenji; Shiraishi, Kouichi; Kanaya, Fumihide; Ikeda, Keiichi; Usui, Ritsuko; Yamamoto, Kenji; Kim, Seung U.; Manome, Yoshinobu

    2014-01-01

    Several in vivo studies suggest that nanoparticles (smaller than 100 nm) have the ability to reach the brain tissue. Moreover, some nanoparticles can penetrate into the brains of murine fetuses through the placenta by intravenous administration to pregnant mice. However, it is not clear whether the penetrated nanoparticles affect neurogenesis or brain function. To evaluate its effects on neural stem cells, we assayed a human neural stem cell (hNSCs) line exposed in vitro to three types of silica particles (30 nm, 70 nm, and <44 μm) and two types of titanium oxide particles (80 nm and < 44 μm). Our results show that hNSCs aggregated and exhibited abnormal morphology when exposed to the particles at concentrations ≥ 0.1 mg/mL for 7 days. Moreover, all the particles affected the gene expression of Nestin (stem cell marker) and neurofilament heavy polypeptide (NF-H, neuron marker) at 0.1 mg/mL. In contrast, only 30-nm silica particles at 1.0 mg/mL significantly reduced mitochondrial activity. Notably, 30-nm silica particles exhibited acute membrane permeability at concentrations ≥62.5 μg/mL in 24 h. Although these concentrations are higher than the expected concentrations of nanoparticles in the brain from in vivo experiments in a short period, these thresholds may indicate the potential toxicity of accumulated particles for long-term usage or continuous exposure. PMID:24992594

  14. Isolation, chromosomal localization, and differential expression of mitochondrial manganese superoxide dismutase and chloroplastic copper/zinc superoxide dismutase genes in wheat.

    PubMed

    Wu, G; Wilen, R W; Robertson, A J; Gusta, L V

    1999-06-01

    Superoxide dismutase (SOD) gene expression was investigated to elucidate its role in drought and freezing tolerance in spring and winter wheat (Triticum aestivum). cDNAs encoding chloroplastic Cu/ZnSODs and mitochondrial MnSODs were isolated from wheat. MnSOD and Cu/ZnSOD genes were mapped to the long arms of the homologous group-2 and -7 chromosomes, respectively. Northern blots indicated that MnSOD genes were drought inducible and decreased after rehydration. In contrast, Cu/ZnSOD mRNA was not drought inducible but increased after rehydration. In both spring and winter wheat seedlings exposed to 2 degrees C, MnSOD transcripts attained maximum levels between 7 and 49 d. Transcripts of Cu/ZnSOD mRNA were detected sooner in winter than in spring wheat; however, they disappeared after 21 d of acclimation. Transcripts of both classes of SOD genes increased during natural acclimation in both spring and winter types. Exposure of fully hardened plants to three nonlethal freeze-thaw cycles resulted in Cu/Zn mRNA accumulation; however, MnSOD mRNA levels declined in spring wheat but remained unchanged in winter wheat. The results of the dehydration and freeze-thaw-cycle experiments suggest that winter wheat has evolved a more effective stress-repair mechanism than spring wheat.

  15. Effects of silica and titanium oxide particles on a human neural stem cell line: morphology, mitochondrial activity, and gene expression of differentiation markers.

    PubMed

    Fujioka, Kouki; Hanada, Sanshiro; Inoue, Yuriko; Sato, Keisuke; Hirakuri, Kenji; Shiraishi, Kouichi; Kanaya, Fumihide; Ikeda, Keiichi; Usui, Ritsuko; Yamamoto, Kenji; Kim, Seung U; Manome, Yoshinobu

    2014-07-02

    Several in vivo studies suggest that nanoparticles (smaller than 100 nm) have the ability to reach the brain tissue. Moreover, some nanoparticles can penetrate into the brains of murine fetuses through the placenta by intravenous administration to pregnant mice. However, it is not clear whether the penetrated nanoparticles affect neurogenesis or brain function. To evaluate its effects on neural stem cells, we assayed a human neural stem cell (hNSCs) line exposed in vitro to three types of silica particles (30 nm, 70 nm, and <44 µm) and two types of titanium oxide particles (80 nm and < 44 µm). Our results show that hNSCs aggregated and exhibited abnormal morphology when exposed to the particles at concentrations = 0.1 mg/mL for 7 days. Moreover, all the particles affected the gene expression of Nestin (stem cell marker) and neurofilament heavy polypeptide (NF-H, neuron marker) at 0.1 mg/mL. In contrast, only 30-nm silica particles at 1.0 mg/mL significantly reduced mitochondrial activity. Notably, 30-nm silica particles exhibited acute membrane permeability at concentrations =62.5 µg/mL in 24 h. Although these concentrations are higher than the expected concentrations of nanoparticles in the brain from in vivo experiments in a short period, these thresholds may indicate the potential toxicity of accumulated particles for long-term usage or continuous exposure.

  16. Effects of silica nanoparticle exposure on mitochondrial function during neuronal differentiation.

    PubMed

    Ducray, Angélique D; Felser, Andrea; Zielinski, Jana; Bittner, Aniela; Bürgi, Julia V; Nuoffer, Jean-Marc; Frenz, Martin; Mevissen, Meike

    2017-07-04

    Nanomedicine offers a promising tool for therapies of brain diseases, but potential effects on neuronal health and neuronal differentiation need to be investigated to assess potential risks. The aim of this study was to investigate effects of silica-indocyanine green/poly (ε-caprolactone) nanoparticles (PCL-NPs) engineered for laser tissue soldering in the brain before and during differentiation of SH-SY5Y cells. Considering adaptations in mitochondrial homeostasis during neuronal differentiation, metabolic effects of PCL-NP exposure before and during neuronal differentiation were studied. In addition, kinases of the PI3 kinase (PI3-K/Akt) and the MAP kinase (MAP-K/ERK) pathways related to neuronal differentiation and mitochondrial function were investigated. Differentiation resulted in a decrease in the cellular respiration rate and the extracellular acidification rate (ECAR). PCL-NP exposure impaired mitochondrial function depending on the time of exposure. The cellular respiration rate was significantly reduced compared to differentiated controls when PCL-NPs were given before differentiation. The shift in ECAR was less pronounced in PCL-NP exposure during differentiation. Differentiation and PCL-NP exposure had no effect on expression levels and the enzymatic activity of respiratory chain complexes. The activity of the glycolytic enzyme phosphofructokinase was significantly reduced after differentiation with the effect being more pronounced after PCL-NP exposure before differentiation. The increase in mitochondrial membrane potential observed after differentiation was not found in SH-SY5Y cells exposed to PCL-NPs before differentiation. The cellular adenosine triphosphate (ATP) production significantly dropped during differentiation, and this effect was independent of the PCL-NP exposure. Differentiation and nanoparticle exposure had no effect on superoxide levels at the endpoint of the experiments. A slight decrease in the expression of the neuronal

  17. Murine Mesenchymal Stem Cell Commitment to Differentiation is Regulated by Mitochondrial Dynamics

    PubMed Central

    Forni, Maria Fernanda; Peloggia, Julia; Trudeau, Kyle; Shirihai, Orian; Kowaltowski, Alicia J.

    2015-01-01

    Mouse skin mesenchymal stem cells (msMSCs) are dermis CD105+CD90+CD73+CD29+CD34− mesodermal precursors which, after in vitro induction, undergo chondro, adipo and osteogenesis. Extensive metabolic reconfiguration has been found to occur during differentiation, and the bioenergetic status of a cell is known to be dependent on the quality and abundance of the mitochondrial population, which may be regulated by fusion and fission. However, little is known regarding the impact of mitochondrial dynamics on the differentiation process. We addressed this knowledge gap by isolating MSCs from Swiss female mice, inducing these cells to differentiate into osteo, chondro and adipocytes and measuring changes in mass, morphology, dynamics and bioenergetics. Mitochondrial biogenesis was increased in adipogenesis, as evaluated through confocal microscopy, citrate synthase activity and mtDNA content. The early steps of adipo and osteogenesis involved mitochondrial elongation, as well as increased expression of mitochondrial fusion proteins Mfn1 and 2. Chondrogenesis involved a fragmented mitochondrial phenotype, increased expression of fission proteins Drp1, Fis1 and 2 and enhanced mitophagy. These events were accompanied by profound bioenergetic alterations during the commitment period. Moreover, knockdown of Mfn2 in adipo and osteogenesis and the overexpression of a dominant negative form of Drp1 during chondrogenesis resulted in a loss of differentiation ability. Overall, we find that mitochondrial morphology and its regulating processes of fission/fusion are modulated early on during commitment, leading to alterations in the bioenergetic profile that are important for differentiation. We thus propose a central role for mitochondrial dynamics in the maintenance/commitment of mesenchymal stem cells. PMID:26638184

  18. Mitochondria in mesenchymal stem cell biology and cell therapy: From cellular differentiation to mitochondrial transfer.

    PubMed

    Hsu, Yi-Chao; Wu, Yu-Ting; Yu, Ting-Hsien; Wei, Yau-Huei

    2016-04-01

    Mesenchymal stem cells (MSCs) are characterized to have the capacity of self-renewal and the potential to differentiate into mesoderm, ectoderm-like and endoderm-like cells. MSCs hold great promise for cell therapies due to their multipotency in vitro and therapeutic advantage of hypo-immunogenicity and lower tumorigenicity. Moreover, it has been shown that MSCs can serve as a vehicle to transfer mitochondria into cells after cell transplantation. Mitochondria produce most of the energy through oxidative phosphorylation in differentiated cells. It has been increasingly clear that the switch of energy supply from glycolysis to aerobic metabolism is essential for successful differentiation of MSCs. Post-translational modifications of proteins have been established to regulate mitochondrial function and metabolic shift during MSCs differentiation. In this article, we review and provide an integrated view on the roles of different protein kinases and sirtuins in the maintenance and differentiation of MSCs. Importantly, we provide evidence to suggest that alteration in the expression of Sirt3 and Sirt5 and relative changes in the acylation levels of mitochondrial proteins might be involved in the activation of mitochondrial function and adipogenic differentiation of adipose-derived MSCs. We summarize their roles in the regulation of mitochondrial biogenesis and metabolism, oxidative responses and differentiation of MSCs. On the other hand, we discuss recent advances in the study of mitochondrial dynamics and mitochondrial transfer as well as their roles in the differentiation and therapeutic application of MSCs to improve cell function in vitro and in animal models. Accumulating evidence has substantiated that the therapeutic potential of MSCs is conferred not only by cell replacement and paracrine effects but also by transferring mitochondria into injured tissues or cells to modulate the cellular metabolism in situ. Therefore, elucidation of the underlying mechanisms

  19. Mesodermal developmental gene Tbx15 impairs adipocyte differentiation and mitochondrial respiration.

    PubMed

    Gesta, Stephane; Bezy, Olivier; Mori, Marcelo A; Macotela, Yazmin; Lee, Kevin Y; Kahn, C Ronald

    2011-02-15

    Increased intraabdominal (visceral) fat is associated with a high risk of diabetes and metabolic syndrome. We have previously shown that the mesodermal developmental transcription factor Tbx15 is highly differentially expressed between visceral and subcutaneous (s.c.) fat in both humans and rodents, and in humans visceral fat Tbx15 expression is decreased in obesity. Here we show that, in mice, Tbx15 is 260-fold more highly expressed in s.c. preadipocytes than in epididymal preadipocytes. Overexpression of Tbx15 in 3T3-L1 preadipocytes impairs adipocyte differentiation and decreases triglyceride content. This defect in differentiation can be corrected by stimulating cells with the PPARγ agonist rosiglitazone (Rosi). However, triglyceride accumulation remains decreased by ∼50%, due to a decrease in basal lipogenic rate and increase in basal lipolytic rate. 3T3-L1 preadipocytes overexpressing Tbx15 also have a 15% reduction in mitochondrial mass and a 28% reduction in basal mitochondrial respiration (P = 0.004) and ATP turnover (P = 0.02), and a 45% (P = 0.003) reduction in mitochondrial respiratory capacity. Thus, differential expression of Tbx15 between fat depots plays an important role in the interdepot differences in adipocyte differentiation, triglyceride accumulation, and mitochondrial function that may contribute to the risk of diabetes and metabolic disease.

  20. Expression of polyalanine stretches induces mitochondrial dysfunction.

    PubMed

    Toriumi, Kazuya; Oma, Yoko; Kino, Yoshihiro; Futai, Eugene; Sasagawa, Noboru; Ishiura, Shoichi

    2008-05-15

    In recent years, several novel types of disorders have been characterized, including what have been termed polyalanine diseases, in which patients have expanded triplet repeats in specific genes, resulting in the translation of aberrantly elongated polyalanine stretches. In this study, we showed that yellow fluorescent protein (YFP)-fused elongated polyalanine stretches localized exclusively to the cytoplasm and formed aggregates. Additionally, the polyalanine stretches themselves were toxic. We sought to identify proteins that bound directly to the polyalanine stretches, as factors that might be involved in triggering cell death. Many mitochondrial proteins were identified as polyalanine-binding proteins. We showed that one of the identified proteins, succinate dehydrogenase subunit A, was decreased in the mitochondria of cells expressing polyalanine stretches; as a result, succinate oxidative activity was decreased. Furthermore, the polyalanine stretches also associated directly with mitochondria. This suggests that polya-lanine stretches might directly induce cell death. Additionally, the mitochondrial membrane potential was reduced in cells expressing polyalanine stretches. We propose a novel mechanism by which polyalanine stretches may cause cytotoxicity through mitochondrial dysfunction. This may be a common mechanism underlying the pathogenesis of all polyalanine diseases.

  1. Differential retrotranslocation of mitochondrial Bax and Bak

    PubMed Central

    Todt, Franziska; Cakir, Zeynep; Reichenbach, Frank; Emschermann, Frederic; Lauterwasser, Joachim; Kaiser, Andrea; Ichim, Gabriel; Tait, Stephen WG; Frank, Stephan; Langer, Harald F; Edlich, Frank

    2015-01-01

    The Bcl-2 proteins Bax and Bak can permeabilize the outer mitochondrial membrane and commit cells to apoptosis. Pro-survival Bcl-2 proteins control Bax by constant retrotranslocation into the cytosol of healthy cells. The stabilization of cytosolic Bax raises the question whether the functionally redundant but largely mitochondrial Bak shares this level of regulation. Here we report that Bak is retrotranslocated from the mitochondria by pro-survival Bcl-2 proteins. Bak is present in the cytosol of human cells and tissues, but low shuttling rates cause predominant mitochondrial Bak localization. Interchanging the membrane anchors of Bax and Bak reverses their subcellular localization compared to the wild-type proteins. Strikingly, the reduction of Bax shuttling to the level of Bak retrotranslocation results in full Bax toxicity even in absence of apoptosis induction. Thus, fast Bax retrotranslocation is required to protect cells from commitment to programmed death. PMID:25378477

  2. Dynamic regulation of genes involved in mitochondrial DNA replication and transcription during mouse brown fat cell differentiation and recruitment.

    PubMed

    Murholm, Maria; Dixen, Karen; Qvortrup, Klaus; Hansen, Lillian H L; Amri, Ez-Zoubir; Madsen, Lise; Barbatelli, Giorgio; Quistorff, Bjørn; Hansen, Jacob B

    2009-12-24

    Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1) and a remarkably higher mitochondrial abundance in brown adipocytes. Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white and brown fat, brown adipose tissue fractions and in selected adipose tissues during cold exposure. We find a massive induction of the majority of such genes during brown adipocyte differentiation and recruitment, e.g. of the mitochondrial transcription factors A (Tfam) and B2 (Tfb2m), whereas only a subset of the same genes were induced during white adipose conversion. In addition, PR domain containing 16 (PRDM16) was found to be expressed at substantially higher levels in brown compared to white pre-adipocytes and adipocytes. We demonstrate that forced expression of Tfam but not Tfb2m in brown adipocyte precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. Using both in vitro and in vivo model systems of white and brown fat cell differentiation, we report a detailed characterisation of gene expression linked to mitochondrial biogenesis and function. We find significant differences in differentiating white and brown adipocytes, which might explain the notable increase in mitochondrial content observed during brown adipose conversion. In addition, our data support a key role of PRDM16 in triggering brown adipocyte differentiation, including mitochondrial biogenesis and expression of UCP1.

  3. Alternative NF-κB Regulates RANKL-induced Osteoclast Differentiation and Mitochondrial Biogenesis via Independent Mechanisms

    PubMed Central

    Zeng, Rong; Faccio, Roberta; Novack, Deborah V

    2016-01-01

    Mitochondrial biogenesis, the generation of new mitochondrial DNA and proteins, has been linked to osteoclast (OC) differentiation and function. In this study we used mice with mutations in key alternative NF-κB pathway proteins, RelB and NIK, to dissect the complex relationship between mitochondrial biogenesis and osteoclastogenesis. OC precursors lacking either NIK or RelB, RANKL were unable to increase mitochondrial DNA or OxPhos protein expression, associated with lower oxygen consumption rates. Transgenic OC precursors expressing constitutively active NIK showed normal RANKL-induced mitochondrial biogenesis (OxPhos expression and mitochondria copy number) compared to controls, but larger mitochondrial dimensions and increased oxygen consumption rates, suggesting increased mitochondrial function. To deduce the mechanism for mitochondrial biogenesis defects in NIK- and RelB-deficient precursors, we examined expression of genes known to control this process. PGC-1β (Ppargc1b) expression, but not PGC-1α, PPRC1 or ERRα, was significantly reduced in RelB−/− and NIK−/− OCs. Because PGC-1β has been reported to positively regulate both mitochondrial biogenesis and differentiation in OCs, we retrovirally overexpressed PGC-1β in RelB−/− cells, but surprisingly found that it did not affect differentiation, nor restore RANKL-induced mitochondrial biogenesis. To determine whether the blockade in osteoclastogenesis in RelB-deficient cells precludes mitochondrial biogenesis, we rescued RelB−/− differentiation via overexpression of NFATc1. Mitochondrial parameters in neither WT nor RelB-deficient cultures were affected by NFATc1 overexpression, and bone resorption in RelB −/− was not restored. Furthermore, NFATc1 co-overexpression with PGC-1β, while allowing OC differentiation, did not rescue mitochondrial biogenesis or bone resorption in RelB−/− OCs, by CTX-I levels. Thus, our results indicate that the alternative NF-κB pathway plays dual, but

  4. Dual Modulation of the Mitochondrial Permeability Transition Pore and Redox Signaling Synergistically Promotes Cardiomyocyte Differentiation From Pluripotent Stem Cells

    PubMed Central

    Cho, Sung Woo; Park, Jin‐Sung; Heo, Hye Jin; Park, Sang‐Wook; Song, Sukhyun; Kim, Injune; Han, Yong‐Mahn; Yamashita, Jun K.; Youm, Jae Boum; Han, Jin; Koh, Gou Young

    2014-01-01

    Background Cardiomyocytes that differentiate from pluripotent stem cells (PSCs) provide a crucial cellular resource for cardiac regeneration. The mechanisms of mitochondrial metabolic and redox regulation for efficient cardiomyocyte differentiation are, however, still poorly understood. Here, we show that inhibition of the mitochondrial permeability transition pore (mPTP) by Cyclosporin A (CsA) promotes cardiomyocyte differentiation from PSCs. Methods and Results We induced cardiomyocyte differentiation from mouse and human PSCs and examined the effect of CsA on the differentiation process. The cardiomyogenic effect of CsA mainly resulted from mPTP inhibition rather than from calcineurin inhibition. The mPTP inhibitor NIM811, which does not have an inhibitory effect on calcineurin, promoted cardiomyocyte differentiation as much as CsA did, but calcineurin inhibitor FK506 only slightly increased cardiomyocyte differentiation. CsA‐treated cells showed an increase in mitochondrial calcium, mitochondrial membrane potential, oxygen consumption rate, ATP level, and expression of genes related to mitochondrial function. Furthermore, inhibition of mitochondrial oxidative metabolism reduced the cardiomyogenic effect of CsA while antioxidant treatment augmented the cardiomyogenic effect of CsA. Conclusions Our data show that mPTP inhibition by CsA alters mitochondrial oxidative metabolism and redox signaling, which leads to differentiation of functional cardiomyocytes from PSCs. PMID:24627421

  5. Differential Expression Analysis for Pathways

    PubMed Central

    Haynes, Winston A.; Higdon, Roger; Stanberry, Larissa; Collins, Dwayne; Kolker, Eugene

    2013-01-01

    Life science technologies generate a deluge of data that hold the keys to unlocking the secrets of important biological functions and disease mechanisms. We present DEAP, Differential Expression Analysis for Pathways, which capitalizes on information about biological pathways to identify important regulatory patterns from differential expression data. DEAP makes significant improvements over existing approaches by including information about pathway structure and discovering the most differentially expressed portion of the pathway. On simulated data, DEAP significantly outperformed traditional methods: with high differential expression, DEAP increased power by two orders of magnitude; with very low differential expression, DEAP doubled the power. DEAP performance was illustrated on two different gene and protein expression studies. DEAP discovered fourteen important pathways related to chronic obstructive pulmonary disease and interferon treatment that existing approaches omitted. On the interferon study, DEAP guided focus towards a four protein path within the 26 protein Notch signalling pathway. PMID:23516350

  6. Mitochondrial aerobic respiration is activated during hair follicle stem cell differentiation, and its dysfunction retards hair regeneration

    PubMed Central

    Tang, Yan; Luo, Binping; Deng, Zhili; Wang, Ben; Liu, Fangfen; Li, Jinmao; Shi, Wei; Xie, Hongfu; Hu, Xingwang

    2016-01-01

    Background. Emerging research revealed the essential role of mitochondria in regulating stem/progenitor cell differentiation of neural progenitor cells, mesenchymal stem cells and other stem cells through reactive oxygen species (ROS), Notch or other signaling pathway. Inhibition of mitochondrial protein synthesis results in hair loss upon injury. However, alteration of mitochondrial morphology and metabolic function during hair follicle stem cells (HFSCs) differentiation and how they affect hair regeneration has not been elaborated upon. Methods. We compared the difference in mitochondrial morphology and activity between telogen bulge cells and anagen matrix cells. Expression levels of mitochondrial ROS and superoxide dismutase 2 (SOD2) were measured to evaluate redox balance. In addition, the level of pyruvate dehydrogenase kinase (PDK) and pyruvate dehydrogenase (PDH) were estimated to present the change in energetic metabolism during differentiation. To explore the effect of the mitochondrial metabolism on regulating hair regeneration, hair growth was observed after application of a mitochondrial respiratory inhibitor upon hair plucking. Results. During HFSCs differentiation, mitochondria became elongated with more abundant organized cristae and showed higher activity in differentiated cells. SOD2 was enhanced for redox balance with relatively stable ROS levels in differentiated cells. PDK increased in HFSCs while differentiated cells showed enhanced PDH, indicating that respiration switched from glycolysis to oxidative phosphorylation during differentiation. Inhibiting mitochondrial respiration in differentiated hair follicle cells upon hair plucking repressed hair regeneration in vivo. Conclusions. Upon HFSCs differentiation, mitochondria are elongated with more abundant cristae and show higher activity, accompanying with activated aerobic respiration in differentiated cells for higher energy supply. Also, dysfunction of mitochondrial respiration delays hair

  7. Defining a Model for Mitochondrial Function in mESC Differentiation

    EPA Science Inventory

    Defining a Model for Mitochondrial Function in mESC DifferentiationDefining a Model for Mitochondrial Function in mESC Differentiation Differentiating embryonic stem cells (ESCs) undergo mitochondrial maturation leading to a switch from a system dependent upon glycolysis to a re...

  8. Defining a Model for Mitochondrial Function in mESC Differentiation

    EPA Science Inventory

    Defining a Model for Mitochondrial Function in mESC DifferentiationDefining a Model for Mitochondrial Function in mESC Differentiation Differentiating embryonic stem cells (ESCs) undergo mitochondrial maturation leading to a switch from a system dependent upon glycolysis to a re...

  9. Proinflammatory cytokines differentially regulate adipocyte mitochondrial metabolism, oxidative stress, and dynamics

    PubMed Central

    Hahn, Wendy S.; Kuzmicic, Jovan; Burrill, Joel S.; Donoghue, Margaret A.; Foncea, Rocio; Jensen, Michael D.; Lavandero, Sergio; Arriaga, Edgar A.

    2014-01-01

    Proinflammatory cytokines differentially regulate adipocyte mitochondrial metabolism, oxidative stress, and dynamics. Macrophage infiltration of adipose tissue and the chronic low-grade production of inflammatory cytokines have been mechanistically linked to the development of insulin resistance, the forerunner of type 2 diabetes mellitus. In this study, we evaluated the chronic effects of TNFα, IL-6, and IL-1β on adipocyte mitochondrial metabolism and morphology using the 3T3-L1 model cell system. TNFα treatment of cultured adipocytes led to significant changes in mitochondrial bioenergetics, including increased proton leak, decreased ΔΨm, increased basal respiration, and decreased ATP turnover. In contrast, although IL-6 and IL-1β decreased maximal respiratory capacity, they had no effect on ΔΨm and varied effects on ATP turnover, proton leak, or basal respiration. Only TNFα treatment of 3T3-L1 cells led to an increase in oxidative stress (as measured by superoxide anion production and protein carbonylation) and C16 ceramide synthesis. Treatment of 3T3-L1 adipocytes with cytokines led to decreased mRNA expression of key transcription factors and control proteins implicated in mitochondrial biogenesis, including PGC-1α and eNOS as well as deceased expression of COX IV and Cyt C. Whereas each cytokine led to effects on expression of mitochondrial markers, TNFα exclusively led to mitochondrial fragmentation and decreased the total level of OPA1 while increasing OPA1 cleavage, without expression of levels of mitofusin 2, DRP-1, or mitofilin being affected. In summary, these results indicate that inflammatory cytokines have unique and specialized effects on adipocyte metabolism, but each leads to decreased mitochondrial function and a reprogramming of fat cell biology. PMID:24595304

  10. The Differential DRP1 Phosphorylation and Mitochondrial Dynamics in the Regional Specific Astroglial Death Induced by Status Epilepticus

    PubMed Central

    Ko, Ah-Reum; Hyun, Hye-Won; Min, Su-Ji; Kim, Ji-Eun

    2016-01-01

    The response and susceptibility to astroglial degenerations are relevant to the distinctive properties of astrocytes in a hemodynamic-independent manner following status epilepticus (SE). Since impaired mitochondrial fission plays an important role in mitosis, apoptosis and programmed necrosis, we investigated whether the unique pattern of mitochondrial dynamics is involved in the characteristics of astroglial death induced by SE. In the present study, SE induced astroglial apoptosis in the molecular layer of the dentate gyrus, accompanied by decreased mitochondrial length. In contrast, clasmatodendritic (autophagic) astrocytes in the CA1 region showed mitochondrial elongation induced by SE. Mdivi-1 (an inhibitor of mitochondrial fission) effectively attenuated astroglial apoptosis, but WY14643 (an enhancer of mitochondrial fission) aggravated it. In addition, Mdivi-1 accelerated clasmatodendritic changes in astrocytes. These regional specific mitochondrial dynamics in astrocytes were closely correlated with dynamin-related protein 1 (DRP1; a mitochondrial fission protein) phosphorylation, not optic atrophy 1 (OPA1; a mitochondrial fusion protein) expression. To the best of our knowledge, the present data demonstrate for the first time the novel role of DRP1-mediated mitochondrial fission in astroglial loss. Thus, the present findings suggest that the differential astroglial mitochondrial dynamics may participate in the distinct characteristics of astroglial death induced by SE. PMID:27242436

  11. Expression of a Mitochondrial Progesterone Receptor (PR-M) in Leiomyomata and Association With Increased Mitochondrial Membrane Potential

    PubMed Central

    Feng, Quanling; Crochet, John R.; Dai, Qunsheng; Leppert, Phyllis C.

    2014-01-01

    Context: Clinical evidence supports a role for progestins in the growth of leiomyomata (fibroids). The mechanism(s) for this is thought to involve gene regulation via the nuclear progesterone receptors. Recently a mitochondrial progesterone receptor (PR-M) has been identified with evidence of a progesterone/progestin-dependent increase in cellular respiration. This observation raises a possible new mechanism whereby progesterone/progestin may affect the growth of fibroids. Objective: The goals of this research were to determine differential expression of PR-M in normal myometrium compared with the edge of a fibroid within the same uterus, to demonstrate a progestin-dependent increase in mitochondria membrane potential using an immortalized human myometrial cell line and to examine mitochondrial membrane potential in transfected cells expressing the complete coding sequence of PR-M. Design: Protein levels of PR-M, PR-B, PR-A, mitochondrial porin, and glyceraldehyde-3-phosphate dehydrogenase were determined in the myometrium and adjacent edge of a fibroid in 10 subjects undergoing hysterectomy for benign indications. Mitochondrial membrane potential was determined by fluorescent emission of 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolecarbocyanide iodine in hTERT-HM cells treated with R5020 and in transfected hTERT-HM cells determined by the fluorescent emission of tetramethylrhodamine methyl ester. Results: Higher levels of PR-M and mitochondrial porin were found in the fibroid edge compared with adjacent myometrium. Progestin increased mitochondrial membrane potential in hTERT-HM cells, which was not affected by a translation inhibitor. This effect was exaggerated in hTERT-HM cells expressing PR-M after transient transfection. Conclusion: These studies suggest a mechanism whereby progesterone/progestin may affect the growth of fibroids by altering mitochondrial activity. PMID:24423317

  12. Effect of mitochondrial fission inhibition on C2C12 differentiation

    PubMed Central

    Bloemberg, Darin; Quadrilatero, Joe

    2016-01-01

    The differentiation of skeletal muscle is commonly examined in cell culture using the C2C12 line of mouse skeletal myoblasts. This process shares many similarities with that which occurs during embryonic development, such as the transient activation of caspases. Here, we examined the effect of inhibiting mitochondrial fission, using mdivi-1, on the ability of C2C12 cells to terminally differentiate. This was performed using immunofluorescent identification of cell morphology and myosin expression, as well as immunoblotting for markers of muscle differentiation. Furthermore, the effect of mdivi-1 administration on activation of caspase-2 and -3 was assessed using spectrofluorometric measurement of specific enzyme activity. PMID:27054170

  13. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly.

    PubMed

    Shan, Yuxi; Cortopassi, Gino

    2016-01-01

    Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with the gene Hspa9/Mortalin in multiple ways: the HSPA9 locus maps to 5q31.2 that is frequently deleted in human MDS; mutant Hspa9 causes zebrafish MDS; and Hspa9 knockdown mice have decreased hematopoiesis. We show here that HSPA9 functions in mitochondrial ISC biogenesis, and is required for erythroid differentiation. HSPA9 interacts with and stabilizes the mitochondrial ISC biogenesis proteins frataxin, Nfs1, ISCU, and Nfu. MDS-causing mutations in HSPA9 protein change its interactions with ISC biogenesis proteins. Depletion of HSPA9 decreases aconitase activity, which requires an ISC at its active site, but not that of the non-ISC requiring malate dehydrogenase, and increases IRP1 binding activity. In erythroid cell lines, Hspa9 depletion inhibited erythroid differentiation, post-transcriptionally regulating the expression of Alas2 and FeCH, as expected through known ISC control of the IRE response elements in these genes. By contrast, the Alas2 open reading frame rescued the Hspa9-dependent defect in erythroid differentiation, but not when uncoupled from its 5'-IRE sequence. Thus, Hspa9 depletion causes a mitochondrial ISC deficit, altering IRP1-IRE binding and FeCH stability, which consequently inhibits Alas2 translation, heme synthesis, and erythroid differentiation, i.e.: Hspa9->ISC->IRP/IRE->Alas2->heme synthesis->erythroid differentiation. Thus Hspa9 regulates erythroid differentiation through ISC cluster assembly, providing a pathophysiological mechanism for an MDS subtype characterized by HSPA9 haploinsufficiency, and suggests hemin and other pharmacological stimulators of ISC synthesis as potential routes to therapy.

  14. A Flavonoid Compound Promotes Neuronal Differentiation of Embryonic Stem Cells via PPAR-β Modulating Mitochondrial Energy Metabolism

    PubMed Central

    Mei, Yu-qin; Pan, Zong-fu; Chen, Wen-teng; Xu, Min-hua; Zhu, Dan-yan; Yu, Yong-ping; Lou, Yi-jia

    2016-01-01

    Relatively little is known regarding mitochondrial metabolism in neuronal differentiation of embryonic stem (ES) cells. By using a small molecule, present research has investigated the pattern of cellular energy metabolism in neural progenitor cells derived from mouse ES cells. Flavonoid compound 4a faithfully facilitated ES cells to differentiate into neurons morphologically and functionally. The expression and localization of peroxisome proliferator-activated receptors (PPARs) were examined in neural progenitor cells. PPAR-β expression showed robust upregulation compared to solvent control. Treatment with PPAR-β agonist L165041 alone or together with compound 4a significantly promoted neuronal differentiation, while antagonist GSK0660 blocked the neurogenesis-promoting effect of compound 4a. Consistently, knockdown of PPAR-β in ES cells abolished compound 4a-induced neuronal differentiation. Interestingly, we found that mitochondrial fusion protein Mfn2 was also abolished by sh-PPAR-β, resulting in abnormal mitochondrial Ca2+ ([Ca2+]M) transients as well as impaired mitochondrial bioenergetics. In conclusion, we demonstrated that by modulating mitochondrial energy metabolism through Mfn2 and mitochondrial Ca2+, PPAR-β took an important role in neuronal differentiation induced by flavonoid compound 4a. PMID:27315062

  15. A Flavonoid Compound Promotes Neuronal Differentiation of Embryonic Stem Cells via PPAR-β Modulating Mitochondrial Energy Metabolism.

    PubMed

    Mei, Yu-Qin; Pan, Zong-Fu; Chen, Wen-Teng; Xu, Min-Hua; Zhu, Dan-Yan; Yu, Yong-Ping; Lou, Yi-Jia

    2016-01-01

    Relatively little is known regarding mitochondrial metabolism in neuronal differentiation of embryonic stem (ES) cells. By using a small molecule, present research has investigated the pattern of cellular energy metabolism in neural progenitor cells derived from mouse ES cells. Flavonoid compound 4a faithfully facilitated ES cells to differentiate into neurons morphologically and functionally. The expression and localization of peroxisome proliferator-activated receptors (PPARs) were examined in neural progenitor cells. PPAR-β expression showed robust upregulation compared to solvent control. Treatment with PPAR-β agonist L165041 alone or together with compound 4a significantly promoted neuronal differentiation, while antagonist GSK0660 blocked the neurogenesis-promoting effect of compound 4a. Consistently, knockdown of PPAR-β in ES cells abolished compound 4a-induced neuronal differentiation. Interestingly, we found that mitochondrial fusion protein Mfn2 was also abolished by sh-PPAR-β, resulting in abnormal mitochondrial Ca2+ ([Ca2+]M) transients as well as impaired mitochondrial bioenergetics. In conclusion, we demonstrated that by modulating mitochondrial energy metabolism through Mfn2 and mitochondrial Ca2+, PPAR-β took an important role in neuronal differentiation induced by flavonoid compound 4a.

  16. Mitochondrial gene expression: influence of nutrients and hormones.

    PubMed

    Berdanier, Carolyn D

    2006-11-01

    Mitochondrial gene transcription research has exploded over the last decade. Nuclear-encoded proteins, nutrients, and hormones all work to regulate the transcription of this genome. To date, very few of the transcription factors have been shown to have negative effects on mitochondrial gene expression, although there are likely conditions where such downregulation may occur.

  17. Differentiation of Human Neural Stem Cells into Motor Neurons Stimulates Mitochondrial Biogenesis and Decreases Glycolytic Flux

    PubMed Central

    Keeney, Paula M.

    2015-01-01

    Differentiation of human pluripotent stem cells (hPSCs) in vitro offers a way to study cell types that are not accessible in living patients. Previous research suggests that hPSCs generate ATP through anaerobic glycolysis, in contrast to mitochondrial oxidative phosphorylation (OXPHOS) in somatic cells; however, specialized cell types have not been assessed. To test if mitobiogenesis is increased during motor neuron differentiation, we differentiated human embryonic stem cell (hESC)- and induced pluripotent stem cell-derived human neural stem cells (hNSCs) into motor neurons. After 21 days of motor neuron differentiation, cells increased mRNA and protein levels of genes expressed by postmitotic spinal motor neurons. Electrophysiological analysis revealed voltage-gated currents characteristic of excitable cells and action potential formation. Quantitative PCR revealed an increase in peroxisome proliferator-activated receptor gamma coactivator 1-α (PGC-1α), an upstream regulator of transcription factors involved in mitobiogenesis, and several of its downstream targets in hESC-derived cultures. This correlated with an increase in protein expression of respiratory subunits, but no increase in protein reflecting mitochondrial mass in either cell type. Respiration analysis revealed a decrease in glycolytic flux in both cell types on day 21 (D21), suggesting a switch from glycolysis to OXPHOS. Collectively, our findings suggest that mitochondrial biogenesis, but not mitochondrial mass, is increased during differentiation of hNSCs into motor neurons. These findings help us to understand human motor neuron mitobiogenesis, a process impaired in amyotrophic lateral sclerosis, a neurodegenerative disease characterized by death of motor neurons in the brain and spinal cord. PMID:25892363

  18. Hypothalamic and amygdalar cell lines differ markedly in mitochondrial rather than nuclear encoded gene expression

    PubMed Central

    2013-01-01

    Background Corticotropin-releasing hormone (CRH) plays an important role in regulating the mammalian stress response. Two of the most extensively studied neuronal populations that express CRH are in the hypothalamus and amygdala. Both regions are involved in the stress response, but the amygdala is also involved in mediating response to fear and anxiety. Given that both hypothalamus and amygdala have overlapping functions, but their CRH-expressing neurons may respond differently to a given perturbation, we sought to identify differentially expressed genes between two neuronal cell types, amygdalar AR-5 and hypothalamic IVB cells. Thus, we performed a microarray analysis. Our hypothesis was that we would identify differentially expressed transcription factors, coregulators and chromatin-modifying enzymes. Results A total of 31,042 genes were analyzed, 10,572 of which were consistently expressed in both cell lines at a 95% confidence level. Of the 10,572 genes, 2,320 genes in AR-5 were expressed at ≥ 2-fold relative to IVBs, 1,104 genes were expressed at ≥2-fold in IVB relative to AR-5 and 7,148 genes were expressed at similar levels between the two cell lines. The greatest difference was in six mitochondrial DNA-encoded genes, which were highly abundant in AR-5 relative to IVB cells. The relative abundance of these genes ranged from 413 to 885-fold according to the microarray results. Differential expression of these genes was verified by RTqPCR. The differentially expressed mitochondrial genes were cytochrome b (MT-CYB), cytochrome c oxidase subunit 1 and 2 (MT-CO1 and MT-CO2) and NADH-ubiquinone oxidoreductase chain 1, 2, and 3 (MT-ND1, MT-ND2, MT-ND3). Conclusion As expected, the array revealed differential expression of transcription factors and coregulators; however the greatest difference between the two cell lines was in genes encoded by the mitochondrial genome. These genes were abundant in AR-5 relative to IVBs. At present, the reason for the marked

  19. Decreased Mitochondrial OGG1 Expression is Linked to Mitochondrial Defects and Delayed Hepatoma Cell Growth

    PubMed Central

    Lee, Young-Kyoung; Youn, Hwang-Guem; Wang, Hee-Jung; Yoon, Gyesoon

    2013-01-01

    Many solid tumor cells exhibit mitochondrial respiratory impairment; however, the mechanisms of such impairment in cancer development remain unclear. Here, we demonstrate that SNU human hepatoma cells with declined mitochondrial respiratory activity showed decreased expression of mitochondrial 8-oxoguanine DNA glycosylase/lyase (mtOGG1), a mitochondrial DNA repair enzyme; similar results were obtained with human hepatocellular carcinoma tissues. Among several OGG1-2 variants with a mitochondrial- targeting sequence (OGG1-2a, -2b, -2c, -2d, and -2e), OGG1-2a was the major mitochondrial isoform in all examined hepatoma cells. Interestingly, hepatoma cells with low mtOGG1 levels showed delayed cell growth and increased intracellular reactive oxygen species (ROS) levels. Knockdown of OGG1-2 isoforms in Chang-L cells, which have active mitochondrial respiration with high mtOGG1 levels, significantly decreased cellular respiration and cell growth, and increased intracellular ROS. Overexpression of OGG1-2a in SNU423 cells, which have low mtOGG1 levels, effectively recovered cellular respiration and cell growth activities, and decreased intracellular ROS. Taken together, our results suggest that mtOGG1 plays an important role in maintaining mitochondrial respiration, thereby contributing to cell growth of hepatoma cells. PMID:23677377

  20. Increased mitochondrial function downstream from KDM5A histone demethylase rescues differentiation in pRB-deficient cells

    PubMed Central

    Váraljai, Renáta; Islam, Abul B.M.M.K.; Beshiri, Michael L.; Rehman, Jalees; Lopez-Bigas, Nuria; Benevolenskaya, Elizaveta V.

    2015-01-01

    The retinoblastoma tumor suppressor protein pRb restricts cell growth through inhibition of cell cycle progression. Increasing evidence suggests that pRb also promotes differentiation, but the mechanisms are poorly understood, and the key question remains as to how differentiation in tumor cells can be enhanced in order to diminish their aggressive potential. Previously, we identified the histone demethylase KDM5A (lysine [K]-specific demethylase 5A), which demethylates histone H3 on Lys4 (H3K4), as a pRB-interacting protein counteracting pRB's role in promoting differentiation. Here we show that loss of Kdm5a restores differentiation through increasing mitochondrial respiration. This metabolic effect is both necessary and sufficient to induce the expression of a network of cell type-specific signaling and structural genes. Importantly, the regulatory functions of pRB in the cell cycle and differentiation are distinct because although restoring differentiation requires intact mitochondrial function, it does not necessitate cell cycle exit. Cells lacking Rb1 exhibit defective mitochondria and decreased oxygen consumption. Kdm5a is a direct repressor of metabolic regulatory genes, thus explaining the compensatory role of Kdm5a deletion in restoring mitochondrial function and differentiation. Significantly, activation of mitochondrial function by the mitochondrial biogenesis regulator Pgc-1α (peroxisome proliferator-activated receptor γ-coactivator 1α; also called PPARGC1A) a coactivator of the Kdm5a target genes, is sufficient to override the differentiation block. Overexpression of Pgc-1α, like KDM5A deletion, inhibits cell growth in RB-negative human cancer cell lines. The rescue of differentiation by loss of KDM5A or by activation of mitochondrial biogenesis reveals the switch to oxidative phosphorylation as an essential step in restoring differentiation and a less aggressive cancer phenotype. PMID:26314709

  1. Moderate superoxide production is an early promoter of mitochondrial biogenesis in differentiating N2a neuroblastoma cells.

    PubMed

    Valero, T; Moschopoulou, G; Mayor-Lopez, L; Kintzios, S

    2012-12-01

    Reactive oxygen species (ROS) have been widely considered as harmful for cell development and as promoters of cell aging by increasing oxidative stress. However, ROS have an important role in cell signaling and they have been demonstrated to be beneficial by triggering hormetic signals, which could protect the organism from later insults. In the present study, N2a murine neuroblastoma cells were used as a paradigm of cell-specific (neural) differentiation partly mediated by ROS. Differentiation was triggered by the established treatments of serum starvation, forskolin or dibutyryl cyclic AMP. A marked differentiation, expressed as the development of neurites, was detected by fixation and staining with coomassie brilliant blue after 48 h treatment. This was accompanied by an increase in mitochondrial mass detected by mitotracker green staining, an increased expression of the peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1-alpha (PGC-1α) and succinate dehydrogenase activity as detected by MTT. In line with these results, an increase in free radicals, specifically superoxide anion, was detected in differentiating cells by flow cytometry. Superoxide scavenging by MnTBAP and MAPK inhibition by PD98059 partially reversed differentiation and mitochondrial biogenesis. In this way, we demonstrated that mitochondrial biogenesis and differentiation are mediated by superoxide and MAPK cues. Our data suggest that differentiation and mitochondrial biogenesis in N2a cells are part of a hormetic response which is triggered by a modest increase of superoxide anion concentration within the mitochondria.

  2. Expression of petite mitochondrial DNA in vivo: zygotic gene rescue.

    PubMed

    Strausberg, R L; Butow, R A

    1977-07-01

    A protocol is introduced for probing the organization and regulation of expression of the yeast mitochondrial genome, termed "zygotic gene rescue." The procedure is based on the notion that genes retained on mitochondrial DNA of on the notion that genes retained on mitochondrial DNA of petites can be expressed in zygotes of a cross between petite and wild type. To test the validity of this notion, we have taken advantage of our ability to discriminate, by mobility differences on sodium dodecyl sulfate/polyacrylamide gels, different forms of the product of alleles of the mitochondrial gene, varI. In petite strains that have retained the varI gene, its characteristic product appears in zygotes 4-5 hr after mating; no product is observed in petite strains deleted in the varI locus. Our studies indicate that (i) expression in the zygote of the varI gene in the petite genome is not exclusively the result of recombination with mitochondrial DNA of the wild-type tester, and (ii) the varI gene is probably reiterated in the petite mitochondrial genome. The strength of the technique of zygotic gene rescue in the analysis of the mitochondrial genome is discussed.

  3. Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells

    PubMed Central

    Burzio, Verónica A.; Villota, Claudio; Villegas, Jaime; Landerer, Eduardo; Boccardo, Enrique; Villa, Luisa L.; Martínez, Ronny; Lopez, Constanza; Gaete, Fancy; Toro, Viviana; Rodriguez, Ximena; Burzio, Luis O.

    2009-01-01

    We reported the presence in human cells of a noncoding mitochondrial RNA that contains an inverted repeat (IR) of 815 nucleotides (nt) covalently linked to the 5′ end of the mitochondrial 16S RNA (16S mtrRNA). The transcript contains a stem-loop structure and is expressed in human proliferating cells but not in resting cells. Here, we demonstrate that, in addition to this transcript, normal human proliferating cells in culture express 2 antisense mitochondrial transcripts. These transcripts also contain stem-loop structures but strikingly they are down-regulated in tumor cell lines and tumor cells present in 17 different tumor types. The differential expression of these transcripts distinguishes normal from tumor cells and might contribute a unique vision on cancer biology and diagnostics. PMID:19470459

  4. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  5. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  6. Cyclophilin-D: a resident regulator of mitochondrial gene expression.

    PubMed

    Radhakrishnan, Jeejabai; Bazarek, Stanley; Chandran, Bala; Gazmuri, Raúl J

    2015-07-01

    Cyclophilin-D (Cyp-D) is a mitochondrial matrix peptidyl-prolyl isomerase. Because cyclophilins can regulate nuclear gene expression, we examined whether Cyp-D could regulate mitochondrial gene expression. We demonstrated in HEK 293T cells that transfected Cyp-D interacts with mitochondrial transcription factors B1 and B2 (TFB2M) but not with mitochondrial transcription factor A. We also demonstrated that Cyp-D interacts in vivo with TFB2M. Genetic silencing of Cyp-D and pharmacologic inhibition of Cyp-D markedly reduced mitochondrial transcription to 18 ± 5% (P < 0.05) and 24 ± 3% (P < 0.05) of respective controls. The level of interaction between Cyp-D and TFB2M correlated with the level of nascent mitochondrial RNA intensity (r = 0.896; P = 0.0156). Cyp-D silencing down-regulated mitochondrial transcripts initiated from the heavy strand promoter 2 [i.e., NADH dehydrogenase 1 (ND1) by 11-fold, P < 0.005; cytochrome oxidase 1 (COX1) by 4-fold, P < 0.001; and ATP synthase subunit 6 (ATP6) by 6.5-fold, P < 0.005); but not NADH dehydrogenase 6 (ND6)], which is initiated from the light strand promoter. Cyp-D silencing reduced mitochondrial membrane potential and cellular oxygen consumption (from 59 ± 5 to 34 ± 1 µmol oxygen/min/10(6) cells, P < 0.001); the latter without a statistically significant reversal after uncoupling electron transport from ATP synthesis, consistent with down-regulation of electron transport complexes. Accordingly, these studies provide novel evidence that Cyp-D could play a key role in regulating mitochondrial gene expression. © FASEB.

  7. Depletion of mitoferrins leads to mitochondrial dysfunction and impairment of adipogenic differentiation in 3T3-L1 preadipocytes.

    PubMed

    Chen, Y-C; Wu, Y-T; Wei, Y-H

    2015-01-01

    Dysregulation of iron homeostasis is a potential risk factor for type 2 diabetes mellitus (T2DM) and insulin resistance. Iron transported into mitochondria by mitoferrins is mainly utilized for the biosynthesis of iron-sulfur clusters, heme, and other cofactors. Recent studies revealed that mitochondrial dysfunction leads to impaired adipogenesis and insulin insensitivity in adipocytes. However, it is unknown whether mitochondrial iron import and iron status affect the biogenesis and function of mitochondria during adipogenic differentiation. In this study, we used double knockdown of mitoferrin 1 and mitoferrin 2 (Mfrn1/2) to investigate the role of mitochondrial iron homeostasis in mitochondrial bioenergetic function and adipogenic differentiation. The results showed that depletion of Mfrn1/2 in 3T3-L1 preadipocytes impaired the biosynthesis of iron-sulfur proteins in mitochondria due to a decrease in mitochondrial iron content. This was associated with a decrease in mitochondrial oxygen consumption rate and intracellular ATP level in adipocytes with Mfrn1/2 knockdown. Remarkably, Mfrn1/2 deficiency reduced the expression of adipogenic genes and lipid production during adipogenic differentiation. Moreover, insulin-induced glucose uptake and Akt phosphorylation at the Ser473 residue were decreased concurrently in adipocytes differentiated from 3T3-L1 preadipocytes after knockdown of Mfrn1/2. These findings suggest that dysregulation of mitochondrial iron metabolism elicited by knockdown of Mfrn1/2 results in mitochondrial dysfunction, which culminates in the compromise of differentiation and insulin insensitivity of adipocytes. This scenario may explain the recent findings that iron deficiency or alterations in iron metabolism are associated with the pathogenesis of T2DM.

  8. Modulation of Mitochondrial DNA Copy Number to Induce Hepatocytic Differentiation of Human Amniotic Epithelial Cells.

    PubMed

    Vaghjiani, Vijesh; Cain, Jason E; Lee, William; Vaithilingam, Vijayaganapathy; Tuch, Bernard E; St John, Justin C

    2017-09-05

    Mitochondrial deoxyribonucleic acid (mtDNA) copy number is tightly regulated during pluripotency and differentiation. There is increased demand of cellular adenosine triphosphate (ATP) during differentiation for energy-intensive cell types such as hepatocytes and neurons to meet the cell's functional requirements. During hepatocyte differentiation, mtDNA copy number should be synchronously increased to generate sufficient ATP through oxidative phosphorylation. Unlike bone marrow mesenchymal cells, mtDNA copy number failed to increase by 28 days of differentiation of human amniotic epithelial cells (hAEC) into hepatocyte-like cells (HLC) despite their expression of some end-stage hepatic markers. This was due to higher levels of DNA methylation at exon 2 of POLGA, the mtDNA-specific replication factor. Treatment with a DNA demethylation agent, 5-azacytidine, resulted in increased mtDNA copy number, reduced DNA methylation at exon 2 of POLGA, and reduced hepatic gene expression. Depletion of mtDNA followed by subsequent differentiation did not increase mtDNA copy number, but reduced DNA methylation at exon 2 of POLGA and increased expression of hepatic and pluripotency genes. We encapsulated hAEC in barium alginate microcapsules and subsequently differentiated them into HLC. Encapsulation resulted in no net increase of mtDNA copy number but a significant reduction in DNA methylation of POLGA. RNAseq analysis showed that differentiated HLC express hepatocyte-specific genes but also increased expression of inflammatory interferon genes. Differentiation in encapsulated cells showed suppression of inflammatory genes as well as increased expression of genes associated with hepatocyte function pathways and networks. This study demonstrates that an increase in classical hepatic gene expression can be achieved in HLC through encapsulation, although they fail to effectively regulate mtDNA copy number.

  9. Inhibition of mitochondrial function in HL60 cells is associated with an increased apoptosis and expression of CD14.

    PubMed

    Mills, K I; Woodgate, L J; Gilkes, A F; Walsh, V; Sweeney, M C; Brown, G; Burnett, A K

    1999-09-24

    The myelomonocytic cell line HL60 can be induced by a variety of chemical agents to differentiation to either neutrophils or monocytes. Examination of gene expression, by differential display, in cells induced to monocytes with 1alpha,25-dihydroxyvitamin D(3) or neutrophils with all-trans retinoic acid (ATRA) identified a number of clones with altered patterns of expression over the period of differentiation. One of these clones was the mitochondrial gene NADH dehydrogenase subunit 4 (ND4) which showed a differential pattern of expression between the neutrophil and monocyte lineages. The potential of mitochondrial inhibitors to induce differentiation was investigated by treating the HL60 cells with either the NADH dehydrogenase inhibitor, Rotenone, the complex III inhibitor, Antimycin A, or the highly specific mitochondrial ATP-synthase inhibitor, Oligomycin. Although functional assays of differentiation did not produce any positive results, all the inhibitors resulted in a dramatic increase in CD14 expression at day 1, with CD38 markers not observed until day 3. The increased expression of CD14 was accompanied by a decrease in viability and all CD14 positive cells were also positive for Annexin V, a marker of apoptosis. These results suggest that inhibition of the components of the mitochondrial pathways may lead to the marking of some cells, via CD14, for cell death, whilst allowing commitment to differentiation to occur in the surviving population. Copyright 1999 Academic Press.

  10. Evidence for mitochondrial genetic control of autosomal gene expression.

    PubMed

    Kassam, Irfahan; Qi, Tuan; Lloyd-Jones, Luke; Holloway, Alexander; Jan Bonder, Marc; Henders, Anjali K; Martin, Nicholas G; Powell, Joseph E; Franke, Lude; Montgomery, Grant W; Visscher, Peter M; McRae, Allan F

    2016-12-15

    The mitochondrial and nuclear genomes coordinate and co-evolve in eukaryotes in order to adapt to environmental changes. Variation in the mitochondrial genome is capable of affecting expression of genes on the nuclear genome. Sex-specific mitochondrial genetic control of gene expression has been demonstrated in Drosophila melanogaster, where males were found to drive most of the total variation in gene expression. This has potential implications for male-related health and disease resulting from variation in mtDNA solely inherited from the mother. We used a family-based study comprised of 47,323 gene expression probes and 78 mitochondrial SNPs (mtSNPs) from n = 846 individuals to examine the extent of mitochondrial genetic control of gene expression in humans. This identified 15 significant probe-mtSNP associations (P<10-8) corresponding to 5 unique genes on the mitochondrial and nuclear genomes, with three of these genes corresponding to mitochondrial genetic control of gene expression in the nuclear genome. The associated mtSNPs for three genes (one cis and two trans associations) were replicated (P < 0.05) in an independent dataset of n = 452 unrelated individuals. There was no evidence for sexual dimorphic gene expression in any of these five probes. Sex-specific effects were examined by applying our analysis to males and females separately and testing for differences in effect size. The MEST gene was identified as having the most significantly different effect sizes across the sexes (P≈10-7). MEST was similarly expressed in males and females with the G allele; however, males with the C allele are highly expressed for MEST, while females show no expression of the gene. This study provides evidence for the mitochondrial genetic control of expression of several genes in humans, with little evidence found for sex-specific effects. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Unequal and genotype-dependent expression of mitochondrial genes in larvae of the pacific oyster Crassostrea gigas.

    PubMed

    Curole, Jason P; Meyer, Eli; Manahan, Donal T; Hedgecock, Dennis

    2010-04-01

    Mitochondria are essential for regulation of energy metabolism, but little is known about patterns of mitochondrial genome expression in invertebrates. To explore the association of mitochondrial expression with differential growth of Crassostrea gigas, the Pacific oyster, we crossed two inbred lines to produce inbred and hybrid larvae, which grew at different rates under the same environmental conditions. Using high-throughput cloning and sequencing methods, we identified 1.1 million expressed sequence tags from the mitochondrial genome, 96.7% of which were perfect matches to genes targeted by the method. Expression varied significantly among genes, ranging over nearly four orders of magnitude, from mt:lRNA, which constituted 21% of all transcripts, to mt:CoII, which constituted less than 0.02% of all transcripts. Variable expression of genes coding for subunits of macromolecular complexes (e.g., mt:CoI and mt:CoII) implies that stoichiometry in these complexes must be regulated post-transcriptionally. Surprisingly, the mitochondrial transcriptome contained non-coding transcripts, which may play a role in the regulation of mitochondrial function. Finally, mitochondrial expression depended strongly on maternal factors and nuclear-cytoplasmic interactions, which may explain previously observed growth differences between reciprocal hybrids. Differences in mitochondrial gene expression could provide a biochemical index for the metabolic basis of genetically determined differences in larval growth.

  12. Classical and Novel TSPO Ligands for the Mitochondrial TSPO Can Modulate Nuclear Gene Expression: Implications for Mitochondrial Retrograde Signaling.

    PubMed

    Yasin, Nasra; Veenman, Leo; Singh, Sukhdev; Azrad, Maya; Bode, Julia; Vainshtein, Alex; Caballero, Beatriz; Marek, Ilan; Gavish, Moshe

    2017-04-07

    It is known that knockdown of the mitochondrial 18 kDa translocator protein (TSPO) as well as TSPO ligands modulate various functions, including functions related to cancer. To study the ability of TSPO to regulate gene expression regarding such functions, we applied microarray analysis of gene expression to U118MG glioblastoma cells. Within 15 min, the classical TSPO ligand PK 11195 induced changes in expression of immediate early genes and transcription factors. These changes also included gene products that are part of the canonical pathway serving to modulate general gene expression. These changes are in accord with real-time, reverse transcriptase (RT) PCR. At the time points of 15, 30, 45, and 60 min, as well as 3 and 24 h of PK 11195 exposure, the functions associated with the changes in gene expression in these glioblastoma cells covered well known TSPO functions. These functions included cell viability, proliferation, differentiation, adhesion, migration, tumorigenesis, and angiogenesis. This was corroborated microscopically for cell migration, cell accumulation, adhesion, and neuronal differentiation. Changes in gene expression at 24 h of PK 11195 exposure were related to downregulation of tumorigenesis and upregulation of programmed cell death. In the vehicle treated as well as PK 11195 exposed cell cultures, our triple labeling showed intense TSPO labeling in the mitochondria but no TSPO signal in the cell nuclei. Thus, mitochondrial TSPO appears to be part of the mitochondria-to-nucleus signaling pathway for modulation of nuclear gene expression. The novel TSPO ligand 2-Cl-MGV-1 appeared to be very specific regarding modulation of gene expression of immediate early genes and transcription factors.

  13. Differential Aminoacylase Expression in Neuroblastoma

    PubMed Central

    Long, Patrick M.; Stradecki, Holly M.; Minturn, Jane E.; Wesley, Umadevi V.; Jaworski, Diane M.

    2012-01-01

    Neuroblastoma, a cancer of the sympathetic nervous system, is the most common extracranial solid tumor in children. MYCN amplification and increased BDNF/TrkB signaling are features of high-risk tumors; yet, only ~25% of malignant tumors display these features. Thus, the identification of additional biomarkers and therapeutic targets is essential. Since aminoacylase 1 (ACY1), an amino acid deacetylase, is a putative tumor suppressor in small cell lung and renal cell carcinomas, we investigated whether it or the other family members aspartoacylase (ASPA, aminoacylase 2) or aminoacylase 3 (ACY3) could serve a similar function in neuroblastoma. Aminoacylase expression was examined in TrkB-positive, MYCN-amplified (SMS-KCNR and SK-N-BE) and TrkB-negative, non-MYCN amplified (SK-N-AS, SK-N-SH, SH-SY5Y, and SH-EP) neuroblastoma cell lines. Each aminoacylase exhibited distinct spatial localization (i.e., cytosolic ACY1, membrane-associated ASPA, and nuclear ACY3). When SK-N-SH cells were treated with neural differentiation agents (e.g., retinoic acid, cAMP) in media containing 10% serum ACY1 was the only aminoacylase whose expression was up-regulated. ASPA was primarily expressed in SH-EP cells of a glial sublineage. ACY3 was more highly expressed in the TrkB-positive, MYCN-amplified lines. All three aminoacylases were expressed in normal human adrenal gland, a common site of neuroblastoma origin, but only ACY1 and ACY3 displayed detectable expression in primary neuroblastoma tumor. Bioinformatics data mining of Kaplan-Meier survival revealed that high ACY3 expression is correlated with poor prognosis; while, low expression of ACY1 or ASPA is correlated with poor prognosis. These data suggest that aminoacylase expression is dysregulated in neuroblastoma. PMID:21128244

  14. Gemini surfactants mediate efficient mitochondrial gene delivery and expression.

    PubMed

    Cardoso, Ana M; Morais, Catarina M; Cruz, A Rita; Cardoso, Ana L; Silva, Sandra G; do Vale, M Luísa; Marques, Eduardo F; Pedroso de Lima, Maria C; Jurado, Amália S

    2015-03-02

    Gene delivery targeting mitochondria has the potential to transform the therapeutic landscape of mitochondrial genetic diseases. Taking advantage of the nonuniversal genetic code used by mitochondria, a plasmid DNA construct able to be specifically expressed in these organelles was designed by including a codon, which codes for an amino acid only if read by the mitochondrial ribosomes. In the present work, gemini surfactants were shown to successfully deliver plasmid DNA to mitochondria. Gemini surfactant-based DNA complexes were taken up by cells through a variety of routes, including endocytic pathways, and showed propensity for inducing membrane destabilization under acidic conditions, thus facilitating cytoplasmic release of DNA. Furthermore, the complexes interacted extensively with lipid membrane models mimicking the composition of the mitochondrial membrane, which predicts a favored interaction of the complexes with mitochondria in the intracellular environment. This work unravels new possibilities for gene therapy toward mitochondrial diseases.

  15. Adult-onset obesity is triggered by impaired mitochondrial gene expression

    PubMed Central

    Perks, Kara L.; Ferreira, Nicola; Richman, Tara R.; Ermer, Judith A.; Kuznetsova, Irina; Shearwood, Anne-Marie J.; Lee, Richard G.; Viola, Helena M.; Johnstone, Victoria P. A.; Matthews, Vance; Hool, Livia C.; Rackham, Oliver; Filipovska, Aleksandra

    2017-01-01

    Mitochondrial gene expression is essential for energy production; however, an understanding of how it can influence physiology and metabolism is lacking. Several proteins from the pentatricopeptide repeat (PPR) family are essential for the regulation of mitochondrial gene expression, but the functions of the remaining members of this family are poorly understood. We created knockout mice to investigate the role of the PPR domain 1 (PTCD1) protein and show that loss of PTCD1 is embryonic lethal, whereas haploinsufficient, heterozygous mice develop age-induced obesity. The molecular defects and metabolic consequences of mitochondrial protein haploinsufficiency in vivo have not been investigated previously. We show that PTCD1 haploinsufficiency results in increased RNA metabolism, in response to decreased protein synthesis and impaired RNA processing that affect the biogenesis of the respiratory chain, causing mild uncoupling and changes in mitochondrial morphology. We demonstrate that with age, these effects lead to adult-onset obesity that results in liver steatosis and cardiac hypertrophy in response to tissue-specific differential regulation of the mammalian target of rapamycin pathways. Our findings indicate that changes in mitochondrial gene expression have long-term consequences on energy metabolism, providing evidence that haploinsufficiency of PTCD1 can be a major predisposing factor for the development of metabolic syndrome. PMID:28835921

  16. Adult-onset obesity is triggered by impaired mitochondrial gene expression.

    PubMed

    Perks, Kara L; Ferreira, Nicola; Richman, Tara R; Ermer, Judith A; Kuznetsova, Irina; Shearwood, Anne-Marie J; Lee, Richard G; Viola, Helena M; Johnstone, Victoria P A; Matthews, Vance; Hool, Livia C; Rackham, Oliver; Filipovska, Aleksandra

    2017-08-01

    Mitochondrial gene expression is essential for energy production; however, an understanding of how it can influence physiology and metabolism is lacking. Several proteins from the pentatricopeptide repeat (PPR) family are essential for the regulation of mitochondrial gene expression, but the functions of the remaining members of this family are poorly understood. We created knockout mice to investigate the role of the PPR domain 1 (PTCD1) protein and show that loss of PTCD1 is embryonic lethal, whereas haploinsufficient, heterozygous mice develop age-induced obesity. The molecular defects and metabolic consequences of mitochondrial protein haploinsufficiency in vivo have not been investigated previously. We show that PTCD1 haploinsufficiency results in increased RNA metabolism, in response to decreased protein synthesis and impaired RNA processing that affect the biogenesis of the respiratory chain, causing mild uncoupling and changes in mitochondrial morphology. We demonstrate that with age, these effects lead to adult-onset obesity that results in liver steatosis and cardiac hypertrophy in response to tissue-specific differential regulation of the mammalian target of rapamycin pathways. Our findings indicate that changes in mitochondrial gene expression have long-term consequences on energy metabolism, providing evidence that haploinsufficiency of PTCD1 can be a major predisposing factor for the development of metabolic syndrome.

  17. A focused microarray to study human mitochondrial and nuclear gene expression.

    PubMed

    Voss, Joachim G; Raju, Raghavan; Logun, Carolea; Danner, Robert L; Munson, Peter J; Rangel, Zoila; Dalakas, Marinos C

    2008-04-01

    A focused microarray (huMITOchip) was developed to study alterations of human mitochondrial and nuclear gene expression in health and disease. The huMITOchip contains 4,774 probe sets identical to the Affymetrix U 133 plus 2.0 chip covering genes affecting mitochondrial, lipid, cytokine, apoptosis, and muscle function transcripts. Unlike other gene chips, the huMITOchip has 51 probe sets that interrogate 37 genes of the mitochondrial genome. The human mitochondrial gene chip was validated against the Affymetrix U133 plus 2.0 array using an in vitro system of CCL136 muscle cell line stimulated with or without interferon gamma (IFN-gamma). The 37 genes from the mtDNA demonstrated absolute gene expression levels ranging from 0.1 to 3,182. The comparison of the two gene chips yielded an excellent Pearson's correlation coefficient (r = 0.98). At least 17 probe sets were differentially expressed in response to IFN-gamma on both chips, with a high degree of concordance. This is the first report on the development of a focused oligonucleotide microarray containing genes of the mitochondrial genome.

  18. A Focused Microarray to Study Human Mitochondrial and Nuclear Gene Expression

    PubMed Central

    Voss, Joachim G.; Raju, Raghavan; Logun, Carolea; Danner, Robert L.; Munson, Peter J.; Rangel, Zoila; Dalakas, Marinos C.

    2016-01-01

    A focused microarray (huMITOchip) was developed to study alterations of human mitochondrial and nuclear gene expression in health and disease. The huMITOchip contains 4,774 probe sets identical to the Affymetrix U 133 plus 2.0 chip covering genes affecting mitochondrial, lipid, cytokine, apoptosis, and muscle function transcripts. Unlike other gene chips, the huMITOchip has 51 probe sets that interrogate 37 genes of the mitochondrial genome. The human mitochondrial gene chip was validated against the Affymetrix U133 plus 2.0 array using an in vitro system of CCL136 muscle cell line stimulated with or without interferon gamma (IFN-γ). The 37 genes from the mtDNA demonstrated absolute gene expression levels ranging from 0.1 to 3,182. The comparison of the two gene chips yielded an excellent Pearson’s correlation coefficient (r = 0.98). At least 17 probe sets were differentially expressed in response to IFN-γ on both chips, with a high degree of concordance. This is the first report on the development of a focused oligonucleotide microarray containing genes of the mitochondrial genome. PMID:18398222

  19. SIRT3 blocks myofibroblast differentiation and pulmonary fibrosis by preventing mitochondrial DNA damage.

    PubMed

    Bindu, Samik; Pillai, Vinodkumar B; Kanwal, Abhinav; Samant, Sadhana; Mutlu, Gökhan M; Verdin, Eric; Dulin, Nickolai; Gupta, Mahesh P

    2017-01-01

    Myofibroblast differentiation is a key process in the pathogenesis of fibrotic diseases. Transforming growth factor-β1 (TGF-β1) is a powerful inducer of myofibroblast differentiation and is implicated in pathogenesis of tissue fibrosis. This study was undertaken to determine the role of mitochondrial deacetylase SIRT3 in TGF-β1-induced myofibroblast differentiation in vitro and lung fibrosis in vivo. Treatment of human lung fibroblasts with TGF-β1 resulted in increased expression of fibrosis markers, smooth muscle α-actin (α-SMA), collagen-1, and fibronectin. TGF-β1 treatment also caused depletion of endogenous SIRT3, which paralleled with increased production of reactive oxygen species (ROS), DNA damage, and subsequent reduction in levels of 8-oxoguanine DNA glycosylase (OGG1), an enzyme that hydrolyzes oxidized guanine (8-oxo-dG) and thus protects DNA from oxidative damage. Overexpression of SIRT3 by adenovirus-mediated transduction reversed the effects of TGF-β1 on ROS production and mitochondrial DNA damage and inhibited TGF-β1-induced myofibroblast differentiation. To determine the antifibrotic role of SIRT3 in vivo, we used the bleomycin-induced mouse model of pulmonary fibrosis. Compared with wild-type controls, Sirt3-knockout mice showed exacerbated fibrosis after intratracheal instillation of bleomycin. Increased lung fibrosis was associated with decreased levels of OGG1 and concomitant accumulation of 8-oxo-dG and increased mitochondrial DNA damage. In contrast, the transgenic mice with whole body Sirt3 overexpression were protected from bleomycin-induced mtDNA damage and development of lung fibrosis. These data demonstrate a critical role of SIRT3 in the control of myofibroblast differentiation and lung fibrosis. Copyright © 2017 the American Physiological Society.

  20. Regulation of mitochondrial biogenesis and GLUT4 expression by exercise.

    PubMed

    Holloszy, John O

    2011-04-01

    Endurance exercise training can induce large increases mitochondria and the GLUT4 isoform of the glucose transporter in skeletal muscle. For a long time after the discovery in the 1960s that exercise results in an increase in muscle mitochondria, there was no progress in elucidation of the mechanisms involved. The reason for this lack of progress was that nothing was known regarding how expression of the genes-encoding mitochondrial proteins is coordinately regulated. This situation changed rapidly after discovery of transcription factors that control transcription of genes-encoding mitochondrial proteins and, most importantly, the discovery of peroxisome proliferator-gamma coactivator-1α (PGC-1α). This transcription coactivator binds to and activates transcription factors that regulate transcription of genes-encoding mitochondrial proteins. Thus, PGC-1α activates and coordinates mitochondrial biogenesis. It is now known that exercise rapidly activates and induces increased expression of PGC-1α. The exercise-generated signals that lead to PGC-1α activation and increased expression are the increases in cytosolic Ca(2+) and decreases in ATP and creatine phosphate (∼P). Ca(2+) mediates its effect by activating CAMKII, while the decrease in ∼P mediates its effect via activation of AMPK. Expression of the GLUT4 isoform of the glucose transporter is regulated in parallel with mitochondrial biogenesis via the same signaling pathways. This review describes what is known regarding the regulation of mitochondrial biogenesis and GLUT4 expression by exercise. A major component of this review deals with the physiological and metabolic consequences of the exercise-induced increase in mitochondria and GLUT4. © 2011 American Physiological Society. Compr Physiol 1:699-729, 2011.

  1. Bioenergetics and mitochondrial transmembrane potential during differentiation of cultured osteoblasts

    NASA Technical Reports Server (NTRS)

    Komarova, S. V.; Ataullakhanov, F. I.; Globus, R. K.

    2000-01-01

    To evaluate the relationship between osteoblast differentiation and bioenergetics, cultured primary osteoblasts from fetal rat calvaria were grown in medium supplemented with ascorbate to induce differentiation. Before ascorbate treatment, the rate of glucose consumption was 320 nmol. h(-1). 10(6) cells(-1), respiration was 40 nmol. h(-1). 10(6) cells(-1), and the ratio of lactate production to glucose consumption was approximately 2, indicating that glycolysis was the main energy source for immature osteoblasts. Ascorbate treatment for 14 days led to a fourfold increase in respiration, a threefold increase in ATP production, and a fivefold increase in ATP content compared with that shown in immature cells. Confocal imaging of mitochondria stained with a transmembrane potential-sensitive vital dye showed that mature cells possessed abundant amounts of high-transmembrane-potential mitochondria, which were concentrated near the culture medium-facing surface. Acute treatment of mature osteoblasts with metabolic inhibitors showed that the rate of glycolysis rose to maintain the cellular energy supply constant. Thus progressive differentiation coincided with changes in cellular metabolism and mitochondrial activity, which are likely to play key roles in osteoblast function.

  2. Bioenergetics and mitochondrial transmembrane potential during differentiation of cultured osteoblasts

    NASA Technical Reports Server (NTRS)

    Komarova, S. V.; Ataullakhanov, F. I.; Globus, R. K.

    2000-01-01

    To evaluate the relationship between osteoblast differentiation and bioenergetics, cultured primary osteoblasts from fetal rat calvaria were grown in medium supplemented with ascorbate to induce differentiation. Before ascorbate treatment, the rate of glucose consumption was 320 nmol. h(-1). 10(6) cells(-1), respiration was 40 nmol. h(-1). 10(6) cells(-1), and the ratio of lactate production to glucose consumption was approximately 2, indicating that glycolysis was the main energy source for immature osteoblasts. Ascorbate treatment for 14 days led to a fourfold increase in respiration, a threefold increase in ATP production, and a fivefold increase in ATP content compared with that shown in immature cells. Confocal imaging of mitochondria stained with a transmembrane potential-sensitive vital dye showed that mature cells possessed abundant amounts of high-transmembrane-potential mitochondria, which were concentrated near the culture medium-facing surface. Acute treatment of mature osteoblasts with metabolic inhibitors showed that the rate of glycolysis rose to maintain the cellular energy supply constant. Thus progressive differentiation coincided with changes in cellular metabolism and mitochondrial activity, which are likely to play key roles in osteoblast function.

  3. 1,25-Dihydroxyvitamin D3/vitamin D receptor suppresses brown adipocyte differentiation and mitochondrial respiration.

    PubMed

    Ricciardi, Carolyn J; Bae, Jiyoung; Esposito, Debora; Komarnytsky, Slavko; Hu, Pan; Chen, Jiangang; Zhao, Ling

    2015-09-01

    The vitamin D system plays a role in metabolism regulation. 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) suppressed 3T3-L1 white adipocyte differentiation. Vitamin D receptor (VDR) knockout mice showed increased energy expenditure, whereas mice with adipose-specific VDR over-expression showed decreased energy expenditure. Brown adipose tissue (BAT), now known to be present in adult humans, functions in non-shivering thermogenesis by uncoupling ATP synthesis from respiration and plays an important role in energy expenditure. However, the effects of 1,25(OH)2D3/VDR on brown adipocyte differentiation and mitochondrial respiration have not been reported. mRNA expression of VDR and the metabolizing enzymes 1α-hydroxylase (CYP27B1) and 24-hydroxylase (CYP24A1) were examined in BAT of mice models of obesity and during brown adipocyte differentiation. The effects of 1,25(OH)2D3 and VDR over-expression on brown adipocyte differentiation and functional outcomes were evaluated. No significant changes in mRNA of VDR and CYP27B1 were noted in both diet-induced obese (DIO) and ob/ob mice, whereas uncoupling protein 1 mRNA was downregulated in BAT of ob/ob, but not DIO mice when compared to the controls. In contrast, mRNA of VDR, CYP24A1, and CYP27B1 were downregulated during brown adipocyte differentiation in vitro. 1,25(OH)2D3 dose-dependently suppressed brown adipocyte differentiation, accompanied by suppressed isoproterenol-stimulated oxygen consumption rates (OCR), maximal OCR and OCR from proton leak. Consistently, over-expression of VDR also suppressed brown adipocyte differentiation. Further, both 1,25(OH)2D3 and VDR over-expression suppressed PPARγ transactivation in brown preadipocytes. Our results demonstrate the suppressive effects of 1,25(OH)2D3/VDR signaling on brown adipocyte differentiation and mitochondrial respiration. The role of 1,25(OH)2D3/VDR system in regulating BAT development and function in obesity warrant further investigation.

  4. Does the mitochondrial transcription-termination complex play an essential role in controlling differential transcription of the mitochondrial DNA?

    PubMed

    Selwood, S P; Chrzanowska-Lightowlers, Z M; Lightowlers, R N

    2000-02-01

    The mechanism of mitochondrial transcription is well documented although the method of regulation remains obscure. The mitochondrial transcription-termination complex, mTERF, holds a key position in determining the fate of heavy-strand promotor-initiated transcripts and has been suggested as a candidate in the regulation of mitochondrial DNA (mtDNA) transcription. We report here the first example of a modulation of mTERF-complex binding activity concomitant with a differential mtDNA transcription rate. We suggest that these observations are indicative of a method of intra-organellar transcriptional fine tuning.

  5. AK2 deficiency compromises the mitochondrial energy metabolism required for differentiation of human neutrophil and lymphoid lineages

    PubMed Central

    Six, E; Lagresle-Peyrou, C; Susini, S; De Chappedelaine, C; Sigrist, N; Sadek, H; Chouteau, M; Cagnard, N; Fontenay, M; Hermine, O; Chomienne, C; Reynier, P; Fischer, A; André-Schmutz, I; Gueguen, N; Cavazzana, M

    2015-01-01

    Reticular dysgenesis is a human severe combined immunodeficiency that is primarily characterized by profound neutropenia and lymphopenia. The condition is caused by mutations in the adenylate kinase 2 (AK2) gene, resulting in the loss of mitochondrial AK2 protein expression. AK2 regulates the homeostasis of mitochondrial adenine nucleotides (ADP, ATP and AMP) by catalyzing the transfer of high-energy phosphate. Our present results demonstrate that AK2-knocked-down progenitor cells have poor proliferative and survival capacities and are blocked in their differentiation toward lymphoid and granulocyte lineages. We also observed that AK2 deficiency impaired mitochondrial function in general and oxidative phosphorylation in particular – showing that AK2 is critical in the control of energy metabolism. Loss of AK2 disrupts this regulation and leads to a profound block in lymphoid and myeloid cell differentiation. PMID:26270350

  6. Interferon-stimulated gene ISG12b1 inhibits adipogenic differentiation and mitochondrial biogenesis in 3T3-L1 cells.

    PubMed

    Li, Bing; Shin, Jonghyun; Lee, Kichoon

    2009-03-01

    Microarray analysis was performed to find a new group of genes or pathways that might be important in adipocyte development and metabolism. Among them, a mouse interferon-stimulated gene 12b1 (ISG12b1) is expressed at a 400-fold higher level in adipocytes compared with stromal-vascular cells. It is predominantly expressed in adipose tissue among other tissues we tested. Developmentally, ISG12b1 mRNA expression was initially inhibited followed by a dramatic induction during both in vivo and in vitro adipogenic differentiation. Adenovirus-mediated overexpression of ISG12b1 inhibited adipogenic differentiation in 3T3-L1 cells as shown by decreased lipid staining with Oil-Red-O and reduction in adipogenic marker proteins including peroxisome proliferator-activated receptor-gamma (PPARgamma), and CCAAT/enhancer-binding protein-alpha (C/EBPalpha). Our bioinformatics analysis for the predicted localization of ISG12b1 protein suggested the mitochondrial localization, which was confirmed by the colocalization of hemagglutinin-tagged ISG12b1 protein with mitochondrial marker MitoTracker. In addition, ISG12b1 protein was exclusively detected in protein extract from the fractionated mitochondria by Western blot analysis. Furthermore, overexpression of ISG12b1 in adipocytes reduced mitochondrial DNA content and gene expression of mitochondrial transcription factor A (mtTFA), nuclear respiratory factor 1 (NRF1), and cytochrome oxidase II, suggesting an inhibitory role of ISG12b1 in mitochondrial biogenesis and function. Activation of mitochondrial biogenesis and function by treatment with PPARgamma and PPARalpha agonists in 3T3-L1 cells and cold exposure in mice induced mitochondrial transcription factors and reduced ISG12 expression. These data demonstrated that mitochondrial-localized ISG12b1 protein inhibits adipocyte differentiation and mitochondrial biogenesis and function, implying the important role of mitochondrial function in adipocyte development and associated

  7. Differentiation State-Specific Mitochondrial Dynamic Regulatory Networks Are Revealed by Global Transcriptional Analysis of the Developing Chicken Lens

    PubMed Central

    Chauss, Daniel; Basu, Subhasree; Rajakaruna, Suren; Ma, Zhiwei; Gau, Victoria; Anastas, Sara; Brennan, Lisa A.; Hejtmancik, J. Fielding; Menko, A. Sue; Kantorow, Marc

    2014-01-01

    The mature eye lens contains a surface layer of epithelial cells called the lens epithelium that requires a functional mitochondrial population to maintain the homeostasis and transparency of the entire lens. The lens epithelium overlies a core of terminally differentiated fiber cells that must degrade their mitochondria to achieve lens transparency. These distinct mitochondrial populations make the lens a useful model system to identify those genes that regulate the balance between mitochondrial homeostasis and elimination. Here we used an RNA sequencing and bioinformatics approach to identify the transcript levels of all genes expressed by distinct regions of the lens epithelium and maturing fiber cells of the embryonic Gallus gallus (chicken) lens. Our analysis detected more than 15,000 unique transcripts expressed by the embryonic chicken lens. Of these, more than 3000 transcripts exhibited significant differences in expression between lens epithelial cells and fiber cells. Multiple transcripts coding for separate mitochondrial homeostatic and degradation mechanisms were identified to exhibit preferred patterns of expression in lens epithelial cells that require mitochondria relative to lens fiber cells that require mitochondrial elimination. These included differences in the expression levels of metabolic (DUT, PDK1, SNPH), autophagy (ATG3, ATG4B, BECN1, FYCO1, WIPI1), and mitophagy (BNIP3L/NIX, BNIP3, PARK2, p62/SQSTM1) transcripts between lens epithelial cells and lens fiber cells. These data provide a comprehensive window into all genes transcribed by the lens and those mitochondrial regulatory and degradation pathways that function to maintain mitochondrial populations in the lens epithelium and to eliminate mitochondria in maturing lens fiber cells. PMID:24928582

  8. Nuclear expression of a mitochondrial DNA gene: mitochondrial targeting of allotopically expressed mutant ATP6 in transgenic mice.

    PubMed

    Dunn, David A; Pinkert, Carl A

    2012-01-01

    Nuclear encoding of mitochondrial DNA transgenes followed by mitochondrial targeting of the expressed proteins (allotopic expression; AE) represents a potentially powerful strategy for creating animal models of mtDNA disease. Mice were created that allotopically express either a mutant (A6M) or wildtype (A6W) mt-Atp6 transgene. Compared to non-transgenic controls, A6M mice displayed neuromuscular and motor deficiencies (wire hang, pole, and balance beam analyses; P < 0.05), no locomotor differences (gait analysis; P < 0.05) and enhanced endurance in Rota-Rod evaluations (P < 0.05). A6W mice exhibited inferior muscle strength (wire hang test; P < 0.05), no difference in balance beam footsteps, accelerating Rota-Rod, pole test and gait analyses; (P < 0.05) and superior performance in balance beam time-to-cross and constant velocity Rota-Rod analyses (P < 0.05) in comparison to non-transgenic control mice. Mice of both transgenic lines did not differ from non-transgenic controls in a number of bioenergetic and biochemical tests including measurements of serum lactate and mitochondrial MnSOD protein levels, ATP synthesis rate, and oxygen consumption (P > 0.05). This study illustrates a mouse model capable of circumventing in vivo mitochondrial mutations. Moreover, it provides evidence supporting AE as a tool for mtDNA disease research with implications in development of DNA-based therapeutics.

  9. The Impact of Mitochondrial Complex Inhibition on mESC Differentiation

    EPA Science Inventory

    The Impact of Mitochondrial Complex Inhibition on mESC Differentiation JE Royland, SH Warren, S Jeffay, MR Hoopes, HP Nichols, ES Hunter U.S. Environmental Protection Agency, Integrated Systems Toxicology Division, Research Triangle Park, NC The importance of mitochondrial funct...

  10. The Impact of Mitochondrial Complex Inhibition on mESC Differentiation

    EPA Science Inventory

    The Impact of Mitochondrial Complex Inhibition on mESC Differentiation JE Royland, SH Warren, S Jeffay, MR Hoopes, HP Nichols, ES Hunter U.S. Environmental Protection Agency, Integrated Systems Toxicology Division, Research Triangle Park, NC The importance of mitochondrial funct...

  11. [Standardized indirect immunofluorescence. Differentiation of mitochondrial, microsomal and ribosomal antibodies].

    PubMed

    Storch, W

    1977-02-15

    By an extensive standardisation of the indirect immunofluorescence for the demonstration espeially of mitochondrial antibodies we succeeded in recognizing atypical fluorescence patterns and in describing their exact localisation. On the basis of absorption studies with mitochondrias, microsomas and ribosomas by comparative observation of sections of liver, stomach and kidneys of rats the preferred sort of reaction and the intensity of fluorescence of antibodies against mitochondria, microsomas and ribosomas were empirically established. Antimitochondrial antibodies react above all with the parietal cells of the stomach and the distal epithelia of the tubulus of the kidney. Antibodies against microsomas of liver and kidney are characterized by a brilliant diffuse cytoplasmatic fluorescence of the hepatocytes and by a comparatively weaker fluorescence of exclusively proximal tubuli of the kidneys of rats. Antibodies against ribosomas lead to a fluorescence especially of the main cells of the stomach. The differentiation of several cytoplasmatic antibodies is among others of interest for the diagnosis of certain autoimmune diseases. Although there are numerous still unclear findings and "overlap" phenomena the existence of high titre antibodies against mitochondrias speaks for a primarily biliary cirrhosis or a pseudo-LE-syndrome, the existence of antibodies against microsomas of kidney and liver of rats for a special form of a chronically active hepatitis and the existence of the very rare antibodies against ribosomas for an active lupus erythematodes disseminatus.

  12. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  13. DNA microarray analysis of genes differentially expressed in adipocyte differentiation.

    PubMed

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming

    2014-06-01

    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  14. A reduction in ATP demand and mitochondrial activity with neural differentiation of human embryonic stem cells.

    PubMed

    Birket, Matthew J; Orr, Adam L; Gerencser, Akos A; Madden, David T; Vitelli, Cathy; Swistowski, Andrzej; Brand, Martin D; Zeng, Xianmin

    2011-02-01

    Here, we have investigated mitochondrial biology and energy metabolism in human embryonic stem cells (hESCs) and hESC-derived neural stem cells (NSCs). Although stem cells collectively in vivo might be expected to rely primarily on anaerobic glycolysis for ATP supply, to minimise production of reactive oxygen species, we show that in vitro this is not so: hESCs generate an estimated 77% of their ATP through oxidative phosphorylation. Upon differentiation of hESCs into NSCs, oxidative phosphorylation declines both in absolute rate and in importance relative to glycolysis. A bias towards ATP supply from oxidative phosphorylation in hESCs is consistent with the expression levels of the mitochondrial gene regulators peroxisome-proliferator-activated receptor γ coactivator (PGC)-1α, PGC-1β and receptor-interacting protein 140 (RIP140) in hESCs when compared with a panel of differentiated cell types. Analysis of the ATP demand showed that the slower ATP turnover in NSCs was associated with a slower rate of most energy-demanding processes but occurred without a reduction in the cellular growth rate. This mismatch is probably explained by a higher rate of macromolecule secretion in hESCs, on the basis of evidence from electron microscopy and an analysis of conditioned media. Taken together, our developmental model provides an understanding of the metabolic transition from hESCs to more quiescent somatic cell types, and supports important roles for mitochondria and secretion in hESC biology.

  15. Ancient Out-of-Africa Mitochondrial DNA Variants Associate with Distinct Mitochondrial Gene Expression Patterns

    PubMed Central

    Mishmar, Dan

    2016-01-01

    Mitochondrial DNA (mtDNA) variants have been traditionally used as markers to trace ancient population migrations. Although experiments relying on model organisms and cytoplasmic hybrids, as well as disease association studies, have served to underline the functionality of certain mtDNA SNPs, only little is known of the regulatory impact of ancient mtDNA variants, especially in terms of gene expression. By analyzing RNA-seq data of 454 lymphoblast cell lines from the 1000 Genomes Project, we found that mtDNA variants defining the most common African genetic background, the L haplogroup, exhibit a distinct overall mtDNA gene expression pattern, which was independent of mtDNA copy numbers. Secondly, intra-population analysis revealed subtle, yet significant, expression differences in four tRNA genes. Strikingly, the more prominent African mtDNA gene expression pattern best correlated with the expression of nuclear DNA-encoded RNA-binding proteins, and with SNPs within the mitochondrial RNA-binding proteins PTCD1 and MRPS7. Our results thus support the concept of an ancient regulatory transition of mtDNA-encoded genes as humans left Africa to populate the rest of the world. PMID:27812116

  16. The effects of mitochondrial genotype on hypoxic survival and gene expression in a hybrid population of the killifish, Fundulus heteroclitus

    PubMed Central

    Flight, Patrick A.; Nacci, Diane; Champlin, Denise; Whitehead, Andrew; Rand, David M.

    2012-01-01

    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study we draw on a population of the teleost fish, Fundulus heteroclitus, where functionally distinct subspecies hybridize, likely as a result of past glacial events. We had two specific aims: 1) to determine the effect of mtDNA genotype on survivorship of male and female fish under hypoxic stress; 2) to determine the effect of hypoxic stress, sex and mtDNA genotype on gene expression. We found an unexpected and highly significant effect of sex on survivorship under hypoxic conditions, but no significant effect of mtDNA genotype. Gene expression analyses revealed hundreds of transcripts differentially regulated by sex and hypoxia. Mitochondrial transcripts and other predicted pathways were among those influenced by hypoxic stress, and a transcript corresponding to the mtDNA control region was the most highly suppressed transcript under conditions of hypoxia. An RT-PCR experiment on the control region was consistent with microarray results. Effects of mtDNA sequence variation on genome expression were limited, however a potentially important epistasis between mtDNA sequence and expression of a nuclear-encoded mitochondrial translation protein was discovered. Overall, these results confirm that mitochondrial regulation is a major component of hypoxia tolerance and further suggest that purifying selection has been the predominant selective force on mitochondrial genomes in these two subspecies. PMID:21980951

  17. The effects of mitochondrial genotype on hypoxic survival and gene expression in a hybrid population of the killifish, Fundulus heteroclitus.

    PubMed

    Flight, Patrick A; Nacci, Diane; Champlin, Denise; Whitehead, Andrew; Rand, David M

    2011-11-01

    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study, we draw on a population of the teleost fish, Fundulus heteroclitus, where functionally distinct subspecies hybridize, likely as a result of past glacial events. We had two specific aims: (i) to determine the effect of mtDNA genotype on survivorship of male and female fish under hypoxic stress and (ii) to determine the effect of hypoxic stress, sex and mtDNA genotype on gene expression. We found an unexpected and highly significant effect of sex on survivorship under hypoxic conditions, but no significant effect of mtDNA genotype. Gene expression analyses revealed hundreds of transcripts differentially regulated by sex and hypoxia. Mitochondrial transcripts and other predicted pathways were among those influenced by hypoxic stress, and a transcript corresponding to the mtDNA control region was the most highly suppressed transcript under the conditions of hypoxia. An RT-PCR experiment on the control region was consistent with microarray results. Effects of mtDNA sequence variation on genome expression were limited; however, a potentially important epistasis between mtDNA sequence and expression of a nuclear-encoded mitochondrial translation protein was discovered. Overall, these results confirm that mitochondrial regulation is a major component of hypoxia tolerance and further suggest that purifying selection has been the predominant selective force on mitochondrial genomes in these two subspecies.

  18. Melatonin enhances neural stem cell differentiation and engraftment by increasing mitochondrial function.

    PubMed

    Mendivil-Perez, Miguel; Soto-Mercado, Viviana; Guerra-Librero, Ana; Fernandez-Gil, Beatriz I; Florido, Javier; Shen, Ying-Qiang; Tejada, Miguel A; Capilla-Gonzalez, Vivian; Rusanova, Iryna; Garcia-Verdugo, José M; Acuña-Castroviejo, Darío; López, Luis Carlos; Velez-Pardo, Carlos; Jimenez-Del-Rio, Marlene; Ferrer, José M; Escames, Germaine

    2017-09-01

    Neural stem cells (NSCs) are regarded as a promising therapeutic approach to protecting and restoring damaged neurons in neurodegenerative diseases (NDs) such as Parkinson's disease and Alzheimer's disease (PD and AD, respectively). However, new research suggests that NSC differentiation is required to make this strategy effective. Several studies have demonstrated that melatonin increases mature neuronal markers, which reflects NSC differentiation into neurons. Nevertheless, the possible involvement of mitochondria in the effects of melatonin during NSC differentiation has not yet been fully established. We therefore tested the impact of melatonin on NSC proliferation and differentiation in an attempt to determine whether these actions depend on modulating mitochondrial activity. We measured proliferation and differentiation markers, mitochondrial structural and functional parameters as well as oxidative stress indicators and also evaluated cell transplant engraftment. This enabled us to show that melatonin (25 μM) induces NSC differentiation into oligodendrocytes and neurons. These effects depend on increased mitochondrial mass/DNA/complexes, mitochondrial respiration, and membrane potential as well as ATP synthesis in NSCs. It is also interesting to note that melatonin prevented oxidative stress caused by high levels of mitochondrial activity. Finally, we found that melatonin enriches NSC engraftment in the ND mouse model following transplantation. We concluded that a combined therapy involving transplantation of NSCs pretreated with pharmacological doses of melatonin could efficiently restore neuronal cell populations in PD and AD mouse models depending on mitochondrial activity promotion. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. TGF-β1-Mediated Differentiation of Fibroblasts Is Associated with Increased Mitochondrial Content and Cellular Respiration

    PubMed Central

    Negmadjanov, Ulugbek; Godic, Zarko; Rizvi, Farhan; Emelyanova, Larisa; Ross, Gracious; Richards, John; Holmuhamedov, Ekhson L.; Jahangir, Arshad

    2015-01-01

    Objectivs Cytokine-dependent activation of fibroblasts to myofibroblasts, a key event in fibrosis, is accompanied by phenotypic changes with increased secretory and contractile properties dependent on increased energy utilization, yet changes in the energetic profile of these cells are not fully described. We hypothesize that the TGF-β1-mediated transformation of myofibroblasts is associated with an increase in mitochondrial content and function when compared to naive fibroblasts. Methods Cultured NIH/3T3 mouse fibroblasts treated with TGF-β1, a profibrotic cytokine, or vehicle were assessed for transformation to myofibroblasts (appearance of α-smooth muscle actin [α-SMA] stress fibers) and associated changes in mitochondrial content and functions using laser confocal microscopy, Seahorse respirometry, multi-well plate reader and biochemical protocols. Expression of mitochondrial-specific proteins was determined using western blotting, and the mitochondrial DNA quantified using Mitochondrial DNA isolation kit. Results Treatment with TGF-β1 (5 ng/mL) induced transformation of naive fibroblasts into myofibroblasts with a threefold increase in the expression of α-SMA (6.85 ± 0.27 RU) compared to cells not treated with TGF-β1 (2.52 ± 0.11 RU). TGF-β1 exposure increased the number of mitochondria in the cells, as monitored by membrane potential sensitive dye tetramethylrhodamine, and expression of mitochondria-specific proteins; voltage-dependent anion channels (0.54 ± 0.05 vs. 0.23 ± 0.05 RU) and adenine nucleotide transporter (0.61 ± 0.11 vs. 0.22 ± 0.05 RU), as well as mitochondrial DNA content (530 ± 12 μg DNA/106 cells vs. 307 ± 9 μg DNA/106 cells in control). TGF-β1 treatment was associated with an increase in mitochondrial function with a twofold increase in baseline oxygen consumption rate (2.25 ± 0.03 vs. 1.13 ± 0.1 nmol O2/min/106 cells) and FCCP-induced mitochondrial respiration (2.87 ± 0.03 vs. 1.46 ± 0.15 nmol O2/min/106 cells

  20. TGF-β1-mediated differentiation of fibroblasts is associated with increased mitochondrial content and cellular respiration.

    PubMed

    Negmadjanov, Ulugbek; Godic, Zarko; Rizvi, Farhan; Emelyanova, Larisa; Ross, Gracious; Richards, John; Holmuhamedov, Ekhson L; Jahangir, Arshad

    2015-01-01

    Cytokine-dependent activation of fibroblasts to myofibroblasts, a key event in fibrosis, is accompanied by phenotypic changes with increased secretory and contractile properties dependent on increased energy utilization, yet changes in the energetic profile of these cells are not fully described. We hypothesize that the TGF-β1-mediated transformation of myofibroblasts is associated with an increase in mitochondrial content and function when compared to naive fibroblasts. Cultured NIH/3T3 mouse fibroblasts treated with TGF-β1, a profibrotic cytokine, or vehicle were assessed for transformation to myofibroblasts (appearance of α-smooth muscle actin [α-SMA] stress fibers) and associated changes in mitochondrial content and functions using laser confocal microscopy, Seahorse respirometry, multi-well plate reader and biochemical protocols. Expression of mitochondrial-specific proteins was determined using western blotting, and the mitochondrial DNA quantified using Mitochondrial DNA isolation kit. Treatment with TGF-β1 (5 ng/mL) induced transformation of naive fibroblasts into myofibroblasts with a threefold increase in the expression of α-SMA (6.85 ± 0.27 RU) compared to cells not treated with TGF-β1 (2.52 ± 0.11 RU). TGF-β1 exposure increased the number of mitochondria in the cells, as monitored by membrane potential sensitive dye tetramethylrhodamine, and expression of mitochondria-specific proteins; voltage-dependent anion channels (0.54 ± 0.05 vs. 0.23 ± 0.05 RU) and adenine nucleotide transporter (0.61 ± 0.11 vs. 0.22 ± 0.05 RU), as well as mitochondrial DNA content (530 ± 12 μg DNA/106 cells vs. 307 ± 9 μg DNA/106 cells in control). TGF-β1 treatment was associated with an increase in mitochondrial function with a twofold increase in baseline oxygen consumption rate (2.25 ± 0.03 vs. 1.13 ± 0.1 nmol O2/min/106 cells) and FCCP-induced mitochondrial respiration (2.87 ± 0.03 vs. 1.46 ± 0.15 nmol O2/min/106 cells). TGF-β1 induced differentiation

  1. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-07-15

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  2. The canonical intrinsic mitochondrial death pathway has a non-apoptotic role in signaling lens cell differentiation.

    PubMed

    Weber, Gregory F; Menko, A Sue

    2005-06-10

    The mitochondrial cell death pathway is known for its role in signaling apoptosis. Here, we describe a novel function for the mitochondrial cell death pathway in signaling initiation of differentiation in the developing lens. Most remarkably, we induced lens cell differentiation by short-term exposure of lens epithelial cells to the apoptogen staurosporine. Activation of apoptosis-related pathways induced lens epithelial cells to express differentiation-specific markers and to undergo morphogenetic changes that led to formation of the lens-like structures known as lentoids. The fact that multiple stages of differentiation are expressed at a single stage of development in the embryonic lens made it possible to precisely determine the timing of expression of proteins associated with the apoptotic pathway. We discovered that there was high expression in the lens equatorial epithelium (the region of the lens in which differentiation is initiated) of pro-apoptotic molecules such as Bax and Bcl-x(S) and release of cytochrome c from mitochondria. Furthermore, we found significant caspase-3-like activity in the equatorial epithelium, yet this activity was far lower than that associated with lens cell apoptosis. These apoptotic pathways are likely regulated by the concurrent expression of prosurvival molecules, including Bcl-2 and Bcl-x(L); phosphorylation of Bad; and high expression of inhibitor of apoptosis proteins chicken IAP1, IAP3, and survivin. This finding suggests that prosurvival pathways allow pro-apoptotic molecules to function as molecular switches in the differentiation process without tipping the balance toward apoptosis. We call this process apoptosis-related Bcl-2- and caspase-dependent (ABC) differentiation.

  3. Permeability transition pore-mediated mitochondrial superoxide flashes regulate cortical neural progenitor differentiation.

    PubMed

    Hou, Yan; Mattson, Mark P; Cheng, Aiwu

    2013-01-01

    In the process of neurogenesis, neural progenitor cells (NPCs) cease dividing and differentiate into postmitotic neurons that grow dendrites and an axon, become excitable, and establish synapses with other neurons. Mitochondrial biogenesis and aerobic metabolism provide energy substrates required to support the differentiation, growth and synaptic activity of neurons. Mitochondria may also serve signaling functions and, in this regard, it was recently reported that mitochondria can generate rapid bursts of superoxide (superoxide flashes), the frequency of which changes in response to environmental conditions and signals including oxygen levels and Ca(2+) fluxes. Here we show that the frequency of mitochondrial superoxide flashes increases as embryonic cerebral cortical neurons differentiate from NPCs, and provide evidence that the superoxide flashes serve a signaling function that is critical for the differentiation process. The superoxide flashes are mediated by mitochondrial permeability transition pore (mPTP) opening, and pharmacological inhibition of the mPTP suppresses neuronal differentiation. Moreover, superoxide flashes and neuronal differentiation are inhibited by scavenging of mitochondrial superoxide. Conversely, manipulations that increase superoxide flash frequency accelerate neuronal differentiation. Our findings reveal a regulatory role for mitochondrial superoxide flashes, mediated by mPTP opening, in neuronal differentiation.

  4. Mitochondrial-related gene expression changes are sensitive to agonal-pH state: implications for brain disorders

    PubMed Central

    Vawter, MP; Tomita, H; Meng, F; Bolstad, B; Li, J; Evans, S; Choudary, P; Atz, M; Shao, L; Neal, C; Walsh, DM; Burmeister, M; Speed, T; Myers, R; Jones, EG; Watson, SJ; Akil, H; Bunney, WE

    2010-01-01

    Mitochondrial defects in gene expression have been implicated in the pathophysiology of bipolar disorder and schizophrenia. We have now contrasted control brains with low pH versus high pH and showed that 28% of genes in mitochondrial-related pathways meet criteria for differential expression. A majority of genes in the mitochondrial, chaperone and proteasome pathways of nuclear DNA-encoded gene expression were decreased with decreased brain pH, whereas a majority of genes in the apoptotic and reactive oxygen stress pathways showed an increased gene expression with a decreased brain pH. There was a significant increase in mitochondrial DNA copy number and mitochondrial DNA gene expression with increased agonal duration. To minimize effects of agonal-pH state on mood disorder comparisons, two classic approaches were used, removing all subjects with low pH and agonal factors from analysis, or grouping low and high pH as a separate variable. Three groups of potential candidate genes emerged that may be mood disorder related: (a) genes that showed no sensitivity to pH but were differentially expressed in bipolar disorder or major depressive disorder; (b) genes that were altered by agonal-pH in one direction but altered in mood disorder in the opposite direction to agonal-pH and (c) genes with agonal-pH sensitivity that displayed the same direction of changes in mood disorder. Genes from these categories such as NR4A1 and HSPA2 were confirmed with Q-PCR. The interpretation of postmortem brain studies involving broad mitochondrial gene expression and related pathway alterations must be monitored against the strong effect of agonal-pH state. Genes with the least sensitivity to agonal-pH could present a starting point for candidate gene search in neuropsychiatric disorders. PMID:16636682

  5. Gene Expression in a Drosophila Model of Mitochondrial Disease

    PubMed Central

    Fernández-Ayala, Daniel J. M.; Chen, Shanjun; Kemppainen, Esko; O'Dell, Kevin M. C.; Jacobs, Howard T.

    2010-01-01

    Background A point mutation in the Drosophila gene technical knockout (tko), encoding mitoribosomal protein S12, was previously shown to cause a phenotype of respiratory chain deficiency, developmental delay, and neurological abnormalities similar to those presented in many human mitochondrial disorders, as well as defective courtship behavior. Methodology/Principal Findings Here, we describe a transcriptome-wide analysis of gene expression in tko25t mutant flies that revealed systematic and compensatory changes in the expression of genes connected with metabolism, including up-regulation of lactate dehydrogenase and of many genes involved in the catabolism of fats and proteins, and various anaplerotic pathways. Gut-specific enzymes involved in the primary mobilization of dietary fats and proteins, as well as a number of transport functions, were also strongly up-regulated, consistent with the idea that oxidative phosphorylation OXPHOS dysfunction is perceived physiologically as a starvation for particular biomolecules. In addition, many stress-response genes were induced. Other changes may reflect a signature of developmental delay, notably a down-regulation of genes connected with reproduction, including gametogenesis, as well as courtship behavior in males; logically this represents a programmed response to a mitochondrially generated starvation signal. The underlying signalling pathway, if conserved, could influence many physiological processes in response to nutritional stress, although any such pathway involved remains unidentified. Conclusions/Significance These studies indicate that general and organ-specific metabolism is transformed in response to mitochondrial dysfunction, including digestive and absorptive functions, and give important clues as to how novel therapeutic strategies for mitochondrial disorders might be developed. PMID:20066047

  6. Transgene expression of Drosophila melanogaster nucleoside kinase reverses mitochondrial thymidine kinase 2 deficiency.

    PubMed

    Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A; Kuiper, Raoul V; Curbo, Sophie; Karlsson, Anna

    2013-02-15

    A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK(+/-) transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK(+/-)TK2(-/-) mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK(+/-)TK2(-/-) mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency.

  7. Bcmimp1, a Botrytis cinerea Gene Transiently Expressed in planta, Encodes a Mitochondrial Protein

    PubMed Central

    Benito-Pescador, David; Santander, Daniela; Arranz, M.; Díaz-Mínguez, José M.; Eslava, Arturo P.; van Kan, Jan A. L.; Benito, Ernesto P.

    2016-01-01

    Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of reactive oxygen species, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor. PMID:26952144

  8. Bcmimp1, a Botrytis cinerea Gene Transiently Expressed in planta, Encodes a Mitochondrial Protein.

    PubMed

    Benito-Pescador, David; Santander, Daniela; Arranz, M; Díaz-Mínguez, José M; Eslava, Arturo P; van Kan, Jan A L; Benito, Ernesto P

    2016-01-01

    Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of reactive oxygen species, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.

  9. Adipocyte differentiation is regulated by mitochondrial trifunctional protein α-subunit via sirtuin 1.

    PubMed

    Liu, Hong-Xia; Wang, Yan-Mei; Hu, Jian-Ping; Huang, Li-Ying; Fang, Ning-Yuan

    2017-08-15

    Mitochondrial trifunctional protein α-subunit (MTPα) is involved in the fatty acid β-oxidation (FAO) pathway. Two MTPα activities, 3-hydroxyacyl-CoA dehydrogenase and long-chain hydratase, have been linked with the occurrence and development of obesity and obesity-related disorders. These activities catalyze two steps in the FAO pathway (the second and third reactions). However, the role of MTPα in the pathogenesis of obesity has not been evaluated, and the functional role of MTPα in adipocyte differentiation has not been determined. Here, we analyzed the functional role of MTPα using in vitro and in vivo models of adipogenesis. MTPα expression was upregulated during the differentiation of 3T3-L1 preadipocyte cells into adipocytes. MTPα gene silencing stimulated peroxisome proliferator-activated receptor gamma (PPARγ) and CCAAT-enhancer-binding protein alpha(C/EBPα) expression, which promoted adipocyte differentiation. By contrast, MTPα overexpression blocked adipogenesis in 3T3-L1 cells. Further analysis showed that MTPα positively regulated sirtuin 1 (SIRT1). Injection of preadipocytes overexpressing MTPα into athymic mice significantly impaired de novo fat pad formation compared with that of the control, and furthermore MTPα knockdown enhances fat pad formation at a time point earlier than 5-week, such as week-2 and week-3, when the control fat pad is not fully developed. In summary, our data indicate that MTPα is a novel factor that negatively regulates adipocyte differentiation. We propose a pathway in which MTPα inhibits adipogenesis by promoting SIRT1 expression, which represses PPARγ and attenuates adipogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. A conserved MADS-box phosphorylation motif regulates differentiation and mitochondrial function in skeletal, cardiac, and smooth muscle cells.

    PubMed

    Mughal, W; Nguyen, L; Pustylnik, S; da Silva Rosa, S C; Piotrowski, S; Chapman, D; Du, M; Alli, N S; Grigull, J; Halayko, A J; Aliani, M; Topham, M K; Epand, R M; Hatch, G M; Pereira, T J; Kereliuk, S; McDermott, J C; Rampitsch, C; Dolinsky, V W; Gordon, J W

    2015-10-29

    Exposure to metabolic disease during fetal development alters cellular differentiation and perturbs metabolic homeostasis, but the underlying molecular regulators of this phenomenon in muscle cells are not completely understood. To address this, we undertook a computational approach to identify cooperating partners of the myocyte enhancer factor-2 (MEF2) family of transcription factors, known regulators of muscle differentiation and metabolic function. We demonstrate that MEF2 and the serum response factor (SRF) collaboratively regulate the expression of numerous muscle-specific genes, including microRNA-133a (miR-133a). Using tandem mass spectrometry techniques, we identify a conserved phosphorylation motif within the MEF2 and SRF Mcm1 Agamous Deficiens SRF (MADS)-box that regulates miR-133a expression and mitochondrial function in response to a lipotoxic signal. Furthermore, reconstitution of MEF2 function by expression of a neutralizing mutation in this identified phosphorylation motif restores miR-133a expression and mitochondrial membrane potential during lipotoxicity. Mechanistically, we demonstrate that miR-133a regulates mitochondrial function through translational inhibition of a mitophagy and cell death modulating protein, called Nix. Finally, we show that rodents exposed to gestational diabetes during fetal development display muscle diacylglycerol accumulation, concurrent with insulin resistance, reduced miR-133a, and elevated Nix expression, as young adult rats. Given the diverse roles of miR-133a and Nix in regulating mitochondrial function, and proliferation in certain cancers, dysregulation of this genetic pathway may have broad implications involving insulin resistance, cardiovascular disease, and cancer biology.

  11. Ketamine induces toxicity in human neurons differentiated from embryonic stem cells via mitochondrial apoptosis pathway

    PubMed Central

    Bosnjak, Zeljko J.; Yan, Yasheng; Canfield, Scott; Muravyeva, Maria Y.; Kikuchi, Chika; Wells, Clive; Corbett, John; Bai, Xiaowen

    2013-01-01

    Ketamine is widely used for anesthesia in pediatric patients. Growing evidence indicates that ketamine causes neurotoxicity in a variety of developing animal models. Our understanding of anesthesia neurotoxicity in humans is currently limited by difficulties in obtaining neurons and performing developmental toxicity studies in fetal and pediatric populations. It may be possible to overcome these challenges by obtaining neurons from human embryonic stem cells (hESCs) in vitro. hESCs are able to replicate indefinitely and differentiate into every cell type. In this study, we investigated the toxic effect of ketamine on neurons differentiated from hESCs. Two-week-old neurons were treated with different doses and durations of ketamine with or without the reactive oxygen species (ROS) scavenger, Trolox. Cell viability, ultrastructure, mitochondrial membrane potential (ΔΨm), cytochrome c distribution within cells, apoptosis, and ROS production were evaluated. Here we show that ketamine induced ultrastructural abnormalities and dose- and time-dependently caused cell death. In addition, ketamine decreased ΔΨm and increased cytochrome c release from mitochondria. Ketamine also increased ROS production and induced differential expression of oxidative stress-related genes. Specifically, abnormal ultrastructural and ΔΨm changes occurred earlier than cell death in the ketamine-induced toxicity process. Furthermore, Trolox significantly decreased ROS generation and attenuated cell death caused by ketamine in a dose-dependent manner. In conclusion, this study illustrates that ketamine time- and dose-dependently induces human neurotoxicity via ROS-mediated mitochondrial apoptosis pathway and that these side effects can be prevented by the antioxidant agent Trolox. Thus, hESC-derived neurons might provide a promising tool for studying anesthetic-induced developmental neurotoxicity and prevention strategies. PMID:22873495

  12. FoxO1 interacts with transcription factor EB and differentially regulates mitochondrial uncoupling proteins via autophagy in adipocytes

    PubMed Central

    Liu, Longhua; Tao, Zhipeng; Zheng, Louise D; Brooke, Joseph P; Smith, Cayleen M; Liu, Dongmin; Long, Yun Chau; Cheng, Zhiyong

    2016-01-01

    Mitochondrial uncoupling proteins (UCPs) are inducible and play an important role in metabolic and redox homeostasis. Recent studies have suggested that FoxO1 controls mitochondrial biogenesis and morphology, but it remains largely unknown how FoxO1 may regulate mitochondrial UCPs. Here we show that FoxO1 interacted with transcription factor EB (Tfeb), a key regulator of autophagosome and lysosome, and mediated the expression of UCP1, UCP2 and UCP3 differentially via autophagy in adipocytes. UCP1 was down-regulated but UCP2 and UCP3 were upregulated during adipocyte differentiation, which was associated with increased Tfeb and autophagy activity. However, inhibition of FoxO1 suppressed Tfeb and autophagy, attenuating UCP2 and UCP3 but increasing UCP1 expression. Pharmacological blockade of autophagy recapitulated the effects of FoxO1 inhibition on UCPs. Chromatin immunoprecipitation assay demonstrated that FoxO1 interacted with Tfeb by directly binding to its promoter, and silencing FoxO1 led to drastic decrease in Tfeb transcript and protein levels. These data provide the first line of evidence that FoxO1 interacts with Tfeb to regulate autophagy and UCP expression in adipocytes. Dysregulation of FoxO1→autophagy→UCP pathway may account for metabolic changes in obesity. PMID:27777789

  13. Mitophagy is required for mitochondrial biogenesis and myogenic differentiation of C2C12 myoblasts.

    PubMed

    Sin, Jon; Andres, Allen M; Taylor, David J R; Weston, Thomas; Hiraumi, Yoshimi; Stotland, Aleksandr; Kim, Brandon J; Huang, Chengqun; Doran, Kelly S; Gottlieb, Roberta A

    2016-01-01

    Myogenesis is a crucial process governing skeletal muscle development and homeostasis. Differentiation of primitive myoblasts into mature myotubes requires a metabolic switch to support the increased energetic demand of contractile muscle. Skeletal myoblasts specifically shift from a highly glycolytic state to relying predominantly on oxidative phosphorylation (OXPHOS) upon differentiation. We have found that this phenomenon requires dramatic remodeling of the mitochondrial network involving both mitochondrial clearance and biogenesis. During early myogenic differentiation, autophagy is robustly upregulated and this coincides with DNM1L/DRP1 (dynamin 1-like)-mediated fragmentation and subsequent removal of mitochondria via SQSTM1 (sequestosome 1)-mediated mitophagy. Mitochondria are then repopulated via PPARGC1A/PGC-1α (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha)-mediated biogenesis. Mitochondrial fusion protein OPA1 (optic atrophy 1 [autosomal dominant]) is then briskly upregulated, resulting in the reformation of mitochondrial networks. The final product is a myotube replete with new mitochondria. Respirometry reveals that the constituents of these newly established mitochondrial networks are better primed for OXPHOS and are more tightly coupled than those in myoblasts. Additionally, we have found that suppressing autophagy with various inhibitors during differentiation interferes with myogenic differentiation. Together these data highlight the integral role of autophagy and mitophagy in myogenic differentiation.

  14. Mitophagy is required for mitochondrial biogenesis and myogenic differentiation of C2C12 myoblasts

    PubMed Central

    Sin, Jon; Andres, Allen M.; Taylor, David J. R.; Weston, Thomas; Hiraumi, Yoshimi; Stotland, Aleksandr; Kim, Brandon J.; Huang, Chengqun; Doran, Kelly S.; Gottlieb, Roberta A.

    2016-01-01

    ABSTRACT Myogenesis is a crucial process governing skeletal muscle development and homeostasis. Differentiation of primitive myoblasts into mature myotubes requires a metabolic switch to support the increased energetic demand of contractile muscle. Skeletal myoblasts specifically shift from a highly glycolytic state to relying predominantly on oxidative phosphorylation (OXPHOS) upon differentiation. We have found that this phenomenon requires dramatic remodeling of the mitochondrial network involving both mitochondrial clearance and biogenesis. During early myogenic differentiation, autophagy is robustly upregulated and this coincides with DNM1L/DRP1 (dynamin 1-like)-mediated fragmentation and subsequent removal of mitochondria via SQSTM1 (sequestosome 1)-mediated mitophagy. Mitochondria are then repopulated via PPARGC1A/PGC-1α (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha)-mediated biogenesis. Mitochondrial fusion protein OPA1 (optic atrophy 1 [autosomal dominant]) is then briskly upregulated, resulting in the reformation of mitochondrial networks. The final product is a myotube replete with new mitochondria. Respirometry reveals that the constituents of these newly established mitochondrial networks are better primed for OXPHOS and are more tightly coupled than those in myoblasts. Additionally, we have found that suppressing autophagy with various inhibitors during differentiation interferes with myogenic differentiation. Together these data highlight the integral role of autophagy and mitophagy in myogenic differentiation. PMID:26566717

  15. Nitric oxide inhibition of Drp1-mediated mitochondrial fission is critical for myogenic differentiation

    PubMed Central

    De Palma, C; Falcone, S; Pisoni, S; Cipolat, S; Panzeri, C; Pambianco, S; Pisconti, A; Allevi, R; Bassi, MT; Cossu, G; Pozzan, T; Moncada, S; Scorrano, L; Brunelli, S; Clementi, E

    2011-01-01

    During myogenic differentiation the short mitochondria of myoblasts change into the extensively elongated network observed in myotubes. The functional relevance and the molecular mechanisms driving the formation of this mitochondrial network are unknown. We now show that mitochondrial elongation is required for myogenesis to occur and that this event depends on the cellular generation of nitric oxide (NO). Inhibition of NO synthesis in myogenic precursor cells leads to inhibition of mitochondrial elongation and of myogenic differentiation. This is due to the enhanced activity, translocation and docking of the pro-fission GTPase dynamin-related protein-1 (Drp1) to mitochondria, leading also to a latent mitochondrial dysfunction that increased sensitivity to apoptotic stimuli. These effects of NO inhibition were not observed in myogenic precursor cells containing a dominant-negative form of Drp1. Both NO-dependent repression of Drp1 action and maintenance of mitochondrial integrity and function were mediated through the soluble guanylate cyclase. These data uncover a novel level of regulation of differentiation linking mitochondrial morphology and function to myogenic differentiation. PMID:20467441

  16. Mitochondrial respiratory gene expression is suppressed in many cancers

    PubMed Central

    Reznik, Ed; Wang, Qingguo; La, Konnor; Schultz, Nikolaus; Sander, Chris

    2017-01-01

    The fundamental metabolic decision of a cell, the balance between respiration and fermentation, rests in part on expression of the mitochondrial genome (mtDNA) and coordination with expression of the nuclear genome (nuDNA). Previously we described mtDNA copy number depletion across many solid tumor types (Reznik et al., 2016). Here, we use orthogonal RNA-sequencing data to quantify mtDNA expression (mtRNA), and report analogously lower expression of mtRNA in tumors (relative to normal tissue) across a majority of cancer types. Several cancers exhibit a trio of mutually consistent evidence suggesting a drop in respiratory activity: depletion of mtDNA copy number, decreases in mtRNA levels, and decreases in expression of nuDNA-encoded respiratory proteins. Intriguingly, a minority of cancer types exhibit a drop in mtDNA expression but an increase in nuDNA expression of respiratory proteins, with unknown implications for respiratory activity. Our results indicate suppression of respiratory gene expression across many cancer types. DOI: http://dx.doi.org/10.7554/eLife.21592.001 PMID:28099114

  17. Mitochondrial and Nuclear Genomic Responses to Loss of LRPPRC Expression*

    PubMed Central

    Gohil, Vishal M.; Nilsson, Roland; Belcher-Timme, Casey A.; Luo, Biao; Root, David E.; Mootha, Vamsi K.

    2010-01-01

    Rapid advances in genotyping and sequencing technology have dramatically accelerated the discovery of genes underlying human disease. Elucidating the function of such genes and understanding their role in pathogenesis, however, remain challenging. Here, we introduce a genomic strategy to characterize such genes functionally, and we apply it to LRPPRC, a poorly studied gene that is mutated in Leigh syndrome, French-Canadian type (LSFC). We utilize RNA interference to engineer an allelic series of cellular models in which LRPPRC has been stably silenced to different levels of knockdown efficiency. We then combine genome-wide expression profiling with gene set enrichment analysis to identify cellular responses that correlate with the loss of LRPPRC. Using this strategy, we discovered a specific role for LRPPRC in the expression of all mitochondrial DNA-encoded mRNAs, but not the rRNAs, providing mechanistic insights into the enzymatic defects observed in the disease. Our analysis shows that nuclear genes encoding mitochondrial proteins are not collectively affected by the loss of LRPPRC. We do observe altered expression of genes related to hexose metabolism, prostaglandin synthesis, and glycosphingolipid biology that may either play an adaptive role in cell survival or contribute to pathogenesis. The combination of genetic perturbation, genomic profiling, and pathway analysis represents a generic strategy for understanding disease pathogenesis. PMID:20220140

  18. Modulation of mitochondrial gene expression in pulmonary epithelial cells exposed to oxidants.

    PubMed Central

    Janssen, Y M; Driscoll, K E; Timblin, C R; Hassenbein, D; Mossman, B T

    1998-01-01

    Oxidants are important in the regulation of signal transduction and gene expression. Multiple classes of genes are transcriptionally activated by oxidants and are implicated in different phenotypic responses. In the present study, we performed differential mRNA display to elucidate genes that are induced or repressed after exposure of rat lung epithelial (RLE) cells to H2O2 or crocidolite asbestos, a pathogenic mineral that generates oxidants. After 8 or 24 hr of exposure, RNA was extracted, reverse transcribed, and amplified by polymerase chain reaction with degenerate primers to visualize alterations in gene expression. The seven clones obtained were sequenced and encoded the mitochondrial genes, NADH dehydrogenase subunits ND5 and ND6, and 16S ribosomal RNA. Evaluation of their expression by Northern blot analysis revealed increased expression of 16S rRNA after 1 or 2 hr of exposure to H2O2. At later time periods (4 and 24 hr), mRNA levels of 16S rRNA and NADH dehydrogenase were decreased in H2O2-treated RLE cells when compared to sham controls. Crocidolite asbestos caused increases in 16S rRNA levels after 8 hr of exposure, whereas after 24 hr of exposure to asbestos, 16S rRNA levels were decreased in comparison to sham controls. In addition to these oxidants, the nitric oxide generator spermine NONOate caused similar decreases in NADH dehydrogenase mRNA levels after 4 hr of exposure. The present data and previous studies demonstrated that all oxidants examined resulted in apoptosis in RLE cells during the time frame where alterations of mitochondrial gene expression were observed. As the mitochondrion is a major organelle that controls apoptosis, alterations in expression of mitochondrial genes may be involved in the regulation of apoptosis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9788897

  19. Effects of dietary fatty acids on mitochondrial phospholipid compositions, oxidative status and mitochondrial gene expression of zebrafish at different ages.

    PubMed

    Betancor, M B; Almaida-Pagán, P F; Hernández, A; Tocher, D R

    2015-10-01

    Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL) and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, mitochondrial membrane PL compositions, oxidative status (TBARS content and SOD activity) and mtDNA gene expression of muscle and liver were analyzed in zebrafish fed two diets with lipid supplied either by rapeseed oil (RO) or a blend 60:40 of RO and DHA500 TG oil (DHA). Two feeding trials were performed using zebrafish from the same population of two ages (8 and 21 months). Dietary FA composition affected fish growth in 8-month-old animals, which could be related to an increase in stress promoted by diet composition. Lipid peroxidation was considerably higher in mitochondria of 8-month-old zebrafish fed the DHA diet than in animals fed the RO diet. This could indicate higher oxidative damage to mitochondrial lipids, very likely due to increased incorporation of DHA in PL of mitochondrial membranes. Lipids would be among the first molecules affected by mitochondrial reactive oxygen species, and lipid peroxidation could propagate oxidative reactions that would damage other molecules, including mtDNA. Mitochondrial lipid peroxidation and gene expression of 21-month-old fish showed lower responsiveness to diet composition than those of younger fish. Differences found in the effect of diet composition on mitochondrial lipids between the two age groups could be indicating age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  20. Nicotinamide phosphoribosyltransferase and SIRT3 expression are increased in well-differentiated thyroid carcinomas.

    PubMed

    Shackelford, Rodney; Hirsh, Sharon; Henry, Katherine; Abdel-Mageed, Asim; Kandil, Emad; Coppola, Domenico

    2013-08-01

    Nicotinamide phosphoribosyltransferase (NAMPT) catalyzes the rate-limiting step of nicotinamide adenine dinucleotide (NAD(+)) synthesis. NAMPT expression promotes angiogenesis, DNA synthesis, cell growth and survival, and mitochondrial biogenesis and function. Sirtuin-3 (SIRT3) is an NAD(+)-dependent deacetylase which functions in conjunction with mitochondrial NAMPT to promote cell survival following genotoxic stress. NAMPT expression is increased in several human malignancies, while SIRT3 levels are increased in some malignancies and suppressed in others. Based on this, we hypothesized that NAMPT and SIRT3 expression might be increased in well-differentiated thyroid carcinomas (TCs), follicular carcinomas (FC) and papillary thyroid carcinomas (PTC). Immunohistochemical analysis for NAMPT and SIRT3 staining was performed on these tumors using tissue microarrays. NAMPT and SIRT3 expression was low in benign thyroid tissues, moderately increased in FC, and more highly expressed in PTC. Specifically we observed both NAMPT and SIRT3 to be highly expressed in well-differentiated TCs. The data suggest that mitochondrial alterations play a role in the development and maintenance of well-differentiated TC. Since an effective pharmacological NAMPT inhibitor is currently in clinical use, further studies of NAMPT overexpression in well-differentiated TCs may be useful in selecting patients for NAMPT inhibitor therapy, particularly for metastatic well-differentiated thyroid carcinomas refractory to other treatments.

  1. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure.

    PubMed

    Al Kaddissi, Simone; Legeay, Alexia; Elia, Antonia Concetta; Gonzalez, Patrice; Floriani, Magali; Cavalie, Isabelle; Massabuau, Jean-Charles; Gilbin, Rodolphe; Simon, Olivier

    2014-08-01

    The present study investigates cadmium effects on the transcription of mitochondrial genes of Procambarus clarkii after acute (0.05, 0.5, and 5 mg Cd/L; 4-10 days) and chronic exposures (10 μg Cd/L; 30-60 days). Transcriptional responses of cox1, atp6, and 12S using quantitative real-time RT-PCR were assessed in gills and hepatopancreas. Additionally, the expression levels of genes involved in detoxification and/or oxidative stress responses [mt, sod(Mn)] and enzymatic activities of antioxidants (SOD, CAT, GPX, and GST) were analyzed. The histopathological effects in hepatopancreas of crayfish were evaluated by light microscopy. Relationships between endpoints at different levels of biological organization and Cd bioaccumulation were also examined. Cd induced high levels of bioaccumulation, which was followed by mitochondrial dysfunction and histological alterations in both experiments. Moreover, perturbations in the defence mechanisms against oxidative stress tended to increase with time. Results also showed that molecular responses can vary depending on the intensity and duration of the chemical stress applied to the organisms and that the study of mt gene expression levels seemed to be the best tool to assess Cd intoxication.

  2. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  3. Mitochondrial-Targeted Nitroxides Disrupt Mitochondrial Architecture and Inhibit Expression of Peroxiredoxin 3 and FOXM1 in Malignant Mesothelioma Cells

    PubMed Central

    Cunniff, Brian; Benson, Kira; Stumpff, Jason; Newick, Kheng; Held, Paul; Taatjes, Douglas; Joseph, Joy; Kalyanaraman, Balaraman; Heintz, Nicholas H.

    2013-01-01

    Malignant mesothelioma (MM) is an intractable tumor of the peritoneal and pleural cavities primarily linked to exposure to asbestos. Recently, we described an interplay between mitochondrial-derived oxidants and expression of FOXM1, a redox-responsive transcription factor that has emerged as a promising therapeutic target in solid malignancies. Here we have investigated the effects of nitroxides targeted to mitochondria via triphenylphosphonium (TPP) moieties on mitochondrial oxidant production, expression of FOXM1 and peroxiredoxin 3 (PRX3), and cell viability in MM cells in culture. Both Mito-carboxy-proxyl (MCP) and Mito-TEMPOL (MT) caused dose-dependent increases in mitochondrial oxidant production that was accompanied by inhibition of expression of FOXM1 and PRX3 and loss of cell viability. At equivalent concentrations TPP, CP, and TEMPOL had no effect on these endpoints. Live cell ratiometric imaging with a redox-responsive green fluorescent protein targeted to mitochondria (mito-roGFP) showed that MCP and MT, but not CP, TEMPOL, or TPP, rapidly induced mitochondrial fragmentation and swelling, morphological transitions that were associated with diminished ATP levels and increased production of mitochondrial oxidants. Mdivi-1, an inhibitor of mitochondrial fission, did not rescue mitochondria from fragmentation by MCP. Immunofluorescence microscopy experiments indicate a fraction of FOXM1 coexists in the cytoplasm with mitochondrial PRX3. Our results indicate that MCP and MT inhibit FOXM1 expression and MM tumor cell viability via perturbations in redox homeostasis caused by marked disruption of mitochondrial architecture, and suggest that both compounds, either alone or in combination with thiostrepton or other agents, may provide credible therapeutic options for the management of MM. PMID:23018647

  4. Peroxisome proliferator activated receptor-γ agonists protect oligodendrocyte progenitors against tumor necrosis factor-alpha-induced damage: Effects on mitochondrial functions and differentiation.

    PubMed

    De Nuccio, C; Bernardo, A; Cruciani, C; De Simone, R; Visentin, S; Minghetti, L

    2015-09-01

    The activation of the nuclear receptor peroxisome proliferator-activated receptor-γ (PPAR-γ) is known to exert anti-inflammatory and neuroprotective effects and PPAR-γ agonists are considered potential therapeutic agents in brain diseases including those affecting myelin. In demyelinating diseases such as multiple sclerosis (MS), inflammation is one of the causes of myelin and axonal damage. Oligodendrocyte (OL) differentiation is highly dependent on mitochondria, which are major targets of inflammatory insult. Here we show that PPAR-γ agonists protect OL progenitors against the maturational arrest induced by the inflammatory cytokine TNF-α by affecting mitochondrial functions. We demonstrate that the inhibition of OL differentiation by TNF-α is associated with i) increased mitochondrial superoxide production; ii) decreased mitochondrial membrane potential (mMP); and iii) decreased ADP-induced Ca(2+) oscillations, which we previously showed to be dependent on efficient mitochondria. The TNF-α effects were comparable to those of the mitochondrial toxin rotenone, further suggesting that TNF-α damage is mediated by mitochondrial function impairment. PPAR-γ agonists protected OL progenitors against the inhibitory activities of both TNF-α and rotenone on mMP, mitochondrial ROS production, Ca(2+) oscillations and OL differentiation. Finally, the PPAR-γ agonist pioglitazone increased the expression of PGC-1α (a mitochondrial biogenesis master regulator), UCP2 (a mitochondrial protein known to reduce ROS production), and cytochrome oxidase subunit COX1. These findings confirm the central role of mitochondria in OL differentiation and point to mitochondria as major targets of PPAR-γ agonist protection against TNF-α damage. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Alterations in intrinsic mitochondrial function with aging are fiber type-specific and do not explain differential atrophy between muscles.

    PubMed

    Picard, Martin; Ritchie, Darmyn; Thomas, Melissa M; Wright, Kathryn J; Hepple, Russell T

    2011-12-01

    To determine whether mitochondrial dysfunction is causally related to muscle atrophy with aging, we examined respiratory capacity, H(2) O(2) emission, and function of the mitochondrial permeability transition pore (mPTP) in permeabilized myofibers prepared from four rat muscles that span a range of fiber type and degree of age-related atrophy. Muscle atrophy with aging was greatest in fast-twitch gastrocnemius (Gas) muscle (-38%), intermediate in both the fast-twitch extensor digitorum longus (EDL) and slow-twitch soleus (Sol) muscles (-21%), and non-existent in adductor longus (AL) muscle (+47%). In contrast, indices of mitochondrial dysfunction did not correspond to this differential degree of atrophy. Specifically, despite higher protein expression for oxidative phosphorylation (oxphos) system in fast Gas and EDL, state III respiratory capacity per myofiber wet weight was unchanged with aging, whereas the slow Sol showed proportional decreases in oxphos protein, citrate synthase activity, and state III respiration. Free radical leak (H(2) O(2) emission per O(2) flux) under state III respiration was higher with aging in the fast Gas, whereas state II free radical leak was higher in the slow AL. Only the fast muscles had impaired mPTP function with aging, with lower mitochondrial calcium retention capacity in EDL and shorter time to mPTP opening in Gas and EDL. Collectively, our results underscore that the age-related changes in muscle mitochondrial function depend largely upon fiber type and are unrelated to the severity of muscle atrophy, suggesting that intrinsic changes in mitochondrial function are unlikely to be causally involved in aging muscle atrophy. © 2011 The Authors. Aging Cell © 2011 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

  6. Recombinant Mitochondrial Transcription Factor A with N-terminal Mitochondrial Transduction Domain Increases Respiration and Mitochondrial Gene Expression

    PubMed Central

    Iyer, Shilpa; Thomas, Ravindar R.; Portell, Francisco R.; Dunham, Lisa D.; Quigley, Caitlin K.; Bennett, James P.

    2009-01-01

    We developed a scalable procedure to produce human mitochondrial transcription factor A (TFAM) modified with an N-terminal protein transduction domain (PTD) and mitochondrial localization signal (MLS) that allow it to cross membranes and enter mitochondria through its “mitochondrial transduction domain” (MTD=PTD+MLS). Alexa488-labeled MTD-TFAM rapidly entered the mitochondrial compartment of cybrid cells carrying the G11778A LHON mutation. MTD-TFAM reversibly increased respiration and levels of respiratory proteins. In vivo treatment of mice with MTD-TFAM increased motor endurance and complex I-driven respiration in mitochondria from brain and skeletal muscle. MTD-TFAM increases mitochondrial bioenergetics and holds promise for treatment of mitochondrial diseases involving deficiencies of energy production. PMID:19460293

  7. Expression of 16 Nitrogenase Proteins within the Plant Mitochondrial Matrix

    PubMed Central

    Allen, Robert S.; Tilbrook, Kimberley; Warden, Andrew C.; Campbell, Peter C.; Rolland, Vivien; Singh, Surinder P.; Wood, Craig C.

    2017-01-01

    The industrial production and use of nitrogenous fertilizer involves significant environmental and economic costs. Strategies to reduce fertilizer dependency are required to address the world's increasing demand for sustainable food, fibers, and biofuels. Biological nitrogen fixation, a process unique to diazatrophic bacteria, is catalyzed by the nitrogenase complex, and reconstituting this function in plant cells is an ambitious biotechnological strategy to reduce fertilizer use. Here we establish that the full array of biosynthetic and catalytic nitrogenase (Nif) proteins from the diazotroph Klebsiella pneumoniae can be individually expressed as mitochondrial targeting peptide (MTP)-Nif fusions in Nicotiana benthamiana. We show that these are correctly targeted to the plant mitochondrial matrix, a subcellular location with biochemical and genetic characteristics potentially supportive of nitrogenase function. Although Nif proteins B, D, E, F, H, J, K, M, N, Q, S, U, V, X, Y, and Z were all detectable by Western blot analysis, the NifD catalytic component was the least abundant. To address this problem, a translational fusion between NifD and NifK was designed based on the crystal structure of the nitrogenase MoFe protein heterodimer. This fusion protein enabled equimolar NifD:NifK stoichiometry and improved NifD expression levels in plants. Finally, four MTP-Nif fusion proteins (B, S, H, Y) were successfully co-expressed, demonstrating that multiple components of nitrogenase can be targeted to plant mitochondria. These results establish the feasibility of reconstituting the complete componentry for nitrogenase in plant cells, within an intracellular environment that could support the conversion of nitrogen gas into ammonia. PMID:28316608

  8. Expression of 16 Nitrogenase Proteins within the Plant Mitochondrial Matrix.

    PubMed

    Allen, Robert S; Tilbrook, Kimberley; Warden, Andrew C; Campbell, Peter C; Rolland, Vivien; Singh, Surinder P; Wood, Craig C

    2017-01-01

    The industrial production and use of nitrogenous fertilizer involves significant environmental and economic costs. Strategies to reduce fertilizer dependency are required to address the world's increasing demand for sustainable food, fibers, and biofuels. Biological nitrogen fixation, a process unique to diazatrophic bacteria, is catalyzed by the nitrogenase complex, and reconstituting this function in plant cells is an ambitious biotechnological strategy to reduce fertilizer use. Here we establish that the full array of biosynthetic and catalytic nitrogenase (Nif) proteins from the diazotroph Klebsiella pneumoniae can be individually expressed as mitochondrial targeting peptide (MTP)-Nif fusions in Nicotiana benthamiana. We show that these are correctly targeted to the plant mitochondrial matrix, a subcellular location with biochemical and genetic characteristics potentially supportive of nitrogenase function. Although Nif proteins B, D, E, F, H, J, K, M, N, Q, S, U, V, X, Y, and Z were all detectable by Western blot analysis, the NifD catalytic component was the least abundant. To address this problem, a translational fusion between NifD and NifK was designed based on the crystal structure of the nitrogenase MoFe protein heterodimer. This fusion protein enabled equimolar NifD:NifK stoichiometry and improved NifD expression levels in plants. Finally, four MTP-Nif fusion proteins (B, S, H, Y) were successfully co-expressed, demonstrating that multiple components of nitrogenase can be targeted to plant mitochondria. These results establish the feasibility of reconstituting the complete componentry for nitrogenase in plant cells, within an intracellular environment that could support the conversion of nitrogen gas into ammonia.

  9. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  10. Acute and chronic mitochondrial respiratory chain deficiency differentially regulate lysosomal biogenesis

    PubMed Central

    Fernández-Mosquera, Lorena; Diogo, Cátia V.; Yambire, King Faisal; Santos, Gabriela L.; Luna Sánchez, Marta; Bénit, Paule; Rustin, Pierre; Lopez, Luis Carlos; Milosevic, Ira; Raimundo, Nuno

    2017-01-01

    Mitochondria are key cellular signaling platforms, affecting fundamental processes such as cell proliferation, differentiation and death. However, it remains unclear how mitochondrial signaling affects other organelles, particularly lysosomes. Here, we demonstrate that mitochondrial respiratory chain (RC) impairments elicit a stress signaling pathway that regulates lysosomal biogenesis via the microphtalmia transcription factor family. Interestingly, the effect of mitochondrial stress over lysosomal biogenesis depends on the timeframe of the stress elicited: while RC inhibition with rotenone or uncoupling with CCCP initially triggers lysosomal biogenesis, the effect peaks after few hours and returns to baseline. Long-term RC inhibition by long-term treatment with rotenone, or patient mutations in fibroblasts and in a mouse model result in repression of lysosomal biogenesis. The induction of lysosomal biogenesis by short-term mitochondrial stress is dependent on TFEB and MITF, requires AMPK signaling and is independent of calcineurin signaling. These results reveal an integrated view of how mitochondrial signaling affects lysosomes, which is essential to fully comprehend the consequences of mitochondrial malfunction, particularly in the context of mitochondrial diseases. PMID:28345620

  11. Low-dose ionizing radiation induces mitochondrial fusion and increases expression of mitochondrial complexes I and III in hippocampal neurons

    PubMed Central

    Chang, Chuang-Rung; Kao, Mou-Chieh; Chen, Kuan-Wei; Chiu, Shih-Che; Hsu, Ming-Ling; Hsiang, I-Chou; Chen, Yu-Jen; Chen, Linyi

    2015-01-01

    High energy ionizing radiation can cause DNA damage and cell death. During clinical radiation therapy, the radiation dose could range from 15 to 60 Gy depending on targets. While 2 Gy radiation has been shown to cause cancer cell death, studies also suggest a protective potential by low dose radiation. In this study, we examined the effect of 0.2-2 Gy radiation on hippocampal neurons. Low dose 0.2 Gy radiation treatment increased the levels of MTT. Since hippocampal neurons are post-mitotic, this result reveals a possibility that 0.2 Gy irradiation may increase mitochondrial activity to cope with stimuli. Maintaining neural plasticity is an energy-demanding process that requires high efficient mitochondrial function. We thus hypothesized that low dose radiation may regulate mitochondrial dynamics and function to ensure survival of neurons. Our results showed that five days after 0.2 Gy irradiation, no obvious changes on neuronal survival, neuronal synapses, membrane potential of mitochondria, reactive oxygen species levels, and mitochondrial DNA copy numbers. Interestingly, 0.2 Gy irradiation promoted the mitochondria fusion, resulting in part from the increased level of a mitochondrial fusion protein, Mfn2, and inhibition of Drp1 fission protein trafficking to the mitochondria. Accompanying with the increased mitochondrial fusion, the expressions of complexes I and III of the electron transport chain were also increased. These findings suggest that, hippocampal neurons undergo increased mitochondrial fusion to modulate cellular activity as an adaptive mechanism in response to low dose radiation. PMID:26415228

  12. Low-dose ionizing radiation induces mitochondrial fusion and increases expression of mitochondrial complexes I and III in hippocampal neurons.

    PubMed

    Chien, Ling; Chen, Wun-Ke; Liu, Szu-Ting; Chang, Chuang-Rung; Kao, Mou-Chieh; Chen, Kuan-Wei; Chiu, Shih-Che; Hsu, Ming-Ling; Hsiang, I-Chou; Chen, Yu-Jen; Chen, Linyi

    2015-10-13

    High energy ionizing radiation can cause DNA damage and cell death. During clinical radiation therapy, the radiation dose could range from 15 to 60 Gy depending on targets. While 2 Gy radiation has been shown to cause cancer cell death, studies also suggest a protective potential by low dose radiation. In this study, we examined the effect of 0.2-2 Gy radiation on hippocampal neurons. Low dose 0.2 Gy radiation treatment increased the levels of MTT. Since hippocampal neurons are post-mitotic, this result reveals a possibility that 0.2 Gy irradiation may increase mitochondrial activity to cope with stimuli. Maintaining neural plasticity is an energy-demanding process that requires high efficient mitochondrial function. We thus hypothesized that low dose radiation may regulate mitochondrial dynamics and function to ensure survival of neurons. Our results showed that five days after 0.2 Gy irradiation, no obvious changes on neuronal survival, neuronal synapses, membrane potential of mitochondria, reactive oxygen species levels, and mitochondrial DNA copy numbers. Interestingly, 0.2 Gy irradiation promoted the mitochondria fusion, resulting in part from the increased level of a mitochondrial fusion protein, Mfn2, and inhibition of Drp1 fission protein trafficking to the mitochondria. Accompanying with the increased mitochondrial fusion, the expressions of complexes I and III of the electron transport chain were also increased. These findings suggest that, hippocampal neurons undergo increased mitochondrial fusion to modulate cellular activity as an adaptive mechanism in response to low dose radiation.

  13. Optimized Allotopic Expression of the Human Mitochondrial ND4 Prevents Blindness in a Rat Model of Mitochondrial Dysfunction

    PubMed Central

    Ellouze, Sami; Augustin, Sébastien; Bouaita, Aicha; Bonnet, Crystel; Simonutti, Manuel; Forster, Valérie; Picaud, Serge; Sahel, Jose-Alain; Corral-Debrinski, Marisol

    2008-01-01

    Mitochondrial diseases due to mutations in mitochondrial DNA can no longer be ignored in most medical areas. With prevalence certainly higher than one in 6000, they probably represent the most common form of metabolic disorders. Despite progress in identification of their molecular mechanisms, little has been done with regard to therapy. We have recently optimized the allotopic expression for the mitochondrial genes ATP6, ND1, and ND4 and obtained a complete and long-lasting rescue of mitochondrial dysfunction in the human fibroblasts in which these genes were mutated. However, biosafety and benefit to mitochondrial function must be validated in animal models prior to clinical applications. To create an animal model of Leber Hereditary Optic Neuropathy (LHON), we introduced the human ND4 gene harboring the G11778A mutation, responsible of 60% of LHON cases, to rat eyes by in vivo electroporation. The treatment induced the degeneration of retinal ganglion cells (RGCs), which were 40% less abundant in treated eyes than in control eyes. This deleterious effect was also confirmed in primary cell culture, in which both RGC survival and neurite outgrowth were compromised. Importantly, RGC loss was clearly associated with a decline in visual performance. A subsequent electroporation with wild-type ND4 prevented both RGC loss and the impairment of visual function. Hence, these data provide the proof-of-principle that optimized allotopic expression can be an effective treatment for LHON, and they open the way to clinical studies on other devastating mitochondrial disorders. PMID:18771762

  14. Optimized allotopic expression of the human mitochondrial ND4 prevents blindness in a rat model of mitochondrial dysfunction.

    PubMed

    Ellouze, Sami; Augustin, Sébastien; Bouaita, Aicha; Bonnet, Crystel; Simonutti, Manuel; Forster, Valérie; Picaud, Serge; Sahel, Jose-Alain; Corral-Debrinski, Marisol

    2008-09-01

    Mitochondrial diseases due to mutations in mitochondrial DNA can no longer be ignored in most medical areas. With prevalence certainly higher than one in 6000, they probably represent the most common form of metabolic disorders. Despite progress in identification of their molecular mechanisms, little has been done with regard to therapy. We have recently optimized the allotopic expression for the mitochondrial genes ATP6, ND1, and ND4 and obtained a complete and long-lasting rescue of mitochondrial dysfunction in the human fibroblasts in which these genes were mutated. However, biosafety and benefit to mitochondrial function must be validated in animal models prior to clinical applications. To create an animal model of Leber Hereditary Optic Neuropathy (LHON), we introduced the human ND4 gene harboring the G11778A mutation, responsible of 60% of LHON cases, to rat eyes by in vivo electroporation. The treatment induced the degeneration of retinal ganglion cells (RGCs), which were 40% less abundant in treated eyes than in control eyes. This deleterious effect was also confirmed in primary cell culture, in which both RGC survival and neurite outgrowth were compromised. Importantly, RGC loss was clearly associated with a decline in visual performance. A subsequent electroporation with wild-type ND4 prevented both RGC loss and the impairment of visual function. Hence, these data provide the proof-of-principle that optimized allotopic expression can be an effective treatment for LHON, and they open the way to clinical studies on other devastating mitochondrial disorders.

  15. Dietary fatty acids affect mitochondrial phospholipid compositions and mitochondrial gene expression of rainbow trout liver at different ages.

    PubMed

    Almaida-Pagán, P F; De Santis, C; Rubio-Mejía, O L; Tocher, D R

    2015-01-01

    Mitochondria are among the first responders to various stressors that challenge the homeostasis of cells and organisms. Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL), particularly cardiolipin (CL), and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, liver mitochondrial membrane PL compositions, lipid peroxidation, and mtDNA gene expression were analyzed in rainbow trout fed three diets with the same base formulation but with lipid supplied either by fish oil (FO), rapeseed oil (RO), or high DHA oil (DHA) during 6 weeks. Specifically, two feeding trials were performed using fish from the same population of two ages (1 and 3 years), and PL class compositions of liver mitochondria, fatty acid composition of individual PL classes, TBARS content, and mtDNA expression were determined. Dietary fatty acid composition strongly affected mitochondrial membrane composition from trout liver but observed changes did not fully reflect the diet, particularly when it contained high DHA. The changes were PL specific, CL being particularly resistant to changes in DHA. Some significant differences observed in expression of mtDNA with diet may suggest long-term dietary effects in mitochondrial gene expression which could affect electron transport chain function. All the changes were influenced by fish age, which could be related to the different growth rates observed between 1- and 3-year-old trout but that could also indicate age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  16. Expression and Purification of Mitochondrial RNA Polymerase and Transcription Factor A from Drosophila melanogaster.

    PubMed

    Gajewski, John P; Arnold, Jamie J; Salminen, Tiina S; Kaguni, Laurie S; Cameron, Craig E

    2016-01-01

    Mitochondrial gene expression is essential in all organisms. Our understanding of mitochondrial transcription on a biochemical level has been limited by the inability to purify the individual protein components involved in mitochondrial gene expression. Recently, new systems have been identified that permit purification of these proteins from bacteria. However, the generalizability of these systems is not clear. Here, we have applied the technology from the Cameron lab to express and purify mitochondrial RNA polymerase and transcription factor A from Drosophila melanogaster. We show that the use of SUMO system to produce SUMO fusion proteins in bacteria is effective not only for the human and mouse proteins, but also for the fly proteins. The application of this system to produce the mitochondrial proteins from other organisms should permit detailed understanding of mitochondrial transcription from any organism.

  17. Reduced expression of Paternally Expressed Gene-3 enhances somatic cell reprogramming through mitochondrial activity perturbation.

    PubMed

    Theka, Ilda; Sottile, Francesco; Aulicino, Francesco; Garcia, Alvaro Castells; Cosma, Maria Pia

    2017-08-29

    Imprinted genes control several cellular and metabolic processes in embryonic and adult tissues. In particular, paternally expressed gene-3 (Peg3) is active in the adult stem cell population and during muscle and neuronal lineage development. Here we have investigated the role of Peg3 in mouse embryonic stem cells (ESCs) and during the process of somatic cell reprogramming towards pluripotency. Our data show that Peg3 knockdown increases expression of pluripotency genes in ESCs and enhances reprogramming efficiency of both mouse embryonic fibroblasts and neural stem cells. Interestingly, we observed that altered activity of Peg3 correlates with major perturbations of mitochondrial gene expression and mitochondrial function, which drive metabolic changes during somatic cell reprogramming. Overall, our study shows that Peg3 is a regulator of pluripotent stem cells and somatic cell reprogramming.

  18. Portacaval shunting causes differential mitochondrial superoxide production in brain regions.

    PubMed

    Kosenko, Elena A; Tikhonova, Lyudmila A; Alilova, Gubidat A; Montoliu, Carmina; Barreto, George E; Aliev, Gjumrakch; Kaminsky, Yury G

    2017-09-27

    The portacaval shunting (PCS) prevents portal hypertension and recurrent bleeding of esophageal varices. On the other hand, it can induce chronic hyperammonemia and is considered to be the best model of mild hepatic encephalopathy (HE). Pathogenic mechanisms of HE and dysfunction of the brain in hyperammonemia are not fully elucidated, but it was originally suggested that the pathogenetic defect causes destruction of antioxidant defense which leads to an increase in the production of reactive oxygen species (ROS) and the occurrence of oxidative stress. In order to gain insight into the pathogenic mechanisms of HE in the brain tissue, we investigated the effects of PCS in rats on free radicals production and activity levels of antioxidant and prooxidant enzymes in mitochondria isolated from different brain areas. We found that O2(·-) production, activities of Mn-superoxide dismutase (Mn-SOD), glutathione peroxidase (GPx), glutathione reductase (GR), glutathione transferase (GT), nitric oxide synthase (NOS), and levels of carbonylated proteins differed between the four brain regions both in the amount and response to PCS. In PCS rats, Mn-SOD activity in the cerebellum was significantly decreased, and remained unchanged in the neocortex, hippocampus and striatum compared with that in sham-operated animals. Among the four brain regions in control rats, the levels of the carbonyl groups in mitochondrial proteins were maximal in the cerebellum. 4 weeks after PCS, the content of carbonylated proteins were higher only in mitochondria of this brain region. Under control conditions, O2(·-) production by submitochondrial particles in the cerebellum was significantly higher than in other brain regions, but was significantly increased in each brain region from PCS animals. Indeed, the production of O2(·-) by submitochondrial particles correlated with mitochondrial ammonia levels in the four brain regions of control and PCS-animals. These findings are the first to suggest

  19. Expression and putative role of mitochondrial transport proteins in cancer.

    PubMed

    Lytovchenko, Oleksandr; Kunji, Edmund R S

    2017-03-22

    Cancer cells undergo major changes in energy and biosynthetic metabolism. One of them is the Warburg effect, in which pyruvate is used for fermentation rather for oxidative phosphorylation. Another major one is their increased reliance on glutamine, which helps to replenish the pool of Krebs cycle metabolites used for other purposes, such as amino acid or lipid biosynthesis. Mitochondria are central to these alterations, as the biochemical pathways linking these processes run through these organelles. Two membranes, an outer and inner membrane, surround mitochondria, the latter being impermeable to most organic compounds. Therefore, a large number of transport proteins are needed to link the biochemical pathways of the cytosol and mitochondrial matrix. Since the transport steps are relatively slow, it is expected that many of these transport steps are altered when cells become cancerous. In this review, changes in expression and regulation of these transport proteins are discussed as well as the role of the transported substrates.

  20. Meta-analysis of differentially expressed genes in ankylosing spondylitis.

    PubMed

    Lee, Y H; Song, G G

    2015-05-18

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in ankylosing spondylitis (AS). We performed a meta-analysis using the integrative meta-analysis of expression data program on publicly available microarray AS Gene Expression Omnibus (GEO) datasets. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using the Kyoto Encyclopedia of Genes and Genomes. Four GEO datasets, including 31 patients with AS and 39 controls, were available for the meta-analysis. We identified 65 genes across the studies that were consistently DE in patients with AS vs controls (23 upregulated and 42 downregulated). The upregulated gene with the largest effect size (ES; -1.2628, P = 0.020951) was integral membrane protein 2A (ITM2A), which is expressed by CD4+ T cells and plays a role in activation of T cells. The downregulated gene with the largest ES (1.2299, P = 0.040075) was mitochondrial ribosomal protein S11 (MRPS11). The most significant GO enrichment was in the respiratory electron transport chain category (P = 1.67 x 10-9). Therefore, our meta-analysis identified genes that were consistently DE as well as biological pathways associated with gene expression changes in AS.

  1. Analysis of Mitochondrial Function and Localisation during Human Embryonic Stem Cell Differentiation In Vitro

    PubMed Central

    Prowse, Andrew B. J.; Chong, Fenny; Elliott, David A.; Elefanty, Andrew G.; Stanley, Edouard G.; Gray, Peter P.; Munro, Trent P.; Osborne, Geoffrey W.

    2012-01-01

    Human embryonic stem cell (hESC) derivatives show promise as viable cell therapy options for multiple disorders in different tissues. Recent advances in stem cell biology have lead to the reliable production and detailed molecular characterisation of a range of cell-types. However, the role of mitochondria during differentiation has yet to be fully elucidated. Mitochondria mediate a cells response to altered energy requirements (e.g. cardiomyocyte contraction) and, as such, the mitochondrial phenotype is likely to change during the dynamic process of hESC differentiation. We demonstrate that manipulating mitochondrial biogenesis alters mesendoderm commitment. To investigate mitochondrial localisation during early lineage specification of hESCs we developed a mitochondrial reporter line, KMEL2, in which sequences encoding the green fluorescent protein (GFP) are targeted to the mitochondria. Differentiation of KMEL2 lines into the three germ layers showed that the mitochondria in these differentiated progeny are GFP positive. Therefore, KMEL2 hESCs facilitate the study of mitochondria in a range of cell types and, importantly, permit real-time analysis of mitochondria via the GFP tag. PMID:23284940

  2. Introducing Knowledge into Differential Expression Analysis

    PubMed Central

    Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin

    2010-01-01

    Abstract Gene expression measurements allow determining sets of up- or down-regulated, or unchanged genes in a particular experimental condition. Additional biological knowledge can suggest examples of genes from one of these sets. For instance, known target genes of a transcriptional activator are expected, but are not certain to go down after this activator is knocked out. Available differential expression analysis tools do not take such imprecise examples into account. Here we put forward a novel partially supervised mixture modeling methodology for differential expression analysis. Our approach, guided by imprecise examples, clusters expression data into differentially expressed and unchanged genes. The partially supervised methodology is implemented by two methods: a newly introduced belief-based mixture modeling, and soft-label mixture modeling, a method proved efficient in other applications. We investigate on synthetic data the input example settings favorable for each method. In our tests, both belief-based and soft-label methods prove their advantage over semi-supervised mixture modeling in correcting for erroneous examples. We also compare them to alternative differential expression analysis approaches, showing that incorporation of knowledge yields better performance. We present a broad range of knowledge sources and data to which our partially supervised methodology can be applied. First, we determine targets of Ste12 based on yeast knockout data, guided by a Ste12 DNA-binding experiment. Second, we distinguish miR-1 from miR-124 targets in human by clustering expression data under transfection experiments of both microRNAs, using their computationally predicted targets as examples. Finally, we utilize literature knowledge to improve clustering of time-course expression profiles. PMID:20726790

  3. Differential Mitochondrial Adaptation in Primary Vascular Smooth Muscle Cells from a Diabetic Rat Model

    PubMed Central

    Keller, Amy C.; Knaub, Leslie A.; McClatchey, P. Mason; Connon, Chelsea A.; Bouchard, Ron; Miller, Matthew W.; Geary, Kate E.; Walker, Lori A.; Klemm, Dwight J.; Reusch, Jane E. B.

    2016-01-01

    Diabetes affects more than 330 million people worldwide and causes elevated cardiovascular disease risk. Mitochondria are critical for vascular function, generate cellular reactive oxygen species (ROS), and are perturbed by diabetes, representing a novel target for therapeutics. We hypothesized that adaptive mitochondrial plasticity in response to nutrient stress would be impaired in diabetes cellular physiology via a nitric oxide synthase- (NOS-) mediated decrease in mitochondrial function. Primary smooth muscle cells (SMCs) from aorta of the nonobese, insulin resistant rat diabetes model Goto-Kakizaki (GK) and the Wistar control rat were exposed to high glucose (25 mM). At baseline, significantly greater nitric oxide evolution, ROS production, and respiratory control ratio (RCR) were observed in GK SMCs. Upon exposure to high glucose, expression of phosphorylated eNOS, uncoupled respiration, and expression of mitochondrial complexes I, II, III, and V were significantly decreased in GK SMCs (p < 0.05). Mitochondrial superoxide increased with high glucose in Wistar SMCs (p < 0.05) with no change in the GK beyond elevated baseline concentrations. Baseline comparisons show persistent metabolic perturbations in a diabetes phenotype. Overall, nutrient stress in GK SMCs caused a persistent decline in eNOS and mitochondrial function and disrupted mitochondrial plasticity, illustrating eNOS and mitochondria as potential therapeutic targets. PMID:27034743

  4. Transcriptome study of differential expression in schizophrenia

    PubMed Central

    Sanders, Alan R.; Göring, Harald H. H.; Duan, Jubao; Drigalenko, Eugene I.; Moy, Winton; Freda, Jessica; He, Deli; Shi, Jianxin; Gejman, Pablo V.

    2013-01-01

    Schizophrenia genome-wide association studies (GWAS) have identified common SNPs, rare copy number variants (CNVs) and a large polygenic contribution to illness risk, but biological mechanisms remain unclear. Bioinformatic analyses of significantly associated genetic variants point to a large role for regulatory variants. To identify gene expression abnormalities in schizophrenia, we generated whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. Regression analysis identified 95 transcripts differentially expressed by affection status at a genome-wide false discovery rate (FDR) of 0.05, while simultaneously controlling for confounding effects. These transcripts represented 89 genes with functions such as neurotransmission, gene regulation, cell cycle progression, differentiation, apoptosis, microRNA (miRNA) processing and immunity. This functional diversity is consistent with schizophrenia's likely significant pathophysiological heterogeneity. The overall enrichment of immune-related genes among those differentially expressed by affection status is consistent with hypothesized immune contributions to schizophrenia risk. The observed differential expression of extended major histocompatibility complex (xMHC) region histones (HIST1H2BD, HIST1H2BC, HIST1H2BH, HIST1H2BG and HIST1H4K) converges with the genetic evidence from GWAS, which find the xMHC to be the most significant susceptibility locus. Among the differentially expressed immune-related genes, B3GNT2 is implicated in autoimmune disorders previously tied to schizophrenia risk (rheumatoid arthritis and Graves’ disease), and DICER1 is pivotal in miRNA processing potentially linking to miRNA alterations in schizophrenia (e.g. MIR137, the second strongest GWAS finding). Our analysis provides novel candidate genes for further study to assess their potential contribution to schizophrenia. PMID:23904455

  5. Differential submitochondrial localization of PINK1 as a molecular switch for mediating distinct mitochondrial signaling pathways.

    PubMed

    Fallaize, Dana; Chin, Lih-Shen; Li, Lian

    2015-12-01

    Mutations in mitochondrial kinase PINK1 cause Parkinson disease (PD), but the submitochondrial site(s) of PINK1 action remains unclear. Here, we report that three-dimensional structured illumination microscopy (3D-SIM) enables super-resolution imaging of protein submitochondrial localization. Dual-color 3D-SIM imaging analysis revealed that PINK1 resides in the cristae membrane and intracristae space but not on the outer mitochondrial membrane (OMM) of healthy mitochondria. Under normal physiological conditions, PINK1 colocalizes with its substrate TRAP1 in the cristae membrane and intracristae space. In response to mitochondrial depolarization, PINK1, but not TRAP1, translocates to the OMM. The PINK1 translocation to the OMM of depolarized mitochondria is independent of new protein synthesis and requires combined action of PINK1 transmembrane domain and C-terminal region. We found that mitochondrial depolarization-induced PINK1 OMM translocation is required for recruitment of parkin to the OMM of damaged mitochondria. Our findings suggest that differential submitochondrial localization of PINK1 serves as a molecular switch for mediating two distinct mitochondrial signaling pathways in maintenance of mitochondrial homeostasis. Furthermore, our study provides evidence for the involvement of deregulated PINK1 submitochondrial localization in PD pathogenesis.

  6. Differential effects of wild-type and A53T mutant isoform of alpha-synuclein on the mitochondrial proteome of differentiated SH-SY5Y cells.

    PubMed

    Pennington, Kyla; Peng, Jianhe; Hung, Chao-Chun; Banks, Rosamonde E; Robinson, Philip A

    2010-05-07

    Increased levels of wild-type (WT) alpha-synuclein (alpha-syn) and mutant A53T alpha-syn are associated with Parkinson's disease (PD), a disease linked to abnormal mitochondrial function. This study compared mitochondria prepared from differentiated SH-SY5Y cells overexpressing WT or A53T alpha-syn with control cells, using 2-D difference in-gel electrophoresis. Statistical analysis was carried out primarily using ANOVA (p < 0.01; Host:WT:A53T) and subsequently using independent t tests (host vs WT, host vs A53T). Of the protein spots found to be differentially expressed (n = 71; p < 0.01, >1.8/<-1.8 fold change), 63 proteins were identified by LC-MS/MS, with the majority (77%) significantly altered in WT samples only. Twenty-three proteins known to be integral components of the mitochondria were abnormally expressed including those with roles in ATP synthesis, oxidoreduction, motor activity, carbohydrate metabolism, protein transcription, and protein folding. Thirteen forms of cytoskeletal proteins were also found to be overexpressed in the mitochondrial preparations from WT alpha-syn cells, suggesting an increased interaction of mitochondria with the cytoskeletal network. Altered levels of four mitochondrial proteins (HSPA9 (mortalin), NDUFS1, DLAT, ATP5A1) were confirmed using Western blot analysis. Furthermore, a significant reduction in OXPHOS 1 activity was observed in the WT alpha-syn cells, suggesting that there are functional consequences of the observed altered protein expression changes in the mitochondria.

  7. TrxR2 deficiencies promote chondrogenic differentiation and induce apoptosis of chondrocytes through mitochondrial reactive oxygen species.

    PubMed

    Yan, Jidong; Xu, Jing; Fei, Yao; Jiang, Congshan; Zhu, Wenhua; Han, Yan; Lu, Shemin

    2016-05-15

    Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of

  8. IAA8 expression during vascular cell differentiation

    Treesearch

    Andrew T. Groover; Amy Pattishall; Alan M. Jones

    2003-01-01

    We report the characterization of a member of the auxin-induced IAA gene family from zinnia, designated zIAA8, which is expressed by mesophyll cells differentiating as tracheary elements in vitro. Transcription of zIAA8 is upregulated within 3 h after cell isolation in inductive medium,...

  9. Cigarette smoke decreases mitochondrial porin expression and steroidogenesis

    SciTech Connect

    Bose, Mahuya; Whittal, Randy M.; Gairola, C. Gary; Bose, Himangshu S.

    2008-03-01

    Steroidogenic acute regulatory protein (StAR) facilitates the movement of cholesterol from the outer to inner mitochondrial membrane for steroidogenesis. Here, we investigated the effect of cigarette smoke (CS) on steroidogenesis using adrenal mitochondria isolated from mice chronically exposed to CS. Steroidogenesis was decreased approximately 78% in CS-exposed mitochondria, as measured by synthesis of the steroid hormone precursor pregnenolone. This effect was accompanied by decreased mitochondrial import of {sup 35}S-StAR. Further characterization of the imported {sup 35}S-StAR by native gradient PAGE revealed the presence of a high molecular weight complex in both control and CS-exposed groups. Following density gradient fractionation of {sup 35}S-StAR that had been extracted from control mitochondria, precursor StAR could be found in fractions 2-6 and smaller-sized StAR complexes in fractions 6-13. In the CS-exposed group, the appearance of precursor shifted from fraction 1-6 and the smaller complexes in fractions 6-9 disappeared. Mass spectrometric analysis revealed that the {sup 35}S-StAR-associated protein complex was composed of several resident matrix proteins as well as the OMM resident, VDAC. VDAC expression was greatly reduced by CS, and blockage of VDAC with Koenig's polyanion decreased pregnenolone synthesis in isolated mitochondria. Taken together, these results suggest that VDAC may participate in steroidogenesis by promoting StAR interaction with the OMM and that CS may inhibit steroidogenesis by reducing VDAC-StAR interactions.

  10. Quantitative Changes in Gimap3 and Gimap5 Expression Modify Mitochondrial DNA Segregation in Mice

    PubMed Central

    Jokinen, Riikka; Lahtinen, Taina; Marttinen, Paula; Myöhänen, Maarit; Ruotsalainen, Pilvi; Yeung, Nicolas; Shvetsova, Antonina; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Öhman, Tiina; Nyman, Tuula A.; Weiler, Hartmut; Battersby, Brendan J.

    2015-01-01

    Mammalian mitochondrial DNA (mtDNA) is a high-copy maternally inherited genome essential for aerobic energy metabolism. Mutations in mtDNA can lead to heteroplasmy, the co-occurence of two different mtDNA variants in the same cell, which can segregate in a tissue-specific manner affecting the onset and severity of mitochondrial dysfunction. To investigate mechanisms regulating mtDNA segregation we use a heteroplasmic mouse model with two polymorphic neutral mtDNA haplotypes (NZB and BALB) that displays tissue-specific and age-dependent selection for mtDNA haplotypes. In the hematopoietic compartment there is selection for the BALB mtDNA haplotype, a phenotype that can be modified by allelic variants of Gimap3. Gimap3 is a tail-anchored member of the GTPase of the immunity-associated protein (Gimap) family of protein scaffolds important for leukocyte development and survival. Here we show how the expression of two murine Gimap3 alleles from Mus musculus domesticus and M. m. castaneus differentially affect mtDNA segregation. The castaneus allele has incorporated a uORF (upstream open reading frame) in-frame with the Gimap3 mRNA that impairs translation and imparts a negative effect on the steady-state protein abundance. We found that quantitative changes in the expression of Gimap3 and the paralogue Gimap5, which encodes a lysosomal protein, affect mtDNA segregation in the mouse hematopoietic tissues. We also show that Gimap3 localizes to the endoplasmic reticulum and not mitochondria as previously reported. Collectively these data show that the abundance of protein scaffolds on the endoplasmic reticulum and lysosomes are important to the segregation of the mitochondrial genome in the mouse hematopoietic compartment. PMID:25808953

  11. Differential gene detection incorporating common expression patterns

    NASA Astrophysics Data System (ADS)

    Oba, Shigeyuki; Ishii, Shin

    2009-12-01

    In detection of differentially expressed (DE) genes between different groups of samples based on a high-throughput expression measurement system, we often use a classical statistical testing based on a simple assumption that the expression of a certain DE gene in one group is higher or lower in average than that in the other group. Based on this simple assumption, the theory of optimal discovery procedure (ODP) (Storey, 2005) provided an optimal thresholding function for DE gene detection. However, expression patterns of DE genes over samples may have such a structure that is not exactly consistent with group labels assigned to the samples. Appropriate treatment of such a structure can increase the detection ability. Namely, genes showing similar expression patterns to other biologically meaningful genes can be regarded as statistically more significant than those showing expression patterns independent of other genes, even if differences in mean expression levels are comparable. In this study, we propose a new statistical thresholding function based on a latent variable model incorporating expression patterns together with the ODP theory. The latent variable model assumes hidden common signals behind expression patterns over samples and the ODP theory is extended to involve the latent variables. When applied to several gene expression data matrices which include cluster structures or 'cancer outlier' structures, the newly-proposed thresholding functions showed prominently better detection performance of DE genes than the original ODP thresholding function did. We also demonstrate how the proposed methods behave through analyses of real breast cancer and lymphoma datasets.

  12. Sirtuin 3 is required for osteogenic differentiation through maintenance of PGC-1ɑ-SOD2-mediated regulation of mitochondrial function

    PubMed Central

    Ding, Yong; Yang, Hongmei; Wang, Yucai; Chen, Jun; Ji, Zhenwei; Sun, Honghui

    2017-01-01

    Osteogenic differentiation is crucial for the maintenance of bone homeostasis. Sirtuin 3 (SIRT3), a member of sirtuins family, functions as a critical deacetylase that regulates many key proteins. In the current study, we aimed to clarify the role of SIRT3 in osteogenic differentiation and the possible mechanisms, using mouse pre-osteoblastic MC3T3-E1 cells. Expression of SIRT3 was substantially increased in differentiated MC3T3-E1 cells. Knock down of SIRT3 significantly decreased alkaline phosphatase (ALP) staining, and mRNA expression of runt-related transcription factor 2 (Runx2) and collagen type I ɑ 1 (Col1ɑ1), and osteocalcin in differentiated MC3T3-E1 cells. Overexpression of wild type but not mutant SIRT3 could reverse SIRT3 knockdown-resulted decrease of ALP staining. Complex I, II, III, IV, and V activities, oxygen consumption and mitochondrial membrane potential were significantly decreased by SIRT3 knockdown. Moreover, SIRT3 knockdown reduced mitochondrial density, increased mitochondrial size and decreased the expression of NRF1 and TFAM. Knock down of SIRT3 decreased mRNA and protein expression of SOD2 and increased ROS level. Overexpression of SOD2 significantly suppressed SIRT3 knockdown-induced decrease of mitochondrial function and osteogenic differentiation. SIRT3 knockdown resulted in a significant decrease of PGC-1ɑ protein expression but not mRNA expression. Overexpression of wild type but not mutant SIRT3 could reverse SIRT3 knockdown-resulted decrease of PGC-1ɑ protein expression. Moreover, we detected a direct interaction between SIRT3 and PGC-1ɑ and SIRT3 knockdown reduced SIRT3 and PGC-1ɑ interaction, resulting in a reduction of PGC-1ɑ protein stability and PGC-1ɑ-binding in the promoters of SOD2. Overexpression of PGC-1ɑ blocked SIRT3 knockdown-induced decrease of SOD2 expression, increase of ROS level, and decrease of mitochondrial function and biogenesis, leading to improvement of osteogenesis. Overall, the data provide a

  13. Differentiation of mitochondrial DNA and Y chromosomes in Russian populations.

    PubMed

    Malyarchuk, Boris; Derenko, Miroslava; Grzybowski, Tomasz; Lunkina, Arina; Czarny, Jakub; Rychkov, Serge; Morozova, Irina; Denisova, Galina; Miścicka-Sliwka, Danuta

    2004-12-01

    The genetic composition of the Russian population was investigated by analyzing both mitochondrial DNA (mtDNA) and Y-chromosome loci polymorphisms that allow for the different components of a population gene pool to be studied, depending on the mode of DNA marker inheritance. mtDNA sequence variation was examined by using hypervariable segment I (HVSI) sequencing and restriction analysis of the haplogroup-specific sites in 325 individuals representing 5 Russian populations from the European part of Russia. The Y-chromosome variation was investigated in 338 individuals from 8 Russian populations (including 5 populations analyzed for mtDNA variation) using 12 binary markers. For both uniparental systems most of the observed haplogroups fell into major West Eurasian haplogroups (97.9% and 99.7% for mtDNA and Y-chromosome haplogroups, respectively). Multidimensional scaling analysis based on pairwise F(ST) values between mtDNA HVSI sequences in Russians compared to other European populations revealed a considerable heterogeneity of Russian populations; populations from the southern and western parts of Russia are separated from eastern and northern populations. Meanwhile, the multidimensional scaling analysis based on Y-chromosome haplogroup F(ST) values demonstrates that the Russian gene pool is close to central-eastern European populations, with a much higher similarity to the Baltic and Finno-Ugric male pools from northern European Russia. This discrepancy in the depth of penetration of mtDNA and Y-chromosome lineages characteristic for the most southwestern Russian populations into the east and north of eastern Europe appears to indicate that Russian colonization of the northeastern territories might have been accomplished mainly by males rather than by females.

  14. Lipid Peroxidation-Derived Reactive Aldehydes Directly and Differentially Impair Spinal Cord and Brain Mitochondrial Function

    PubMed Central

    Vaishnav, Radhika A.; Singh, Indrapal N.; Miller, Darren M.

    2010-01-01

    Abstract Mitochondrial bioenergetic dysfunction in traumatic spinal cord and brain injury is associated with post-traumatic free radical–mediated oxidative damage to proteins and lipids. Lipid peroxidation by-products, such as 4-hydroxy-2-nonenal and acrolein, can form adducts with proteins and exacerbate the effects of direct free radical–induced protein oxidation. The aim of the present investigation was to determine and compare the direct contribution of 4-hydroxy-2-nonenal and acrolein to spinal cord and brain mitochondrial dysfunction. Ficoll gradient–isolated mitochondria from normal rat spinal cords and brains were treated with carefully selected doses of 4-hydroxy-2-nonenal or acrolein, followed by measurement of complex I– and complex II–driven respiratory rates. Both compounds were potent inhibitors of mitochondrial respiration in a dose-dependent manner. 4-Hydroxy-2-nonenal significantly compromised spinal cord mitochondrial respiration at a 0.1-μM concentration, whereas 10-fold greater concentrations produced a similar effect in brain. Acrolein was more potent than 4-hydroxy-2-nonenal, significantly decreasing spinal cord and brain mitochondrial respiration at 0.01 μM and 0.1 μM concentrations, respectively. The results of this study show that 4-hydroxy-2-nonenal and acrolein can directly and differentially impair spinal cord and brain mitochondrial function, and that the targets for the toxic effects of aldehydes appear to include pyruvate dehydrogenase and complex I–associated proteins. Furthermore, they suggest that protein modification by these lipid peroxidation products may directly contribute to post-traumatic mitochondrial damage, with spinal cord mitochondria showing a greater sensitivity than those in brain. PMID:20392143

  15. Mitochondrial Matrix Ca2+ Accumulation Regulates Cytosolic NAD+/NADH Metabolism, Protein Acetylation, and Sirtuin Expression

    PubMed Central

    Marcu, Raluca; Wiczer, Brian M.; Neeley, Christopher K.

    2014-01-01

    Mitochondrial calcium uptake stimulates bioenergetics and drives energy production in metabolic tissue. It is unknown how a calcium-mediated acceleration in matrix bioenergetics would influence cellular metabolism in glycolytic cells that do not require mitochondria for ATP production. Using primary human endothelial cells (ECs), we discovered that repetitive cytosolic calcium signals (oscillations) chronically loaded into the mitochondrial matrix. Mitochondrial calcium loading in turn stimulated bioenergetics and a persistent elevation in NADH. Rather than serving as an impetus for mitochondrial ATP generation, matrix NADH rapidly transmitted to the cytosol to influence the activity and expression of cytosolic sirtuins, resulting in global changes in protein acetylation. In endothelial cells, the mitochondrion-driven reduction in both the cytosolic and mitochondrial NAD+/NADH ratio stimulated a compensatory increase in SIRT1 protein levels that had an anti-inflammatory effect. Our studies reveal the physiologic importance of mitochondrial bioenergetics in the metabolic regulation of sirtuins and cytosolic signaling cascades. PMID:24865966

  16. Mitochondrial and lipogenic effects of vitamin D on differentiating and proliferating human keratinocytes.

    PubMed

    Consiglio, Marco; Viano, Marta; Casarin, Stefania; Castagnoli, Carlotta; Pescarmona, Gianpiero; Silvagno, Francesca

    2015-10-01

    Even in cells that are resistant to the differentiating effects of vitamin D, the activated vitamin D receptor (VDR) can downregulate the mitochondrial respiratory chain and sustain cell growth through enhancing the activity of biosynthetic pathways. The aim of this study was to investigate whether vitamin D is effective also in modulating mitochondria and biosynthetic metabolism of differentiating cells. We compared the effect of vitamin D on two cellular models: the primary human keratinocytes, differentiating and sensitive to the genomic action of VDR, and the human keratinocyte cell line HaCaT, characterized by a rapid growth and resistance to vitamin D. We analysed the nuclear translocation and features of VDR, the effects of vitamin D on mitochondrial transcription and the consequences on lipid biosynthetic fate. We found that the negative modulation of respiratory chain is a general mechanism of action of vitamin D, but at high doses, the HaCaT cells became resistant to mitochondrial effects by upregulating the catabolic enzyme CYP24 hydroxylase. In differentiating keratinocytes, vitamin D treatment promoted intracellular lipid deposition, likewise the inhibitor of respiratory chain stigmatellin, whereas in proliferating HaCaT, this biosynthetic pathway was not inducible by the hormone. By linking the results on respiratory chain and lipid accumulation, we conclude that vitamin D, by suppressing respiratory chain transcription in all keratinocytes, is able to support both the proliferation and the specialized metabolism of differentiating cells. Through mitochondrial control, vitamin D can have an essential role in all the metabolic phenotypes occurring in healthy and diseased skin.

  17. A mitochondrial sirtuin, SIRT3, regulates muscle differentiation and metabolism

    USDA-ARS?s Scientific Manuscript database

    SIRT3 is a member of the sirtuin family of NAD-dependent deacetylases and is localized to the mitochondria. SIRT3 is highly expressed in brown adipose tissue, heart, muscle, and metabolically active tissue enriched with mitochondria. Recent reports found that SIRT3 is able to deacetylate and regula...

  18. Differential contribution of the mitochondrial translation pathway to the survival of diffuse large B-cell lymphoma subsets.

    PubMed

    Norberg, Erik; Lako, Ana; Chen, Pei-Hsuan; Stanley, Illana A; Zhou, Feng; Ficarro, Scott B; Chapuy, Bjoern; Chen, Linfeng; Rodig, Scott; Shin, Donghyuk; Choi, Dong Wook; Lee, Sangho; Shipp, Margaret A; Marto, Jarrod A; Danial, Nika N

    2017-02-01

    Diffuse large B-cell lymphomas (DLBCLs) are a highly heterogeneous group of tumors in which subsets share molecular features revealed by gene expression profiles and metabolic fingerprints. While B-cell receptor (BCR)-dependent DLBCLs are glycolytic, OxPhos-DLBCLs rely on mitochondrial energy transduction and nutrient utilization pathways that provide pro-survival benefits independent of BCR signaling. Integral to these metabolic distinctions is elevated mitochondrial electron transport chain (ETC) activity in OxPhos-DLBCLs compared with BCR-DLBCLs, which is linked to greater protein abundance of ETC components. To gain insights into molecular determinants of the selective increase in ETC activity and dependence on mitochondrial energy metabolism in OxPhos-DLBCLs, we examined the mitochondrial translation pathway in charge of the synthesis of mitochondrial DNA encoded ETC subunits. Quantitative mass spectrometry identified increased expression of mitochondrial translation factors in OxPhos-DLBCL as compared with the BCR subtype. Biochemical and functional assays indicate that the mitochondrial translation pathway is required for increased ETC activity and mitochondrial energy reserves in OxPhos-DLBCL. Importantly, molecular depletion of several mitochondrial translation proteins using RNA interference or pharmacological perturbation of the mitochondrial translation pathway with the FDA-approved inhibitor tigecycline (Tigecyl) is selectively toxic to OxPhos-DLBCL cell lines and primary tumors. These findings provide additional molecular insights into the metabolic characteristics of OxPhos-DLBCLs, and mark the mitochondrial translation pathway as a potential therapeutic target in these tumors.

  19. iTRAQ-based analysis of progerin expression reveals mitochondrial dysfunction, reactive oxygen species accumulation and altered proteostasis.

    PubMed

    Mateos, Jesús; Landeira-Abia, Arancha; Fafián-Labora, Juan Antonio; Fernández-Pernas, Pablo; Lesende-Rodríguez, Iván; Fernández-Puente, Patricia; Fernández-Moreno, Mercedes; Delmiro, Aitor; Martín, Miguel A; Blanco, Francisco J; Arufe, María C

    2015-06-12

    Nuclear accumulation of a mutant form of the nuclear protein Lamin-A, called Progerin (PG) or Lamin AΔ50, occurs in Hutchinson-Gilford Progeria Syndrome (HGPS) or Progeria, an accelerated aging disease. One of the main symptoms of this genetic disorder is a loss of sub-cutaneous fat due to a dramatic lipodystrophy. We stably induced the expression of human PG and GFP -Green Fluorescent Protein- as control in 3T3L1 cells using a lentiviral system to study the effect of PG expression in the differentiation capacity of this cell line, one of the most used adipogenic models. Quantitative proteomics (iTRAQ) was done to study the effect of the PG accumulation. Several of the modulated proteins were validated by immunoblotting and real-time PCR. Mitochondrial function was analyzed by measurement of a) the mitochondrial basal activity, b) the superoxide anion production and c) the individual efficiency of the different complex of the respiratory chain. We found that over-expression PG by lentiviral gene delivery leads to a decrease in the proliferation rate and to defects in adipogenic capacity when compared to the control. Quantitative proteomics analysis showed 181 proteins significantly (p<0.05) modulated in PG-expressing preadipocytes. Mitochondrial function is impaired in PG-expressing cells. Specifically, we have detected an increase in the activity of the complex I and an overproduction of Superoxide anion. Incubation with Reactive Oxygen Species (ROS) scavenger agents drives to a decrease in autophagic proteolysis as revealed by LC3-II/LC3-I ratio. PG expression in 3T3L1 cells promotes changes in several Biological Processes, including structure of cytoskeleton, lipid metabolism, calcium regulation, translation, protein folding and energy generation by the mitochondria. Our data strengthen the contribution of ROS accumulation to the premature aging phenotype and establish a link between mitochondrial dysfunction and loss of proteostasis in HGPS.

  20. Proteomic analysis of increased Parkin expression and its interactants provides evidence for a role in modulation of mitochondrial function.

    PubMed

    Davison, Eleanor J; Pennington, Kyla; Hung, Chao-Chun; Peng, Jianhe; Rafiq, Rumana; Ostareck-Lederer, Antje; Ostareck, Dirk H; Ardley, Helen C; Banks, Rosamonde E; Robinson, Philip A

    2009-09-01

    Parkin is an ubiquitin-protein ligase (E3), mutations of which cause juvenile onset - autosomal recessive Parkinson's disease, and result in reduced enzymic activity. In contrast, increased levels are protective against mitochondrial dysfunction and neurodegeneration, the mechanism of which is largely unknown. In this study, 2-DE and MS proteomic techniques were utilised to investigate the effects of increased Parkin levels on protein expression in whole cell lysates using in an inducible Parkin expression system in HEK293 cells, and also to isolate potential interactants of Parkin using tandem affinity purification and MS. Nine proteins were significantly differentially expressed (+/-2-fold change; p<0.05) using 2-DE analysis. MS revealed the identity of these proteins to be ACAT2, HNRNPK, HSPD1, PGK1, PRDX6, VCL, VIM, TPI1, and IMPDH2. The first seven of these were reduced in expression. Western blot analysis confirmed the reduction in one of these proteins (HNRNPK), and that its levels were dependent on 26S proteasomal activity. Tandem affinity purification/MS revealed 14 potential interactants of Parkin; CKB, DBT, HSPD1, HSPA9, LRPPRC, NDUFS2, PRDX6, SLC25A5, TPI1, UCHL1, UQCRC1, VCL, YWHAZ, YWHAE. Nine of these are directly involved in mitochondrial energy metabolism and glycolysis; four were also identified in the 2-DE study (HSP60, PRDX6, TPI1, and VCL). This study provides further evidence for a role for Parkin in regulating mitochondrial activity within cells.

  1. Increased expression of humanin peptide in diffuse-type pigmented villonodular synovitis: implication of its mitochondrial abnormality.

    PubMed

    Ijiri, K; Tsuruga, H; Sakakima, H; Tomita, K; Taniguchi, N; Shimoonoda, K; Komiya, S; Goldring, M B; Majima, H J; Matsuyama, T

    2005-06-01

    To define the pathogenesis of pigmented villonodular synovitis (PVNS), by searching for highly expressed genes in primary synovial cells from patients with PVNS. A combination of subtraction cloning and Southern colony hybridisation was used to detect highly expressed genes in PVNS in comparison with rheumatoid synovial cells. Northern hybridisation was performed to confirm the differential expression of the humanin gene in PVNS. Expression of the humanin peptide was analysed by western blotting and immunohistochemistry. Electron microscopic immunohistochemistry was performed to investigate the distribution of this peptide within the cell. 68 highly expressed genes were identified in PVNS. Humanin genes were strongly expressed in diffuse-type PVNS, but were barely detected in nodular-type PVNS, rheumatoid arthritis, or osteoarthritis. Humanin peptide was identified in synovium from diffuse-type PVNS, and most of the positive cells were distributed in the deep layer of the synovial tissue. Double staining with anti-humanin and anti-heat shock protein 60 showed that humanin was expressed mainly in mitochondria. Electron microscopy disclosed immunolocalisation of this peptide, predominantly around dense iron deposits within the siderosome. Increased expression of the humanin peptide in mitochondria and siderosomes is characteristic of synovial cells from diffuse-type PVNS. Humanin is an anti-apoptotic peptide which is encoded in the mitochondrial genome. Present findings suggest that mitochondrial dysfunction may be the principal factor in pathogenesis of diffuse-type PVNS and that humanin peptide may play a part in the neoplastic process in this form of PVNS.

  2. Expression of bovine mitochondrial tRNASer GCU derivatives in Escherichia coli.

    PubMed Central

    Hayashi, I; Kawai, G; Watanabe, K

    1997-01-01

    By replacing a stretch of five A-U base pairs in the acceptor stem with G-C pairs, mitochondrial tRNA-SerGCU lacking a D arm could be expressed in Escherichia coli cells in considerable amounts. The expressed tRNA with no modified nucleoside was serylated in vitro with the mitochondrial enzyme. The tRNASerGCU derivatives carrying identity elements for alanine tRNA and the related anticodons were expressed. However, this expression event did not affect cell growth, probably because the expression started from the late log phase, which suggests that these mitochondrial tRNA derivatives are not involved in E.coli gene expression systems. Although there are some restrictions in the secondary structure of tRNAs that can be expressed by this method, it could prove useful for preparing large amounts of heterologous tRNAs in vivo. PMID:9254711

  3. Bayesian modeling of differential gene expression.

    PubMed

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim

    2006-03-01

    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  4. Maternal obesity programs mitochondrial and lipid metabolism gene expression in infant umbilical vein endothelial cells

    PubMed Central

    Ramos Costa, Suzana Maria; Isganaitis, Elvira; Matthews, Tucker; Hughes, Katelyn; Daher, Grace; Dreyfuss, Jonathan M.; Pontes da Silva, Giselia Alves; Patti, Mary-Elizabeth

    2016-01-01

    Background/Objectives Maternal obesity increases risk for childhood obesity, but molecular mechanisms are not well understood. We hypothesized that primary umbilical vein endothelial cells (HUVEC) from infants of overweight and obese mothers would harbor transcriptional patterns reflecting offspring obesity risk. Subjects/Methods In this observational cohort study, we recruited 13 lean (pre-pregnancy BMI <25.0 kg/m2) and 24 overweight-obese (‘ov-ob’, BMI ≥25.0 kg/m2) women. We isolated primary HUVEC, and analyzed both gene expression (Primeview, Affymetrix) and cord blood levels of hormones and adipokines. Results 142 transcripts were differentially expressed in HUVEC from infants of overweight-obese mothers (false discovery rate, FDR <0.05). Pathway analysis revealed that genes involved in mitochondrial and lipid metabolism were negatively correlated with maternal BMI (FDR <0.05). To test whether these transcriptomic patterns were associated with distinct nutrient exposures in the setting of maternal obesity, we analyzed the cord blood lipidome and noted significant increases in levels of total free fatty acids (lean: 95.5 ± 37.1 ug/ml, ov-ob: 124.1 ± 46.0 ug/ml, P=0.049), palmitate (lean: 34.5 ± 12.7 ug/ml, ov-ob: 46.3 ± 18.4 ug/ml, P=0.03) and stearate (lean: 20.8 ± 8.2 ug/ml, ov-ob: 29.7 ± 17.2 ug/ml, P=0.04), in infants of overweight-obese mothers. Conclusion Prenatal exposure to maternal obesity alters HUVEC expression of genes involved in mitochondrial and lipid metabolism, potentially reflecting developmentally-programmed differences in oxidative and lipid metabolism. PMID:27531045

  5. p53 and tumor necrosis factor alpha regulate the expression of a mitochondrial chloride channel protein.

    PubMed

    Fernández-Salas, E; Sagar, M; Cheng, C; Yuspa, S H; Weinberg, W C

    1999-12-17

    A novel chloride intracellular channel (CLIC) gene, clone mc3s5/mtCLIC, has been identified from differential display analysis of differentiating mouse keratinocytes from p53+/+ and p53-/- mice. The 4.2-kilobase pair cDNA contains an open reading frame of 762 base pairs encoding a 253-amino acid protein with two putative transmembrane domains. mc3s5/mtCLIC protein shares extensive homology with a family of intracellular organelle chloride channels but is the first shown to be differentially regulated. mc3s5/mtCLIC mRNA is expressed to the greatest extent in vivo in heart, lung, liver, kidney, and skin, with reduced levels in some organs from p53-/- mice. mc3s5/mtCLIC mRNA and protein are higher in p53+/+ compared with p53-/- basal keratinocytes in culture, and both increase in differentiating keratinocytes independent of genotype. Overexpression of p53 in keratinocytes induces mc3s5/mtCLIC mRNA and protein. Exogenous human recombinant tumor necrosis factor alpha also up-regulates mc3s5/mtCLIC mRNA and protein in keratinocytes. Subcellular fractionation of keratinocytes indicates that both the green fluorescent protein-mc3s5 fusion protein and the endogenous mc3s5/mtCLIC are localized to the cytoplasm and mitochondria. Similarly, mc3s5/mtCLIC was localized to mitochondria and cytoplasmic fractions of rat liver homogenates. Furthermore, mc3s5/mtCLIC colocalized with cytochrome oxidase in keratinocyte mitochondria by immunofluorescence and was also detected in the cytoplasmic compartment. Sucrose gradient-purified mitochondria from rat liver confirmed this mitochondrial localization. This represents the first report of localization of a CLIC type chloride channel in mitochondria and the first indication that expression of an organellular chloride channel can be regulated by p53 and tumor necrosis factor alpha.

  6. Differential gene expression during multistage carcinogenesis

    SciTech Connect

    Bowden, G.T. ); Krieg, P. )

    1991-06-01

    The use of the mouse skin multistage model of carcinogenesis has aided our understanding of critical target genes in chemical carcinogenesis. The mutagenic activation of the Harvey-ras proto-oncogene has been found to be an early event associated with the initiation of mouse skin tumors by the polycyclic aromatic hydrocarbon 7,12 dimethylbenz(a)anthracene and the pure initiator ethyl carbamate (urethane). In contrast to chemical initiation of mouse skin tumors, ionizing radiation-initiated malignant skin tumors have been shown to possess distinct non-ras transforming gene(s). Differential screening of cDNA libraries made from chemically initiated malignant skin tumors has been used to identify a number of cellular gene transcripts that are overexpressed during mouse skin tumor progression. These differentially expressed genes include {beta}-actin, ubiquitin, a hyperproliferative keratin (K6), a gene whose product is a member of a fatty acid or lipid-binding protein family, and a gene called transin or stromelysin. The overexpression of the stromelysin gene, which encodes a metalloproteinase that degrades proteins in the basement membrane, is hypothesized to play a functional role in malignant tumor cell invasion and metastasis. The authors believe that the cloning, identification, and characterization of gene sequences that are differentially expressed during tumor progression could lead to the discovery of gene products that either play functional roles in skin tumor progression or in the maintenance of various progressive tumor phenotypes.

  7. Increasing levels of cardiolipin differentially influence packing of phospholipids found in the mitochondrial inner membrane.

    PubMed

    Zeczycki, Tonya N; Whelan, Jarrett; Hayden, William Tyler; Brown, David A; Shaikh, Saame Raza

    2014-07-18

    It is essential to understand the role of cardiolipin (CL) in mitochondrial membrane organization given that changes in CL levels contribute to mitochondrial dysfunction in type II diabetes, ischemia-reperfusion injury, heart failure, breast cancer, and aging. Specifically, there are contradictory data on how CL influences the molecular packing of membrane phospholipids. Therefore, we determined how increasing levels of heart CL impacted molecular packing in large unilamellar vesicles, modeling heterogeneous lipid mixtures found within the mitochondrial inner membrane, using merocyanine (MC540) fluorescence. We broadly categorized lipid vesicles of equal mass as loosely packed, intermediate, and highly packed based on peak MC540 fluorescence intensity. CL had opposite effects on loosely versus highly packed vesicles. Exposure of loosely packed vesicles to increasing levels of CL dose-dependently increased membrane packing. In contrast, increasing amounts of CL in highly packed vesicles decreased the packing in a dose-dependent manner. In vesicles that were categorized as intermediate packing, CL had either no effect or decreased packing at select doses in a dose-independent manner. Altogether, the results aid in resolving some of the discrepant data by demonstrating that CL displays differential effects on membrane packing depending on the composition of the lipid environment. This has implications for mitochondrial protein activity in response to changing CL levels in microdomains of varying composition.

  8. Dysfunctional chloroplasts up-regulate the expression of mitochondrial genes in Arabidopsis seedlings.

    PubMed

    Liao, Jo-Chien; Hsieh, Wei-Yu; Tseng, Ching-Chih; Hsieh, Ming-Hsiun

    2016-02-01

    Chloroplasts and mitochondria play important roles in maintaining metabolic and energy homeostasis in the plant cell. The interactions between these two organelles, especially photosynthesis and respiration, have been intensively studied. Still, little is known about the regulation of mitochondrial gene expression by chloroplasts and vice versa. The gene expression machineries in chloroplasts and mitochondria rely heavily on the nuclear genome. Thus, the interactions between nucleus and these organelles, including anterograde and retrograde regulation, have been actively investigated in the last two decades. Norflurazon (NF) and lincomycin (Lin) are two commonly used inhibitors to study chloroplast-to-nucleus retrograde signaling in plants. We used NF and Lin to block the development and functions of chloroplasts and examined their effects on mitochondrial gene expression, RNA editing and splicing. The editing of most mitochondrial transcripts was not affected, but the editing extents of nad4-107, nad6-103, and ccmFc-1172 decreased slightly in NF- and Lin-treated seedlings. While the splicing of mitochondrial transcripts was not significantly affected, steady-state mRNA levels of several mitochondrial genes increased significantly in NF- and Lin-treated seedlings. Moreover, Lin seemed to have more profound effects than NF on the expression of mitochondrial genes, indicating that signals derived from these two inhibitors might be distinct. NF and Lin also significantly induced the expression of nuclear genes encoding subunits of mitochondrial electron transport chain complexes. Thus, dysfunctional chloroplasts may coordinately up-regulate the expression of nuclear and mitochondrial genes encoding subunits of respiratory complexes.

  9. Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

    PubMed Central

    Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

    2015-01-01

    Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

  10. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  11. Abundant mitochondrial genome diversity, population differentiation and convergent evolution in pines.

    PubMed Central

    Wu, J; Krutovskii, K V; Strauss, S H

    1998-01-01

    We examined mitochondrial DNA polymorphisms via the analysis of restriction fragment length polymorphisms in three closely related species of pines from western North America: knobcone (Pinus attenuata Lemm.), Monterey (P. radiata D. Don), and bishop (P. muricata D. Don). A total of 343 trees derived from 13 populations were analyzed using 13 homologous mitochondrial gene probes amplified from three species by polymerase chain reaction. Twenty-eight distinct mitochondrial DNA haplotypes were detected and no common haplotypes were found among the species. All three species showed limited variability within populations, but strong differentiation among populations. Based on haplotype frequencies, genetic diversity within populations (HS) averaged 0.22, and population differentiation (GST and theta) exceeded 0.78. Analysis of molecular variance also revealed that >90% of the variation resided among populations. For the purposes of genetic conservation and breeding programs, species and populations could be readily distinguished by unique haplotypes, often using the combination of only a few probes. Neighbor-joining phenograms, however, strongly disagreed with those based on allozymes, chloroplast DNA, and morphological traits. Thus, despite its diagnostic haplotypes, the genome appears to evolve via the rearrangement of multiple, convergent subgenomic domains. PMID:9832536

  12. Synthesis of mitochondrial uncoupling protein in brown adipocytes differentiated in cell culture

    SciTech Connect

    Kopecky, J.; Baudysova, M.; Zanotti, F.; Janikova, D.; Pavelka, S.; Houstek, J. )

    1990-12-25

    In order to characterize the biogenesis of unique thermogenic mitochondria of brown adipose tissue, differentiation of precursor cells isolated from mouse brown adipose tissue was studied in cell culture. Synthesis of mitochondrial uncoupling protein (UCP), F1-ATPase, and cytochrome oxidase was examined by L-(35S)methionine labeling and immunoblotting. For the first time, synthesis of physiological amounts of the UCP, a key and tissue-specific component of thermogenic mitochondria, was observed in cultures at about confluence (day 6), indicating that a complete differentiation of brown adipocytes was achieved in vitro. In postconfluent cells (day 8) the content of UCP decreased rapidly, in contrast to some other mitochondrial proteins (beta subunit of F1-ATPase, cytochrome oxidase). In these cells, it was possible, by using norepinephrine, to induce specifically the synthesis of the UCP but not of F1-ATPase or cytochrome oxidase. The maximal response was observed at 0.1 microM norepinephrine and the synthesis of UCP remained activated for at least 24 h. Detailed analysis revealed a major role of the beta-adrenergic receptors and elevated intracellular concentration of cAMP in stimulation of UCP synthesis. A quantitative recovery of the newly synthesized UCP in the mitochondrial fraction indicated completed biogenesis of functionally competent thermogenic mitochondria.

  13. The mitochondrial aspartate/glutamate carrier isoform 1 gene expression is regulated by CREB in neuronal cells

    PubMed Central

    Menga, Alessio; Iacobazzi, Vito; Infantino, Vittoria; Avantaggiati, Maria Laura; Palmieri, Ferdinando

    2015-01-01

    The aspartate/glutamate carrier isoform 1 is an essential mitochondrial transporter that exchanges intramitochondrial aspartate and cytosolic glutamate across the inner mitochondrial membrane. It is expressed in brain, heart and muscle and is involved in important biological processes, including myelination. However, the signals that regulate the expression of this transporter are still largely unknown. In this study we first identify a CREB binding site within the aspartate/glutamate carrier gene promoter that acts as a strong enhancer element in neuronal SH-SY5Y cells. This element is regulated by active, phosphorylated CREB protein and by signal pathways that modify the activity of CREB itself and, most noticeably, by intracellular Ca2+ levels. Specifically, aspartate/glutamate carrier gene expression is induced via CREB by forskolin while it is inhibited by the PKA inhibitor, H89. Furthermore, the CREB-induced activation of gene expression is increased by thapsigargin, which enhances cytosolic Ca2+, while it is inhibited by BAPTA-AM that reduces cytosolic Ca2+ or by STO-609, which inhibits CaMK-IV phosphorylation. We further show that CREB-dependent regulation of aspartate/glutamate carrier gene expression occurs in neuronal cells in response to pathological (inflammation) and physiological (differentiation) conditions. Since this carrier is necessary for neuronal functions and is involved in myelinogenesis, our results highlight that targeting of CREB activity and Ca2+ might be therapeutically exploited to increase aspartate/glutamate carrier gene expression in neurodegenerative diseases. PMID:25597433

  14. Predominant expression of the mitochondrial dicarboxylate carrier in white adipose tissue.

    PubMed Central

    Das, K; Lewis, R Y; Combatsiaris, T P; Lin, Y; Shapiro, L; Charron, M J; Scherer, P E

    1999-01-01

    We report the identification of a novel mouse protein closely related to the family of mitochondrial uncoupling proteins and the oxoglutarate carrier. The cDNA encodes a protein of 287 amino acids that shares all the hallmark features of the mitochondrial transporter superfamily, including six predicted transmembrane domains. It is nearly identical to the sequence recently reported for the rat mitochondrial dicarboxylate carrier (DIC). We find that murine DIC (mDIC) is expressed at very high levels in mitochondria of white adipocytes and is strongly induced in the course of 3T3-L1 adipogenesis. To determine the consequences of the presence of mDIC on the mitochondrial membrane potential, we transiently expressed mDIC in 293-T cells. Overexpression of mDIC leads to significant mitochondrial hyperpolarization. In addition, exposure to cold down-regulates mDIC levels in vivo. In contrast, free fatty acids lead to an up-regulation of mDIC protein in 3T3-L1 adipocytes. This is the first report demonstrating preferential expression in white adipose tissue of any mitochondrial transporter. However, it remains to be determined which metabolic pathways most critically depend on high level expression of mDIC in the adipocyte. PMID:10567211

  15. Relationship between Sirt1 expression and mitochondrial proteins during conditions of chronic muscle use and disuse.

    PubMed

    Chabi, Beatrice; Adhihetty, Peter J; O'Leary, Michael F N; Menzies, Keir J; Hood, David A

    2009-12-01

    Sirt1 is a NAD(+)-dependent histone deacetylase that interacts with the regulatory protein of mitochondrial biogenesis PGC-1alpha and is sensitive to metabolic alterations. We assessed whether a strict relationship between the expression of Sirt1, mitochondrial proteins, and PGC-1alpha existed across tissues possessing a wide range of oxidative capabilities, as well as in skeletal muscle subject to chronic use (voluntary wheel running or electrical stimulation for 7 days, 10 Hz; 3 h/day) or disuse (denervation for up to 21 days) in which organelle biogenesis is altered. PGC-1alpha levels were not closely associated with the expression of Sirt1, measured using immunoblotting or via enzymatic deacetylase activity. The mitochondrial protein cytochrome c increased by 70-90% in soleus and plantaris muscles of running animals, whereas Sirt1 activity remained unchanged. In chronically stimulated muscle, cytochrome c was increased by 30% compared with nonstimulated muscle, whereas Sirt1 activity was increased modestly by 20-25%. In contrast, in denervated muscle, these markers of mitochondrial content were decreased by 30-50% compared with the control muscle, whereas Sirt1 activity was increased by 75-80%. Our data suggest that Sirt1 and PGC-1alpha expression are independently regulated and that, although Sirt1 activity may be involved in mitochondrial biogenesis, its expression is not closely correlated to changes in mitochondrial proteins during conditions of chronic muscle use and disuse.

  16. Lithium increases PGC-1alpha expression and mitochondrial biogenesis in primary bovine aortic endothelial cells.

    PubMed

    Struewing, Ian T; Barnett, Corey D; Tang, Tao; Mao, Catherine D

    2007-06-01

    Lithium is a therapeutic agent commonly used to treat bipolar disorder and its beneficial effects are thought to be due to a combination of activation of the Wnt/beta-catenin pathway via inhibition of glycogen synthase kinase-3beta and depletion of the inositol pool via inhibition of the inositol monophosphatase-1. We demonstrated that lithium in primary endothelial cells induced an increase in mitochondrial mass leading to an increase in ATP production without any significant change in mitochondrial efficiency. This increase in mitochondrial mass was associated with an increase in the mRNA levels of mitochondrial biogenesis transcription factors: nuclear respiratory factor-1 and -2beta, as well as mitochondrial transcription factors A and B2, which lead to the coordinated upregulation of oxidative phosphorylation components encoded by either the nuclear or mitochondrial genome. These effects of lithium on mitochondrial biogenesis were independent of the inhibition of glycogen synthase kinase-3beta and independent of inositol depletion. Also, expression of the coactivator PGC-1alpha was increased, whereas expression of the coactivator PRC was not affected. Lithium treatment rapidly induced a decrease in activating Akt-Ser473 phosphorylation and inhibitory Forkhead box class O (FOXO1)-Thr24 phosphorylation, as well as an increase in activating c-AMP responsive element binding (CREB)-Ser133 phosphorylation, two mechanisms known to control PGC-1alpha expression. Together, our results show that lithium induces mitochondrial biogenesis via CREB/PGC-1alpha and FOXO1/PGC-1alpha cascades, which highlight the pleiotropic effects of lithium and reveal also novel beneficial effects via preservation of mitochondrial functions.

  17. Control of gene expression and mitochondrial biogenesis in the muscular adaptation to endurance exercise.

    PubMed

    Joseph, Anna-Maria; Pilegaard, Henriette; Litvintsev, Anastassia; Leick, Lotte; Hood, David A

    2006-01-01

    Every time a bout of exercise is performed, a change in gene expression occurs within the contracting muscle. Over the course of many repeated bouts of exercise (i.e. training), the cumulative effects of these alterations lead to a change in muscle phenotype. One of the most prominent of these adaptations is an increase in mitochondrial content, which confers a greater resistance to muscle fatigue. This essay reviews current knowledge on the regulation of exercise-induced mitochondrial biogenesis at the molecular level. The major steps involved include, (i) transcriptional regulation of nuclear-encoded genes encoding mitochondrial proteins by the coactivator peroxisome-proliferator-activated receptor g coactivator-1, (ii) control of mitochondrial DNA gene expression by the transcription factor Tfam, (iii) mitochondrial fission and fusion mechanisms, and (iv) import of nuclear-derived gene products into the mitochondrion via the protein import machinery. It is now known that exercise can modify the rates of several of these steps, leading to mitochondrial biogenesis. An understanding of how exercise can produce this effect could help us decide whether exercise is beneficial for patients suffering from mitochondrial disorders, as well as a variety of metabolic diseases.

  18. Electrical stimulation of neonatal cardiomyocytes results in the sequential activation of nuclear genes governing mitochondrial proliferation and differentiation

    PubMed Central

    Xia, Yang; Buja, L. Maximilian; Scarpulla, Richard C.; McMillin, Jeanie B.

    1997-01-01

    Electrical stimulation of neonatal cardiac myocytes produces hypertrophy and cellular maturation with increased mitochondrial content and activity. To investigate the patterns of gene expression associated with these processes, cardiac myocytes were stimulated for varying times up to 72 hr in serum-free culture. The mRNA contents for genes associated with transcriptional activation [c-fos, c-jun, JunB, nuclear respiratory factor 1 (NRF-1)], mitochondrial proliferation [cytochrome c (Cyt c), cytochrome oxidase], and mitochondrial differentiation [carnitine palmitoyltransferase I (CPT-I) isoforms] were measured. The results establish a temporal pattern of mRNA induction beginning with c-fos (0.25–3 hr) and followed sequentially by c-jun (0.5–3 hr), JunB (0.5–6 hr), NRF-1 (1–12 hr), Cyt c (12–72 hr), and muscle-specific CPT-I (48–72 hr). Induction of the latter was accompanied by a marked decrease in the liver-specific CPT-I mRNA, thus supporting the developmental fidelity of this pattern of gene regulation. Consistent with a transcriptional mechanism, electrical stimulation increased c-fos, β-myosin heavy chain, and Cyt c promoter activities. These increases coincided with a rise in their respective endogenous gene transcripts. NRF-1, cAMP response element, and Sp-1 site mutations within the Cyt c promoter reduced luciferase expression in both stimulated and nonstimulated myocytes. Mutations in the NRF-1 and CRE sites inhibited the induction by electrical stimulation (5-fold and 2-fold, respectively) whereas mutation of the Sp-1 site maintained or increased the fold induction. This finding is consistent with the appearance of NRF-1 and fos/jun mRNAs prior to that of Cyt c and suggests that induction of these transcription factors is a prerequisite for the transcriptional activation of Cyt c expression. These results support a regulatory role for NRF-1 and possibly AP-1 in the initiation of mitochondrial proliferation. PMID:9326621

  19. Altered mitochondrial gene expression in the nonchromosomal stripe 2 mutant of maize

    PubMed Central

    Feiler, Heidi S.; Newton, Kathleen J.

    1987-01-01

    The genetic and molecular analyses of higher plant mitochondria can be facilitated by studying maternally-inherited mutations, such as the nonchromosomal stripe (NCS) mutants of maize, that have deleterious effects on plant growth. We have previously demonstrated a correlation between specific alterations in mitochondrial DNA and the expression of NCS phenotypes. In the present studies, the effects of the NCS2 mutation on mitochondrial gene expression are evaluated. Proteins synthesized by mitochondria isolated from NCS2 mutants and from related plants with normal growth have been compared. NCS2 mitochondria synthesize much reduced amounts of a single polypeptide. Probes corresponding to the mitochondrial DNA region altered in NCS2 hybridize to an aberrant set of transcripts in NCS2 mitochondria. Transcripts homologous to several previously characterized plant mitochondrial genes are similar in NCS2 and related non-mutant mitochondria. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5. PMID:16453769

  20. [Evolution of the mitochondrial DNA and its expression system--comparison between animal and plant kingdom].

    PubMed

    Piechota, Janusz; Jańska, Hanna

    2008-01-01

    The information about features of the Eukaryotic cells is maintained not only in the nucleus, but also in the extranuclear genomes localized in mitochondria and chloroplasts. Comparison between plant and animal mitochondrial genomes allows to perceive two extremely distinct evolution strategies. Animals clearly tend to reduce the size of the mitochondrial genome to the minimum. In accordance with this, the simplification in decoding of genetic information present in the genome is observed. On the contrary, plant mitochondrial genomes tend to increase their size. Accumulation of extraordinary solutions for maintaining and expression of genetic information present in the genome is the second distinctive feature of plant mitochondria.

  1. A Critical Role of Mitochondrial Phosphatase Ptpmt1 in Embryogenesis Reveals a Mitochondrial Metabolic Stress-Induced Differentiation Checkpoint in Embryonic Stem Cells ▿

    PubMed Central

    Shen, Jinhua; Liu, Xia; Yu, Wen-Mei; Liu, Jie; Groot Nibbelink, Milou; Guo, Caiying; Finkel, Toren; Qu, Cheng-Kui

    2011-01-01

    Mitochondria are highly dynamic organelles that play multiple roles in cells. How mitochondria cooperatively modulate embryonic stem (ES) cell function during development is not fully understood. Global disruption of Ptpmt1, a mitochondrial Pten-like phosphatidylinositol phosphate (PIP) phosphatase, resulted in developmental arrest and postimplantation lethality. Ptpmt1−/− blastocysts failed to outgrow, and inner-cell-mass cells failed to thrive. Depletion of Ptpmt1 in conditional knockout ES cells decreased proliferation without affecting energy homeostasis or cell survival. Differentiation of Ptpmt1-depleted ES cells was essentially blocked. This was accompanied by upregulation of cyclin-dependent kinase inhibitors and a significant cell cycle delay. Reintroduction of wild-type but not of catalytically deficient Ptpmt1 C132S or truncated Ptpmt1 lacking the mitochondrial localization signal restored the differentiation capabilities of Ptpmt1 knockout ES cells. Intriguingly, Ptpmt1 is specifically important for stem cells, as ablation of Ptpmt1 in differentiated embryonic fibroblasts did not disturb cellular function. Further analyses demonstrated that oxygen consumption of Ptpmt1-depleted cells was decreased, while glycolysis was concomitantly enhanced. In addition, mitochondrial fusion/dynamics were compromised in Ptpmt1 knockout cells due to accumulation of PIPs. These studies, while establishing a crucial role for Ptpmt1 phosphatase in embryogenesis, reveal a mitochondrial metabolic stress-activated checkpoint in the control of ES cell differentiation. PMID:21986498

  2. Diabetes and activation of peroxisome proliferator activated receptor alpha increases mitochondrial thioesterase I protein expression and activity in the heart

    USDA-ARS?s Scientific Manuscript database

    Mitochondrial thioesterase-I (MTE-I) catalyzes the de-esterification of fattyacyl-CoAs to fatty acid anions in the mitochondrial matrix, which are extruded to the cytosol, thus preventing the accumulation of toxic mitochondrial fattyacyl-CoAs. MTE-I mRNA expression in the heart is regulated by perox...

  3. Treatment of human astrocytoma U87 cells with silicon dioxide nanoparticles lowers their survival and alters their expression of mitochondrial and cell signaling proteins.

    PubMed

    Lai, James C K; Ananthakrishnan, Gayathri; Jandhyam, Sirisha; Dukhande, Vikas V; Bhushan, Alok; Gokhale, Mugdha; Daniels, Christopher K; Leung, Solomon W

    2010-10-05

    Recent evidence suggests silicon dioxide micro- and nanoparticles induce cytotoxic effects on lung cells. Thus, there is an increasing concern regarding their potential health hazard. Nevertheless, the putative toxicity of nanoparticles in mammalian cells has not yet been systematically investigated. We previously noted that several metallic oxide nanoparticles exert differential cytotoxic effects on human neural and nonneural cells. Therefore, we hypothesized that silicon dioxide nanoparticles induce cytotoxicity in U87 cells by lowering their survival by decreasing cell survival signaling and disturbing mitochondrial function. To investigate this hypothesis, we determined the activities of the key mitochondrial enzymes, citrate synthase and malate dehydrogenase, in astrocytoma U87 cells treated with silicon dioxide nanoparticles. In addition, we studied the expression of the mitochondrial DNA-encoded proteins, cytochrome C oxidase II and nicotinamide adenine dinucleotide (NADPH) dehydrogenase subunit 6, and cell signaling pathway protein extracellular signal-regulated kinase (ERK) and phosphorylated ERK in treated U87 cells. The activated form of ERK controls cell growth, differentiation, and proliferation. In parallel, we determined survival of U87 cells after treating them with various concentrations of silicon dioxide nanoparticles. Our results indicated that treatment with silicon dioxide nanoparticles induced decreases in U87 cell survival in a dose-related manner. The activities of citrate synthase and malate dehydrogenase in treated U87 cells were increased, possibly due to an energetic compensation in surviving cells. However, the expression of mitochondrial DNA-encoded cytochrome C oxidase subunit II and NADH dehydrogenase subunit 6 and the cell signaling protein ERK and phosphorylated ERK were altered in the treated U87 cells, suggesting that silicon dioxide nanoparticles induced disruption of mitochondrial DNA-encoded protein expression, leading to

  4. Treatment of human astrocytoma U87 cells with silicon dioxide nanoparticles lowers their survival and alters their expression of mitochondrial and cell signaling proteins

    PubMed Central

    Lai, James CK; Ananthakrishnan, Gayathri; Jandhyam, Sirisha; Dukhande, Vikas V; Bhushan, Alok; Gokhale, Mugdha; Daniels, Christopher K; Leung, Solomon W

    2010-01-01

    Recent evidence suggests silicon dioxide micro- and nanoparticles induce cytotoxic effects on lung cells. Thus, there is an increasing concern regarding their potential health hazard. Nevertheless, the putative toxicity of nanoparticles in mammalian cells has not yet been systematically investigated. We previously noted that several metallic oxide nanoparticles exert differential cytotoxic effects on human neural and nonneural cells. Therefore, we hypothesized that silicon dioxide nanoparticles induce cytotoxicity in U87 cells by lowering their survival by decreasing cell survival signaling and disturbing mitochondrial function. To investigate this hypothesis, we determined the activities of the key mitochondrial enzymes, citrate synthase and malate dehydrogenase, in astrocytoma U87 cells treated with silicon dioxide nanoparticles. In addition, we studied the expression of the mitochondrial DNA-encoded proteins, cytochrome C oxidase II and nicotinamide adenine dinucleotide (NADPH) dehydrogenase subunit 6, and cell signaling pathway protein extracellular signal-regulated kinase (ERK) and phosphorylated ERK in treated U87 cells. The activated form of ERK controls cell growth, differentiation, and proliferation. In parallel, we determined survival of U87 cells after treating them with various concentrations of silicon dioxide nanoparticles. Our results indicated that treatment with silicon dioxide nanoparticles induced decreases in U87 cell survival in a dose-related manner. The activities of citrate synthase and malate dehydrogenase in treated U87 cells were increased, possibly due to an energetic compensation in surviving cells. However, the expression of mitochondrial DNA-encoded cytochrome C oxidase subunit II and NADH dehydrogenase subunit 6 and the cell signaling protein ERK and phosphorylated ERK were altered in the treated U87 cells, suggesting that silicon dioxide nanoparticles induced disruption of mitochondrial DNA-encoded protein expression, leading to

  5. Comparison of liver mitochondrial proteins derived from newborn cloned calves and from cloned adult cattle by two-dimensional differential gel electrophoresis.

    PubMed

    Takeda, Kumiko; Tasai, Mariko; Akagi, Satoshi; Watanabe, Shinya; Oe, Mika; Chikuni, Koichi; Ohnishi-Kameyama, Mayumi; Hanada, Hirofumi; Nakamura, Yoshiaki; Tagami, Takahiro; Nirasawa, Keijiro

    2011-04-01

    Aberrant reprogramming of donor somatic cell nuclei may result in many severe problems in animal cloning. The inability to establish functional interactions between donor nucleus and recipient mitochondria is also likely responsible for such a developmental deficiency. However, detailed knowledge of protein expression during somatic cell nuclear transfer (SCNT) in cattle is lacking. In the present study, variations in mitochondrial protein levels between SCNT-derived and control cattle, and from calves derived by artificial insemination were investigated. Mitochondrial fractions were prepared from frozen liver samples and subjected to two-dimensional (2-D) fluorescence differential gel electrophoresis (DIGE) using CyDye™ dyes. Protein expression changes were confirmed with a volume ratio greater than 2.0 (P < 0.05). 2D-DIGE analysis revealed differential expression of three proteins for SCNT cattle (n = 4) and seven proteins for SCNT calves (n = 6) compared to controls (P < 0.05). Different protein patterning was observed among SCNT animals even if animals were generated from the same donor cell source. No differences were detected in two of the SCNT cattle. Moreover, there was no novel protein identified in any of the SCNT cattle or calves. In conclusion, variation in mitochondrial protein expression concentrations was observed in non-viable, neonatal SCNT calves and among SCNT individuals. This result implicates mitochondrial-related gene expression in early developmental loss of SCNT embryos. Comparative proteomic analysis represents an important tool for further studies on SCNT animals. Copyright © 2011 Wiley-Liss, Inc.

  6. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer.

    PubMed

    Nilsson, Roland; Jain, Mohit; Madhusudhan, Nikhil; Sheppard, Nina Gustafsson; Strittmatter, Laura; Kampf, Caroline; Huang, Jenny; Asplund, Anna; Mootha, Vamsi K

    2014-01-01

    Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta-analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses.

  7. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer

    NASA Astrophysics Data System (ADS)

    Nilsson, Roland; Jain, Mohit; Madhusudhan, Nikhil; Sheppard, Nina Gustafsson; Strittmatter, Laura; Kampf, Caroline; Huang, Jenny; Asplund, Anna; Mootha, Vamsi K.

    2014-01-01

    Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta-analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses.

  8. Aluminium induced oxidative stress results in decreased mitochondrial biogenesis via modulation of PGC-1α expression.

    PubMed

    Sharma, Deep Raj; Sunkaria, Aditya; Wani, Willayat Yousuf; Sharma, Reeta Kumari; Kandimalla, Ramesh J L; Bal, Amanjit; Gill, Kiran Dip

    2013-12-01

    The present investigation was carried out to elucidate a possible molecular mechanism related to the effects of aluminium-induced oxidative stress on various mitochondrial respiratory complex subunits with special emphasis on the role of Peroxisome proliferator activated receptor gamma co-activator 1α (PGC-1α) and its downstream targets i.e. Nuclear respiratory factor-1(NRF-1), Nuclear respiratory factor-2(NRF-2) and Mitochondrial transcription factor A (Tfam) in mitochondrial biogenesis. Aluminium lactate (10mg/kgb.wt./day) was administered intragastrically to rats for 12 weeks. After 12 weeks of exposure, we found an increase in ROS levels, mitochondrial DNA oxidation and decrease in citrate synthase activity in the Hippocampus (HC) and Corpus striatum (CS) regions of rat brain. On the other hand, there was a decrease in the mRNA levels of the mitochondrial encoded subunits-NADH dehydrogenase (ND) subunits i.e. ND1, ND2, ND3, Cytochrome b (Cytb), Cytochrome oxidase (COX) subunits i.e. COX1, COX3, ATP synthase (ATPase) subunit 6 along with reduced expression of nuclear encoded subunits COX4, COX5A, COX5B of Electron transport chain (ETC). Besides, a decrease in mitochondrial DNA copy number and mitochondrial content in both regions of rat brain was observed. The PGC-1α was down-regulated in aluminium treated rats along with NRF-1, NRF-2 and Tfam, which act downstream from PGC-1α in aluminium treated rats. Electron microscopy results revealed a significant increase in the mitochondrial swelling, loss of cristae, chromatin condensation and decreases in mitochondrial number in case of aluminium treated rats as compared to control. So, PGC-1α seems to be a potent target for aluminium neurotoxicity, which makes it an almost ideal target to control or limit the damage that has been associated with the defective mitochondrial function seen in neurodegenerative diseases. © 2013.

  9. Distinct Splice Variants of Dynamin-related Protein 1 Differentially Utilize Mitochondrial Fission Factor as an Effector of Cooperative GTPase Activity*

    PubMed Central

    Macdonald, Patrick J.; Francy, Christopher A.; Stepanyants, Natalia; Lehman, Lance; Baglio, Anthony; Mears, Jason A.; Qi, Xin; Ramachandran, Rajesh

    2016-01-01

    Multiple isoforms of the mitochondrial fission GTPase dynamin-related protein 1 (Drp1) arise from the alternative splicing of its single gene-encoded pre-mRNA transcript. Among these, the longer Drp1 isoforms, expressed selectively in neurons, bear unique polypeptide sequences within their GTPase and variable domains, known as the A-insert and the B-insert, respectively. Their functions remain unresolved. A comparison of the various biochemical and biophysical properties of the neuronally expressed isoforms with that of the ubiquitously expressed, and shortest, Drp1 isoform (Drp1-short) has revealed the effect of these inserts on Drp1 function. Utilizing various biochemical, biophysical, and cellular approaches, we find that the A- and B-inserts distinctly alter the oligomerization propensity of Drp1 in solution as well as the preferred curvature of helical Drp1 self-assembly on membranes. Consequently, these sequences also suppress Drp1 cooperative GTPase activity. Mitochondrial fission factor (Mff), a tail-anchored membrane protein of the mitochondrial outer membrane that recruits Drp1 to sites of ensuing fission, differentially stimulates the disparate Drp1 isoforms and alleviates the autoinhibitory effect imposed by these sequences on Drp1 function. Moreover, the differential stimulatory effects of Mff on Drp1 isoforms are dependent on the mitochondrial lipid, cardiolipin (CL). Although Mff stimulation of the intrinsically cooperative Drp1-short isoform is relatively modest, CL-independent, and even counter-productive at high CL concentrations, Mff stimulation of the much less cooperative longest Drp1 isoform (Drp1-long) is robust and occurs synergistically with increasing CL content. Thus, membrane-anchored Mff differentially regulates various Drp1 isoforms by functioning as an allosteric effector of cooperative GTPase activity. PMID:26578513

  10. Distinct Splice Variants of Dynamin-related Protein 1 Differentially Utilize Mitochondrial Fission Factor as an Effector of Cooperative GTPase Activity.

    PubMed

    Macdonald, Patrick J; Francy, Christopher A; Stepanyants, Natalia; Lehman, Lance; Baglio, Anthony; Mears, Jason A; Qi, Xin; Ramachandran, Rajesh

    2016-01-01

    Multiple isoforms of the mitochondrial fission GTPase dynamin-related protein 1 (Drp1) arise from the alternative splicing of its single gene-encoded pre-mRNA transcript. Among these, the longer Drp1 isoforms, expressed selectively in neurons, bear unique polypeptide sequences within their GTPase and variable domains, known as the A-insert and the B-insert, respectively. Their functions remain unresolved. A comparison of the various biochemical and biophysical properties of the neuronally expressed isoforms with that of the ubiquitously expressed, and shortest, Drp1 isoform (Drp1-short) has revealed the effect of these inserts on Drp1 function. Utilizing various biochemical, biophysical, and cellular approaches, we find that the A- and B-inserts distinctly alter the oligomerization propensity of Drp1 in solution as well as the preferred curvature of helical Drp1 self-assembly on membranes. Consequently, these sequences also suppress Drp1 cooperative GTPase activity. Mitochondrial fission factor (Mff), a tail-anchored membrane protein of the mitochondrial outer membrane that recruits Drp1 to sites of ensuing fission, differentially stimulates the disparate Drp1 isoforms and alleviates the autoinhibitory effect imposed by these sequences on Drp1 function. Moreover, the differential stimulatory effects of Mff on Drp1 isoforms are dependent on the mitochondrial lipid, cardiolipin (CL). Although Mff stimulation of the intrinsically cooperative Drp1-short isoform is relatively modest, CL-independent, and even counter-productive at high CL concentrations, Mff stimulation of the much less cooperative longest Drp1 isoform (Drp1-long) is robust and occurs synergistically with increasing CL content. Thus, membrane-anchored Mff differentially regulates various Drp1 isoforms by functioning as an allosteric effector of cooperative GTPase activity.

  11. Aluminium induced oxidative stress results in decreased mitochondrial biogenesis via modulation of PGC-1α expression

    SciTech Connect

    Sharma, Deep Raj; Sunkaria, Aditya; Wani, Willayat Yousuf; Sharma, Reeta Kumari; Kandimalla, Ramesh J.L.; Bal, Amanjit; Gill, Kiran Dip

    2013-12-01

    The present investigation was carried out to elucidate a possible molecular mechanism related to the effects of aluminium-induced oxidative stress on various mitochondrial respiratory complex subunits with special emphasis on the role of Peroxisome proliferator activated receptor gamma co-activator 1α (PGC-1α) and its downstream targets i.e. Nuclear respiratory factor-1(NRF-1), Nuclear respiratory factor-2(NRF-2) and Mitochondrial transcription factor A (Tfam) in mitochondrial biogenesis. Aluminium lactate (10 mg/kg b.wt./day) was administered intragastrically to rats for 12 weeks. After 12 weeks of exposure, we found an increase in ROS levels, mitochondrial DNA oxidation and decrease in citrate synthase activity in the Hippocampus (HC) and Corpus striatum (CS) regions of rat brain. On the other hand, there was a decrease in the mRNA levels of the mitochondrial encoded subunits–NADH dehydrogenase (ND) subunits i.e. ND1, ND2, ND3, Cytochrome b (Cytb), Cytochrome oxidase (COX) subunits i.e. COX1, COX3, ATP synthase (ATPase) subunit 6 along with reduced expression of nuclear encoded subunits COX4, COX5A, COX5B of Electron transport chain (ETC). Besides, a decrease in mitochondrial DNA copy number and mitochondrial content in both regions of rat brain was observed. The PGC-1α was down-regulated in aluminium treated rats along with NRF-1, NRF-2 and Tfam, which act downstream from PGC-1α in aluminium treated rats. Electron microscopy results revealed a significant increase in the mitochondrial swelling, loss of cristae, chromatin condensation and decreases in mitochondrial number in case of aluminium treated rats as compared to control. So, PGC-1α seems to be a potent target for aluminium neurotoxicity, which makes it an almost ideal target to control or limit the damage that has been associated with the defective mitochondrial function seen in neurodegenerative diseases. - Highlights: • Aluminium decreases the mRNA levels of mitochondrial and nuclear encoded

  12. Global variability in gene expression and alternative splicing is modulated by mitochondrial content.

    PubMed

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J

    2015-05-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype.

  13. Global variability in gene expression and alternative splicing is modulated by mitochondrial content

    PubMed Central

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J.

    2015-01-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype. PMID:25800673

  14. Differentiating between monozygotic twins through next-generation mitochondrial genome sequencing.

    PubMed

    Wang, Zheng; Zhu, Ruxin; Zhang, Suhua; Bian, Yinnan; Lu, Daru; Li, Chengtao

    2015-12-01

    Monozygotic (MZ) twins, considered to be genetically identical, cannot be distinguished from one another by standard forensic DNA testing. A recent study employed whole genome sequencing to identify extremely rare mutations and reported that mutation analysis could be used to differentiate between MZ twins. Compared with nuclear DNA, mitochondrial DNA (mtDNA) has higher mutation rates; therefore, minor differences theoretically exist in MZ twins' mitochondrial genome (mtGenome). However, conventional Sanger-type sequencing (STS) is neither amenable to, nor feasible for, the detection of low-level sequence variants. The recent introduction of massively parallel sequencing (MPS) has the capability to sequence many targeted regions of multiple samples simultaneously with desirable depth of coverage. Thus, the aim of this study was to assess whether full mtGenome sequencing analysis can be used to differentiate between MZ twins. Ten sets of MZ twins provided blood samples that underwent extraction, quantification, mtDNA enrichment, library preparation, and ultra-deep sequencing. Point heteroplasmies were observed in eight sets of MZ twins, and a single nucleotide variant (nt15301) was detected in five sets of MZ twins. Thus, this study demonstrates that ultra-deep mtGenome sequencing could be used to differentiate between MZ twins.

  15. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  16. Collagen gene expression during limb cartilage differentiation

    PubMed Central

    1986-01-01

    As limb mesenchymal cells differentiate into chondrocytes, they initiate the synthesis of type II collagen and cease synthesizing type I collagen. Changes in the cytoplasmic levels of type I and type II collagen mRNAs during the course of limb chondrogenesis in vivo and in vitro were examined using cloned cDNA probes. A striking increase in cytoplasmic type II collagen mRNA occurs coincident with the crucial condensation stage of chondrogenesis in vitro, in which prechondrogenic mesenchymal cells become closely juxtaposed before depositing a cartilage matrix. Thereafter, a continuous and progressive increase in the accumulation of cytoplasmic type II collagen mRNA occurs which parallels the progressive accumulation of cartilage matrix by cells. The onset of overt chondrogenesis, however, does not involve activation of the transcription of the type II collagen gene. Low levels of type II collagen mRNA are present in the cytoplasm of prechondrogenic mesenchymal cells at the earliest stages of limb development, well before the accumulation of detectable levels of type II collagen. Type I collagen gene expression during chondrogenesis is regulated, at least in part, at the translational level. Type I collagen mRNAs are present in the cytoplasm of differentiated chondrocytes, which have ceased synthesizing detectable amounts of type I collagen. PMID:3754261

  17. Nuclear gene dosage effects upon the expression of maize mitochondrial genes.

    PubMed Central

    Auger, D L; Newton, K J; Birchler, J A

    2001-01-01

    Each mitochondrion possesses a genome that encodes some of its own components. The nucleus encodes most of the mitochondrial proteins, including the polymerases and factors that regulate the expression of mitochondrial genes. Little is known about the number or location of these nuclear factors. B-A translocations were used to create dosage series for 14 different chromosome arms in maize plants with normal cytoplasm. The presence of one or more regulatory factors on a chromosome arm was indicated when variation of its dosage resulted in the alteration in the amount of a mitochondrial transcript. We used quantitative Northern analysis to assay the transcript levels of three mitochondrially encoded components of the cytochrome c oxidase complex (cox1, cox2, and cox3). Data for a nuclearly encoded component (cox5b) and for two mitochondrial genes that are unrelated to cytochrome c oxidase, ATP synthase alpha-subunit and 18S rRNA, were also determined. Two tissues, embryo and endosperm, were compared and most effects were found to be tissue specific. Significantly, the array of dosage effects upon mitochondrial genes was similar to what had been previously found for nuclear genes. These results support the concept that although mitochondrial genes are prokaryotic in origin, their regulation has been extensively integrated into the eukaryotic cell. PMID:11290725

  18. Mitochondrial content is central to nuclear gene expression: Profound implications for human health.

    PubMed

    Muir, Rebecca; Diot, Alan; Poulton, Joanna

    2016-02-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing "Mitochondrial replacement therapy" to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important.

  19. Mitochondrial content is central to nuclear gene expression: Profound implications for human health

    PubMed Central

    Muir, Rebecca; Diot, Alan

    2016-01-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing “Mitochondrial replacement therapy” to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important. PMID:26725055

  20. MicroRNAs Regulate Cellular ATP Levels by Targeting Mitochondrial Energy Metabolism Genes during C2C12 Myoblast Differentiation.

    PubMed

    Siengdee, Puntita; Trakooljul, Nares; Murani, Eduard; Schwerin, Manfred; Wimmers, Klaus; Ponsuksili, Siriluck

    2015-01-01

    In our previous study, we identified an miRNA regulatory network involved in energy metabolism in porcine muscle. To better understand the involvement of miRNAs in cellular ATP production and energy metabolism, here we used C2C12 myoblasts, in which ATP levels increase during differentiation, to identify miRNAs modulating these processes. ATP level, miRNA and mRNA microarray expression profiles during C2C12 differentiation into myotubes were assessed. The results suggest 14 miRNAs (miR-423-3p, miR-17, miR-130b, miR-301a/b, miR-345, miR-15a, miR-16a, miR-128, miR-615, miR-1968, miR-1a/b, and miR-194) as cellular ATP regulators targeting genes involved in mitochondrial energy metabolism (Cox4i2, Cox6a2, Ndufb7, Ndufs4, Ndufs5, and Ndufv1) during C2C12 differentiation. Among these, miR-423-3p showed a high inverse correlation with increasing ATP levels. Besides having implications in promoting cell growth and cell cycle progression, its function in cellular ATP regulation is yet unknown. Therefore, miR-423-3p was selected and validated for the function together with its potential target, Cox6a2. Overexpression of miR-423-3p in C2C12 myogenic differentiation lead to decreased cellular ATP level and decreased expression of Cox6a2 compared to the negative control. These results suggest miR-423-3p as a novel regulator of ATP/energy metabolism by targeting Cox6a2.

  1. MicroRNAs Regulate Cellular ATP Levels by Targeting Mitochondrial Energy Metabolism Genes during C2C12 Myoblast Differentiation

    PubMed Central

    Siengdee, Puntita; Trakooljul, Nares; Murani, Eduard; Schwerin, Manfred; Wimmers, Klaus; Ponsuksili, Siriluck

    2015-01-01

    In our previous study, we identified an miRNA regulatory network involved in energy metabolism in porcine muscle. To better understand the involvement of miRNAs in cellular ATP production and energy metabolism, here we used C2C12 myoblasts, in which ATP levels increase during differentiation, to identify miRNAs modulating these processes. ATP level, miRNA and mRNA microarray expression profiles during C2C12 differentiation into myotubes were assessed. The results suggest 14 miRNAs (miR-423-3p, miR-17, miR-130b, miR-301a/b, miR-345, miR-15a, miR-16a, miR-128, miR-615, miR-1968, miR-1a/b, and miR-194) as cellular ATP regulators targeting genes involved in mitochondrial energy metabolism (Cox4i2, Cox6a2, Ndufb7, Ndufs4, Ndufs5, and Ndufv1) during C2C12 differentiation. Among these, miR-423-3p showed a high inverse correlation with increasing ATP levels. Besides having implications in promoting cell growth and cell cycle progression, its function in cellular ATP regulation is yet unknown. Therefore, miR-423-3p was selected and validated for the function together with its potential target, Cox6a2. Overexpression of miR-423-3p in C2C12 myogenic differentiation lead to decreased cellular ATP level and decreased expression of Cox6a2 compared to the negative control. These results suggest miR-423-3p as a novel regulator of ATP/energy metabolism by targeting Cox6a2. PMID:26010876

  2. Allotopic expression of ATP6 in the mouse as a transgenic model of mitochondrial disease.

    PubMed

    Dunn, David A; Pinkert, Carl A

    2015-01-01

    Progress in animal modeling of polymorphisms and mutations in mitochondrial DNA (mtDNA) is not as developed as nuclear transgenesis due to a host of cellular and physiological distinctions. mtDNA mutation modeling is of critical importance as mutations in the mitochondrial genome give rise to a variety of pathological conditions and play a contributing role in many others. Nuclear localization and transcription of mtDNA genes followed by cytoplasmic translation and transport into mitochondria (allotopic expression, AE) provide an opportunity to create in vivo modeling of a targeted mutation in mitochondrial genes and has been suggested as a strategy for gene replacement therapy in patients harboring mitochondrial DNA mutations. Here, we use our AE approach to transgenic mouse modeling of the pathogenic human T8993G mutation in mtATP6 as a case study for designing AE animal models.

  3. A mitochondrial uncoupling artifact can be caused by expression of uncoupling protein 1 in yeast.

    PubMed Central

    Stuart, J A; Harper, J A; Brindle, K M; Jekabsons, M B; Brand, M D

    2001-01-01

    Uncoupling protein 1 (UCP1) from mouse was expressed in yeast and the specific (GDP-inhibitable) and artifactual (GDP-insensitive) effects on mitochondrial uncoupling were assessed. UCP1 provides a GDP-inhibitable model system to help interpret the uncoupling effects of high expression in yeast of other members of the mitochondrial carrier protein family, such as the UCP1 homologues UCP2 and UCP3. Yeast expressing UCP1 at modest levels (approx. 1 microg/mg of mitochondrial protein) showed no growth defect, normal rates of chemically uncoupled respiration and an increased non-phosphorylating proton conductance that was completely GDP-sensitive. The catalytic-centre activity of UCP1 in these yeast mitochondria was similar to that in mammalian brown-adipose-tissue mitochondria. However, yeast expressing UCP1 at higher levels (approx. 11 microg/mg of mitochondrial protein) showed a growth defect. Their mitochondria had depressed chemically uncoupled respiration rates and an increased proton conductance that was partly GDP-insensitive. Thus, although UCP1 shows native behaviour at modest levels of expression in yeast, higher levels (or rates) of expression can lead to an uncoupling that is not a physiological property of the native protein and is therefore artifactual. This observation might be important in the interpretation of results from experiments in which the functions of UCP1 homologues are verified by their ability to uncouple yeast mitochondria. PMID:11389685

  4. Betulinic Acid Induces Apoptosis in Differentiated PC12 Cells Via ROS-Mediated Mitochondrial Pathway.

    PubMed

    Wang, Xi; Lu, Xiaocheng; Zhu, Ronglan; Zhang, Kaixin; Li, Shuai; Chen, Zhongjun; Li, Lixin

    2017-01-25

    Betulinic acid (BA), a pentacyclic triterpene of natural origin, has been demonstrated to have varied biologic activities including anti-viral, anti-inflammatory, and anti-malarial effects; it has also been found to induce apoptosis in many types of cancer. However, little is known about the effect of BA on normal cells. In this study, the effects of BA on normal neuronal cell apoptosis and the mechanisms involved were studied using differentiated PC12 cells as a model. Treatment with 50 μM BA for 24 h apparently induced PC12 cell apoptosis. In the early stage of apoptosis, the level of intracellular reactive oxygen species (ROS) increased. Afterwards, the loss of the mitochondrial membrane potential, the release of cytochrome c and the activation of caspase-3 occurred. Treatment with antioxidants could significantly reduce BA-induced PC12 cell apoptosis. In conclusion, we report for the first time that BA induced the mitochondrial apoptotic pathway in differentiated PC12 cells through ROS.

  5. Differential mitochondrial calcium responses in different cell types detected with a mitochondrial calcium fluorescent indicator, mito-GCaMP2.

    PubMed

    Chen, Min; Wang, Yanru; Hou, Tingting; Zhang, Huiliang; Qu, Aijuan; Wang, Xianhua

    2011-10-01

    Mitochondrial calcium plays a crucial role in mitochondrial metabolism, cell calcium handling, and cell death. However, some mechanisms concerning mitochondrial calcium regulation are still unknown, especially how mitochondrial calcium couples with cytosolic calcium. In this work, we constructed a novel mitochondrial calcium fluorescent indicator (mito-GCaMP2) by genetic manipulation. Mito-GCaMP2 was imported into mitochondria with high efficiency and the fluorescent signals co-localized with that of tetramethyl rhodamine methyl ester, a mitochondrial membrane potential indicator. The mitochondrial inhibitors specifically decreased the signals of mito-GCaMP2. The apparent K(d) of mito-GCaMP2 was 195.0 nmol/L at pH 8.0 in adult rat cardiomyocytes. Furthermore, we observed that mito-GCaMP2 preferred the alkaline pH surrounding of mitochondria. In HeLa cells, we found that mitochondrial calcium ([Ca(2+)](mito)) responded to the changes of cytosolic calcium ([Ca(2+)](cyto)) induced by histamine or thapasigargin. Moreover, external Ca(2+) (100 μmol/L) directly induced an increase of [Ca(2+)](mito) in permeabilized HeLa cells. However, in rat cardiomyocytes [Ca(2+)](mito) did not respond to cytosolic calcium transients stimulated by electric pacing or caffeine. In permeabilized cardiomyocytes, 600 nmol/L free Ca(2+) repeatedly increased the fluorescent signals of mito-GCaMP2, which excluded the possibility that mito-GCaMP2 lost its function in cardiomyocytes mitochondria. These results showed that the response of mitochondrial calcium is diverse in different cell lineages and suggested that mitochondria in cardiomyocytes may have a special defense mechanism to control calcium flux.

  6. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression.

    PubMed

    Gómez-Sánchez, Rubén; Gegg, Matthew E; Bravo-San Pedro, José M; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M; González-Polo, Rosa Ana; Schapira, Anthony H V

    2014-02-01

    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection.

  7. Flower-enhanced expression of a nuclear-encoded mitochondrial respiratory protein is associated with changes in mitochondrion number.

    PubMed Central

    Huang, J; Struck, F; Matzinger, D F; Levings, C S

    1994-01-01

    The mitochondrial Rieske iron-sulfur protein is an obligatory component of the respiratory electron transport chain that is encoded by a single-copy gene in mammals and fungi. In contrast, this protein is encoded by a small gene family in dicotyledonous tobacco and monocotyledonous maize. We cloned four cDNAs from tobacco that encode the mitochondrial Rieske iron-sulfur protein. These clones, along with a previously isolated cDNA, represent five independent members of the gene family that can be divided into three subfamilies. All of these genes were derived from the two progenitor species and were expressed in amphidiploid tobacco. The proteins encoded by these five genes are probably functional because they all contain the universally conserved hexyl peptides necessary for the 2Fe-2S cluster formation. The expression of the Rieske protein gene family is differentially regulated; a 6- to 11-fold higher level of steady state transcripts was found in flowers than in leaves, stems, and roots. Members of at least two subfamilies were preferentially expressed in flowers, indicating that they share a common cis-regulatory element(s), which can respond to a flower-specific signal(s). Although approximately 10 times more transcripts occurred in flowers than in leaves, flower and leaf mitochondria contained a similar amount of the Rieske protein. Flowers, however, contained seven times more Rieske proteins than leaves. These results indicated an increase in mitochondrion number in flowers. High-energy demands during anther development might bring about an increase in mitochondrion numbers in flowers and the flower-enhanced expression of the Rieske protein gene family. Our results suggested that nuclear genes encoding mitochondrial respiratory proteins could sense and respond to changes in energy metabolism and/or changes in mitochondrion numbers. PMID:8180500

  8. Increased expression of humanin peptide in diffuse-type pigmented villonodular synovitis: implication of its mitochondrial abnormality

    PubMed Central

    Ijiri, K; Tsuruga, H; Sakakima, H; Tomita, K; Taniguchi, N; Shimoonoda, K; Komiya, S; Goldring, M; Majima, H; Matsuyama, T

    2005-01-01

    Objectives: To define the pathogenesis of pigmented villonodular synovitis (PVNS), by searching for highly expressed genes in primary synovial cells from patients with PVNS. Methods: A combination of subtraction cloning and Southern colony hybridisation was used to detect highly expressed genes in PVNS in comparison with rheumatoid synovial cells. Northern hybridisation was performed to confirm the differential expression of the humanin gene in PVNS. Expression of the humanin peptide was analysed by western blotting and immunohistochemistry. Electron microscopic immunohistochemistry was performed to investigate the distribution of this peptide within the cell. Results: 68 highly expressed genes were identified in PVNS. Humanin genes were strongly expressed in diffuse-type PVNS, but were barely detected in nodular-type PVNS, rheumatoid arthritis, or osteoarthritis. Humanin peptide was identified in synovium from diffuse-type PVNS, and most of the positive cells were distributed in the deep layer of the synovial tissue. Double staining with anti-humanin and anti-heat shock protein 60 showed that humanin was expressed mainly in mitochondria. Electron microscopy disclosed immunolocalisation of this peptide, predominantly around dense iron deposits within the siderosome. Conclusions: Increased expression of the humanin peptide in mitochondria and siderosomes is characteristic of synovial cells from diffuse-type PVNS. Humanin is an anti-apoptotic peptide which is encoded in the mitochondrial genome. Present findings suggest that mitochondrial dysfunction may be the principal factor in pathogenesis of diffuse-type PVNS and that humanin peptide may play a part in the neoplastic process in this form of PVNS. PMID:15567815

  9. Abnormal Mitochondrial Function and Impaired Granulosa Cell Differentiation in Androgen Receptor Knockout Mice

    PubMed Central

    Wang, Ruey-Sheng; Chang, Heng-Yu; Kao, Shu-Huei; Kao, Cheng-Heng; Wu, Yi-Chen; Yeh, Shuyuan; Tzeng, Chii-Reuy; Chang, Chawnshang

    2015-01-01

    In the ovary, the paracrine interactions between the oocyte and surrounded granulosa cells are critical for optimal oocyte quality and embryonic development. Mice lacking the androgen receptor (AR−/−) were noted to have reduced fertility with abnormal ovarian function that might involve the promotion of preantral follicle growth and prevention of follicular atresia. However, the detailed mechanism of how AR in granulosa cells exerts its effects on oocyte quality is poorly understood. Comparing in vitro maturation rate of oocytes, we found oocytes collected from AR−/− mice have a significantly poor maturating rate with 60% reached metaphase II and 30% remained in germinal vesicle breakdown stage, whereas 95% of wild-type AR (AR+/+) oocytes had reached metaphase II. Interestingly, we found these AR−/− female mice also had an increased frequency of morphological alterations in the mitochondria of granulosa cells with reduced ATP generation (0.18 ± 0.02 vs. 0.29 ± 0.02 µM/mg protein; p < 0.05) and aberrant mitochondrial biogenesis. Mechanism dissection found loss of AR led to a significant decrease in the expression of peroxisome proliferator-activated receptor γ (PPARγ) co-activator 1-β (PGC1-β) and its sequential downstream genes, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM), in controlling mitochondrial biogenesis. These results indicate that AR may contribute to maintain oocyte quality and fertility via controlling the signals of PGC1-β-mediated mitochondrial biogenesis in granulosa cells. PMID:25941928

  10. Cilostazol promotes mitochondrial biogenesis in human umbilical vein endothelial cells through activating the expression of PGC-1α

    SciTech Connect

    Zuo, Luning; Li, Qiang; Sun, Bei; Xu, Zhiying; Ge, Zhiming

    2013-03-29

    Highlights: ► First time to show that cilostazol promotes the expressions of PGC-1α. ► First time to show that cilostazol stimulates mitochondrial biogenesis in HUVECs. ► PKA/CREB pathway mediates the effect of cilostazol on PGC-1α expression. ► Suggesting the roles of cilostazol in mitochondrial dysfunction related disease. -- Abstract: Mitochondrial dysfunction is frequently observed in vascular diseases. Cilostazol is a drug approved by the US Food and Drug Administration for the treatment of intermittent claudication. Cilostazol increases intracellular cyclic adenosine monophosphate (cAMP) levels through inhibition of type III phosphodiesterase. The effects of cilostazol in mitochondrial biogenesis in human umbilical vein endothelial cells (HUVECs) were investigated in this study. Cilostazol treated HUVECs displayed increased levels of ATP, mitochondrial DNA/nuclear DNA ratio, expressions of cytochrome B, and mitochondrial mass, suggesting an enhanced mitochondrial biogenesis induced by cilostazol. The promoted mitochondrial biogenesis could be abolished by Protein kinase A (PKA) specific inhibitor H-89, implying that PKA pathway played a critical role in increased mitochondrial biogenesis after cilostazol treatment. Indeed, expression levels of peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α), NRF 1 and mitochondrial transcription factor A (TFAM) were significantly increased in HUVECs after incubation with cilostazol at both mRNA levels and protein levels. Importantly, knockdown of PGC-1α could abolish cilostazol-induced mitochondrial biogenesis. Enhanced expression of p-CREB and PGC-1α induced by cilostazol could be inhibited by H-89. Moreover, the increased expression of PGC-1α induced by cilostazol could be inhibited by downregulation of CREB using CREB siRNA at both mRNA and protein levels. All the results indicated that cilostazol promoted mitochondrial biogenesis through activating the expression of PGC-1α in

  11. Importance of mitochondrial dysfunction in oxidative stress response: A comparative study of gene expression profiles.

    PubMed

    Shibanuma, Motoko; Inoue, Anna; Ushida, Kyota; Uchida, Tetsu; Ishikawa, Fumihiro; Mori, Kazunori; Nose, Kiyoshi

    2011-06-01

    Mitochondria are considered to play an important role in oxidative stress response since they are a source of reactive oxygen species and are also targeted by these species. This study examined the mitochondrial conditions in cells of epithelial origin that were exposed to H(2)O(2) and found a decline in the membrane potential along with a specific loss of UQCRC1, a sub-unit of complex III, suggesting that mitochondrial dysfunction occurs upon exposure to oxidative stress. This observation led to the hypothesis that certain cellular responses to oxidative stress occurred because of mitochondrial dysfunction. When mitochondria-less (pseudo ρ0) cells were examined as a model of mitochondrial dysfunction, striking similarities were found in their cellular responses compared with those found in cells exposed to oxidative stress, including changes in gene expression and gelatinolytic enzyme activities, thus suggesting that cellular responses to oxidative stress were partly mediated by mitochondrial dysfunction. This possibility was further validated by microarray analysis, which suggested that almost one-fourth of the cellular responses to oxidative stress were mediated by mitochondrial dysfunction that accompanies oxidative stress, thereby warranting a therapeutic strategy that targets mitochondria for the treatment of oxidative stress-associated diseases.

  12. Relationship between mitochondrial DNA Copy Number and SIRT1 Expression in Porcine Oocytes

    PubMed Central

    Sato, Daichi; Itami, Nobuhiko; Tasaki, Hidetaka; Takeo, Shun; Kuwayama, Takehito; Iwata, Hisataka

    2014-01-01

    The present study assessed the effect of resveratrol on the expression of SIRT1 and mitochondrial quality and quantity in porcine oocytes. Supplementing the maturation medium with 20 µM resveratrol increased the expression of SIRT1, and enhanced mitochondrial functions, as observed from the increased ATP content and mitochondrial membrane potential. Addition of resveratrol also improved the ability of oocytes to develop into the blastocyst stage following activation. The effects of resveratrol on mitochondrial number were examined by comparing the mitochondrial DNA copy number (Mt number) between group of oocytes collected from the same donor gilt ovaries. Supplementing the maturation medium with only resveratrol did not affect the Mt number in the oocytes. However, supplementing the maturation medium with 10 µM MG132, a proteasome inhibitor, significantly increased the amount of ubiquitinated proteins and Mt number by 12 and 14%, respectively. In addition, when resveratrol was added to the medium containing MG132, the Mt number increased significantly by 39%, this effect was diminished by the addition of the SIRT1 inhibitor EX527. Furthermore, supplementing the medium with MG132 and EX527 did not affect Mt number. The mean SIRT1 expression in 20 oocytes was significantly and positively correlated with the Mt number in oocytes collected from the same donor. This study suggests that the expression of SIRT1 is associated with the Mt number in oocytes. In addition, activation of SIRT1 by resveratrol enhances the biosynthesis and degradation of mitochondria in oocytes, thereby replenishing and improving mitochondrial function and the developmental ability of oocytes. PMID:24747689

  13. Axin is expressed in mitochondria and suppresses mitochondrial ATP synthesis in HeLa cells.

    PubMed

    Shin, Jee-Hye; Kim, Hyun-Wook; Rhyu, Im Joo; Kee, Sun-Ho

    2016-01-01

    Many recent studies have revealed that axin is involved in numerous cellular functions beyond the negative regulation of β-catenin-dependent Wnt signaling. Previously, an association of ectopic axin with mitochondria was observed. In an effort to investigate the relationship between axin and mitochondria, we found that axin expression suppressed cellular ATP production, which was more apparent as axin expression levels increased. Also, mitochondrial expression of axin was observed using two axin-expressing HeLa cell models: doxycycline-inducible ectopic axin expression (HeLa-axin) and axin expression enhanced by long-term treatment with XAV939 (HeLa-XAV). In biochemical analysis, axin is associated with oxidative phosphorylation (OXPHOS) complex IV and is involved in defects in the assembly of complex IV-containing supercomplexes. Functionally, axin expression reduced the activity of OXPHOS complex IV and the oxygen consumption rate (OCR), suggesting axin-mediated mitochondrial dysfunction. Subsequent studies using various inhibitors of Wnt signaling showed that the reduction in cellular ATP levels was weaker in cases of ICAT protein expression and treatment with iCRT3 or NSC668036 compared with XAV939 treatment, suggesting that XAV939 treatment affects ATP synthesis in addition to suppressing Wnt signaling activity. Axin-mediated regulation of mitochondrial function may be an additional mechanism to Wnt signaling for regulation of cell growth.

  14. Guava fruit extract and its triterpene constituents have osteoanabolic effect: Stimulation of osteoblast differentiation by activation of mitochondrial respiration via the Wnt/β-catenin signaling.

    PubMed

    Porwal, Konica; Pal, Subhashis; Dev, Kapil; China, Shyamsundar Pal; Kumar, Yogesh; Singh, Chandan; Barbhuyan, Tarun; Sinha, Neeraj; Sanyal, Sabyasachi; Trivedi, Arun Kumar; Maurya, Rakesh; Chattopadhyay, Naibedya

    2017-03-08

    The aim of this study was to evaluate the skeletal effect of guava triterpene-enriched extract (GE) in rats and identify osteogenic compounds thereof, and determine their modes of action. In growing female rats, GE at 250 mg/kg dose increased parameters of peak bone mass including femur length, bone mineral density (BMD) and biomechanical strength, suggesting that GE promoted modeling-directed bone growth. GE also stimulated bone regeneration at the site of bone injury. In adult osteopenic rats (osteopenia induced by ovariectomy, OVX) GE completely restored the lost bones at both axial and appendicular sites, suggesting a strong osteoanabolic effect. Serum metabolomics studies showed changes in several metabolites (some of which are related to bone metabolism) in OVX compared with ovary-intact control and GE treatment to OVX rats reversed those. Out of six abundantly present triterpenes in GE, ursolic acid (UA) and 2α-hydroxy ursolic acid (2α-UA) induced osteogenic differentiation in vitro as did GE by activating Wnt/β-catenin pathway assessed by phosphorylation of GSK-3β. Over-expressing of constitutively active GSK-3β (caGSK-3β) in osteoblasts abolished the differentiation-promoting effect of GE, UA and 2α-UA. All three increased both glycolysis and mitochondrial respiration but only rotenone (inhibitor of mitochondrial electron transfer) and not 2-deoxyglucose (to block glycolysis) inhibited osteoblast differentiation. In addition, caGSK-3β over-expression attenuated the enhanced mitochondrial respiration caused by GE, UA and 2α-UA. We conclude that GE has osteoanabolic effect which is contributed by UA and 2α-UA, and involve activation of canonical Wnt signaling which in turn modulates cellular energy metabolism leading to osteoblast differentiation.

  15. Screening differentially expressed genes in an amphipod (Hyalella azteca) exposed to fungicide vinclozolin by suppression subtractive hybridization.

    PubMed

    Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H

    2014-01-01

    Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.

  16. Pancreatic β-Cell Dysfunction in Diet-Induced Obese Mice: Roles of AMP-Kinase, Protein Kinase Cε, Mitochondrial and Cholesterol Metabolism, and Alterations in Gene Expression.

    PubMed

    Pepin, Émilie; Al-Mass, Anfal; Attané, Camille; Zhang, Kezhuo; Lamontagne, Julien; Lussier, Roxane; Madiraju, S R Murthy; Joly, Erik; Ruderman, Neil B; Sladek, Robert; Prentki, Marc; Peyot, Marie-Line

    2016-01-01

    Diet induced obese (DIO) mice can be stratified according to their weight gain in response to high fat diet as low responders (LDR) and high responders (HDR). This allows the study of β-cell failure and the transitions to prediabetes (LDR) and early diabetes (HDR). C57BL/6N mice were fed for 8 weeks with a normal chow diet (ND) or a high fat diet and stratified as LDR and HDR. Freshly isolated islets from ND, LDR and HDR mice were studied ex-vivo for mitochondrial metabolism, AMPK activity and signalling, the expression and activity of key enzymes of energy metabolism, cholesterol synthesis, and mRNA profiling. Severely compromised glucose-induced insulin secretion in HDR islets, as compared to ND and LDR islets, was associated with suppressed AMP-kinase activity. HDR islets also showed reduced acetyl-CoA carboxylase activity and enhanced activity of 3-hydroxy-3-methylglutaryl-CoA reductase, which led respectively to elevated fatty acid oxidation and increased cholesterol biosynthesis. HDR islets also displayed mitochondrial membrane hyperpolarization and reduced ATP turnover in the presence of elevated glucose. Expression of protein kinase Cε, which reduces both lipolysis and production of signals for insulin secretion, was elevated in DIO islets. Genes whose expression increased or decreased by more than 1.2-fold were minor between LDR and ND islets (17 differentially expressed), but were prominent between HDR and ND islets (1508 differentially expressed). In HDR islets, particularly affected genes were related to cell cycle and proliferation, AMPK signaling, mitochondrial metabolism and cholesterol metabolism. In conclusion, chronically reduced AMPK activity, mitochondrial dysfunction, elevated cholesterol biosynthesis in islets, and substantial alterations in gene expression accompany β-cell failure in HDR islets. The β-cell compensation process in the prediabetic state (LDR) is largely independent of transcriptional adaptive changes, whereas the transition

  17. Pancreatic β-Cell Dysfunction in Diet-Induced Obese Mice: Roles of AMP-Kinase, Protein Kinase Cε, Mitochondrial and Cholesterol Metabolism, and Alterations in Gene Expression

    PubMed Central

    Pepin, Émilie; Al-Mass, Anfal; Attané, Camille; Zhang, Kezhuo; Lamontagne, Julien; Lussier, Roxane; Madiraju, S. R. Murthy; Joly, Erik; Ruderman, Neil B.; Sladek, Robert; Prentki, Marc; Peyot, Marie-Line

    2016-01-01

    Diet induced obese (DIO) mice can be stratified according to their weight gain in response to high fat diet as low responders (LDR) and high responders (HDR). This allows the study of β-cell failure and the transitions to prediabetes (LDR) and early diabetes (HDR). C57BL/6N mice were fed for 8 weeks with a normal chow diet (ND) or a high fat diet and stratified as LDR and HDR. Freshly isolated islets from ND, LDR and HDR mice were studied ex-vivo for mitochondrial metabolism, AMPK activity and signalling, the expression and activity of key enzymes of energy metabolism, cholesterol synthesis, and mRNA profiling. Severely compromised glucose-induced insulin secretion in HDR islets, as compared to ND and LDR islets, was associated with suppressed AMP-kinase activity. HDR islets also showed reduced acetyl-CoA carboxylase activity and enhanced activity of 3-hydroxy-3-methylglutaryl-CoA reductase, which led respectively to elevated fatty acid oxidation and increased cholesterol biosynthesis. HDR islets also displayed mitochondrial membrane hyperpolarization and reduced ATP turnover in the presence of elevated glucose. Expression of protein kinase Cε, which reduces both lipolysis and production of signals for insulin secretion, was elevated in DIO islets. Genes whose expression increased or decreased by more than 1.2-fold were minor between LDR and ND islets (17 differentially expressed), but were prominent between HDR and ND islets (1508 differentially expressed). In HDR islets, particularly affected genes were related to cell cycle and proliferation, AMPK signaling, mitochondrial metabolism and cholesterol metabolism. In conclusion, chronically reduced AMPK activity, mitochondrial dysfunction, elevated cholesterol biosynthesis in islets, and substantial alterations in gene expression accompany β-cell failure in HDR islets. The β-cell compensation process in the prediabetic state (LDR) is largely independent of transcriptional adaptive changes, whereas the transition

  18. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae).

    PubMed

    Sokolova, Inna M; Sokolov, Eugene P; Ponnappa, Kavita M

    2005-07-01

    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 microg L-1 (Cd-exposed) Cd2+ on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4+respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  19. Dietary isoflavone daidzein promotes Tfam expression that increases mitochondrial biogenesis in C2C12 muscle cells.

    PubMed

    Yoshino, Makiko; Naka, Ayano; Sakamoto, Yuri; Shibasaki, Ayako; Toh, Mariko; Tsukamoto, Sakuka; Kondo, Kazuo; Iida, Kaoruko

    2015-11-01

    Mitochondrial dysfunction in muscles leads to a wide range of metabolic and age-related disorders. Recently, it has been reported that a natural polyphenol, resveratrol, affects mitochondrial biogenesis. This study aimed to identify other natural polyphenolic compounds that regulate mitochondrial biogenesis in muscles. For this purpose, we used the C2C12 murine muscle cell line. Screening involved a reporter assay based on the promoter of mitochondrial transcription factor A (Tfam). We found that several polyphenols exhibited the ability to increase Tfam promoter activity and that the soy isoflavone daidzein was a most potent candidate that regulated mitochondrial biogenesis. When C2C12 myotubes were treated with 25-50 μM daidzein for 24h, there were significant increases in the expression of Tfam and mitochondrial genes such as COX1 and Cytb as well as the mitochondrial content. Using several mutant Tfam promoter fragments, we found that the transcription factor, nuclear respiratory factor (NRF) and its coactivator, PGC1α, were necessary for the effect of daidzein on Tfam expression. Finally, silencing of sirtuin-1 (SIRT1) by shRNA resulted in inhibition of the daidzein effects on mitochondrial gene expression. In conclusion, daidzein regulates mitochondrial biogenesis in muscle cells by regulating transcriptional networks through a SIRT1-associated pathway. These results suggest that daidzein would be beneficial to protect against a wide range of diseases caused by muscle mitochondrial dysfunction. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Differential proteomic profiling unveils new molecular mechanisms associated with mitochondrial complex III deficiency

    PubMed Central

    Morán, María; López-Bernardo, Elia; Cadenas, Susana; Hidalgo, Beatriz; Sánchez, Ricardo; Seneca, Sara; Arenas, Joaquín; Martín, Miguel A.; Ugalde, Cristina

    2014-01-01

    We have analyzed the cellular pathways and metabolic adaptations that take place in primary skin fibroblasts from patients with mutations in BCS1L, a major genetic cause of mitochondrial complex III enzyme deficiency. Mutant fibroblasts exhibited low oxygen consumption rates and intracellular ATP levels, indicating that the main altered molecular event probably is a limited respiration-coupled ATP production through the OXPHOS system. Two-dimensional DIGE and MALDI-TOF/TOF mass spectrometry analyses unambiguously identified 39 proteins whose expression was significantly altered in complex III-deficient fibroblasts. Extensive statistical and cluster analyses revealed a protein profile characteristic for the BCS1L mutant fibroblasts that included alterations in energy metabolism, cell signaling and gene expression regulation, cytoskeleton formation and maintenance, and intracellular stress responses. The physiological validation of the predicted functional adaptations of human cultured fibroblasts to complex III deficiency confirmed the up-regulation of glycolytic enzyme activities and the accumulation of branched-chain among other amino acids, suggesting the activation of anaerobic glycolysis and cellular catabolic states, in particular protein catabolism, together with autophagy as adaptive responses to mitochondrial respiratory chain dysfunction and ATP deficiency. Our data point to an overall metabolic and genetic reprogramming that could contribute to explain the clinical manifestations of complex III deficiency in patients. PMID:25239759

  1. Mitochondrial GPX1 silencing triggers differential photosynthesis impairment in response to salinity in rice plants.

    PubMed

    Lima-Melo, Yugo; Carvalho, Fabricio E L; Martins, Márcio O; Passaia, Gisele; Sousa, Rachel H V; Neto, Milton C Lima; Margis-Pinheiro, Márcia; Silveira, Joaquim A G

    2016-08-01

    The physiological role of plant mitochondrial glutathione peroxidases is scarcely known. This study attempted to elucidate the role of a rice mitochondrial isoform (GPX1) in photosynthesis under normal growth and salinity conditions. GPX1 knockdown rice lines (GPX1s) were tested in absence and presence of 100 mM NaCl for 6 d. Growth reduction of GPX1s line under non-stressful conditions, compared with non-transformed (NT) plants occurred in parallel to increased H2 O2 and decreased GSH contents. These changes occurred concurrently with photosynthesis impairment, particularly in Calvin cycle's reactions, since photochemical efficiency did not change. Thus, GPX1 silencing and downstream molecular/metabolic changes modulated photosynthesis differentially. In contrast, salinity induced reduction in both phases of photosynthesis, which were more impaired in silenced plants. These changes were associated with root morphology alterations but not shoot growth. Both studied lines displayed increased GPX activity but H2 O2 content did not change in response to salinity. Transformed plants exhibited lower photorespiration, water use efficiency and root growth, indicating that GPX1 could be important to salt tolerance. Growth reduction of GPX1s line might be related to photosynthesis impairment, which in turn could have involved a cross talk mechanism between mitochondria and chloroplast originated from redox changes due to GPX1 deficiency.

  2. Stress and corticosteroids regulate rat hippocampal mitochondrial DNA gene expression via the glucocorticoid receptor

    PubMed Central

    Hunter, Richard G.; Seligsohn, Ma’ayan; Rubin, Todd G.; Griffiths, Brian B.; Ozdemir, Yildirim; Pfaff, Donald W.; Datson, Nicole A.; McEwen, Bruce S.

    2016-01-01

    Glucocorticoids (GCs) are involved in stress and circadian regulation, and produce many actions via the GC receptor (GR), which is classically understood to function as a nuclear transcription factor. However, the nuclear genome is not the only genome in eukaryotic cells. The mitochondria also contain a small circular genome, the mitochondrial DNA (mtDNA), that encodes 13 polypeptides. Recent work has established that, in the brain and other systems, the GR is translocated from the cytosol to the mitochondria and that stress and corticosteroids have a direct influence on mtDNA transcription and mitochondrial physiology. To determine if stress affects mitochondrially transcribed mRNA (mtRNA) expression, we exposed adult male rats to both acute and chronic immobilization stress and examined mtRNA expression using quantitative RT-PCR. We found that acute stress had a main effect on mtRNA expression and that expression of NADH dehydrogenase 1, 3, and 6 (ND-1, ND-3, ND-6) and ATP synthase 6 (ATP-6) genes was significantly down-regulated. Chronic stress induced a significant up-regulation of ND-6 expression. Adrenalectomy abolished acute stress-induced mtRNA regulation, demonstrating GC dependence. ChIP sequencing of GR showed that corticosterone treatment induced a dose-dependent association of the GR with the control region of the mitochondrial genome. These findings demonstrate GR and stress-dependent transcriptional regulation of the mitochondrial genome in vivo and are consistent with previous work linking stress and GCs with changes in the function of brain mitochondria. PMID:27457949

  3. Increased mitochondrial ROS formation by acetaminophen in human hepatic cells is associated with gene expression changes suggesting disruption of the mitochondrial electron transport chain.

    PubMed

    Jiang, Jian; Briedé, Jacob J; Jennen, Danyel G J; Van Summeren, Anke; Saritas-Brauers, Karen; Schaart, Gert; Kleinjans, Jos C S; de Kok, Theo M C M

    2015-04-16

    Acetaminophen (APAP) overdosage results in hepatotoxicity, but the underlying molecular mechanisms are still not completely understood. In the current study, we focused on mitochondrial-specific oxidative liver injury induced by APAP exposure. Owning to genetic polymorphisms in the CYP2E1 gene or varying inducibility by xenobiotics, the CYP2E1 mRNA level and protein activity vary extensively among individuals. As CYP2E1 is a known ROS generating enzyme, we chose HepG2 to minimize CYP2E1-induced ROS formation, which will help us better understand the APAP induced mitochondrial-specific hepatotoxicity in a subpopulation with low CYP2E1 activity. HepG2 cells were exposed to a low and toxic dose (0.5 and 10mM) of APAP and analyzed at four time points for genome-wide gene expression. Mitochondria were isolated and electron spin resonance spectroscopy was performed to measure the formation of mitochondrial ROS. The yield of ATP was measured to confirm the impact of the toxic dose of APAP on cellular energy production. Our results indicate that 10mM APAP significantly influences the expression of mitochondrial protein-encoding genes in association with an increase in mitochondrial ROS formation. Additionally, 10mM APAP affects the expression of genes encoding the subunits of electron transport chain (ETC) complexes, which may alter normal mitochondrial functions by disrupting the assembly, stability, and structural integrity of ETC complexes, leading to a measurable depletion of ATP, and cell death. The expression of mitochondrium-specific antioxidant enzyme, SOD2, is reduced which may limit the ROS scavenging ability and cause imbalance of the mitochondrial ROS homeostasis. Overall, transcriptome analysis reveals the molecular processes involved in the observed APAP-induced increase of mitochondrial ROS formation and the associated APAP-induced oxidative stress.

  4. Over-expression of mitochondrial ferritin affects the JAK2/STAT5 pathway in K562 cells and causes mitochondrial iron accumulation

    PubMed Central

    Santambrogio, Paolo; Erba, Benedetta Gaia; Campanella, Alessandro; Cozzi, Anna; Causarano, Vincenza; Cremonesi, Laura; Gallì, Anna; Della Porta, Matteo Giovanni; Invernizzi, Rosangela; Levi, Sonia

    2011-01-01

    Background Mitochondrial ferritin is a nuclear encoded iron-storage protein localized in mitochondria. It has anti-oxidant properties related to its ferroxidase activity, and it is able to sequester iron avidly into the organelle. The protein has a tissue-specific pattern of expression and is also highly expressed in sideroblasts of patients affected by hereditary sideroblastic anemia and by refractory anemia with ringed sideroblasts. The present study examined whether mitochondrial ferritin has a role in the pathogenesis of these diseases. Design and Methods We analyzed the effect of mitochondrial ferritin over-expression on the JAK2/STAT5 pathway, on iron metabolism and on heme synthesis in erythroleukemic cell lines. Furthermore its effect on apoptosis was evaluated on human erythroid progenitors. Results Data revealed that a high level of mitochondrial ferritin reduced reactive oxygen species and Stat5 phosphorylation while promoting mitochondrial iron loading and cytosolic iron starvation. The decline of Stat5 phosphorylation induced a decrease of the level of anti-apoptotic Bcl-xL transcript compared to that in control cells; however, transferrin receptor 1 transcript increased due to the activation of the iron responsive element/iron regulatory protein machinery. Also, high expression of mitochondrial ferritin increased apoptosis, limited heme synthesis and promoted the formation of Perls-positive granules, identified by electron microscopy as iron granules in mitochondria. Conclusions Our results provide evidence suggesting that Stat5-dependent transcriptional regulation is displaced by strong cytosolic iron starvation status induced by mitochondrial ferritin. The protein interferes with JAK2/STAT5 pathways and with the mechanism of mitochondrial iron accumulation. PMID:21712541

  5. Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity

    PubMed Central

    Lindinger, Peter W.; Christe, Martine; Eberle, Alex N.; Kern, Beatrice; Peterli, Ralph; Peters, Thomas; Jayawardene, Kamburapola J.I.; Fearnley, Ian M.; Walker, John E.

    2015-01-01

    Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender. PMID:26217759

  6. Photoperiod-sensitive cytoplasmic male sterility in wheat: nuclear-mitochondrial incompatibility results in differential processing of the mitochondrial orf25 gene.

    PubMed

    Ogihara, Y; Kurihara, Y; Futami, K; Tsuji, K; Murai, K

    1999-12-01

    An alloplasmic wheat line with the cytoplasm of Aegilops crassa expresses photoperiod-sensitive cytoplasmic male sterility (PCMS). Southern- and Northern-hybridization analyses showed that this line contains alterations in both the gene structure and transcription patterns of the mitochondrial gene orf25. In this study, the nucleotide sequence around the orf25 gene of Ae. crassa (CR-orf25) and common wheat (AE-orf25) was determined, and we found that the upstream region of CR-orf25 had been replaced by that of rps7 of common wheat (AE-rps7) through recombination. A novel open reading frame (orf48) is present upstream of CR-orf25. In these three genes, transcription was initiated from the consensus promoter motif of plant mitochondrial genes located in the upstream regions. Processing enzymes in Ae. crassa and common wheat cleave the respective precursor mRNAs, namely CR-orf25 and AE-rps7, at sites similar to that of the premature mitochondrial 26S rRNA. In contrast, the precursor mRNA is not effectively processed at the target sequence of CR-orf25 in the alloplasmic wheat line. Because major transcripts of the euplasmic CR-orf25 and AE-rps7 genes would result in a truncated orf48 product, one possibility is that the orf48 protein might disturb mitochondrial function at a specific stage and hence affect the expression of the PCMS trait.

  7. Differential diagnosis of Mendelian and mitochondrial disorders in patients with suspected multiple sclerosis.

    PubMed

    Weisfeld-Adams, James D; Katz Sand, Ilana B; Honce, Justin M; Lublin, Fred D

    2015-03-01

    Several single gene disorders share clinical and radiologic characteristics with multiple sclerosis and have the potential to be overlooked in the differential diagnostic evaluation of both adult and paediatric patients with multiple sclerosis. This group includes lysosomal storage disorders, various mitochondrial diseases, other neurometabolic disorders, and several other miscellaneous disorders. Recognition of a single-gene disorder as causal for a patient's 'multiple sclerosis-like' phenotype is critically important for accurate direction of patient management, and evokes broader genetic counselling implications for affected families. Here we review single gene disorders that have the potential to mimic multiple sclerosis, provide an overview of clinical and investigational characteristics of each disorder, and present guidelines for when clinicians should suspect an underlying heritable disorder that requires diagnostic confirmation in a patient with a definite or probable diagnosis of multiple sclerosis.

  8. Differential diagnosis of Mendelian and mitochondrial disorders in patients with suspected multiple sclerosis

    PubMed Central

    Katz Sand, Ilana B.; Honce, Justin M.; Lublin, Fred D.

    2015-01-01

    Several single gene disorders share clinical and radiologic characteristics with multiple sclerosis and have the potential to be overlooked in the differential diagnostic evaluation of both adult and paediatric patients with multiple sclerosis. This group includes lysosomal storage disorders, various mitochondrial diseases, other neurometabolic disorders, and several other miscellaneous disorders. Recognition of a single-gene disorder as causal for a patient’s ‘multiple sclerosis-like’ phenotype is critically important for accurate direction of patient management, and evokes broader genetic counselling implications for affected families. Here we review single gene disorders that have the potential to mimic multiple sclerosis, provide an overview of clinical and investigational characteristics of each disorder, and present guidelines for when clinicians should suspect an underlying heritable disorder that requires diagnostic confirmation in a patient with a definite or probable diagnosis of multiple sclerosis. PMID:25636970

  9. Mitochondrial differentiation in a polymorphic land snail: evidence for Pleistocene survival within the boundaries of permafrost.

    PubMed

    Haase, M; Misof, B; Wirth, T; Baminger, H; Baur, B

    2003-05-01

    The genetic differentiation of populations having colonized formerly unsuitable habitats after the Pleistocene glaciations depends to a great extent on the speed of expansion. Slow dispersers maintain their refugial diversity whereas fast dispersal leads to a reduction of diversity in the newly colonized areas. During the Pleistocene, almost the entire current range of the land snail Arianta arbustorum has repeatedly been covered with ice or been subjected to permafrost. Owing to the low potential for dispersal of land snails, slow (re)colonization of the wide range from southern refugia can be excluded. Alternatively, fast, passive dispersal from southern refugia or survival in and expansion from multiple refugia within the area subjected to permafrost may account for the current distribution. To distinguish between these scenarios we reconstructed a phylogeography based on the sequences of a fragment of the cytochrome oxidase I from 133 individuals collected at 45 localities and analysed the molecular variance. Seventy-five haplotypes were found that diverged on average at 7.52% of positions. This high degree of diversity suggests that A. arbustorum is an old species in which the population structure, isolation and the hermaphroditic nature have reduced the probability of lineage extinction. The genetic structure was highly significant with the highest variance partition found among regions. Geographic distance and mitochondrial differentiation were not congruent. Lineages had overlapping ranges. The clear genetic differentiation and the patchy pattern of haplotype distribution suggest that colonization of formerly unsuitable habitats was mainly achieved from multiple populations from within the permafrost area.

  10. Multi-focal control of mitochondrial gene expression by oncogenic MYC provides potential therapeutic targets in cancer

    PubMed Central

    Oran, Amanda R.; Adams, Clare M.; Zhang, Xiao-yong; Gennaro, Victoria J.; Pfeiffer, Harla K.; Mellert, Hestia S.; Seidel, Hans E.; Mascioli, Kirsten; Kaplan, Jordan; Gaballa, Mahmoud R.; Shen, Chen; Rigoutsos, Isidore; King, Michael P.; Cotney, Justin L.; Arnold, Jamie J.; Sharma, Suresh D.; Martinez, Ubaldo E.; Vakoc, Christopher R.; Chodosh, Lewis A.; Thompson, James E.; Bradner, James E.; Cameron, Craig E.; Shadel, Gerald S.; Eischen, Christine M.; McMahon, Steven B.

    2016-01-01

    Despite ubiquitous activation in human cancer, essential downstream effector pathways of the MYC transcription factor have been difficult to define and target. Using a structure/function-based approach, we identified the mitochondrial RNA polymerase (POLRMT) locus as a critical downstream target of MYC. The multifunctional POLRMT enzyme controls mitochondrial gene expression, a process required both for mitochondrial function and mitochondrial biogenesis. We further demonstrate that inhibition of this newly defined MYC effector pathway causes robust and selective tumor cell apoptosis, via an acute, checkpoint-like mechanism linked to aberrant electron transport chain complex assembly and mitochondrial reactive oxygen species (ROS) production. Fortuitously, MYC-dependent tumor cell death can be induced by inhibiting the mitochondrial gene expression pathway using a variety of strategies, including treatment with FDA-approved antibiotics. In vivo studies using a mouse model of Burkitt's Lymphoma provide pre-clinical evidence that these antibiotics can successfully block progression of MYC-dependent tumors. PMID:27590350

  11. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  12. SCaMC-1Like a Member of the Mitochondrial Carrier (MC) Family Preferentially Expressed in Testis and Localized in Mitochondria and Chromatoid Body

    PubMed Central

    Amigo, Ignacio; Traba, Javier; Satrústegui, Jorgina; del Arco, Araceli

    2012-01-01

    Mitochondrial carriers (MC) form a highly conserved family involved in solute transport across the inner mitochondrial membrane in eukaryotes. In mammals, ATP-Mg/Pi carriers, SCaMCs, form the most complex subgroup with four paralogs, SCaMC-1, -2, -3 and -3L, and several splicing variants. Here, we report the tissue distribution and subcellular localization of a mammalian-specific SCaMC paralog, 4930443G12Rik/SCaMC-1Like (SCaMC-1L), which displays unanticipated new features. SCaMC-1L proteins show higher amino acid substitution rates than its closest paralog SCaMC-1. In mouse, SCaMC-1L expression is restricted to male germ cells and regulated during spermatogenesis but unexpectedly its localization is not limited to mitochondrial structures. In mature spermatids SCaMC-1L is detected in the mitochondrial sheath but in previous differentiation stages appears associated to cytosolic granules which colocalize with specific markers of the chromatoid body (CB) in post-meiotic round spermatids and inter-mitochondrial cement (IMC) in spermatocytes. The origin of this atypical distribution was further investigated by transient expression in cell lines. Similarly to male germ cells, in addition to mitochondrial and cytosolic distribution, a fraction of SCaMC-1L-expressing COS-7 cells display cytosolic SCaMC-1L-aggregates which exhibit aggresomal-like features as the CB. Our results indicate that different regions of SCaMC-1L hinder its import into mitochondria and this apparently favours the formation of cytosolic aggregates in COS-7 cells. This mechanism could be also operational in male germ cells and explain the incorporation of SCaMC-1L into germinal granules. PMID:22792342

  13. Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration.

    PubMed

    Hakkaart, Gerrit A J; Dassa, Emmanuel P; Jacobs, Howard T; Rustin, Pierre

    2006-03-01

    Human mitochondrial respiration is distinct from that of most plants, microorganisms and even some metazoans in that it reduces molecular oxygen only through the highly cyanide-sensitive enzyme cytochrome c oxidase. Here we show that expression of the cyanide-insensitive alternative oxidase (AOX), recently identified in the ascidian Ciona intestinalis, is well tolerated by cultured human cells and confers spectacular cyanide resistance to mitochondrial substrate oxidation. The expressed AOX seems to be confined to mitochondria. AOX involvement in electron flow is triggered by a highly reduced redox status of the respiratory chain (RC) and enhanced by pyruvate; otherwise, the enzyme remains essentially inactive. AOX expression promises to be a valuable tool to limit the deleterious consequences of RC deficiency in human cells and whole animals.

  14. Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration

    PubMed Central

    Hakkaart, Gerrit A J; Dassa, Emmanuel P; Jacobs, Howard T; Rustin, Pierre

    2006-01-01

    Human mitochondrial respiration is distinct from that of most plants, microorganisms and even some metazoans in that it reduces molecular oxygen only through the highly cyanide-sensitive enzyme cytochrome c oxidase. Here we show that expression of the cyanide-insensitive alternative oxidase (AOX), recently identified in the ascidian Ciona intestinalis, is well tolerated by cultured human cells and confers spectacular cyanide resistance to mitochondrial substrate oxidation. The expressed AOX seems to be confined to mitochondria. AOX involvement in electron flow is triggered by a highly reduced redox status of the respiratory chain (RC) and enhanced by pyruvate; otherwise, the enzyme remains essentially inactive. AOX expression promises to be a valuable tool to limit the deleterious consequences of RC deficiency in human cells and whole animals. PMID:16322757

  15. Stable Expression of Functional Mitochondrial Uncoupling Protein in Chinese Hamster Ovary Cells

    NASA Astrophysics Data System (ADS)

    Casteilla, L.; Blondel, O.; Klaus, S.; Raimbault, S.; Diolez, P.; Moreau, F.; Bouillaud, F.; Ricquier, D.

    1990-07-01

    The mitochondrial uncoupling protein (UCP) is a membranous proton carrier exclusively synthesized in brown adipocytes. The cDNA for the rat UCP was placed in an expression vector and transfected into mammalian cells. Its expression was tested in transiently transfected CHO cells. In these cells the UCP was detected in mitochondria by using antibodies. Permanent expression of the UCP was achieved in stable transformed CHO cell lines. In these cells the UCP was characterized in mitochondrial membranes, by using antibodies and hydroxyapatite purification. The protein expressed in CHO cells displayed the functional characteristics of brown adipocyte UCP. It induced the uncoupling of respiration in isolated CHO mitochondria. The membrane potential of transformed mitochondria was also significantly lowered, as a result of the proton translocating activity of the UCP. GDP is known to inhibit the proton pathway in brown fat mitochondria. Addition of GDP to CHO mitochondria containing UCP resulted in a recoupling of respiration and an increase in membrane potential. Thus we conclude that functional UCP is expressed in CHO cells and that the insertion of the UCP alone in any mitochondria is sufficient to induce the uncoupling of respiration. This approach should allow studies on the structure-function relationship of the UCP and of several other related mitochondrial carriers.

  16. Activation of pattern recognition receptors in brown adipocytes induces inflammation and suppresses uncoupling protein 1 expression and mitochondrial respiration.

    PubMed

    Bae, Jiyoung; Ricciardi, Carolyn J; Esposito, Debora; Komarnytsky, Slavko; Hu, Pan; Curry, Benjamin J; Brown, Patricia L; Gao, Zhanguo; Biggerstaff, John P; Chen, Jiangang; Zhao, Ling

    2014-05-15

    Pattern recognition receptors (PRR), Toll-like receptors (TLR), and nucleotide-oligomerization domain-containing proteins (NOD) play critical roles in mediating inflammation and modulating functions in white adipocytes in obesity. However, the role of PRR activation in brown adipocytes, which are recently found to be present in adult humans, has not been studied. Here we report that mRNA of TLR4, TLR2, NOD1, and NOD2 is upregulated, paralleled with upregulated mRNA of inflammatory cytokines and chemokines in the brown adipose tissue (BAT) of the obese mice. During brown adipocyte differentiation, mRNA and protein expression of NOD1 and TLR4, but not TLR2 and NOD2, is also increased. Activation of TLR4, TLR2, or NOD1 in brown adipocytes induces activation of NF-κB and MAPK signaling pathways, leading to inflammatory cytokine/chemokine mRNA expression and/or protein secretion. Moreover, activation of TLR4, TLR2, or NOD1 attenuates both basal and isoproterenol-induced uncoupling protein 1 (UCP-1) expression without affecting mitochondrial biogenesis and lipid accumulation in brown adipocytes. Cellular bioenergetics measurements confirm that attenuation of UCP-1 expression by PRR activation is accompanied by suppression of both basal and isoproterenol-stimulated oxygen consumption rates and isoproterenol-induced uncoupled respiration from proton leak; however, maximal respiration and ATP-coupled respiration are not changed. Further, the attenuation of UCP-1 by PRR activation appears to be mediated through downregulation of the UCP-1 promoter activities. Taken together, our results demonstrate the role of selected PRR activation in inducing inflammation and downregulation of UCP-1 expression and mitochondrial respiration in brown adipocytes. Our results uncover novel targets in BAT for obesity treatment and prevention. Copyright © 2014 the American Physiological Society.

  17. Differential Effect of Endurance Training on Mitochondrial Protein Damage, Degradation, and Acetylation in the Context of Aging

    PubMed Central

    Johnson, Matthew L.; Irving, Brian A.; Lanza, Ian R.; Vendelbo, Mikkel H.; Konopka, Adam R.; Robinson, Matthew M.; Henderson, Gregory C.; Klaus, Katherine A.; Morse, Dawn M.; Heppelmann, Carrie; Bergen, H. Robert; Dasari, Surendra; Schimke, Jill M.; Jakaitis, Daniel R.

    2015-01-01

    Acute aerobic exercise increases reactive oxygen species and could potentially damage proteins, but exercise training (ET) enhances mitochondrial respiration irrespective of age. Here, we report a differential impact of ET on protein quality in young and older participants. Using mass spectrometry we measured oxidative damage to skeletal muscle proteins before and after 8 weeks of ET and find that young but not older participants reduced oxidative damage to both total skeletal muscle and mitochondrial proteins. Young participants showed higher total and mitochondrial derived semitryptic peptides and 26S proteasome activity indicating increased protein degradation. ET however, increased the activity of the endogenous antioxidants in older participants. ET also increased skeletal muscle content of the mitochondrial deacetylase SIRT3 in both groups. A reduction in the acetylation of isocitrate dehydrogenase 2 was observed following ET that may counteract the effect of acute oxidative stress. In conclusion aging is associated with an inability to improve skeletal muscle and mitochondrial protein quality in response to ET by increasing degradation of damaged proteins. ET does however increase muscle and mitochondrial antioxidant capacity in older individuals, which provides increased buffering from the acute oxidative effects of exercise. PMID:25504576

  18. Mitochondrial enzyme expression in the hippocampus in relation to Alzheimer-type pathology.

    PubMed

    Nagy, Z; Esiri, M M; LeGris, M; Matthews, P M

    1999-04-01

    Recent reports have suggested that mitochondrial dysfunction may contribute to the progression of the pathology of Alzheimer's disease (AD). However, both increases and decreases in the activity of cytochrome oxidase have been described in the hippocampi of AD patients. In this study we used immunohistochemistry and quantitative autoradiographic methods to study the expression pattern of two cytochrome oxidase subunit proteins (nuclear-encoded COX IV and mitochondrial-encoded COX I) in the hippocampus in relation to the development of AD-type pathology. We found heterogeneous expression of both COX subunits in AD with an increased expression of both subunit proteins in healthy, non-tangle-bearing, neurones but absence of both subunit proteins in tangle-bearing neurones. Levels of COX IV but not of COX I were related to the amount of hyperphosphorylated tau accumulated in the same hippocampal region but not to the amount of amyloid deposited in sporadic AD. In Down's syndrome COX I and COX IV were similarly increased in the presence of AD pathology in non-tangle-bearing neurones. However, in these cases levels of enzyme expression were correlated to the amount of amyloid accumulation but not the amount of hyperphosphorylated tau in the hippocampus. We believe that heterogeneity of expression of mitochondrial enzyme proteins between neurones may contribute to the conflicting conclusions in previous reports regarding relative levels of cytochrome oxidase activity in the hippocampus in AD. We hypothesise that the increased mitochondrial enzyme expression in healthy-appearing neurones of AD brains may represent a physiological response to increased functional demand on surviving neurones as a consequence of AD-related neuronal pathology.

  19. In Vivo Determination of Mitochondrial Function Using Luciferase-Expressing Caenorhabditis elegans: Contribution of Oxidative Phosphorylation, Glycolysis, and Fatty Acid Oxidation to Toxicant-Induced Dysfunction.

    PubMed

    Luz, Anthony L; Lagido, Cristina; Hirschey, Matthew D; Meyer, Joel N

    2016-08-01

    Mitochondria are a target of many drugs and environmental toxicants; however, how toxicant-induced mitochondrial dysfunction contributes to the progression of human disease remains poorly understood. To address this issue, in vivo assays capable of rapidly assessing mitochondrial function need to be developed. Here, using the model organism Caenorhabditis elegans, we describe how to rapidly assess the in vivo role of the electron transport chain, glycolysis, or fatty acid oxidation in energy metabolism following toxicant exposure, using a luciferase-expressing ATP reporter strain. Alterations in mitochondrial function subsequent to toxicant exposure are detected by depleting steady-state ATP levels with inhibitors of the mitochondrial electron transport chain, glycolysis, or fatty acid oxidation. Differential changes in ATP following short-term inhibitor exposure indicate toxicant-induced alterations at the site of inhibition. Because a microplate reader is the only major piece of equipment required, this is a highly accessible method for studying toxicant-induced mitochondrial dysfunction in vivo. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  20. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  1. Lipin-1 expression is critical for keratinocyte differentiation.

    PubMed

    Chae, Minjung; Jung, Ji-Yong; Bae, Il-Hong; Kim, Hyoung-June; Lee, Tae Ryong; Shin, Dong Wook

    2016-04-01

    Lipin-1 is an Mg(2+)-dependent phosphatidate phosphatase that facilitates the dephosphorylation of phosphatidic acid to generate diacylglycerol. Little is known about the expression and function of lipin-1 in normal human epidermal keratinocytes (NHEKs). Here, we demonstrate that lipin-1 is present in basal and spinous layers of the normal human epidermis, and lipin-1 expression is gradually downregulated during NHEK differentiation. Interestingly, lipin-1 knockdown (KD) inhibited keratinocyte differentiation and caused G1 arrest by upregulating p21 expression. Cell cycle arrest by p21 is required for commitment of keratinocytes to differentiation, but must be downregulated for the progress of keratinocyte differentiation. Therefore, reduced keratinocyte differentiation results from sustained upregulation of p21 by lipin-1 KD. Lipin-1 KD also decreased the phosphorylation/activation of protein kinase C (PKC)α, whereas lipin-1 overexpression increased PKCα phosphorylation. Treatment with PKCα inhibitors, like lipin-1 KD, stimulated p21 expression, while lipin-1 overexpression reduced p21 expression, implicating PKCα in lipin-1-induced regulation of p21 expression. Taken together, these results suggest that lipin-1-mediated downregulation of p21 is critical for the progress of keratinocyte differentiation after the initial commitment of keratinocytes to differentiation induced by p21, and that PKCα is involved in p21 expression regulation by lipin-1. Copyright © 2016 by the American Society for Biochemistry and Molecular Biology, Inc.

  2. Associations of Mitochondrial Haplogroups B4 and E with Biliary Atresia and Differential Susceptibility to Hydrophobic Bile Acid

    PubMed Central

    Tiao, Mao-Meng; Liou, Chia-Wei; Huang, Li-Tung; Wang, Pei-Wen; Lin, Tsu-Kung; Chen, Jin-Bor; Chou, Yao-Min; Huang, Ying-Hsien; Lin, Hung-Yu; Chen, Chao-Long; Chuang, Jiin-Haur

    2013-01-01

    Mitochondrial dysfunction has been implicated in the pathogenesis of biliary atresia (BA). This study aimed to determine whether a specific mitochondrial DNA haplogroup is implicated in the pathogenesis and prognosis of BA. We determined 40 mitochondrial single nucleotide polymorphisms in 15 major mitochondrial haplogroups by the use of 24-plex PCR and fluorescent beads combined with sequence-specific oligonucleotide probes in 71 patients with BA and in 200 controls in the Taiwanese population of ethnic Chinese background. The haplogroup B4 and E prevalence were significantly lower and higher respectively, in the patients with BA than in the controls (odds ratios, 0.82 [p = 0.007] and 7.36 [p = 0.032] respectively) in multivariate logistic-regression analysis. The 3-year survival rate with native liver was significantly lower in haplogroup E than the other haplogroups (P = 0.037). A cytoplasmic hybrid (cybrid) was obtained from human 143B osteosarcoma cells devoid of mtDNA (ρ0 cell) and was fused with specific mtDNA bearing E and B4 haplogroups donated by healthy Taiwanese subjects. Chenodeoxycholic acid treatment resulted in significantly lower free radical production, higher mitochondrial membrane potential, more viable cells, and fewer apoptotic cybrid B4 cells than parental 143B and cybrid E cells. Bile acid treatment resulted in a significantly greater protective mitochondrial reaction with significantly higher mitochondrial DNA copy number and mitofusin 1 and 2 concentrations in cybrid B4 and parental cells than in cybrid E cells. The results of the study suggested that the specific mitochondrial DNA haplogroups B4 and E were not only associated with lower and higher prevalence of BA respectively, in the study population, but also with differential susceptibility to hydrophobic bile acid in the cybrid harboring different haplogroups. PMID:23966875

  3. Changes in mitochondrial function and mitochondria associated protein expression in response to 2-weeks of high intensity interval training

    PubMed Central

    Vincent, Grace; Lamon, Séverine; Gant, Nicholas; Vincent, Peter J.; MacDonald, Julia R.; Markworth, James F.; Edge, Johann A.; Hickey, Anthony J. R.

    2015-01-01

    Purpose: High-intensity short-duration interval training (HIT) stimulates functional and metabolic adaptation in skeletal muscle, but the influence of HIT on mitochondrial function remains poorly studied in humans. Mitochondrial metabolism as well as mitochondrial-associated protein expression were tested in untrained participants performing HIT over a 2-week period. Methods: Eight males performed a single-leg cycling protocol (12 × 1 min intervals at 120% peak power output, 90 s recovery, 4 days/week). Muscle biopsies (vastus lateralis) were taken pre- and post-HIT. Mitochondrial respiration in permeabilized fibers, citrate synthase (CS) activity and protein expression of peroxisome proliferator-activated receptor gamma coactivator (PGC-1α) and respiratory complex components were measured. Results: HIT training improved peak power and time to fatigue. Increases in absolute oxidative phosphorylation (OXPHOS) capacities and CS activity were observed, but not in the ratio of CCO to the electron transport system (CCO/ETS), the respiratory control ratios (RCR-1 and RCR-2) or mitochondrial-associated protein expression. Specific increases in OXPHOS flux were not apparent after normalization to CS, indicating that gross changes mainly resulted from increased mitochondrial mass. Conclusion: Over only 2 weeks HIT significantly increased mitochondrial function in skeletal muscle independently of detectable changes in mitochondrial-associated and mitogenic protein expression. PMID:25759671

  4. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  5. Infants' perception of expressive behaviors: differentiation of multimodal information.

    PubMed

    Walker-Andrews, A S

    1997-05-01

    The literature on infants' perception of facial and vocal expressions, combined with data from studies on infant-directed speech, mother-infant interaction, and social referencing, supports the view that infants come to recognize the affective expressions of others through a perceptual differentiation process. Recognition of affective expressions changes from a reliance on multimodally presented information to the recognition of vocal expressions and then of facial expressions alone. Face or voice properties become differentiated and discriminated from the whole, standing for the entire emotional expression. Initially, infants detect information that potentially carries the meaning of emotional expressions; only later do infants discriminate and then recognize those expressions. The author reviews data supporting this view and draws parallels between the perceptions of affective expressions and of speech.

  6. Mitochondrial haplotype analysis as a tool for differentiating populations of Verticillium dahliae.

    USDA-ARS?s Scientific Manuscript database

    The ability to monitor mitochondrial background in Verticillium dahliae may provide an additional tool for population studies and monitoring clonal populations. Published mitochondrial genome sequences of V. dahliae (DQ531941) were used to design primers for assessment of mitochondrial haplotype di...

  7. Morphological adaptation with no mitochondrial DNA differentiation in the coastal plain swamp sparrow

    USGS Publications Warehouse

    Greenberg, R.; Cordero, P.J.; Droege, S.; Fleischer, R.C.

    1998-01-01

    We estimated genetic differentiation between morphologically distinct tidal marsh populations of Swamp Sparrows (Melospiza georgiana nigrescens) and the more wide-spread inland populations (M. g. georgiana and M. g. ericrypta). The tidal marsh populations are consistently grayer with more extensive black markings (particularly in the crown), and their bills are larger. These differences are variously shared with other species of salt marsh birds and small mammals. We analyzed mitochondrial DNA sequences (5' end of control region, COII/tlys/ATPase8, and ND2) of Swamp Sparrows and found low levels of genetic variation and no evidence of geographic structure. These results suggest a rapid and recent geographic expansion of Swamp Sparrows from restricted Pleistocene populations. Morphological differentiation has occurred without long-term genetic isolation, suggesting that selection on the divergent traits is intense. The grayer and more melanistic plumage is probably cryptic coloration for foraging on tidal mud, which tends to be grayish as a result of the formation of iron sulfides, rather than iron oxides, under anaerobic conditions.

  8. Genetic diversity and differentiation of the Ryukyu endemic frog Babina holsti as revealed by mitochondrial DNA.

    PubMed

    Tominaga, Atsushi; Matsui, Masafumi; Nakata, Katsushi

    2014-02-01

    We surveyed the genetic diversity and genetic differentiation of an endangered frog, Babina holsti, endemic to Okinawajima and Tokashikijima Islands of the Ryukyus, to elucidate its divergence history and obtain basic data for its conservation. Genetic differentiation between the two island lineages is moderate (3.1% p-distance in the cyt b gene). This result suggests that the two island lineages have been isolated between the late Pliocene and the middle Pleistocene and have never migrated between the current northern part of Okinawajima and Tokashikijima Islands, which were once connected in the late Pleistocene glacial age. On Okinawajima Island, the southernmost sample was constituted by a unique haplotype, without considerable genetic distance from haplotypes detected from northern samples. This unique haplotype composition in the southernmost sample would have resulted from the restricted gene flow between the southernmost population and the other populations in Okinawajima Island. Furthermore, the absence of genetic diversity within the southernmost sample indicates that this population has recently experienced population size reduction, possibly by predation pressure from an introduced mongoose, which is more abundant in the southern part than in the northern part of the island. Lower genetic diversity in the Tokashikijima sample implies a small effective population size for mitochondrial DNA (mtDNA) in B. holsti on the island. Immediate conservation measures should be taken for the populations from the southernmost range in Okinawajima and Tokashikijima.

  9. Morphological adaptation with no mitochondrial DNA differentiation in the coastal plain swamp sparrow

    USGS Publications Warehouse

    Greenberg, R.; Cordero, P.J.; Droege, S.; Fleischer, R.C.

    1998-01-01

    We estimated genetic differentiation between morphologically distinct tidal marsh populations of Swamp Sparrows (Melospiza georgiana nigrescens) and the more widespread inland populations (M. g. georgiana and M. g. ericrypta). The tidal marsh populations are consistently grayer with more extensive black markings (particularly in the crown), and their bills are larger. These differences are variously shared with other species of salt marsh birds and small mammals. We analyzed mitochondrial DNA sequences (5′ end of control region, COII/t-lys/ATPase8, and ND2) of Swamp Sparrows and found low levels of genetic variation and no evidence of geographic structure. These results suggest a rapid and recent geographic expansion of Swamp Sparrows from restricted Pleistocene populations. Morphological differentiation has occurred without long-term genetic isolation, suggesting that selection on the divergent traits is intense. The grayer and more melanistic plumage is probably cryptic coloration for foraging on tidal mud, which tends to be grayish as a result of the formation of iron sulfides, rather than iron oxides, under anaerobic conditions.

  10. Genetic Variation and Geographic Differentiation in Mitochondrial DNA of the Horseshoe Crab, LIMULUS POLYPHEMUS

    PubMed Central

    Saunders, Nancy C.; Kessler, Louis G.; Avise, John C.

    1986-01-01

    Restriction site variation in mitochondrial DNA (mtDNA) of the horseshoe crab (Limulus polyphemus) was surveyed in populations ranging from New Hampshire to the Gulf Coast of Florida. MtDNA clonal diversity was moderately high, particularly in southern samples, and a major genetic "break" (nucleotide sequence divergence approximately 2%) distinguished all sampled individuals which were north vs. south of a region in northeastern Florida. The area of genotypic divergence in Limulus corresponds to a long-recognized zoogeographic boundary between warm-temperate and tropical marine faunas, and it suggests that selection pressures and/or gene flow barriers associated with water mass differences may also influence the evolution of species widely distributed across such transition zones. On the other hand, a comparison of the mtDNA divergence patterns in Limulus with computer models involving stochastic lineage extinction in species with limited gene flow demonstrates that deterministic explanations need not necessarily be invoked to account for the observations. Experiments to distinguish stochastic from deterministic possibilities are suggested. Overall, the pattern and magnitude of mtDNA differentiation in horseshoe crabs is very similar to that typically reported for freshwater and terrestrial species assayed over a comparable geographic range. Results demonstrate for the first time that, geographically, at least some continuously distributed marine organisms can show considerable mtDNA genetic differentiation. PMID:17246319

  11. Alpha-ketoglutarate Curbs Differentiation and Induces Cell Death in Mesenchymal Stromal Precursors with Mitochondrial Dysfunction.

    PubMed

    Singh, Karmveer; Krug, Linda; Basu, Abhijit; Meyer, Patrick; Treiber, Nicolai; Vander Beken, Seppe; Wlaschek, Meinhard; Kochanek, Stefan; Bloch, Wilhelm; Geiger, Hartmut; Maity, Pallab; Scharffetter-Kochanek, Karin

    2017-04-11

    Increased concentrations of reactive oxygen species (ROS) originating from dysfunctional mitochondria contribute to diverse aging-related degenerative disorders. But so far little is known about the impact of distinct ROS on metabolism and fate of stromal precursor cells. We here demonstrate that an increase in superoxide anion radicals due to superoxide dismutase 2 (Sod2) deficiency in stromal precursor cells suppress osteogenic and adipogenic differentiation through fundamental changes in the global metabolite landscape. Our data identify impairment of the pyruvate and L-glutamine metabolism causing toxic accumulation of alpha-ketoglutarate in the Sod2 deficient and intrinsically aged stromal precursor cells as a major cause for their reduced lineage differentiation. Alpha-ketoglutarate accumulation led to enhanced nucleocytoplasmic vacuolation and chromatin condensation-mediated cell death in Sod2 deficient stromal precursor cells as a consequence of DNA damage, Hif-1α instability and reduced histone H3 (Lys27) acetylation. These findings hold promise for prevention and treatment of mitochondrial disorders commonly associated with aged individuals. This article is protected by copyright. All rights reserved.

  12. Molecular differentiation of Russian wild ginseng using mitochondrial nad7 intron 3 region.

    PubMed

    Li, Guisheng; Cui, Yan; Wang, Hongtao; Kwon, Woo-Saeng; Yang, Deok-Chun

    2017-07-01

    Cultivated ginseng is often introduced as a substitute and adulterant of Russian wild ginseng due to its lower cost or misidentification caused by similarity in appearance with wild ginseng. The aim of this study is to develop a simple and reliable method to differentiate Russian wild ginseng from cultivated ginseng. The mitochondrial NADH dehydrogenase subunit 7 (nad7) intron 3 regions of Russian wild ginseng and Chinese cultivated ginseng were analyzed. Based on the multiple sequence alignment result, a specific primer for Russian wild ginseng was designed by introducing additional mismatch and allele-specific polymerase chain reaction (PCR) was performed for identification of wild ginseng. Real-time allele-specific PCR with endpoint analysis was used for validation of the developed Russian wild ginseng single nucleotide polymorphism (SNP) marker. An SNP site specific to Russian wild ginseng was exploited by multiple alignments of mitochondrial nad7 intron 3 regions of different ginseng samples. With the SNP-based specific primer, Russian wild ginseng was successfully discriminated from Chinese and Korean cultivated ginseng samples by allele-specific PCR. The reliability and specificity of the SNP marker was validated by checking 20 individuals of Russian wild ginseng samples with real-time allele-specific PCR assay. An effective DNA method for molecular discrimination of Russian wild ginseng from Chinese and Korean cultivated ginseng was developed. The established real-time allele-specific PCR was simple and reliable, and the present method should be a crucial complement of chemical analysis for authentication of Russian wild ginseng.

  13. Comparative analysis of some aspects of mitochondrial metabolism in differentiated and undifferentiated neuroblastoma cells.

    PubMed

    Klepinin, Aleksandr; Chekulayev, Vladimir; Timohhina, Natalja; Shevchuk, Igor; Tepp, Kersti; Kaldma, Andrus; Koit, Andre; Saks, Valdur; Kaambre, Tuuli

    2014-02-01

    The aim of the present study is to clarify some aspects of the mechanisms of regulation of mitochondrial metabolism in neuroblastoma (NB) cells. Experiments were performed on murine Neuro-2a (N2a) cell line, and the same cells differentiated by all-trans-retinoic acid (dN2a) served as in vitro model of normal neurons. Oxygraphy and Metabolic Control Analysis (MCA) were applied to characterize the function of mitochondrial oxidative phosphorylation (OXPHOS) in NB cells. Flux control coefficients (FCCs) for components of the OXPHOS system were determined using titration studies with specific non-competitive inhibitors in the presence of exogenously added ADP. Respiration rates of undifferentiated Neuro-2a cells (uN2a) and the FCC of Complex-II in these cells were found to be considerably lower than those in dN2a cells. Our results show that NB is not an exclusively glycolytic tumor and could produce a considerable part of ATP via OXPHOS. Two important enzymes - hexokinase-2 and adenylate kinase-2 can play a role in the generation of ATP in NB cells. MCA has shown that in uN2a cells the key sites in the regulation of OXPHOS are complexes I, II and IV, whereas in dN2a cells complexes II and IV. Results obtained for the phosphate and adenine nucleotide carriers showed that in dN2a cells these carriers exerted lower control over the OXPHOS than in undifferentiated cells. The sum of FCCs for both types of NB cells was found to exceed significantly that for normal cells suggesting that in these cells the respiratory chain was somehow reorganized or assembled into large supercomplexes.

  14. The Expression of Ubiquitous Mitochondrial Creatine Kinase Is Downregulated as Prostate Cancer Progression

    PubMed Central

    Amamoto, Rie; Uchiumi, Takeshi; Yagi, Mikako; Monji, Keisuke; Song, YooHyun; Oda, Yoshinao; Shiota, Masaki; Yokomizo, Akira; Naito, Seiji; Kang, Dongchon

    2016-01-01

    Background: Mitochondria play crucial roles in cell signaling events, interorganellar communication, aging, cell proliferation and apoptosis, and mitochondrial impairment has been shown to accelerate or modulate cancer progression. Ubiquitous mitochondrial creatine kinase (uMtCK) is predominantly localized in the intermembrane space of mitochondria and catalyzes the reversible exchange of high-energy phosphate between adenosine tri-phosphate (ATP) and phosphocreatine. However, little is known about its expression and function in human prostate cancer progression. Method: We investigated the expression of uMtCK in 148 prostate carcinoma tissues and matched normal tissue by immunohistochemistry. The expression and localization of uMtCK and hexokinase II, a marker of glycolysis, were examined in prostate carcinoma cell lines using western blot and immunofluorescence. Results: MtCK expression was significantly lower in high Gleason grade carcinoma compared with normal prostate or low grade carcinoma. Western blot further revealed that uMtCK was highly expressed in LNCaP and 22Rv1 cell lines, as well as in the normal prostate cell line RWPE-1. However, uMtCK expression was almost absent in PC3 and DU145 cell lines, in correlation with absent or mutant p53 expression, respectively. In contrast, hexokinase II was overexpressed in PC3 cells. Moreover, in the low uMtCK expressing cell lines, glycolytic ATP production was increased, whereas mitochondrial ATP production was decreased. Conclusions: These data suggest that uMtCK is downregulated as prostate cancer progresses in correlation with a metabolic switch in ATP usage. PMID:26722360

  15. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  16. Regulation of the cell cycle via mitochondrial gene expression and energy metabolism in HeLa cells.

    PubMed

    Xiong, Wei; Jiao, Yang; Huang, Weiwei; Ma, Mingxing; Yu, Min; Cui, Qinghua; Tan, Deyong

    2012-04-01

    Human cervical cancer HeLa cells have functional mitochondria. Recent studies have suggested that mitochondrial metabolism plays an essential role in tumor cell proliferation. Nevertheless, how cells coordinate mitochondrial dynamics and cell cycle progression remains to be clarified. To investigate the relationship between mitochondrial function and cell cycle regulation, the mitochondrial gene expression profile and cellular ATP levels were determined by cell cycle progress analysis in the present study. HeLa cells were synchronized in the G0/G1 phase by serum starvation, and re-entered cell cycle by restoring serum culture, time course experiment was performed to analyze the expression of mitochondrial transcription regulators and mitochondrial genes, mitochondrial membrane potential (MMP), cellular ATP levels, and cell cycle progression. The results showed that when arrested G0/G1 cells were stimulated in serum-containing medium, the amount of DNA and the expression levels of both mRNA and proteins in mitochondria started to increase at 2 h time point, whereas the MMP and ATP level elevated at 4 h. Furthermore, the cyclin D1 expression began to increase at 4 h after serum triggered cell cycle. ATP synthesis inhibitor-oligomycin-treatment suppressed the cyclin D1 and cyclin B1 expression levels and blocked cell cycle progression. Taken together, our results suggested that increased mitochondrial gene expression levels, oxidative phosphorylation activation, and cellular ATP content increase are important events for triggering cell cycle. Finally, we demonstrated that mitochondrial gene expression levels and cellular ATP content are tightly regulated and might play a central role in regulating cell proliferation.

  17. Plectin isoform P1b and P1d deficiencies differentially affect mitochondrial morphology and function in skeletal muscle.

    PubMed

    Winter, Lilli; Kuznetsov, Andrey V; Grimm, Michael; Zeöld, Anikó; Fischer, Irmgard; Wiche, Gerhard

    2015-08-15

    Plectin, a versatile 500-kDa cytolinker protein, is essential for muscle fiber integrity and function. The most common disease caused by mutations in the human plectin gene, epidermolysis bullosa simplex with muscular dystrophy (EBS-MD), is characterized by severe skin blistering and progressive muscular dystrophy. Besides displaying pathological desmin-positive protein aggregates and degenerative changes in the myofibrillar apparatus, skeletal muscle specimens of EBS-MD patients and plectin-deficient mice are characterized by massive mitochondrial alterations. In this study, we demonstrate that structural and functional alterations of mitochondria are a primary aftermath of plectin deficiency in muscle, contributing to myofiber degeneration. We found that in skeletal muscle of conditional plectin knockout mice (MCK-Cre/cKO), mitochondrial content was reduced, and mitochondria were aggregated in sarcoplasmic and subsarcolemmal regions and were no longer associated with Z-disks. Additionally, decreased mitochondrial citrate synthase activity, respiratory function and altered adenosine diphosphate kinetics were characteristic of plectin-deficient muscles. To analyze a mechanistic link between plectin deficiency and mitochondrial alterations, we comparatively assessed mitochondrial morphology and function in whole muscle and teased muscle fibers of wild-type, MCK-Cre/cKO and plectin isoform-specific knockout mice that were lacking just one isoform (either P1b or P1d) while expressing all others. Monitoring morphological alterations of mitochondria, an isoform P1b-specific phenotype affecting the mitochondrial fusion-fission machinery and manifesting with upregulated mitochondrial fusion-associated protein mitofusin-2 could be identified. Our results show that the depletion of distinct plectin isoforms affects mitochondrial network organization and function in different ways.

  18. Non-cytotoxic copper overload boosts mitochondrial energy metabolism to modulate cell proliferation and differentiation in the human erythroleukemic cell line K562.

    PubMed

    Ruiz, Lina M; Jensen, Erik L; Rossel, Yancing; Puas, German I; Gonzalez-Ibanez, Alvaro M; Bustos, Rodrigo I; Ferrick, David A; Elorza, Alvaro A

    2016-07-01

    Copper is integral to the mitochondrial respiratory complex IV and contributes to proliferation and differentiation, metabolic reprogramming and mitochondrial function. The K562 cell line was exposed to a non-cytotoxic copper overload to evaluate mitochondrial dynamics, function and cell fate. This induced higher rates of mitochondrial turnover given by an increase in mitochondrial fusion and fission events and in the autophagic flux. The appearance of smaller and condensed mitochondria was also observed. Bioenergetics activity included more respiratory complexes, higher oxygen consumption rate, superoxide production and ATP synthesis, with no decrease in membrane potential. Increased cell proliferation and inhibited differentiation also occurred. Non-cytotoxic copper levels can modify mitochondrial metabolism and cell fate, which could be used in cancer biology and regenerative medicine. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  19. Over-expression of mitochondrial heat shock protein 70 suppresses programmed cell death in rice.

    PubMed

    Qi, Yaocheng; Wang, Hongjuan; Zou, Yu; Liu, Cheng; Liu, Yanqi; Wang, Ying; Zhang, Wei

    2011-01-03

    In this study, we identified and functionally characterized the mitochondrial heat shock protein 70 (mtHsp70). Over-expression of mtHsp70 suppressed heat- and H(2)O(2)-induced programmed cell death (PCD) in rice protoplasts, as reflected by higher cell viability, decreased DNA laddering and chromatin condensation. Mitochondrial membrane potential (Δψ(m)) after heat shock was destroyed gradually in protoplasts, but mtHsp70 over-expression showed higher Δψ(m) relative to the vector control cells, and partially inhibited cytochrome c release from mitochondria to cytosol. Heat treatment also significantly increased reactive oxygen species (ROS) generation, a phenomenon not observed in protoplasts over-expressing mtHsp70. Together, these results suggest that mtHsp70 may suppress PCD in rice protoplasts by maintaining mitochondrial Δψ(m) and inhibiting the amplification of ROS. Copyright © 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure

    PubMed Central

    Wu, San-Pin; Kao, Chung-Yang; Wang, Leiming; Creighton, Chad J.; Yang, Jin; Donti, Taraka R.; Harmancey, Romain; Vasquez, Hernan G.; Graham, Brett H.; Bellen, Hugo J.; Taegtmeyer, Heinrich; Chang, Ching-Pin; Tsai, Ming-Jer; Tsai, Sophia Y.

    2015-01-01

    Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP-TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy. PMID:26356605

  1. Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure.

    PubMed

    Wu, San-Pin; Kao, Chung-Yang; Wang, Leiming; Creighton, Chad J; Yang, Jin; Donti, Taraka R; Harmancey, Romain; Vasquez, Hernan G; Graham, Brett H; Bellen, Hugo J; Taegtmeyer, Heinrich; Chang, Ching-Pin; Tsai, Ming-Jer; Tsai, Sophia Y

    2015-09-10

    Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP-TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy.

  2. Expression of genes related to mitochondrial function in Nellore cattle divergently ranked on residual feed intake.

    PubMed

    Fonseca, Larissa Fernanda Simielli; Gimenez, Daniele Fernanda Jovino; Mercadante, Maria Eugênia Zerlotti; Bonilha, Sarah Figueiredo Martins; Ferro, Jesus Aparecido; Baldi, Fernando; de Souza, Fábio Ricardo Pablos; de Albuquerque, Lucia Galvão

    2015-02-01

    Several measures have been proposed to investigate and improve feed efficiency in cattle. One of the most commonly used measure of feed efficiency is residual feed intake (RFI), which is estimated as the difference between actual feed intake and expected feed intake based on the animal's average live weight. This measure permits to identify and select the most efficient animals without selecting for higher mature weight. Mitochondrial function has been indicated as a major factor that influences RFI. The analysis of genes involved in mitochondrial function is therefore an alternative to identify molecular markers associated with higher feed efficiency. This study analyzed the expression of PGC1α, TFAM, UCP2 and UCP3 genes by quantitative real-time PCR in liver and muscle tissues of two groups of Nellore cattle divergently ranked on RFI values in order to evaluate the relationship of these genes with RFI. In liver tissue, higher expression of TFAM and UCP2 genes was observed in the negative RFI group. Expression of PGC1α gene did not differ significantly between the two groups, whereas UCP3 gene was not expressed in liver tissue. In muscle tissue, higher expression of TFAM gene was observed in the positive RFI group. Expression of PGC1α, UCP2 and UCP3 genes did not differ significantly between the two groups. These results suggest the use of TFAM and UCP2 as possible candidate gene markers in breeding programs designed to increase the feed efficiency of Nellore cattle.

  3. Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

    PubMed Central

    2014-01-01

    Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

  4. Equine skeletal muscle adaptations to exercise and training: evidence of differential regulation of autophagosomal and mitochondrial components.

    PubMed

    Bryan, Kenneth; McGivney, Beatrice A; Farries, Gabriella; McGettigan, Paul A; McGivney, Charlotte L; Gough, Katie F; MacHugh, David E; Katz, Lisa M; Hill, Emmeline W

    2017-08-09

    A single bout of exercise induces changes in gene expression in skeletal muscle. Regular exercise results in an adaptive response involving changes in muscle architecture and biochemistry, and is an effective way to manage and prevent common human diseases such as obesity, cardiovascular disorders and type II diabetes. However, the biomolecular mechanisms underlying such responses still need to be fully elucidated. Here we performed a transcriptome-wide analysis of skeletal muscle tissue in a large cohort of untrained Thoroughbred horses (n = 51) before and after a bout of high-intensity exercise and again after an extended period of training. We hypothesized that regular high-intensity exercise training primes the transcriptome for the demands of high-intensity exercise. An extensive set of genes was observed to be significantly differentially regulated in response to a single bout of high-intensity exercise in the untrained cohort (3241 genes) and following multiple bouts of high-intensity exercise training over a six-month period (3405 genes). Approximately one-third of these genes (1025) and several biological processes related to energy metabolism were common to both the exercise and training responses. We then developed a novel network-based computational analysis pipeline to test the hypothesis that these transcriptional changes also influence the contextual molecular interactome and its dynamics in response to exercise and training. The contextual network analysis identified several important hub genes, including the autophagosomal-related gene GABARAPL1, and dynamic functional modules, including those enriched for mitochondrial respiratory chain complexes I and V, that were differentially regulated and had their putative interactions 're-wired' in the exercise and/or training responses. Here we have generated for the first time, a comprehensive set of genes that are differentially expressed in Thoroughbred skeletal muscle in response to both exercise and

  5. [Screening of differentially expressed genes during adipocyte differentiation by suppression subtractive hybridization technique].

    PubMed

    Yi, Xiao-qing; Xiao, Yan-feng; Yin, Chun-yan; Xu, Er-di

    2012-05-01

    To screening differentially expressed genes related to adipocyte differentiation. Total RNA extracted from the preadipocyte cell line SW872 was taken as the Driver and the total RNA from the differentiated adipocytes SW872 as the Tester. Suppression subtractive hybridization (SSH) was used to isolate the cDNA fragments of differentially expressed genes. The products of SSH were inserted into pGM-T vector to establish the subtractive library. The library was amplified through E.coli transformation and positive clones of the transformants were screened. Positive clones were sequenced. Nucleic acid similarity was subsequently analyzed by comparing with the data from GenBank. There were 135 white clones in the cDNA library, 64 positive clones were chosen randomly and sequenced and similarity search revealed 34 genes which expressed differentially in adipocyte differentiation. The subtracted cDNA library for differentially expressed in adipocyte differentiation has been successfully constructed and the interesting candidate genes related to adipocyte differentiation have been identified.

  6. Involvement of nutrients and nutritional mediators in mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene expression.

    PubMed

    Rescigno, Tania; Capasso, Anna; Tecce, Mario Felice

    2017-09-09

    Mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase (HMGCS2) catalyses the first step of ketogenesis and is critical in various metabolic conditions. Several nutrient molecules were able to differentially modulate HMGCS2 expression levels. Docosahexaenoic acid (DHA, C22:6, n-3), eicosapentaenoic acid (EPA, C20:5, n-3), arachidonic acid (AA, C20:4, n-6) and glucose increased HMGCS2 mRNA and protein levels in HepG2 hepatoma cells, while fructose decreased them. The effect of n-6 AA resulted significantly higher than that of n-3 PUFA, but when combined all these molecules were far less efficient. Insulin reduced HMGCS2 mRNA and protein levels in HepG2 cells, even when treated with PUFA and monosaccharides. Several nuclear receptors and transcription factors are involved in HMGCS2 expression regulation. While peroxysome proliferator activated receptor α (PPAR-α) agonist WY14643 increased HMGCS2 expression, this treatment was unable to affect PUFA-mediated regulation of HMGCS2 expression. Forkhead box O1 (FoxO1) inhibitor AS1842856 reduced HMGCS2 expression and suppressed induction promoted by fatty acids. Cells treatment with liver X receptor alpha (LXRα) agonist T0901317 reduced HMGCS2 mRNA, indicating a role for this transcription factor as suppressor of HMGCS2 gene. Previous observations already indicated HMGCS2 expression as possible nutrition status reference: our results show that several nutrients as well as specific nutritional related hormonal conditions are able to affect significantly HMGCS2 gene expression, indicating a relevant role for PUFA, which are mostly derived from nutritional intake. These insights into mechanisms of its regulation, specifically through nutrients commonly associated with disease risk, indicate HMGCS2 expression as possible reference marker of metabolic and nutritional status. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis.

    PubMed Central

    Virbasius, J V; Scarpulla, R C

    1994-01-01

    Mitochondrial transcription factor A (mtTFA), the product of a nuclear gene, stimulates transcription from the two divergent mitochondrial promoters and is likely the principal activator of mitochondrial gene expression in vertebrates. Here we establish that the proximal promoter of the human mtTFA gene is highly dependent upon recognition sites for the nuclear respiratory factors, NRF-1 and NRF-2, for activity. These factors have been previously implicated in the activation of numerous nuclear genes that contribute to mitochondrial respiratory function. The affinity-purified factors from HeLa cells specifically bind to the mtTFA NRF-1 and NRF-2 sites through guanine nucleotide contacts that are characteristic for each site. Mutations in these contacts eliminate NRF-1 and NRF-2 binding and also dramatically reduce promoter activity in transfected cells. Although both factors contribute, NRF-1 binding appears to be the major determinant of promoter function. This dependence on NRF-1 activation is confirmed by in vitro transcription using highly purified recombinant proteins that display the same binding specificities as the HeLa cell factors. The activation of the mtTFA promoter by both NRF-1 and NRF-2 therefore provides a link between the expression of nuclear and mitochondrial genes and suggests a mechanism for their coordinate regulation during organelle biogenesis. Images PMID:8108407

  8. Expression Profiling of Mitochondrial Voltage-Dependent Anion Channel-1 Associated Genes Predicts Recurrence-Free Survival in Human Carcinomas

    PubMed Central

    Lim, Inja; Zhou, Tong; Bang, Hyoweon

    2014-01-01

    Background Mitochondrial voltage-dependent anion channels (VDACs) play a key role in mitochondria-mediated apoptosis. Both in vivo and in vitro evidences indicate that VDACs are actively involved in tumor progression. Specifically, VDAC-1, one member of the VDAC family, was thought to be a potential anti-cancer therapeutic target. Our previous study demonstrated that the human gene VDAC1 (encoding the VDAC-1 isoform) was significantly up-regulated in lung tumor tissue compared with normal tissue. Also, we found a significant positive correlation between the gene expression of VDAC1 and histological grade in breast cancer. However, the prognostic power of VDAC1 and its associated genes in human cancers is largely unknown. Methods We systematically analyzed the expression pattern of VDAC1 and its interacting genes in breast, colon, liver, lung, pancreatic, and thyroid cancers. The genes differentially expressed between normal and tumor tissues in human carcinomas were identified. Results The expression level of VDAC1 was uniformly up-regulated in tumor tissue compared with normal tissue in breast, colon, liver, lung, pancreatic, and thyroid cancers. Forty-four VDAC1 interacting genes were identified as being commonly differentially expressed between normal and tumor tissues in human carcinomas. We designated VDAC1 and the 44 dysregulated interacting genes as the VDAC1 associated gene signature (VAG). We demonstrate that the VAG signature is a robust prognostic biomarker to predict recurrence-free survival in breast, colon, and lung cancers, and is independent of standard clinical and pathological prognostic factors. Conclusions VAG represents a promising prognostic biomarker in human cancers, which may enhance prediction accuracy in identifying patients at higher risk for recurrence. Future therapies aimed specifically at VDAC1 associated genes may lead to novel agents in the treatment of cancer. PMID:25333947

  9. Maraviroc reduces cytokine expression and secretion in human adipose cells without altering adipogenic differentiation.

    PubMed

    Díaz-Delfín, Julieta; Domingo, Pere; Giralt, Marta; Villarroya, Francesc

    2013-03-01

    Maraviroc (MVC) is a drug approved for use as part of HAART in treatment-experienced HIV-1 patients with CCR5-tropic virus. Despite the current concerns on the alterations in adipose tissue that frequently appear in HIV-infected patients under HAART, there is no information available on the effects of MVC on adipose tissue. Here we studied the effects of MVC during and after the differentiation of human adipocytes in culture, and compared the results with the effects of efavirenz (EFV). We measured the acquisition of adipocyte morphology; the gene expression levels of markers for mitochondrial toxicity, adipogenesis and inflammation; and the release of adipokines and cytokines to the medium. Additionally, we determined the effects of MVC on lipopolysaccharide (LPS)-induced pro-inflammatory cytokine expression in adipocytes. Unlike EFV-treated pre-adipocytes, MVC-treated pre-adipocytes showed no alterations in the capacity to differentiate into adipocytes and accumulated lipids normally. Consistent with this, there were no changes in the mRNA levels of PPARγ or SREBP-1c, two master regulators of adipogenesis. In addition, MVC caused a significant decrease in the gene expression and release of pro-inflammatory cytokines, whereas EFV had the opposite effect. Moreover, MVC lowered inflammation-related gene expression and inhibited the LPS-induced expression of pro-inflammatory genes in differentiated adipocytes. We conclude that MVC does not alter adipocyte differentiation but rather shows anti-inflammatory properties by inhibiting the expression and secretion of pro-inflammatory cytokines. Collectively, our results suggest that MVC may minimize adverse effects on adipose tissue development, metabolism, and inflammation, and thus could be a potentially beneficial component of antiretroviral therapy.

  10. Mitochondrial dysfunction in a transgenic mouse model expressing human amyloid precursor protein (APP) with the Arctic mutation.

    PubMed

    Rönnbäck, Annica; Pavlov, Pavel F; Mansory, Mansorah; Gonze, Prisca; Marlière, Nicolas; Winblad, Bengt; Graff, Caroline; Behbahani, Homira

    2016-02-01

    Accumulation of amyloid β-peptide (Aβ) in the brain is an important event in the pathogenesis of Alzheimer disease. We have used a transgenic mouse model expressing human amyloid precursor protein (APP) with the Arctic mutation to investigate whether Aβ deposition is correlated with mitochondrial functions in these animals. We found evidence of mitochondrial dysfunction (i.e., decreased mitochondrial membrane potential, increased production of reactive oxygen species and oxidative DNA damage) at 6 months of age, when the mice showed very mild Aβ deposition. More pronounced mitochondrial abnormalities were present in 24-month-old TgAPParc mice with more extensive Aβ pathology. This study demonstrates for the first time mitochondrial dysfunction in transgenic mice with a mutation within the Aβ peptide (the Arctic APP mutation), and confirms previous studies suggesting that mitochondrial dysfunction and oxidative stress is an early event in the pathogenesis of Alzheimer disease. This study demonstrates mitochondrial dysfunction in transgenic mice with a mutation within the amyloid beta (Aβ) peptide (the Arctic amyloid precursor protein (APP) mutation). We found evidence of mitochondrial dysfunction (i.e. decreased mitochondrial membrane potential (MMP), increased production of reactive oxygen species (ROS) and oxidative DNA damage) at 6 months of age, when very mild Aβ deposition is present in the mice. Also, the cytochrome c (COX) activity was significantly decreased in mitochondria from transgenic mice at 24 months of age.

  11. MicroRNA-7 Regulates the Function of Mitochondrial Permeability Transition Pore by Targeting VDAC1 Expression*

    PubMed Central

    Chaudhuri, Amrita Datta; Choi, Doo Chul; Kabaria, Savan; Tran, Alan

    2016-01-01

    Mitochondrial dysfunction is one of the major contributors to neurodegenerative disorders including Parkinson disease. The mitochondrial permeability transition pore is a protein complex located on the mitochondrial membrane. Under cellular stress, the pore opens, increasing the release of pro-apoptotic proteins, and ultimately resulting in cell death. MicroRNA-7 (miR-7) is a small non-coding RNA that has been found to exhibit a protective role in the cellular models of Parkinson disease. In the present study, miR-7 was predicted to regulate the function of mitochondria, according to gene ontology analysis of proteins that are down-regulated by miR-7. Indeed, miR-7 overexpression inhibited mitochondrial fragmentation, mitochondrial depolarization, cytochrome c release, reactive oxygen species generation, and release of mitochondrial calcium in response to 1-methyl-4-phenylpyridinium (MPP+) in human neuroblastoma SH-SY5Y cells. In addition, several of these findings were confirmed in mouse primary neurons. Among the mitochondrial proteins identified by gene ontology analysis, the expression of voltage-dependent anion channel 1 (VDAC1), a constituent of the mitochondrial permeability transition pore, was down-regulated by miR-7 through targeting 3′-untranslated region of VDAC1 mRNA. Similar to miR-7 overexpression, knockdown of VDAC1 also led to a decrease in intracellular reactive oxygen species generation and subsequent cellular protection against MPP+. Notably, overexpression of VDAC1 without the 3′-UTR significantly abolished the protective effects of miR-7 against MPP+-induced cytotoxicity and mitochondrial dysfunction, suggesting that the protective effect of miR-7 is partly exerted through promoting mitochondrial function by targeting VDAC1 expression. These findings point to a novel mechanism by which miR-7 accomplishes neuroprotection by improving mitochondrial health. PMID:26801612

  12. Differential expression of Ran GTPase during HMBA-induced differentiation in murine erythroleukemia cells.

    PubMed

    Vanegas, N; García-Sacristán, A; López-Fernández, L A; Párraga, M; del Mazo, J; Hernández, P; Schvartzman, J B; Krimer, D B

    2003-07-01

    Murine erythroleukemia (MEL) cells undergo erythroid differentiation in vitro when treated with hexamethylene bisacetamide (HMBA). To identify genes involved in the commitment of MEL cells to differentiate, we screened a cDNA library constructed from HMBA-induced cells by differential hybridization and isolated GTPase Ran as a down-regulated gene. We observed that Ran was expressed in a biphasic mode. Following a decrease in mRNA level during the initial hours of induction, Ran re-expressed at 24-48 h, and gradually declined again. To investigate the role of Ran during MEL differentiation we constructed MEL transfectants capable to express or block Ran mRNA production constitutively. No effects were observed on cell growth and proliferation. Blockage of Ran, however, interfered with MEL cell differentiation resulting in a decrease of cell survival in the committed population.

  13. Expression of deoxynucleoside kinases and 5'-nucleotidases in mouse tissues: implications for mitochondrial toxicity.

    PubMed

    Rylova, Svetlana N; Mirzaee, Saeedeh; Albertioni, Freidoun; Eriksson, Staffan

    2007-06-30

    Anti-HIV nucleoside therapy can result in mitochondrial toxicity affecting muscles, peripheral nerves, pancreas and adipose tissue. The cytosolic deoxycytidine kinase (dCK; EC 2.7.1.74) and thymidine kinase (TK1; EC 2.7.1.21), the mitochondrial thymidine kinase (TK2) and deoxyguanosine kinase (dGK; EC 2.7.1.113) as well as 5'-deoxynucleotidases (5'-dNT; EC 3.1.3.5) are enzymes that control rate-limiting steps in formation of intracellular and intra-mitochondrial nucleotides. The mRNA levels and activities of these enzymes were determined in mouse tissues, using real-time PCR and selective enzyme assays. The expression of mRNA for all these enzymes and the mitochondrial deoxynucleotide carrier was detected in all tissues with a 5-10-fold variation. TK1 activities were only clearly detected in spleen and testis, while TK2, dGK and dCK activities were found in all tissues. dGK activities were higher than any other dNK in all tissues, except spleen and testis. In skeletal muscle dGK activity was 5-fold lower, TK2 and dCK levels were 10-fold lower as compared with other tissues. The variation in 5'-dNT activities was about eight-fold with the highest levels in brain and lowest in brown fat. Thus, the salvage of deoxynucleosides in muscles is 5-10-fold lower as compared to other non-proliferating tissues and 100-fold lower compared to spleen. These results may help to explain tissue specific toxicity observed with nucleoside analogs used in HIV treatment as well as symptoms in inherited mitochondrial TK2 deficiencies.

  14. α-Syntrophin Modulates Myogenin Expression in Differentiating Myoblasts

    PubMed Central

    Kim, Min Jeong; Hwang, Sung Ho; Lim, Jeong A.; Froehner, Stanley C.; Adams, Marvin E.; Kim, Hye Sun

    2010-01-01

    Background α-Syntrophin is a scaffolding protein linking signaling proteins to the sarcolemmal dystrophin complex in mature muscle. However, α-syntrophin is also expressed in differentiating myoblasts during the early stages of muscle differentiation. In this study, we examined the relationship between the expression of α-syntrophin and myogenin, a key muscle regulatory factor. Methods and Findings The absence of α-syntrophin leads to reduced and delayed myogenin expression. This conclusion is based on experiments using muscle cells isolated from α-syntrophin null mice, muscle regeneration studies in α-syntrophin null mice, experiments in Sol8 cells (a cell line that expresses only low levels of α-syntrophin) and siRNA studies in differentiating C2 cells. In primary cultured myocytes isolated from α-syntrophin null mice, the level of myogenin was less than 50% that from wild type myocytes (p<0.005) 40 h after differentiation induction. In regenerating muscle, the expression of myogenin in the α-syntrophin null muscle was reduced to approximately 25% that of wild type muscle (p<0.005). Conversely, myogenin expression is enhanced in primary cultures of myoblasts isolated from a transgenic mouse over-expressing α-syntrophin and in Sol8 cells transfected with a vector to over-express α-syntrophin. Moreover, we find that myogenin mRNA is reduced in the absence of α-syntrophin and increased by α-syntrophin over-expression. Immunofluorescence microscopy shows that α-syntrophin is localized to the nuclei of differentiating myoblasts. Finally, immunoprecipitation experiments demonstrate that α-syntrophin associates with Mixed-Lineage Leukemia 5, a regulator of myogenin expression. Conclusions We conclude that α-syntrophin plays an important role in regulating myogenesis by modulating myogenin expression. PMID:21179410

  15. Myofibroblast differentiation and its functional properties are inhibited by nicotine and e-cigarette via mitochondrial OXPHOS complex III

    PubMed Central

    Lei, Wei; Lerner, Chad; Sundar, Isaac K.; Rahman, Irfan

    2017-01-01

    Nicotine is the major stimulant in tobacco products including e-cigarettes. Fibroblast to myofibroblast differentiation is a key process during wound healing and is dysregulated in lung diseases. The role of nicotine and e-cigarette derived nicotine on cellular functions including profibrotic response and other functional aspects is not known. We hypothesized that nicotine and e-cigarettes affect myofibroblast differentiation, gel contraction, and wound healing via mitochondria stress through nicotinic receptor-dependent mechanisms. To test the hypothesis, we exposed human lung fibroblasts with various doses of nicotine and e-cigarette condensate and determined myofibroblast differentiation, mitochondrial oxidative phosphorylation (OXPHOS), wound healing, and gel contraction at different time points. We found that both nicotine and e-cigarette inhibit myofibroblast differentiation as shown by smooth muscle actin and collagen type I, alpha 1 abundance. Nicotine and e-cigarette inhibited OXPHOS complex III accompanied by increased MitoROS, and this effect was augmented by complex III inhibitor antimycin A. These mitochondrial associated effects by nicotine resulted in inhibition of myofibroblast differentiation. These effects were associated with inhibition of wound healing and gel contraction suggesting that nicotine is responsible for dysregulated repair during injurious responses. Thus, our data suggest that nicotine causes dysregulated repair by inhibition of myofibroblast differentiation via OXPHOS pathway. PMID:28256533

  16. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  17. Apolipoprotein O expression in mouse liver enhances hepatic lipid accumulation by impairing mitochondrial function.

    PubMed

    Tian, Feng; Wu, Chen-Lu; Yu, Bi-Lian; Liu, Ling; Hu, Jia-Rui

    2017-09-09

    Apolipoprotein O (ApoO) was recently observed in the cellular mitochondrial inner membrane, which plays a role in mitochondrial function and is associated with myocardiopathy. Empirical information on the physiological functions of apoO is therefore limited. In this study, we aimed to elucidate the effect of apoO on hepatic fatty acid metabolism. An adenoviral vector expressing hApoO was constructed and introduced into chow diet and high-fat diet induced mice and the L02 human hepatoma cell line. High levels of hApoO mRNA and protein were detected in the liver, and the expression of lipid metabolism genes was significantly altered compared with negative controls. The liver function indices (serum ALT and AST) were clearly elevated, and the ultrastructure of cellular mitochondria was distinctly altered in the liver after apoO overexpression. Further, mitochondrial membrane potential decreased with hApoO treatment in L02 cells. These results establish a link between apoO and lipid accumulation and could suggest a new pathway for regulating non-alcoholic fatty liver disease progression. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Low feed efficient broilers within a single genetic line exhibit higher oxidative stress and protein expression in breast muscle with lower mitochondrial complex activity.

    PubMed

    Iqbal, M; Pumford, N R; Tang, Z X; Lassiter, K; Wing, T; Cooper, M; Bottje, W

    2004-03-01

    The objectives of this study were to determine the effects of low or high feed efficiency (FE) on a) protein oxidation, b) the activities of various respiratory chain complexes, and c) expression of various mitochondrial proteins in male broilers within a single genetic line. Tissue homogenate or mitochondria were isolated from breast muscle of broilers with high (0.80 +/- 0.01) and low FE (0.62 +/- 0.02). The complex activities were measured spectrophotometrically, and the levels of oxidized protein (carbonyl) and immunoreactive mitochondrial proteins were analyzed using Western blots. Protein carbonyl levels were higher in low FE compared with high FE broilers breast muscle, which indicated enhanced protein oxidation in low FE mitochondria. Activities of all respiratory chain complexes (I, II, III, IV) were higher in high FE compared with low FE broilers for breast mitochondria. Whereas the expression of immunoreactive proteins was higher in low FE muscle mitochondria for 5 mitochondrial proteins [core I, cyt c1, cyt b (complex III), COX II (cytochrome c oxidase subunit II, complex IV), and adenine nucleotide translocator (ANT1)], there were no differences between groups in the expression of 9 other respiratory chain protein subunits associated with complexex I, II, III, IV, and V. SDS-PAGE revealed a protein band of 47 kDa that was expressed at a higher level in low FE compared with high FE mitochondria. The differential expression of certain mitochondrial proteins and the 47-kDa band might be a compensatory response either to the lower complex activities or increased protein oxidation observed in low FE birds.

  19. Expression of a novel non-coding mitochondrial RNA in human proliferating cells

    PubMed Central

    Villegas, Jaime; Burzio, Veronica; Villota, Claudio; Landerer, Eduardo; Martinez, Ronny; Santander, Marcela; Martinez, Rodrigo; Pinto, Rodrigo; Vera, María I.; Boccardo, Enrique; Villa, Luisa L.; Burzio, Luis O.

    2007-01-01

    Previously, we reported the presence in mouse cells of a mitochondrial RNA which contains an inverted repeat (IR) of 121 nucleotides (nt) covalently linked to the 5′ end of the mitochondrial 16S RNA (16S mtrRNA). Here, we report the structure of an equivalent transcript of 2374 nt which is over-expressed in human proliferating cells but not in resting cells. The transcript contains a hairpin structure comprising an IR of 815 nt linked to the 5′ end of the 16S mtrRNA and forming a long double-stranded structure or stem and a loop of 40 nt. The stem is resistant to RNase A and can be detected and isolated after digestion with the enzyme. This novel transcript is a non-coding RNA (ncRNA) and several evidences suggest that the transcript is synthesized in mitochondria. The expression of this transcript can be induced in resting lymphocytes stimulated with phytohaemagglutinin (PHA). Moreover, aphidicolin treatment of DU145 cells reversibly blocks proliferation and expression of the transcript. If the drug is removed, the cells re-assume proliferation and over-express the ncmtRNA. These results suggest that the expression of the ncmtRNA correlates with the replicative state of the cell and it may play a role in cell proliferation. PMID:17962305

  20. Cholesterol can modulate mitochondrial aquaporin-8 expression in human hepatic cells.

    PubMed

    Danielli, Mauro; Capiglioni, Alejo M; Marrone, Julieta; Calamita, Giuseppe; Marinelli, Raúl A

    2017-05-01

    Hepatocyte mitochondrial aquaporin-8 (mtAQP8) works as a multifunctional membrane channel protein that facilitates the uptake of ammonia for its detoxification to urea as well as the mitochondrial release of hydrogen peroxide. Since early oligonucleotide microarray studies in liver of cholesterol-fed mice showed an AQP8 downregulation, we tested whether alterations of cholesterol content per se modulate mtAQP8 expression in human hepatocyte-derived Huh-7 cells. Cholesterol loading with methyl-β-cyclodextrin (mβCD):cholesterol complexes downregulated the proteolytic activation of cholesterol-responsive sterol regulatory element-binding protein (SREBP) transcriptions factors 1 and 2, and the expression of the target gene 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). Under such conditions, mtAQP8 mRNA and protein expressions were significantly reduced. In contrast, cholesterol depletion using mβCD alone increased SREBP-1 and 2 activation and upregulated HMGCR and mtAQP8 mRNA and protein expressions. The results suggest that cholesterol can regulate transcriptionally human hepatocyte mtAQP8 expression likely via SREBPs. The functional implications of our findings are discussed. © 2017 IUBMB Life, 69(5):341-346, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  1. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  2. Expression changes in mRNAs and mitochondrial damage in lens epithelial cells with selenite.

    PubMed

    Belusko, P B; Nakajima, T; Azuma, M; Shearer, T R

    2003-10-13

    An overdose of sodium selenite induces cataracts in young rats. The mid-stage events producing the cataract include calpain-induced hydrolysis and precipitation of lens proteins. Apoptosis in lens epithelial cells has been suggested as an initial event in selenite cataracts. Expression levels of two genes associated with apoptosis were altered in lens epithelial cells from selenite-injected rats. The purpose of the present experiment was to perform a more comprehensive search for changes in expression of mRNAs in lens epithelial cells in order to more fully delineate the early events in selenite-induced cataracts. Lens epithelial cells were harvested at 1 and 2 days after a single subcutaneous injection of sodium selenite (30 mumol/kg body weight) into 12-day-old rats. Gene expression was analyzed using a commercial DNA array (Rat Genome U34A GeneChip array, Affymetrix). Of approximately 8000 genes assayed by hybridization, 13 genes were decreased and 27 genes were increased in the rat lens epithelial cells after injection of selenite. Some of the up-regulated genes included apoptosis-related genes, and a majority of the down-regulated genes were mitochondrial genes. Previously observed changes in expression of EGR-1 mRNA were also confirmed. Changes in the expression patterns of mRNAs were also confirmed by RT-PCR. To determine the mechanism for damage of lens epithelial cells (alpha TN4 cell) by culture in selenite, leakage of cytochrome c from mitochondria was measured. Selenite caused significant leakage of cytochrome c into the cytosol of alpha TN4 cells. Our data suggested that the loss of integrity of lens epithelial cells by selenite might be caused by preferential down-regulation of mitochondrial RNAs, release of cytochrome c, and impaired mitochondrial function. Up-regulation of mRNAs involved in maintenance of DNA, regulation of metabolism, and induction of apoptosis may also play roles.

  3. Differential expression of somatostatin receptors in medulloblastoma.

    PubMed

    Guyotat, J; Champier, J; Pierre, G S; Jouvet, A; Bret, P; Brisson, C; Belin, M F; Signorelli, F; Montange, M F

    2001-01-01

    Somatostatin receptors have been found on a variety of tumours like neuroendocrine breast or brain tumours. Their detection opens new diagnostic and therapeutic paths. The aim of this work was to investigate their expression in medulloblastomas. Using both techniques, reverse transcriptase-polymerase chain reaction and immunohistochemistry, we analysed mRNA of different subtypes of somatostatin receptors in 15 medulloblastomas and the localisation of the subtype SSTR2 receptor at the cellular level in 13 medulloblastomas. All five subtypes mRNA were variably expressed in each medulloblastoma. The signal obtained after Southern blotting for SSTR2 receptor amplification was the highest as compared to the signal obtained for the other receptor subtypes. Immunostaining for SSTR2A receptor was present in every tumour specimen and was specifically located to the cellular membrane of neoplastic cells. No staining was identified at the level of peritumoral veins. The evidence of predominant expression of SSTR2 receptors in medulloblastomas opens interesting prospects for their diagnosis and therapy.

  4. Marked over expression of uncoupling protein-2 in beta cells exerts minor effects on mitochondrial metabolism

    SciTech Connect

    Hals, Ingrid K.; Ogata, Hirotaka; Pettersen, Elin; Ma, Zuheng; Bjoerklund, Anneli; Skorpen, Frank; Egeberg, Kjartan Wollo; Grill, Valdemar

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer The impact of UCP-2 over expression on mitochondrial function is controversial. Black-Right-Pointing-Pointer We tested mitochondrial functions at defined levels of overexpression. Black-Right-Pointing-Pointer We find minor increases of fatty acid oxidation and uncoupling. Black-Right-Pointing-Pointer Effects were seen only at high level (fourfold) of over expression. Black-Right-Pointing-Pointer Hence it is doubtful whether these effects are of importance in diabetes. -- Abstract: Evidence is conflicting as to the impact of elevated levels of uncoupling protein-2 (UCP-2) on insulin-producing beta cells. Here we investigated effects of a fourfold induction of UCP-2 protein primarily on mitochondrial parameters and tested for replication of positive findings at a lower level of induction. We transfected INS-1 cells to obtain a tet-on inducible cell line. A 48 h exposure to 1 {mu}g/ml of doxycycline (dox) induced UCP-2 fourfold (424 {+-} 113%, mean {+-} SEM) and 0.1 {mu}g/ml twofold (178 {+-} 29%, n = 3). Fourfold induced cells displayed normal viability (MTT, apoptosis), normal cellular insulin contents and, glucose-induced insulin secretion (+27 {+-} 11%) as well as D-[U-{sup 14}C]-glucose oxidation (+5 {+-} 9% at 11 mM glucose). Oxidation of [1-{sup 14}C]-oleate was increased from 4088 to 5797 fmol/{mu}g prot/2 h at 3.3 mM glucose, p < 0.03. Oxidation of L-[{sup 14}C(U)]-glutamine was unaffected. Induction of UCP-2 did not significantly affect measures of mitochondrial membrane potential (Rhodamine 123) or mitochondrial mass (Mitotracker Green) and did not affect ATP levels. Oligomycin-inhibited oxygen consumption (a measure of mitochondrial uncoupling) was marginally increased, the effect being significant in comparison with dox-only treated cells, p < 0.05. Oxygen radicals, assessed by dichlorofluorescin diacetate, were decreased by 30%, p < 0.025. Testing for the lower level of UCP-2 induction did not reproduce any of the

  5. Transcriptome-wide co-expression analysis identifies LRRC2 as a novel mediator of mitochondrial and cardiac function

    PubMed Central

    Leleu, Marion; Rowe, Glenn C.; Palygin, Oleg; Bukowy, John D.; Kuo, Judy; Rech, Monika; Hermans-Beijnsberger, Steffie; Schaefer, Sebastian; Adami, Eleonora; Creemers, Esther E.; Heinig, Matthias; Schroen, Blanche; Arany, Zoltan; Petretto, Enrico; Geurts, Aron M.

    2017-01-01

    Mitochondrial dysfunction contributes to myriad monogenic and complex pathologies. To understand the underlying mechanisms, it is essential to define the full complement of proteins that modulate mitochondrial function. To identify such proteins, we performed a meta-analysis of publicly available gene expression data. Gene co-expression analysis of a large and heterogeneous compendium of microarray data nominated a sub-population of transcripts that whilst highly correlated with known mitochondrial protein-encoding transcripts (MPETs), are not themselves recognized as generating proteins either localized to the mitochondrion or pertinent to functions therein. To focus the analysis on a medically-important condition with a strong yet incompletely understood mitochondrial component, candidates were cross-referenced with an MPET-enriched module independently generated via genome-wide co-expression network analysis of a human heart failure gene expression dataset. The strongest uncharacterized candidate in the analysis was Leucine Rich Repeat Containing 2 (LRRC2). LRRC2 was found to be localized to the mitochondria in human cells and transcriptionally-regulated by the mitochondrial master regulator Pgc-1α. We report that Lrrc2 transcript abundance correlates with that of β-MHC, a canonical marker of cardiac hypertrophy in humans and experimentally demonstrated an elevation in Lrrc2 transcript in in vitro and in vivo rodent models of cardiac hypertrophy as well as in patients with dilated cardiomyopathy. RNAi-mediated Lrrc2 knockdown in a rat-derived cardiomyocyte cell line resulted in enhanced expression of canonical hypertrophic biomarkers as well as increased mitochondrial mass in the context of increased Pgc-1α expression. In conclusion, our meta-analysis represents a simple yet powerful springboard for the nomination of putative mitochondrially-pertinent proteins relevant to cardiac function and enabled the identification of LRRC2 as a novel mitochondrially

  6. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  7. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  8. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  9. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia.

    PubMed

    Schrans-Stassen, B H; van de Kant, H J; de Rooij, D G; van Pelt, A M

    1999-12-01

    The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16%+/-2% (mean +/- SD), in VII 45%+/-15%, in IX/X 78%+/-14% and in XII 90%+/-1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.

  10. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  11. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.

    2015-01-01

    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor (http://bioconductor.org/). Contact: jtleek@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  12. Chlorpromazine inhibits mitochondrial apoptotic pathway via increasing expression of tissue factor.

    PubMed

    Wu, Jing; Li, Aimei; Li, Yujun; Li, Xiaoguang; Zhang, Qingmeng; Song, Wuqi; Wang, Yao; Ogutu, James O; Wang, Jindong; Li, Jianbo; Tang, Renkuan; Zhang, Fengmin

    2016-01-01

    Chlorpromazine (CPZ) is a widely used antipsychotic drug with antagonistic effect on dopamine receptors. Accumulating evidence has shown that CPZ plays a neuroprotective role in various models of toxicity and apoptosis. However, the underlying mechanism contributing to this protective effect remains unclear. Here, we evaluate the effect of CPZ on mitochondrial apoptotic pathway in the neuron system. Higher levels of B-cell lymphoma-2 (Bcl-2) and tissue factor (TF) but lower apoptotic rate were found in hippocampus of CPZ-treated schizophrenic patients compared with non-antipsychotic treated controls. Additionally, both short-term and long-term treatment of CPZ in rats could up-regulate the levels of Bcl-2 and TF with no cytotoxic effects. In the in vitro experiment, expression of Bcl-2 was up-regulated in the C6 glioma cells transfected with pEGFP-N1-TF recombinant plasmid. Furthermore, in another independent rat model of apoptosis, compared with the group administrated with alcohol only, the brains of the CPZ-pretreated rats showed lower expression of cleaved caspase-3, cytochrome c and Bax, but higher expression of Bcl-2 and TF. Our data demonstrate that CPZ exerts its neuronal protective effects through inhibiting the activation of mitochondrial apoptotic pathway by up-regulating TF expression, thus providing new insight into CPZ function and application. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Unbiased Gene Expression Analysis Implicates the huntingtin Polyglutamine Tract in Extra-mitochondrial Energy Metabolism

    PubMed Central

    Lee, Jong-Min; Ivanova, Elena V; Seong, Ihn Sik; Cashorali, Tanya; Kohane, Isaac; Gusella, James F; MacDonald, Marcy E

    2007-01-01

    The Huntington's disease (HD) CAG repeat, encoding a polymorphic glutamine tract in huntingtin, is inversely correlated with cellular energy level, with alleles over ∼37 repeats leading to the loss of striatal neurons. This early HD neuronal specificity can be modeled by respiratory chain inhibitor 3-nitropropionic acid (3-NP) and, like 3-NP, mutant huntingtin has been proposed to directly influence the mitochondrion, via interaction or decreased PGC-1α expression. We have tested this hypothesis by comparing the gene expression changes due to mutant huntingtin accurately expressed in STHdhQ111/Q111 cells with the changes produced by 3-NP treatment of wild-type striatal cells. In general, the HD mutation did not mimic 3-NP, although both produced a state of energy collapse that was mildly alleviated by the PGC-1α-coregulated nuclear respiratory factor 1 (Nrf-1). Moreover, unlike 3-NP, the HD CAG repeat did not significantly alter mitochondrial pathways in STHdhQ111/Q111 cells, despite decreased Ppargc1a expression. Instead, the HD mutation enriched for processes linked to huntingtin normal function and Nf-κB signaling. Thus, rather than a direct impact on the mitochondrion, the polyglutamine tract may modulate some aspect of huntingtin's activity in extra-mitochondrial energy metabolism. Elucidation of this HD CAG-dependent pathway would spur efforts to achieve energy-based therapeutics in HD. PMID:17708681

  14. Depletion of mitochondrial DNA by down-regulation of deoxyguanosine kinase expression in non-proliferating HeLa cells

    SciTech Connect

    Franco, Maribel; Johansson, Magnus . E-mail: magnus.johansson@ki.se; Karlsson, Anna

    2007-07-15

    Purine deoxyribonucleotides required for mitochondrial DNA replication are either imported from the cytosol or derived from phosphorylation of deoxyadenosine or deoxyguanosine catalyzed by mitochondrial deoxyguanosine kinase (DGUOK). DGUOK deficiency has been linked to mitochondrial DNA depletion syndromes suggesting an important role for this enzyme in dNTP supply. We have generated HeLa cell lines with 20-30% decreased levels of DGUOK mRNA by the expression of small interfering RNAs directed towards the DGUOK mRNA. The cells with decreased expression of the enzyme showed similar levels of mtDNA as control cells when grown exponentially in culture. However, mtDNA levels rapidly decreased in the cells when cell cycle arrest was induced by serum starvation. DNA incorporation of 9-{beta}-D-arabino-furanosylguanine (araG) was lower in the cells with decreased deoxyguanosine kinase expression, but the total rate of araG phosphorylation was increased in the cells. The increase in araG phosphorylation was shown to be due to increased expression of deoxycytidine kinase. In summary, our findings show that DGUOK is required for mitochondrial DNA replication in resting cells and that small changes in expression of this enzyme may cause mitochondrial DNA depletion. Our data also suggest that alterations in the expression level of DGUOK may induce compensatory changes in the expression of other nucleoside kinases.

  15. Systematic expression analysis of the mitochondrial complex III subunits identifies UQCRC1 as biomarker in clear cell renal cell carcinoma

    PubMed Central

    Ellinger, Jörg; Gromes, Arabella; Poss, Mirjam; Brüggemann, Maria; Schmidt, Doris; Ellinger, Nadja; Tolkach, Yuri; Dietrich, Dimo; Kristiansen, Glen; Müller, Stefan C.

    2016-01-01

    Mitochondrial dysfunction is common in cancer, and the mitochondrial electron transport chain is often affected in carcinogenesis. So far, few is known about the expression of the mitochondrial complex III (ubiquinol-cytochrome c reductase complex) subunits in clear cell renal cell carcinoma (ccRCC). In this study, the NextBio database was used to determine an expression profile of the mitochondrial complex III subunits based on published microarray studies. We observed that five out of 11 subunits of the complex III were downregulated in at least three microarray studies. The decreased mRNA expression level of UQCRFS1 and UQCRC1 in ccRCC was confirmed using PCR. Low mRNA levels UQCRC1 were also correlated with a shorter period of cancer-specific and overall survival. Furthermore, UQCRFS1 and UQCRC1 were also decreased in ccRCC on the protein level as determined using Western blotting and immunohistochemistry. UQCRC1 protein expression was also lower in ccRCC than in papillary and chromophobe subtypes. Analyzing gene expression and DNA methylation in The Cancer Genome Atlas cohort revealed an inverse correlation of gene expression and DNA methylation, suggesting that DNA hypermethylation is regulating the expression of UQCRC1 and UQCRFS1. Taken together, our data implicate that dysregulated UQCRC1 and UQCRFS1 are involved in impaired mitochondrial electron transport chain function. PMID:27845902

  16. What Is Mitochondrial DNA?

    MedlinePlus

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  17. Differentially expressed genes in Hirudo medicinalis ganglia after acetyl-L-carnitine treatment.

    PubMed

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-L-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer's disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism.

  18. Differentially Expressed Genes in Hirudo medicinalis Ganglia after Acetyl-L-Carnitine Treatment

    PubMed Central

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-l-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer’s disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism. PMID:23308261

  19. Differential Expression and Network Inferences through Functional Data Modeling

    PubMed Central

    Telesca, Donatello; Inoue, Lurdes Y.T.; Neira, Mauricio; Etzioni, Ruth; Gleave, Martin; Nelson, Colleen

    2010-01-01

    Time–course microarray data consist of mRNA expression from a common set of genes collected at different time points. Such data are thought to reflect underlying biological processes developing over time. In this article we propose a model that allows us to examine differential expression and gene network relationships using time course microarray data. We model each gene expression profile as a random functional transformation of the scale, amplitude and phase of a common curve. Inferences about the gene–specific amplitude parameters allow us to examine differential gene expression. Inferences about measures of functional similarity based on estimated time transformation functions allow us to examine gene networks while accounting for features of the gene expression profiles. We discuss applications to simulated data as well as to microarray data on prostate cancer progression. PMID:19053995

  20. Differential Expression of Cysteine Dioxygenase 1 in Complex Karyotype Liposarcomas

    PubMed Central

    Shaker, Mohammed; Pascarelli, Kara M; Plantinga, Matthew J; Love, Miles A; Lazar, Alexander J; Ingram, Davis R; von Mehren, Margaret; Lev, Dina; Kipling, David; Broccoli, Dominique

    2014-01-01

    Altered cysteine dioxygenase 1 (CDO1) gene expression has been observed in several cancers but has not yet been investigated in liposarcomas. The aim of this study was to evaluate CDO1 expression in a cohort of liposarcomas and to determine its association with clinicopathological features. Existing microarray data indicated variable CDO1 expression in liposarcoma subtypes. CDO1 mRNA from a larger cohort of liposarcomas was quantified by real time-PCR, and CDO1 protein expression was determined by immunohistochemistry (IHC) in more than 300 tumor specimens. Well-differentiated liposarcomas (WDLSs) had significantly higher CDO1 gene expression and protein levels than dedifferentiated liposarcomas (DDLSs) (P < 0.001). Location of the tumor was not predictive of the expression level of CDO1 mRNA in any histological subtype of liposarcoma. Recurrent tumors did not show any difference in CDO1 expression when compared to primary tumors. CDO1 expression was upregulated as human mesenchymal stem cells (hMSCs) undergo differentiation into mature adipocytes. Our results suggest that CDO1 is a marker of liposarcoma progression and adipogenic differentiation. PMID:24741338

  1. Population-level expression variability of mitochondrial DNA-encoded genes in humans

    PubMed Central

    Wang, Gang; Yang, Ence; Mandhan, Ishita; Brinkmeyer-Langford, Candice L; Cai, James J

    2014-01-01

    Human mitochondria contain multiple copies of a circular genome made up of double-stranded DNA (mtDNA) that encodes proteins involved in cellular respiration. Transcript abundance of mtDNA-encoded genes varies between human individuals, yet the level of variation in the general population has not been systematically assessed. In the present study, we revisited large-scale RNA sequencing data generated from lymphoblastoid cell lines of HapMap samples of European and African ancestry to estimate transcript abundance and quantify expression variation for mtDNA-encoded genes. In both populations, we detected up to over 100-fold difference in mtDNA gene expression between individuals. The marked variation was not due to differences in mtDNA copy number between individuals, but was shaped by the transcription of hundreds of nuclear genes. Many of these nuclear genes were co-expressed with one another, resulting in a module-enriched co-expression network. Significant correlations in expression between genes of the mtDNA and nuclear genomes were used to identify factors involved with the regulation of mitochondrial functions. In conclusion, we determined the baseline amount of variability in mtDNA gene expression in general human populations and cataloged a complete set of nuclear genes whose expression levels are correlated with those of mtDNA-encoded genes. Our findings will enable the integration of information from both mtDNA and nuclear genetic systems, and facilitate the discovery of novel regulatory pathways involving mitochondrial functions. PMID:24398800

  2. Pomelo II: finding differentially expressed genes.

    PubMed

    Morrissey, Edward R; Diaz-Uriarte, Ramón

    2009-07-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool.

  3. Pomelo II: finding differentially expressed genes

    PubMed Central

    Morrissey, Edward R.; Diaz-Uriarte, Ramón

    2009-01-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool. PMID:19435879

  4. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  5. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    PubMed Central

    Barrey, Eric; Mucher, Elodie; Jeansoule, Nicolas; Larcher, Thibaut; Guigand, Lydie; Herszberg, Bérénice; Chaffaux, Stéphane; Guérin, Gérard; Mata, Xavier; Benech, Philippe; Canale, Marielle; Alibert, Olivier; Maltere, Péguy; Gidrol, Xavier

    2009-01-01

    Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM). It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA) and 5 heterozygous (GA) PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p < 0.05). The following genes were up-regulated over 2 fold: IL18, CTSS, LUM, CD44, FN1, GST01. The most down-regulated genes were the following: mitochondrial tRNA, SLC2A2, PRKCα, VEGFα. Data mining analysis showed that protein synthesis, apoptosis, cellular movement, growth and proliferation were the main cellular functions significantly associated with the modulated genes (p < 0.05). Several up-regulated genes, especially IL18, revealed a severe muscular inflammation in PSSM muscles. The up-regulation of glycogen synthase kinase-3 (GSK3β) under its active form could be responsible for glycogen synthase (GYS1) inhibition and hypoxia-inducible factor

  6. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.

    PubMed

    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei

    2015-05-01

    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  7. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  8. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  9. Re-designed N-terminus enhances expression, solubility and crystallizability of mitochondrial protein.

    PubMed

    Gaudry, Agnès; Lorber, Bernard; Neuenfeldt, Anne; Sauter, Claude; Florentz, Catherine; Sissler, Marie

    2012-09-01

    Mitochondrial aminoacyl-tRNA synthetases are key enzymes in translation. They are encoded by the nuclear genome, synthesized as precursors in the cytosol and imported. Most are matured by cleavage of their N-terminal targeting sequence. The poor expression of mature proteins in prokaryotic systems, along with their low solubility and stability after purification are major obstacles for biophysical and crystallographic studies. The purpose of the present work was to analyze the influence of additives on a slightly soluble aspartyl-tRNA synthetase and of the N-terminal sequence of the protein on its expression and solubility. On the one hand, the solubility of the enzyme was augmented to some extent in the presence of a chemical analog of the intermediary product aspartyl-adenylate, 5'-O-[N-(L aspartyl) sulfamoyl] adenosine. On the other hand, expression was enhanced by extending the N-terminus by seven natural amino acids from the predicted targeting sequence. The re-designed enzyme was active, monodisperse, more soluble and yielded crystals that are suitable for structure determination. This result underlines the importance of the N-terminal residue sequence for solubility. It suggests that additional criteria should be taken into account for the prediction of cleavage sites in mitochondrial targeting sequences.

  10. Functional characterization of an N-terminally-truncated mitochondrial porin expressed in Neurospora crassa.

    PubMed

    Shuvo, Sabbir R; Kovaltchouk, Uliana; Zubaer, Abdullah; Kumar, Ayush; Summers, William A T; Donald, Lynda J; Hausner, Georg; Court, Deborah A

    2017-08-01

    Mitochondrial porin, which forms voltage-dependent anion-selective channels (VDAC) in the outer membrane, can be folded into a 19-β-stranded barrel. The N terminus of the protein is external to the barrel and contains α-helical structure. Targeted modifications of the N-terminal region have been assessed in artificial membranes, leading to different models for gating in vitro. However, the in vivo requirements for gating and the N-terminal segment of porin are less well-understood. Using Neurospora crassa porin as a model, the effects of a partial deletion of the N-terminal segment were investigated. The protein, ΔN2-12porin, is assembled into the outer membrane, albeit at lower levels than the wild-type protein. The resulting strain displays electron transport chain deficiencies, concomitant expression of alternative oxidase, and decreased growth rates. Nonetheless, its mitochondrial genome does not contain any significant mutations. Most of the genes that are expressed in high levels in porin-less N. crassa are expressed at levels similar to that of wild type or are slightly increased in ΔN2-12porin strains. Thus, although the N-terminal segment of VDAC is required for complete function in vivo, low levels of a protein lacking part of the N terminus are able to rescue some of the defects associated with the absence of porin.

  11. Differentiation of the dragonfly genus Davidius (Odonata: Gomphidae) in Japan inferred from mitochondrial and nuclear gene genealogies.

    PubMed

    Kiyoshi, Takuya; Sota, Teiji

    2006-01-01

    To infer the differentiation of Japanese Davidius dragonflies, we investigated the genealogies of the mitochondrial cytochrome oxidase subunit I gene (COI) and the nuclear ribosomal RNA gene region encompassing 18S, ITS1, 5.8S, and ITS2 sequences for three species endemic to Japan--Davidius nanus, D. fujiama, and D. moiwanus--as well as D. lunatus from the Korean Peninsula. According to the mitochondrial and nuclear gene genealogies, D. nanus and D. moiwanus are closely related and are sister to the continental species D. lunatus, whereas D. fujiama differentiated from an ancestor of the other three species. Although the mitochondrial DNA data did not resolve the relationships between D. nanus and three D. moiwanus subspecies, the nuclear DNA data indicate the monophyly of D. moiwanus and its subspecies. The nuclear gene genealogy suggests that isolated wetlands used by larval D. moiwanus derive from the ancestral riverine habitats of D. nanus and other Davidius species. The COI sequence divergence among local populations was much greater in D. moiwanus than in D. nanus, which may be the result of differences in the dispersal ranges associated with the habitat types of these species.

  12. Declines in Drp1 and parkin expression underlie DNA damage-induced changes in mitochondrial length and neuronal death.

    PubMed

    Wang, David B; Garden, Gwenn A; Kinoshita, Chizuru; Wyles, Cody; Babazadeh, Nasim; Sopher, Bryce; Kinoshita, Yoshito; Morrison, Richard S

    2013-01-23

    Maintaining proper mitochondrial length is essential for normal mitochondrial function in neurons. Mitochondrial fragmentation has been associated with neuronal cell death caused by a variety of experimental toxic stressors. Despite the fact that oxidative stress is a hallmark of neurodegenerative conditions and aging and the resulting activation of p53 is believed to contribute to the neuropathology, little is still known regarding changes in mitochondrial morphology in p53-dependent neuronal death. Therefore, we specifically addressed the relationship between genotoxic stress, p53 activation, and the regulation of mitochondrial morphology in neurons. In cultured postnatal mouse cortical neurons, treatment with the DNA-damaging agent camptothecin (CPT) resulted in elongated mitochondria, in contrast to fragmented mitochondria observed upon staurosporine and glutamate treatment. In fibroblasts, however, CPT resulted in fragmented mitochondria. CPT treatment in neurons suppressed expression of the mitochondrial fission protein Drp1 and the E3 ubiquitin ligase parkin. The presence of elongated mitochondria and the declines in Drp1 and parkin expression occurred before the commitment point for apoptosis. The CPT-induced changes in Drp1 and parkin were not observed in p53-deficient neurons, while p53 overexpression alone was sufficient to reduce the expression of the two proteins. Elevating Drp1 or parkin expression before CPT treatment enhanced neuronal viability and restored a normal pattern of mitochondrial morphology. The present findings demonstrate that genotoxic stress in neurons results in elongated mitochondria in contrast to fission induced by other forms of stress, and p53-dependent declines in Drp1 and parkin levels contribute to altered mitochondrial morphology and cell death.

  13. Expression of Molecular Differentiation Markers Does Not Correlate with Histological Differentiation Grade in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Demarez, Céline; Hubert, Catherine; Sempoux, Christine; Lemaigre, Frédéric P.

    2016-01-01

    The differentiation status of tumor cells, defined by histomorphological criteria, is a prognostic factor for survival of patients affected with intrahepatic cholangiocarcinoma (ICC). To strengthen the value of morphological differentiation criteria, we wished to correlate histopathological differentiation grade with expression of molecular biliary differentiation markers and of microRNAs previously shown to be dysregulated in ICC. We analysed a series of tumors that were histologically classified as well, moderately or poorly differentiated, and investigated the expression of cytokeratin 7, 19 and 903 (CK7, CK19, CK903), SRY-related HMG box transcription factors 4 and 9 (SOX4, SOX9), osteopontin (OPN), Hepatocyte Nuclear Factor-1 beta (HNF1β), Yes-associated protein (YAP), Epithelial cell adhesion molecule (EPCAM), Mucin 1 (MUC1) and N-cadherin (NCAD) by qRT-PCR and immunostaining, and of miR-31, miR-135b, miR-132, miR-200c, miR-221 and miR-222. Unexpectedly, except for subcellular location of SOX9 and OPN, no correlation was found between the expression levels of these molecular markers and histopathological differentiation grade. Therefore, our data point toward necessary caution when investigating the evolution and prognosis of ICC on the basis of cell differentiation criteria. PMID:27280413

  14. Differential expression of microRNAs in mouse embryonic bladder

    SciTech Connect

    Liu, Benchun; Cunha, Gerald R.; Baskin, Laurence S.

    2009-08-07

    MicroRNAs (miRNAs) are involved in several biological processes including development, differentiation and proliferation. Analysis of miRNA expression patterns in the process of embryogenesis may have substantial value in determining the mechanism of embryonic bladder development as well as for eventual therapeutic intervention. The miRNA expression profiles are distinct among the cellular types and embryonic stages as demonstrated by microarray technology and validated by quantitative real-time RT-PCR approach. Remarkably, the miRNA expression patterns suggested that unique miRNAs from epithelial and submucosal areas are responsible for mesenchymal cellular differentiation, especially regarding bladder smooth muscle cells. Our data show that miRNA expression patterns are unique in particular cell types of mouse bladder at specific developmental stages, reflecting the apparent lineage and differentiation status within the embryonic bladder. The identification of unique miRNAs expression before and after smooth muscle differentiation in site-specific area of the bladder indicates their roles in embryogenesis and may aid in future clinical intervention.

  15. The Bicoid Stability Factor Controls Polyadenylation and Expression of Specific Mitochondrial mRNAs in Drosophila melanogaster

    PubMed Central

    Grönke, Sebastian; Stewart, James B.; Mourier, Arnaud; Ruzzenente, Benedetta; Kukat, Christian; Wibom, Rolf; Habermann, Bianca; Partridge, Linda; Larsson, Nils-Göran

    2011-01-01

    The bicoid stability factor (BSF) of Drosophila melanogaster has been reported to be present in the cytoplasm, where it stabilizes the maternally contributed bicoid mRNA and binds mRNAs expressed from early zygotic genes. BSF may also have other roles, as it is ubiquitously expressed and essential for survival of adult flies. We have performed immunofluorescence and cell fractionation analyses and show here that BSF is mainly a mitochondrial protein. We studied two independent RNAi knockdown fly lines and report that reduced BSF protein levels lead to a severe respiratory deficiency and delayed development at the late larvae stage. Ubiquitous knockdown of BSF results in a severe reduction of the polyadenylation tail lengths of specific mitochondrial mRNAs, accompanied by an enrichment of unprocessed polycistronic RNA intermediates. Furthermore, we observed a significant reduction in mRNA steady state levels, despite increased de novo transcription. Surprisingly, mitochondrial de novo translation is increased and abnormal mitochondrial translation products are present in knockdown flies, suggesting that BSF also has a role in coordinating the mitochondrial translation in addition to its role in mRNA maturation and stability. We thus report a novel function of BSF in flies and demonstrate that it has an important intra-mitochondrial role, which is essential for maintaining mtDNA gene expression and oxidative phosphorylation. PMID:22022283

  16. Interactive effects of dietary lipid and phenotypic feed efficiency on the expression of nuclear and mitochondrial genes involved in the mitochondrial electron transport chain in rainbow trout.

    PubMed

    Eya, Jonathan C; Ukwuaba, Vitalis O; Yossa, Rodrigue; Gannam, Ann L

    2015-04-07

    A 2 × 3 factorial study was conducted to evaluate the effects of dietary lipid level on the expression of mitochondrial and nuclear genes involved in electron transport chain in all-female rainbow trout Oncorhynchus mykiss. Three practical diets with a fixed crude protein content of 40%, formulated to contain 10% (40/10), 20% (40/20) and 30% (40/30) dietary lipid, were fed to apparent satiety to triplicate groups of either low-feed efficient (F120; 217.66 ± 2.24 g initial average mass) or high-feed efficient (F136; 205.47 ± 1.27 g) full-sib families of fish, twice per day, for 90 days. At the end of the experiment, the results showed that there is an interactive effect of the dietary lipid levels and the phenotypic feed efficiency (growth rate and feed efficiency) on the expression of the mitochondrial genes nd1 (NADH dehydrogenase subunit 1), cytb (Cytochrome b), cox1 (Cytochrome c oxidase subunits 1), cox2 (Cytochrome c oxidase subunits 2) and atp6 (ATP synthase subunit 6) and nuclear genes ucp2α (uncoupling proteins 2 alpha), ucp2β (uncoupling proteins 2 beta), pparα (peroxisome proliferator-activated receptor alpha), pparβ (peroxisome proliferatoractivated receptor beta) and ppargc1α (proliferator-activated receptor gamma coactivator 1 alpha) in fish liver, intestine and muscle, except on ppargc1α in the muscle which was affected by the diet and the family separately. Also, the results revealed that the expression of mitochondrial genes is associated with that of nuclear genes involved in electron transport chain in fish liver, intestine and muscle. Furthermore, this work showed that the expression of mitochondrial genes parallels with the expression of genes encoding uncoupling proteins (UCP) in the liver and the intestine of rainbow trout. This study for the first time presents the molecular basis of the effects of dietary lipid level on mitochondrial and nuclear genes involved in mitochondrial electron transport chain in fish.

  17. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout

    PubMed Central

    Eya, Jonathan C.; Ukwuaba, Vitalis O.; Yossa, Rodrigue; Gannam, Ann L.

    2015-01-01

    A 2 × 3 factorial study was conducted to evaluate the effects of dietary lipid level on the expression of mitochondrial and nuclear genes involved in electron transport chain in all-female rainbow trout Oncorhynchus mykiss. Three practical diets with a fixed crude protein content of 40%, formulated to contain 10% (40/10), 20% (40/20) and 30% (40/30) dietary lipid, were fed to apparent satiety to triplicate groups of either low-feed efficient (F120; 217.66 ± 2.24 g initial average mass) or high-feed efficient (F136; 205.47 ± 1.27 g) full-sib families of fish, twice per day, for 90 days. At the end of the experiment, the results showed that there is an interactive effect of the dietary lipid levels and the phenotypic feed efficiency (growth rate and feed efficiency) on the expression of the mitochondrial genes nd1 (NADH dehydrogenase subunit 1), cytb (Cytochrome b), cox1 (Cytochrome c oxidase subunits 1), cox2 (Cytochrome c oxidase subunits 2) and atp6 (ATP synthase subunit 6) and nuclear genes ucp2α (uncoupling proteins 2 alpha), ucp2β (uncoupling proteins 2 beta), pparα (peroxisome proliferator-activated receptor alpha), pparβ (peroxisome proliferatoractivated receptor beta) and ppargc1α (proliferator-activated receptor gamma coactivator 1 alpha) in fish liver, intestine and muscle, except on ppargc1α in the muscle which was affected by the diet and the family separately. Also, the results revealed that the expression of mitochondrial genes is associated with that of nuclear genes involved in electron transport chain in fish liver, intestine and muscle. Furthermore, this work showed that the expression of mitochondrial genes parallels with the expression of genes encoding uncoupling proteins (UCP) in the liver and the intestine of rainbow trout. This study for the first time presents the molecular basis of the effects of dietary lipid level on mitochondrial and nuclear genes involved in mitochondrial electron transport chain in fish. PMID:25853266

  18. Characterization of unique and differentially expressed proteins in anthracnose-tolerant Florida hybrid bunch grapes.

    PubMed

    Vasanthaiah, Hemanth K N; Katam, Ramesh; Basha, Sheikh M

    2009-06-01

    Anthracnose is a major disease in Florida hybrid bunch grapes, caused by a fungus viz. Elsinoe ampelina. Florida hybrid bunch grapes are grown in southeastern USA for their superior wine characteristics. However, the effect of anthracnose on grape productivity and wine quality is a major concern to grape growers. Our research is aimed at determining biochemical basis of anthracnose tolerance in Florida hybrid bunch grape. Leaf samples were collected from the plants infected with E. ampelina at different periods and analyzed for differential protein expression using high throughput two-dimensional gel electrophoresis. Among the 32 differentially expressed leaf proteins, two were uniquely expressed in tolerant genotypes in response to E. ampelina infection. These proteins were identified as mitochondrial adenosine triphosphate synthase and glutamine synthetase, which are known to play a major role in carbohydrate metabolism and defense. Several proteins including ribulose 1-5 bisphosphate-carboxylase involved in photosynthesis were found to be suppressed in susceptible genotypes compared to tolerant genotypes following E. ampelina infection. The results indicate that the anthracnose-tolerant genotypes have the ability to up-regulate and induce new proteins upon infection to defend the invasion of the pathogen as well as maintain the normal regulatory processes.

  19. Differentially-Expressed Pseudogenes in HIV-1 Infection

    PubMed Central

    Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

    2015-01-01

    Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

  20. Differential Expression Profile of MicroRNAs during Differentiation of Cardiomyocytes Exposed to Polychlorinated Biphenyls

    PubMed Central

    Zhu, Chun; Yu, Zhang-Bin; Zhu, Jin-Gai; Hu, Xiao-Shan; Chen, Yu-Lin; Qiu, Yu-Fang; Xu, Zheng-Feng; Qian, Lin-Mei; Han, Shu-Ping

    2012-01-01

    Exposure to persistent environmental pollutants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of congenital heart defects. MicroRNAs (miRNAs) have been shown to be involved in cardiac development. The objective of this study was to investigate changes in miRNA expression profiles during the differentiation of cardiomyocytes exposed to PCBs. For that purpose, PCBs (Aroclor 1254) at a concentration of 2.5 μmol/L were added on day 0 of differentiation of P19 mouse embryonal carcinoma cells into cardiac myocytes. The relative expression of miRNA genes was determined by miRNA microarray and real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) analyses. The microarray results revealed that 45 miRNAs, of which 14 were upregulated and 31 were downregulated, were differentially expressed in P19 cells treated with PCBs compared with control cells. The miRNA expression data was validated with real-time RT-PCR. The expression of certain potential target genes (Wnt1) was found to be reduced in P19 cells treated with PCBs, whereas the expression of other potential predicted target genes (GSK3β) was increased. Our results demonstrate a critical role of miRNAs in mediating the effect of PCBs during the differentiation of P19 cells into cardiac myocytes. PMID:23443104

  1. Differential Expression of CXCL12 and CXCR4 During Human Fetal Neural Progenitor Cell Differentiation

    PubMed Central

    Peng, Hui; Kolb, Ryan; Kennedy, J. E.

    2007-01-01

    Stromal cell-derived factor 1 alpha (SDF-1α, CXCL12) and its receptor CXCR4 play an important role in the central nervous system (CNS) development and adulthood by mediating cell migration, enhancing precursor cell proliferation, assisting in neuronal circuit formation, and possibly regulating migration during repair. The expression pattern of CXCR4 and CXCL12 during neurogenesis has not been thoroughly elucidated. In this study, we investigated the expression of CXCL12 and CXCR4 during neural progenitor cells (NPC) differentiation by microarray analysis and reverse transcriptase-polymerase chain reaction (RT-PCR) using human fetal NPC as a model system. The production of CXCL12 was measured by enzyme-linked immunosorbent assay (ELISA). CXCR4 expression was determined by florescence-activated cell sorting (FACS) analysis, immunocytochemical staining, and CXCR4-mediated inhibition of cyclic AMP (cAMP) accumulation. Our data demonstrated that CXCR4 expression is significantly upregulated when NPC are differentiated into neuronal precursors, whereas CXCL12 is upregulated when differentiated into astrocytes. We also provide evidence that CXCR4 localization changes as neurons mature. In neuronal precursors, CXCR4 is localized in both neuronal processes and the cell body, whereas in mature neurons, it is primarily expressed on axons and dendrites. This differential expression of CXCR4 and CXCL12 may be important for the temporal regulation of neuronal migration and circuit formation during development and possibly in adult neurogenesis and repair. PMID:18040858

  2. From 'differential expression' to 'differential networking' - identification of dysfunctional regulatory networks in diseases.

    PubMed

    de la Fuente, Alberto

    2010-07-01

    Understanding diseases requires identifying the differences between healthy and affected tissues. Gene expression data have revolutionized the study of diseases by making it possible to simultaneously consider thousands of genes. The identification of disease-associated genes requires studying the genes in the context of the regulatory systems they are involved in. A major goal is to identify specific regulatory networks that are dysfunctional in a given disease state. Although we still have not reached a stage where the elucidation of differential regulatory networks is commonly feasible, recent advances have described the first steps towards this goal - the identification of differential coexpression networks. This review describes the shift from differential gene expression to differential networking and outlines how this shift will affect the study of the genetic basis of disease.

  3. PGC-1 alpha regulates HO-1 expression, mitochondrial dynamics and biogenesis: Role of epoxyeicosatrienoic acid.

    PubMed

    Singh, Shailendra P; Schragenheim, Joseph; Cao, Jian; Falck, John R; Abraham, Nader G; Bellner, Lars

    2016-09-01

    Obesity is a risk factor in the development of type 2 diabetes mellitus (DM2), which is associated with increased morbidity and mortality, predominantly as a result of cardiovascular complications. Increased adiposity is a systemic condition characterized by increased oxidative stress (ROS), increased inflammation, inhibition of anti-oxidant genes such as HO-1 and increased degradation of epoxyeicosatrienoic acids (EETs). We previously demonstrated that EETs attenuate mitochondrial ROS. We postulate that EETs increase peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), which controls mitochondrial function, oxidative metabolism and induction of HO-1. Cultured murine adipocytes and mice fed a high fat (HF) diet were used to assess functional relationship between EETs, HO-1 and (PGC-1α) using an EET analogue (EET-A) and lentivirus to knock down the PPARGC1A gene. EET-A increased PGC-1α and HO-1 in cultured adipocytes and increased the expression of genes involved in thermogenesis and adipocyte browning (UCP1 and PRDM16, respectively). PGC-1α knockdown prevented EET-A-induced HO-1expression, suggesting that PGC-1α is upstream of HO-1. MRI data obtained from fat tissues showed that EET-A administration to mice on a HF diet significantly reduced total body fat content, subcutaneous and visceral fat deposits and reduced the VAT: SAT ratio. Moreover EET-A normalized the VO2 and RQ (VCO2/VO2) in mice fed a HF diet, an effect that was completely prevented in PGC-1α deficient mice. In addition, EET-A increased mitochondrial biogenesis and function as measured by OPA1, MnSOD, Mfn1, Mfn2, and SIRT3, an effect that was inhibited by knockdown of PGC-1α. Taken together, our findings show that EET-A increased PGC-1α thereby increasing mitochondrial viability, increased fusion potential thereby providing metabolic protection and increased VO2 consumption in HF-induced obesity in mice, thus demonstrating that the EET-mediated increase in HO-1

  4. Pathways and genes differentially expressed in the motor cortex of patients with sporadic amyotrophic lateral sclerosis

    PubMed Central

    Lederer, Carsten W; Torrisi, Antonietta; Pantelidou, Maria; Santama, Niovi; Cavallaro, Sebastiano

    2007-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a fatal disorder caused by the progressive degeneration of motoneurons in brain and spinal cord. Despite identification of disease-linked mutations, the diversity of processes involved and the ambiguity of their relative importance in ALS pathogenesis still represent a major impediment to disease models as a basis for effective therapies. Moreover, the human motor cortex, although critical to ALS pathology and physiologically altered in most forms of the disease, has not been screened systematically for therapeutic targets. Results By whole-genome expression profiling and stringent significance tests we identify genes and gene groups de-regulated in the motor cortex of patients with sporadic ALS, and interpret the role of individual candidate genes in a framework of differentially expressed pathways. Our findings emphasize the importance of defense responses and cytoskeletal, mitochondrial and proteasomal dysfunction, reflect reduced neuronal maintenance and vesicle trafficking, and implicate impaired ion homeostasis and glycolysis in ALS pathogenesis. Additionally, we compared our dataset with publicly available data for the SALS spinal cord, and show a high correlation of changes linked to the diseased state in the SALS motor cortex. In an analogous comparison with data for the Alzheimer's disease hippocampus we demonstrate a low correlation of global changes and a moderate correlation for changes specifically linked to the SALS diseased state. Conclusion Gene and sample numbers investigated allow pathway- and gene-based analyses by established error-correction methods, drawing a molecular portrait of the ALS motor cortex that faithfully represents many known disease features and uncovers several novel aspects of ALS pathology. Contrary to expectations for a tissue under oxidative stress, nuclear-encoded mitochondrial genes are uniformly down-regulated. Moreover, the down-regulation of mitochondrial and glycolytic

  5. Berberine Inhibits Doxorubicin-Triggered Cardiomyocyte Apoptosis via Attenuating Mitochondrial Dysfunction and Increasing Bcl-2 Expression

    PubMed Central

    Lv, Xiuxiu; Yu, Xiaohui; Wang, Yiyang; Wang, Faqiang; Li, Hongmei; Wang, Yanping; Lu, Daxiang; Qi, Renbin; Wang, Huadong

    2012-01-01

    Cardiomyocyte apoptosis is an important event in doxorubicin (DOX)-induced cardiac injury. The aim of the present study was to investigate the protection of berberine (Ber) against DOX- triggered cardiomyocyte apoptosis in neonatal rat cardiomyocytes and rats. In neonatal rat cardiomyocytes, Ber attenuated DOX-induced cellular injury and apoptosis in a dose-dependent manner. However, Ber has no significant effect on viability of MCF-7 breast cancer cells treated with DOX. Ber reduced caspase-3 and caspase-9, but not caspase-8 activity in DOX-treated cardiomyocytes. Furthermore, Ber decreased adenosine monophosphate-activated protein kinase α (AMPKα) and p53 phosphorylation at 2 h, cytosolic cytochrome c and mitochondrial Bax levels and increased Bcl-2 level at 6 h in DOX-stimulated cardiomyocytes. Pretreatment with compound C, an AMPK inhibitor, also suppressed p53 phosphorylation and apoptosis in DOX-treated cardiomyocytes. DOX stimulation for 30 min led to a loss of mitochondrial membrane potential and a rise in the AMP/ATP ratio. Ber markedly reduced DOX-induced mitochondrial membrane potential loss and an increase in the AMP/ATP ratio at 1 h and 2 h post DOX exposure. In in vivo experiments, Ber significantly improved survival, increased stroke volume and attenuated myocardial injury in DOX-challenged rats. TUNEL and Western blot assays showed that Ber not only decreased myocardial apoptosis, caspase-3 activation, AMPKα and p53 phosphorylation, but also increased Bcl-2 expression in myocardium of rats exposed to DOX for 84 h. These findings indicate that Ber attenuates DOX-induced cardiomyocyte apoptosis via protecting mitochondria, inhibiting an increase in the AMP/ATP ratio and AMPKα phosphorylation as well as elevating Bcl-2 expression, which offer a novel mechanism responsible for protection of Ber against DOX-induced cardiomyopathy. PMID:23077597

  6. The dual role of cyclin C connects stress regulated gene expression to mitochondrial dynamics

    PubMed Central

    Strich, Randy; Cooper, Katrina F.

    2014-01-01

    Following exposure to cytotoxic agents, cellular damage is first recognized by a variety of sensor mechanisms. Thenceforth, the damage signal is transduced to the nucleus to install the correct gene expression program including the induction of genes whose products either detoxify destructive compounds or repair the damage they cause. Next, the stress signal is disseminated throughout the cell to effect the appropriate changes at organelles including the mitochondria. The mitochondria represent an important signaling platform for the stress response. An initial stress response of the mitochondria is extensive fragmentation. If the damage is prodigious, the mitochondria fragment (fission) and lose their outer membrane integrity leading to the release of pro-apoptotic factors necessary for programmed cell death (PCD) execution. As this complex biological process contains many moving parts, it must be exquisitely coordinated as the ultimate decision is life or death. The conserved C-type cyclin plays an important role in executing this molecular Rubicon by coupling changes in gene expression to mitochondrial fission and PCD. Cyclin C, along with its cyclin dependent kinase partner Cdk8, associates with the RNA polymerase holoenzyme to regulate transcription. In particular, cyclin C-Cdk8 repress many stress responsive genes. To relieve this repression, cyclin C is destroyed in cells exposed to pro-oxidants and other stressors. However, prior to its destruction, cyclin C, but not Cdk8, is released from its nuclear anchor (Med13), translocates from the nucleus to the cytoplasm where it interacts with the fission machinery and is both necessary and sufficient to induce extensive mitochondria fragmentation. Furthermore, cytoplasmic cyclin C promotes PCD indicating that it mediates both mitochondrial fission and cell death pathways. This review will summarize the role cyclin C plays in regulating stress-responsive transcription. In addition, we will detail this new function

  7. Targeted impairment of thymidine kinase 2 expression in cells induces mitochondrial DNA depletion and reveals molecular mechanisms of compensation of mitochondrial respiratory activity

    SciTech Connect

    Villarroya, Joan; Lara, Mari-Carmen; Dorado, Beatriz; Garrido, Marta; Garcia-Arumi, Elena; Meseguer, Anna; Hirano, Michio; Vila, Maya R.

    2011-04-08

    Highlights: {yields} We impaired TK2 expression in Ost TK1{sup -} cells via siRNA-mediated interference (TK2{sup -}). {yields} TK2 impairment caused severe mitochondrial DNA (mtDNA) depletion in quiescent cells. {yields} Despite mtDNA depletion, TK2{sup -} cells show high cytochrome oxidase activity. {yields} Depletion of mtDNA occurs without imbalance in the mitochondrial dNTP pool. {yields} Nuclear-encoded ENT1, DNA-pol {gamma}, TFAM and TP gene expression is lowered in TK2{sup -} cells. -- Abstract: The mitochondrial DNA (mtDNA) depletion syndrome comprises a clinically heterogeneous group of diseases characterized by reductions of the mtDNA abundance, without associated point mutations or rearrangements. We have developed the first in vitro model to study of mtDNA depletion due to reduced mitochondrial thymidine kinase 2 gene (TK2) expression in order to understand the molecular mechanisms involved in mtDNA depletion syndrome due to TK2 mutations. Small interfering RNA targeting TK2 mRNA was used to decrease TK2 expression in Ost TK1{sup -} cells, a cell line devoid of endogenous thymidine kinase 1 (TK1). Stable TK2-deficient cell lines showed a reduction of TK2 levels close to 80%. In quiescent conditions, TK2-deficient cells showed severe mtDNA depletion, also close to 80% the control levels. However, TK2-deficient clones showed increased cytochrome c oxidase activity, higher cytochrome c oxidase subunit I transcript levels and higher subunit II protein expression respect to control cells. No alterations of the deoxynucleotide pools were found, whereas a reduction in the expression of genes involved in nucleoside/nucleotide homeostasis (human equilibrative nucleoside transporter 1, thymidine phosphorylase) and mtDNA maintenance (DNA-polymerase {gamma}, mitochondrial transcription factor A) was observed. Our findings highlight the importance of cellular compensatory mechanisms that enhance the expression of respiratory components to ensure respiratory activity

  8. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  9. Differential expression of Notch family members in astrocytomas and medulloblastomas.

    PubMed

    Xu, Peng; Yu, Shizhu; Jiang, Rongcai; Kang, Chunsheng; Wang, Guangxiu; Jiang, Hao; Pu, Peiyu

    2009-12-01

    Notch signaling pathway plays an integral role in determining cell fates in development. Growing evidence demonstrates that Notch signaling pathway has versatile effects in tumorigenesis depending on the tumor type, grade and stage. Notch signaling pathway is deregulated in some brain tumors. To examine the differential expression of Notch family members (Notch1, 2, 3, 4) in human astrocytomas and medulloblastomas, and to evaluate their roles in the development of both tumor types. Immunohistochemical staining and Western blot analysis were used to detect Notch1, 2, 3, 4 expression in tissue microarray and freshly resected tissue samples of normal brain, astrocytomas and medulloblastomas. Notch family members were not expressed or barely detectable in normal brain tissues. Notch1, 3, 4 were highly expressed but Notch2 was not expressed in astrocytomas. The percentage of immunopositive tumor cells and level of Notch1 expression was increased with tumor grade. In addition, overexpression of Notch2 was detected in medulloblastomas in contrast to low or no expression of Notch1, 3, 4. Differential expression of Notch1, 2, 3, 4 is detected in astrocytomas and medulloblastomas, that may be related to their different roles playing in the development of brain tumors.

  10. Analysis of Mitochondrial Proteins in the Surviving Myocardium after Ischemia Identifies Mitochondrial Pyruvate Carrier Expression as Possible Mediator of Tissue Viability*

    PubMed Central

    Fernández-Caggiano, Mariana; Prysyazhna, Oleksandra; Barallobre-Barreiro, Javier; CalviñoSantos, Ramón; Aldama López, Guillermo; Generosa Crespo-Leiro, Maria; Eaton, Philip; Doménech, Nieves

    2016-01-01

    The endogenous mechanisms contributing to tissue survival following myocardial infarction are not fully understood. We investigated the alterations in the mitochondrial proteome after ischemia-reperfusion (I/R) and its possible implications on cell survival. Mitochondrial proteomic analysis of cardiac tissue from an in vivo porcine I/R model found that surviving tissue in the peri-infarct border zone showed increased expression of several proteins. Notably, these included subunits of the mitochondrial pyruvate carrier (MPC), namely MPC1 and MPC2. Western blot, immunohistochemistry, and mRNA analysis corroborated the elevated expression of MPC in the surviving tissue. Furthermore, MPC1 and MPC2 protein levels were found to be markedly elevated in the myocardium of ischemic cardiomyopathy patients. These findings led to the hypothesis that increased MPC expression is cardioprotective due to enhancement of mitochondrial pyruvate uptake in the energy-starved heart following I/R. To test this, isolated mouse hearts perfused with a modified Krebs buffer (containing glucose, pyruvate, and octanoate as metabolic substrates) were subjected to I/R with or without the MPC transport inhibitor UK5099. UK5099 increased myocardial infarction and attenuated post-ischemic recovery of left ventricular end-diastolic pressure. However, aerobically perfused control hearts that were exposed to UK5099 did not modulate contractile function, although pyruvate uptake was blocked as evidenced by increased cytosolic lactate and pyruvate levels. Our findings indicate that increased expression of MPC leads to enhanced uptake and utilization of pyruvate during I/R. We propose this as a putative endogenous mechanism that promotes myocardial survival to limit infarct size. PMID:26582072

  11. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  12. A mitochondrial complex I defect impairs cold-regulated nuclear gene expression.

    PubMed

    Lee, Byeong-ha; Lee, Hojoung; Xiong, Liming; Zhu, Jian-Kang

    2002-06-01

    To study low-temperature signaling in plants, we previously screened for cold stress response mutants using bioluminescent Arabidopsis plants that express the firefly luciferase reporter gene driven by the stress-responsive RD29A promoter. Here, we report on the characterization and cloning of one mutant, frostbite1 (fro1), which shows reduced luminescence induction by cold. fro1 plants display reduced cold induction of stress-responsive genes such as RD29A, KIN1, COR15A, and COR47. fro1 leaves have a reduced capacity for cold acclimation, appear water-soaked, leak electrolytes, and accumulate reactive oxygen species constitutively. FRO1 was isolated through positional cloning and found to encode a protein with high similarity to the 18-kD Fe-S subunit of complex I (NADH dehydrogenase, EC 1.6.5.3) in the mitochondrial electron transfer chain. Confocal imaging shows that the FRO1:green fluorescent protein fusion protein is localized in mitochondria. These results suggest that cold induction of nuclear gene expression is modulated by mitochondrial function.

  13. Isolation of differentially expressed cDNAs during ferret tracheal development: application of differential display PCR.

    PubMed

    Sehgal, A; Presente, A; Dudus, L; Engelhardt, J F

    1996-01-01

    The technique of differential display polymerase chain reaction (DD-PCR) was used to identify cDNA sequences, which are temporally expressed during ferret tracheal airway development. Such differentially expressed cDNAs may ultimately prove to be useful markers in elucidating mechanisms of epithelial differentiation and submucosal gland development in the airway. Using two sets of oligonucleotide primers 15 differentially amplified cDNAs were isolated by comparative reverse transcriptase (RT) PCR of 6-h and 3-day postnatal tracheal poly-A mRNA. In situ hybridization was used to assess the reliability of this method and confirm the differential mRNA expression patterns of cloned cDNAs. Results of in situ hybridization analysis demonstrated that 10 of the 15 cDNA sequences gave a temporally regulated pattern of expression, which was concordant with that of the differential display. Furthermore, sequence analysis of the 15 isolated cDNAs revealed that the majority of clones were amplified from two inverted decamer primers. These findings demonstrate the lack of poly-T priming in the differential display reaction, which suggests that this method may yield substantially more information regarding the coding sequence of cloned genes. In support of this observation, 6 of the 15 cDNA sequences contained one complete open reading frame. Although the majority of cDNAs demonstrated no homology to sequence data bases at the DNA or amino acid level, clone FT-4, which demonstrated a differential expression pattern limited to 3-day tracheal time points, was composed of a 10-amino acid repeat domain that was structurally similar to neuropeptide anthoRFamide and barley D hordein seed protein. A second interesting clone, FT-3, demonstrated an infrequent pattern of expression within a subset of epithelial cells limited to early developmental time points (6 h) and was dramatically reduced by 3 days postnatally. Several additional clones with no homologies to previously cloned genes

  14. Schlafen 12 expression modulates prostate cancer cell differentiation.

    PubMed

    Kovalenko, Pavlo L; Basson, Marc D

    2014-07-01

    Schlafen proteins have previously been linked to leukocyte and intestinal epithelial differentiation. We hypothesized that Schlafen 12 (SLFN12) overexpression in human prostate epithelial cells would modulate expression of prostate-specific antigen (PSA) and dipeptidyl peptidase 4 (DPP4), markers of prostatic epithelial differentiation. Differentiation of the human prostate cancer cell lines LNCaP and PC-3 was compared after infection with an adenoviral vector coding for SLFN12 (Ad-SLFN12) or green fluorescent protein (GFP) only expressing virus (control). Transcript levels of SLFN12, PSA, and DPP4 were evaluated by real-time reverse transcription PCR and protein levels by Western blotting. Because mixed lineage kinase (MLK) and one of its downstream effectors (extracellular signal-regulated kinases [ERK]) have previously been implicated in some aspects of prostate epithelial differentiation, we conducted further studies in which LNCaP cells were cotreated with dimethyl sulfoxide (control), PD98059 (ERK inhibitor), or MLK inhibitor during transfection with Ad-SLFN12 for 72 h. Treatment of LNCaP or PC-3 cells with Ad-SLFN12 reduced PSA expression by 56.6±4.6% (P<0.05) but increased DPP4 transcript level by 4.8±1.0 fold (P<0.05) versus Ad-GFP-treated controls. Further studies in LNCaP cells showed that Ad-SLFN12 overexpression increased the ratio of the mature E-cadherin protein to its precursor protein. Furthermore, SLFN12 overexpression promoted DPP4 expression either when MLK or ERK was blocked. ERK inhibition did not reverse SLFN12-induced changes in PSA, E-cadherin, or DPP4. SLFN12 may regulate differentiation in prostate epithelial cells, at least in part independently of ERK or MLK. Understanding how SLFN12 influences prostatic epithelial differentiation may ultimately identify targets to influence the phenotype of prostatic malignancy. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Schlafen 12 expression modulates prostate cancer cell differentiation

    PubMed Central

    Kovalenko, Pavlo L.; Basson, Marc D.

    2014-01-01

    Background Schlafen proteins have previously been linked to leukocyte and intestinal epithelial differentiation. We hypothesized that Schlafen 12 (SLFN12) overexpression in prostate epithelial cells would modulate expression of prostate-specific antigen (PSA) and dipeptidyl peptidase-4 (DPP4), markers of prostatic epithelial differentiation. Materials and Methods Differentiation of the prostate cancer cell line LNCaP and PC-3 was compared after infection with an adenoviral vector coding for SLFN12-GFP (Ad-SLFN12) or GFP only expressing virus (control). Transcript levels of SLFN12, PSA and DPP4 were evaluated by RT-PCR and protein levels by Western blotting. Because Mixed Lineage Kinase (MLK) and one of its downstream effectors (ERK) have previously been implicated in some aspects of prostate epithelial differentiation, we conducted further studies in which LNCaP cells were co-treated with DMSO (control), PD98059 (ERK inhibitor) or MLK inhibitor during transfection with Ad-GFP-SLFN12 for 72 hours. Results Treatment of LNCaP or PC-3 cells with Ad-SLFN12 reduced PSA expression by 56.6±4.6% (p<0.05) but increased DPP4 transcript level by 4.8±1.0 fold (p<0.05) vs. Ad-GFP-treated controls. Further studies in LNCaP cells showed that Ad-SLFN12 overexpression increased the ratio of the mature E-cadherin protein to its precursor protein. Furthermore, SLFN12 overexpression promoted DPP4 expression either when MLK or ERK were blocked. ERK inhibition did not reverse SLFN12-induced changes in PSA, E-cadherin or DPP4. Conclusions SLFN12 may regulate differentiation in prostate epithelial cells, at least in part independently of ERK or MLK. Understanding how SLFN12 influences prostatic epithelial differentiation may ultimately identify targets to influence the phenotype of prostatic malignancy. PMID:24768141

  16. Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells

    PubMed Central

    Pohjoismäki, Jaakko L. O.; Wanrooij, Sjoerd; Hyvärinen, Anne K.; Goffart, Steffi; Holt, Ian J.; Spelbrink, Johannes N.; Jacobs, Howard T.

    2006-01-01

    Mitochondrial transcription factor A (TFAM) is an abundant mitochondrial protein of the HMG superfamily, with various putative roles in mitochondrial DNA (mtDNA) metabolism. In this study we have investigated the effects on mtDNA replication of manipulating TFAM expression in cultured human cells. Mammalian mtDNA replication intermediates (RIs) fall into two classes, whose mechanistic relationship is not properly understood. One class is characterized by extensive RNA incorporation on the lagging strand, whereas the other has the structure of products of conventional, strand-coupled replication. TFAM overexpression increased the overall abundance of RIs and shifted them substantially towards those of the conventional, strand-coupled type. The shift was most pronounced in the rDNA region and at various replication pause sites and was accompanied by a drop in the relative amount of replication-termination intermediates, a substantial reduction in mitochondrial transcripts, mtDNA decatenation and progressive copy number depletion. TFAM overexpression could be partially phenocopied by treatment of cells with dideoxycytidine, suggesting that its effects are partially attributable to a decreased rate of fork progression. TFAM knockdown also resulted in mtDNA depletion, but RIs remained mainly of the ribosubstituted type, although termination intermediates were enhanced. We propose that TFAM influences the mode of mtDNA replication via its combined effects on different aspects of mtDNA metabolism. PMID:17062618

  17. Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse

    PubMed Central

    Paul, Erin; Kielbasinski, Marissa; Sedivy, John M.; Murga-Zamalloa, Carlos; Khanna, Hemant; Klysik, Jan E.

    2009-01-01

    Supv3L1 is an evolutionarily conserved helicase that plays a critical role in the mitochondrial RNA surveillance and degradation machinery. Conditional ablation of Supv3L1 in adult mice leads to premature aging phenotypes including loss of muscle mass and adipose tissue and severe skin abnormalities. To get insights into the spatial and temporal expression of Supv3L1 in the mouse, we generated knock-in and transgenic strains in which an EGFP reporter was placed under control of the Supv3L1 native promoter. During development, expression of Supv3L1 begins at the blastocyst stage, becomes widespread and strong in all fetal tissues and cell types, and continues during postnatal growth. In mature animals reporter expression is only slightly diminished in most tissues and continues to be highly expressed in the brain, peripheral sensory organs, and testis. Together, these data confirm that Supv3L1 is an important developmentally regulated gene, which continues to be expressed in all mature tissues, particularly the rapidly proliferating cells of testes, but also in the brain and sensory organs. The transgenic mice and cell lines derived from them constitute a valuable tool for the examination of the spatial and temporal aspects of Supv3L1 promoter activity, and should facilitate future screens for small molecules that regulate Supv3L1 expression. PMID:19937380

  18. Angiostatin regulates the expression of antiangiogenic and proapoptotic pathways via targeted inhibition of mitochondrial proteins

    PubMed Central

    Lee, Tong-Young; Muschal, Stefan; Pravda, Elke A.; Folkman, Judah; Abdollahi, Amir

    2009-01-01

    Angiostatin, a proteolytic fragment of plasminogen, is a potent endogenous antiangiogenic agent. The molecular mechanisms governing angiostatin's antiangiogenic and antitumor effects are not well understood. Here, we report the identification of mitochondrial compartment as the ultimate target of angiostatin. After internalization of angiostatin into the cell, at least 2 proteins within the mitochondria bind this molecule: malate dehydrogenase, a member of Krebs cycle, and adenosine triphosphate synthase. In vitro and in vivo studies revealed differential regulation of key prosurvival and angiogenesis-related proteins in angiostatin-treated tumors and tumor-endothelium. Angiostatin induced apoptosis via down-regulation of mitochondrial BCL-2. Angiostatin treatment led to down-regulation of c-Myc and elevated levels of another key antiangiogenic protein, thrombospondin-1, reinforcing its antitumor and antiangiogenic effects. Further evidence is provided for reduced recruitment and infiltration of bone marrow–derived macrophages in angiostatin-treated tumors. The observed effects of angiostatin were restricted to the tumor site and were not observed in other major organs of the mice, indicating unique tumor specific bioavailability. Together, our data suggest mitochondria as a novel target for antiangiogenic therapy and provide mechanistic insights to the antiangiogenic and antitumor effects of angiostatin. PMID:19465692

  19. Prion Protein Expression Regulates Embryonic Stem Cell Pluripotency and Differentiation

    PubMed Central

    Miranda, Alberto; Pericuesta, Eva

    2011-01-01

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis. PMID:21483752

  20. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    PubMed

    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso

    2011-04-04

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  1. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation

    PubMed Central

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-01-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1. PMID:25502213

  2. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation.

    PubMed

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-11-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1.

  3. Medaka tert produces multiple variants with differential expression during differentiation in vitro and in vivo

    PubMed Central

    Rao, Feng; Wang, Tiansu; Li, Mingyou; Li, Zhendong; Hong, Ni; Zhao, Haobin; Yan, Yan; Lu, Wenqing; Chen, Tiansheng; Wang, Weijia; Lim, Menghuat; Yuan, Yongming; Liu, Ling; Zeng, Lingbing; Wei, Qiwei; Guan, Guijun; Li, Changming; Hong, Yunhan

    2011-01-01

    Embryonic stem (ES) cells have immortality for self-renewal and pluripotency. Differentiated human cells undergo replicative senescence. In human, the telomerase reverse transcriptase (Tert), namely the catalytic subunit of telomerase, exhibits differential expression to regulate telomerase activity governing cellular immortality or senescence, and telomerase activity or tert expression is a routine marker of pluripotent ES cells. Here we have identified the medaka tert gene and determined its expression and telomerase activity in vivo and in vitro. We found that the medaka tert locus produces five variants called terta to terte encoding isoforms TertA to TertE. The longest TertA consists of 1090 amino acid residues and displays a maximum of 34% identity to the human TERT and all the signature motifs of the Tert family. TertB to TertE are novel isoforms and have considerable truncation due to alternative splicing. The terta RNA is ubiquitous in embryos, adult tissues and cell lines, and accompanies ubiquitous telomerase activity in vivo and in vitro as revealed by TRAP assays. The tertb RNA was restricted to the testis, absent in embryos before gastrulation and barely detectable in various cell lines The tertc transcript was absent in undifferentiated ES cells but became evident upon ES cell differentiation, in vivo it was barely detectable in early embryos and became evident when embryogenesis proceeds. Therefore, ubiquitous terta expression correlates with ubiquitous telomerase activity in medaka, and expression of other tert variants appears to delineate cell differentiation in vitro and in vivo. PMID:21547060

  4. Peripheral blood gene expression signature differentiates children with autism from unaffected siblings

    PubMed Central

    Kong, SW; Shimizu-Motohashi, Y; Campbell, MG; Lee, IH; Collins, CD; Brewster, SJ; Holm, IA; Rappaport, L

    2013-01-01

    Autism spectrum disorder (ASD) is one of the most prevalent neurodevelopmental disorders with high heritability, yet a majority of genetic contribution to pathophysiology is not known. Siblings of individuals with ASD are at increased risk for ASD and autistic traits, but the genetic contribution for simplex families is estimated to be less when compared to multiplex families. To explore the genomic (dis-) similarity between proband and unaffected sibling in simplex families, we used genome-wide gene expression profiles of blood from 20 proband-unaffected sibling pairs and 18 unrelated control individuals. The global gene expression profiles of unaffected siblings were more similar to those from probands as they shared genetic and environmental background. One hundred eighty nine genes were significantly differentially expressed between proband-sib pairs (nominal p-value < 0.01) after controlling for age, sex, and family effects. Probands and siblings were distinguished into two groups by cluster analysis with these genes. Overall, unaffected siblings were equally distant from the centroid of probands and from that of unrelated controls with the differentially expressed genes. Interestingly, 5 of 20 siblings had gene expression profiles that were more similar to unrelated controls than to their matched probands. In summary, we found a set of genes that distinguished probands from the unaffected siblings, and a subgroup of unaffected siblings who were more similar to probands. The pathways that characterized probands compared to siblings using peripheral blood gene expression profiles were the up-regulation of ribosomal, spliceosomal, and mitochondrial pathways, and the down-regulation of neuroreceptor-ligand, immune response and calcium signaling pathways. Further integrative study with structural genetic variations such as de novo mutations, rare variants, and copy number variations would clarify whether these transcriptomic changes are structural or environmental

  5. Complete mitochondrial genome of Helicoverpa zea (Boddie) and expression profiles of mitochondrial-encoded genes in early and late embryos

    USDA-ARS?s Scientific Manuscript database

    The mitochondrial genome of the bollworm, Helicoverpa zea, was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogen...

  6. Microarray analysis reveals differential gene expression in hybrid sunflower species

    PubMed Central

    LAI, ZHAO; GROSS, BRIANA L.; YIZOU; ANDREWS, JUSTEN; RIESEBERG, LOREN H.

    2008-01-01

    This paper describes the creation of a cDNA microarray for annual sunflowers and its use to elucidate patterns of gene expression in Helianthus annuus, Helianthus petiolaris, and the homoploid hybrid species Helianthus deserticola. The array comprises 3743 ESTs (expressed sequence tags) representing approximately 2897 unique genes. It has an average clone/EST identity rate of 91%, is applicable across species boundaries within the annual sunflowers, and shows patterns of gene expression that are highly reproducible according to real-time RT–PCR (reverse transcription–polymerase chain reaction) results. Overall, 12.8% of genes on the array showed statistically significant differential expression across the three species. Helianthus deserticola displayed transgressive, or extreme, expression for 58 genes, with roughly equal numbers exhibiting up- or down-regulation relative to both parental species. Transport-related proteins were strongly over-represented among the transgressively expressed genes, which makes functional sense given the extreme desert floor habitat of H. deserticola. The potential adaptive value of differential gene expression was evaluated for five genes in two populations of early generation (BC2) hybrids between the parental species grown in the H. deserticola habitat. One gene (a G protein-coupled receptor) had a significant association with fitness and maps close to a QTL controlling traits that may be adaptive in the desert habitat. PMID:16626449

  7. Expression of a gene encoding mitochondrial aldehyde dehydrogenase in rice increases under submerged conditions.

    PubMed

    Nakazono, M; Tsuji, H; Li, Y; Saisho, D; Arimura, S; Tsutsumi, N; Hirai, A

    2000-10-01

    It is known that alcoholic fermentation is important for survival of plants under anaerobic conditions. Acetaldehyde, one of the intermediates of alcoholic fermentation, is not only reduced by alcohol dehydrogenase but also can be oxidized by aldehyde dehydrogenase (ALDH). To determine whether ALDH plays a role in anaerobic metabolism in rice (Oryza sativa L. cv Nipponbare), we characterized a cDNA clone encoding mitochondrial ALDH from rice (Aldh2a). Analysis of sub-cellular localization of ALDH2a protein using green fluorescent protein and an in vitro ALDH assay using protein extracts from Escherichia coli cells that overexpressed ALDH2a indicated that ALDH2a functions in the oxidation of acetaldehyde in mitochondria. A Southern-blot analysis indicated that mitochondrial ALDH is encoded by at least two genes in rice. We found that the Aldh2a mRNA was present at high levels in leaves of dark-grown seedlings, mature leaf sheaths, and panicles. It is interesting that expression of the rice Aldh2a gene, unlike the expression of the tobacco (Nicotiana tabacum) Aldh2a gene, was induced in rice seedlings by submergence. Experiments with ruthenium red, which is a blocker of Ca(2+) fluxes in rice as well as maize (Zea mays), suggest that the induction of expression of Adh1 and Pdc1 by low oxygen stress is regulated by elevation of the cytosolic Ca(2+) level. However, the induction of Aldh2a gene expression may not be controlled by the cytosolic Ca(2+) level elevation. A possible involvement of ALDH2a in the submergence tolerance of rice is discussed.

  8. Wilms' tumor (WT1) gene expression in rat decidual differentiation.

    PubMed

    Zhou, J; Rauscher, F J; Bondy, C

    1993-09-01

    The Wilm's tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract, where it is thought to play a role in the differentiation of these tissues. We have used immunocytochemistry and in situ hybridization to study WT1 expression in the rat uterus during normal development and pregnancy from 0 to 20 days post coitum (p.c.). WT1 mRNA was abundant in uterine stroma from juvenile rats, but was much less abundant in uterine tissue from sexually mature rats; WT1 expression is not affected by ovariectomy or by treatment with estradiol or estradiol plus progesterone. WT1 gene was highly expressed, however, in the endometrial cells of early pregnancy. On day 6 p.c. WT1 mRNA was detected in anti-mesometrial decidual cells, and WT1 immunoreactivity was concentrated in the nuclei of these cells. All cells of fully-developed deciduoma at 7-8 days p.c. demonstrated WT1 expression. WT1 was not detected in trophoblast/placental tissues but remained abundant in the decidua basalis until parturition. The expression of WT1 was compared with insulin-like growth factor-II (IGF-II) and its receptor in the decidual since it has been shown that IGF-II gene transcription is repressed by WT1 in vitro. However, no spatiotemporal correlation in the expression of these three genes was found in differentiation of the rat decidua. In summary, these data suggest a role for WT1 in decidualization, since its expression is activated during the differentiation of uterine stromal cells into decidual cells.

  9. Genetic variation architecture of mitochondrial genome reveals the differentiation in Korean landrace and weedy rice

    PubMed Central

    Tong, Wei; He, Qiang; Park, Yong-Jin

    2017-01-01

    Mitochondrial genome variations have been detected despite the overall conservation of this gene content, which has been valuable for plant population genetics and evolutionary studies. Here, we describe mitochondrial variation architecture and our performance of a phylogenetic dissection of Korean landrace and weedy rice. A total of 4,717 variations across the mitochondrial genome were identified adjunct with 10 wild rice. Genetic diversity assessment revealed that wild rice has higher nucleotide diversity than landrace and/or weedy, and landrace rice has higher diversity than weedy rice. Genetic distance was suggestive of a high level of breeding between landrace and weedy rice, and the landrace showing a closer association with wild rice than weedy rice. Population structure and principal component analyses showed no obvious difference in the genetic backgrounds of landrace and weedy rice in mitochondrial genome level. Phylogenetic, population split, and haplotype network evaluations were suggestive of independent origins of the indica and japonica varieties. The origin of weedy rice is supposed to be more likely from cultivated rice rather than from wild rice in mitochondrial genome level. PMID:28256554

  10. Genetic variation architecture of mitochondrial genome reveals the differentiation in Korean landrace and weedy rice.

    PubMed

    Tong, Wei; He, Qiang; Park, Yong-Jin

    2017-03-03

    Mitochondrial genome variations have been detected despite the overall conservation of this gene content, which has been valuable for plant population genetics and evolutionary studies. Here, we describe mitochondrial variation architecture and our performance of a phylogenetic dissection of Korean landrace and weedy rice. A total of 4,717 variations across the mitochondrial genome were identified adjunct with 10 wild rice. Genetic diversity assessment revealed that wild rice has higher nucleotide diversity than landrace and/or weedy, and landrace rice has higher diversity than weedy rice. Genetic distance was suggestive of a high level of breeding between landrace and weedy rice, and the landrace showing a closer association with wild rice than weedy rice. Population structure and principal component analyses showed no obvious difference in the genetic backgrounds of landrace and weedy rice in mitochondrial genome level. Phylogenetic, population split, and haplotype network evaluations were suggestive of independent origins of the indica and japonica varieties. The origin of weedy rice is supposed to be more likely from cultivated rice rather than from wild rice in mitochondrial genome level.

  11. Unraveling the Limits of Mitochondrial Control Region to Estimate the Fine Scale Population Genetic Differentiation in Anadromous Fish Tenualosa ilisha

    PubMed Central

    Verma, Rashmi; Singh, Mahender; Kumar, Sudhir

    2016-01-01

    The mitochondrial control region has been the first choice for examining the population structure but hypervariability and homoplasy have reduced its suitability. We analysed eight populations using control region for examining the population structure of Hilsa. Although the control region analysis revealed broad structuring between the Arabian Sea and Bay of Bengal (FST  0.0441, p < 0.001) it was unable to detect structure among riverine populations. These results suggest that the markers used must be able to distinguish populations and control region has led to an underestimation of genetic differentiation among populations of Hilsa. PMID:27313951

  12. Mitochondrial adaptations to chronic muscle use: effect of iron deficiency.

    PubMed

    Hood, D A; Kelton, R; Nishio, M L

    1992-03-01

    1. The effects of chronic muscle use on mitochondrial structure, enzymes and gene expression is reviewed. The role of iron deficiency in modulating this adaptation is discussed. 2. Chronic muscle use and disuse alter mitochondrial composition and affect mitochondrial subpopulations differentially. This has implications for an understanding of organelle assembly. 3. Iron deficiency decreases mitochondrial functional mass within muscle by reducing the level of heme and non-heme iron-containing components. This alters the metabolic response during exercise and results in a reduced endurance performance. 4. Both iron deficiency and chronic muscle use represent contrasting experimental models for the study of mitochondrial function and biogenesis.

  13. Insulin Sensitizing Pharmacology of Thiazolidinediones Correlates with Mitochondrial Gene Expression rather than Activation of PPARγ

    PubMed Central

    Bolten, Charles W.; Blanner, Patrick M.; McDonald, William G.; Staten, Nicholas R.; Mazzarella, Richard A.; Arhancet, Graciela B.; Meier, Martin F.; Weiss, David J.; Sullivan, Patrick M.; Hromockyj, Alexander E.; Kletzien, Rolf F.; Colca, Jerry R.

    2007-01-01

    Insulin sensitizing thiazolidinediones (TZDs) are generally considered to work as agonists for the nuclear receptor peroxisome proliferative activated receptor-gamma (PPARγ). However, TZDs also have acute, non-genomic metabolic effects and it is unclear which actions are responsible for the beneficial pharmacology of these compounds. We have taken advantage of an analog, based on the metabolism of pioglitazone, which has much reduced ability to activate PPARγ. This analog (PNU-91325) was compared to rosiglitazone, the most potent PPARγ activator approved for human use, in a variety of studies both in vitro and in vivo. The data demonstrate that PNU-91325 is indeed much less effective than rosiglitazone at activating PPARγ both in vitro and in vivo. In contrast, both compounds bound similarly to a mitochondrial binding site and acutely activated PI-3 kinase-directed phosphorylation of AKT, an action that was not affected by elimination of PPARγ activation. The two compounds were then compared in vivo in both normal C57 mice and diabetic KKAy mice to determine whether their pharmacology correlated with biomarkers of PPARγ activation or with the expression of other gene transcripts. As expected from previous studies, both compounds improved insulin sensitivity in the diabetic mice, and this occurred in spite of the fact that there was little increase in expression of the classic PPARγ target biomarker adipocyte binding protein-2 (aP2) with PNU-91325 under these conditions. An examination of transcriptional profiling of key target tissues from mice treated for one week with both compounds demonstrated that the relative pharmacology of the two thiazolidinediones correlated best with an increased expression of an array of mitochondrial proteins and with expression of PPARγ coactivator 1-alpha (PGC1α), the master regulator of mitochondrial biogenesis. Thus, important pharmacology of the insulin sensitizing TZDs may involve acute actions, perhaps on the

  14. Differential Expression of Sclerostin In Adult and Juvenile Mouse Calvaria

    PubMed Central

    Kwan, Matthew D.; Quarto, Natalina; Gupta, Deepak M.; Slater, Bethany; Wan, Derrick C.; Longaker, Michael T.

    2010-01-01

    Background An understanding of the molecular mechanisms controlling bone formation is central to skeletal tissue engineering efforts. The observation that immature animals are able to heal calvarial defects while adult animals are not has proven to be a useful tool for examining these mechanisms. Thus, we compared expression of sclerostin, a bone inhibitor, between the calvaria of juvenile and adult mice. Methods Parietal bone was harvested from juvenile (6 day old, n=20) and adult (60 day old, n=20) mice. Sclerostin transcript and protein levels were compared between the parietal bone of juvenile and adult mice using polymerase chain reaction (PCR), Western blotting, and immunohistochemistry (IHC). Finally, osteoblasts from the parietal bone of juvenile and adult mice were harvested and cultured under osteogenic differentiation conditions with and without recombinant sclerostin (200ng/ml). Terminal osteogenic differentiation was assessed at 21 days with Alizarin red staining. Results PCR, Western blot analysis, and IHC all confirmed greater expression of sclerostin in the parietal bone of adult mice when compared to that of juvenile mice. Osteoblasts, whether from juvenile or adult parietal bones, demonstrated reduced capacity for osteogenic differentiation when exposed to recombinant sclerostin. Conclusion Given sclerostin’s role in inhibiting bone formation, our findings suggest that differences in expression levels of sclerostin may play a role in the differential regenerative capacity of calvaria from juvenile and adult animals. These findings suggest it as a potential target to abrogate in future tissue engineering studies. PMID:21285764

  15. Mitochondrial capacity, oxidative damage and hypoxia gene expression are associated with age-related division of labor in honey bee, Apis mellifera L., workers.

    PubMed

    Cervoni, Mário S; Cardoso-Júnior, Carlos A M; Craveiro, Giovana; Souza, Anderson de O; Alberici, Luciane C; Hartfelder, Klaus

    2017-09-14

    During adult life, honeybee workers undergo a succession of behavioral states. Nurses bees perform tasks inside the nest, and when they are about 2-3 weeks old they initiate foraging. This switch is associated with alterations in diet, and with the levels of juvenile hormone and vitellogenin circulating in hemolymph. Less clear is whether this behavioral maturation involves major changes at the cellular level, such as mitochondrial activity and the redox environment in the head, thorax and abdomen. Using high-resolution respirometry, biochemical assays and RT-qPCR, we evaluated the association of these parameters with this behavioral change. We found that tissues from the head and abdomen of nurses have a higher OXPHOS capacity than those of foragers, while for the thorax we found an opposite situation. Since higher mitochondrial activity tends to generate more H2O2 and H2O2 is known to stabilize HIF-1α, this would be expected to stimulate hypoxia signaling. The positive correlation that we observed between mitochondrial activity and hif-1α gene expression in abdomen and head tissue of nurses would be in line with this hypothesis. Higher expression of antioxidant enzyme genes was observed in foragers, which could explain their low levels of protein carbonylation. No alterations were seen in NO levels, suggesting that NO signaling is unlikely to be involved in behavioral maturation. We conclude that the behavioral change seen in honeybee workers is reflected in differential mitochondrial activities and redox parameters, and we consider that this can provide insights into the underlying aging process. © 2017. Published by The Company of Biologists Ltd.

  16. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  17. Expression of YY1 in Differentiated Thyroid Cancer.

    PubMed

    Arribas, Jéssica; Castellví, Josep; Marcos, Ricard; Zafón, Carles; Velázquez, Antonia

    2015-05-01

    The transcription factor Yin Yang 1 (YY1) has an important regulatory role in tumorigenesis, but its implication in thyroid cancer has not been yet investigated. In the present study, we have analyzed the expression of YY1 in differentiated thyroid cancer and assessed the association of YY1 expression with clinical features. Expression of YY1 was evaluated in human thyroid cancer cell lines, a series of matched normal/tumor thyroid tissues and in a thyroid cancer tissue microarray, using real-time PCR, Western blot, and/or immunohistochemistry. YY1 was overexpressed in thyroid cancer cells, at transcription and protein levels. A significant increase of YY1 mRNA was also observed in tumor thyroid tissues. Moreover, immunohistochemical analysis of the thyroid cancer tissue microarray revealed that both papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) present increased YY1 protein levels (48 and 19%, respectively). After stratification by the level of YY1 protein, positive YY1 expression identifies 88% of patients with PTC. The association of YY1 expression with clinicopathological features in PTC and FTC showed that YY1 expression was related with age at diagnosis. Our data indicates for the first time overexpression of YY1 in differentiated thyroid cancer, with YY1 being more frequently overexpressed in the PTC subtype.

  18. Imbalanced Production of Reactive Oxygen Species and Mitochondrial Antioxidant SOD2 in Fabry Disease-Specific Human Induced Pluripotent Stem Cell-Differentiated Vascular Endothelial Cells.

    PubMed

    Tseng, Wei-Lien; Chou, Shih-Jie; Chiang, Huai-Chih; Wang, Mong-Lien; Chien, Chian-Shiu; Chen, Kuan-Hsuan; Leu, Hsin-Bang; Wang, Chien-Ying; Chang, Yuh-Lih; Liu, Yung-Yang; Jong, Yuh-Jyh; Lin, Shinn-Zong; Chiou, Shih-Hwa; Lin, Shing-Jong; Yu, Wen-Chung

    2017-03-13

    Fabry disease (FD) is an X-linked inherited lysosomal storage disease caused by α-galactosidase A (GLA) deficiency. Progressive intracellular accumulation of globotriaosylceramide (Gb3) is considered to be pathogenically responsible for the phenotype variability of FD that causes cardiovascular dysfunction; however, molecular mechanisms underlying the impairment of FD-associated cardiovascular tissues remain unclear. In this study, we reprogrammed human induced pluripotent stem cells (hiPSCs) from peripheral blood cells of patients with FD (FD-iPSCs); subsequently differentiated them into vascular endothelial-like cells (FD-ECs) expressing CD31, VE-cadherin, and vWF; and investigated their ability to form vascular tube-like structures. FD-ECs recapitulated the FD pathophysiological phenotype exhibiting intracellular Gb3 accumulation under a transmission electron microscope. Moreover, compared with healthy control iPSC-derived endothelial cells (NC-ECs), reactive oxygen species (ROS) production considerably increased in FD-ECs. Microarray analysis was performed to explore the possible mechanism underlying Gb3 accumulation-induced ROS production in FD-ECs. Our results revealed that superoxide dismutase 2 (SOD2), a mitochondrial antioxidant, was significantly downregulated in FD-ECs. Compared with NC-ECs, AMPK activity was significantly enhanced in FD-ECs. Furthermore, to investigate the role of Gb3 in these effects, human umbilical vein endothelial cells (HUVECs) were treated with Gb3. After Gb3 treatment, we observed that SOD2 expression was suppressed and AMPK activity was enhanced in a dose-dependent manner. Collectively, our results indicate that excess accumulation of Gb3 suppressed SOD2 expression, increased ROS production, enhanced AMPK activation, and finally caused vascular endothelial dysfunction. Our findings suggest that dysregulated mitochondrial ROS may be a potential target for treating FD.

  19. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  20. Bendavia restores mitochondrial energy metabolism gene expression and suppresses cardiac fibrosis in the border zone of the infarcted heart

    PubMed Central

    Shi, Jianru; Dai, Wangde; Hale, Sharon L.; Brown, David A.; Wang, Miao; Han, Xianlin; Kloner, Robert A.

    2016-01-01

    Aims We have observed that Bendavia, a mitochondrial-targeting peptide that binds the phospholipid cardiolipin and stabilizes the components of electron transport and ATP generation, improves cardiac function and prevents left ventricular remodeling in a 6 week rat myocardial infarction (MI) model. We hypothesized that Bendavia restores mitochondrial biogenesis and gene expression, suppresses cardiac fibrosis, and preserves sarco/endoplasmic reticulum (SERCA2a) level in the noninfarcted border zone of infarcted hearts. Main methods Starting 2 hours after left coronary artery ligation, rats were randomized to receive Bendavia (3 mg/kg/day), water or sham operation. At 6 weeks, PCR array and qRT-PCR was performed to detect gene expression. Picrosirius red staining was used to analyze collagen deposition. Key findings There was decreased expression of 70 out of 84 genes related to mitochondrial energy metabolism in the border zone of untreated hearts. This down-regulation was largely reversed by Bendavia treatment. Downregulated mitochondrial biogenesis and glucose & fatty acid (FA) oxidation related genes were restored by administration of Bendavia. Matrix metalloproteinase (MMP9) and tissue inhibitor of metalloproteinase (TIMP1) gene expression were significantly increased in the border zone of untreated hearts. Bendavia completely prevented up-regulation of MMP9, but maintained TIMP1 gene expression. Picrosirius red staining demonstrated that Bendavia suppressed collagen deposition within border zone. In addition, Bendavia showed a trend toward restoring SERCA2a expression. Significance Bendavia restored expression of mitochondrial energy metabolism related genes, prevented myocardial matrix remodeling and preserved SERCA2a expression in the noninfarcted border, which may have contributed to the preservation of cardiac structure and function. PMID:26431885

  1. Human biallelic MFN2 mutations induce mitochondrial dysfunction, upper body adipose hyperplasia, and suppression of leptin expression

    PubMed Central

    Rocha, Nuno; Bulger, David A; Frontini, Andrea; Titheradge, Hannah; Gribsholt, Sigrid Bjerge; Knox, Rachel; Page, Matthew; Harris, Julie; Payne, Felicity; Adams, Claire; Sleigh, Alison; Crawford, John; Gjesing, Anette Prior; Bork-Jensen, Jette; Pedersen, Oluf; Barroso, Inês; Hansen, Torben; Cox, Helen; Reilly, Mary; Rossor, Alex; Brown, Rebecca J; Taylor, Simeon I; McHale, Duncan; Armstrong, Martin; Oral, Elif A; Saudek, Vladimir; O’Rahilly, Stephen; Maher, Eamonn R; Richelsen, Bjørn; Savage, David B; Semple, Robert K

    2017-01-01

    MFN2 encodes mitofusin 2, a membrane-bound mediator of mitochondrial membrane fusion and inter-organelle communication. MFN2 mutations cause axonal neuropathy, with associated lipodystrophy only occasionally noted, however homozygosity for the p.Arg707Trp mutation was recently associated with upper body adipose overgrowth. We describe similar massive adipose overgrowth with suppressed leptin expression in four further patients with biallelic MFN2 mutations and at least one p.Arg707Trp allele. Overgrown tissue was composed of normal-sized, UCP1-negative unilocular adipocytes, with mitochondrial network fragmentation, disorganised cristae, and increased autophagosomes. There was strong transcriptional evidence of mitochondrial stress signalling, increased protein synthesis, and suppression of signatures of cell death in affected tissue, whereas mitochondrial morphology and gene expression were normal in skin fibroblasts. These findings suggest that specific MFN2 mutations cause tissue-selective mitochondrial dysfunction with increased adipocyte proliferation and survival, confirm a novel form of excess adiposity with paradoxical suppression of leptin expression, and suggest potential targeted therapies. DOI: http://dx.doi.org/10.7554/eLife.23813.001 PMID:28414270

  2. Corticosterone reduces brain mitochondrial function and expression of mitofusin, BDNF in depression-like rodents regardless of exercise preconditioning.

    PubMed

    Liu, Weina; Zhou, Chenglin

    2012-07-01

    Both chronic mild stress and an injection of corticosterone induce depression-like states in rodents. To further link mitochondrial dysfunction to the pathophysiology of major depression, here we describe two rat models of a depressive-like state induced by chronic unpredictable mild stress (CUMS) or corticosterone treatment (CORT). It is also a model that allows the simultaneous study of effects of exercise preconditioning on behavioral, electrophysiological, biochemical and molecular markers in the same animal. Exercise preconditioning ahead of CUMS and CORT treatment prevents many behavioral abnormalities resulted from CUMS. The changes in mitochondrial activity in brain and reduced expressions of superoxide dismutase (SOD1, SOD2), mitofusin (Mfn1, Mfn2) as well as brain-derived neurotrophic factor (BDNF) suggest that both CORT and CUMS may impair mitochondrial function and/or expressions of mitofusion and antioxidant enzymes that, in turn, may increase oxidative stress and reduce energy production in brain with depression-like behaviors. These findings suggest an underlying mechanism by which CORT, as well as CUMS, induces brain mitochondrial dysfunction that is associated with depressive-like states. Remarkably, physical exercise is identified as a helpful and preventive measure to promote mitochondrial function and expressions of mitofusin, BDNF and antioxidant enzymes in brain, so as to protect brain energy metabolism against CUMS, rather than the compound of corticosterone. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Differential protein expression in metallothionein protection from depleted uranium-induced nephrotoxicity

    PubMed Central

    Hao, Yuhui; Huang, Jiawei; Liu, Cong; Li, Hong; Liu, Jing; Zeng, Yiping; Yang, Zhangyou; Li, Rong

    2016-01-01

    The purpose of this study was to investigate the underlying mechanism of metallothionein (MT) protection from depleted uranium (DU) using a proteomics approach to search for a DU toxicity-differential protein. MT−/− and MT+/+ mice were administrated with a single dose of DU (10 mg/kg, i.p.) or equal volume of saline. After 4 days, protein changes in kidney tissues were evaluated using a proteomics approach. A total of 13 differentially expressed proteins were identified using two-dimensional electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The validating results showed that the expression of aminoacylase-3 (ACY-3) and the mitochondrial ethylmalonic encephalopathy 1 (ETHE1) decreased significantly after DU exposure; in addition, the reduction in MT−/− mice was more significant than that in MT+/+ mice. The results also showed that exogenous ETHE1 or ACY-3 could increase the survival rate of human embryonic kidney 293 (HEK293) cells after DU exposure. A specific siRNA of ETHE1 significantly increased cell apoptosis rates after DU exposure, whereas exogenous ETHE1 significantly decreased cell apoptosis rates. In summary, ACY-3 and ETHE1 might involve in protection roles of MT. ETHE1 could be a new sensitive molecular target of DU-induced cell apoptosis. PMID:27966587

  4. Differential gene expression in auristatin PHE-treated Cryptococcus neoformans.

    PubMed

    Woyke, Tanja; Berens, Michael E; Hoelzinger, Dominique B; Pettit, George R; Winkelmann, Günther; Pettit, Robin K

    2004-02-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 micro M) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans.

  5. Differential Gene Expression in Auristatin PHE-Treated Cryptococcus neoformans

    PubMed Central

    Woyke, Tanja; Berens, Michael E.; Hoelzinger, Dominique B.; Pettit, George R.; Winkelmann, Günther; Pettit, Robin K.

    2004-01-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 μM) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans. PMID:14742210

  6. Differential proteome and gene expression for testis of mice exposed to carbon ion radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Hong; Li, Hongyan

    Objective To investigate the effect and mechanism of high linear energy transfer (LET) carbon ion irradiation (CIR) on reproduction in the testis of male Swiss Webster mice, and assess the risk associated with space environment. Methods Male mice underwent whole-body irradiation with CIR (0.5, 1 and 4Gy), and matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF) analysis was used to determine the alteration in protein expression in 2-DE (two-dimensional gel electrophoresis) gels of testes caused by irradiation after 7, 14 days. Results 15 differentially expressed proteins, such as glucose-regulated protein(GRP78), aconitate hydratase-mitochondrial precursor (ACO), pyruvate kinase isozymes M1/M2 (PKM1/M2), glutathione-S-transferaseA3 (GSTA3), glutathione S-transferase Pi 1 (GSTP1), Cu/Zn super-oxide dismutase (SOD1), Peptidyl-prolyl cis-trans isomerase (Pin1) and Heat shock 70 kDa protein 4L (HSPa4L), were identified and these proteins were mainly involved in energy supply, the endoplasmic reticulum, cell proliferation, cell cycle, antioxidant capacity and mitochondrial respiration, which play important roles in the inhibition of testicular function in response to CIR. Furthermore, we confirmed the relationship between transcription of mRNA and the abundance of proteins. Conclusion The findings of the present study demonstrated that these proteins may lead to new insights into the molecular mechanism of CIR toxicity, and suggested that the gene expression response to CIR involves diverse regulatory mechanisms from transcription of mRNA to the formation of functional proteins. These data also may provide a scientific basis for protecting astronauts and space traveler’s health and safety.

  7. Differential gene expression in anterior and posterior annulus fibrosus.

    PubMed

    Koerner, John D; Markova, Dessislava Z; Yadla, Sanjay; Mendelis, Joseph; Hilibrand, Alan; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg; Kepler, Christopher K

    2014-11-01

    Laboratory study. To evaluate the differential gene expression of cytokines and growth factors in anterior versus posterior annulus fibrosus (AF) intervertebral disc (IVD) specimens. Histological analysis has demonstrated regional differences in vascular and neural ingrowth in the IVD, and similar differences may exist for cytokine and growth factor expression in patients with degenerative disc disease (DDD). Regional expression of these cytokines may also be related to the pain experienced in DDD. IVD tissue was obtained from patients undergoing anterior lumbar interbody fusion surgery for back pain with radiological evidence of disc degeneration. For a control group, the discs of patients undergoing anterior lumbar discectomy for degenerative scoliosis were obtained as well. The tissue was carefully removed and separated into anterior and posterior AF. After tissue processing, an antibody array was completed to determine expression levels of 42 cytokines and growth factors. Nine discs from 7 patients with DDD and 5 discs from 2 patients with scoliosis were analyzed. In the DDD group, there were 10 cytokines and growth factors with significantly increased expression in the posterior AF versus the anterior AF ([interleukin] IL-4, IL-5, IL-6, M-CSF, MDC, tumor necrosis factor β, EGF, IGF-1, angiogenin, leptin). In the scoliosis group, only angiogenin and PDGF-BB demonstrated increased expression in the posterior AF. No cytokines or growth factors had increased expression in the anterior AF compared with posterior AF. The posterior AF expresses increased levels of cytokines and growth factors compared with the anterior AF in patients with DDD. This differential expression may be important for targeting treatment of painful IVDs. N/A.

  8. Expression of turtle riboflavin-binding protein represses mitochondrial electron transport gene expression and promotes flowering in Arabidopsis.

    PubMed

    Li, Liang; Hu, Li; Han, Li-Ping; Ji, Hongtao; Zhu, Yueyue; Wang, Xiaobing; Ge, Jun; Xu, Manyu; Shen, Dan; Dong, Hansong

    2014-12-30

    Recently we showed that de novo expression of a turtle riboflavin-binding protein (RfBP) in transgenic Arabidopsis increased H2O2 concentrations inside leaf cells, enhanced the expression of floral regulatory gene FD and floral meristem identity gene AP1 at the shoot apex, and induced early flowering. Here we report that RfBP-induced H2O2 presumably results from electron leakage at the mitochondrial electron transport chain (METC) and this source of H2O2 contributes to the early flowering phenotype. While enhanced expression of FD and AP1 at the shoot apex was correlated with early flowering, the foliar expression of 13 of 19 METC genes was repressed in RfBP-expressing (RfBP+) plants. Inside RfBP+ leaf cells, cytosolic H2O2 concentrations were increased possibly through electron leakage because similar responses were also induced by a known inducer of electron leakage from METC. Early flowering no longer occurred when the repression on METC genes was eliminated by RfBP gene silencing, which restored RfBP+ to wild type in levels of FD and AP1 expression, H2O2, and flavins. Flowering was delayed by the external riboflavin application, which brought gene expression and flavins back to the steady-state levels but only caused 55% reduction of H2O2 concentrations in RfBP+ plants. RfBP-repressed METC gene expression remedied the cytosolic H2O2 diminution by genetic disruption of transcription factor NFXLl and compensated for compromises in FD and AP1 expression and flowering time. By contrast, RfBP resembled a peroxisomal catalase mutation, which augments the cytosolic H2O2, to enhance FD and AP1 expression and induce early flowering. RfBP-repressed METC gene expression potentially causes electron leakage as one of cellular sources for the generation of H2O2 with the promoting effect on flowering. The repressive effect on METC gene expression is not the only way by which RfBP induces H2O2 and currently unappreciated factors may also function under RfBP+ background.

  9. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    SciTech Connect

    Jang, Min-Kyung; Jung, Myeong Ho

    2014-11-07

    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  10. Sulforaphane induces differential modulation of mitochondrial biogenesis and dynamics in normal cells and tumor cells.

    PubMed

    Negrette-Guzmán, Mario; Huerta-Yepez, Sara; Vega, Mario I; León-Contreras, Juan Carlos; Hernández-Pando, Rogelio; Medina-Campos, Omar Noel; Rodríguez, Esteban; Tapia, Edilia; Pedraza-Chaverri, José

    2017-02-01

    Antioxidant-based chemotherapy has been intensely debated. Herein, we show that sulforaphane (SFN) induced mitochondrial biogenesis followed by mitochondrial fusion in a kidney cell line commonly used in nephroprotective models. At the same concentration and exposure time, SFN induced cell death in prostate cancer cells accompanied by mitochondrial biogenesis and fragmentation. Stabilization of the nuclear factor E2-related factor-2 (Nrf2) could be associated with these effects in the tumor cell line. An increase in the peroxisome proliferator-activated receptor-γ co-activator-1α (PGC1α) level and a decrease in the hypoxia-inducible factor-1α (HIF1α) level would suggest a possible metabolic shift. The knockdown in the nuclear respiratory factor-1 (NRF1) attenuated the SFN-induced effect on prostate cancer cells demonstrating that mitochondrial biogenesis plays an important role in cell death for this kind of tumor cells. This evidence supports SFN as a potential antineoplastic agent that could inhibit tumor development and could protect normal tissues by modulating common processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Differential inhibition/inactivation of mitochondrial complex I implicates its alteration in malignant cells.

    PubMed

    Ghosh, A; Bera, S; Ghosal, S; Ray, S; Basu, A; Ray, M

    2011-09-01

    Methylglyoxal strongly inhibited mitochondrial respiration of a wide variety of malignant tissues including sarcoma of mice, whereas no such significant effect was noted on mitochondrial respiration of normal tissues with the exception of cardiac cells. This inhibition by methylglyoxal was found to be at the level of mitochondrial complex I (NADH dehydrogenase) of the electron transport chain. L-Lactaldehyde, which is structurally and metabolically related to methylglyoxal, could protect against this inhibition. NADH dehydrogenase of submitochondrial particles of malignant and cardiac cells was inhibited by methylglyoxal. This enzyme of these cells was also inactivated by methylglyoxal. The possible involvement of lysine residue(s) for the activity of NADH dehydrogenase was also investigated by using lysine-specific reagents trinitrobenzenesulfonic acid (TNBS) and pyridoxal 5' phosphate (PP). Inactivation of NADH dehydrogenase by both TNBS and PP convincingly demonstrated the involvement of lysine residue(s) for the activity of the sarcoma and cardiac enzymes, whereas both TNBS and PP failed to inactivate the enzymes of skeletal muscle and liver. Together these studies demonstrate a specific effect of methylglyoxal on mitochondrial complex I of malignant cells and importantly some distinct alteration of this complex in cancer cells.

  12. An araC-controlled bacterial cre expression system to produce DNA minicircle vectors for nuclear and mitochondrial gene therapy.

    PubMed

    Bigger, B W; Tolmachov, O; Collombet, J M; Fragkos, M; Palaszewski, I; Coutelle, C

    2001-06-22

    The presence of CpG motifs and their associated sequences in bacterial DNA causes an immunotoxic response following the delivery of these plasmid vectors into mammalian hosts. We describe a biotechnological approach to the elimination of this problem by the creation of a bacterial cre recombinase expression system, tightly controlled by the arabinose regulon. This permits the Cre-mediated and -directed excision of the entire bacterial vector sequences from plasmid constructs to create supercoiled gene expression minicircles for gene therapy. Minicircle yields using standard culture volumes are sufficient for most in vitro and in vivo applications whereas minicircle expression in vitro is significantly increased over standard plasmid transfection. By the simple expedient of removing the bacterial DNA complement, we significantly reduce the size and CpG content of these expression vectors, which should also reduce DNA-induced inflammatory responses in a dose-dependent manner. We further describe the generation of minicircle expression vectors for mammalian mitochondrial gene therapy, for which no other vector systems currently exist. The removal of bacterial vector sequences should permit appropriate transcription and correct transcriptional cleavage from the mitochondrial minicircle constructs in a mitochondrial environment and brings the realization of mitochondrial gene therapy a step closer.

  13. Differential expression in RNA-seq: a matter of depth.

    PubMed

    Tarazona, Sonia; García-Alcalde, Fernando; Dopazo, Joaquín; Ferrer, Alberto; Conesa, Ana

    2011-12-01

    Next-generation sequencing (NGS) technologies are revolutionizing genome research, and in particular, their application to transcriptomics (RNA-seq) is increasingly being used for gene expression profiling as a replacement for microarrays. However, the properties of RNA-seq data have not been yet fully established, and additional research is needed for understanding how these data respond to differential expression analysis. In this work, we set out to gain insights into the characteristics of RNA-seq data analysis by studying an important parameter of this technology: the sequencing depth. We have analyzed how sequencing depth affects the detection of transcripts and their identification as differentially expressed, looking at aspects such as transcript biotype, length, expression level, and fold-change. We have evaluated different algorithms available for the analysis of RNA-seq and proposed a novel approach--NOISeq--that differs from existing methods in that it is data-adaptive and nonparametric. Our results reveal that most existing methodologies suffer from a strong dependency on sequencing depth for their differential expression calls and that this results in a considerable number of false positives that increases as the number of reads grows. In contrast, our proposed method models the noise distribution from the actual data, can therefore better adapt to the size of the data set, and is more effective in controlling the rate of false discoveries. This work discusses the true potential of RNA-seq for studying regulation at low expression ranges, the noise within RNA-seq data, and the issue of replication.

  14. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  15. Carnitine Palmitoyltransferase 1 Increases Lipolysis, UCP1 Protein Expression and Mitochondrial Activity in Brown Adipocytes

    PubMed Central

    Calderon-Dominguez, María; Sebastián, David; Fucho, Raquel; Weber, Minéia; Mir, Joan F.; García-Casarrubios, Ester; Obregón, María Jesús; Zorzano, Antonio; Valverde, Ángela M.; Serra, Dolors

    2016-01-01

    The discovery of active brown adipose tissue (BAT) in adult humans and the fact that it is reduced in obese and diabetic patients have put a spotlight on this tissue as a key player in obesity-induced metabolic disorders. BAT regulates energy expenditure through thermogenesis; therefore, harnessing its thermogenic fat-burning power is an attractive therapeutic approach. We aimed to enhance BAT thermogenesis by increasing its fatty acid oxidation (FAO) rate. Thus, we expressed carnitine palmitoyltransferase 1AM (CPT1AM), a permanently active mutant form of CPT1A (the rate-limiting enzyme in FAO), in a rat brown adipocyte (rBA) cell line through adenoviral infection. We found that CPT1AM-expressing rBA have increased FAO, lipolysis, UCP1 protein levels and mitochondrial activity. Additionally, enhanced FAO reduced the palmitate-induced increase in triglyceride content and the expression of obese and inflammatory markers. Thus, CPT1AM-expressing rBA had enhanced fat-burning capacity and improved lipid-induced derangements. This indicates that CPT1AM-mediated increase in brown adipocytes FAO may be a new approach to the treatment of obesity-induced disorders. PMID:27438137

  16. Mitochondrial membrane potential (DeltaPsi) and Ca(2+)-induced differentiation in HaCaT keratinocytes.

    PubMed

    Savignan, F; Ballion, B; Odessa, M F; Charveron, M; Bordat, P; Dufy, B

    2004-01-01

    We have used the human calcium- and temperature-dependent (HaCaT) keratinocyte cell line to elucidate mechanisms of switching from a proliferating to a differentiating state. When grown in low calcium medium (<0.1 mM) HaCaT cells proliferate. However, an increase in the calcium concentration of the culture medium, [Ca(2+)](0), induces growth arrest and the cells start to differentiate. Numerous studies have already shown that the increase in [Ca(2+)](0) results in acute and sustained increases in intracellular calcium concentration, [Ca(2+)](i). We find that the Ca(2+)-induced cell differentiation of HaCaT cells is also accompanied by a significant decrease in mitochondrial membrane potential, DeltaPsi. By combining patch-clamp electrophysiological recordings and microspectrofluorimetric measurements of DeltaPsi on single cells, we show that the increase in [Ca(2+)](i) led to DeltaPsi depolarization. In addition, we report that tetraethylammonium (TEA), a blocker of plasma membrane K(+) channels, which is known to inhibit cell proliferation, and 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), a blocker of plasma membrane Cl(-) channels, also affect DeltaPsi. Both these agents stimulate HaCaT cell differentiation. These data therefore strongly suggest a direct causal relationship between depolarization of DeltaPsi and the inhibition of proliferation and induction of differentiation in HaCaT keratinocytes.

  17. Strontium Promotes Cementoblasts Differentiation through Inhibiting Sclerostin Expression In Vitro

    PubMed Central

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose. PMID:25003114

  18. Strontium promotes cementoblasts differentiation through inhibiting sclerostin expression in vitro.

    PubMed

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan; Hu, Min

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.

  19. Expression of dystrophin Dp71 during PC12 cell differentiation.

    PubMed

    Cisneros, B; Rendon, A; Genty, V; Aranda, G; Marquez, F; Mornet, D; Montañez, C

    1996-08-02

    The expression of dystrophin-protein 71 (Dp71) was investigated during nerve growth factor (NGF) induced differentiation of PC12 cells. A semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assay was designed to measure Dp71 mRNA, whereas the Dp71 protein amount was evaluated by immunoblot analysis using an anti-dystrophin monoclonal antibody. Comparison with control cultures showed that Dp71 mRNA and protein levels increased in parallel with NGF treatment peaking with increments of 60% and 1.4 times, respectively. The upregulation of Dp71 expression during PC12 cells differentiation point at PC12 cells as a suitable model for studying the function of Dp71 in neuronal cells.

  20. Studies of Hematopoietic Cell Differentiation with a Ratiometric and Reversible Sensor of Mitochondrial Reactive Oxygen Species

    PubMed Central

    Kaur, Amandeep; Jankowska, Karolina; Pilgrim, Chelsea; Fraser, Stuart T.

    2016-01-01

    Abstract Aims: Chronic elevations in cellular redox state are known to result in the onset of various pathological conditions, but transient increases in reactive oxygen species (ROS)/reactive nitrogen species (RNS) are necessary for signal transduction and various physiological functions. There is a distinct lack of reversible fluorescent tools that can aid in studying and unraveling the roles of ROS/RNS in physiology and pathology by monitoring the variations in cellular ROS levels over time. In this work, we report the development of ratiometric fluorescent sensors that reversibly respond to changes in mitochondrial redox state. Results: Photophysical studies of the developed flavin–rhodamine redox sensors, flavin–rhodamine redox sensor 1 (FRR1) and flavin–rhodamine redox sensor 2 (FRR2), confirmed the reversible response of the probes upon reduction and re-oxidation over more than five cycles. The ratiometric output of FRR1 and FRR2 remained unaltered in the presence of other possible cellular interferants (metals and pH). Microscopy studies indicated clear mitochondrial localization of both probes, and FRR2 was shown to report the time-dependent increase of mitochondrial ROS levels after lipopolysaccharide stimulation in macrophages. Moreover, it was used to study the variations in mitochondrial redox state in mouse hematopoietic cells at different stages of embryonic development and maturation. Innovation: This study provides the first ratiometric and reversible probes for ROS, targeted to the mitochondria, which reveal variations in mitochondrial ROS levels at different stages of embryonic and adult blood cell production. Conclusions: Our results suggest that with their ratiometric and reversible outputs, FRR1 and FRR2 are valuable tools for the future study of oxidative stress and its implications in physiology and pathology. Antioxid. Redox Signal. 24, 667–679. PMID:26865422

  1. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  2. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  3. Differential Expression of Proteoglycans by Corneal Stromal Cells in Keratoconus.

    PubMed

    García, Beatriz; García-Suárez, Olivia; Merayo-Lloves, Jesús; Alcalde, Ignacio; Alfonso, José F; Fernández-Vega Cueto, Luis; Meana, Álvaro; Vázquez, Fernando; Quirós, Luis M

    2016-05-01

    Keratoconus is a heterogeneous disease associated with a range of pathologies, including disorders that involve proteoglycans (PGs). Some PG alterations, mainly in keratan sulfate (KS), occur in keratoconus. In this article, we studied the differential expression of the genes encoding PGs in cells isolated from keratoconus patients and healthy controls, as well as in corneal sections. Human central corneal tissue was obtained from cadaver donors and patients undergoing penetrating keratoplasty surgery. A transcriptomic approach was used, employing quantitative PCR, to analyze both the expression of the enzymes involved in glycosaminoglycan (GAG) biosynthesis and the PG core proteins. The expressions of the differentially expressed core proteins and of the GAG chains were also analyzed by immunocytochemistry in the cultured cells, as well as by immunohistochemistry in corneal sections. The mRNA levels of most major matrix PG mRNAs in the cultured keratoconic stromal cells decreased except collagen XVIII, which increased. At keratocyte surfaces, some heparan sulfate PGs were down-regulated. With respect to GAGs, there were changes in gene expression for the polymerization of the GAG chains, mainly KS and chondroitin sulfate, and in the modification of the saccharidic chains, pointing to an alteration of the sulfation patterns of all GAG species. Most of the PG core proteins underwent significant changes in cultured keratoconic cells and corneas. With regard to GAG chains, the polymerization of the chains and their chemical modification was modified in way that depended on the specific type of GAG involved.

  4. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  5. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  6. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  7. In recurrent primary biliary cirrhosis after liver transplantation, biliary epithelial cells show increased expression of mitochondrial proteins.

    PubMed

    Sasaki, Motoko; Hsu, Maylee; Yeh, Matthew M; Nakanuma, Yasuni

    2015-10-01

    In biliary epithelial lesions in primary biliary cirrhosis (PBC), mitochondrial proteins associated with deregulated autophagy are abnormally expressed. We examined whether this could be used as a diagnostic marker for end-stage PBC and recurrent PBC after liver transplantation. We examined the expression of the mitochondrial protein pyruvate dehydrogenase complex-E2 component and cytochrome c oxidase, subunit I (CCO), the autophagy-related marker microtubule-associated protein-light chain 3 (LC3), and p62/sequestosome-1 and the senescence markers p16(Ink4a) and p21(WAF1/Cip1) in small bile ducts and bile ductules in explanted livers from patients with PBC (n = 20) in comparison with liver tissue from control patients (n = 21) and post-transplant samples including recurrent PBC and cellular rejection (n = 28). Intense granular expression of mitochondrial proteins was significantly more frequent in small bile ducts in explanted livers with PBC than in control livers (p < 0.05). Post-transplant samples comprised of three groups: group A (positive for mitochondrial proteins, n = 7), group B (positive for either autophagy-related or senescence markers but negative for mitochondrial proteins, n = 7), and group C (all negative, n = 14). All but one case of group A were clinically and histologically diagnosed as recurrent PBC. In contrast, all cases of group B were diagnosed as cellular rejection. This study suggests that the expression of mitochondrial proteins in small bile ducts may be a useful diagnostic marker for end-stage PBC and recurrent PBC after liver transplantation.

  8. HnRNPA2 is a novel histone acetyltransferase that mediates mitochondrial stress-induced nuclear gene expression

    PubMed Central

    Guha, Manti; Srinivasan, Satish; Guja, Kip; Mejia, Edison; Garcia-Diaz, Miguel; Johnson, F Brad; Ruthel, Gordon; Kaufman, Brett A; Rappaport, Eric F; Glineburg, M Rebecca; Fang, Ji-Kang; Szanto, Andres Klein; Nakagawa, Hiroshi; Basha, Jeelan; Kundu, Tapas; Avadhani, Narayan G

    2016-01-01

    Reduced mitochondrial DNA copy number, mitochondrial DNA mutations or disruption of electron transfer chain complexes induce mitochondria-to-nucleus retrograde signaling, which induces global change in nuclear gene expression ultimately contributing to various human pathologies including cancer. Recent studies suggest that these mitochondrial changes cause transcriptional reprogramming of nuclear genes although the mechanism of this cross talk remains unclear. Here, we provide evidence that mitochondria-to-nucleus retrograde signaling regulates chromatin acetylation and alters nuclear gene expression through the heterogeneous ribonucleoprotein A2 (hnRNAP2). These processes are reversed when mitochondrial DNA content is restored to near normal cell levels. We show that the mitochondrial stress-induced transcription coactivator hnRNAP2 acetylates Lys 8 of H4 through an intrinsic histone lysine acetyltransferase (KAT) activity with Arg 48 and Arg 50 of hnRNAP2 being essential for acetyl-CoA binding and acetyltransferase activity. H4K8 acetylation at the mitochondrial stress-responsive promoters by hnRNAP2 is essential for transcriptional activation. We found that the previously described mitochondria-to-nucleus retrograde signaling-mediated transformation of C2C12 cells caused an increased expression of genes involved in various oncogenic processes, which is retarded in hnRNAP2 silenced or hnRNAP2 KAT mutant cells. Taken together, these data show that altered gene expression by mitochondria-to-nucleus retrograde signaling involves a novel hnRNAP2-dependent epigenetic mechanism that may have a role in cancer and other pathologies. PMID:27990297

  9. Differential expression of CART in ewes with differing ovulation rates.

    PubMed

    Juengel, Jennifer L; French, Michelle C; Quirke, Laurel D; Kauff, Alexia; Smith, George W; Johnstone, Peter D

    2017-04-01

    We hypothesised that cocaine- and amphetamine-regulated transcript (CARTPT) would be differentially expressed in ewes with differing ovulation rates. Expression of mRNA for CARTPT, as well as LHCGR, FSHR, CYP19A1 and CYP17A1 was determined in antral follicles ≥1 mm in diameter collected during the follicular phase in ewes heterozygous for the Booroola and Inverdale genes (I+B+; average ovulation rate 4) and ++ contemporaries (++; average ovulation rate 1.8). In ++ ewes (n = 6), CARTPT was expressed in small follicles (1 to <3 mm diameter), where 18.8 ± 2.5% follicles expressed CARTPT CART peptide was also detected in follicular fluid of some follicles of ++ ewes. In I+B+ ewes, 5/6 ewes did not have any follicles that expressed CARTPT, and no CART peptide was detected in any follicle examined. Expression pattern of CYP19A1 differed between I+B+ and ++ ewes with an increased percentage of small and medium follicles (3 to <4.5 mm diameter) but decreased percentage of large follicles (≥4.5 mm diameter) expressing CYP19A1 in the I+B+ ewes. Many of the large follicles from the I+B+ ewes appeared non-functional and expression of LHCGR, FSHR, CYP17A1 and CYP19A1 was less than that observed in ++ ewes. Expression of FSHR and CYP17A1 was not different between groups in small and medium follicles, but LHCGR expression was approximately double in I+B+ ewes compared to that in ++ ewes. Thus, ewes with high ovulation rates had a distinct pattern of expression of CARTPT mRNA and protein compared to ewes with normal ovulation rates, providing evidence for CART being important in the regulation of ovulation rate. © 2017 Society for Reproduction and Fertility.

  10. RBM4 promotes pancreas cell differentiation and insulin expression.

    PubMed

    Lin, Jung-Chun; Yan, Yu-Ting; Hsieh, Wen-Kou; Peng, Pey-Jey; Su, Chun-Hao; Tarn, Woan-Yuh

    2013-01-01

    The RNA-binding protein RNA-binding motif protein 4 (RBM4) modulates alternative splicing of muscle-specific mRNA isoforms during muscle cell differentiation. To better understand the physiological function of RBM4, we exploited a gene knockout strategy in the present study. Mice with targeted disruption of one of the two Rbm4 genes exhibited hyperglycemia coincident with reduced levels of serum insulin and reduced size of pancreatic islets. The embryonic pancreases of Rbm4-deficient mice showed reduced expression or aberrant splicing of many transcripts encoding factors required for pancreas cell differentiation and function. Using pancreatic acinar AR42J cells, we demonstrated that RBM4 promoted insulin gene expression by altering the isoform balance of the transcription factors Isl1 and Pax4 via alternative splicing control. RBM4 overexpression was sufficient to convert AR42J cells into insulin-producing cells. Moreover, RBM4 may mediate glucose-induced insulin expression and insulin receptor isoform switches. These results suggest that RBM4 may have role in promoting pancreas cell differentiation and endocrine function, essentially via alternative splicing regulation.

  11. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation.

    PubMed

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-07-07

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer's disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes.

  12. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation

    PubMed Central

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-01-01

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer’s disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes. PMID:27383650

  13. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  14. Physical exercise in aging human skeletal muscle increases mitochondrial calcium uniporter expression levels and affects mitochondria dynamics.

    PubMed

    Zampieri, Sandra; Mammucari, Cristina; Romanello, Vanina; Barberi, Laura; Pietrangelo, Laura; Fusella, Aurora; Mosole, Simone; Gherardi, Gaia; Höfer, Christian; Löfler, Stefan; Sarabon, Nejc; Cvecka, Jan; Krenn, Matthias; Carraro, Ugo; Kern, Helmut; Protasi, Feliciano; Musarò, Antonio; Sandri, Marco; Rizzuto, Rosario

    2016-12-01

    Age-related sarcopenia is characterized by a progressive loss of muscle mass with decline in specific force, having dramatic consequences on mobility and quality of life in seniors. The etiology of sarcopenia is multifactorial and underlying mechanisms are currently not fully elucidated. Physical exercise is known to have beneficial effects on muscle trophism and force production. Alterations of mitochondrial Ca(2+) homeostasis regulated by mitochondrial calcium uniporter (MCU) have been recently shown to affect muscle trophism in vivo in mice. To understand the relevance of MCU-dependent mitochondrial Ca(2+) uptake in aging and to investigate the effect of physical exercise on MCU expression and mitochondria dynamics, we analyzed skeletal muscle biopsies from 70-year-old subjects 9 weeks trained with either neuromuscular electrical stimulation (ES) or leg press. Here, we demonstrate that improved muscle function and structure induced by both trainings are linked to increased protein levels of MCU Ultrastructural analyses by electron microscopy showed remodeling of mitochondrial apparatus in ES-trained muscles that is consistent with an adaptation to physical exercise, a response likely mediated by an increased expression of mitochondrial fusion protein OPA1. Altogether these results indicate that the ES-dependent physiological effects on skeletal muscle size and force are associated with changes in mitochondrial-related proteins involved in Ca(2+) homeostasis and mitochondrial shape. These original findings in aging human skeletal muscle confirm the data obtained in mice and propose MCU and mitochondria-related proteins as potential pharmacological targets to counteract age-related muscle loss.

  15. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  16. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  17. The 18-kDa Translocator Protein Inhibits Vascular Cell Adhesion Molecule-1 Expression via Inhibition of Mitochondrial Reactive Oxygen Species

    PubMed Central

    Joo, Hee Kyoung; Lee, Yu Ran; Kang, Gun; Choi, Sunga; Kim, Cuk-Seong; Ryoo, Sungwoo; Park, Jin Bong; Jeon, Byeong Hwa

    2015-01-01

    Translocator protein 18 kDa (TSPO) is a mitochondrial outer membrane protein and is abundantly expressed in a variety of organ and tissues. To date, the functional role of TSPO on vascular endothelial cell activation has yet to be fully elucidated. In the present study, the phorbol 12-myristate 13-acetate (PMA, 250 nM), an activator of protein kinase C (PKC), was used to induce vascular endothelial activation. Adenoviral TSPO overexpression (10–100 MOI) inhibited PMA-induced vascular cell adhesion molecule-1 (VCAM-1) and intracellular cell adhesion molecule-1 (ICAM-1) expression in a dose dependent manner. PMA-induced VCAM-1 expressions were inhibited by Mito-TEMPO (0.1–0.5 μM), a specific mitochondrial antioxidants, and cyclosporin A (1–5 μM), a mitochondrial permeability transition pore inhibitor, implying on an important role of mitochondrial reactive oxygen species (ROS) on the endothelial activation. Moreover, adenoviral TSPO overexpression inhibited mitochondrial ROS production and manganese superoxide dismutase expression. On contrasts, gene silencing of TSPO with siRNA increased PMA-induced VCAM-1 expression and mitochondrial ROS production. Midazolam (1–50 μM), TSPO ligands, inhibited PMA-induced VCAM-1 and mitochondrial ROS production in endothelial cells. These results suggest that mitochondrial TSPO can inhibit PMA-induced endothelial inflammation via suppression of VCAM-1 and mitochondrial ROS production in endothelial cells. PMID:26608360

  18. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  19. The Kunitz-protease inhibitor domain in amyloid precursor protein reduces cellular mitochondrial enzymes expression and function.

    PubMed

    Chua, Li-Min; Lim, Mei-Li; Wong, Boon-Seng

    2013-08-09

    Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) and this can be contributed by aberrant metabolic enzyme function. But, the mechanism causing this enzymatic impairment is unclear. Amyloid precursor protein (APP) is known to be alternatively spliced to produce three major isoforms in the brain (APP695, APP751, APP770). Both APP770 and APP751 contain the Kunitz Protease Inhibitory (KPI) domain, but the former also contain an extra OX-2 domain. APP695 on the other hand, lacks both domains. In AD, up-regulation of the KPI-containing APP isoforms has been reported. But the functional contribution of this elevation is unclear. In the present study, we have expressed and compared the effect of the non-KPI containing APP695 and the KPI-containing APP751 on mitochondrial function. We found that the KPI-containing APP751 significantly decreased the expression of three major mitochondrial metabolic enzymes; citrate synthase, succinate dehydrogenase and cytochrome c oxidase (COX IV). This reduction lowers the NAD(+)/NADH ratio, COX IV activity and mitochondrial membrane potential. Overall, this study demonstrated that up-regulation of the KPI-containing APP isoforms is likely to contribute to the impairment of metabolic enzymes and mitochondrial function in AD.

  20. Differential expression of antimicrobial peptides in margins of chronic wounds.

    PubMed

    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine

    2010-07-01

    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  1. Differential toxicity and venom gland gene expression in Centruroides vittatus.

    PubMed

    McElroy, Thomas; McReynolds, C Neal; Gulledge, Alyssa; Knight, Kelci R; Smith, Whitney E; Albrecht, Eric A

    2017-01-01

    Variation in venom toxicity and composition exists in many species. In this study, venom potency and venom gland gene expression was evaluated in Centruroides vittatus, size class I-II (immature) and size class IV (adults/penultimate instars) size classes. Venom toxicity was evaluated by probit analysis and returned ED50 values of 50.1 μg/g for class IV compared to 134.2 μg/g for class I-II 24 hours post injection, suggesting size class IV was 2.7 fold more potent. Next generation sequencing (NGS and qPCR were used to characterize venom gland gene expression. NGS data was assembled into 36,795 contigs, and annotated using BLASTx with UNIPROT. EdgeR analysis of the sequences showed statistically significant differential expression in transcripts associated with sodium and potassium channel modulation. Sodium channel modulator expression generally favored size class IV; in contrast, potassium channel modulators were favored in size class I-II expression. Real-time quantitative PCR of 14 venom toxin transcripts detected relative expression ratios that paralleled NGS data and identified potential family members or splice variants for several sodium channel modulators. Our data suggests ontogenetic differences in venom potency and venom related genes expression exist between size classes I-II and IV.

  2. Stoichiometric expression of mtHsp40 and mtHsp70 modulates mitochondrial morphology and cristae structure via Opa1L cleavage.