Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

2007-07-01

A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

Structures of Astromaterials Revealed by EBSD

NASA Technical Reports Server (NTRS)

Zolensky, M.

2018-01-01

Groups at the Johnson Space Center and the University of Tokyo have been using electron back-scattered diffraction (EBSD) to reveal the crystal structures of extraterrestrial minerals for many years. Even though we also routinely use transmission electron microscopy, synchrotron X-ray diffraction (SXRD), and conventional electron diffraction, we find that EBSD is the most powerful technique for crystal structure elucidation in many instances. In this talk I describe a few of the cases where we have found EBSD to provide crucial, unique information. See attachment.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Expression and crystallographic studies of the Arabidopsis thaliana GDP-D-mannose pyrophosphorylase VTC1.

PubMed

Zhao, Shun; Liu, Lin

2016-10-01

GDP-D-mannose pyrophosphorylase catalyzes the production of GDP-D-mannose, an intermediate product in the plant ascorbic acid (AsA) biosynthetic pathway. This enzyme is a key regulatory target in AsA biosynthesis and is encoded by VITAMIN C DEFECTIVE 1 (VTC1) in the Arabidopsis thaliana genome. Here, recombinant VTC1 was expressed, purified and crystallized. Diffraction data were obtained from VTC1 crystals grown in the absence and presence of substrate using X-rays. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution and belonged to space group R32, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°; the crystal of VTC1 in the presence of substrate diffracted X-rays to 1.75 Å resolution and belonged to space group P2 1 , with unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°.

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis

PubMed Central

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M.; Bartlam, Mark

2016-01-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate. PMID:26919520

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis.

PubMed

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M; Bartlam, Mark

2016-03-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate.

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

X-ray diffraction and infrared spectroscopy studies of Ba(Fe1/2Nb1/2)O3-(Na1/2Bi1/2)TiO3 ceramics

NASA Astrophysics Data System (ADS)

Chandra, K. P.; Yadav, Anjana; Prasad, K.

2018-05-01

Ceramics (1-x)Ba(Fe1/2Nb1/2)O3-x(Na1/2Bi1/2)TiO3; 0≤x≤1.0 were prepared by conventional ceramic synthesis technique. Rietveld refinements of X-ray diffraction data of these ceramics were carried out using FullProf software and determined their crystal symmetry, space group and unit cell dimensions. Rietveld refinement revealed that Ba(Fe1/2Nb1/2)O3 has cubic structure with space group Pm 3 ¯ m and Na1/2Bi1/2)TiO3 has rhombohedral structure with space group R3c. Addition of (Na1/2Bi1/2)TiO3 to Ba(Fe1/2Nb1/2)O3 resulted in the change of unit cell structure from cubic to tetragonal (P4/mmm) for x = 0.75 and the X-Ray diffraction peaks slightly shift towards higher Bragg's angle, suggesting slight decrease in unit cell volume. SEM studies were carried out in order to access the quality of the prepared ceramics which showed a change in grain shapes with the increase of (Na1/2Bi1/2)TiO3 content. FTIR spectra confirmed the formation of perovskite type solid solutions.

Instrument and method for focusing X-rays, gamma rays and neutrons

DOEpatents

Smither, Robert K.

1984-01-01

A crystal diffraction instrument or diffraction grating instrument with an improved crystalline structure or grating spacing structure having a face for receiving a beam of photons or neutrons and diffraction planar spacing or grating spacing along that face with the spacing increasing progressively along the face to provide a decreasing Bragg diffraction angle for a monochromatic radiation and thereby increasing the usable area and acceptance angle. The increased planar spacing for the diffraction crystal is provided by the use of a temperature differential across the crystalline structure, by assembling a plurality of crystalline structures with different compositions, by an individual crystalline structure with a varying composition and thereby a changing planar spacing along its face, and by combinations of these techniques. The increased diffraction grating element spacing is generated during the fabrication of the diffraction grating by controlling the cutting tool that is cutting the grooves or controlling the laser beam, electron beam or ion beam that is exposing the resist layer, etc. It is also possible to vary this variation in grating spacing by applying a thermal gradient to the diffraction grating in much the same manner as is done in the crystal diffraction case.

Instrument and method for focusing x rays, gamma rays, and neutrons

DOEpatents

Smither, R.K.

1982-03-25

A crystal-diffraction instrument or diffraction-grating instrument is described with an improved crystalline structure or grating spacing structure having a face for receiving a beam of photons or neutrons and diffraction planar spacing or grating spacing along that face with the spacing increasing progressively along the face to provide a decreasing Bragg diffraction angle for a monochromatic radiation and thereby increasing the usable area and acceptance angle. The increased planar spacing for the diffraction crystal is provided by the use of a temperature differential across the line structures with different compositions, by an individual crystalline structure with a varying composition and thereby a changing planar spacing along its face, and by combinations of these techniques. The increased diffraction grating element spacing is generated during the fabrication of the diffraction grating by controlling the cutting tool that is cutting the grooves or controlling the laser beam, electron beam, or ion beam that is exposing the resist layer, etc. It is also possible to vary this variation in grating spacing by applying a thermal gradient to the diffraction grating in much the same manner as is done in the crystal-diffraction case.

First-principles prediction of low-energy structures for AlH3

NASA Astrophysics Data System (ADS)

Sun, Shoutian; Ke, Xuezhi; Chen, Changfeng; Tanaka, Isao

2009-01-01

We report density-functional calculations that predict ten different low-energy structures for aluminum hydride AlH3 with space groups Pnma , P6/mmm , I4/mcm , P4/mbm , P4/nmm , Pm3¯m , P21/m , P21/c , Pbcm , and P4/n . Phonon calculations within harmonic approximation reveal unstable modes in the P6/mmm , I4/mcm , P4/mbm , P4/nmm , Pm3¯m , P21/m , and P21/c structures, indicating that they are unstable at low temperatures. The calculations show that the thermodynamic stabilities for AlH3 with space groups Pnma , Pbcm , and P4/n are overall close to the existing α - and γ-AlH3 . From x-ray powder-diffraction patterns, the simulated main-peak positions for AlH3 (P4/n) are in good agreement with experimental δ-AlH3 . A full Rietveld analysis reveals that the fitting space groups R3¯c , Pbcm , and Pnma to the experimental x-ray powder-diffraction pattern of α-AlH3 gives almost the same satisfactory result.

NMR, symmetry elements, structure and phase transitions in the argyrodite family

NASA Astrophysics Data System (ADS)

Gaudin, E.; Taulelle, F.; Boucher, F.; Evain, M.

1998-02-01

Cu7PSe6 belongs to a family of structures known as the argyrodites. It undergoes two phases transitions. The high temperature phase has been determined by X-ray diffraction. It has a Foverline{4}3m space group. Medium temperature phases have been refined using a non-harmonic technique and the space group proposed is P213. The low temperature phase had an apparent space group of Foverline{4}3m also. Use of X-ray diffraction and NMR together has allowed to determine the space groups of all phases as being respectively Foverline{4}3m, P213 and Pmn21. Positioning of disordered coppers in the structure is therefore possible and the structure can be described by connex polyhedra of PSe3-4 and SeCux-2_x. The phase transitions can be understood by an ordered motion of SeCux-2x polyhedra. If these polyhedra set in motion independently two transitions are to be observed, if they are coupled only one is observed. Cu7PSe6 appartient à une famille de composés connus sous le nom d'argyrodites. Cu7PSe6 possède deux transitions de phase. La structure de haute température a été déterminée par diffraction des rayons X. Elle se décrit par le groupe d'espace Foverline{4}3m. La phase de moyenne température a été raffinée en utilisant une technique non-harmonique et le groupe d'espace proposé est P213. La phase de basse température possède également un groupe d'espace apparent Foverline{4}3m. En utilisant ensemble la diffraction des rayons X et la RMN, il a été possible de déterminer les groupes d'espace de toutes les phases comme étant respectivement Foverline{4}3m, P213 et Pmn21. Placer les atomes de cuivre, désordonnés, dans la structure devient alors possible et la structure peut se décrire comme un ensemble de polyèdres connexes de PSe3-4 et SeCux-2_x. Les transitions de phases se décrivent alors comme des mouvements ordonnés des polyèdres SeCux-2_x. Si ces polyèdres se mettent en mouvement indépendamment, deux transitions de phases sont attendues, si leur mise en mouvement est couplée, une seule est observée.

Purification, crystallization and preliminary X-ray diffraction of the N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu

2013-12-24

The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.

Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

Symmetry and light stuffing of H o 2 T i 2 O 7 ,   E r 2 T i 2 O 7 , and Y b 2 T i 2 O 7 characterized by synchrotron x-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baroudi, Kristen; Gaulin, Bruce D.; Lapidus, Saul H.

2015-07-01

The Ho2Ti2O7, Er2Ti2O7 and Yb2Ti2O7 pyrochlores were studied by synchrotron X-ray diffraction to determine whether the (002) peak, forbidden in the pyrochlore space group Fd-3m but observed in single crystal neutron scattering measurements, is present due to a deviation of their pyrochlore structure from Fd-3m symmetry. Synchrotron diffraction measurements on precisely synthesized stoichiometric and non-stoichiometric powders and a crushed floating zone crystal of Ho2Ti2O7 revealed that the (002) reflection is absent in all cases to a sensitivity of approximately one part in 30,000 of the strongest X-ray diffraction peak. This indicates to high sensitivity that the structural space group ofmore » these rare earth titanate pyrochlores is Fd-3m, and that thus the (002) peak observed in the neutron scattering experiments has a non-structural origin. The cell parameters and internal strain for lightly stuffed Ho2+xTi2-xO7 are also presented.« less

Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

2006-10-01

Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

Evidence for monoclinic distortion in the ground state phase of underdoped La 1.95Sr 0.05CuO 4: A single crystal neutron diffraction study

DOE PAGES

Singh, Anar; Schefer, Jurg; Sura, Ravi; ...

2016-03-24

The existing controversy about the symmetry of the crystal structure of the ground state of the critical doped La 1.95Sr 0.05CuO 4 has been resolved by analyzing the single crystal neutron diffraction data collected between 5 and 730 K. We observed small but significant intensities for "forbidden" reflections given by extinction rules of the orthorhombic Bmab space group at low temperatures. A careful investigation of neutron diffraction data reveals that the crystal structure of La 1.95Sr 0.05CuO 4 at 5 K is monoclinic with B2/m (2/m 1 1) space group. The monoclinic structure emerges from the orthorhombic structure in amore » continuous way; however, the structure is stable below similar to 120K which agrees with other observed phenomena. Lastly, our results on symmetry changes are crucial for the interpretation of physical properties also in other high temperature superconductors with similar structures.« less

Evidence for monoclinic distortion in the ground state phase of underdoped La{sub 1.95}Sr{sub 0.05}CuO{sub 4}: A single crystal neutron diffraction study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anar, E-mail: singhanar@gmail.com; Schefer, Jürg; Frontzek, Matthias

2016-03-28

The existing controversy about the symmetry of the crystal structure of the ground state of the critical doped La{sub 1.95}Sr{sub 0.05}CuO{sub 4} has been resolved by analyzing the single crystal neutron diffraction data collected between 5 and 730 K. We observed small but significant intensities for “forbidden” reflections given by extinction rules of the orthorhombic Bmab space group at low temperatures. A careful investigation of neutron diffraction data reveals that the crystal structure of La{sub 1.95}Sr{sub 0.05}CuO{sub 4} at 5 K is monoclinic with B2/m (2/m 1 1) space group. The monoclinic structure emerges from the orthorhombic structure in a continuous way;more » however, the structure is stable below ∼120 K which agrees with other observed phenomena. Our results on symmetry changes are crucial for the interpretation of physical properties also in other high temperature superconductors with similar structures.« less

Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony

2006-03-01

A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less

The indexing ambiguity in serial femtosecond crystallography (SFX) resolved using an expectation maximization algorithm.

PubMed

Liu, Haiguang; Spence, John C H

2014-11-01

Crystallographic auto-indexing algorithms provide crystal orientations and unit-cell parameters and assign Miller indices based on the geometric relations between the Bragg peaks observed in diffraction patterns. However, if the Bravais symmetry is higher than the space-group symmetry, there will be multiple indexing options that are geometrically equivalent, and hence many ways to merge diffraction intensities from protein nanocrystals. Structure factor magnitudes from full reflections are required to resolve this ambiguity but only partial reflections are available from each XFEL shot, which must be merged to obtain full reflections from these 'stills'. To resolve this chicken-and-egg problem, an expectation maximization algorithm is described that iteratively constructs a model from the intensities recorded in the diffraction patterns as the indexing ambiguity is being resolved. The reconstructed model is then used to guide the resolution of the indexing ambiguity as feedback for the next iteration. Using both simulated and experimental data collected at an X-ray laser for photosystem I in the P63 space group (which supports a merohedral twinning indexing ambiguity), the method is validated.

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

2005-08-01

Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

Low orthopyroxene from a lunar deep crustal rock - A new pyroxene polymorph of space group P21ca

NASA Technical Reports Server (NTRS)

Smyth, J. R.

1974-01-01

Bronzite crystals (En86Fs11Wo3) from a slowly-cooled lunar troctolitic granulite, have space group P21ca, a postulated, but previously unreported space group. Diffractions violating the b-glide extinction conditions have been observed in long-exposure X-ray precession photographs from three of these crystals and on an automated X-ray diffractometer. P21ca is a subgroup of the common orthopyroxene space group Pbca, and its cell dimensions (a = 18.235 plus or minus 0.004 A, b = 8.831 plus or minus 0.002 A, c = 5.189 plus or minus 0.001 A) are similar to those of terrestrial bronzites. It is postulated that the lower symmetry space group has developed as a result of very slow cooling at pressures of one to two kilobars deep in the lunar crust.

Absence of pressure-induced amorphization in LiKSO4.

PubMed

Machon, D; Pinheiro, C B; Bouvier, P; Dmitriev, V P; Crichton, W A

2010-08-11

Angle-resolved synchrotron radiation diffraction was used to investigate lithium potassium sulfate (LiKSO(4)) crystals under high pressure. We confirm that the title compound undergoes three phase transitions, α →β, β → γ and γ →δ, observed at around 0.8 GPa, 4.0 GPa and 7.0 GPa, respectively. Two competitive structures are proposed for the β-phase after powder diffraction data Rietveld refinements: an orthorhombic (space group Cmc 2(1)) or a monoclinic (space group Cc) structure. These structures correspond to the models of the low temperature phases. The γ-phase is indexed by a monoclinic structure. Finally, the δ-phase is found to be highly disordered. No evidence of any pressure-induced amorphous phase was observed up to 24 GPa, even under imposed highly non-hydrostatic conditions, contrary to previous propositions.

Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

2006-06-01

SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Revisiting the magnetic structure and charge ordering in La1 /3Sr2 /3FeO3 by neutron powder diffraction and Mössbauer spectroscopy

NASA Astrophysics Data System (ADS)

Li, F.; Pomjakushin, V.; Mazet, T.; Sibille, R.; Malaman, B.; Yadav, R.; Keller, L.; Medarde, M.; Conder, K.; Pomjakushina, E.

2018-05-01

The magnetic ordering of La1 /3Sr2 /3FeO3 perovskite has been studied by neutron powder diffraction and 57Fe Mössbauer spectroscopy down to 2 K. From symmetry analysis, a chiral helical model and a collinear model are proposed to describe the magnetic structure. Both are commensurate, with propagation vector k =(0 ,0 ,1 ) in R 3 ¯c space group. In the former model, the magnetic moments of Fe adopt the magnetic space group P 3221 and have helical and antiferromagnetic ordering propagating along the c axis. The model allows only a single Fe site, with a magnetic moment of 3.46(2)μB at 2 K. In the latter model, the magnetic moments of iron ions adopt the magnetic space group C 2 /c or C 2'/c' and are aligned collinearly. The model allows the presence of two inequivalent Fe sites with magnetic moments of amplitude 3.26(3)μB and 3.67(2)μB, respectively. The neutron-diffraction pattern is equally well fitted by either model. The Mössbauer spectroscopy study suggests a single charge state Fe3.66 + above the magnetic transition and a charge disproportionation into Fe(3.66 -ζ )+ and Fe(3.66 +2 ζ )+ below the magnetic transition. The compatibility of the magnetic structure models with the Mössbauer spectroscopy results is discussed.

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

Diffraction studies of the high pressure phases of GaAs and GaP

NASA Technical Reports Server (NTRS)

Baublitz, M., Jr.; Ruoff, A. L.

1982-01-01

High pressure structural phase transitions of GaAs and GaP have been studied by energy dispersive X-ray diffraction with the radiation from the Cornell High Energy Synchrotron Source. GaAs began to transform at 172 + or - 7 kbar to an orthorhombic structure possibly belonging to space group Fmmm. GaP transformed to a tetragonal beta-Sn type phase at 215 + or - 8 kbar. Although pressure transmitting media were used to minimize shear stresses in the specimens, the high pressure diffraction results were interpreted as showing evidence for planar defects in the specimens.

Pressure induced structural transitions in CuSbS 2 and CuSbSe 2 thermoelectric compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Jason; Kumar, Ravhi S.; Sneed, Daniel

Here, we investigate the structural behavior of CuSbS 2 and CuSbSe 2 thermoelectric materials under high pressure conditions up to 80 GPa using angle dispersive X-ray diffraction in a diamond anvil cell (DAC). We also perform high pressure Raman spectroscopy measurements up to 16 GPa. We observed a pressure-induced structural transformation from the ambient orthorhombic structure with space group Pnma to a triclinic type structure with space group P1 beginning around 8 GPa in both samples and completing at 13 GPa and 10 GPa in CuSbS 2 and CuSbSe 2, respectively. High pressure Raman experiments complement the transitions observed bymore » high pressure X-ray diffraction (HPXRD). Finally, the transitions were found to be reversible on releasing the pressure to ambient in the DAC. The bulk modulus and compressibility of these materials are further discussed.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Pressure induced structural transitions in CuSbS 2 and CuSbSe 2 thermoelectric compounds

DOE PAGES

Baker, Jason; Kumar, Ravhi S.; Sneed, Daniel; ...

2015-04-27

Here, we investigate the structural behavior of CuSbS 2 and CuSbSe 2 thermoelectric materials under high pressure conditions up to 80 GPa using angle dispersive X-ray diffraction in a diamond anvil cell (DAC). We also perform high pressure Raman spectroscopy measurements up to 16 GPa. We observed a pressure-induced structural transformation from the ambient orthorhombic structure with space group Pnma to a triclinic type structure with space group P1 beginning around 8 GPa in both samples and completing at 13 GPa and 10 GPa in CuSbS 2 and CuSbSe 2, respectively. High pressure Raman experiments complement the transitions observed bymore » high pressure X-ray diffraction (HPXRD). Finally, the transitions were found to be reversible on releasing the pressure to ambient in the DAC. The bulk modulus and compressibility of these materials are further discussed.« less

Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lundgren, Stina; Andersen, Birgit; Piškur, Jure

2007-10-01

β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

New Powder Diffraction File (PDF-4) in relational database format: advantages and data-mining capabilities.

PubMed

Kabekkodu, Soorya N; Faber, John; Fawcett, Tim

2002-06-01

The International Centre for Diffraction Data (ICDD) is responding to the changing needs in powder diffraction and materials analysis by developing the Powder Diffraction File (PDF) in a very flexible relational database (RDB) format. The PDF now contains 136,895 powder diffraction patterns. In this paper, an attempt is made to give an overview of the PDF-4, search/match methods and the advantages of having the PDF-4 in RDB format. Some case studies have been carried out to search for crystallization trends, properties, frequencies of space groups and prototype structures. These studies give a good understanding of the basic structural aspects of classes of compounds present in the database. The present paper also reports data-mining techniques and demonstrates the power of a relational database over the traditional (flat-file) database structures.

Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

2007-04-01

Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

Empirically testing vaterite structural models using neutron diffraction and thermal analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakoumakos, Bryan C.; Pracheil, Brenda M.; Koenigs, Ryan

Otoliths, calcium carbonate (CaCO 3) ear bones, are among the most commonly used age and growth structures of fishes. Most fish otoliths are comprised of the most dense CaCO 3 polymorph, aragonite. Sturgeon otoliths, in contrast, have been characterized as the rare and structurally enigmatic polymorph, vaterite a metastable polymorph of CaCO 3. Vaterite is an important material ranging from biomedical to personal care applications although its crystal structure is highly debated. We characterized the structure of sturgeon otoliths using thermal analysis and neutron powder diffraction, which is used non-destructively. We confirmed that while sturgeon otoliths are primarily composed ofmore » vaterite, they also contain the denser CaCO 3 polymorph, calcite. For the vaterite fraction, neutron diffraction data provide enhanced discrimination of the carbonate group compared to x-ray diffraction data, owing to the different relative neutron scattering lengths, and thus offer the opportunity to uniquely test the more than one dozen crystal structural models that have been proposed for vaterite. Of those, space group P6 522 model, a = 7.1443(4)Å , c = 25.350(4)Å , V = 1121.5(2)Å 3 provides the best fit to the neutron powder diffraction data, and allows for a structure refinement using rigid carbonate groups.« less

Empirically testing vaterite structural models using neutron diffraction and thermal analysis

DOE PAGES

Chakoumakos, Bryan C.; Pracheil, Brenda M.; Koenigs, Ryan; ...

2016-11-18

Otoliths, calcium carbonate (CaCO 3) ear bones, are among the most commonly used age and growth structures of fishes. Most fish otoliths are comprised of the most dense CaCO 3 polymorph, aragonite. Sturgeon otoliths, in contrast, have been characterized as the rare and structurally enigmatic polymorph, vaterite a metastable polymorph of CaCO 3. Vaterite is an important material ranging from biomedical to personal care applications although its crystal structure is highly debated. We characterized the structure of sturgeon otoliths using thermal analysis and neutron powder diffraction, which is used non-destructively. We confirmed that while sturgeon otoliths are primarily composed ofmore » vaterite, they also contain the denser CaCO 3 polymorph, calcite. For the vaterite fraction, neutron diffraction data provide enhanced discrimination of the carbonate group compared to x-ray diffraction data, owing to the different relative neutron scattering lengths, and thus offer the opportunity to uniquely test the more than one dozen crystal structural models that have been proposed for vaterite. Of those, space group P6 522 model, a = 7.1443(4)Å , c = 25.350(4)Å , V = 1121.5(2)Å 3 provides the best fit to the neutron powder diffraction data, and allows for a structure refinement using rigid carbonate groups.« less

La 3+ doping of the Sr 2CoWO 6 double perovskite: A structural and magnetic study

NASA Astrophysics Data System (ADS)

López, C. A.; Viola, M. C.; Pedregosa, J. C.; Carbonio, R. E.; Sánchez, R. D.; Fernández-Díaz, M. T.

2008-11-01

La-doped Sr 2CoWO 6 double perovskites have been prepared in air in polycrystalline form by solid-state reaction. These materials have been studied by X-ray powder diffraction (XRPD), neutron powder diffraction (NPD) and magnetic susceptibility. The structural refinement was performed from combined XRPD and NPD data (D2B instrument, λ=1.594 Å). At room temperature, the replacement of Sr 2+ by La 3+ induces a change of the tetragonal structure, space group I4/ m of the undoped Sr 2CoWO 6 into the distorted monoclinic crystal structure, space group P2 1/ n, Z=2. The structure of La-doped phases contains alternating CoO 6 and (Co/W)O 6 octahedra, almost fully ordered. On the other hand, the replacement of Sr 2+ by La 3+ induces a partial replacement of W 6+ by Co 2+ into the B sites, i.e. Sr 2-xLa xCoW 1-yCo yO 6 ( y= x/4) with segregation of SrWO 4. Magnetic and neutron diffraction measurements indicate an antiferromagnetic ordering below TN=24 K independently of the La-substitution.

Crystallographic site swapping of La3+ ion in BaA'LaTeO6 (A' = Na, K, Rb) double perovskite type compounds: diffraction and photoluminescence evidence for the site swapping.

PubMed

Phatak, R; Gupta, S K; Krishnan, K; Sali, S K; Godbole, S V; Das, A

2014-02-28

Double perovskite type compounds of the formula BaA'LaTeO6 (A' = Na, K, Rb) were synthesized by solid state route and their crystal structures were determined by Rietveld analysis using powder X-ray diffraction and neutron diffraction data. Na compound crystallizes in the monoclinic system with P2₁/n space group whereas, K and Rb compounds crystallize in Fm3m space group. All the three compounds show rock salt type ordering at B site. Crystal structure analysis shows that La ion occupies A site in Na compound whereas, it occupies B site in K and Rb compounds according to the general formula of AA'BB'O6 for a double perovskite type compound. Effect of this crystallographic site swapping of the La ion was also observed in the photoluminescence study by doping Eu(3+) in La(3+) site. The large decrease in the intensity of the electric dipole ((5)D0-(7)F2) transition in the Rb compound compared to the Na compound indicates that Eu(3+) ion resides in the centrosymmetric octahedral environment in the Rb compound.

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

PubMed

Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

2011-02-01

Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balotra, Sahil; Newman, Janet; French, Nigel G.

2014-02-19

The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

Crystal structure of hydrocortisone acetate, C23H32O6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaduk, James A.; Gindhart, Amy M.; Blanton, Thomas N.

The crystal structure of hydrocortisone acetate has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Hydrocortisone acetate crystallizes in space groupP2 1(#4) witha= 8.85173(3) Å,b= 13.53859(3) Å,c= 8.86980(4) Å,β= 101.5438(3)°,V= 1041.455(6) Å 3, andZ= 2. Both hydroxyl groups form hydrogen bonds to the ketone oxygen atom on the steroid ring system, resulting in a three-dimensional hydrogen bond network. The powder pattern has been submitted to ICDD for inclusion in the Powder Diffraction File™.

Crystallization of chicken egg white lysozyme from assorted sulfate salts

NASA Astrophysics Data System (ADS)

Forsythe, Elizabeth L.; Snell, Edward H.; Malone, Christine C.; Pusey, Marc L.

1999-01-01

Chicken egg white lysozyme has been found to crystallize from ammonium, sodium, potassium, rubidium, magnesium, and manganese sulfates at acidic and basic pH, with protein concentrations from 60 to 190 mg/ml. Crystals have also been grown at 4°C in the absence of any other added salts using isoionic lysozyme which was titrated to pH 4.6 with dilute sulfuric acid. Four different crystal forms have been obtained, depending upon the temperature, protein concentration, and precipitating salt employed. Crystals grown at 15°C were generally tetragonal, with space group P4 32 12. Crystallization at 20°C typically resulted in the formation of orthorhombic crystals, space group P2 12 12 1. The tetragonal ↔ orthorhombic transition appeared to be a function of both the temperature and protein concentration, occurring between 15 and 20°C and between 100 and 125 mg/ml protein concentration. Crystallization from 1.2 M magnesium sulfate at pH 7.8 gave a trigonal crystal, space group P3 12 1, a= b=87.4, c=73.7, γ=120°, which diffracted to 2.8 Å. Crystallization from ammonium sulfate at pH 4.6, generally at lower temperatures, was also found to result in a monoclinic form, space group C2, a=65.6, b=95.0, c=41.2, β=119.2°. A crystal of ˜0.2×0.2×0.5 mm grown from bulk solution diffracted to ˜3.5 Å.

Crystal structure of choline fenofibrate (Trilipix®), (C5H14NO) (C17H14ClO4)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaduk, James A.; Zhong, Kai; Gindhart, Amy M.

2016-04-04

The crystal structure of choline fenofibrate has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Choline fenofibrate crystallizes in space groupPbca(#61) witha= 12.341 03(2),b= 28.568 70(6),c= 12.025 62(2) Å,V= 4239.84(1) Å 3, andZ= 8. The hydroxyl group of the choline anion makes a strong hydrogen bond to the ionized carboxylate group of the fenofibrate anion. Together with C–H···O hydrogen bonds, these link the cations and anions into layers parallel to theac-plane. The powder pattern has been submitted to ICDD for inclusion in the Powder Diffraction File™.

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Eyeglass: A Very Large Aperture Diffractive Space Telescope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hyde, R; Dixit, S; Weisberg, A

2002-07-29

Eyeglass is a very large aperture (25-100 meter) space telescope consisting of two distinct spacecraft, separated in space by several kilometers. A diffractive lens provides the telescope's large aperture, and a separate, much smaller, space telescope serves as its mobile eyepiece. Use of a transmissive diffractive lens solves two basic problems associated with very large aperture space telescopes; it is inherently fieldable (lightweight and flat, hence packagable and deployable) and virtually eliminates the traditional, very tight, surface shape tolerances faced by reflecting apertures. The potential drawback to use of a diffractive primary (very narrow spectral bandwidth) is eliminated by correctivemore » optics in the telescope's eyepiece. The Eyeglass can provide diffraction-limited imaging with either single-band, multiband, or continuous spectral coverage. Broadband diffractive telescopes have been built at LLNL and have demonstrated diffraction-limited performance over a 40% spectral bandwidth (0.48-0.72 {micro}m). As one approach to package a large aperture for launch, a foldable lens has been built and demonstrated. A 75 cm aperture diffractive lens was constructed from 6 panels of 1 m thick silica; it achieved diffraction-limited performance both before and after folding. This multiple panel, folding lens, approach is currently being scaled-up at LLNL. We are building a 5 meter aperture foldable lens, involving 72 panels of 700 {micro}m thick glass sheets, diffractively patterned to operate as coherent f/50 lens.« less

On the Tetragonal Forms of KMo 4O 6

NASA Astrophysics Data System (ADS)

McCarroll, W. H.; Ramanujachary, K. V.; Greenblatt, M.; Marsh, Richard E.

1995-06-01

A reexamination of the X-ray diffraction data for the tetragonal form of KMo4O6 prepared by fused salt electrolysis leads to the conclusion that the crystal structure is better described by using space group P 4/mbm and not P4¯ as previously reported. However, refinement in the new space group does not result in any significant changes in the atomic arrangement. Possible reasons for the significant difference between the c lattice parameter of this form of KMo4O6 and that prepared at high pressures are also discussed.

Structure, dielectric and electric properties of diisobutylammonium hydrogen sulfate crystal

NASA Astrophysics Data System (ADS)

Bednarchuk, Tamara J.; Kinzhybalo, Vasyl; Markiewicz, Ewa; Hilczer, Bożena; Pietraszko, Adam

2018-02-01

Diisobutylammonium hydrogen sulfate, a new organic-inorganic hybrid compound, was successfully synthesized and three structural phases in 298-433 K temperature range were revealed by differential scanning calorimetry and X-ray powder diffraction studies. Single crystal X-ray diffraction data were used to describe the crystal structures in each particular case. In phase III (below 336/319 K on heating/cooling) the crystal arrangement appears to be within the triclinic symmetry with P-1 space group. During heating in the 336-339 K region (and 319-337 K on cooling) the crystal exists in the phase II, characterized by monoclinic symmetry with P21/c space group. Consequently, above 339 K (during heating, and 337 K during cooling temperature sequences), i.e. in phase I the crystal exhibits orthorhombic symmetry (Cmce space group). Ferroelastic domain structure was observed in phase III. These phase boundaries (III→II and II→I) were accompanied by the presence of small anomalies, apparent in the dielectric permittivity and electric conductivity experimental data. Fast proton transport with activation energy of 0.23 eV was observed in the high temperature phase I and related to phonon assisted proton diffusion conditioned by disorder of diisobutylammonium (diba) cations, as well as by high thermal displacements of oxygen and sulfur atoms of hydrogen sulfate anion (hs).

Ba0.06(Na,Bi)0.94Ti1-x(Ni1/3Nb2/3)xO3 ceramics: X-ray diffraction and infrared spectroscopy studies

NASA Astrophysics Data System (ADS)

Mishra, R. K.; Prasad, Ashutosh; Chandra, K. P.; Prasad, K.

2018-05-01

Non-lead ceramic samples of Ba0.06(Na0.5Bi0.5)0.94Ti1-x(Ni1/3Nb2/3)xO3; 0 ≤ x ≤ 1.0 were prepared by standard high temperature ceramic synthesis method. Rietveld refinements of X-ray diffraction data of these ceramics were carried out using FullProf software and determined their crystal symmetry, space group and unit cell dimensions. Rietveld refinement revealed that Ba0.06(Na0.5Bi0.5)0.94TiO3 has a monoclinic structure with space group P4/m while B0.06(Na0.5Bi0.5)0.94(Ni1/3Nb2/3)O3 has tetragonal (pseudo-cubic) structure with space group P4/mmm. Partial replacement of Ti4+ ion by pseudo-cation (Ni1/33 +Nb2/3 5 +) 4 + resulted in the change of unit cell structure from monoclinic to tetragonal. SEM studies were carried out in order to access the quality of the prepared ceramics which showed a change in grain sizes with the increase of (Ni1/33 +Nb2/3 5 +) 4 + content. FTIR spectra confirmed the formation of perovskite type solid solutions.

Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

2014-02-19

The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

PubMed

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-10-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

PubMed Central

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-01-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

Synchrotron X-ray powder diffraction data of LASSBio-1515: A new N-acylhydrazone derivative compound

NASA Astrophysics Data System (ADS)

Costa, F. N.; Braz, D.; Ferreira, F. F.; da Silva, T. F.; Barreiro, E. J.; Lima, L. M.; Colaço, M. V.; Kuplich, L.; Barroso, R. C.

2014-02-01

In this work, synchrotron X-ray powder diffraction data allowed for a successful indexing of LASSBio-1515 compound, candidate to analgesic and anti-inflammatory activity. X-ray powder diffraction data collected in transmission and high-throughput geometries were used to analyze this compound. The X-ray wavelength of the synchrotron radiation used in this study was determined to be λ=1.55054 Å. LASSBio-1515 was found to be monoclinic with space group P21/c and unit cell parameters a=11.26255(16) Å, b=12.59785(16) Å, c=8.8540(1) Å, β=90.5972(7)° and V=1256.17(3) Å3.

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens.

PubMed

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-09-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å.

Crystal structure of methylprednisolone acetate form II, C 24H 32O 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wheatley, Austin M.; Kaduk, James A.; Gindhart, Amy M.

The crystal structure of methylprednisolone acetate form II, C 24H 32O 6, has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Methylprednisolone acetate crystallizes in space groupP2 12 12 1(#19) witha= 8.17608(2),b= 9.67944(3),c= 26.35176(6) Å,V= 2085.474(6) Å 3, andZ= 4. Both hydroxyl groups act as hydrogen bond donors, resulting in a two-dimensional hydrogen bond network in theabplane. C–H…O hydrogen bonds also contribute to the crystal energy. The powder pattern is included in the Powder Diffraction File™ as entry 00-065-1412.

When combined X-ray and polarized neutron diffraction data challenge high-level calculations: spin-resolved electron density of an organic radical.

PubMed

Voufack, Ariste Bolivard; Claiser, Nicolas; Lecomte, Claude; Pillet, Sébastien; Pontillon, Yves; Gillon, Béatrice; Yan, Zeyin; Gillet, Jean Michel; Marazzi, Marco; Genoni, Alessandro; Souhassou, Mohamed

2017-08-01

Joint refinement of X-ray and polarized neutron diffraction data has been carried out in order to determine charge and spin density distributions simultaneously in the nitronyl nitroxide (NN) free radical Nit(SMe)Ph. For comparison purposes, density functional theory (DFT) and complete active-space self-consistent field (CASSCF) theoretical calculations were also performed. Experimentally derived charge and spin densities show significant differences between the two NO groups of the NN function that are not observed from DFT theoretical calculations. On the contrary, CASSCF calculations exhibit the same fine details as observed in spin-resolved joint refinement and a clear asymmetry between the two NO groups.

Crystallization of Chicken Egg White Lysozyme from Assorted Sulfate Salts

NASA Technical Reports Server (NTRS)

Forsythe, Elizabeth L.; Snell, Edward H.; Malone, Christine C.; Pusey, Marc L.

1999-01-01

Chicken egg white lysozyme has been found to crystallize from ammonium, sodium, potassium, rubidium, magnesium, and manganese sulfates at acidic and basic pH, with protein concentrations from 60 to 190 mg/ml. Crystals have also been grown at 4 C in the absence of any other added salts using isoionic lysozyme which was titrated to pH 4.6 with dilute sulfuric acid. Four different crystal forms have been obtained, depending upon the temperature, protein concentration, and precipitating salt employed. Crystals grown at 15 C were generally tetragonal, with space group P4(sub 3)2(sub 1)2. Crystallization at 20 C typically resulted in the formation of orthorhombic crystals, space group P2(sub 1)2(sub 1)2(sub 1). The tetragonal reversible reaction orthorhombic transition appeared to be a function of both the temperature and protein concentration, occurring between 15 and 20 C and between 100 and 125 mg/ml protein concentration. Crystallization from 1.2 M magnesium sulfate at pH 7.8 gave a trigonal crystal, space group P3(sub 1)2(sub 1), a = b = 87.4, c = 73.7, gamma = 120 deg, which diffracted to 2.8 A. Crystallization from ammonium sulfate at pH 4.6, generally at lower temperatures, was also found to result in a monoclinic form. space group C2, a = 65.6, b = 95.0, c = 41.2, beta = 119.2 deg. A crystal of approximately 0.2 x 0.2 x 0.5 mm grown from bulk solution diffracted to approximately 3.5 A.

Crystal Structure of Garnet-Related Li-Ion Conductor Li7–3xGaxLa3Zr2O12: Fast Li-Ion Conduction Caused by a Different Cubic Modification?

PubMed Central

2016-01-01

Li-oxide garnets such as Li7La3Zr2O12 (LLZO) are among the most promising candidates for solid-state electrolytes to be used in next-generation Li-ion batteries. The garnet-structured cubic modification of LLZO, showing space group Ia-3d, has to be stabilized with supervalent cations. LLZO stabilized with Ga3+ shows superior properties compared to LLZO stabilized with similar cations; however, the reason for this behavior is still unknown. In this study, a comprehensive structural characterization of Ga-stabilized LLZO is performed by means of single-crystal X-ray diffraction. Coarse-grained samples with crystal sizes of several hundred micrometers are obtained by solid-state reaction. Single-crystal X-ray diffraction results show that Li7–3xGaxLa3Zr2O12 with x > 0.07 crystallizes in the acentric cubic space group I-43d. This is the first definite record of this cubic modification for LLZO materials and might explain the superior electrochemical performance of Ga-stabilized LLZO compared to its Al-stabilized counterpart. The phase transition seems to be caused by the site preference of Ga3+. 7Li NMR spectroscopy indicates an additional Li-ion diffusion process for LLZO with space group I-43d compared to space group Ia-3d. Despite all efforts undertaken to reveal structure–property relationships for this class of materials, this study highlights the potential for new discoveries. PMID:27019548

An introduction to data reduction: space-group determination, scaling and intensity statistics.

PubMed

Evans, Philip R

2011-04-01

This paper presents an overview of how to run the CCP4 programs for data reduction (SCALA, POINTLESS and CTRUNCATE) through the CCP4 graphical interface ccp4i and points out some issues that need to be considered, together with a few examples. It covers determination of the point-group symmetry of the diffraction data (the Laue group), which is required for the subsequent scaling step, examination of systematic absences, which in many cases will allow inference of the space group, putting multiple data sets on a common indexing system when there are alternatives, the scaling step itself, which produces a large set of data-quality indicators, estimation of |F| from intensity and finally examination of intensity statistics to detect crystal pathologies such as twinning. An appendix outlines the scoring schemes used by the program POINTLESS to assign probabilities to possible Laue and space groups.

Study of the structure of PyHReO{sub 4} under high pressure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kichanov, S. E., E-mail: ekich@nf.jinr.ru; Kozlenko, D. P.; Wasicki, J. W.

2007-05-15

The structure of deuterated pyridinium perrhenate (d{sub 5}PyH)ReO{sub 4} (C{sub 5}D{sub 5}NHReO{sub 4}) is studied by X-ray diffraction at room temperature and pressures up to 3.5 GPa and by neutron diffraction in the temperature range 10-293 K and at pressures up to 2.0 GPa. Under normal conditions, this compound belongs to the orthorhombic space group Cmc2{sub 1} (ferroelectric phase II). At room temperature and pressures above P > 0.7 GPa, a transition to an orthorhombic phase (paraelectric phase II) is observed. This paraelectric phase is described by the space group Cmcm. At a pressure as high as P = 2.0more » GPa, phase I remains stable at temperatures down to 10 K. This fact indicates that the high pressure suppresses the ferroelectric state in deuterated pyridinium perrhenate (d{sub 5}PyH)ReO{sub 4}.« less

Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

PubMed Central

Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

2006-01-01

The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Edward B.; Gurda-Whitaker, Brittney; Govindasamy, Lakshmanan

2006-12-01

Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. The diffraction data were subsequently processed and reduced with an overall R{sub sym} of 12.3% and a completeness of 89.0%. Based on the unit-cellmore » volume, rotation-function and translation-function results and packing considerations, there is one virus capsid (60 viral proteins) per unit cell and there are ten viral proteins per crystallographic asymmetric unit. The AAV1 capsid shares both the twofold and threefold crystallographic symmetry operators. The AAV1 data have been initially phased using a polyalanine model (based on the crystal structure of AAV4) to 4.0 Å resolution and the structure determination and refinement is in progress using tenfold noncrystallographic symmetry electron-density averaging.« less

Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

PubMed

Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

2014-02-01

Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

Four crystal forms of a Bence-Jones protein

PubMed Central

Makino, Debora L.; Henschen-Edman, Agnes H.; McPherson, Alexander

2005-01-01

Four crystal forms have been grown and characterized by X-ray diffraction of a Bence-Jones protein collected from the urine of a multiple myeloma patient more than 40 years ago. Closely related tetragonal and orthorhombic forms belonging to space groups P43212 and P212121, with unit-cell parameters a = b = 68.7, c = 182.1 and a = 67.7, b = 69.4, c = 87.3 Å, diffract to 1.5 and 1.9 Å, respectively. Two closely related trigonal forms, both belonging to space group P3121 with unit-cell parameters a = b = 154.3 Å but differing by a doubling of the c axis, one 46.9 Å and the other 94.0 Å, diffract to 2.9 and 2.6 Å resolution, respectively. The trigonal crystal of short c-axis length shows a positive indication of twinning. The trigonal crystal of longer c axis, which appeared only after eight months of incubation at room temperature, is likely to be composed of proteolytically degraded molecules and unlike the other crystal forms contains two entire Bence-Jones dimers in the asymmetric unit. This latter crystal form may shed some light on the formation of fibrils common to certain storage diseases. PMID:16508097

Crystallization, X-ray diffraction analysis and SIRAS/molecular-replacenent phasing of three crystal forms of Anabaena sensory rhodopsin transducer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vogeley, Lutz; Luecke, Hartmut, E-mail: hudel@uci.edu

2006-04-01

Crystals of Anabaena sensory rhodopsin transducer, the transducer for the cyanobacterial photosensor Anabaena sensory rhodopsin, obtained in the space groups P4, C2 and P2{sub 1}2{sub 1}2{sub 1} diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for these crystal forms were obtained by SIRAS phasing using an iodide quick-soak derivative (P4) and molecular replacement (C2 and P2{sub 1}2{sub 1}2{sub 1}). Anabaena sensory rhodopsin transducer (ASRT) is a 14.7 kDa soluble signaling protein associated with the membrane-embedded light receptor Anabaena sensory rhodopsin (ASR) from Anabaena sp., a freshwater cyanobacterium. Crystals of ASRT were obtained in three different space groups, P4, C2more » and P2{sub 1}2{sub 1}2{sub 1}, which diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for one of these crystal forms (P4) were obtained by SIRAS phasing using an iodide quick-soak derivative and a partial model was built. Phases for the remaining crystal forms were obtained by molecular replacement using the partial model from the P4 crystal form.« less

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

High-pressure structural behavior of hydrogarnet, katoite Ca3Al2(O4H4)3

NASA Astrophysics Data System (ADS)

Kyono, A.; Kato, M.; Sano-Furukawa, A.; Machida, S. I.; Hattori, T.

2016-12-01

High-pressure structural behavior of hydrogarnet, katoite Ca3Al2(O4H4)3, was investigated using single-crystal synchrotron x-ray diffraction, Raman spectroscopic, and neutron diffraction analyses. The high-pressure single-crystal synchrotron x-ray diffraction was performed at BL10A, Photon Factory, KEK, Japan. With compression, the a lattice parameter decreased continuously from 12.565 (1) Å to 12.226 (3) Å up to 7.1 GPa. A fit to the Birch-Murnaghan equation of state (EoS) based on the P-V data gives K0 = 56.0 (6) GPa, K' = 4.3 (1), and V0 = 1984.2 (5) Å3, which were consistent with the previous study by Lager et al. (2002). Weak reflections forbidden by the systematic absence of hk0 with k, l = 2n were observed at 5.5 GPa and their intensities became stronger as increasing pressure. The pattern change of systematic absence implies phase transformation from space group Ia-3d to its non-centrosymmetric space group I-43d. High-pressure Raman spectroscopic study was performed up to 8.3 GPa at room temperature. The pressure dependence of lattice modes showed a positive pressure shifts, whereas that of OH stretching vibration mode was changed negative above 5.1 GPa. The change indicates that the strength of hydrogen bonding turns to increase above 5.1 GPa. High-pressure and high-temperature neutron diffraction study was performed with six-axis large volume press, ATSUHIME, at BL11 (PLANET), J-PARC, Japan. At a pressure of approximately 8 GPa, the a lattice parameter increased with temperature, but neither thermal decomposition nor dehydroxylation process occurred up to 1123 K. The crystal structure of katoite was determined by Rietveld method using neutron diffraction data with the space group I-43d. The volume of dodecahedral site containing Ca cations and that of octahedral site occupied by Al cations remained almost constant with temperature, but two crystallographically inequivalent tetrahedral sites which were caused by phase transformation behaved differently from each other. The volume of T2 site was continuously increased, but that of T1 site was constantly decreased, resulting from anisotropic expansion of the dodecahedral site. Consequently, these anisotropic modifications of coordination polyhedra seem to induce the thermal decomposition of katoite at 1123 K and 8 GPa.

Scientific management of Space Telescope

NASA Technical Reports Server (NTRS)

Odell, C. R.

1981-01-01

A historical summay is given on the science management of the Space Telescope, the inception of which began in 1962, when scientists and engineers first recommended the development of a nearly diffraction limited substantial-size optical telescope. Phase A, the feasibility requirements generation phase, began in 1971 and consisted largely of NASA scientists and a NASA design. Phase B, the preliminary design phase, established a tiered structure of scientists, led by the Large Space Telescope operations and Management Work Group. A Mission Operations Working Group headed six instrument definition teams to develop the essential instrument definitions. Many changes took place during Phase B, before design and development, which began in 1978 and still continues today.

Cloning, expression, purification and crystallization of saccharopine reductase from Magnaporthe grisea.

PubMed

Johansson, E; Steffens, J J; Emptage, M; Lindqvist, Y; Schneider, G

2000-05-01

The gene coding for saccharopine reductase (E.C. 1.5.1.10), an enzyme of the alpha-aminoadipic pathway of lysine biosynthesis in the pathogenic fungus Magnaporthe grisea, was cloned and expressed in Escherichia coli. The purified enzyme was crystallized in space groups C2 and C222(1) using ammonium sulfate pH 4.8 or PEG 6000 pH 4. 1 as precipitants. The unit-cell parameters are a = 115.0, b = 56.6, c = 74.3 A, beta = 111.1 degrees for space group C2, and a = 89.3, b = 119.0, c = 195.9 A for space group C222(1). The crystals diffract to resolutions of 2.0 A (C2) and 2.4 A (C222(1)) at synchrotron sources.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

Structure of N-(5-ethyl-[1,3,4]-thiadiazole-2-yl)toluenesulfonamide by combined X-ray powder diffraction, 13C solid-state NMR and molecular modelling.

PubMed

Hangan, Adriana; Borodi, Gheorghe; Filip, Xenia; Tripon, Carmen; Morari, Cristian; Oprean, Luminita; Filip, Claudiu

2010-12-01

The crystal structure solution of the title compound is determined from microcrystalline powder using a multi-technique approach that combines X-ray powder diffraction (XRPD) data analysis based on direct-space methods with information from (13)C solid-state NMR (SSNMR), and molecular modelling using the GIPAW (gauge including projector augmented-wave) method. The space group is Pbca with one molecule in the asymmetric unit. The proposed methodology proves very useful for unambiguously characterizing the supramolecular arrangement adopted by the N-(5-ethyl-[1,3,4]-thiadiazole-2-yl)toluenesulfonamide molecules in the crystal, which consists of extended double strands held together by C-H···π non-covalent interactions.

Rayleigh-wave diffractions due to a void in the layered half space

USGS Publications Warehouse

Xia, J.; Xu, Y.; Miller, R.D.; Nyquist, Jonathan E.

2006-01-01

Void detection is challenging due to the complexity of near-surface materials and the limited resolution of geophysical methods. Although multichannel, high-frequency, surface-wave techniques can provide reliable shear (S)-wave velocities in different geological settings, they are not suitable for detecting voids directly based on anomalies of the S-wave velocity because of limitations on the resolution of S-wave velocity profiles inverted from surface-wave phase velocities. Xia et al. (2006a) derived a Rayleigh-wave diffraction traveltime equation due to a void in the homogeneous half space. Encouraging results of directly detecting a void from Rayleigh-wave diffractions were presented (Xia et al., 2006a). In this paper we used four two-dimensional square voids in the layered half space to demonstrate the feasibility of detecting a void with Rayleigh-wave diffractions. Rayleigh-wave diffractions were recognizable for all these models after removing direct surface waves by F-K filtering. We evaluate the feasibility of applying the Rayleigh-wave diffraction traveltime equation to a void in the layered earth model. The phase velocity of diffracted Rayleigh waves is predominately determined by surrounding materials of a void. The modeling results demonstrate that the Rayleigh-wave diffraction traveltime equation due to a void in the homogeneous half space can be applied to the case of a void in the layered half space. In practice, only two diffraction times are necessary to define the depth to the top of a void and the average velocity of diffracted Rayleigh waves. ?? 2005 Society of Exploration Geophysicists.

TakeTwo: an indexing algorithm suited to still images with known crystal parameters

PubMed Central

Ginn, Helen Mary; Roedig, Philip; Kuo, Anling; Evans, Gwyndaf; Sauter, Nicholas K.; Ernst, Oliver; Meents, Alke; Mueller-Werkmeister, Henrike; Miller, R. J. Dwayne; Stuart, David Ian

2016-01-01

The indexing methods currently used for serial femtosecond crystallography were originally developed for experiments in which crystals are rotated in the X-ray beam, providing significant three-dimensional information. On the other hand, shots from both X-ray free-electron lasers and serial synchrotron crystallo­graphy experiments are still images, in which the few three-dimensional data available arise only from the curvature of the Ewald sphere. Traditional synchrotron crystallography methods are thus less well suited to still image data processing. Here, a new indexing method is presented with the aim of maximizing information use from a still image given the known unit-cell dimensions and space group. Efficacy for cubic, hexagonal and orthorhombic space groups is shown, and for those showing some evidence of diffraction the indexing rate ranged from 90% (hexagonal space group) to 151% (cubic space group). Here, the indexing rate refers to the number of lattices indexed per image. PMID:27487826

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens

PubMed Central

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-01-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å. PMID:26323306

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

PubMed

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-12-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

PubMed Central

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-01-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

Influence of gamma ray irradiation on stoichiometry of hydrothermally synthesized bismuth telluride nanoparticles

NASA Astrophysics Data System (ADS)

Abishek, N. S.; Naik, K. Gopalakrishna

2018-05-01

Bismuth telluride (Bi2Te3) nanoparticles were synthesized by the hydrothermal method at 200 °C for 24 h. The synthesized Bi2Te3 nanoparticles were irradiated with gamma rays at doses of 50 kGy and 100 kGy. The structural characterization of the pre-irradiated and post-irradiated samples was carried out by X-ray diffraction technique and was found to have rhombohedral phase having R3 ¯m (166) space group. The X-ray diffraction peaks were found to shift towards lower diffraction angle with gamma ray irradiation. The morphologies and compositions of the grown Bi2Te3 nanoparticles were studied using Field Emission Scanning Electron Microscope and X-ray energy dispersive analysis, respectively. The possible cause for the shift in the X-ray diffraction peaks with gamma ray irradiation has been discussed in the present work.

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

PubMed Central

Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

2009-01-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

PubMed

Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

2009-10-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Hybrid Modes in Long Wavelength Free Electron Lasers

DTIC Science & Technology

2010-12-01

response, including the time for reviewing instruction, searching existing data sources, gathering and maintaining the data needed, and completing and...diffraction along one axis, allowing free space diffraction along the other axis. We continue the analysis of the relativistic electron beam, co-propagating...control diffraction along one axis, allowing free space diffraction along the other axis. We continue the analysis of the relativistic electron beam, co

Expression, purification, crystallization and preliminary crystallographic study of isolated modules of the mouse coactivator-associated arginine methyltransferase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Troffer-Charlier, Nathalie; Cura, Vincent; Hassenboehler, Pierre

2007-04-01

Isolated modules of mouse coactivator-associated arginine methyltransferase 1 encompassing the protein arginine N-methyltransferase catalytic domain have been overexpressed, purified and crystallized. X-ray diffraction data have been collected and have enabled determination of the structures by multiple isomorphous replacement using anomalous scattering. Coactivator-associated arginine methyltransferase 1 (CARM1) plays a crucial role in gene expression as a coactivator of several nuclear hormone receptors and also of non-nuclear receptor systems. Its recruitment by the transcriptional machinery induces protein methylation, leading to chromatin remodelling and gene activation. CARM1{sub 28–507} and two structural states of CARM1{sub 140–480} were expressed, purified and crystallized. Crystals of CARM1{submore » 28–507} belong to space group P6{sub 2}22, with unit-cell parameters a = b = 136.0, c = 125.3 Å; they diffract to beyond 2.5 Å resolution using synchrotron radiation and contain one monomer in the asymmetric unit. The structure of CARM1{sub 28–507} was solved by multiple isomorphous replacement and anomalous scattering methods. Crystals of apo CARM1{sub 140–480} belong to space group I222, with unit-cell parameters a = 74.6, b = 99.0, c = 207.4 Å; they diffract to beyond 2.7 Å resolution and contain two monomers in the asymmetric unit. Crystals of CARM1{sub 140–480} in complex with S-adenosyl-l-homocysteine belong to space P2{sub 1}2{sub 1}2, with unit-cell parameters a = 74.6, b = 98.65, c = 206.08 Å; they diffract to beyond 2.6 Å resolution and contain four monomers in the asymmetric unit. The structures of apo and holo CARM1{sub 140–480} were solved by molecular-replacement techniques from the structure of CARM1{sub 28–507}.« less

Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brüx, Christian; Niefind, Karsten; Ben-David, Alon

2005-12-01

The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

Crystallization and preliminary X-ray crystallographic analysis of the cysteine protease inhibitor clitocypin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galeša, Katja; Brzin, Jože; Sabotič, Jerica

2006-01-01

Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. A diffraction data set to 1.55 Å resolution was obtained from a crystal belonging to space group P2, with unit-cell parameters a = 38.326, b = 33.597, c = 55.568 Å, βmore » = 104°. An inability to achieve isomorphism forced the use of MAD and SAD phasing methods. Phasing is in progress.« less

Studies on the growth, structural, spectral and third-order nonlinear optical properties of ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate single crystal.

PubMed

Silambarasan, A; Krishna Kumar, M; Thirunavukkarasu, A; Mohan Kumar, R; Umarani, P R

2015-01-25

An organic nonlinear optical bulk single crystal, Ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate (ACHBS) was successfully grown by solution growth technique. Single crystal X-ray diffraction study confirms that, the grown crystal belongs to P21/c space group. Powder X-ray diffraction and high resolution X-ray diffraction analyses revealed the crystallinity of the grown crystal. Infrared spectral analysis showed the vibrational behavior of chemical bonds and its functional groups. The thermal stability and decomposition stages of the grown crystal were studied by TG-DTA analysis. UV-Visible transmittance studies showed the transparency region and cut-off wavelength of the grown crystal. The third-order nonlinear optical susceptibility of the grown crystal was estimated by Z-scan technique using He-Ne laser source. The mechanical property of the grown crystal was studied by using Vicker's microhardness test. Copyright © 2014 Elsevier B.V. All rights reserved.

Polycrystalline PLZT/ITO Ceramic Electro-Optic Phase Gratings: Electro- Optically Reconfigurable Diffractive Devices for Free-Space and In-Wafer Interconnects

DTIC Science & Technology

1994-09-01

free-space and waveguide interconnects is investigated through the fabrication, testing and modeling of polycrystalline PLZT/ITO ceramic electro - optic phase...only gratings. PLZT Diffraction grating, Electro - optic diffraction grating, Optical switching, Optical interconnects, Reconfigurable interconnect

New 2D diffraction model and its applications to terahertz parallel-plate waveguide power splitters

PubMed Central

Zhang, Fan; Song, Kaijun; Fan, Yong

2017-01-01

A two-dimensional (2D) diffraction model for the calculation of the diffraction field in 2D space and its applications to terahertz parallel-plate waveguide power splitters are proposed in this paper. Compared with the Huygens-Fresnel principle in three-dimensional (3D) space, the proposed model provides an approximate analytical expression to calculate the diffraction field in 2D space. The diffraction filed is regarded as the superposition integral in 2D space. The calculated results obtained from the proposed diffraction model agree well with the ones by software HFSS based on the element method (FEM). Based on the proposed 2D diffraction model, two parallel-plate waveguide power splitters are presented. The splitters consist of a transmitting horn antenna, reflectors, and a receiving antenna array. The reflector is cylindrical parabolic with superimposed surface relief to efficiently couple the transmitted wave into the receiving antenna array. The reflector is applied as computer-generated holograms to match the transformed field to the receiving antenna aperture field. The power splitters were optimized by a modified real-coded genetic algorithm. The computed results of the splitters agreed well with the ones obtained by software HFSS verify the novel design method for power splitter, which shows good applied prospects of the proposed 2D diffraction model. PMID:28181514

Optical characteristics of sol-gel derived M3SiO5:Eu3+ (M = Sr, Ca and Mg) nanophosphors for display device technology

NASA Astrophysics Data System (ADS)

Singh, Devender; Sheoran, Suman; Bhagwan, Shri; Kadyan, Sonika

2016-12-01

A series of trivalent europium-doped M3SiO5 (M = Sr, Ca and Mg) phosphors were synthesized using sol-gel process at 950°C. Samples were further reheated at high temperature to study the effect of reheating on crystal structure and optical characteristics. X-ray diffraction measurement of these materials was carried out to know the crystal structure. Diffraction pattern showed monoclinic structure having space group Cm for Ca3SiO5 materials. However, tetragonal phase with space group P4/ncc was observed for Sr3SiO5 materials. Mg3SiO5 material show mixed diffraction peaks at 950 and 1,150°C. Transmission electron microscopic analysis was used to estimate the particle size of silicates. Photoluminescence emission spectra were recorded to check the luminescence properties of prepared materials. These phosphors exhibited a strong orange-red light under excitation at 395 nm. The prepared phosphors exhibited most intense peak in 610-620 nm region due to the 5D0→7F2 transition of europium (III) ion available in lattice. To overcome the deficiency of red silicates, M3SiO5 materials were explored and they might be integrated with ultraviolet LEDs to generate light which may be suitable for display applications.

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Jing; Li, Ming; Chen, Jiashu

Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

Neutron diffraction, specific heat and magnetization studies on Nd{sub 2}CuTiO{sub 6}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rayaprol, S., E-mail: sudhindra@csr.res.in; Kaushik, S. D.; Kumar, Naresh

2016-05-23

Structural and physical properties of a double-perovskite compound, Nd{sub 2}CuTiO{sub 6} have been studied using neutron diffraction, magnetization and specific heat measurements. The compound crystallizes in an orthorhombic structure in space group Pnma. The interesting observation we make here is that, though no long range magnetic order is observed between 2 and 300 K, the low temperature specific heat and magnetic susceptibility behavior exhibits non-Fermi liquid like behavior in this insulating compound. The magnetization and specific heat data are presented and discussed in light of these observations.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Growth and characterization of organic NLO material: Clobetasol propionate

NASA Astrophysics Data System (ADS)

Purusothaman, R.; Rajesh, P.; Ramasamy, P.

2015-06-01

Single crystals of clobetasol propionate (CP) have been grown by slow evaporation solution technique using mixed solvent of methanol-acetone. The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm their lattice parameter and space group. The powder X-ray diffraction pattern of the grown CP has been indexed. Thermal analysis was performed to study the thermal stability of the grown crystals. Photoluminescence spectrum shows broad emission peak observed at 421 nm. Nonlinear optical studies were carried out for the grown crystal and second harmonic generation (SHG) efficiency was found in the crystal.

Diffraction Correlation to Reconstruct Highly Strained Particles

NASA Astrophysics Data System (ADS)

Brown, Douglas; Harder, Ross; Clark, Jesse; Kim, J. W.; Kiefer, Boris; Fullerton, Eric; Shpyrko, Oleg; Fohtung, Edwin

2015-03-01

Through the use of coherent x-ray diffraction a three-dimensional diffraction pattern of a highly strained nano-crystal can be recorded in reciprocal space by a detector. Only the intensities are recorded, resulting in a loss of the complex phase. The recorded diffraction pattern therefore requires computational processing to reconstruct the density and complex distribution of the diffracted nano-crystal. For highly strained crystals, standard methods using HIO and ER algorithms are no longer sufficient to reconstruct the diffraction pattern. Our solution is to correlate the symmetry in reciprocal space to generate an a priori shape constraint to guide the computational reconstruction of the diffraction pattern. This approach has improved the ability to accurately reconstruct highly strained nano-crystals.

Revealing small-scale diffracting discontinuities by an optimization inversion algorithm

NASA Astrophysics Data System (ADS)

Yu, Caixia; Zhao, Jingtao; Wang, Yanfei

2017-02-01

Small-scale diffracting geologic discontinuities play a significant role in studying carbonate reservoirs. The seismic responses of them are coded in diffracted/scattered waves. However, compared with reflections, the energy of these valuable diffractions is generally one or even two orders of magnitude weaker. This means that the information of diffractions is strongly masked by reflections in the seismic images. Detecting the small-scale cavities and tiny faults from the deep carbonate reservoirs, mainly over 6 km, poses an even bigger challenge to seismic diffractions, as the signals of seismic surveyed data are weak and have a low signal-to-noise ratio (SNR). After analyzing the mechanism of the Kirchhoff migration method, the residual of prestack diffractions located in the neighborhood of the first Fresnel aperture is found to remain in the image space. Therefore, a strategy for extracting diffractions in the image space is proposed and a regularized L 2-norm model with a smooth constraint to the local slopes is suggested for predicting reflections. According to the focusing conditions of residual diffractions in the image space, two approaches are provided for extracting diffractions. Diffraction extraction can be directly accomplished by subtracting the predicted reflections from seismic imaging data if the residual diffractions are focused. Otherwise, a diffraction velocity analysis will be performed for refocusing residual diffractions. Two synthetic examples and one field application demonstrate the feasibility and efficiency of the two proposed methods in detecting the small-scale geologic scatterers, tiny faults and cavities.

Space grating optical structure of the retina and RGB-color vision.

PubMed

Lauinger, Norbert

2017-02-01

Diffraction of light at the spatial cellular phase grating outer nuclear layer of the retina could produce Fresnel near-field interferences in three RGB diffraction orders accessible to photoreceptors (cones/rods). At perpendicular light incidence the wavelengths of the RGB diffraction orders in photopic vision-a fundamental R-wave with two G+B-harmonics-correspond to the peak wavelengths of the spectral brightness sensitivity curves of the cones at 559 nmR, 537 nmG, and 447 nmB. In scotopic vision the R+G diffraction orders optically fuse at 512 nm, the peak value of the rod's spectral brightness sensitivity curve. The diffractive-optical transmission system with sender (resonator), space waves, and receiver antennae converts the spectral light components involved in imaging into RGB space. The colors seen at objects are diffractive-optical products in the eye, as the German philosopher A. Schopenhauer predicted. They are second related to the overall illumination in object space. The RGB transmission system is the missing link optically managing the spectral tuning of the RGB photopigments.

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

2005-08-01

This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

Structural phase transition in d-benzil characterised by capacitance measurements and neutron powder diffraction

NASA Astrophysics Data System (ADS)

Goossens, D. J.; Wu, Xiaodong; Prior, M.

2005-12-01

The ferroelectric phase transition in deuterated benzil, C 14H 10O 2, has been studied using capacitance measurements and neutron powder diffraction. Hydrogenous benzil shows a phase transition at 83.5 K from a high temperature P3 121 phase to a cell-doubled P2 1 phase. The phase transition in d-benzil occurs at 88.1 K, a small isotope effect. Neutron powder diffraction was consistent with a low temperature phase of space group P2 1. Upon deuteration the transition remained first-order and the dynamics of the phenyl ring dominated the behaviour. The isotope effect can be attributed to the difference in mass and moment of inertia between C 6H 5 and C 6D 5.

Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

PubMed Central

Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

2008-01-01

Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

Metrology of variable-line-spacing x-ray gratings using the APS Long Trace Profiler

NASA Astrophysics Data System (ADS)

Sheung, Janet; Qian, Jun; Sullivan, Joseph; Thomasset, Muriel; Manton, Jonathan; Bean, Sunil; Takacs, Peter; Dvorak, Joseph; Assoufid, Lahsen

2017-09-01

As resolving power targets have increased with each generation of beamlines commissioned in synchrotron radiation facilities worldwide, diffraction gratings are quickly becoming crucial optical components for meeting performance targets. However, the metrology of variable-line-spacing (VLS) gratings for high resolution beamlines is not widespread; in particular, no metrology facility at any US DOE facility is currently equipped to fully characterize such gratings. To begin to address this issue, the Optics Group at the Advanced Photon Source at Argonne, in collaboration with SOLEIL and with support from Brookhaven National Laboratory (BNL), has developed an alternative beam path addition to the Long Trace Profiler (LTP) at Argonne's Advanced Photon Source. This significantly expands the functionality of the LTP not only to measure mirrors surface slope profile at normal incidence, but also to characterize the groove density of VLS diffraction gratings in the Littrow incidence up to 79°, which covers virtually all diffraction gratings used at synchrotrons in the first order. The LTP light source is a 20mW HeNe laser, which yields enough signal for diffraction measurements to be performed on low angle blazed gratings optimized for soft X-ray wavelengths. We will present the design of the beam path, technical requirements for the optomechanics, and our data analysis procedure. Finally, we discuss challenges still to be overcome and potential limitations with use of the LTP to perform metrology on diffraction gratings.

Solid state characterization and crystal structure from X-ray powder diffraction of two polymorphic forms of ranitidine base.

PubMed

de Armas, Héctor Novoa; Peeters, Oswald M; Blaton, Norbert; Van Gyseghem, Elke; Martens, Johan; Van Haele, Gerrit; Van Den Mooter, Guy

2009-01-01

Ranitidine hydrochloride (RAN-HCl), a known anti-ulcer drug, is the product of reaction between HCl and ranitidine base (RAN-B). RAN-HCl has been extensively studied; however this is not the case of the RAN-B. The solid state characterization of RAN-B polymorphs has been carried out using different analytical techniques (microscopy, thermal analysis, Fourier transform infrared spectrometry in the attenuated total reflection mode, (13)C-CPMAS-NMR spectroscopy and X-ray powder diffraction). The crystal structures of RAN-B form I and form II have been determined using conventional X-ray powder diffraction in combination with simulated annealing and whole profile pattern matching, and refined using rigid-body Rietveld refinement. RAN-B form I is a monoclinic polymorph with cell parameters: a = 7.317(2), b = 9.021(2), c = 25.098(6) A, beta = 95.690(1) degrees and space group P2(1)/c. The form II is orthorhombic: a = 31.252(4), b = 13.052(2), c = 8.0892(11) A with space group Pbca. In RAN-B polymorphs, the nitro group is involved in a strong intramolecular hydrogen bond responsible for the existence of a Z configuration in the enamine portion of the molecules. A tail to tail packing motif can be denoted via intermolecular hydrogen bonds. The crystal structures of RAN-B forms are compared to those of RAN-HCl polymorphs. RAN-B polymorphs are monotropic polymorphic pairs. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

Crystal structure of paliperidone palmitate (INVEGA SUSTENNA®), C39H57FN4O4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaduk, James A.; Dmitrienko, Artem O.; Gindhart, Amy M.

2017-08-29

The crystal structure of paliperidone palmitate has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Paliperidone palmitate crystallizes in space groupP2 1/c(#14) witha= 34.415 40(35),b= 10.093 49(7),c= 10.904 92(9) Å,β= 94.3917(9)°,V= 3776.94(6) Å 3, andZ= 4. The conformation of the paliperidone fragment differs from that of the parent compound. The palmitate chain exhibits a slight twist close to the ester group. Several C–H•••O hydrogen bonds contribute to the crystal packing, which is dominated by van der Waals interactions. The powder pattern is included in the Powder Diffraction File™ as entry 00-066-1614.

Diffraction-Based Optical Switch

NASA Technical Reports Server (NTRS)

Sperno, Stevan M. (Inventor); Fuhr, Peter L. (Inventor); Schipper, John F. (Inventor)

2005-01-01

Method and system for controllably redirecting a light beam, having a central wavelength lambda, from a first light-receiving site to a second light-receiving site. A diffraction grating is attached to or part of a piezoelectric substrate, which is connected to one or two controllable voltage difference sources. When a substrate voltage difference is changed and the diffraction grating length in each of one or two directions is thereby changed, at least one of the diffraction angle, the diffraction order and the central wavelength is controllably changed. A diffracted light beam component, having a given wavelength, diffraction angle and diffraction order, that is initially received at a first light receiving site (e.g., a detector or optical fiber) is thereby controllably shifted or altered and can be received at a second light receiving site. A polynomially stepped, chirped grating is used in one embodiment. In another embodiment, an incident light beam, having at least one of first and second wavelengths, lambda1 and lambda2, is received and diffracted at a first diffraction grating to provide a first diffracted beam. The first diffracted beam is received and diffracted at a second diffraction grating to produce a second diffracted beam. The second diffracted beam is received at a light-sensitive transducer, having at least first and second spaced apart light detector elements that are positioned so that, when the incident light beam has wavelength lambda1 or lambda2 (lambda1 not equal to lambda2), the second diffracted beam is received at the first element or at the second element, respectively; change in a selected physical parameter at the second grating can also be sensed or measured. A sequence of spaced apart light detector elements can be positioned along a linear or curvilinear segment with equal or unequal spacing.

NMR crystallography of zeolites: How far can we go without diffraction data?

PubMed

Brouwer, Darren H; Van Huizen, Jared

2018-05-10

Nuclear magnetic resonance (NMR) crystallography-an approach to structure determination that seeks to integrate solid-state NMR spectroscopy, diffraction, and computation methods-has emerged as an effective strategy to determine structures of difficult-to-characterize materials, including zeolites and related network materials. This paper explores how far it is possible to go in determining the structure of a zeolite framework from a minimal amount of input information derived only from solid-state NMR spectroscopy. It is shown that the framework structure of the fluoride-containing and tetramethylammonium-templated octadecasil clathrasil material can be solved from the 1D 29 Si NMR spectrum and a single 2D 29 Si NMR correlation spectrum alone, without the space group and unit cell parameters normally obtained from diffraction data. The resulting NMR-solved structure is in excellent agreement with the structures determined previously by diffraction methods. It is anticipated that NMR crystallography strategies like this will be useful for structure determination of other materials, which cannot be solved from diffraction methods alone. Copyright © 2018 John Wiley & Sons, Ltd.

Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

PubMed

Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

2012-12-01

Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

Crystallization of Chicken Egg White Lysozyme from Assorted Sulfate Salts

NASA Technical Reports Server (NTRS)

Forsythe, Elizabeth L.; Snell, Edward H.; Malone, Christine C.; Pusey, Marc L.

1998-01-01

Chicken egg white lysozyme has been found to crystallize from ammonium, sodium, potassium, rubidium, magnesium, and manganese sulfates at acidic and basic pH, with protein concentrations from 60 to 190 mg/ml. Four different crystal morphologies have been obtained, depending upon the temperature, protein concentration, and precipitating salt employed, Crystals grown at 15 C were generally tetragonal, with space group P43212. Crystallization at 20 C typically resulted in the formation of orthorhombic crystals, space group P21212 1. The tetragonal much less than orthorhombic morphology transition appeared to be a function of both the temperature and protein concentration, occurring between 15 and 20 C and between 100 and 125 mg/ml protein concentration. Crystallization from 0.8 -1.2M magnesium sulfate at pH 7.6 - 8.0 gave a hexagonal (trigonal) crystal form, space group P3121, which diffracted to 2.8 A. Ammonium sulfate was also found to result in a monoclinic form, space group C2. Small twinned monoclinic crystals of approx. 0.2 mm on edge were grown by dialysis followed by seeded sitting drop crystallization.

Incommensurate crystallography without additional dimensions.

PubMed

Kocian, Philippe

2013-07-01

It is shown that the Euclidean group of translations, when treated as a Lie group, generates translations not only in Euclidean space but on any space, curved or not. Translations are then not necessarily vectors (straight lines); they can be any curve compatible with the parameterization of the considered space. In particular, attention is drawn to the fact that one and only one finite and free module of the Lie algebra of the group of translations can generate both modulated and non-modulated lattices, the modulated character being given only by the parameterization of the space in which the lattice is generated. Moreover, it is shown that the diffraction pattern of a structure is directly linked to the action of that free and finite module. In the Fourier transform of a whole structure, the Fourier transform of the electron density of one unit cell (i.e. the structure factor) appears concretely, whether the structure is modulated or not. Thus, there exists a neat separation: the geometrical aspect on the one hand and the action of the group on the other, without requiring additional dimensions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Haishuang; Krysiak, Yaşar; Hoffmann, Kristin

The crystal structure and disorder phenomena of Al{sub 4}B{sub 2}O{sub 9}, an aluminum borate from the mullite-type family, were studied using automated diffraction tomography (ADT), a recently established method for collection and analysis of electron diffraction data. Al{sub 4}B{sub 2}O{sub 9}, prepared by sol-gel approach, crystallizes in the monoclinic space group C2/m. The ab initio structure determination based on three-dimensional electron diffraction data from single ordered crystals reveals that edge-connected AlO{sub 6} octahedra expanding along the b axis constitute the backbone. The ordered structure (A) was confirmed by TEM and HAADF-STEM images. Furthermore, disordered crystals with diffuse scattering along themore » b axis are observed. Analysis of the modulation pattern implies a mean superstructure (AAB) with a threefold b axis, where B corresponds to an A layer shifted by ½a and ½c. Diffraction patterns simulated for the AAB sequence including additional stacking disorder are in good agreement with experimental electron diffraction patterns. - Graphical abstract: Crystal structure and disorder phenomena of B-rich Al{sub 4}B{sub 2}O{sub 9} studied by automated electron diffraction tomography (ADT) and described by diffraction simulation using DISCUS. - Highlights: • Ab-initio structure solution by electron diffraction from single nanocrystals. • Detected modulation corresponding mainly to three-fold superstructure. • Diffuse diffraction streaks caused by stacking faults in disordered crystals. • Observed streaks explained by simulated electron diffraction patterns.« less

Nature, diffraction-free propagation via space-time correlations, and nonlinear generation of time-diffracting light beams

NASA Astrophysics Data System (ADS)

Porras, Miguel A.

2018-06-01

We investigate the properties of the recently introduced time-diffracting (TD) beams in free space. They are shown to be paraxial and quasimonochromatic realizations of spatiotemporal localized waves traveling undistorted at arbitrary speeds. The paraxial and quasimonochromatic regime is shown to be necessary to observe what can properly be named diffraction in time. In this regime, the spatiotemporal frequency correlations for diffraction-free propagation are approximated by parabolic correlations. Time-diffracting beams of finite energy traveling at quasiluminal velocities are seen to form substantially longer foci or needles of light than the so-called abruptly focusing and defocusing needle of light or limiting TD beam of infinite speed. Exploring the properties of TD beams under Lorentz transformations and their transformation by paraxial optical systems, we realize that the nonlinear polarization of material media induced by a strongly localized fundamental pump wave generates a TD beam at its second harmonic, whose diffraction-free behavior as a needle of light in free space can be optimized with a standard 4 f -imager system.

Image degradation characteristics and restoration based on regularization for diffractive imaging

NASA Astrophysics Data System (ADS)

Zhi, Xiyang; Jiang, Shikai; Zhang, Wei; Wang, Dawei; Li, Yun

2017-11-01

The diffractive membrane optical imaging system is an important development trend of ultra large aperture and lightweight space camera. However, related investigations on physics-based diffractive imaging degradation characteristics and corresponding image restoration methods are less studied. In this paper, the model of image quality degradation for the diffraction imaging system is first deduced mathematically based on diffraction theory and then the degradation characteristics are analyzed. On this basis, a novel regularization model of image restoration that contains multiple prior constraints is established. After that, the solving approach of the equation with the multi-norm coexistence and multi-regularization parameters (prior's parameters) is presented. Subsequently, the space-variant PSF image restoration method for large aperture diffractive imaging system is proposed combined with block idea of isoplanatic region. Experimentally, the proposed algorithm demonstrates its capacity to achieve multi-objective improvement including MTF enhancing, dispersion correcting, noise and artifact suppressing as well as image's detail preserving, and produce satisfactory visual quality. This can provide scientific basis for applications and possesses potential application prospects on future space applications of diffractive membrane imaging technology.

Preliminary X-ray crystallographic analysis of glutathione transferase zeta 1 (GSTZ1a-1a)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boone, Christopher D.; Zhong, Guo; Smeltz, Marci

2014-01-21

Crystals of glutathione transferase zeta 1 were grown and shown to diffract X-rays to 3.1 Å resolution. They belonged to space group P1, with unit-cell parameters a = 42.0, b = 49.6, c = 54.6 Å, α = 82.9, β = 69.9, γ = 73.4°.

TakeTwo: an indexing algorithm suited to still images with known crystal parameters

DOE PAGES

Ginn, Helen Mary; Roedig, Philip; Kuo, Anling; ...

2016-08-01

The indexing methods currently used for serial femtosecond crystallography were originally developed for experiments in which crystals are rotated in the X-ray beam, providing significant three-dimensional information. On the other hand, shots from both X-ray free-electron lasers and serial synchrotron crystallography experiments are still images, in which the few three-dimensional data available arise only from the curvature of the Ewald sphere. Traditional synchrotron crystallography methods are thus less well suited to still image data processing. Here, a new indexing method is presented with the aim of maximizing information use from a still image given the known unit-cell dimensions and spacemore » group. Efficacy for cubic, hexagonal and orthorhombic space groups is shown, and for those showing some evidence of diffraction the indexing rate ranged from 90% (hexagonal space group) to 151% (cubic space group). Here, the indexing rate refers to the number of lattices indexed per image.« less

Classification of crystal structure using a convolutional neural network

PubMed Central

Park, Woon Bae; Chung, Jiyong; Sohn, Keemin; Pyo, Myoungho

2017-01-01

A deep machine-learning technique based on a convolutional neural network (CNN) is introduced. It has been used for the classification of powder X-ray diffraction (XRD) patterns in terms of crystal system, extinction group and space group. About 150 000 powder XRD patterns were collected and used as input for the CNN with no handcrafted engineering involved, and thereby an appropriate CNN architecture was obtained that allowed determination of the crystal system, extinction group and space group. In sharp contrast with the traditional use of powder XRD pattern analysis, the CNN never treats powder XRD patterns as a deconvoluted and discrete peak position or as intensity data, but instead the XRD patterns are regarded as nothing but a pattern similar to a picture. The CNN interprets features that humans cannot recognize in a powder XRD pattern. As a result, accuracy levels of 81.14, 83.83 and 94.99% were achieved for the space-group, extinction-group and crystal-system classifications, respectively. The well trained CNN was then used for symmetry identification of unknown novel inorganic compounds. PMID:28875035

Classification of crystal structure using a convolutional neural network.

PubMed

Park, Woon Bae; Chung, Jiyong; Jung, Jaeyoung; Sohn, Keemin; Singh, Satendra Pal; Pyo, Myoungho; Shin, Namsoo; Sohn, Kee-Sun

2017-07-01

A deep machine-learning technique based on a convolutional neural network (CNN) is introduced. It has been used for the classification of powder X-ray diffraction (XRD) patterns in terms of crystal system, extinction group and space group. About 150 000 powder XRD patterns were collected and used as input for the CNN with no handcrafted engineering involved, and thereby an appropriate CNN architecture was obtained that allowed determination of the crystal system, extinction group and space group. In sharp contrast with the traditional use of powder XRD pattern analysis, the CNN never treats powder XRD patterns as a deconvoluted and discrete peak position or as intensity data, but instead the XRD patterns are regarded as nothing but a pattern similar to a picture. The CNN interprets features that humans cannot recognize in a powder XRD pattern. As a result, accuracy levels of 81.14, 83.83 and 94.99% were achieved for the space-group, extinction-group and crystal-system classifications, respectively. The well trained CNN was then used for symmetry identification of unknown novel inorganic compounds.

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

NASA Astrophysics Data System (ADS)

Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

1996-10-01

θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

Holographic diffractive structures for daylighting, phase 1

NASA Astrophysics Data System (ADS)

1985-10-01

Advanced Environmental Research Group (AERG) has researched and developed a proprietary device which will passively track the Sun throughout a wide range of latitudes, hours of the day and seasons of the year. The Holographic Diffractive Structure (HDS), consists of novel holographic diffraction grating designs applied to a substrate suitable for mounting or incorporated into window glazings. The HDS installations will be a low cost system for the controlled management of sunlight in buildings for energy savings and an enhanced lighting environment. The HDSs act to intercept sunlight and redirect it away from the immediate window area towards the darker regions at the rear of the room, or (via light guides) to interior spaces without windows, or (used on the facade of a building) to redirect sunlight into dark urban canyons or onto the facades of other nearby buildings.

Crystallization of human nicotinamide phosphoribosyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

2007-05-01

Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

Crystallography, chemistry and structural disorder in the new high-Tc Bi-Ca-Sr-Cu-O superconductor

NASA Technical Reports Server (NTRS)

Veblen, D. R.; Heaney, P. J.; Angel, R. J.; Finger, L. W.; Hazen, R. M.

1988-01-01

Diffraction experiments are reported which indicate that the new Bi-Ca-Sr-Cu-O layer-structure superconductor possesses a primitive orthorhombic unit cell with probable space group Pnnn. The material exhibits severe structural disorder which is primarily related to stacking within the layers. The apparent orthorhombic structure is an average resulting from orthorhombic material mixed with monoclinic domains in two twinned orientations. Two distinct types of structural disorder that are common in materials synthesized to date are also described. This disorder complicates the crystallographic analysis and suggests that X-ray and neutron diffraction methods may yield only an average structure.

Swinging Symmetry, Multiple Structural Phase Transitions, and Versatile Physical Properties in RECuGa3 (RE = La-Nd, Sm-Gd).

PubMed

Subbarao, Udumula; Rayaprol, Sudhindra; Dally, Rebecca; Graf, Michael J; Peter, Sebastian C

2016-01-19

The compounds RECuGa3 (RE = La-Nd, Sm-Gd) were synthesized by various techniques. Preliminary X-ray diffraction (XRD) analyses at room temperature suggested that the compounds crystallize in the tetragonal system with either the centrosymmetric space group I4/mmm (BaAl4 type) or the non-centrosymmetric space group I4mm (BaNiSn3 type). Detailed single-crystal XRD, neutron diffraction, and synchrotron XRD studies of selected compounds confirmed the non-centrosymmetric BaNiSn3 structure type at room temperature with space group I4mm. Temperature-dependent single-crystal XRD, powder XRD, and synchrotron beamline measurements showed a structural transition between centro- and non-centrosymmetry followed by a phase transition to the Rb5Hg19 type (space group I4/m) above 400 K and another transition to the Cu3Au structure type (space group Pm3̅m) above 700 K. Combined single-crystal and synchrotron powder XRD studies of PrCuGa3 at high temperatures revealed structural transitions at higher temperatures, highlighting the closeness of the BaNiSn3 structure to other structure types not known to the RECuGa3 family. The crystal structure of RECuGa3 is composed of eight capped hexagonal prism cages [RE4Cu4Ga12] occupying one rare-earth atom in each ring, which are shared through the edge of Cu and Ga atoms along the ab plane, resulting in a three-dimensional network. Resistivity and magnetization measurements demonstrated that all of these compounds undergo magnetic ordering at temperatures between 1.8 and 80 K, apart from the Pr and La compounds: the former remains paramagnetic down to 0.3 K, while superconductivity was observed in the La compound at T = 1 K. It is not clear whether this is intrinsic or due to filamentary Ga present in the sample. The divalent nature of Eu in EuCuGa3 was confirmed by magnetization measurements and X-ray absorption near edge spectroscopy and is further supported by the crystal structure analysis.

Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

NASA Astrophysics Data System (ADS)

Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D. M.; Conway, Barbara R.; Timmins, Peter

2007-03-01

We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2NC(CH 3) 3-n(CH 2OH) n, with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family ( n=0, 1, 2), but significantly contrasting structural properties for the member with n=3.

Synthesis, structural and optical properties of (ALa)(FeMn)O6 (A = Ba and Sr) double perovskites

NASA Astrophysics Data System (ADS)

Kumar, Dinesh; Sudarshan, V.; Singh, Akhilesh Kumar

2018-05-01

Here, we report structural and optical properties of ALaFeMnO6 (A = Ba and Sr) double perovskite synthesized via auto-combustion followed by calcinations process. Rietveld refinement of structure using x-ray diffraction data reveals that BaLaFeMnO6 crystallizes into cubic crystal structure with space group Pm-3m while SrLaFeMnO6 crystallizes into rhombohedral crystal structure having space group R-3c. The absorption spectrum measurement using UV-Vis spectroscopy reveals that these samples are prefect insulator having energy band gap between conduction and valence band of the order of 6 eV.

Monoclinic deformation of calcite crystals at ambient conditions

NASA Astrophysics Data System (ADS)

Przeniosło, R.; Fabrykiewicz, P.; Sosnowska, I.

2016-09-01

High resolution synchrotron radiation powder diffraction shows that the average crystal structure of calcite at ambient conditions is described with the trigonal space group R 3 bar c but there is a systematic hkl-dependent Bragg peak broadening. A modelling of this anisotropic peak broadening with the microstrain model from Stephens (1999) [15] is presented. The observed lattice parameters' correlations can be described by assuming a monoclinic-type deformation of calcite crystallites. A quantitative model of this monoclinic deformation observed at ambient conditions is described with the space group C 2 / c . The monoclinic unit cell suggested at ambient conditions is related with the monoclinic unit cell reported in calcite at high pressure (Merrill and Bassett (1975) [10]).

Synchrotron X-ray reciprocal-space mapping, topography and diffraction resolution studies of macromolecular crystal quality.

PubMed

Boggon, T J; Helliwell, J R; Judge, R A; Olczak, A; Siddons, D P; Snell, E H; Stojanoff, V

2000-07-01

A comprehensive study of microgravity and ground-grown chicken egg-white lysozyme crystals is presented using synchrotron X-ray reciprocal-space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed reduced intrinsic mosaicities on average, but no differences in terms of strain over their ground-grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the ground-control case only a small volume of the crystal contributed to the intensity at the diffraction peak. The techniques prove to be highly complementary, with the reciprocal-space mapping providing a quantitative measure of the crystal mosaicity and strain (or variation in lattice spacing) and the topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out at the synchrotron.

Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

NASA Technical Reports Server (NTRS)

Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

2000-01-01

A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

3-dimensional indexation of the icosahedral diffraction pattern using the techniques of electron microscopy

NASA Astrophysics Data System (ADS)

Bourdillon, Antony

2012-11-01

The following facts about icosahedra need wider attention. 1) The golden section τ is as fundamental to the icosahedral structure (length /edge) as π is to the sphere (circumference /diameter). 2) The diffraction series are in restricted Fibonacci order because the ratio of adjacent terms fn/fn-1 does not vary, but is the constant τ. The series is therefore geometric. 3) Because of the tetragonal subgroup in the icosahedral point group symmetry, many axes in the icosahedral structure have identical orientation to axes in the face centered cubic matrix of Al6Mn [1] (e.g. [100] and [111]). On these bases, a three dimensional stereographic projection will be presented. 4) A quasi-Bragg law is derived that correctly represents the diffraction series in powers of τ [2]. Furthermore, by employing the normal conventions of electron microscopy, all diffraction patterns are completely indexed in three dimensions. These are the topic of this presentation. Significant consequences will be presented elsewhere: 1) The diffraction pattern intensities near all main axes are correctly simulated, and all atoms are located on a specimen image. 2) The quasi-Bragg law has a special metric. Atomic locations are consistently calculated for the first time. 3) Whereas the Bragg law transforms a crystal lattice in real space into a reciprocal lattice in diffraction space, the quasi-Bragg law transforms a geometric diffraction pattern into a hierarchic structure. 4) Hyperspatial indexation [3] is superceded. [1] Shechtman, D.; Blech, I.; Gratias, D.; Cahn, J.W., Metallic phase with long-range orientational order and no translational symmetry, Phys. Rev. Lett., 1984, 53, 1951-3. [2] Bourdillon, A. J., Nearly free electron band structures in a logarithmically periodic solid, Sol. State Comm. 2009, 149, 1221-1225. [3] Duneau, M., and Katz, A., Phys Rev Lett 54, 2688-2691

Use of reciprocal lattice layer spacing in electron backscatter diffraction pattern analysis

PubMed

Michael; Eades

2000-03-01

In the scanning electron microscope using electron backscattered diffraction, it is possible to measure the spacing of the layers in the reciprocal lattice. These values are of great use in confirming the identification of phases. The technique derives the layer spacing from the higher-order Laue zone rings which appear in patterns from many materials. The method adapts results from convergent-beam electron diffraction in the transmission electron microscope. For many materials the measured layer spacing compares well with the calculated layer spacing. A noted exception is for higher atomic number materials. In these cases an extrapolation procedure is described that requires layer spacing measurements at a range of accelerating voltages. This procedure is shown to improve the accuracy of the technique significantly. The application of layer spacing measurements in EBSD is shown to be of use for the analysis of two polytypes of SiC.

Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at

2015-05-22

Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and themore » latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)« less

[Fine stereo structure for natural organic molecules, a preliminary study. II. Melting point influenced by structure factors].

PubMed

Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y

1995-06-01

Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.

Synthesis and characterization of 3-acetoxy-2-methyl-N-(phenyl)benzamide and 3-acetoxy-2-methyl-N-(4- methylphenyl)benzamide

NASA Astrophysics Data System (ADS)

Kırca, Başak Koşar; Çakmak, Şükriye; Kütük, Halil; Odabaşoğlu, Mustafa; Büyükgüngör, Orhan

2018-01-01

This study treats about two successfully synthesized secondary amide compounds 3-Acetoxy-2-methyl-N-(phenyl)benzamide, I and 3-Acetoxy-2-methyl-N-(4-methylphenyl)benzamide, II. Compounds were characterized by FTIR, 1H NMR, 13C NMR and X-ray single crystal diffraction analysis techniques. Single crystal X-ray diffraction analyses show that while I crystallized in the orthorhombic system with space group Pbca, II crystallized in the triclinic system with space group P-1 and the asymmetric unit of II consists of two crystallographically independent molecules. Lattice constants are a = 7.9713 (3) Å, b = 9.5059 (3) Å, c = 37.1762 (2) Å, Z = 8 for I and a = 7.5579 (8) Å, b = 8.8601 (8) Å, c = 23.363 (3) Å, α = 97.011 (9) °, β = 96.932 (9)°, γ = 90.051 (8)°, Z = 4 for II. Crystallographic studies also show that the supramolecular structures were stabilized by intramolecular, intermolecular hydrogen bonds and Csbnd H … π interactions for both compounds. Characteristic amide bonds were observed in IR and NMR spectra.

Crystallization and X-ray diffraction analysis of the RNA primer/promoter-binding domain of influenza A virus RNA-dependent RNA polymerase PB2

PubMed Central

Kuzuhara, Takashi; Kise, Daisuke; Yoshida, Hiroko; Horita, Takahiro; Murazaki, Yoshimi; Utsunomiya, Hiroko; Tsuge, Hideaki

2009-01-01

The C-terminal domain protein (amino-acid residues 535–759) of the PB2 subunit of the RNA-dependent RNA polymerase from the highly pathogenic influenza A virus was expressed as a soluble protein in Escherichia coli and crystallized using sodium formate as a precipitant. Data sets were collected from crystals of native and selenomethionine-substituted protein on the KEK NW12 beamline at the Photon Factory and the crystals diffracted to a maximum resolution of 2.44 Å for the SeMet-derivative crystal. The native crystals were found to belong to space group P3221, with unit-cell parameters a = b = 52.5, c = 156.3 Å. The Matthews value (V M) was 2.7 Å3 Da−1, assuming the presence of one molecule in the asymmetric unit. The SeMet-derivative crystals were found to belong to the same space group, with unit-cell parameters a = b = 52.6, c = 156.4 Å. Attempts are being made to solve the structure by multi-wavelength anomalous dispersion phasing. PMID:19194006

A comparative study of the Aurivillius phase ferroelectrics CaBi 4Ti 4O 15 and BaBi 4Ti 4O 15

NASA Astrophysics Data System (ADS)

Tellier, J.; Boullay, Ph.; Manier, M.; Mercurio, D.

2004-06-01

The room temperature structures of the four-layer Aurivillius phase ferroelectrics CaBi 4Ti 4O 15 and BaBi 4Ti 4O 15 are determined by means of single crystal X-ray diffraction. Regarding the CaBi 4Ti 4O 15 phase, in agreement with the tolerance factor, a significant deformation of the perovskite blocks is observed. The rotation system of the octahedra is typical from even layer Aurivillius phases and leads to the use of the space group A2 1am. For the BaBi 4Ti 4O 15 phase, only a weak variation with respect to the F2 mm space group can be suggested from single crystal X-ray diffraction. A significant presence of Ba atoms in the [ M2O 2] slabs is confirmed in agreement with the previous works but specific Ba 2+ and Bi 3+ sites have to be considered due to the large difference in bounding requirement of these cations. Possible origins for the ferroelectric relaxor behavior of the Ba-based compound are discussed in view of the presented structural analyses.

Compression of subrelativistic space-charge-dominated electron bunches for single-shot femtosecond electron diffraction.

PubMed

van Oudheusden, T; Pasmans, P L E M; van der Geer, S B; de Loos, M J; van der Wiel, M J; Luiten, O J

2010-12-31

We demonstrate the compression of 95 keV, space-charge-dominated electron bunches to sub-100 fs durations. These bunches have sufficient charge (200 fC) and are of sufficient quality to capture a diffraction pattern with a single shot, which we demonstrate by a diffraction experiment on a polycrystalline gold foil. Compression is realized by means of velocity bunching by inverting the positive space-charge-induced velocity chirp. This inversion is induced by the oscillatory longitudinal electric field of a 3 GHz radio-frequency cavity. The arrival time jitter is measured to be 80 fs.

Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan

2007-12-01

Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Photon Sieve Bandwidth Broadening by Reduction of Chromatic Aberration Effects Using Second-Stage Diffractive Optics

DTIC Science & Technology

2015-03-26

A photon sieve is a lightweight diffractive optic which can be useful for space - based imaging applications. It is limited by chromatic...would also like to thank my sponsor, Dr. Matthew G. McHarg from the Space Physics and Atmospheric Research Center, United States Air Force Academy, as...Page 21. Radial Hole Spacing

Complex space monofilar approximation of diffraction currents on a conducting half plane

NASA Technical Reports Server (NTRS)

Lindell, I. V.

1987-01-01

Simple approximation of diffraction surface currents on a conducting half plane, due to an incoming plane wave, is obtained with a line current (monofile) in complex space. When compared to an approximating current at the edge, the diffraction pattern is seen to improve by an order of magnitude for a minimal increase of computation effort. Thus, the inconvient Fresnel integral functions can be avoided for quick calculations of diffracted fields and the accuracy is good in other directions than along the half plane. The method can be applied to general problems involving planar metal edges.

Diffraction and microscopy with attosecond electron pulse trains

NASA Astrophysics Data System (ADS)

Morimoto, Yuya; Baum, Peter

2018-03-01

Attosecond spectroscopy1-7 can resolve electronic processes directly in time, but a movie-like space-time recording is impeded by the too long wavelength ( 100 times larger than atomic distances) or the source-sample entanglement in re-collision techniques8-11. Here we advance attosecond metrology to picometre wavelength and sub-atomic resolution by using free-space electrons instead of higher-harmonic photons1-7 or re-colliding wavepackets8-11. A beam of 70-keV electrons at 4.5-pm de Broglie wavelength is modulated by the electric field of laser cycles into a sequence of electron pulses with sub-optical-cycle duration. Time-resolved diffraction from crystalline silicon reveals a < 10-as delay of Bragg emission and demonstrates the possibility of analytic attosecond-ångström diffraction. Real-space electron microscopy visualizes with sub-light-cycle resolution how an optical wave propagates in space and time. This unification of attosecond science with electron microscopy and diffraction enables space-time imaging of light-driven processes in the entire range of sample morphologies that electron microscopy can access.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

2008-08-01

Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Subburaman, P.; Austin, B.P.; Shaw, G.X.

2010-11-03

Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

Ordered structure of FeGe2 formed during solid-phase epitaxy

NASA Astrophysics Data System (ADS)

Jenichen, B.; Hanke, M.; Gaucher, S.; Trampert, A.; Herfort, J.; Kirmse, H.; Haas, B.; Willinger, E.; Huang, X.; Erwin, S. C.

2018-05-01

Fe3Si /Ge (Fe ,Si ) /Fe3Si thin-film stacks were grown by a combination of molecular beam epitaxy and solid-phase epitaxy (Ge on Fe3Si ). The stacks were analyzed using electron microscopy, electron diffraction, and synchrotron x-ray diffraction. The Ge(Fe,Si) films crystallize in the well-oriented, layered tetragonal structure FeGe2 with space group P 4 m m . This kind of structure does not exist as a bulk material and is stabilized by the solid-phase epitaxy of Ge on Fe3Si . We interpret this as an ordering phenomenon induced by minimization of the elastic energy of the epitaxial film.

Pressure-induced phase transitions of β-type pyrochlore CsTaWO 6

DOE PAGES

Zhang, F. X.; Tracy, C. L.; Shamblin, J.; ...

2016-09-30

The β-type pyrochlore CsTaWO 6 was studied by synchrotron X-ray diffraction (XRD) and Raman scattering methods up to pressures of 43 GPa using a diamond anvil cell (DAC). With increasing pressure, the cubic pyrochlore in space group of Fd-3¯m with combining macron]m transforms to an orthorhombic structure (space group: Pnma) at 5.9 GPa and then to a monoclinic structure (space group: P2 1/c) at ~18 GPa. The structural evolution in CsTaWO 6 is a continuous process and experimental results suggest that the initial cubic phase has a tetragonal distortion at ambient conditions. Both XRD and Raman measurements indicate that themore » pressure-induced phase transitions in CsTaWO 6 are reversible. Lastly, these results may provide a structural explanation of previous experimental resistivity measurement results for the isostructural superconductor K(Cs)Os 2O 6 at high pressure conditions.« less

Pressure-induced phase transitions of β-type pyrochlore CsTaWO 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, F. X.; Tracy, C. L.; Shamblin, J.

The β-type pyrochlore CsTaWO 6 was studied by synchrotron X-ray diffraction (XRD) and Raman scattering methods up to pressures of 43 GPa using a diamond anvil cell (DAC). With increasing pressure, the cubic pyrochlore in space group of Fd-3¯m with combining macron]m transforms to an orthorhombic structure (space group: Pnma) at 5.9 GPa and then to a monoclinic structure (space group: P2 1/c) at ~18 GPa. The structural evolution in CsTaWO 6 is a continuous process and experimental results suggest that the initial cubic phase has a tetragonal distortion at ambient conditions. Both XRD and Raman measurements indicate that themore » pressure-induced phase transitions in CsTaWO 6 are reversible. Lastly, these results may provide a structural explanation of previous experimental resistivity measurement results for the isostructural superconductor K(Cs)Os 2O 6 at high pressure conditions.« less

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

PubMed

Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

2013-11-01

Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

Spiral chain structure of high pressure selenium-II{sup '} and sulfur-II from powder x-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujihisa, Hiroshi; Yamawaki, Hiroshi; Sakashita, Mami

2004-10-01

The structure of high pressure phases, selenium-II{sup '} (Se-II{sup '}) and sulfur-II (S-II), for {alpha}-Se{sub 8} (monoclinic Se-I) and {alpha}-S{sub 8} (orthorhombic S-I) was studied by powder x-ray diffraction experiments. Se-II{sup '} and S-II were found to be isostructural and to belong to the tetragonal space group I4{sub 1}/acd, which is made up of 16 atoms in the unit cell. The structure consisted of unique spiral chains with both 4{sub 1} and 4{sub 3} screws. The results confirmed that the structure sequence of the pressure-induced phase transitions for the group VIb elements depended on the initial molecular form. The chemicalmore » bonds of the phases are also discussed from the interatomic distances that were obtained.« less

Exsolution in clinoamphiboles

USGS Publications Warehouse

Ross, M.; Papike, J.J.; Weiblen, P.W.

1968-01-01

Ten amphibole specimens from a variety of metamorphic rocks such as talc schists, eclogites, and metamorphosed iron formations contain lamellae of a second amphibole oriented parallel to (101) or (100), or both, of the host. Tremolites, actinolites, and hornblendes commonly have lamellae of a calcium-poor clinoamphibole with P21/m space-group symmetry, or lamellae of citmmingtonite with C2/m space-group symmetry. Likewise ciimmingtonites and P21/m clinoamphiboles commonly contain lamellae of calcium-rich C2/m amphiboles such as tremolite. Results of x-ray diffraction, electron-probe, and microscope studies indicate that most lamellae result from unmixing of a homogeneous amphibole. The P21/m clinoampliibole is analogous to the clinopyroxene pigeonite in agreement with the results of M. G. Bown.

Slowing of Bessel light beam group velocity

NASA Astrophysics Data System (ADS)

Alfano, Robert R.; Nolan, Daniel A.

2016-02-01

Bessel light beams experience diffraction-limited propagation. A different basic spatial property of a Bessel beam is reported and investigated. It is shown a Bessel beam is a natural waveguide causing its group velocity can be subluminal (slower than the speed of light) when the optical frequency ω approaches a critical frequency ωc. A free space dispersion relation for a Bessel beam, the dependence of its wave number on its angular frequency, is developed from which the Bessel beam's subluminal group velocity is derived. It is shown under reasonable laboratory conditions that a Bessel light beam has associated parameters that allow slowing near a critical frequency. The application of Bessel beams with 1 μm spot size to slow down 100 ps to 200 ps over 1 cm length for a natural optical buffer in free space is presented.

Potassium rich rare earth (RE) borates K 3RE(BO 3) 2

NASA Astrophysics Data System (ADS)

Gao, J. H.; Li, R. K.

2008-01-01

A series of new compounds in the K 3RE(BO 3) 2 (RE = Y, Nd, Sm, Gd, Tb, Er and Lu) system were synthesized. Powder X-ray diffraction indicates that structures of the K 3RE(BO 3) 2 series can be separated into two different types with boundary between Gd and Tb. Single crystals of two representative compounds K 3Sm(BO 3) 2 and K 3Y(BO 3) 2 were obtained from a K 2O-B 2O 3 melt. The structure of K 3Y(BO 3) 2, determined from single crystal X-ray diffraction data, belongs to Pnnm space group, with lattice constants of a = 9.3377(9) Å, b = 6.7701(6) Å and c = 5.5058(4) Å. With a larger rare earth element, e.g. Sm 3+, K 3Sm(BO 3) 2 crystallizes in space group Pnma, with cell parameters of a = 9.046(3) Å, b = 7.100(2) Å and c = 11.186(3) Å. The structure of K 3Y(BO 3) 2 can be described as a three-dimensional framework formed by isolated YO 6 octahedra jointed by BO 3 triangles by sharing their apical oxygen atoms. The structure of K 3Sm(BO 3) 2 contains infinite [SmO 4BO 3] ∞ chains formed by corner sharing SmO 7 pentagonal dipyramid and BO 3 group, and those chains are interconnected by the other BO 3 groups.

Total chemical synthesis and X-ray structure of kaliotoxin by racemic protein crystallography.

PubMed

Pentelute, Brad L; Mandal, Kalyaneswar; Gates, Zachary P; Sawaya, Michael R; Yeates, Todd O; Kent, Stephen B H

2010-11-21

Here we report the total synthesis of kaliotoxin by 'one pot' native chemical ligation of three synthetic peptides. A racemic mixture of D- and L-kaliotoxin synthetic protein molecules gave crystals in the centrosymmetric space group P1 that diffracted to atomic-resolution (0.95 Å), enabling the X-ray structure of kaliotoxin to be determined by direct methods.

Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

2008-07-01

Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

Acceleration of color computer-generated hologram from three-dimensional scenes with texture and depth information

NASA Astrophysics Data System (ADS)

Shimobaba, Tomoyoshi; Kakue, Takashi; Ito, Tomoyoshi

2014-06-01

We propose acceleration of color computer-generated holograms (CGHs) from three-dimensional (3D) scenes that are expressed as texture (RGB) and depth (D) images. These images are obtained by 3D graphics libraries and RGB-D cameras: for example, OpenGL and Kinect, respectively. We can regard them as two-dimensional (2D) cross-sectional images along the depth direction. The generation of CGHs from the 2D cross-sectional images requires multiple diffraction calculations. If we use convolution-based diffraction such as the angular spectrum method, the diffraction calculation takes a long time and requires large memory usage because the convolution diffraction calculation requires the expansion of the 2D cross-sectional images to avoid the wraparound noise. In this paper, we first describe the acceleration of the diffraction calculation using "Band-limited double-step Fresnel diffraction," which does not require the expansion. Next, we describe color CGH acceleration using color space conversion. In general, color CGHs are generated on RGB color space; however, we need to repeat the same calculation for each color component, so that the computational burden of the color CGH generation increases three-fold, compared with monochrome CGH generation. We can reduce the computational burden by using YCbCr color space because the 2D cross-sectional images on YCbCr color space can be down-sampled without the impairing of the image quality.

Effect of screw threading dislocations and inverse domain boundaries in GaN on the shape of reciprocal-space maps.

PubMed

Barchuk, Mykhailo; Motylenko, Mykhaylo; Lukin, Gleb; Pätzold, Olf; Rafaja, David

2017-04-01

The microstructure of polar GaN layers, grown by upgraded high-temperature vapour phase epitaxy on [001]-oriented sapphire substrates, was studied by means of high-resolution X-ray diffraction and transmission electron microscopy. Systematic differences between reciprocal-space maps measured by X-ray diffraction and those which were simulated for different densities of threading dislocations revealed that threading dislocations are not the only microstructure defect in these GaN layers. Conventional dark-field transmission electron microscopy and convergent-beam electron diffraction detected vertical inversion domains as an additional microstructure feature. On a series of polar GaN layers with different proportions of threading dislocations and inversion domain boundaries, this contribution illustrates the capability and limitations of coplanar reciprocal-space mapping by X-ray diffraction to distinguish between these microstructure features.

Method of Generating X-Ray Diffraction Data for Integral Detection of Twin Defects in Super-Hetero-Epitaxial Materials

NASA Technical Reports Server (NTRS)

Park, Yeonjoon (Inventor); Choi, Sang Hyouk (Inventor); King, Glen C. (Inventor); Elliott, James R. (Inventor)

2009-01-01

A method provides X-ray diffraction (XRD) data suitable for integral detection of a twin defect in a strained or lattice-matched epitaxial material made from components having crystal structures having symme try belonging to different space groups. The material is mounted in a n X-ray diffraction (XRD) system. In one embodiment, the XRD system's goniometer angle Omega is set equal to (Theta(sub B)-Beta) where The ta(sub B) is a Bragg angle for a designated crystal plane of the allo y that is disposed at a non-perpendicular orientation with respect to the {111) crystal plane, and Beta is the angle between the designate d crystal plane and a { 111 } crystal plane of one of the epitaxial components. The XRD system's detector angle is set equal to (Theta(su b B)+Beta). The material can be rotated through an angle of azimuthal rotation Phi about the axis aligned with the material. Using the det ector, the intensity of the X-ray diffraction is recorded at least at the angle at which the twin defect occurs.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Neutron diffraction and μ SR studies of two polymorphs of nickel niobate NiNb 2 O 6

DOE PAGES

Munsie, T. J. S.; Wilson, M. N.; Millington, A.; ...

2017-10-13

Neutron diffraction and muon spin relaxation (μSR) studies are presented in this paper for the newly characterized polymorph of NiNb 2O 6 (β-NiNb 2O 6) with space group P4 2/n and μSR data only for the previously known columbite structure polymorph with space group Pbcn. The magnetic structure of the P4 2/n form was determined from neutron diffraction using both powder and single-crystal data. Powder neutron diffraction determined an ordering wave vector →k=( 1/ 2, 1/ 2, 1/ 2). Single-crystal data confirmed the same →k vector and showed that the correct magnetic structure consists of antiferromagnetically coupled chains running alongmore » the a or b axis in adjacent Ni 2+ layers perpendicular to the c axis, which is consistent with the expected exchange interaction hierarchy in this system. The refined magnetic structure is compared with the known magnetic structures of the closely related trirutile phases, NiSb 2O 6 and NiTa 2O 6. μSR data finds a transition temperature of T N~15K for this system, while the columbite polymorph exhibits a lower T N=5.7(3) K. Our μSR measurements also allowed us to estimate the critical exponent of the order parameter β for each polymorph. We found β =0.25(3) and 0.16(2) for the β and columbite polymorphs, respectively. The single-crystal neutron scattering data give a value for the critical exponent β =0.28(3) for β-NiNb 2O 6, in agreement with the μSR value. While both systems have β values less than 0.3, which is indicative of reduced dimensionality, this effect appears to be much stronger for the columbite system. Finally, in other words, although both systems appear to be well described by S=1 spin chains, the interchain interactions in the β polymorph are likely much larger.« less

Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.

2005-11-01

Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponemamore » pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.« less

Neutron diffraction and μ SR studies of two polymorphs of nickel niobate NiNb2O6

NASA Astrophysics Data System (ADS)

Munsie, T. J. S.; Wilson, M. N.; Millington, A.; Thompson, C. M.; Flacau, R.; Ding, C.; Guo, S.; Gong, Z.; Aczel, A. A.; Cao, H. B.; Williams, T. J.; Dabkowska, H. A.; Ning, F.; Greedan, J. E.; Luke, G. M.

2017-10-01

Neutron diffraction and muon spin relaxation (μ SR ) studies are presented for the newly characterized polymorph of NiNb2O6 (β -NiNb2O6) with space group P4 2/n and μ SR data only for the previously known columbite structure polymorph with space group P b c n . The magnetic structure of the P4 2/n form was determined from neutron diffraction using both powder and single-crystal data. Powder neutron diffraction determined an ordering wave vector k ⃗=(1/2 ,1/2 ,1/2 ) . Single-crystal data confirmed the same k ⃗ vector and showed that the correct magnetic structure consists of antiferromagnetically coupled chains running along the a or b axis in adjacent Ni2 + layers perpendicular to the c axis, which is consistent with the expected exchange interaction hierarchy in this system. The refined magnetic structure is compared with the known magnetic structures of the closely related trirutile phases, NiSb2O6 and NiTa2O6 . μ SR data finds a transition temperature of TN˜15 K for this system, while the columbite polymorph exhibits a lower TN=5.7 (3 ) K. Our μ SR measurements also allowed us to estimate the critical exponent of the order parameter β for each polymorph. We found β =0.25 (3 ) and 0.16(2) for the β and columbite polymorphs, respectively. The single-crystal neutron scattering data give a value for the critical exponent β =0.28 (3 ) for β -NiNb2O6 , in agreement with the μ SR value. While both systems have β values less than 0.3, which is indicative of reduced dimensionality, this effect appears to be much stronger for the columbite system. In other words, although both systems appear to be well described by S =1 spin chains, the interchain interactions in the β polymorph are likely much larger.

Neutron diffraction and μ SR studies of two polymorphs of nickel niobate NiNb 2 O 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munsie, T. J. S.; Wilson, M. N.; Millington, A.

Neutron diffraction and muon spin relaxation (μSR) studies are presented in this paper for the newly characterized polymorph of NiNb 2O 6 (β-NiNb 2O 6) with space group P4 2/n and μSR data only for the previously known columbite structure polymorph with space group Pbcn. The magnetic structure of the P4 2/n form was determined from neutron diffraction using both powder and single-crystal data. Powder neutron diffraction determined an ordering wave vector →k=( 1/ 2, 1/ 2, 1/ 2). Single-crystal data confirmed the same →k vector and showed that the correct magnetic structure consists of antiferromagnetically coupled chains running alongmore » the a or b axis in adjacent Ni 2+ layers perpendicular to the c axis, which is consistent with the expected exchange interaction hierarchy in this system. The refined magnetic structure is compared with the known magnetic structures of the closely related trirutile phases, NiSb 2O 6 and NiTa 2O 6. μSR data finds a transition temperature of T N~15K for this system, while the columbite polymorph exhibits a lower T N=5.7(3) K. Our μSR measurements also allowed us to estimate the critical exponent of the order parameter β for each polymorph. We found β =0.25(3) and 0.16(2) for the β and columbite polymorphs, respectively. The single-crystal neutron scattering data give a value for the critical exponent β =0.28(3) for β-NiNb 2O 6, in agreement with the μSR value. While both systems have β values less than 0.3, which is indicative of reduced dimensionality, this effect appears to be much stronger for the columbite system. Finally, in other words, although both systems appear to be well described by S=1 spin chains, the interchain interactions in the β polymorph are likely much larger.« less

Space charge effects in ultrafast electron diffraction and imaging

NASA Astrophysics Data System (ADS)

Tao, Zhensheng; Zhang, He; Duxbury, P. M.; Berz, Martin; Ruan, Chong-Yu

2012-02-01

Understanding space charge effects is central for the development of high-brightness ultrafast electron diffraction and microscopy techniques for imaging material transformation with atomic scale detail at the fs to ps timescales. We present methods and results for direct ultrafast photoelectron beam characterization employing a shadow projection imaging technique to investigate the generation of ultrafast, non-uniform, intense photoelectron pulses in a dc photo-gun geometry. Combined with N-particle simulations and an analytical Gaussian model, we elucidate three essential space-charge-led features: the pulse lengthening following a power-law scaling, the broadening of the initial energy distribution, and the virtual cathode threshold. The impacts of these space charge effects on the performance of the next generation high-brightness ultrafast electron diffraction and imaging systems are evaluated.

On the diffraction pattern of bundled rare-earth silicide nanowires on Si(0 0 1).

PubMed

Timmer, F; Bahlmann, J; Wollschläger, J

2017-11-01

Motivated by the complex diffraction pattern observed for bundled rare-earth silicide nanowires on the Si(0 0 1) surface, we investigate the influence of the width and the spacing distribution of the nanowires on the diffraction pattern. The diffraction pattern of the bundled rare-earth silicide nanowires is analyzed by the binary surface technique applying a kinematic approach to diffraction. Assuming a categorical distribution for the (individual) nanowire size and a Poisson distribution for the size of the spacing between adjacent nanowire-bundles, we are able to determine the parameters of these distributions and derive an expression for the distribution of the nanowire-bundle size. Additionally, the comparison of our simulations to the experimental diffraction pattern reveal that a (1  ×  1)-periodicity on top of the nanowires has to be assumed for a good match.

Single-Slit Diffraction and the Uncertainty Principle

ERIC Educational Resources Information Center

Rioux, Frank

2005-01-01

A theoretical analysis of single-slit diffraction based on the Fourier transform between coordinate and momentum space is presented. The transform between position and momentum is used to illuminate the intimate relationship between single-slit diffraction and uncertainty principle.

X-ray diffraction and spectroscopy study of nano-Eu 2O 3 structural transformation under high pressure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Zhenhai; Wang, Qinglin; Ma, Yanzhang

Nanoscale materials exhibit properties that are quite distinct from those of bulk materials because of their size restricted nature. Here, we investigated the high-pressure structural stability of cubic (C-type) nano-Eu2O3 using in situ synchrotron X-ray diffraction (XRD), Raman and luminescence spectroscopy, and impedance spectra techniques. Our high-pressure XRD experimental results revealed a pressure-induced structural phase transition in nano-Eu2O3 from the C-type phase (space group: Ia-3) to a hexagonal phase (A-type, space group: P-3m1). Our reported transition pressure (9.3 GPa) in nano-Eu2O3 is higher than that of the corresponding bulk-Eu2O3 (5.0 GPa), which is contrary to the preceding reported experimental result.more » After pressure release, the A-type phase of Eu2O3 transforms into a new monoclinic phase (B-type, space group: C2/m). Compared with bulk-Eu2O3, C-type and A-type nano-Eu2O3 exhibits a larger bulk modulus. Our Raman and luminescence findings and XRD data provide consistent evidence of a pressure-induced structural phase transition in nano-Eu2O3. To our knowledge, we have performed the first high-pressure impedance spectra investigation on nano-Eu2O3 to examine the effect of the structural phase transition on its transport properties. We propose that the resistance inflection exhibited at ~12 GPa results from the phase boundary between the C-type and A-type phases. Besides, we summarized and discussed the structural evolution process by the phase diagram of lanthanide sesquioxides (Ln2O3) under high pressure.« less

Copper-based metal coordination complexes with Voriconazole ligand: Syntheses, structures and antimicrobial properties

NASA Astrophysics Data System (ADS)

Zhao, Yan-Ming; Tang, Gui-Mei; Wang, Yong-Tao; Cui, Yue-Zhi; Ng, Seik Weng

2018-03-01

Three new chiral metal coordination complexes, namely, [Cu(FZ)2(CH3COO)2(H2O)]·2H2O (1), [Cu(FZ)2(NO3)2] (2), and [Cu2(FZ)2 (H2O)8](SO4)2·4H2O (3) [FZ = (2R,3S)-2-(2,4-difluorophenyl)-3-(5-fluoro-4-pyrimidiny)-1-(1H-1,2,4-triazol-1-yl)-2-butanol) (Voriconazole)] have been obtained by the reaction of Cu(II) salts and the free ligand FZ at room temperature. Complexes 1-3 were structurally characterized by X-ray single-crystal diffraction, IR, UV-vis, powder X-ray diffraction (PXRD), and thermogravimetric analysis (TGA). Complex 1 crystallizes in the chiral space group C2, which exhibits a mono-nuclear structure. Both complexes 2 and 3 display a one-dimensional (1D) tape structure, which crystallize in chiral space group P21212 and P212121, respectively. Among these complexes, there exist a variety of hydrogen bonds and stacking interactions, through which a three-dimensional supramolecular architecture will be generated. Compared with the standard (Voriconazole), these Cu-based complexes show the more potent inhibiting efficiency against the species of Candida and Aspergillus. Moreover, among these complexes, complex 1 shows the most excellent efficiency.

Crystallization and preliminary X-ray analysis of alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko

The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less

Trithallium hydrogen bis(sulfate), Tl(3)H(SO(4))(2), in the super-ionic phase by X-ray powder diffraction.

PubMed

Matsuo, Yasumitsu; Kawachi, Shinya; Shimizu, Yuya; Ikehata, Seiichiro

2002-07-01

The structure of trithallium hydrogen bis(sulfate), Tl(3)H(SO(4))(2), in the super-ionic phase has been analyzed by Rietveld analysis of the X-ray powder diffraction pattern. Atomic parameters based on the isotypic Rb(3)H(SeO(4))(2) crystal in space group R3m in the super-ionic phase were used as the starting model, because it has been shown from the comparison of thermal and electric properties in Tl(3)H(SO(4))(2) and M(3)H(SO(4))(2) type crystals (M = Rb, Cs or NH(4)) that the room-temperature Tl(3)H(SO(4))(2) phase is isostructural with the high-temperature R3m-symmetry M(3)H(SO(4))(2) crystals. The structure was determined in the trigonal space group R3m and the Rietveld refinement shows that an hydrogen-bond O-H...O separation is slightly shortened compared with O-H...O separations in isotypic M(3)H(SeO(4))(2) crystals. In addition, it was found that the distortion of the SO(4) tetrahedra in Tl(3)H(SO(4))(2) is less than that in isotypic crystals.

Crystallization of a 2:2 complex of granulocyte-colony stimulating factor (GCSF) with the ligand-binding region of the GCSF receptor

PubMed Central

Honjo, Eijiro; Tamada, Taro; Maeda, Yoshitake; Koshiba, Takumi; Matsukura, Yasuko; Okamoto, Tomoyuki; Ishibashi, Matsujiro; Tokunaga, Masao; Kuroki, Ryota

2005-01-01

The granulocyte-colony stimulating factor (GCSF) receptor receives signals for regulating the maturation, proliferation and differentiation of the precursor cells of neutrophilic granulocytes. The signalling complex composed of two GCSFs (GCSF, 19 kDa) and two GCSF receptors (GCSFR, 34 kDa) consisting of an Ig-like domain and a cytokine-receptor homologous (CRH) domain was crystallized. A crystal of the complex was grown in 1.0 M sodium formate and 0.1 M sodium acetate pH 4.6 and belongs to space group P41212 (or its enantiomorph P43212), with unit-cell parameters a = b = 110.1, c = 331.8 Å. Unfortunately, this crystal form did not diffract beyond 5 Å resolution. Since the heterogeneity of GCSF receptor appeared to prevent the growth of good-quality crystals, the GCSF receptor was fractionated by anion-exchange chromatography. Crystals of the GCSF–fractionated GCSF receptor complex were grown as a new crystal form in 0.2 M ammonium phosphate. This new crystal form diffracted to beyond 3.0 Å resolution and belonged to space group P3121 (or its enantiomorph P3221), with unit-cell parameters a = b = 134.8, c = 105.7 Å. PMID:16511159

Application of the phase extension method in virus crystallography.

PubMed

Reddy, Vijay S

2016-01-01

The procedure for phase extension (PX) involves gradually extending the initial phases from low resolution (e.g., ~8Å) to the high-resolution limit of a diffraction data set. Structural redundancy present in the viral capsids that display icosahedral symmetry results in a high degree of non-crystallographic symmetry (NCS), which in turn translates into higher phasing power and is critical for improving and extending phases to higher resolution. Greater completeness of the diffraction data and determination of a molecular replacement solution, which entails accurately identifying the virus particle orientation(s) and position(s), are important for the smooth progression of the PX procedure. In addition, proper definition of a molecular mask (envelope) around the NCS-asymmetric unit has been found to be important for the success of density modification procedures, such as density averaging and solvent flattening. Regardless of the degree of NCS, the PX method appears to work well in all space groups, provided an accurate molecular mask is used along with reasonable initial phases. However, in the cases with space group P1, in addition to requiring a molecular mask, starting the phase extension at a higher resolution (e.g., 6Å) overcame the previously reported problems due to Babinet phases and phase flipping errors.

Electron microscope studies of nano-domain structures in Ru-based magneto-superconductors: RuSr(2)Gd(1.5)Ce(0.5)Cu(2)O(10-delta) (Ru-1222) and RuSr(2)GdCu(2)O(8) (Ru-1212).

PubMed

Yokosawa, Tadahiro; Awana, V P S Veer Pal Singh; Kimoto, Koji; Takayama-Muromachi, Eiji; Karppinen, Maarit; Yamauchi, Hisao; Matsui, Yoshio

2004-01-01

Microstructures of the RuSr(2)Gd(1.5)Ce(0.5)Cu(2)O(10-delta) (Ru-1222) and RuSr(2)GdCu(2)O(8) (Ru-1212) magneto-superconductors have been investigated by using selected-area electron diffraction, convergent-beam electron diffraction, dark-field electron microscopy and high-resolution electron microscopy at room temperature. Both Ru-1212 and Ru-1222 consist of nm-size domains stacked along the [Formula: see text] direction, where the domains are formed by two types of superstructures due to ordering of rotated RuO(6) octahedra about the c-axis. In Ru-1212, both primitive-and body-centered tetragonal superstructures (the possible space groups: P4/mbm and I4/mcm) are derived to form the corresponding nm-domains. It is of great interest that Ru-1212 consists of domains of two crystallographically different superstructures, while the similar domains observed in Ru-1222 have crystallographically identical superstructure with an orthorhombic symmetry (possible space group: Aeam), related by 90 degrees rotation around the c-axis (Yokosawa et al., 2003, submitted for publication).

Crystallization and preliminary X-ray crystallographic studies of Drep-3, a DFF-related protein from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Hyun Ho; Tookes, Hansel Emory; Wu, Hao, E-mail: haowu@med.cornell.edu

2006-06-01

The D. melanogaster Drep-3 protein has been crystallized. Crystals were obtained at 293 K that diffracted to 2.8 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}. During apoptosis, DNA fragmentation is mainly mediated by the caspase-activated DFF40 nuclease. DFF40 exists as a heterodimeric complex with its inhibitor DFF45. Upon apoptosis induction, DFF45 is cleaved by caspases to allow DFF40 activation. Drep-3 is a recently identified regulator of the DFF40 system in Drosophila melanogaster. Here, Drep-3 was expressed with a C-terminal His tag in Escherichia coli and the protein was purified to homogeneity. Multi-angle light-scattering analysis showed thatmore » Drep-3 is a homotetramer in solution. Native and selenomethionine-substituted Drep-3 proteins were crystallized at 293 K and X-ray diffraction data were collected to 2.8 and 3.0 Å resolution, respectively. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 56.9, b = 125.4, c = 168.7 Å. The asymmetric unit is estimated to contain one homotetramer.« less

Purification, crystallization and preliminary X-ray analysis of phycocyanin and phycoerythrin from Porphyra yezoensis Ueda

PubMed Central

Cai, Chuner; Wu, Lian; Li, Chunxia; He, Peimin; Li, Jie; Zhou, Jiahai

2011-01-01

Porphyra yezoensis is one of the most important and widely cultured seaweeds in China. Phycobiliproteins exhibit excellent spectroscopic properties and play versatile roles in the biomedical, food, cosmetics and chemical synthetic dye industries. Here, the purification and crystallization of phycoerythrin and phycocyanin, two phycobiliproteins extracted from P. yezoensis, are described. Using a novel protocol including co-precipitation with ammonium sulfate and hydroxyapatite column chromatography, both phycobiliproteins were produced on a large scale with improved quality and yield compared with those previously reported. Native PAGE analysis indicated that phycoerythrin and phycocyanin exist as (αβ)3 heterohexamers in solution. The crystals of phycoerythrin diffracted to 2.07 Å resolution and belonged to space group R3. The unit-cell parameters referred to hexagonal axes are a = b = 187.7, c = 59.7 Å, with nine (αβ)2 heterotetramers per unit cell. The crystals of phycocyanin diffracted to 2.70 Å resolution in space group P21. Matthews coefficient analysis shows that 10–19 (αβ) heterodimers of phycocyanin in the asymmetric unit would be reasonable. A self-rotation function calculation clarified this ambiguity and indicated that 12 (αβ) heterodimers of phycocyanin are assembled in the asymmetric unit. PMID:21543866

Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

2007-03-01

Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

Applications of thermal-gradients method for the optimization of α-amylase crystallization conditions based on dynamic and static light scattering data

NASA Astrophysics Data System (ADS)

Delboni, L. F.; Iulek, J.; Burger, R.; da Silva, A. C. R.; Moreno, A.

2002-02-01

The expression, purification, crystallization, and characterization by X-ray diffraction of α-amylase are described here. Dynamic and static light scattering methods with a temperature controller was used to optimize the crystallization conditions of α-amylase from Bacillus stearothermophilus an important enzyme in many fields of industrial activity. After applying thermal gradients for growing crystals, X-ray cryo-crystallographic methods were employed for the data collection. Crystals grown by these thermal-gradients diffracted up to a maximum resolution of 3.8 Å, which allowed the determination of the unit cell constants as follows: a=61.7 Å, b=86.7 Å, c=92.2 Å and space group C222 (or C222 1).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sippel, K.; Boehlein, S; Sakai, Y

Mycoplasma genitalium is a human pathogen that is associated with nongonococcal urethritis in men and cervicitis in women. The cloning, expression, purification and crystallization of the protein MG289 from M. genitalium strain G37 are reported here. Crystals of MG289 diffracted X-rays to 2.8 {angstrom} resolution. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.7, b = 90.9, c = 176.1 {angstrom}. The diffraction data after processing had an overall R{sub merge} of 8.7%. The crystal structure of Cypl, the ortholog of MG289 from M. hyorhinis, has recently been determined, providing amore » reasonable phasing model; molecular replacement is currently under way.« less

A hydrous Ca-bearing magnesium carbonate from playa lake sediments, Salines Lake, Spain

USGS Publications Warehouse

Queralt, I.; Julia, R.; Plana, F.; Bischoff, J.L.

1997-01-01

Sediments of playa Lake Salines, SE, Spain, contain a carbonate mineral characterized by X-ray diffraction peaks very similar to, but systematically shifted from those of pure magnesite. Analyses (SEM, IR and Raman spectroscopy, DTA, TGA, and ICP) indicate the mineral is a hydrous Ca-bearing magnesium carbonate with the chemical formula (Mg0.92,Ca0.08)CO3??3H2O. Thermal characteristics of the mineral are similar to those of other known hydrated magnesium carbonates. X-ray and electron diffraction data suggests a monoclinic system (P21/n space group) with unit-cell parameters of a = 6.063(6), b = 10.668(5), and c = 6.014(4) A?? and ?? = 107.28??.

Crystal structure and superconducting properties of KSr2Nb3O10

NASA Astrophysics Data System (ADS)

Kawaguchi, T.; Horigane, K.; Itoh, Y.; Kobayashi, K.; Horie, R.; Kambe, T.; Akimitsu, J.

2018-05-01

We performed X-ray diffraction (XRD) and DC magnetic susceptibility measurements to elucidate the crystal structure and superconducting properties of KSr2Nb3O10. From the diffraction pattern indexing, it was found that KSr2Nb3O10 crystallizes with monoclinic symmetry, space group P21/m(11). We succeeded in preparing high temperature (HT) and low temperature (LT) phases of KSr2Nb3O10 powder samples synthesized by a conventional solid state reaction and an ion-exchange reaction, respectively. Superconductivity was observed at 4 K by Li intercalation and it was found that the superconducting volume fraction of the LT phase ( 1.4%) is clearly larger than that of the HT phase (0.07%).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalsi, Deepti; Rayaprol, S.; Siruguri, V.

We report the crystallographic properties of RE{sub 2}NiGe{sub 3} (RE=La, Ce) synthesized by arc melting. Rietveld refinement on the powder neutron diffraction (ND) data suggest both compounds are isostructural and crystallize in the non-centrosymmetric Er{sub 2}RhSi{sub 3} type structure having hexagonal space group P6{sup ¯}2c. In the crystal structure of RE{sub 2}NiGe{sub 3}, two dimensional arrangements of nickel and germanium atoms lead to the formation of hexagonal layers with rare earth atoms sandwiched between them. Magnetic susceptibility measurements performed in low fields exhibit antiferromagnetic ordering in cerium compound around (T{sub o}=) 3.2 K. Neutron diffraction measurements at 2.8 K (i.e.,more » at T« less

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Michael R.; Selby, Thomas L.

2012-10-30

A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

PubMed Central

Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya

2006-01-01

A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326

Application of powder X-ray diffraction in studying the compaction behavior of bulk pharmaceutical powders.

PubMed

Bandyopadhyay, Rebanta; Selbo, Jon; Amidon, Gregory E; Hawley, Michael

2005-11-01

This study investigates the effects of crystal lattice deformation on the powder X-ray diffraction (PXRD) patterns of compressed polycrystalline specimen (compacts/tablets) made from molecular, crystalline powders. The displacement of molecules and the corresponding adjustment of interplanar distances (d-spacings) between diffracting planes of PNU-288034 and PNU-177553, which have crystal habits with a high aspect ratio favoring preferred orientation during tableting, are demonstrated by shifts in the diffracted peak positions. The direction of shift in diffracted peak positions suggests a reduction of interplanar d-spacing in the crystals of PNU-288034 and PNU-177553 following compaction. There is also a general reduction of peak intensities following compression at the different compressive loads. The lattice strain representing the reduction in d-spacing is proportional to the original d-spacing of the uncompressed sample suggesting that, as with systems that obey a simple Hooke's law relationship, the further apart the planes of atoms/molecules within the lattice are, the easier it is for them to approach each other under compressive stresses. For a third model compound comprising more equant-shaped crystals of PNU-141659, the shift in diffracted peak positions are consistent with an expansion of lattice spacing after compression. This apparent anomaly is supported by the PXRD studies of the bulk powder consisting of fractured crystals where also, the shift in peak position suggests expansion of the lattice planes. Thus the crystals of PNU-141659 may be fracturing under the compressive loads used to produce the compacts. Additional studies are underway to relate the PXRD observations with the bulk tableting properties of these model compounds.

Programmable spectrometer using MOEMs devices for space applications

NASA Astrophysics Data System (ADS)

Viard, Thierry; Buisset, Christophe; Rejeaunier, Xavier; Zamkotsian, Frédéric; Venancio, Luis M.

2017-11-01

A new class of spectrometer can be designed using programmable components such as MOEMS which enable to tune the beam in spectral width and central wavelength. It becomes possible to propose for space applications a spectrometer with programmable resolution and adjustable spectral bandwidth. The proposed way to tune the output beam is to use the diffraction effect with the so-called PMDG (Programmable Micro Diffraction Gratings ) diffractive MEMS. In that case, small moving structures can form programmable gratings, diffracting or not the incoming light. In the proposed concept, the MOEMS is placed in the focal plane of a first diffracting stage (using a grating for instance). With such implementation, the MOEMS component can be used to select some wavelengths (for instance by reflecting them) and to switch-off the others (for instance by diffracting them). A second diffracting stage is used to recombine the beam composed by all the selected wavelengths. It becomes then possible to change and adjust the filter in λ and Δλ. This type of implementation is very interesting for space applications (Astronomy, Earth observation, planetary observation). Firstly because it becomes possible to tune the filtering function quasi instantaneously. And secondly because the focal plane dimension can be reduced to a single detector (for application without field of view) or to a linear detector instead of a 2D matrix detector (for application with field of view) thanks to a sequential acquisition of the signal.

Crystallographic and magnetic structure of the novel compound ErGe 1.83

NASA Astrophysics Data System (ADS)

Oleksyn, O.; Schobinger-Papamantellos, P.; Ritter, C.; de Groot, C. H.; Buschow, K. H. J.

1997-02-01

The crystal structure and the magnetic ordering of the novel orthorhombic compound ErGe 2-x has been studied by neutron powder diffraction and magnetic measurements. The crystal structure belongs to the DyGe 1.85-type (space group Cmc2 1)·ErGe 2-x ( x = 0.17 (2)) orders antiferromagnetically below TN = 6 K and displays a metamagnetic behaviour. The magnetic cell has the same size as the chemical unit cell ( q = 0 ). The magnetic space group is Cmc2 1 (Sh 36173). At T = 1.5 K the magnetic moments of the two erbium sites have the same ordered magnetic moment values of 7.63 (6) μB/Er and are antiferromagnetically coupled leading to an uniaxial structure along the a direction.

Hydrothermal synthesis and crystal structure of alkaline earth metal (Mg, Ca) based on 2,5-Dimethylbenzene-1,4-diylbis(methylene) diphosphonic acid

NASA Astrophysics Data System (ADS)

Xie, Y. C.; Cheng, Q. R.; Pan, Z. Q.

2018-02-01

New magnesium phosphonates Mg(H2L)31 (H4L = 2,5-dimethylbenzene-1,4 -diylbis(methylene)diphosphonic acid) and Ca(H2L)·2H2O 2 have been hydrothermally synthesized from H4L and the corresponding metal salts. Complex 1 and 2 have been characterized by IR, powder and single-crystal X-ray diffraction methods. Complex 1 crystallizes in trigonal space group R-3c and complex 2 belongs to the triclinic space group. The complexes both form two-dimensional (2D) network structure and show three-dimensional (3D) network through hydrogen bonds. Thermal stability of complex 1 and 2 have also been investigated. CCDC: 1534599 for 1; 1536423 for 2.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli.

PubMed

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-02-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli

PubMed Central

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-01-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114

Different structures of monoclinic martensitic phases in titanium nickelide

NASA Astrophysics Data System (ADS)

Voronin, V. I.; Naish, V. E.; Novoselova, T. V.; Pushin, V. G.; Sagaradze, I. V.

2000-03-01

The detailed theoretical and experimental analysis has been undertaken to bring to light the true structure of the monoclinic phase in titanium nickelide (NiTi). Theoretical models for such a phase have been proposed to describe the experimental data. In addition to the well-known B19‧ phase two more structures - new monoclinic M phase with Cm space group and triclinic phase with P1 space group - have been produced and analyzed in detail. Diffraction patterns have been obtained from different NiTi samples by using the neutron diffractometer IVV2 at different temperatures. From the refinement by DBWS-9411 program all these neutron patterns have been decoded successfully. The proposed new structures and stereotype B19‧ one agree with correspondent experimental data and the agreement is quite good.

How to assign a (3 + 1)-dimensional superspace group to an incommensurately modulated biological macromolecular crystal

PubMed Central

2017-01-01

Periodic crystal diffraction is described using a three-dimensional (3D) unit cell and 3D space-group symmetry. Incommensurately modulated crystals are a subset of aperiodic crystals that need four to six dimensions to describe the observed diffraction pattern, and they have characteristic satellite reflections that are offset from the main reflections. These satellites have a non-integral relationship to the primary lattice and require q vectors for processing. Incommensurately modulated biological macromolecular crystals have been frequently observed but so far have not been solved. The authors of this article have been spearheading an initiative to determine this type of crystal structure. The first step toward structure solution is to collect the diffraction data making sure that the satellite reflections are well separated from the main reflections. Once collected they can be integrated and then scaled with appropriate software. Then the assignment of the superspace group is needed. The most common form of modulation is in only one extra direction and can be described with a (3 + 1)D superspace group. The (3 + 1)D superspace groups for chemical crystallographers are fully described in Volume C of International Tables for Crystallography. This text includes all types of crystallographic symmetry elements found in small-molecule crystals and can be difficult for structural biologists to understand and apply to their crystals. This article provides an explanation for structural biologists that includes only the subset of biological symmetry elements and demonstrates the application to a real-life example of an incommensurately modulated protein crystal. PMID:28808437

Sound Diffraction Around Movable Partitions in Teaching Spaces. Education Building Report 1.

ERIC Educational Resources Information Center

Choudhury, N. K. D.

This study concerns the diffraction of sound around flexible partitions used in teaching spaces. It includes a comprehensive study of the acoustical conditions in several school buildings in India, Malaysia, Singapore, and Sri Lanka. The noise reduction properties of some typical partitions the minimum height of the partition between two teaching…

Observables of QCD diffraction

NASA Astrophysics Data System (ADS)

Mieskolainen, Mikael; Orava, Risto

2017-03-01

A new combinatorial vector space measurement model is introduced for soft QCD diffraction. The model independent mathematical construction resolves experimental complications; the theoretical framework of the approach includes the Good-Walker view of diffraction, Regge phenomenology together with AGK cutting rules and random fluctuations.

Grain size dependent phase stabilities and presence of a monoclinic (Pm) phase in the morphotropic phase boundary region of (1-x)Bi(Mg1/2Ti1/2)O3-xPbTiO3 piezoceramics

NASA Astrophysics Data System (ADS)

Upadhyay, Ashutosh; Singh, Akhilesh Kumar

2015-04-01

Results of the room temperature structural studies on (1-x)Bi(Mg1/2Ti1/2)O3-xPbTiO3 ceramics using Rietveld analysis of the powder x-ray diffraction data in the composition range 0.28 ≤ x ≤ 0.45 are presented. The morphotropic phase boundary region exhibits coexistence of monoclinic (space group Pm) and tetragonal (space group P4 mm) phases in the composition range 0.33 ≤ x ≤ 0.40. The structure is nearly single phase monoclinic (space group Pm) in the composition range 0.28 ≤ x ≤ 0.32. The structure for the compositions with x ≥ 0.45 is found to be predominantly tetragonal with space group P4 mm. Rietveld refinement of the structure rules out the coexistence of rhombohedral and tetragonal phases in the morphotropic phase boundary region reported by earlier authors. The Rietveld structure analysis for the sample x = .35 calcined at various temperatures reveals that phase fraction of the coexisting phases in the morphotropic phase boundary region varies with grain size. The structural parameters of the two coexisting phases also change slightly with changing grain size.

Stress induced modulation of magnetic domain diffraction of single crystalline yttrium iron garnet

NASA Astrophysics Data System (ADS)

Mito, Shinichiro; Yoshihara, Yuki; Takagi, Hiroyuki; Inoue, Mitsuteru

2018-05-01

Stress induced modulation of the diffraction angle and efficiency of the light reflected from a stripe-domain magnetic garnet was demonstrated. The spacing of the magnetic domain was changed using the inverse magnetostriction effect. The sample structure was a piezo actuator/Al reflection layer/magnetic garnet substrate. A diffraction angle between the 0th and 1st ordered light was changed from 9.12 deg. to 10.20 deg. This result indicates that the domain spacing was changed from 3.3 μm to 3.0 μm. The change of the diffraction angle was irreversible for the voltage. However, reversible, linear and continuous change of the diffraction efficiency was observed. These results could be applicable for a voltage-driven optical solid state light deflector with low power consumption and high switching speed.

Table of interplanar spacings for crystal-structure determinations by X-ray diffraction with molybdenum, copper, cobalt, iron, and chromium radiations

NASA Technical Reports Server (NTRS)

Kittel, J Howard

1945-01-01

For a simple diffraction pattern, the time required to calculate interplanar distances from measurements of the pattern is not excessive. If more than a few lines are present, however, or if several patterns are to be studied, it is very advantageous to have available a table giving interplanar spacings directly in terms of the linear measurements made on the film of the lines appearing on the diffraction pattern. The preparation of the table given here was undertaken when the expansion of research activities involving X-ray diffraction techniques indicated that such a table would greatly decrease the time required to analyze diffraction patterns. The table was prepared for use with K alpha(sub 1) radiation from the following target materials: molybdenum, copper, cobalt, iron, and chromium.

Hard diffraction and deep inelastic scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bjorken, J.D.

1994-04-01

Since the advent of hard-collision physics, the study of diffractive processes - shadow physics - has been less prominent than before. However, there is now a renewed interest in the subject, especially in that aspect which synthesizes the short-distance, hard-collision phenomena with the classical physics of large rapidity-gaps. This is especially stimulated by the recent data on deep-inelastic scattering from HERA, as well as the theoretical work which relates to it. The word diffraction is sometimes used by high-energy physicists in a loose way. The author defines this term to mean: A diffractive process occurs if and only if theremore » is a large rapidity gap in the produced-particle phase space which is not exponentially suppressed. Here a rapidity gap means essentially no hadrons produced into the rapidity gap (which operates in the {open_quotes}lego{close_quotes} phase-space of pseudo-rapidity and azimuthal angle). And non-exponential suppression implies that the cross-section for creating a gap with width {Delta}{eta} does not have a power-law decrease with increasing subenergy s=e{sup {Delta}{eta}}, but behaves at most like some power of pseudorapidity {Delta}{eta}{approx}log(s). The term hard diffraction shall simply refer to those diffractive process which have jets in the final-state phase-space.« less

Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

1999-01-01

Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

Cloning, expression, purification, crystallization and X-ray diffraction analysis of dihydrodipicolinate synthase from the human pathogenic bacterium Bartonella henselae strain Houston-1 at 2.1 Å resolution

DOE PAGES

Naqvi, Kubra F.; Staker, Bart L.; Dobson, Renwick C. J.; ...

2016-01-01

The enzyme dihydrodipicolinate synthase catalyzes the committed step in the synthesis of diaminopimelate and lysine to facilitate peptidoglycan and protein synthesis. Dihydrodipicolinate synthase catalyzes the condensation of L-aspartate 4-semialdehyde and pyruvate to synthesize L-2,3-dihydrodipicolinate. Here, the cloning, expression, purification, crystallization and X-ray diffraction analysis of dihydrodipicolinate synthase from the pathogenic bacteriumBartonella henselae, the causative bacterium of cat-scratch disease, are presented. Protein crystals were grown in conditions consisting of 20%(w/v) PEG 4000, 100 mMsodium citrate tribasic pH 5.5 and were shown to diffract to ~2.10 Å resolution. They belonged to space groupP2 12 12 1, with unit-cell parametersa= 79.96,b= 106.33,c= 136.25more » Å. The finalRvalues wereR r.i.m.= 0.098,R work= 0.183,R free= 0.233.« less

Magnetic and neutron diffraction study on quaternary oxides MTeMoO6 (M = Mn and Zn)

NASA Astrophysics Data System (ADS)

Doi, Yoshihiro; Suzuki, Ryo; Hinatsu, Yukio; Ohoyama, Kenji

2009-01-01

Crystal structures and magnetic properties of quaternary oxides MTeMoO6 (M = Mn and Zn) were investigated. From the Rietveld analyses for the powder x-ray and neutron diffraction measurements, their detailed structures have been determined. Both compounds have orthorhombic structure with space group P 21212 and a charge configuration of M2+Te4+Mo6+O6. ZnTeMoO6 shows diamagnetic behavior. In this structure, M ions are arranged in a square-planar manner. The temperature dependence of the magnetic susceptibility for MnTeMoO6 shows a broad peak at ~33 K, which is due to a two-dimensional characteristic of the magnetic interaction. In addition, this compound shows an antiferromagnetic transition at 20 K. The magnetic structure was determined by the powder neutron diffraction measurement at 3.3 K. The magnetic moments of Mn2+ ions (4.45 μB) order in a collinear antiferromagnetic arrangement along the b axis.

Purification, crystallization and preliminary diffraction studies of an ectromelia virus glutaredoxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.

2005-06-01

Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less

Structural analysis of PrBaMn2O5+δ under SOFC anode conditions by in-situ neutron powder diffraction

NASA Astrophysics Data System (ADS)

Tomkiewicz, Alex C.; Tamimi, Mazin A.; Huq, Ashfia; McIntosh, Steven

2016-10-01

The crystal structure and oxygen stoichiometry of the proposed double perovskite solid oxide fuel cell (SOFC) anode material PrBaMn2O5+δ were determined under SOFC anode conditions via in-situ neutron diffraction. Measurements were performed in reducing atmospheres between 692 K and 984 K. The structure was fit to a tetragonal (space group P4/mmm) layered double perovskite structure with alternating Pr and Ba A-site cation layers. Under all conditions examined, the oxygen sites in the Ba and Mn layers were fully occupied, while the sites in the Pr layer were close to completely vacant. The results of the neutron diffraction experiments are compared to previous thermogravimetric analysis experiments to verify the accuracy of both experiments. PrBaMn2O5+δ was shown to be stable over a wide range of reducing atmospheres similar to anode operating conditions in solid oxide fuel cells without significant structural changes.

Neutron diffraction study of a non-strichiometric Ni-Mn-Ga MSM alloy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ari-Gur, Pnina; Garlea, Vasile O

2013-01-01

The structure and chemical order of a Heusler alloy of non-stoichiometric composition Ni-Mn-Ga were studied using constant-wavelength (1.538 ) neutron diffraction at 363K and the diffraction pattern was refined using the FullProf software. At this temperature the structure is austenite (cubic) with Fm-3m space group and lattice constant of a = 5.83913(4) [ ]. The chemical order is of critical importance in these alloys, as Mn becomes antiferromagnetic when the atoms are closer than the radius of the 3d shell. In the studied alloy the refinement of the site occupancy showed that the 4b (Ga site) contained as much asmore » 22% Mn; that significantly alters the distances between the Mn atoms in the crystal and, as a result, also the exchange energy between some of the Mn atoms. Based on the refinement, the composition was determined to be Ni1.91Mn1.29Ga0.8« less

Large-scale purification and crystallization of the endoribonuclease XendoU: troubleshooting with His-tagged proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renzi, Fabiana; Panetta, Gianna; Vallone, Beatrice

Recombinant His-tagged XendoU, a eukaryotic endoribonuclease, appeared to aggregate in the presence of divalent cations. Monodisperse protein which yielded crystals diffracting to 2.2 Å was obtained by addition of EDTA. XendoU is the first endoribonuclease described in higher eukaryotes as being involved in the endonucleolytic processing of intron-encoded small nucleolar RNAs. It is conserved among eukaryotes and its viral homologue is essential in SARS replication and transcription. The large-scale purification and crystallization of recombinant XendoU are reported. The tendency of the recombinant enzyme to aggregate could be reversed upon the addition of chelating agents (EDTA, imidazole): aggregation is a potentialmore » drawback when purifying and crystallizing His-tagged proteins, which are widely used, especially in high-throughput structural studies. Purified monodisperse XendoU crystallized in two different space groups: trigonal P3{sub 1}21, diffracting to low resolution, and monoclinic C2, diffracting to higher resolution.« less

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

X-ray diffraction and infrared spectroscopy of N,N-dimethylformamide and dimethyl sulfoxide solvatomorphs of betulonic acid.

PubMed

Boryczka, Stanisław; Jastrzebska, Maria; Bębenek, Ewa; Kusz, Joachim; Zubko, Maciej; Kadela, Monika; Michalik, Ewa

2012-12-01

X-ray diffraction and infrared spectroscopy measurements for the N,N-dimethylformamide (DMF) and dimethyl sulfoxide (DMSO) solvatomorphs of betulonic acid (BA) were investigated. BA [3-oxolup-20(29)-en-28-oic acid, C(30)H(46)O(3)] exhibits a wide spectrum of biological activities and is considered to be a promising natural agent for the treatment of various cancer diseases. BA as a noncrystalline substance was obtained by oxidation of betulin. Crystal structures and the spectral data allowed analysis of hydrogen bonding (H-bonding), molecular conformation, and crystal packing differences in the solvatomorphs. Crystals of BA solvates were grown from the DMF-acetone (1:10, v/v) and DMSO-water (9:1, v/v) solutions. BA-DMF (1:1) solvate crystallizes in the monoclinic P2(1) space group, Z = 2. The unit cell parameters are as follows: cell lengths a = 13.2458(5) Å, b = 6.6501(2) Å, c = 17.9766(7) Å, and β = 110.513(4)°. BA-DMSO (1:1) solvate crystallizes in the orthorhombic P2(1)2(1)2(1) (Z = 4) space group with the following unit cell parameters: a = 6.6484(4) Å, b = 13.3279(8) Å, and c = 32.6821(19) Å. Conformational analysis of the six-membered rings, cyclopentane ring, and isopropenyl group showed differences in comparison with other betulin derivatives examined earlier. For both solvates, the intermolecular packing arrangement was governed mainly by H-bonds. The shortest H-bonds with D···A distances of 2.604 and 2.657 Å, and almost linear DH···A connection occurred between OH of carboxylic group of BA and oxygen atoms from O=C and O=S groups of DMF and DMSO, respectively. Copyright © 2012 Wiley Periodicals, Inc.

Hydrothermal synthesis, crystal structure and properties of 2-D and 3-D lanthanide sulfates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Yan; Ding Shaohua; Zheng Xuefang

2007-07-15

Two new lanthanum sulfates DySO{sub 4}(OH) 1 and Eu{sub 2}(SO{sub 4}){sub 3}(H{sub 2}O){sub 8} 2 have been hydrothermally synthesized. The colorless crystals were characterized by IR, TGA, ICP and XRD. The structure was determined by single-crystal X-ray diffraction. 1 crystallizes with monoclinic symmetry, space group P2(1)/n [a=7.995(4) A, b=10.945(5) A, c=8.164(4) A, {alpha}=90{sup o}, {beta}=93.619(6){sup o}, {gamma}=90{sup o}, V=713.0(5) A{sup 3}, Z=8]. It displays a three-dimensional framework, based on the novel Dy-O chains connected by the sulfate groups through helical chains. 2 crystallizes with monoclinic symmetry, space group C2/c, [a=13.5605(17) A, b=6.7676(8) A, c=18.318(2) A, {alpha}=90{sup o}, {beta}=102.265(2){sup o}, {gamma}=90{supmore » o}, V=1642.7 (4) A{sup 3}, Z=4]. Its layered framework is attained by the europium atoms connected by the sulfate groups arranged in a helical manner. - Graphical abstract: Two new lanthanum sulfates DySO{sub 4}(OH) 1 and Eu{sub 2} (SO{sub 4}){sub 3} (H{sub 2}O){sub 8} 2 have been hydrothermally synthesized. The colorless crystals were characterized by IR, TGA, ICP and XRD. The structure was determined by single-crystal X-ray diffraction. It displays a three dimensional framework, based on the novel Dy-O chains connected by the sulfate groups through helical chains.« less

Synthesis of three new thiophene condensed pyrene derivatives, crystal structure and evaluation of their photophysical properties

NASA Astrophysics Data System (ADS)

Moriguchi, Tetsuji; Yakeya, Daisuke; Tsuge, Akihiko; Jalli, Venkataprasad

2018-04-01

Three new thiophene condensed fluorescent pyrene derivatives have been synthesized by a two-step process, via. Wittig reaction followed by iodine promoted photocyclization. These molecules have been characterized by 1H NMR and EI-MS. Further, the molecular structures of 4a, 4b and 4c has been confirmed by single crystal X-ray diffraction analysis. The protons located in the fjord and cove-regions of molecules 4b and 4c showed downfield shifts of the protons. Molecule 4a crystallized under monoclinic system with space group P21/c, molecule 4b crystallized under monoclinic system with space group C2/c and the molecule 4c crystalized under triclinic system with space group P-1. Molecules 4a, 4b and 4c showed strong absorption maxima wavelengths at 305, 358 and 330 nm, respectively. The molar extinctinction coefficients (ε) of the compounds 4a, 4b and 4c indicated molecule 4c has better ability to absorb UV light, molecule 4b has better fluorescence intensity than molecule 4a and 4c.

Crystallization of lanthanum and yttrium aluminosilicate glasses

NASA Astrophysics Data System (ADS)

Sadiki, Najim; Coutures, Jean Pierre; Fillet, Catherine; Dussossoy, Jean Luc

2006-01-01

The crystallization behaviour of aluminosilicate glasses of lanthanum (LAS) and yttrium (YAS) containing 2-8 mol% of Ln 2O 3 (Ln = La or Y), 12-30 mol% of Al 2O 3, and 64-80 mol% of SiO 2 has been studied by DTA, XRD and SEM-EDX analysis. X-ray diffraction results indicate the presence of the mullite phase and La 2Si 2O 7 in the monoclinic high-temperature G form (group space P2 1/c) for the LAS glasses, and mullite y-Y 2Si 2O 7 in the monoclinic structure (group space C2/m) and a small amount of β-Y 2Si 2O 7 in the orthorhombic structure (space group Pna2) for the YAS. For both cases, very little tridymite phase is observed. The results also show that the values of Tg for YAS are higher than those for LAS glasses. The crystallization of LAS glasses is more difficult than that of YAS. For all samples, we observed only one kind of mullite (Al/Si = 3.14).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivenet, Murielle; Vigier, Nicolas; Roussel, Pascal

Six new layered uranyl vanadates (NH{sub 4}){sub 2}[(UO{sub 2}){sub 2}V{sub 2}O{sub 8}] (1), (H{sub 2}EN)[(UO{sub 2}){sub 2}V{sub 2}O{sub 8}] (2), (H{sub 2}DAP)[(UO{sub 2}){sub 2}V{sub 2}O{sub 8}] (3), (H{sub 2}PIP)[(UO{sub 2}){sub 2}(VO{sub 4}){sub 2}].0,8H{sub 2}O (4), (H{sub 2}DMPIP)[(UO{sub 2}){sub 2}V{sub 2}O{sub 8}] (5), (H{sub 2}DABCO)[(UO{sub 2}){sub 2}(VO{sub 4}){sub 2}] (6) were prepared from mild-hydrothermal reactions using 1,2-ethylenediamine (EN); 1,3-diaminopropane (DAP); piperazine (PIP); 1-methylpiperazine (MPIP); 1,4-diazabicyclo[2,2,2]octane (DABCO). The structures of 1, 4, 5 and 6 were solved using single-crystal X-ray diffraction data while the structural models of 2 and 3 were established from powder X-ray diffraction data. In compounds 1, 2, 3more » and 5, the uranyl-vanadate layers are built from dimers of edge-shared UO{sub 7} pentagonal bipyramids and dimers of edge-shared VO{sub 5} square pyramids further connected through edge-sharing. In 1 and 3, the layers are identical to that occurring in the carnotite group of uranyl-vanadates. In 2 and 5, the V{sub 2}O{sub 8} dimers differ in orientation leading to a new type of layer. The layers of compound 4 and 6 are built from chains of edge-shared UO{sub 7} pentagonal bipyramids connected by VO{sub 4} tetrahedra and are of uranophane-type anion topology. For the six compounds, the ammonium or organoammonium cation resides in the space between the inorganic layers. Crystallographic data: 1 monoclinic, space group P2{sub 1}/c with a=6.894(2), b=8.384(3), c=10.473(4) A and {beta}=106.066(5){sup o}, 2 monoclinic, space group P2{sub 1}/a with a=13.9816(6), b=8.6165(3), c=10.4237(3) A and {gamma}=93.125(3){sup o}, 3 orthorhombic, space group Pmcn with a=14.7363(8), b=8.6379(4) and c=10.4385(4) A, 4 monoclinic, space group C2/m with a=15.619(2), b=7.1802(8), c=6.9157(8) A and {beta}=101.500(2){sup o}, 5 monoclinic, space group P2{sub 1}/b with a=9.315(2), b=8.617(2), c=10.5246(2) A and {gamma}=114.776(2){sup o}, 6 monoclinic, space group C2/m with a=17.440(2), b=7.1904(9), c=6.8990(8) A and {beta}=98.196(2){sup o}. - Graphical abstract: The three types of layer in layered uranyl-vanadates using diamine as a structure-directing agent.« less

On the Use of Dynamical Diffraction Theory To Refine Crystal Structure from Electron Diffraction Data: Application to KLa5O5(VO4)2, a Material with Promising Luminescent Properties.

PubMed

Colmont, Marie; Palatinus, Lukas; Huvé, Marielle; Kabbour, Houria; Saitzek, Sébastien; Djelal, Nora; Roussel, Pascal

2016-03-07

A new lanthanum oxide, KLa5O5(VO4)2, was synthesized using a flux growth technique that involved solid-state reaction under an air atmosphere at 900 °C. The crystal structure was solved and refined using an innovative approach recently established and based on three-dimensional (3D) electron diffraction data, using precession of the electron beam and then validated against Rietveld refinement and denisty functional theory (DFT) calculations. It crystallizes in a monoclinic unit cell with space group C2/m and has unit cell parameters of a = 20.2282(14) Å, b = 5.8639(4) Å, c = 12.6060(9) Å, and β = 117.64(1)°. Its structure is built on Cresnel-like two-dimensional (2D) units (La5O5) of 4*3 (OLa4) tetrahedra, which run parallel to (001) plane, being surrounded by isolated VO4 tetrahedra. Four isolated vanadate groups create channels that host K(+) ions. Substitution of K(+) cations by another alkali metal is possible, going from lithium to rubidium. Li substitution led to a similar phase with a primitive monoclinic unit cell. A complementary selected area electron diffraction (SAED) study highlighted diffuse streaks associated with stacking faults observed on high-resolution electron microscopy (HREM) images of the lithium compound. Finally, preliminary catalytic tests for ethanol oxidation are reported, as well as luminescence evidence. This paper also describes how solid-state chemists can take advantages of recent progresses in electron crystallography, assisted by DFT calculations and powder X-ray diffraction (PXRD) refinements, to propose new structural types with potential applications to the physicist community.

Exploring the feasibility of focusing CW light through a scattering medium into closely spaced twin peaks via numerical solutions of Maxwell’s equations

NASA Astrophysics Data System (ADS)

Tseng, Snow H.; Chang, Shih-Hui

2018-04-01

Here we present a numerical simulation to analyze the effect of scattering on focusing light into closely-spaced twin peaks. The pseudospectral time-domain (PSTD) is implemented to model continuous-wave (CW) light propagation through a scattering medium. Simulations show that CW light can propagate through a scattering medium and focus into closely-spaced twin peaks. CW light of various wavelengths focusing into twin peaks with sub-diffraction spacing is simulated. In advance, light propagation through scattering media of various number densities is simulated to decipher the dependence of CW light focusing phenomenon on the scattering medium. The reported simulations demonstrate the feasibility of focusing CW light into twin peaks with sub-diffraction dimensions. More importantly, based upon numerical solutions of Maxwell’s equations, research findings show that the sub-diffraction focusing phenomenon can be achieved with scarce or densely-packed scattering media.

Improved Resolution Optical Time Stretch Imaging Based on High Efficiency In-Fiber Diffraction.

PubMed

Wang, Guoqing; Yan, Zhijun; Yang, Lei; Zhang, Lin; Wang, Chao

2018-01-12

Most overlooked challenges in ultrafast optical time stretch imaging (OTSI) are sacrificed spatial resolution and higher optical loss. These challenges are originated from optical diffraction devices used in OTSI, which encode image into spectra of ultrashort optical pulses. Conventional free-space diffraction gratings, as widely used in existing OTSI systems, suffer from several inherent drawbacks: limited diffraction efficiency in a non-Littrow configuration due to inherent zeroth-order reflection, high coupling loss between free-space gratings and optical fibers, bulky footprint, and more importantly, sacrificed imaging resolution due to non-full-aperture illumination for individual wavelengths. Here we report resolution-improved and diffraction-efficient OTSI using in-fiber diffraction for the first time to our knowledge. The key to overcome the existing challenges is a 45° tilted fiber grating (TFG), which serves as a compact in-fiber diffraction device offering improved diffraction efficiency (up to 97%), inherent compatibility with optical fibers, and improved imaging resolution owning to almost full-aperture illumination for all illumination wavelengths. 50 million frames per second imaging of fast moving object at 46 m/s with improved imaging resolution has been demonstrated. This conceptually new in-fiber diffraction design opens the way towards cost-effective, compact and high-resolution OTSI systems for image-based high-throughput detection and measurement.

Phase diagram of the relaxor ferroelectric (1- x )Pb(Mg 1/3Nb 2/3)O 3+ x PbTiO 3 revisited: a neutron powder diffraction study of the relaxor skin effect

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phelan, D.; Rodriguez, E. E.; Gao, J.

2014-11-17

We revisit the phase diagram of the relaxor ferroelectric PMN- xPT using neutron powder diffraction to test suggestions that residual oxygen vacancies and/or strain affect the ground state crystal structure. Powdered samples of PMN- xPT were prepared with nominal compositions of x = 0:10, 0.20, 0.30, and 0.40 and divided into two identical sets, one of which was annealed in air to relieve grinding-induced strain and to promote an ideal oxygen stoichiometry. For a given composition and temperature the same structural phase is observed for each specimen. However, the distortions in all of the annealed samples are smaller than thosemore » in the as-grown samples. Further, the diffraction patterns for x = 0:10, 0.20, and 0.30 are best refined using the monoclinic Cm space group. By comparing our neutron diffraction results to those obtained on single crystals having similar compositions, we conclude that the relaxor skin effect in PMN- xPT vanishes on the Ti-rich side of the morphotropic phase boundary.« less

Structures of chloralide, ?-lactic acid chloralide, malic acid chloralide and citric acid chloralide

NASA Astrophysics Data System (ADS)

Koh, L. L.; Huang, H. H.; Chia, L. H. L.; Liang, E. P.

1995-06-01

The crystal and molecular structures of chloralide ( 1), D-lactic acid chloralide ( 2), malic acid chloralide ( 3) and citric acid chloralide ( 4) have been determined by X-ray diffraction methods. Compound 1 crystallizes in the monoclinic space group, {P2 1}/{c}, a = 6.201(2), b = 17.11(2), c = 10.357(6) Å, β = 95.21(4)°, Z = 4; compound 2 in the monoclinic space group P2 1, a = 7.600(4), b = 5.902(4), c = 9.743(6) Å, β = 99.20(5), Z = 2; compound 3 in the monoclinic space group {P2 1}/{c}, a = 16.500(6), b = 5.819(3), c = 10.120(4) Å, β = 91.41(3), Z = 4; compound 4 in the monoclinic space group {P2 1}/{c}, a = 12.041(3), b = 6.1190(10), c = 17.259(4) Å, β = 101.85(2), Z = 4. The five-membered ring systems of all the compounds are slightly twisted out-of-plane, that of compound 4 being the most puckered. The CCl 3 group is trans to the second CCl 3 group in 1, to the CH 3 group in 2 and to the CH 2COOH group in 3. The two CH 2COOH groups in 4 are disposed axially with respect to the ring. Dipole moment and Kerr constant data for D-lactic acid chloralide suggest a structure in solution which is consistent with the X-ray results. The IR spectra of 2, 3 and 4 are discussed in relation to the structures of these compounds.

Track membranes with open pores used as diffractive filters for space-based x-ray and EUV solar observations.

PubMed

Dominique, Marie; Mitrofanov, A V; Hochedez, J-F; Apel, P Yu; Schühle, U; Pudonin, F A; Orelovich, O L; Zuev, S Yu; Bolsée, D; Hermans, C; BenMoussa, A

2009-02-10

We describe the fabrication and performance of diffractive filters designed for space-based x-ray and EUV solar observations. Unlike traditional thin film filters, diffractive filters can be made to have a high resistance against the destructive mechanical and acoustic loads of a satellite launch. The filters studied are made of plastic track-etched membranes that are metal-coated on one side only. They have all-through open cylindrical pores with diameters as small as 500 nm, limiting their transmittance to very short wavelengths. The spectral transmittance of various diffractive filters with different pore parameters was measured from the soft x-ray to the near IR range (namely, from 1-1100 nm).

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

Studies on synthesis, growth, structural, thermal, linear and nonlinear optical properties of organic picolinium maleate single crystals.

PubMed

Pandi, P; Peramaiyan, G; Sudhahar, S; Chakkaravarthi, G; Mohan Kumar, R; Bhagavannarayana, G; Jayavel, R

2012-12-01

Picolinium maleate (PM), an organic material has been synthesised and single crystals were grown by slow evaporation technique. The structure of the grown crystal was elucidated by using single crystal X-ray diffraction analysis. PM crystal belongs to the monoclinic crystallographic system with space group P2(1)/c. The crystalline perfection of the grown crystals was analyzed by high-resolution X-ray diffraction rocking curve measurements. The presence of functional groups in PM was identified by FTIR and FT-NMR spectral analyses. Thermal behaviour and stability of picolinium maleate were studied by TGA/DTA analyses. UV-Vis spectral studies reveal that PM crystals are transparent in the wavelength region 327-1100 nm. The laser damage threshold value of PM crystal was found to be 4.3 GW/cm(2) using Nd:YAG laser. The Kurtz and Perry powder second harmonic generation technique confirms the nonlinear optical property of the grown crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

Growth and characterization of barium complex of 1,3,5-triazinane-2,4,6-trione in gel: a corrosion inhibiting material

NASA Astrophysics Data System (ADS)

Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Babu, K. Rajendra

2018-05-01

Good quality prismatic crystals of industrially applicable corrosion inhibiting barium complex of 1,3,5-triazinane-2,4,6-trione have been grown by conventional gel method. The crystal structure, packing, and nature of bonds are revealed in the single crystal X-ray diffraction analysis. The crystal has a three-dimensional polymeric structure having a triclinic crystal system with the space group P-1. The powder X-ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal are identified by Fourier transform infrared spectroscopy. Elemental analysis confirms the stoichiometry of the elements present in the complex. Thermogravimetric analysis and differential thermal analysis reveal its good thermal stability. The optical properties like band gap, refractive index and extinction coefficient are evaluated from the UV-visible spectral analysis. The singular property of the material, corrosion inhibition efficiency achieved by the adsorption of the sample molecules is determined by the weight loss method.

The crystal structure of calcite III

NASA Astrophysics Data System (ADS)

Smyth, Joseph R.; Ahrens, Thomas J.

The crystal structure of calcite III has been deduced from existing high pressure powder X-ray diffraction patterns, based on the assumption that it is a displacive modification of the calcite I structure. The structure is monoclinic with space group C2 and a Z of 6. There are two Ca and two C positions, and five O positions, and atom coordinates have been refined by distance-least-squares methods to give reasonable octahedral coordination for Ca and parallel, planar CO3 groups. Unit cell parameters refined from a published powder diffraction pattern at 4.1 GPa are: a = 8.746(8)Å b = 4.685(5)Å c = 8.275(8)Å and β= 94.4°. The structure has a calculated density of 2.949 Mg/m³ at 4.1 GPa which is less than that of aragonite at this pressure and consistent with early piston cylinder studies. This implies that calcite III is indeed a metastable intermediary between calcite I and aragonite.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

PubMed

Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

2014-03-01

Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

Crystal structure of acetanilide at 15 and 295 K by neutron diffraction. Lack of evidence for proton transfer along the N-H...O hydrogen bond

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, S.W.; Eckert, J.; Barthes, M.

1995-11-02

The crystal structure of acetanilide C{sub 8}H{sub 9}NO, M{sub r} = 135.17, orthorhombic, space group Pbca, Z=8, has been determined from neutron diffraction data at 15 and 295 K. The crystal data obtained are presented. This new investigation of the structure of acetanilide has been undertaken in order to assess a recent suggestion that confirmational substates in the amide proton position may be responsible for the vibrational anomalies. We found no evidence for multiple conformations or transfer along the N-H...O hydrogen bond of the amide proton at either temperature. However the intramolecular O...H6 distance from O to the nearest phenylmore » ring proton is unusually short and the amide proton has relatively close contacts with one of the phenyl and one of the methyl protons, which may well affect the vibrational parameters of the respective molecular groups. 44 refs., 6 figs., 5 tabs.« less

The high pressure crystal structures of tin sulphate: a case study for maximal information recovery from 2D powder diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinrichsen, Bernd; Dinnebier, Robert E.; Liu, Haozhe

2008-12-09

Our recently proposed method for automatic detection, calibration and evaluation of Debye-Scherrer ellipses using pattern recognition techniques and advanced signal filtering was applied to 2D powder diffraction data of tin sulphate in dependence on pressure. Three phase transitions towards higher pressure could be identified, and their respective crystal structures have been determined. The high pressure behaviour of the stereoactive lone pair of Sn{sup 2+} was investigated. At ambient conditions, SnSO{sub 4} crystallizes in a strongly distorted Barite structure type in space group Pnma (phase I). In the pressure range between P = 0.15 and P = 0.2 GPa, it exhibitsmore » a displacive second order phase transition into a structure with space group P112{sub 1}/a (phase II at P = 0.2 GPa: a = 8.7022(9) {angstrom}, b = 5.3393(5) {angstrom}, c = 7.0511(6) A, y = 89.90(1){sup o}). A second displacive phase transition occurs between P = 4.40 and P = 5.07 GPa into another structure with space group PI (phase III at P = 13.5 GPa: a = 8.067(3) {angstrom}, b = 5.141(2) {angstrom}, c = 6.609(2) {angstrom}, a = 90.56(3){sup o}, {beta} = 90.65(2){sup o}, y = 89.46(2){sup o}). A third displacive phase transition towards another crystal structure in space group P1 occurs between P = 13.6 and P = 15.3 GPa (phase IV at P = 20.5 GPa: a = 7.889(5) {angstrom}, b = 5.028(3) {angstrom}, c = 6.462(3) {angstrom}, a = 90.99(3){sup o}, {beta}=91.01(3){sup o}, y = 89.89(4){sup o}). A non-linear compression behaviour over the entire pressure range is observed, which can be described by three Vinet relations in the ranges from P = 0.21 to 4.4 GPa, from P = 5.07 to 13.55 GPa and from P = 15.26 to 20.5 GPa. The extrapolated bulk moduli of the high-pressure phases were determined to K{sub 0} = 48(1) GPa for phase II, K{sub 0} = 56(2) GPa for phase III, and K{sub 0} = 51(13) GPa for phase IV. The crystal structures of all phases are refined against X-ray powder diffraction data measured at several pressures between 0.15 and 20.5 GPa. The structural phase transitions of SnSO{sub 4} are mainly characterized by a reorientation of the SO{sub 4} tetrahedra, in order to optimize crystal packing. With increasing pressure, the lone pair which is localized at Sn{sup 2+} increasingly adopts pure s-character.« less

Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

DOE PAGES

Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

2016-08-09

In this paper, we present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional datamore » cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. Finally, we demonstrate this 'big data' approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.« less

Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

In this paper, we present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional datamore » cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. Finally, we demonstrate this 'big data' approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.« less

Determination of Patterson group symmetry from sparse multi-crystal data sets in the presence of an indexing ambiguity.

PubMed

Gildea, Richard J; Winter, Graeme

2018-05-01

Combining X-ray diffraction data from multiple samples requires determination of the symmetry and resolution of any indexing ambiguity. For the partial data sets typical of in situ room-temperature experiments, determination of the correct symmetry is often not straightforward. The potential for indexing ambiguity in polar space groups is also an issue, although methods to resolve this are available if the true symmetry is known. Here, a method is presented to simultaneously resolve the determination of the Patterson symmetry and the indexing ambiguity for partial data sets. open access.

Hexamethylenetetramine assisted hydrothermal synthesis of BiPO4 and its electrochemical properties for supercapacitors

NASA Astrophysics Data System (ADS)

Nithya, V. D.; Kalai Selvan, R.; Vasylechko, Leonid

2015-11-01

The well defined microstructures of BiPO4 were successfully synthesized by the facile hexamethylenetetramine (HMT) assisted hydrothermal method. The low temperature monoclinic BiPO4 structure with space group P21/n, were obtained from X-ray diffraction (XRD) for the pristine and HMT-assisted BiPO4 with 1, 3, 5 and 10 mmole concentration. A transformation from low temperature monazite-type phase to the high temperature SbPO4-type phase of BiPO4 was observed at the 10 mmole concentration. There was a variation in the morphology from polyhedron to octahedra-like and finally into cube shape upon an increase in concentration of HMT. The role of reaction time in the morphology of BiPO4 particles was investigated. The selected area electron diffraction (SAED) pattern elucidated the ordered dot pattern and the calculated d-spacing revealed the formation of BiPO4. An increased specific capacitance of HMT assisted materials (202 F/g) compared with pristine BiPO4 (89 F/g) at 5 mA/cm2 was observed upon morphological variation due to HMT addition.

Twinning of cubic diamond explains reported nanodiamond polymorphs

NASA Astrophysics Data System (ADS)

Németh, Péter; Garvie, Laurence A. J.; Buseck, Peter R.

2015-12-01

The unusual physical properties and formation conditions attributed to h-, i-, m-, and n-nanodiamond polymorphs has resulted in their receiving much attention in the materials and planetary science literature. Their identification is based on diffraction features that are absent in ordinary cubic (c-) diamond (space group: Fd-3m). We show, using ultra-high-resolution transmission electron microscope (HRTEM) images of natural and synthetic nanodiamonds, that the diffraction features attributed to the reported polymorphs are consistent with c-diamond containing abundant defects. Combinations of {113} reflection and <011> rotation twins produce HRTEM images and d-spacings that match those attributed to h-, i-, and m-diamond. The diagnostic features of n-diamond in TEM images can arise from thickness effects of c-diamonds. Our data and interpretations strongly suggest that the reported nanodiamond polymorphs are in fact twinned c-diamond. We also report a new type of twin (<11> rotational), which can give rise to grains with dodecagonal symmetry. Our results show that twins are widespread in diamond nanocrystals. A high density of twins could strongly influence their applications.

Investigation of Next-Generation Earth Radiation Budget Radiometry

NASA Technical Reports Server (NTRS)

Coffey, Katherine L.; Mahan, J. R.

1999-01-01

The current effort addresses two issues important to the research conducted by the Thermal Radiation Group at Virginia Tech. The first research topic involves the development of a method which can properly model the diffraction of radiation as it enters an instrument aperture. The second topic involves the study of a potential next-generation space-borne radiometric instrument concept. Presented are multiple modeling efforts to describe the diffraction of monochromatic radiant energy passing through an aperture for use in the Monte-Carlo ray-trace environment. Described in detail is a deterministic model based upon Heisenberg's uncertainty principle and the particle theory of light. This method is applicable to either Fraunhofer or Fresnel diffraction situations, but is incapable of predicting the secondary fringes in a diffraction pattern. Also presented is a second diffraction model, based on the Huygens-Fresnel principle with a correcting obliquity factor. This model is useful for predicting Fraunhofer diffraction, and can predict the secondary fringes because it keeps track of phase. NASA is planning for the next-generation of instruments to follow CERES (Clouds and the Earth's Radiant Energy System), an instrument which measures components of the Earth's radiant energy budget in three spectral bands. A potential next-generation concept involves modification of the current CERES instrument to measure in a larger number of wavelength bands. This increased spectral partitioning would be achieved by the addition of filters and detectors to the current CERES geometry. The capacity of the CERES telescope to serve for this purpose is addressed in this thesis.

Local and average structures of BaTiO 3-Bi(Zn 1/2Ti 1/2)O 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usher, Tedi-Marie; Iamsasri, Thanakorn; Forrester, Jennifer S.

The complex crystallographic structures of (1-x)BaTiO 3-xBi(Zn 1/2Ti 1/2)O 3 (BT-xBZT) are examined using high resolution synchrotron X-ray diffraction, neutron diffraction, and neutron pair distribution function (PDF) analyses. The short-range structures are characterized from the PDFs, and a combined analysis of the X-ray and neutron diffraction patterns is used to determine the long-range structures. Our results demonstrate that the structure appears different when averaged over different length scales. In all compositions, the local structures determined from the PDFs show local tetragonal distortions (i.e., c/a > 1). But, a box-car fitting analysis of the PDFs reveals variations at different length scales.more » For 0.80BT-0.20BZT and 0.90BT-0.10BZT, the tetragonal distortions decrease at longer atom-atom distances (e.g., 30 vs. 5 ). When the longest distances are evaluated (r > 40 ), the lattice parameters approach cubic. Neutron and X-ray diffraction yield further information about the long-range structure. Compositions 0.80BT-0.20BZT and 0.90BT-0.10BZT appear cubic by Bragg diffraction (no peak splitting), consistent with the PDFs at long distances. However, these patterns cannot be adequately fit using a cubic lattice model; modeling their structures with the P4mm space group allows for a better fit to the patterns because the space group allows for c-axis atomic displacements that occur at the local scale. Furthermore, for the compositions 0.92BT-0.08BZT and 0.94BT-0.06BZT, strong tetragonal distortions are observed at the local scale and a less-distorted tetragonal structure is observed at longer length scales. In Rietveld refinements, the latter is modeled using a tetragonal phase. Since the peak overlap in these two-phase compositions limits the ability to model the local-scale structures as tetragonal, it is approximated in the refinements as a cubic phase. These results demonstrate that alloying BT with BZT results in increased disorder and disrupts the long-range ferroelectric symmetry present in BT, while the large tetragonal distortion present in BZT persists at the local scale.« less

Local and average structures of BaTiO 3-Bi(Zn 1/2Ti 1/2)O 3

DOE PAGES

Usher, Tedi-Marie; Iamsasri, Thanakorn; Forrester, Jennifer S.; ...

2016-11-11

The complex crystallographic structures of (1-x)BaTiO 3-xBi(Zn 1/2Ti 1/2)O 3 (BT-xBZT) are examined using high resolution synchrotron X-ray diffraction, neutron diffraction, and neutron pair distribution function (PDF) analyses. The short-range structures are characterized from the PDFs, and a combined analysis of the X-ray and neutron diffraction patterns is used to determine the long-range structures. Our results demonstrate that the structure appears different when averaged over different length scales. In all compositions, the local structures determined from the PDFs show local tetragonal distortions (i.e., c/a > 1). But, a box-car fitting analysis of the PDFs reveals variations at different length scales.more » For 0.80BT-0.20BZT and 0.90BT-0.10BZT, the tetragonal distortions decrease at longer atom-atom distances (e.g., 30 vs. 5 ). When the longest distances are evaluated (r > 40 ), the lattice parameters approach cubic. Neutron and X-ray diffraction yield further information about the long-range structure. Compositions 0.80BT-0.20BZT and 0.90BT-0.10BZT appear cubic by Bragg diffraction (no peak splitting), consistent with the PDFs at long distances. However, these patterns cannot be adequately fit using a cubic lattice model; modeling their structures with the P4mm space group allows for a better fit to the patterns because the space group allows for c-axis atomic displacements that occur at the local scale. Furthermore, for the compositions 0.92BT-0.08BZT and 0.94BT-0.06BZT, strong tetragonal distortions are observed at the local scale and a less-distorted tetragonal structure is observed at longer length scales. In Rietveld refinements, the latter is modeled using a tetragonal phase. Since the peak overlap in these two-phase compositions limits the ability to model the local-scale structures as tetragonal, it is approximated in the refinements as a cubic phase. These results demonstrate that alloying BT with BZT results in increased disorder and disrupts the long-range ferroelectric symmetry present in BT, while the large tetragonal distortion present in BZT persists at the local scale.« less

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

PubMed

Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

1993-12-20

gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

Structural properties and electrochemistry of α-LiFeO2

NASA Astrophysics Data System (ADS)

Abdel-Ghany, A. E.; Mauger, A.; Groult, H.; Zaghib, K.; Julien, C. M.

2012-01-01

In this work, we study the physico-chemistry and electrochemistry of lithium ferrite synthesized by solid-state reaction. Characterization included X-ray diffraction (XRD), scanning electronic microscopy (SEM), Raman scattering (RS), Fourier transform infrared spectroscopy (FTIR), and SQUID magnetometry. XRD peaks gradually sharpen with increasing firing temperature; all the diffraction peaks can be indexed to the cubic α-LiFeO2 phase (Fm3m space group) with the refined cell parameter a = 4.155 Å. RS and FTIR spectra show the vibrational modes due to covalent Fe-O bonds and the Li-cage mode at low-frequency. The electrochemical properties of Li/LiFeO2 are revisited along with the post-mortem analysis of the positive electrode material using XRD and Raman experiments.

Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

PubMed

Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

2014-07-01

β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, Ying; Xu, Feng, E-mail: xuf@xtal.tsinghua.edu.cn; Bell, Stephen G.

Palustrisredoxin reductase (RPA3782, PuR), a flavin-dependent ferredoxin reductase, is an essential component of the Class I cytochrome P450 systems in Rhodopseudomonas palustris CGA009. Crystals of PuR that diffract to 2.2 Å resolution have been obtained. Palustrisredoxin reductase from Rhodopseudomonas palustris CGA009, a member of the oxygenase-coupled NADH-dependent ferredoxin reductase (ONFR) family, catalyzes electron transfer from NADH to ferredoxins. It is an essential component of the cytochrome P450 systems in R. palustris CGA009, a model organism with diverse metabolic pathways. Here, the crystallization of palustrisredoxin reductase is reported. The crystals belong to the trigonal space group P3{sub 2}21, with unit-cell parametersmore » a = 107.5, b = 107.5, c = 69.9 Å, and diffract to 2.2 Å resolution on a synchrotron source.« less

The crystal structure of the new ternary antimonide Dy 3Cu 20+xSb 11-x ( x≈2)

NASA Astrophysics Data System (ADS)

Fedyna, L. O.; Bodak, O. I.; Fedorchuk, A. O.; Tokaychuk, Ya. O.

2005-06-01

New ternary antimonide Dy 3Cu 20+xSb 11-x ( x≈2) was synthesized and its crystal structure was determined by direct methods from X-ray powder diffraction data (diffractometer DRON-3M, Cu Kα-radiation, R=6.99%,R=12.27%,R=11.55%). The compound crystallizes with the own cubic structure type: space group F 4¯ 3m, Pearson code cF272, a=16.6150(2) Å,Z=8. The structure of the Dy 3Cu 20Sb 11-x ( x≈2) can be obtained from the structure type BaHg 11 by doubling of the lattice parameter and subtraction of 16 atoms. The studied structure was compared with the structures of known compounds, which crystallize in the same space group with similar cell parameters.

Structural investigation of cooperite (PtS) crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rozhdestvina, V. I., E-mail: veronika@ascnet.ru; Udovenko, A. A.; Rubanov, S. V.

2016-03-15

The single-crystal structure of cooperite, a natural platinum sulfide PtS, is studied by X-ray diffraction supported by high-resolution scanning transmission electron microscopy and X-ray spectrum microanalysis. It is found that, in addition to the main reflections corresponding to the known tetragonal cell (a = 3.47 and c = 6.11 Å; space group P4{sub 2}/mmc), many weak reflections with intensities I ≤ 60σ(I) are clearly observed. These reflections fit the tetragonal cell (space group I4/mmm) with doubled parameters. In structures with small (P4{sub 2}/mmc) and large (I4/mmm) cells, the S atoms occupy statistically two special positions. It is shown that themore » chemical composition of the cooperite crystals deviates from the stoichiometric composition: sulfur-deficient specimens predominate.« less

Crystallization of Ulex europaeus lectin I.

PubMed

Vandonselaar, M; Delbaere, L T

1994-10-21

The lectin I from Ulex europaeus (UEAI) has a strong affinity for the H-type 2 human blood group determinant. Single crystals of UEAI have been grown in the monoclinic crystal system. Initial crystals were obtained after 11 months from a solution of 10 mg/ml protein, 40% 2,4-methylpentanediol and 0.1 N acetate buffer at pH 5.2. The technique of washing and reseeding was used to generate large suitable crystals. The space group is C2 with a = 78.84 A, b = 69.85 A, c = 120.62 A, beta = 108.74 degrees and Z = 4; there is one molecular dimer per asymmetric unit and the solvent content is estimated to be 58%. The crystals diffract to at least 2.8 A d spacings and are stable in the X-ray beam for more than three days.

Structural Variation of LaMnO3+δ by Oxygen Nonstoichiometry

NASA Astrophysics Data System (ADS)

Niwa, Eiki; Maeda, Hiroki; Hashimoto, Takuya; Mizusaki, Junichiro

2013-07-01

The relationship between oxygen content and crystal structure of LaMnO3+δ, which is mother phase of cathode material for solid oxide fuel cells, has been investigated by X-ray diffraction, thermogravimetry and iodometric titration. It was confirmed that LaMnO3+δ with different oxygen content can be prepared by controlling sintering temperature in static air. Crystal system of LaMnO3.17±0.02 and LaMnO3.13±0.01 at room temperature was rhombohedral with space group of Rbar {3}c, whereas crystal structure of LaMnO3.08±0.01 was orthorhombic whose space group was proposed to be Pmna (No. 53). With increase of oxygen content in LaMnO3+δ, molar volume decreased and higher crystal symmetry was obtained.

Cardiac morphology after conditions of microgravity during Cosmos 2044

NASA Technical Reports Server (NTRS)

Goldstein, Margaret A.; Edwards, Robert J.; Schroeter, John P.

1992-01-01

Light- and electron-microscopic studies were performed on cardiac muscle from rats flown on Cosmos 2044 and from four control groups. Average cross-sectional area of myofibers was measured by video analysis of the light-microscopic images of papillary and ventricular muscle samples from all animals. This cross-sectional area was significantly decreased in flight rats (P = 0.03) compared with synchronous controls. Additional findings at the electron microscopic level consistent with this atrophy were obtained by stereological analysis and optical diffraction analysis of papillary muscle samples. Slightly higher mitochondrial volume density values and mitochondria-to-myofibril ratios as well as normal A-band spacings (d1,0) and Z-band spacings of myofibrils were observed in the tail-suspension and flight groups. General morphological features similar to those in ventricular samples from the previous Cosmos 1887 flight were observed.

Diffractive optics for quasi-direct space-to-time pulse shaping.

PubMed

Mínguez-Vega, Gladys; Mendoza-Yero, Omel; Lancis, Jesús; Gisbert, Rafael; Andrés, Pedro

2008-10-13

The strong chromatic behavior associated with a conventional diffractive lens is fully exploited to propose a novel optical device for pulse shaping in the femtosecond regime. This device consists of two optical elements: a spatially patterned circularly symmetric mask and a kinoform diffractive lens, which are facing each other. The system performs a mapping between the spatial position of the masking function expressed in the squared radial coordinate and the temporal position in the output waveform. This space-to-time conversion occurs at the chromatic focus of the diffractive lens, and makes it possible to tailor the output central wavelength along the axial location of the output point. Inspection of the validity of our device is performed by means of computer simulations involving the generation of femtosecond optical packets.

Evanescent Properties of Optical Diffraction from 2-Dimensional Hexagonal Photonic Crystals and Their Sensor Applications.

PubMed

Liao, Yu-Yang; Chen, Yung-Tsan; Chen, Chien-Chun; Huang, Jian-Jang

2018-04-03

The sensitivity of traditional diffraction grating sensors is limited by the spatial resolution of the measurement setup. Thus, a large space is required to improve sensor performance. Here, we demonstrate a compact hexagonal photonic crystal (PhC) optical sensor with high sensitivity. PhCs are able to diffract optical beams to various angles in azimuthal space. The critical wavelength that satisfies the phase matching or becomes evanescent was used to benchmark the refractive index of a target analyte applied on a PhC sensor. Using a glucose solution as an example, our sensor demonstrated very high sensitivity and a low limit of detection. This shows that the diffraction mechanism of hexagonal photonic crystals can be used for sensors when compact size is a concern.

Effective increase in beam emittance by phase-space expansion using asymmetric Bragg diffraction.

PubMed

Chu, Chia-Hung; Tang, Mau-Tsu; Chang, Shih-Lin

2015-08-24

We propose an innovative method to extend the utilization of the phase space downstream of a synchrotron light source for X-ray transmission microscopy. Based on the dynamical theory of X-ray diffraction, asymmetrically cut perfect crystals are applied to reshape the position-angle-wavelength space of the light source, by which the usable phase space of the source can be magnified by over one hundred times, thereby "phase-space-matching" the source with the objective lens of the microscope. The method's validity is confirmed using SHADOW code simulations, and aberration through an optical lens such as a Fresnel zone plate is examined via matrix optics for nano-resolution X-ray images.

Structural study of quasi-one-dimensional vanadium pyroxene LiVSi{sub 2}O{sub 6} single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishii, Yuto; Matsushita, Yoshitaka; Oda, Migaku

Single crystals of quasi-one-dimensional vanadium pyroxene LiVSi{sub 2}O{sub 6} were synthesized and the crystal structures at 293 K and 113 K were studied using X-ray diffraction experiments. We found a structural phase transition from the room-temperature crystal structure with space group C2/c to a low-temperature structure with space group P2{sub 1}/c, resulting from a rotational displacement of SiO{sub 4} tetrahedra. The temperature dependence of magnetic susceptibility shows a broad maximum around 116 K, suggesting an opening of the Haldane gap expected for one-dimensional antiferromagnets with S=1. However, an antiferromagnetic long-range order was developed below 24 K, probably caused by amore » weak inter-chain magnetic coupling in the compound. - Graphical abstract: Low temperature crystal structure of LiVSi{sub 2}O{sub 6} and an orbital arrangement within the V-O zig-zag chain along the c-axis. - Highlights: • A low temperature structure of LiVSi{sub 2}O{sub 6} was determined by single crystal X-ray diffraction measurements. • The origin of the structural transition is a rotational displacement of SiO{sub 4} tetrahedra. • The uniform orbital overlap in the V-O zigzag chain makes the system a quasi one-dimensional antiferromagnet.« less

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

The purification, crystallization and preliminary structural characterization of FAD-dependent monooxygenase PhzS, a phenazine-modifying enzyme from Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gohain, Neelakshi; Thomashow, Linda S.; USDA Agricultural Research Service, Root Disease and Biological Control Research Unit, Pullman, Washington 99164-6430

2006-10-01

PhzS, an FAD-dependent monooxygenase that catalyzes a reaction involved in the biosynthesis of the virulence factor pyocyanin in P. aeruginosa, was cloned, overexpressed and crystallized. Data collection from native and seleno-l-methionine-labelled crystals is reported. The blue chloroform-soluble bacterial metabolite pyocyanin (1-hydroxy-5-methyl-phenazine) contributes to the survival and virulence of Pseudomonas aeruginosa, an important Gram-negative opportunistic pathogen of humans and animals. Little is known about the two enzymes, designated PhzM and PhzS, that function in the synthesis of pyocyanin from phenazine-1-carboxylic acid. In this study, the FAD-dependent monooxygenase PhzS was purified and crystallized from lithium sulfate/ammonium sulfate/sodium citrate pH 5.5. Native crystalsmore » belong to space group C2, with unit-cell parameters a = 144.2, b = 96.2, c = 71.7 Å, α = γ = 90, β = 110.5°. They contain two monomers of PhzS in the asymmetric unit and diffract to a resolution of 2.4 Å. Seleno-l-methionine-labelled PhzS also crystallizes in space group C2, but the unit-cell parameters change to a = 70.6, b = 76.2, c = 80.2 Å, α = γ = 90, β = 110.5° and the diffraction limit is 2.7 Å.« less

Eyeglass Large Aperture, Lightweight Space Optics FY2000 - FY2002 LDRD Strategic Initiative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hyde, R

2003-02-10

A series of studies by the Air Force, the National Reconnaissance Office and NASA have identified the critical role played by large optics in fulfilling many of the space related missions of these agencies. Whether it is the Next Generation Space Telescope for NASA, high resolution imaging systems for NRO, or beam weaponry for the Air Force, the diameter of the primary optic is central to achieving high resolution (imaging) or a small spot size on target (lethality). While the detailed requirements differ for each application (high resolution imaging over the visible and near-infrared for earth observation, high damage thresholdmore » but single-wavelength operation for directed energy), the challenges of a large, lightweight primary optic which is space compatible and operates with high efficiency are the same. The advantage of such large optics to national surveillance applications is that it permits these observations to be carried-out with much greater effectiveness than with smaller optics. For laser weapons, the advantage is that it permits more tightly focused beams which can be leveraged into either greater effective range, reduced laser power, and/or smaller on-target spot-sizes; weapon systems can be made either much more effective or much less expensive. This application requires only single-wavelength capability, but places an emphasis upon robust, rapidly targetable optics. The advantages of large aperture optics to astronomy are that it increases the sensitivity and resolution with which we can view the universe. This can be utilized either for general purpose astronomy, allowing us to examine greater numbers of objects in more detail and at greater range, or it can enable the direct detection and detailed examination of extra-solar planets. This application requires large apertures (for both light-gathering and resolution reasons), with broad-band spectral capability, but does not emphasize either large fields-of-view or pointing agility. Despite differences in their requirements and implementations, the fundamental difficulty in utilizing large aperture optics is the same for all of these applications: It is extremely difficult to design large aperture space optics which are both optically precise and can meet the practical requirements for launch and deployment in space. At LLNL we have developed a new concept (Eyeglass) which uses large diffractive optics to solve both of these difficulties; greatly reducing both the mass and the tolerance requirements for large aperture optics. During previous LDRD-supported research, we developed this concept, built and tested broadband diffractive telescopes, and built 50 cm aperture diffraction-limited diffractive lenses (the largest in the world). This work is fully described in UCRL-ID-136262, Eyeglass: A Large Aperture Space Telescope. However, there is a large gap between optical proof-of-principle with sub-meter apertures, and actual 50 meter space telescopes. This gap is far too large (both in financial resources and in spacecraft expertise) to be filled internally at LLNL; implementation of large aperture diffractive space telescopes must be done externally using non-LLNL resources and expertise. While LLNL will never become the primary contractor and integrator for large space optical systems, our natural role is to enable these devices by developing the capability of producing very large diffractive optics. Accordingly, the purpose of the Large Aperture, Lightweight Space Optics Strategic Initiative was to develop the technology to fabricate large, lightweight diffractive lenses. The additional purpose of this Strategic Initiative was, of course, to demonstrate this lens-fabrication capability in a fashion compellingly enough to attract the external support necessary to continue along the path to full-scale space-based telescopes. During this 3 year effort (FY2000-FY2002) we have developed the capability of optically smoothing and diffractively-patterning thin meter-sized sheets of glass into lens panels. We have also developed alignment and seaming techniques which allow individual lens panels to be assembled together, forming a much larger, segmented, diffractive lens. The capabilities provided by this LDRD-supported developmental effort were then demonstrated by the fabrication and testing of a lightweight, 5 meter aperture, diffractive lens.« less

A Chemical Approach to Understanding Oxide Surface Structure and Reactivity

NASA Astrophysics Data System (ADS)

Enterkin, James Andrew

Transmission electron microscopy and diffraction are powerful tools for solving complex structural problems. They complement other analytical techniques, such as x-ray diffraction, elucidating problems which cannot be solved by other techniques. One area where they are of particularly great value is in the determination of surface structures. The research presented herein uses electron microscopy and diffraction as the primary experimental techniques in the development of a chemistry of surface structures. High-resolution electron microscopy revealed that the La4Cu 3MoO12 structure has turbostratic disorder and a lower symmetry space group (Pm) than was previously found. The refinement of the x-ray data was significantly improved by using a disordered model and the Pm space group. A bond valence analysis confirmed that the disordered structure is the superior model. Strontium titanate, SrTiO3, single crystal surfaces were examined principally via transmission electron diffraction. A homologous series with intergrowths was discovered on the (110) surface of strontium titanate, marking the first time that these important concepts of solid state chemistry have been found at the surface. Atmospheric adsorbates, such as H2O and CO2, were found to help to stabilize undercoordinated surface structures on the (100) surface. It was shown that chemical bonding, bond valence, atomic coordination, and stoichiometry greatly influence the development of surface structures. Additionally, such chemistry based analysis was demonstrated to be able to predict surface structure stability and reactivity. Application of a modified Wulff construction to the observed shape of strontium titanate nanocuboids revealed that the surface structure and particle stoichiometry are interlinked, with control over one allowing equally precise control over the other. Platinum nanoparticles on the strontium titanate nanocuboids were shown via high resolution electron microscopy to have cube-on-cube epitaxy, with the shape of the platinum nanoparticles governed by the Winterbottom construction. Precise modification of the support surface will therefore allow engineering of supported metal particles with precise control over which facets are exposed. These results suggest that control over the support surface chemistry can be used to engineer thermodynamically stable, face selective catalysts.

Electric and magnetic polarization singularities of first-order Laguerre-Gaussian beams diffracted at a half-plane screen.

PubMed

Luo, Yamei; Gao, Zenghui; Tang, Bihua; Lü, Baida

2013-08-01

Based on the vector Fresnel diffraction integrals, analytical expressions for the electric and magnetic components of first-order Laguerre-Gaussian beams diffracted at a half-plane screen are derived and used to study the electric and magnetic polarization singularities in the diffraction field for both two- and three-dimensional (2D and 3D) cases. It is shown that there exist 2D and 3D electric and magnetic polarization singularities in the diffraction field, which do not coincide each other in general. By suitably varying the waist width ratio, off-axis displacement parameter, amplitude ratio, or propagation distance, the motion, pair-creation, and annihilation of circular polarization singularities, and the motion of linear polarization singularities take place in 2D and 3D electric and magnetic fields. The V point, at which two circular polarization singularities with the same topological charge but opposite handedness collide, appears in the 2D electric field under certain conditions in the diffraction field and free-space propagation. A comparison with the free-space propagation is also made.

Skin subspace color modeling for daytime and nighttime group activity recognition in confined operational spaces

NASA Astrophysics Data System (ADS)

Shirkhodaie, Amir; Poshtyar, Azin; Chan, Alex; Hu, Shuowen

2016-05-01

In many military and homeland security persistent surveillance applications, accurate detection of different skin colors in varying observability and illumination conditions is a valuable capability for video analytics. One of those applications is In-Vehicle Group Activity (IVGA) recognition, in which significant changes in observability and illumination may occur during the course of a specific human group activity of interest. Most of the existing skin color detection algorithms, however, are unable to perform satisfactorily in confined operational spaces with partial observability and occultation, as well as under diverse and changing levels of illumination intensity, reflection, and diffraction. In this paper, we investigate the salient features of ten popular color spaces for skin subspace color modeling. More specifically, we examine the advantages and disadvantages of each of these color spaces, as well as the stability and suitability of their features in differentiating skin colors under various illumination conditions. The salient features of different color subspaces are methodically discussed and graphically presented. Furthermore, we present robust and adaptive algorithms for skin color detection based on this analysis. Through examples, we demonstrate the efficiency and effectiveness of these new color skin detection algorithms and discuss their applicability for skin detection in IVGA recognition applications.

Structural and thermodynamic study of dicesium molybdate Cs2Mo2O7: Implications for fast neutron reactors

NASA Astrophysics Data System (ADS)

Smith, A. L.; Kauric, G.; van Eijck, L.; Goubitz, K.; Wallez, G.; Griveau, J.-C.; Colineau, E.; Clavier, N.; Konings, R. J. M.

2017-09-01

The structure of α-Cs2Mo2O7 (monoclinic in space group P21 / c), which can form during irradiation in fast breeder reactors in the space between nuclear fuel and cladding, has been refined in this work at room temperature from neutron diffraction data. Furthermore, the compounds' thermal expansion and polymorphism have been investigated using high temperature X-ray diffraction combined with high temperature Raman spectroscopy. A phase transition has been observed at Ttr(α → β)=(621.9±0.8) K using Differential Scanning Calorimetry, and the structure of the β-Cs2Mo2O7 phase, orthorhombic in space group Pbcm, has been solved ab initio from the high temperature X-ray diffraction data. Furthermore, the low temperature heat capacity of α-Cs2Mo2O7 has been measured in the temperature range T=(1.9-313.2) K using a Quantum Design PPMS (Physical Property Measurement System) calorimeter. The heat capacity and entropy values at T=298.15 K have been derived as Cp,mo (Cs2Mo2O7 , cr , 298.15 K) = (211.9 ± 2.1) J K-1mol-1 and Smo (Cs2Mo2O7 , cr , 298.15 K) = (317.4 ± 4.3) J K-1mol-1 . When combined with the enthalpy of formation reported in the literature, these data yield standard entropy and Gibbs energy of formation as Δf Smo (Cs2Mo2O7 , cr , 298.15 K) = - (628.2 ± 4.4) J K-1mol-1 and Δf Gmo (Cs2Mo2O7 , cr , 298.15 K) = - (2115.1 ± 2.5) kJmol-1 . Finally, the cesium partial pressure expected in the gap between fuel and cladding following the disproportionation reaction 2Cs2MoO4=Cs2Mo2O7+2Cs(g)+ 1/2 O2(g) has been calculated from the newly determined thermodynamic functions.

The statistical kinematical theory of X-ray diffraction as applied to reciprocal-space mapping

PubMed

Nesterets; Punegov

2000-11-01

The statistical kinematical X-ray diffraction theory is developed to describe reciprocal-space maps (RSMs) from deformed crystals with defects of the structure. The general solutions for coherent and diffuse components of the scattered intensity in reciprocal space are derived. As an example, the explicit expressions for intensity distributions in the case of spherical defects and of a mosaic crystal were obtained. The theory takes into account the instrumental function of the triple-crystal diffractometer and can therefore be used for experimental data analysis.

Instrument and method for focusing x rays, gamma rays, and neutrons

DOEpatents

Smither, R.K.

1981-04-20

A crystal diffraction instrument is described which has an improved crystalline structure having a face for receiving a beam of photons or neutrons and diffraction planar spacing along that face with the spacing increasing progressively along the face to provide a decreasing Bragg angle and thereby increasing the usable area and acceptance angle. The increased planar spacing is provided by the use of a temperature differential across the crystalline structure, by assembling a plurality of crystalline structure with different compositions, by an individual crystalline structure with a varying composition and thereby a changing planar spacing along its face, and by combinations of these techniques.

Magnetic behaviour of synthetic Co(2)SiO(4).

PubMed

Sazonov, Andrew; Meven, Martin; Hutanu, Vladimir; Heger, Gernot; Hansen, Thomas; Gukasov, Arsen

2009-12-01

Synthetic Co(2)SiO(4) crystallizes in the olivine structure (space group Pnma) with two crystallographically non-equivalent Co positions and shows antiferromagnetic ordering below 50 K. We have investigated the temperature variation of the Co(2)SiO(4) magnetic structure by means of non-polarized and polarized neutron diffraction for single crystals. Measurements with non-polarized neutrons were made at 2.5 K (below T(N)), whereas polarized neutron diffraction experiments were carried out at 70 and 150 K (above T(N)) in an external magnetic field of 7 T parallel to the b axis. Additional accurate non-polarized powder diffraction studies were performed in a broad temperature range from 5 to 500 K with small temperature increments. Detailed symmetry analysis of the Co(2)SiO(4) magnetic structure shows that it corresponds to the magnetic (Shubnikov) group Pnma, which allows the antiferromagnetic configuration (G(x), C(y), A(z)) for the 4a site with inversion symmetry 1 (Co1 position) and (0,C(y),0) for the 4c site with mirror symmetry m (Co2 position). The temperature dependence of the Co1 and Co2 magnetic moments obtained from neutron diffraction experiments was fitted in a modified molecular-field model. The polarized neutron study of the magnetization induced by an applied field shows a non-negligible amount of magnetic moment on the oxygen positions, indicating a delocalization of the magnetic moment from Co towards neighbouring O owing to superexchange coupling. The relative strength of the exchange interactions is discussed based on the non-polarized and polarized neutron data.

Effect of multiple circular holes Fraunhofer diffraction for the infrared optical imaging

NASA Astrophysics Data System (ADS)

Lu, Chunlian; Lv, He; Cao, Yang; Cai, Zhisong; Tan, Xiaojun

2014-11-01

With the development of infrared optics, infrared optical imaging systems play an increasingly important role in modern optical imaging systems. Infrared optical imaging is used in industry, agriculture, medical, military and transportation. But in terms of infrared optical imaging systems which are exposed for a long time, some contaminations will affect the infrared optical imaging. When the contamination contaminate on the lens surface of the optical system, it would affect diffraction. The lens can be seen as complementary multiple circular holes screen happen Fraunhofer diffraction. According to Babinet principle, you can get the diffraction of the imaging system. Therefore, by studying the multiple circular holes Fraunhofer diffraction, conclusions can be drawn about the effect of infrared imaging. This paper mainly studies the effect of multiple circular holes Fraunhofer diffraction for the optical imaging. Firstly, we introduce the theory of Fraunhofer diffraction and Point Spread Function. Point Spread Function is a basic tool to evaluate the image quality of the optical system. Fraunhofer diffraction will affect Point Spread Function. Then, the results of multiple circular holes Fraunhofer diffraction are given for different hole size and hole spacing. We choose the hole size from 0.1mm to 1mm and hole spacing from 0.3mm to 0.8mm. The infrared wavebands of optical imaging are chosen from 1μm to 5μm. We use the MATLAB to simulate light intensity distribution of multiple circular holes Fraunhofer diffraction. Finally, three-dimensional diffraction maps of light intensity are given to contrast.

Facial and meridional isomers of holmium-nitrate N-tert-butylacetamide complexes

NASA Astrophysics Data System (ADS)

Chang, Ye-Di; Xue, Jun-Hui; Kang, Xiao-Yan; Yang, Li-Min; Li, Wei-Hong; Xu, Yi-Zhuang; Zhao, Guo-Zhong; Zhang, Gao-Hui; Liu, Ke-Xin; Chen, Jia-Er; Wu, Jin-Guang

2018-06-01

Two Ho(C6H13NO)3(NO3)3 complexes formed by holmium nitrate and N-tert-butylacetamide (NtBA) (Ho-NtBA(I) in a Cc space group, and Ho-NtBA(II) in a P21/c space group) are reported here to investigate the coordination of lanthanide ions with amide groups. Using X-ray single crystal diffraction, FTIR, Raman, FIR and THz methods the structures of the two complexes were identified, in which Ho3+ is 9-coordinated to three carbonyl oxygen atoms provided by three NtBA ligands and three bidentate nitrate ions to form the "facial" and "meridional" isomers. Their FTIR and Raman spectra indicate the formation of two holmium complexes, the variations of NtBA after holmium coordination and the spectra are similar for the isomers in some extent. Their FIR and THz spectroscopic results show the coordination of holmium ions and THz maybe more sensitive to isomers. The results demonstrate the coordination behaviors of holmium ions and NtBA ligand.

Characterization of ternary bivalent metal complexes with bis(2-hydroxyethyl)iminotris(hydroxymethy)methane (Bis?Tris) and the comparison of five crystal structures of Bis?Tris complexes*1

NASA Astrophysics Data System (ADS)

Inomata, Yoshie; Gochou, Yoshihiro; Nogami, Masanobu; Howell, F. Scott; Takeuchi, Toshio

2004-09-01

Eleven bivalent metal complexes with bis(2-hydroxyethyl)iminotris(hydroxymethy)methane (Bis-Tris:hihm): [M(hihm)(H 2O)]SO 4· nH 2O (M: Co, Ni, Cu, Zn), [MCl(hihm)]Cl· nH 2O (M: Co, Ni, Cu), and [M(HCOO)(hihm)](HCOO) (M: Co, Ni, Cu, Zn) have been prepared and characterized by using their infrared absorption and powder diffuse reflection spectra, magnetic susceptibility, thermal analysis and powder X-ray diffraction analysis. The crystal structures of [Ni(hihm)(H 2O)]SO 4·H 2O ( 2), [Cu(hihm)(H 2O)]SO 4 ( 3), [NiCl(hihm)]Cl·H 2O ( 6), [CuCl(hihm)]Cl ( 7) and [Co(HCOO)(hihm)](HCOO) ( 8) have been determined by single crystal X-ray diffraction analysis. The crystals of [Ni(hihm)(H 2O)]SO 4·H 2O ( 2) and [Cu(hihm)(H 2O)]SO 4 ( 3) are each orthorhombic with the space group P2 12 12 1 and Pna2 1. For both complexes, the metal atom is in a distorted octahedral geometry, ligated by four hydroxyl oxygen atoms, a nitrogen atom and a water molecule. [NiCl(hihm)]Cl·H 2O ( 6) is monoclinic with the space group P2 1/ n. For complex ( 6), the nickel atom is in a distorted octahedral geometry, ligated by four hydroxyl oxygen atoms, a nitrogen atom and a chloride ion. [CuCl(hihm)]Cl ( 7) is orthorhombic with the space group P2 12 12 1. Although in this copper(II) complex the copper atom is ligated by six atoms, it is more reasonable to think that the copper atom is in a trigonal bipyramidal geometry coordinated with five atoms: three hydroxyl oxygen atoms, a nitrogen atom and a chloride ion if the bond distances and angles surrounding the copper atom are taken into consideration. [Co(HCOO)(hihm)](HCOO) ( 8) is monoclinic with the space group P2 1. In cobalt(II) complex ( 8), the cobalt atom is in a distorted octahedral geometry, ligated by four hydroxyl oxygen atoms, a nitrogen atom and an oxygen atom of a formate ion. The structure of complex ( 8) is the same as the structure of [NiCl(hihm)]Cl·H 2O ( 6) except for the formate ion coordinating instead of the chloride ion. [M(hihm)(H 2O)]SO 4·H 2O (M: Co, Zn) ( 1, 4), [CoCl(hihm)]Cl·H 2O ( 5) and [M(HCOO)(hihm)](HCOO) (M: Ni, Cu, Zn) ( 9- 11) seem to have the same structures as the structures of [Ni(hihm)(H 2O)]SO 4·H 2O ( 2), [NiCl(hihm)]Cl·H 2O ( 6) and [Co(HCOO)(hihm)](HCOO) ( 8), respectively, judging by the results of IR and powder diffuse reflection spectra and powder X-ray diffraction analysis. Bis-Tris has coordinated to the metal atoms as a pentadentate ligand in all complexes of which the structures have been determined by single crystal X-ray diffraction analysis in this work.

Towards anti-causal Green's function for three-dimensional sub-diffraction focusing

NASA Astrophysics Data System (ADS)

Ma, Guancong; Fan, Xiying; Ma, Fuyin; de Rosny, Julien; Sheng, Ping; Fink, Mathias

2018-06-01

In causal physics, the causal Green's function describes the radiation of a point source. Its counterpart, the anti-causal Green's function, depicts a spherically converging wave. However, in free space, any converging wave must be followed by a diverging one. Their interference gives rise to the diffraction limit that constrains the smallest possible dimension of a wave's focal spot in free space, which is half the wavelength. Here, we show with three-dimensional acoustic experiments that we can realize a stand-alone anti-causal Green's function in a large portion of space up to a subwavelength distance from the focus point by introducing a near-perfect absorber for spherical waves at the focus. We build this subwavelength absorber based on membrane-type acoustic metamaterial, and experimentally demonstrate focusing of spherical waves beyond the diffraction limit.

Experimental analysis of bidirectional reflectance distribution function cross section conversion term in direction cosine space.

PubMed

Butler, Samuel D; Nauyoks, Stephen E; Marciniak, Michael A

2015-06-01

Of the many classes of bidirectional reflectance distribution function (BRDF) models, two popular classes of models are the microfacet model and the linear systems diffraction model. The microfacet model has the benefit of speed and simplicity, as it uses geometric optics approximations, while linear systems theory uses a diffraction approach to compute the BRDF, at the expense of greater computational complexity. In this Letter, nongrazing BRDF measurements of rough and polished surface-reflecting materials at multiple incident angles are scaled by the microfacet cross section conversion term, but in the linear systems direction cosine space, resulting in great alignment of BRDF data at various incident angles in this space. This results in a predictive BRDF model for surface-reflecting materials at nongrazing angles, while avoiding some of the computational complexities in the linear systems diffraction model.

Overcoming turbulence-induced space-variant blur by using phase-diverse speckle.

PubMed

Thelen, Brian J; Paxman, Richard G; Carrara, David A; Seldin, John H

2009-01-01

Space-variant blur occurs when imaging through volume turbulence over sufficiently large fields of view. Space-variant effects are particularly severe in horizontal-path imaging, slant-path (air-to-ground or ground-to-air) geometries, and ground-based imaging of low-elevation satellites or astronomical objects. In these geometries, the isoplanatic angle can be comparable to or even smaller than the diffraction-limited resolution angle. We report on a postdetection correction method that seeks to correct for the effects of space-variant aberrations, with the goal of reconstructing near-diffraction-limited imagery. Our approach has been to generalize the method of phase-diverse speckle (PDS) by using a physically motivated distributed-phase-screen model. Simulation results are presented that demonstrate the reconstruction of near-diffraction-limited imagery under both matched and mismatched model assumptions. In addition, we present evidence that PDS could be used as a beaconless wavefront sensor in a multiconjugate adaptive optics system when imaging extended scenes.

Diffractive optical elements for transformation of modes in lasers

DOEpatents

Sridharan, Arun K.; Pax, Paul H.; Heebner, John E.; Drachenberg, Derrek R.; Armstrong, James P.; Dawson, Jay W.

2015-09-01

Spatial mode conversion modules are described, with the capability of efficiently transforming a given optical beam profile, at one plane in space into another well-defined optical beam profile at a different plane in space, whose detailed spatial features and symmetry properties can, in general, differ significantly. The modules are comprised of passive, high-efficiency, low-loss diffractive optical elements, combined with Fourier transform optics. Design rules are described that employ phase retrieval techniques and associated algorithms to determine the necessary profiles of the diffractive optical components. System augmentations are described that utilize real-time adaptive optical techniques for enhanced performance as well as power scaling.

Diffractive optical elements for transformation of modes in lasers

DOEpatents

Sridharan, Arun K; Pax, Paul H; Heebner, John E; Drachenberg, Derrek R.; Armstrong, James P.; Dawson, Jay W.

2016-06-21

Spatial mode conversion modules are described, with the capability of efficiently transforming a given optical beam profile, at one plane in space into another well-defined optical beam profile at a different plane in space, whose detailed spatial features and symmetry properties can, in general, differ significantly. The modules are comprised of passive, high-efficiency, low-loss diffractive optical elements, combined with Fourier transform optics. Design rules are described that employ phase retrieval techniques and associated algorithms to determine the necessary profiles of the diffractive optical components. System augmentations are described that utilize real-time adaptive optical techniques for enhanced performance as well as power scaling.

Crystal structure of carnidazole form II from synchrotron X-ray powder diffraction: structural comparison with form I, the hydrated form and the low energy conformations in vacuo.

PubMed

de Armas, Héctor Novoa; Peeters, Oswald M; Blaton, Norbert; Van den Mooter, Guy; De Ridder, Dirk J A; Schenk, Henk

2006-10-01

The crystal structure of carnidazole form II, O-methyl [2-(2-methyl-5-nitro-1H-imidazole-1-yl)ethyl]thiocarbamate, has been determined using synchrotron X-ray powder diffraction in combination with simulated annealing and whole profile pattern matching, and refined by the Rietveld method. For structure solution, 12 degrees of freedom were defined: one motion group and six torsions. Form II crystallizes in space group P2(1)/n, Z=4, with unit cell parameters after Rietveld refinement: a=13.915(4), b=8.095(2), c=10.649(3) A, beta=110.83(1) degrees, and V=1121.1(5) A3. The two polymorphic forms, as well as the hydrate, crystallize in the monoclinic space group P2(1)/n having four molecules in the cell. In form II, the molecules are held together by forming two infinite zig-zag chains via hydrogen bonds of the type N--H...N, the same pattern as in form I. A conformational study of carnidazole, at semiempirical PM3 level, was performed using stochastic approaches based on modification of the flexible torsion angles. The values of the torsion angles for the molecules of the two polymorphic forms and the hydrate of carnidazole are compared to those obtained from the conformational search. Form I and form II are enantiotropic polymorphic pairs this agrees with the fact that the two forms are conformational polymorphs. Copyright (c) 2006 Wiley-Liss, Inc. and the American Pharmacists Association

Structural, dielectric and impedance studies of polycrystalline La0.6Dy0.2Ca0.2MnO3

NASA Astrophysics Data System (ADS)

Nandan, K. R.; Kumar, A. Ruban

2017-05-01

Polycrystalline materials of Dy doped La1-xCaxMnO3 were prepared by Sol-Gel technique using citric acid as a chelating agent at 900°C. The compound was analyzed by powder X-ray diffraction technique and confirmed to be single phased orthorhombic perovskite structure with space group Pnma. From the dielectric and impedance studies confirmed the existence of dielectric relaxation and presence of space charge were observed from the dielectric constant and impedance plots respectively and confirms the existence of relaxation due to oxygen vacancy. Cole-cole plot confirms the presence of dielectric relaxation and grain contribution in the synthesized sample.

Crystallization of the Fab from a human monoclonal antibody against gp 41 of human immunodeficiency virus type I

NASA Technical Reports Server (NTRS)

Casale, Elena; He, Xiao-Min; Snyder, Robert S.; Carter, Daniel C.; Wenisch, Elisabeth; Jungbauer, Alois; Tauer, Christa; Ruker, Florian; Righetti, Pier Giorgio

1990-01-01

A monoclonal IgG antibody directed against gp 41 from the human immunodeficiency virus (HIV-1) has been crystallized in both intact and Fab forms. Crystals of the intact antibody grow as tetragonal-like prisms too small for conventional X-ray analysis. However, the Fab portion of the antibody produces suitable platelike crystals which belong to the space group P2(1)2(1)2(1) with unit cell constants of a = 66.5 A, b = 74.3 A, and c = 105.3 A. There is one molecule of Fab in the asymmetric unit. The Fab crystals show diffraction to d-spacings less than 3.0 A.

White-light diffraction phase microscopy at doubled space-bandwidth product.

PubMed

Shan, Mingguang; Kandel, Mikhail E; Majeed, Hassaan; Nastasa, Viorel; Popescu, Gabriel

2016-12-12

White light diffraction microscopy (wDPM) is a quantitative phase imaging method that benefits from both temporal and spatial phase sensitivity, granted, respectively, by the common-path geometry and white light illumination. However, like all off-axis quantitative phase imaging methods, wDPM is characterized by a reduced space-bandwidth product compared to phase shifting approaches. This happens essentially because the ultimate resolution of the image is governed by the period of the interferogram and not just the diffraction limit. As a result, off-axis techniques generates single-shot, i.e., high time-bandwidth, phase measurements, at the expense of either spatial resolution or field of view. Here, we show that combining phase-shifting and off-axis, the original space-bandwidth is preserved. Specifically, we developed phase-shifting diffraction phase microscopy with white light, in which we measure and combine two phase shifted interferograms. Due to the white light illumination, the phase images are characterized by low spatial noise, i.e., <1nm pathlength. We illustrate the operation of the instrument with test samples, blood cells, and unlabeled prostate tissue biopsy.

ELECTRON MICROSCOPE AND X-RAY DIFFRACTION STUDIES ON A HOMOLOGOUS SERIES OF SATURATED PHOSPHATIDYLCHOLINES.

PubMed

ELBERS, P F; VERVERGAERT, P H

1965-05-01

Three homologous saturated phosphatidylcholines were studied by electron microscopy after tricomplex fixation. The results are compared with those obtained by x-ray diffraction analysis of the same and some other homologous compounds, in the dry crystalline state and after tricomplex fixation. By electron microscopy alternating dark and light bands are observed which are likely to correspond to phosphatide double layers. X-Ray diffraction reveals the presence of lamellar structures of regular spacing. The layer spacings obtained by both methods are in good agreement. From the electron micrographs the width of the polar parts of the double layers can be derived directly. The width of the carboxylglycerylphosphorylcholine moiety of the layers is found by extrapolating the x-ray diffraction data to zero chain length of the fatty acids. When from this width the contribution of the carboxylglyceryl part of the molecules is subtracted, again we find good agreement with the electron microscope measurements. An attempt has been made to account for the different layer spacings measured in terms of orientation of the molecules within the double layers.

Comparative Analysis of Thaumatin Crystals Grown on Earth and in Microgravity. Experiment 23

NASA Technical Reports Server (NTRS)

Ng, Joseph D.; Lorber, Bernard; Giege, Richard; Koszelak, Stanley; Day, John; Greenwood, Aaron; McPherson, Alexander

1998-01-01

The protein thaumatin was studied as a model macromolecule for crystallization in microgravity environment experiments conducted on two U.S. Space Shuttle missions (second United States Microgravity Laboratory (USML-2) and Life and Microgravity Spacelab (LMS)). In this investigation we evaluated and compared the quality of space- and Earth-grown thaumatin crystals using x-ray diffraction analysis and characterized them according to crystal size, diffraction resolution limit, and mosaicity. Two different approaches for growing thaumatin crystals in the microgravity environment, dialysis and liquid-liquid diffusion, were employed as a joint experiment by our two investigative teams. Thaumatin crystals grown under a microgravity environment were generally larger in volume with fewer total crystals. They diffracted to significantly higher resolution and with improved diffraction properties as judged by relative Wilson plots. The mosaicity for space-grown crystals was significantly less than for those grown on Earth. Increasing concentrations of protein in the crystallization chambers under microgravity lead to larger crystals. The data presented here lend further support to the idea that protein crystals of improved quality can be obtained in a microgravity environment.

Crystal structure of rivastigmine hydrogen tartrate Form I (Exelon®), C 14H 23N 2O 2(C 4H 5O 6)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaduk, James A.; Zhong, Kai; Gindhart, Amy M.

2016-03-08

The crystal structure of rivastigmine hydrogen tartrate has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Rivastigmine hydrogen tartrate crystallizes in space groupP2 1(#4) witha= 17.538 34(5),b= 8.326 89(2),c= 7.261 11(2) Å,β= 98.7999(2)°,V= 1047.929(4) Å 3, andZ= 2. The un-ionized end of the hydrogen tartrate anions forms a very strong hydrogen bond with the ionized end of another anion to form a chain. The ammonium group of the rivastigmine cation forms a strong discrete hydrogen bond with the carbonyl oxygen atom of the un-ionized end of the tartrate anion. These hydrogen bondsmore » form a corrugated network in thebc-plane. Both hydroxyl groups of the tartrate anion form intramolecular O–H···O hydrogen bonds. Several C–H···O hydrogen bonds appear to contribute to the crystal energy. The powder pattern is included in the Powder Diffraction File ™as entry 00-064-1501.« less

Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernández, Israel S.; Ständker, Ludger; Hannover Medical School, Center of Pharmacology, 30625 Hannover

2007-08-01

The cloning, expression, purification and crystallization of recombinant human kallikrein 7, directly synthesized in the active form in E. coli, is described. Diffraction data were collected to 2.8 Å resolution from native crystals. Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer.more » In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way.« less

X-ray powder diffraction, spectroscopic study, dielectric properties and thermal analysis of new doped compound TiGa0.67Te2.33O8

NASA Astrophysics Data System (ADS)

Smaoui, S.; Ben Aribia, W.; Kabadou, A.; Abdelmouleh, M.

2017-04-01

A novel mixed valence tellurium oxide, TiGa0.67Te2.33O8, was synthesized and its crystal structure determined using the X-ray powder diffraction technique. The obtained oxide was found to crystallize in a cubic unit-cell, Ia 3 bar space group, with the lattice parameter a = 10.9557(1) Å. Rietveld refinement of the structure led to ultimate confidence factors Rp = 7.63 and Rwp = 6.71. This structure was based on slabs containing groups of (Te/Ga)O4 joined by the metal cations Ti4+. The structure analysis showed a cation ordering of Te4+ and Te6+ yielding a TiGa2/3Te7/3O8 formula. The IR and RAMAN spectra confirmed the presence of the TiO6 and (Te/Ga)O4 groups. The dielectric anomalies observed at 500 K were attributed to the mixed valence structure, arising from the mixed-valence Te6+/Te4+. We detected only one peak in thermal behavior by the DTA/TG analysis; which implied a melting reaction.

NOTE: Calculating diffraction patterns

NASA Astrophysics Data System (ADS)

Rioux, Frank

2003-05-01

Following Marcella's approach to the double-slit experiment (Marcella T V 2002 Eur. J. Phys. 23 615-21), diffraction patterns for two-dimensional masks are calculated by Fourier transform of the Mask geometry into momentum space.

Polar phase transitions in heteroepitaxial stabilized La0.5Y0.5AlO3 thin films

NASA Astrophysics Data System (ADS)

Liu, Shenghua; Zhang, Chunfeng; Zhu, Mengya; He, Qian; Chakhalian, Jak; Liu, Xiaoran; Borisevich, Albina; Wang, Xiaoyong; Xiao, Min

2017-10-01

We report on the fabrication of epitaxial La0.5Y0.5AlO3 ultrathin films on (001) LaAlO3 substrates. Structural characterizations by scanning transmission electron microscopy and x-ray diffraction confirm the high quality of the film with a - b + c - AlO6 octahedral tilt pattern. Unlike either of the nonpolar parent compound, LaAlO3 and YAlO3, second harmonic generation measurements on the thin films suggest a nonpolar-polar phase transition at T c near 500 K, and a polar-polar phase transition at T a near 160 K. By fitting the angular dependence of the second harmonic intensities, we further propose that the two polar structures can be assigned to the Pmc2 1 and Pmn2 1 space group, while the high temperature nonpolar structure belongs to the Pbnm space group.

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Superconductivity in YTE2Ge2 compounds (TE = d-electron transition metal)

NASA Astrophysics Data System (ADS)

Chajewski, G.; Samsel-Czekała, M.; Hackemer, A.; Wiśniewski, P.; Pikul, A. P.; Kaczorowski, D.

2018-05-01

Polycrystalline samples of YTE2Ge2 with TE = Co, Ni, Ru, Rh, Pd and Pt were synthesized and characterized by means of X-ray powder diffraction and low-temperature electrical resistivity and specific heat measurements, supplemented by fully relativistic full-potential local-orbital band structure calculations. We confirm that most of the compounds studied crystallize in a body-centered tetragonal ThCr2S2 -type structure (space group I 4 / mmm) and have three-dimensional Fermi surfaces, while only one of them (YPt2Ge2) forms with a primitive tetragonal CaBe2Ge2 -type unit cell (space group P 4 / nmm) and possesses quasi-two-dimensional Fermi surface sheets with some nesting. Physical properties data show conventional superconductivity in the phases with TE = Co, Pd and Pt, i.e. independently of the structure type (and hence the dimensionality of the Fermi surface).

Structural study of dehydration mechanisms of NH4Th(NO3)5·9H2O

NASA Astrophysics Data System (ADS)

Knyazev, A. V.; Komshina, M. E.; Baranov, E. V.; Savushkin, I. A.; Nipruk, O. V.; Lukoyanov, A. Yu.

2017-12-01

The new pentanitrate thorium compounds NH4Th(NO3)5·nH2O were synthesized and their crystal structures were determined by X-ray diffraction analysis: space group P21/n, a = 10.5476(5), b = 14.0444(7), c = 15.5287(8) Å, β = 109.4999(7)°, Z = 4; R = 0.0246 (NH4Th(NO3)5·9H2O); space group P212121, a = 8.7039(4), b = 11.9985(6), c = 16.3531(8) Å, Z = 4; R = 0.0259 (NH4Th(NO3)5·5H2O). Features of structural changes in the dehydration were revealed. Conditions of thermal decomposition of the thorium compound were established using differential scanning calorimetry. The compound was investigated by IR spectroscopy and its bands are assigned.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Naqvi, Kubra F.; Staker, Bart L.; Dobson, Renwick C. J.

The enzyme dihydrodipicolinate synthase catalyzes the committed step in the synthesis of diaminopimelate and lysine to facilitate peptidoglycan and protein synthesis. Dihydrodipicolinate synthase catalyzes the condensation of L-aspartate 4-semialdehyde and pyruvate to synthesize L-2,3-dihydrodipicolinate. Here, the cloning, expression, purification, crystallization and X-ray diffraction analysis of dihydrodipicolinate synthase from the pathogenic bacteriumBartonella henselae, the causative bacterium of cat-scratch disease, are presented. Protein crystals were grown in conditions consisting of 20%(w/v) PEG 4000, 100 mMsodium citrate tribasic pH 5.5 and were shown to diffract to ~2.10 Å resolution. They belonged to space groupP2 12 12 1, with unit-cell parametersa= 79.96,b= 106.33,c= 136.25more » Å. The finalRvalues wereR r.i.m.= 0.098,R work= 0.183,R free= 0.233.« less

Magnetic and magnetocaloric properties of spin-glass material DyNi 0.67Si 1.34

DOE PAGES

Chen, X.; Mudryk, Y.; Pathak, A. K.; ...

2017-04-18

Structural, magnetic, and magnetocaloric properties of DyNi 0.67Si 1.34 were investigated using X-ray powder diffraction, magnetic susceptibility, and magnetization measurements. X-ray powder diffraction pattern shows that DyNi 0.67Si 1.34 crystallizes in the AlB 2-type hexagonal structure (space group: P6/ mmm, No. 191, a = b = 3.9873(9) Å, and c = 3.9733(1) Å). The compound is a spin-glass with the freezing temperature TG = 6.2 K. The ac magnetic susceptibility measurements confirm magnetic frustration in DyNi 0.67Si 1.34. Furthermore, the maximum value of the magnetic entropy change determined from M(H) data is –16.1 J/kg K at 10.5 K for amore » field change of 70 kOe.« less

Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed

D'Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W; Marsh, May

2014-09-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems.

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed Central

D’Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W.; Marsh, May

2014-01-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems. PMID:25195878

Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

2007-09-01

A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

Hydrogen bonds directed 2D → 3D interdigitated Cd(II) compound: Synthesis, crystal structure and dual-emission luminescent properties

NASA Astrophysics Data System (ADS)

Yu, Yuanyuan

2017-06-01

A new Cd(II) compound, namely [Cd2(btc)(phen)2Cl]n·n(H2O)·n(DMA) (1, H3btc = 1, 3, 5-benzenetricarboxylic acid, phen = 1,10-phenanthroline, DMA = N,N'-dimethylacetamide) has been synthesized and structurally characterized by single-crystal X-ray diffraction analysis. This compound crystallizes in monoclinic P21/n space group with a = 13.5729(7) Å, b = 20.1049(7) Å, c = 13.9450(6) Å, β = 104.671(4)°, Z = 4. Single-crystal X-ray diffraction analysis reveals that compound 1 features a 2D → 3D interdigitated framework directed by the intermolecular hydrogen bonds. In addition, the luminescent properties of compound 1 were also investigated in the solid state at room temperature.

Determination of the absolute chirality of tellurium using resonant diffraction with circularly polarized x-rays.

PubMed

Tanaka, Y; Collins, S P; Lovesey, S W; Matsumami, M; Moriwaki, T; Shin, S

2010-03-31

Many proteins, sugars and pharmaceuticals crystallize into two forms that are mirror images of each other (enantiomers) like our right and left hands. Tellurium is one enantiomer having a space group pair, P3(1)21 (right-handed screw) and P3(2)21 (left-handed screw). X-ray diffraction with dispersion correction terms has been playing an important role in determining the handedness of enantiomers for a long time. However, this approach is not applicable for an elemental crystal such as tellurium or selenium. We have demonstrated that positive and negative circularly polarized x-rays at the resonant energy of tellurium can be used to absolutely distinguish right from left tellurium. This method is applicable to chiral motifs that occur in biomolecules, liquid crystals, ferroelectrics and antiferroelectrics, multiferroics, etc.

Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee,Y.; Kumar, S.; Jobichen, C.

2007-01-01

Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

Fluid synthesis and structure of a new polymorphic modification of boron nitride

NASA Astrophysics Data System (ADS)

Pokropivny, V. V.; Smolyar, A. S.; Ovsiannikova, L. I.; Pokropivny, A. V.; Kuts, V. A.; Lyashenko, V. I.; Nesterenko, Yu. V.

2013-04-01

A new previously unknown phase of boron nitride with a hardness of 0.41-0.63 GPa has been pre-pared by the supercritical fluid synthesis. The presence of a new phase is confirmed by the X-ray spectra and IR absorption spectra, where new reflections and bands are distinguished. The fundamental reflection of the X-ray diffraction pattern is d = 0.286-0.291 nm, and the characteristic band in the infrared absorption spectrum is observed at 704 cm-1. The X-ray diffraction pattern and the experimental and theoretical infrared absorption spectra show that a new synthesized boron nitride phase can be a cluster crystal (space group 211) with a simple cubic lattice. Cage clusters of a fullerene-like morphology B24N24 with point symmetry O are arranged in lattice sites.

Electronic interaction in an outer-sphere mixed-valence double salt: a polarized neutron diffraction study of K(3)(MnO(4))(2).

PubMed

Cannon, Roderick D; Jayasooriya, Upali A; Tilford, Claire; Anson, Christopher E; Sowrey, Frank E; Rosseinsky, David R; Stride, John A; Tasset, Francis; Ressouche, Eric; White, Ross P; Ballou, Rafik

2004-11-01

The mixed-valence double salt K(3)(MnO(4))(2) crystallizes in space group P2(1)/m with Z = 2. The manganese centers Mn1 and Mn2 constitute discrete "permanganate", [Mn(VII)O(4)](-), and "manganate", [Mn(VI)O(4)](2-), ions, respectively. There is a spin-ordering transition to an antiferromagnetic state at ca. T = 5 K. The spin-density distribution in the paramagnetic phase at T = 10 K has been determined by polarized neutron diffraction, confirming that unpaired spin is largely confined to the nominal manganate ion Mn2. Through use of both Fourier refinement and maximum entropy methods, the spin on Mn1 is estimated as 1.75 +/- 1% of one unpaired electron with an upper limit of 2.5%.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiyota, Eduardo; Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP; Sousa, Sylvia Morais de

Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automatedmore » molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.« less

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu

2006-06-01

The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichiamore » coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.« less

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacik, John -Paul; Mekasha, Sophanit; Forsberg, Zarah

Bacteria and fungi express lytic polysaccharide monooxgyenase (LPMO) enzymes that act in conjunction with canonical hydrolytic sugar-processing enzymes to rapidly convert polysaccharides such as chitin, cellulose and starch to single monosaccharide products. In order to gain a better understanding of the structure and oxidative mechanism of these enzymes, large crystals (1–3 mm 3) of a chitin-processing LPMO from the Gram-positive soil bacterium Jonesia denitrificans were grown and screened for their ability to diffract neutrons. In addition to the collection of neutron diffraction data, which were processed to 2.1 Å resolution, a high-resolution room-temperature X-ray diffraction data set was collected andmore » processed to 1.1 Å resolution in space group P2 12 12 1. To our knowledge, this work marks the first successful neutron crystallographic experiment on an LPMO. As a result, joint X-ray/neutron refinement of the resulting data will reveal new details of the structure and mechanism of this recently discovered class of enzymes.« less

Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase

DOE PAGES

Bacik, John -Paul; Mekasha, Sophanit; Forsberg, Zarah; ...

2015-01-01

Bacteria and fungi express lytic polysaccharide monooxgyenase (LPMO) enzymes that act in conjunction with canonical hydrolytic sugar-processing enzymes to rapidly convert polysaccharides such as chitin, cellulose and starch to single monosaccharide products. In order to gain a better understanding of the structure and oxidative mechanism of these enzymes, large crystals (1–3 mm 3) of a chitin-processing LPMO from the Gram-positive soil bacterium Jonesia denitrificans were grown and screened for their ability to diffract neutrons. In addition to the collection of neutron diffraction data, which were processed to 2.1 Å resolution, a high-resolution room-temperature X-ray diffraction data set was collected andmore » processed to 1.1 Å resolution in space group P2 12 12 1. To our knowledge, this work marks the first successful neutron crystallographic experiment on an LPMO. As a result, joint X-ray/neutron refinement of the resulting data will reveal new details of the structure and mechanism of this recently discovered class of enzymes.« less

Synthesis and characterization of graphene oxide using modified Hummer's method

NASA Astrophysics Data System (ADS)

Kaur, Manpreet; Kaur, Harsimran; Kukkar, Deepak

2018-05-01

In the present study, a simple approach has been followed for the synthesis of graphene oxide (GO) using modified Hummers method in which graphite powder was oxidized in the presence of concentrated H2SO4 and KMnO4. The amount of NaNO3 and KMnO4 was varied to produce sheet like structure. The varied concentrations of NaNO3 and KMnO4 resulted in yielding large amount of the product. Structural, morphological and physicochemical features of the product were studied using UV-Visible spectrophotometer, Fourier Transform infrared spectroscopy (FTIR), and crystal structure was determined using X-ray powder diffraction (XRD). UV-Vis spectra of GO was observed at a maximum absorption of 230 nm due to (π-π*) transition of atomic carbon-carbon bonds. FTIR spectra revealed the presence of oxygen containing functional groups which ensures the complete exfoliation of graphite into graphene oxide X-ray powder diffraction pattern of the product showed the diffraction peak at (2θ = 26.7°) with an interlayer spacing of 0.334 nm. All the above characterizations successfully confirmed the formation of GO.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aldridge, James D.; Womick, Jordan M.; Rosmus, Kimberly A.

Novel quaternary lanthanide-substituted oxides of stoichiometry LnxY2-xTi2O7 (where Ln is lanthanum, neodymium, samarium, gadolinium, or ytterbium) were prepared by traditional high-temperature, solid-state techniques and characterized by X-ray powder diffraction. Samples with nominal values of x up to 1.0 were attempted. The well-studied ternary cubic pyrochlore compound yttrium titanium oxide (Y2Ti2O7, space group Fd-3m, Z = 8), served as a parent structural framework in which Ln3+ cations were substituted on the Y3+ site. Laboratory-grade X-ray powder diffraction data revealed pure quaternary pyrochlore phases for LnxY2-xTi2O7 with x ≤ 0.2. Pyrochlore phase purity was verified by Rietveld analysis using high-resolution synchrotron X-raymore » powder diffraction data when x ≤ 0.2, however, for La3+ substitution specifically, pure quaternary pyrochlore formed at x<0.1. Band gap energies on selected samples were determined using optical diffuse reflectance spectroscopy and showed that these materials can be classified as electrical insulators with indirect band gap energies around 3.7 eV.« less

Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong, Hui; Li, Yan; Lou, Xiao-hua

2007-02-01

A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

A combined temperature-dependent electron and single-crystal X-ray diffraction study of the fresnoite compound Rb 2V 4+V 25+O 8

NASA Astrophysics Data System (ADS)

Withers, Ray L.; Höche, Thomas; Liu, Yun; Esmaeilzadeh, Saeid; Keding, Ralf; Sales, Brian

2004-10-01

High-purity Rb2V3O8 has been grown and temperature-dependent electron and single-crystal X-ray diffraction used to carefully investigate its fresnoite-type reciprocal lattice. In contrast to other recently investigated representatives of the fresnoite family of compounds, Rb2V3O8 is not incommensurately modulated with an incommensurate basal plane primary modulation wave vector given by q∼0.3 <110>*. A careful low-temperature electron diffraction study has, however, revealed the existence of weak incommensurate satellite reflections characterized by the primitive primary modulation wave vector q1∼0.16c*. The reciprocal space positioning of these incommensurate satellite reflections, the overall (3+1)-d superspace group symmetry, as well as the shapes of the refined displacement ellipsoids determined from single-crystal XRD refinement, are all consistent with their arising from a distinct type of condensed rigid unit modes (RUMs) of distortion of the Rb2V3O8 parent structure.

Increasing dissolution of trospium chloride by co-crystallization with urea

NASA Astrophysics Data System (ADS)

Skořepová, Eliška; Hušák, Michal; Čejka, Jan; Zámostný, Petr; Kratochvíl, Bohumil

2014-08-01

The search for various solid forms of an active pharmaceutical ingredient (API) is an important step in drug development. Our aim was to prepare co-crystals of trospium chloride, an anticholinergic drug used for the treatment of incontinence, and to investigate if they have advantageous properties for drug formulation. Phase identification was done by powder X-ray diffraction and single-crystal X-ray diffraction. The chemical composition was verified by solution NMR and the dissolution rate of the prepared phases was studied by IDR (intrinsic dissolution rate). For further analysis of phase stability and transitions, combined thermal analysis and temperature-resolved X-ray powder diffraction were used. Urea was selected as a co-crystallization partner. Trospium chloride urea (1:1) co-crystal was prepared by a solvent evaporation. From single-crystal data, the co-crystal structure was solved in a space group P21/c and compared to previously published structures of trospium chloride. Intrinsic dissolution rate revealed that the co-crystal dissolves 32% faster than pure API. However, its low thermal and pressure stability makes it a challenging choice for the final drug formulation.

Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

PubMed

Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

1996-11-15

Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

A pseudo-tetragonal tungsten bronze superstructure: a combined solution of the crystal structure of K6.4(Nb,Ta)(36.3)O94 with advanced transmission electron microscopy and neutron diffraction.

PubMed

Paria Sena, Robert; Babaryk, Artem A; Khainakov, Sergiy; Garcia-Granda, Santiago; Slobodyanik, Nikolay S; Van Tendeloo, Gustaaf; Abakumov, Artem M; Hadermann, Joke

2016-01-21

The crystal structure of the K6.4Nb28.2Ta8.1O94 pseudo-tetragonal tungsten bronze-type oxide was determined using a combination of X-ray powder diffraction, neutron diffraction and transmission electron microscopy techniques, including electron diffraction, high angle annular dark field scanning transmission electron microscopy (HAADF-STEM), annular bright field STEM (ABF-STEM) and energy-dispersive X-ray compositional mapping (STEM-EDX). The compound crystallizes in the space group Pbam with unit cell parameters a = 37.468(9) Å, b = 12.493(3) Å, c = 3.95333(15) Å. The structure consists of corner sharing (Nb,Ta)O6 octahedra forming trigonal, tetragonal and pentagonal tunnels. All tetragonal tunnels are occupied by K(+) ions, while 1/3 of the pentagonal tunnels are preferentially occupied by Nb(5+)/Ta(5+) and 2/3 are occupied by K(+) in a regular pattern. A fractional substitution of K(+) in the pentagonal tunnels by Nb(5+)/Ta(5+) is suggested by the analysis of the HAADF-STEM images. In contrast to similar structures, such as K2Nb8O21, also parts of the trigonal tunnels are fractionally occupied by K(+) cations.

Breaking resolution limits in ultrafast electron diffraction and microscopy.

PubMed

Baum, Peter; Zewail, Ahmed H

2006-10-31

Ultrafast electron microscopy and diffraction are powerful techniques for the study of the time-resolved structures of molecules, materials, and biological systems. Central to these approaches is the use of ultrafast coherent electron packets. The electron pulses typically have an energy of 30 keV for diffraction and 100-200 keV for microscopy, corresponding to speeds of 33-70% of the speed of light. Although the spatial resolution can reach the atomic scale, the temporal resolution is limited by the pulse width and by the difference in group velocities of electrons and the light used to initiate the dynamical change. In this contribution, we introduce the concept of tilted optical pulses into diffraction and imaging techniques and demonstrate the methodology experimentally. These advances allow us to reach limits of time resolution down to regimes of a few femtoseconds and, possibly, attoseconds. With tilted pulses, every part of the sample is excited at precisely the same time as when the electrons arrive at the specimen. Here, this approach is demonstrated for the most unfavorable case of ultrafast crystallography. We also present a method for measuring the duration of electron packets by autocorrelating electron pulses in free space and without streaking, and we discuss the potential of tilting the electron pulses themselves for applications in domains involving nuclear and electron motions.

Ion dynamics in nanocrystalline LiMnPO{sub 4} synthesised by novel template free hydrothermal approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vijayan, Lakshmi, E-mail: lakshmivijayan@gmail.com; Cheruku, Rajesh; Govindaraj, G.

A dense core rectangular shaped nanocrystalline LiMnPO{sub 4} material was synthesized by template free sucrose assisted hydrothermal synthesis. The material possess orthorhombic crystal structure with Pnma, space group having four formula units. The structural characterization was accomplished through X-ray diffraction, thermo gravimetry/differential thermal analysis. Morphology was identified by the SEM, VSM was used to verify the magnetic behavior of the material and electrical characterization was done through impedance spectroscopy and the results were reported.

Thermal Expansion Behavior in TcO2. Toward Breaking the Tc-Tc Bond.

PubMed

Reynolds, Emily; Zhang, Zhaoming; Avdeev, Maxim; Thorogood, Gordon J; Poineau, Frederic; Czerwinski, Kenneth R; Kimpton, Justin A; Kennedy, Brendan J

2017-08-07

The structure of TcO 2 between 25 and 1000 °C has been determined in situ using X-ray powder diffraction methods and is found to remain monoclinic in space group P2 1 /c. Thermal expansion in TcO 2 is highly anisotropic, with negative thermal expansion of the b axis observed above 700 °C. This is the result of an anomalous expansion along the a axis that is a consequence of weakening of the Tc-Tc bonds.

On Structural States of Multiferroic InMnO3

NASA Astrophysics Data System (ADS)

Tyson, Trevor; Yu, Tian; Bai, Jianming; Abeykoon, Milinda; Lalancette, Roger

2015-03-01

InMnO3 (with small R site ion) was recently found to be ferroelectric and to crystallize with space group P63cm under certain preparation conditions (Appl. Phys. Lett. 102, 172901 (2013). We have conducted detailed structural studies to explore the phase diagram and to identify the structural forms of InMnO3 under varying preparation conditions. Detailed diffraction measurement results will be presented. This work is supported by DOE Grant DE-FG02-07ER46402.

Cloning, expression, and crystallization of Cpn60 proteins from Thermococcus litoralis.

PubMed

Osipiuk, J; Sriram, M; Mai, X; Adams, M W; Joachimiak, A

2000-01-01

Two genes of the extreme thermophilic archaeon Thermococcus litoralis homologous to those that code for Cpn60 chaperonins were cloned and expressed in Escherichia coli. Each of the Cpn60 subunits as well as the entire Cpn60 complex crystallize in a variety of morphological forms. The best crystals diffract to 3.6 A resolution at room temperature and belong to the space group 1422 with unit cell parameters a = b = 193.5 A, c = 204.2 A.

Purification, crystallization and preliminary X-ray studies of human augmenter of liver regeneration.

PubMed

Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min

2002-12-01

Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).

The crystal structure of synthetic simmonsite, Na 2LiAlF 6

NASA Astrophysics Data System (ADS)

Ross, Kirk C.; Mitchell, Roger H.; Chakhmouradian, Anton R.

2003-04-01

The structure of the synthetic fluoroperovskite, Na 2LiAlF 6 (simmonsite), has been determined by powder X-ray diffraction using the Rietveld method of structure refinement. The compound adopts space group P2 1/ n [#14; a=5.2842(1); b=5.3698(1); c=7.5063(2) Å; β=89.98(1)°; Z=4), and is a member of the cryolite (Na 2NaAlF 6) structural group characterized by ordering of the B-site cations (Li, Al) and tilting of the BF 6 octahedra according to the tilt scheme a-b-c+. Rotations of the B-site polyhedra are less ( ΦLi=14.9°; ΦAl=17.0°) than those found in cryolite ( ΦNa=18.6; ΦAl=23.5°) because of the larger difference in the ionic radii of the B-site cations in cryolite as compared to those in simmonsite. Na at the A-site is displaced from the special position resulting in 10- and 8-fold coordination in simmonsite and cryolite, respectively. By analogy with the synthetic compound, naturally occurring simmonsite is considered to adopt space group P2 1/ n (#14) and not the P2 1(#4) or P2 1/ m(#11) space groups.

Growth and structure of a new photonic crystal: Chlorine substituted chalcone

NASA Astrophysics Data System (ADS)

Sarveshwara, H. P.; Raghavendra, S.; A, Jayarama; Menezes, Anthoni Praveen; Dharmaprakash, S. M.

2015-06-01

A new organic photonic material 3-(2, 4-dichlorophenyl)-1-(2,5-dimethylthiophen-3-yl)propan-1-one(DMTP) has been synthesized and crystallised in acetone solution. The functional groups present in the new material were identified by FTIR spectroscopy. The material is optically transparent in the wavelength range of 400-1100 nm. The crystal structure of DMTP was determined by single crystal X-ray diffraction. The title compound crystallizes in monoclinic system with a centrosymmetric space group P21/c. The Z-scan study revealed that the optical limiting property exhibited by the DMTP molecule is based on the reverse saturable absorption phenomena.

The structure, thermal expansion and phase transition properties of Ho{sub 2}Mo{sub 3−x}W{sub x}O{sub 12} (x = 0, 1.0, 2.0) solid solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, X.Z.; Hao, L.J.; Wu, M.M.

Graphical abstract: A polymorph with Gd{sub 2}Mo{sub 3}O{sub 12}-type structure (space group: Pba2) for negative thermal expansion material Ho{sub 2}Mo{sub 3}O{sub 12} is observed above 700 °C, this polymorphism could be effectively supressed by W-substiution for Mo, the give the temperature dependence of Pba2 phase contents for Ho{sub 2}Mo{sub 3−x}W{sub x}O{sub 12} (x = 0.0, 1.0, 2.0). - Highlights: • The solid solution Ho{sub 2}Mo{sub 3−x}W{sub x}O{sub 12} was investigated by in situ X-ray diffraction. • It is found that the substitution slightly influence thermal expansion property. • A polymorph of Ho{sub 2}Mo{sub 3}O{sub 12} with Pba2 space group wasmore » observed above 700 °C. • The W-substitution for Mo effectively suppresses this transformation. - Abstract: Three solid solutions of Ho{sub 2}Mo{sub 3−x}W{sub x}O{sub 12}(x = 0, 1.0, 2.0) were prepared by solid state reaction method, the temperature dependent in-situ X-ray diffraction and thermal analysis were performed to investigate their structure and thermal expansion. All samples have orthorhombic structure(space group Pbcn# 60) with negative thermal expansion at the room temperature. the substitution of W for Mo enlarges the lattice constant and slightly influences the negative thermal expansion. An irreversible phase transformation to the Pba2 phase(Tb{sub 2}Mo{sub 3}O{sub 12} structure) was observed at high temperature for Mo-rich samples. This ploymorphism could be effectively suppressed by the W-substitution for Mo, this phenomenon could be explained by the lower electronegativity of W{sup 6+} than Mo{sup 6+}.« less

High-mass diffraction in the QCD dipole picture

NASA Astrophysics Data System (ADS)

Bialas, A.; Navelet, H.; Peschanski, R.

1998-05-01

Using the QCD dipole picture of the BFKL pomeron, the cross-section of single diffractive dissociation of virtual photons at high energy and large diffractively excited masses is calculated. The calculation takes into account the full impact-parameter phase-space and thus allows to obtain an exact value of the triple BFKL Pomeron vertex. It appears large enough to compensate the perturbative 6-gluon coupling factor (α/π)3 thus suggesting a rather appreciable diffractive cross-section.

High resolution synchrotron X-radiation diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Dobbyn, Ronald C.; Black, David; Burdette, Harold; Kuriyama, Masao; Fripp, Archibald; Simchik, Richard

1991-01-01

Irregularities in three crystals grown in space and in four terrestrial crystals grown under otherwise comparable conditions have been observed in high resolution diffraction imaging. The images provide important new clues to the nature and origins of irregularities in each crystal. For two of the materials, mercuric iodide and lead tin telluride, more than one phase (an array of non-diffracting inclusions) was observed in terrestrial samples; but the formation of these multiple phases appears to have been suppressed in directly comparable crystals grown in microgravity. The terrestrial seed crystal of triglycine sulfate displayed an unexpected layered structure, which propagated during directly comparable space growth. Terrestrial Bridgman regrowth of gallium arsenide revealed a mesoscopic structure substantially different from that of the original Czochralski material. A directly comparable crystal is to be grown shortly in space.

Syntheses, structural characterization, and DPPH radical scavenging activity of cocrystals of caffeine with 1- and 2-naphthoxyacetic acids

NASA Astrophysics Data System (ADS)

Suresh Kumar, G. S.; Seethalakshmi, P. G.; Sumathi, D.; Bhuvanesh, N.; Kumaresan, S.

2013-03-01

Caffeine:1-naphthoxyacetic acid [(caf)(1-naa)] and caffeine:2-naphthoxyacetic acid [(caf)(2-naa)] cocrystals have been synthesized and single crystals were grown by slow evaporation technique. The structures of the grown crystals were elucidated using single crystal X-ray diffraction analysis. Both the cocrystals belong to the monoclinic crystallographic system with space group P21/c, Z = 4, and α = γ = 90°, whereas β = 111.4244(18)° for [(caf)(1-naa)] and β = 109.281(6)° for [(caf)(2-naa)]. The crystal packing is predominantly stabilized by hydrogen bonding and π-π stacking interactions. The presence of unionized -COOH functional group in both the cocrystals was identified by FTIR spectral analysis. Thermal behavior and stability of both the cocrystals were studied by TGA/DTA analyses. Solvent-free formation of these cocrystals was confirmed by powder X-ray diffraction analyses. The theoretical energy of cocrystals showed that the formers have higher energy than cocrystals 1 and 2. DPPH radical scavenging activity of cocrystals 1 and 2 is slightly greater than the formers.

Crystal growth, structural, thermal and mechanical behavior of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) single crystals.

PubMed

Mahadevan, M; Ramachandran, K; Anandan, P; Arivanandhan, M; Bhagavannarayana, G; Hayakawa, Y

2014-12-10

Single crystals of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) have been grown successfully from the solution of l-arginine and 4-nitrophenol. Slow evaporation of solvent technique was adopted to grow the bulk single crystals. Single crystal X-ray diffraction analysis confirms the grown crystal has monoclinic crystal system with space group of P21. Powder X-ray diffraction analysis shows the good crystalline nature. The crystalline perfection of the grown single crystals was analyzed by HRXRD by employing a multicrystal X-ray diffractometer. The functional groups were identified from proton NMR spectroscopic analysis. Linear and nonlinear optical properties were determined by UV-Vis spectrophotometer and Kurtz powder technique respectively. It is found that the grown crystal has no absorption in the green wavelength region and the SHG efficiency was found to be 2.66 times that of the standard KDP. The Thermal stability of the crystal was found by obtaining TG/DTA curve. The mechanical behavior of the grown crystal has been studied by Vicker's microhardness method. Copyright © 2014 Elsevier B.V. All rights reserved.

Synthesis and an X-ray diffraction study of Rb{sub 2}[(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serezhkina, L. B., E-mail: Lserezh@ssu.samara.ru; Peresypkina, E. V.; Neklyudova, N. A.

2010-09-15

The synthesis and X-ray diffraction study of compound Rb{sub 2}[(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}], which crystallizes in the monoclinic crystal system, are performed. The unit cell parameters are as follows: a = 7.9996(6) A, b = 8.8259(8) A, c = 11.3220(7) A, {beta} = 105.394(2){sup o}, and V = 770.7(1) A{sup 3}; space group P2{sub 1}/n, Z = 2, and R{sub 1} = 0.0271. [(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}]{sup 2-} layers belonging to the AK{sub 0.5}{sup 02}T{sup 11} crystal chemical group of uranyl complexes (A = UO{sub 2}{sup 2+}, K{sup 02} = C{sub 2}O{sub 4}{sup 2-}, and T{supmore » 11} = C{sub 2}O{sub 4}{sup 2-}) are uranium-containing structural units of the crystals. The layers are connected with outer-sphere rubidium cations by electrostatic interactions.« less

Hydrothermal synthesis and structural analysis of new mixed oxyanion borates: Ba11B26O44(PO4)2(OH)6, Li9BaB15O27(CO3) and Ba3Si2B6O16

NASA Astrophysics Data System (ADS)

Heyward, Carla; McMillen, Colin D.; Kolis, Joseph

2013-07-01

Several new borate compounds, Ba11B26O44(PO4)2(OH)6 (1), Li9BaB15O27(CO3) (2), and Ba3Si2B6O16 (3) were synthesized containing other hetero-oxyanion building blocks in addition to the borate frameworks. They were all prepared under hydrothermal conditions and characterized by single crystal and powder X-ray diffraction, and IR spectroscopy. Crystal data: For 1; space group P21/c, a=6.8909 (14) Å, b=13.629 (3) Å, c=25.851 (5) Å, β=90.04 (3)°; For 2; space group P-31c, a=8.8599 (13) Å, c=15.148 (3) Å; For 3; space group P-1, a=5.0414 (10) Å, b=7.5602 (15) Å, c=8.5374 (17) Å, α=77.15 (3)°, β=77.84 (3)°, γ=87.41 (3)° for 3. Compounds 1 and 2 contain isolated oxyanions [PO4]3- and [CO3]2- respectively, sitting in channels created by the borate framework, while structure 3 has the [SiO4]4- groups directly bonded to the borate groups creating a B-O-Si framework.

Bunch evolution study in optimization of MeV ultrafast electron diffraction

NASA Astrophysics Data System (ADS)

Lu, Xian-Hai; Du, Ying-Chao; Huang, Wen-Hui; Tang, Chuan-Xiang

2014-12-01

Megaelectronvolt ultrafast electron diffraction (UED) is a promising detection tool for ultrafast processes. The quality of diffraction image is determined by the transverse evolution of the probe bunch. In this paper, we study the contributing terms of the emittance and space charge effects to the bunch evolution in the MeV UED scheme, employing a mean-field model with an ellipsoidal distribution as well as particle tracking simulation. The small transverse dimension of the drive laser is found to be critical to improve the reciprocal resolution, exploiting both smaller emittance and larger transverse bunch size before the solenoid. The degradation of the reciprocal spatial resolution caused by the space charge effects should be carefully controlled.

Toward Design Principles for Diffusionless Transformations: The Frustrated Formation of Co–Co Bonds in a Low-Temperature Polymorph of GdCoSi 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vinokur, Anastasiya I.; Fredrickson, Daniel C.

Diffusionless (or displacive) phase transitions allow inorganic materials to show exquisite responsiveness to external stimuli, as is illustrated vividly by the superelasticity, shape memory, and magnetocaloric effects exhibited by martensitic materials. In this Article, we present a new diffusionless transition in the compound GdCoSi 2, whose origin in frustrated bonding points toward generalizable design principles for these transformations. We first describe the synthesis of GdCoSi 2 and the determination of its structure using single crystal X-ray diffraction. While previous studies based on powder X-ray diffraction assigned this compound to the simple CeNi 1–xSi 2 structure type (space group Cmcm), ourmore » structure solution reveals a superstructure variant (space group Pbcm) in which the Co sublattice is distorted to create zigzag chains of Co atoms. DFT-calibrated Hückel calculations, coupled with a reversed approximation Molecular Orbital (raMO) analysis, trace this superstructure to the use of Co–Co isolobal bonds to complete filled 18 electron configurations on the Co atoms, in accordance with the 18–n rule. The formation of these Co–Co bonds is partially impeded, however, by a small degree of electron transfer from Si-based electronic states to those with Co–Co σ* character. The incomplete success of Co–Co bond creation suggests that these interactions are relatively weak, opening the possibility of them being overcome by thermal energy at elevated temperatures. In fact, high-temperature powder and single crystal X-ray diffraction data, as well as differential scanning calorimetry, indicate that a reversible Pbcm to Cmcm transition occurs at about 380 K. This transition is diffusionless, and the available data point toward it being first-order. We expect that similar cases of frustrated interactions could be staged in other rare earth–transition metal–main group phases, providing a potentially rich source of compounds exhibiting diffusionless transformations and the unique properties these transitions mediate.« less

Ammonium–cobalt–nickel phosphates, NH{sub 4}[Co{sub 1−x}Ni{sub x}PO{sub 4}]·H{sub 2}O

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torre-Fernández, Laura; Trobajo, Camino; Pedro, Imanol de

The ammonium–cobalt–nickel phosphates, NH{sub 4}[Co{sub 1−x}Ni{sub x}PO{sub 4}]·H{sub 2}O (x=0.00, 0.34, 0.59, 0.70, 1.00), and the deuterated forms, ND{sub 4}[Co{sub 1−x}Ni{sub x}PO{sub 4}]·D{sub 2}O (x=0.00, 0.38, 0.48, 0.69, 0.85), have been synthesized under mild hydrothermal conditions and characterised using X-ray and neutron diffraction, chemical and thermal analysis, and magnetic measurements. Their crystal structures, including hydrogen positions, were determined by Rietveld refinement using single-crystal X-ray and neutron powder diffraction data. The space group of these orthorhombic crystals modifies as a function of their composition. The magnetic susceptibility and magnetization measurements of these ammonium–cobalt–nickel phosphates show antiferromagnetic behaviour, and the Neel temperaturemore » evolves from 5.5 K (x=0.00) up to 13.2 K (x=1.00). - Graphical abstract: We obtained single crystals for all the members of the family. In this series, although all crystals are orthorhombic, the space group changes as a function of the composition, showing how the single-crystal diffraction data is capable to manifest structural subtleties that had not been described before for this group of materials. All the investigated materials behave antiferromagnetically with ordering temperatures from 5.5 K up to 13.2 K. Display Omitted - Highlights: • The ammonium–cobalt–nickel phosphates, NH{sub 4}[Co{sub 1−x}Ni{sub x}PO{sub 4}]·H{sub 2}O (x=0.00, 0.34, 0.59, 0.70, 1.00) and the deuterated forms ND4[Co1-xNixPO4]·D{sub 2}O (x=0.00, 0.38, 0.49, 0.68, 0.85) have synthesized by hydrothermal synthesis. • The structural studies of these compounds are introduced as a function of the composition. • The magnetic studies show an antiferromagnetically behavior with ordering temperatures from 5.5 K to 13.2 K.« less

Polymorphism of Alprazolam (Xanax): a review of its crystalline phases and identification, crystallographic characterization, and crystal structure of a new polymorph (form III).

PubMed

de Armas, Héctor Novoa; Peeters, Oswald M; Van den Mooter, Guy; Blaton, Norbert

2007-05-01

A new polymorphic form of Alprazolam (Xanax), 8-chloro-1-methyl-6-phenyl-4H-[1,2,4]triazolo-[4,3-alpha][1,4]benzodiazepine, C(17)H(13)ClN(4), has been investigated by means of X-ray powder diffraction (XRPD), single crystal X-ray diffraction, and differential scanning calorimetry (DSC). This polymorphic form (form III) was obtained during DSC experiments after the exothermic recrystallization of the melt of form I. The crystal unit cell dimensions for form III were determined from diffractometer methods. The monoclinic unit cell found for this polymorph using XRPD after indexing the powder diffractogram was confirmed by the cell parameters obtained from single crystal X-ray diffractometry on a crystal isolated from the DSC pans. The single crystal unit cell parameters are: a = 28.929(9), b = 13.844(8), c = 7.361(3) angstroms, beta = 92.82(3) degrees , V = 2944(2) angstroms(3), Z = 8, space group P2(1) (No.4), Dx = 1.393 Mg/m(3). The structure obtained from single crystal X-ray diffraction was used as initial model for Rietveld refinement on the powder diffraction data of form III. The temperature phase transformations of alprazolam were also studied using high temperature XRPD. A review of the different phases available in the Powder Diffraction File (PDF) database for this drug is described bringing some clarification and corrections. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association.

TM surface wave diffraction by a truncated dielectric slab recessed in a perfectly conducting surface. [considering flush mounted space shuttle antenna

NASA Technical Reports Server (NTRS)

Pathak, P. H.; Kouyoumjian, R. G.

1974-01-01

The diffraction of a TM sub o surface wave by a terminated dielectric slab which is flush mounted in a perfectly conducting surface is studied. The incident surface wave gives rise to waves reflected and diffracted by the termination; these reflected and diffracted fields may be expressed in terms of the geometrical theory of diffraction by introducing surface wave reflection and diffraction coefficients which are associated with the termination. In this investigation, the surface wave reflection and diffraction coefficients have been deduced from a formally exact solution to this canonical problem. The solution is obtained by a combination of the generalized scattering matrix technique and function theoretic methods.

Grain size dependent phase stabilities and presence of a monoclinic (Pm) phase in the morphotropic phase boundary region of (1−x)Bi(Mg{sub 1/2}Ti{sub 1/2})O{sub 3}-xPbTiO{sub 3} piezoceramics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhyay, Ashutosh; Singh, Akhilesh Kumar, E-mail: akhilesh-bhu@yahoo.com, E-mail: aksingh.mst@itbhu.ac.in

2015-04-14

Results of the room temperature structural studies on (1−x)Bi(Mg{sub 1/2}Ti{sub 1/2})O{sub 3}-xPbTiO{sub 3} ceramics using Rietveld analysis of the powder x-ray diffraction data in the composition range 0.28 ≤ x ≤ 0.45 are presented. The morphotropic phase boundary region exhibits coexistence of monoclinic (space group Pm) and tetragonal (space group P4 mm) phases in the composition range 0.33 ≤ x ≤ 0.40. The structure is nearly single phase monoclinic (space group Pm) in the composition range 0.28 ≤ x ≤ 0.32. The structure for the compositions with x ≥ 0.45 is found to be predominantly tetragonal with space group P4 mm. Rietveld refinement of the structure rules out the coexistence of rhombohedral and tetragonal phases inmore » the morphotropic phase boundary region reported by earlier authors. The Rietveld structure analysis for the sample x = .35 calcined at various temperatures reveals that phase fraction of the coexisting phases in the morphotropic phase boundary region varies with grain size. The structural parameters of the two coexisting phases also change slightly with changing grain size.« less

La{sup 3+} doping of the Sr{sub 2}CoWO{sub 6} double perovskite: A structural and magnetic study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez, C.A.; Viola, M.C.; Pedregosa, J.C.

2008-11-15

La-doped Sr{sub 2}CoWO{sub 6} double perovskites have been prepared in air in polycrystalline form by solid-state reaction. These materials have been studied by X-ray powder diffraction (XRPD), neutron powder diffraction (NPD) and magnetic susceptibility. The structural refinement was performed from combined XRPD and NPD data (D2B instrument, {lambda}=1.594 A). At room temperature, the replacement of Sr{sup 2+} by La{sup 3+} induces a change of the tetragonal structure, space group I4/m of the undoped Sr{sub 2}CoWO{sub 6} into the distorted monoclinic crystal structure, space group P2{sub 1}/n, Z=2. The structure of La-doped phases contains alternating CoO{sub 6} and (Co/W)O{sub 6} octahedra,more » almost fully ordered. On the other hand, the replacement of Sr{sup 2+} by La{sup 3+} induces a partial replacement of W{sup 6+} by Co{sup 2+} into the B sites, i.e. Sr{sub 2-x}La{sub x}CoW{sub 1-y}Co{sub y}O{sub 6} (y=x/4) with segregation of SrWO{sub 4}. Magnetic and neutron diffraction measurements indicate an antiferromagnetic ordering below T{sub N}=24 K independently of the La-substitution. - Graphical abstract: La-doped Sr{sub 2}CoWO{sub 6} double perovskites have been prepared in polycrystalline form by solid-state reaction. The general formula of these compounds is Sr{sub 2-x}La{sub x}CoW{sub 1-y}Co{sub y}O{sub 6} (y=x/4). XRPD, NPD and magnetic susceptibility studies were performed. The structure of monoclinic La-doped phases contains alternating CoO{sub 6} and (Co/W)O{sub 6} octahedra, almost fully ordered. NPD and magnetic measurements indicate an antiferromagnetic ordering at low temperature.« less

Comparison of the visual and intraocular optical performance of a refractive multifocal IOL with rotational asymmetry and an apodized diffractive multifocal IOL.

PubMed

Alió, Jorge L; Plaza-Puche, Ana B; Javaloy, Jaime; Ayala, María José

2012-02-01

To compare the visual outcomes and intraocular optical quality observed postoperatively in patients implanted with a rotationally asymmetric multifocal intraocular lens (IOL) and an apodized diffractive multifocal IOL. Seventy-four consecutive eyes of 40 cataract patients (age range: 36 to 79 years) were divided into two groups: zonal refractive group, 39 eyes implanted with a rotationally asymmetric multifocal IOL (Lentis Mplus LS-312 IOL, Oculentis GmbH); and diffractive group, 35 eyes implanted with an apodized diffractive multifocal IOL (ReSTOR SN6AD3, Alcon Laboratories Inc). Distance and near visual acuity outcomes, contrast sensitivity, intraocular optical quality, and defocus curves were evaluated during 3-month follow-up. Calculation of the intraocular aberrations was performed by subtracting corneal aberrations from total ocular aberrations. Uncorrected near visual acuity and distance-corrected near visual acuity were better in the diffractive group than in the zonal refractive group (P=.01), whereas intermediate visual acuity (defocus +1.00 and +1.50 diopters) was better in the zonal refractive group. Photopic contrast sensitivity was significantly better in the zonal refractive group (P=.04). Wavefront aberrations (total, higher order, tilt, primary coma) were significantly higher in the zonal refractive group than in the diffractive group (P=.02). Both multifocal IOLs are able to successfully restore visual function after cataract surgery. The zonal refractive multifocal IOL provides better results in contrast sensitivity and intermediate vision, whereas the diffractive multifocal IOL provides better near vision at a closer distance. Copyright 2012, SLACK Incorporated.

Crystal structure and phase transformations of calcium yttrium orthophosphate, Ca 3Y(PO 4) 3

NASA Astrophysics Data System (ADS)

Fukuda, Koichiro; Iwata, Tomoyuki; Niwa, Takahiro

2006-11-01

Crystal structure and phase transformations of calcium yttrium orthophosphate Ca 3Y(PO 4) 3 were investigated by X-ray powder diffraction, selected-area electron diffraction, transmission electron microscopy and optical microscopy. The high-temperature phase is isostructural with eulytite, cubic (space group I4¯3d) with a=0.983320(5) nm, V=0.950790(8) nm 3, Z=4 and D x=3.45 Mg m -3. The crystal structure was refined with a split-atom model, in which the oxygen atoms are distributed over two partially occupied sites. Below the stable temperature range of eulytite, the crystal underwent a martensitic transformation, which is accompanied by the formation of platelike surface reliefs. The inverted crystal is triclinic (space group P1) with a=1.5726(1) nm, b=0.84267(9) nm, c=0.81244(8) nm, α=109.739(4)°, β=90.119(5)°, γ=89.908(7)°, V=1.0134(1) nm 3, Z=4 and D x=3.24 Mg m -3. The crystal grains were composed of pseudo-merohedral twins. The adjacent twin domains were related by the pseudo-symmetry mirror planes parallel to {101¯} with the composition surface {101¯}. When the eulytite was cooled relatively slowly from the stable temperature range, the decomposition reaction of Ca 3Y(PO 4) 3→ β-Ca 3(PO 4) 2+YPO 4 occurred.

Crystallization and X-ray data analysis of the 10 kDa C-terminal lid subdomain from Caenorhabditis elegans Hsp70

DOE Office of Scientific and Technical Information (OSTI.GOV)

Worrall, Liam; Walkinshaw, Malcolm D., E-mail: m.walkinshaw@ed.ac.uk

Crystals of the C-terminal 10 kDa lid subdomain from the C. elegans chaperone Hsp70 have been obtained that diffract X-rays to ∼3.5 Å and belong to space group I2{sub 1}2{sub 1}2{sub 1}. Analysis of X-ray data and initial heavy-atom phasing reveals 24 monomers in the asymmetric unit related by 432 non-crystallographic symmetry. Hsp70 is an important molecular chaperone involved in the regulation of protein folding. Crystals of the C-terminal 10 kDa helical lid domain (residues 542–640) from a Caenorhabditis elegans Hsp70 homologue have been produced that diffract X-rays to ∼3.4 Å. Crystals belong to space group I2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = b = 197, c = 200 Å. The Matthews coefficient, self-rotation function and Patterson map indicate 24 monomers in the asymmetric unit, showing non-crystallographic 432 symmetry. Molecular-replacement studies using the corresponding domain from rat, the only eukaryotic homologue with a known structure, failed and a mercury derivative was obtained. Preliminary MAD phasing using SHELXD and SHARP for location and refinement of the heavy-atom substructure and SOLOMON for density modification produced interpretable maps with a clear protein–solvent boundary. Further density-modification, model-building and refinement are currently under way.« less

Expression, Purification, Crystallization of Two Major Envelope Proteins from White Spot Syndrome Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Hew, C.

2007-01-01

White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less

Measurement of nanoscale three-dimensional diffusion in the interior of living cells by STED-FCS.

PubMed

Lanzanò, Luca; Scipioni, Lorenzo; Di Bona, Melody; Bianchini, Paolo; Bizzarri, Ranieri; Cardarelli, Francesco; Diaspro, Alberto; Vicidomini, Giuseppe

2017-07-06

The observation of molecular diffusion at different spatial scales, and in particular below the optical diffraction limit (<200 nm), can reveal details of the subcellular topology and its functional organization. Stimulated-emission depletion microscopy (STED) has been previously combined with fluorescence correlation spectroscopy (FCS) to investigate nanoscale diffusion (STED-FCS). However, stimulated-emission depletion fluorescence correlation spectroscopy has only been used successfully to reveal functional organization in two-dimensional space, such as the plasma membrane, while, an efficient implementation for measurements in three-dimensional space, such as the cellular interior, is still lacking. Here we integrate the STED-FCS method with two analytical approaches, the recent separation of photons by lifetime tuning and the fluorescence lifetime correlation spectroscopy, to simultaneously probe diffusion in three dimensions at different sub-diffraction scales. We demonstrate that this method efficiently provides measurement of the diffusion of EGFP at spatial scales tunable from the diffraction size down to ∼80 nm in the cytoplasm of living cells.The measurement of molecular diffusion at sub-diffraction scales has been achieved in 2D space using STED-FCS, but an implementation for 3D diffusion is lacking. Here the authors present an analytical approach to probe diffusion in 3D space using STED-FCS and measure the diffusion of EGFP at different spatial scales.

Diphosphine- and CO-Induced Fragmentation of Chloride-bridged Dinuclear Complex and Cp*Ir(mu-Cl)(3)Re(CO)(3) and Attempted Synthesis of Cp*Ir(mu-Cl)(3)Mn(CO)(3): Spectroscopic Data and X-ray Diffraction Structures of the Pentamethylcyclopentadienyl Compounds [Cp*IrCl{(Z)-Ph2PCH = CHPPh2}][Cl]center dot 2CHCl(3) and Cp*Ir(CO)Cl-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammons, Casey; Wang, Xiaoping; Nesterov, Vladimir

2010-01-01

The confacial bioctahedral compound Cp*Ir(mu-Cl)(3)Re(CO)(3) (1) undergoes rapid fragmentation in the presence of the unsaturated diphosphine ligand (Z)-Ph2PCH = CHPPh2 to give the mononuclear compounds [Cp*IrCl {(Z)-Ph2PCH = CHPPh2}][Cl] (2) and fac-ClRe(CO)(3)[(Z)-Ph2PCH = CHPPh2] (3). 2 has been characterized by H-1 and P-31 NMR spectroscopy and X-ray diffraction analysis. 2 center dot 2CHCl(3) crystallizes in the monoclinic space group C2/c, a = 35.023 (8) angstrom, b = 10.189 (2) angstrom, c = 24.003 (6) angstrom, b = 103.340 (3), V = 8,335 (3) angstrom 3, Z = 8, and d(calc) = 1.647 Mg/m(3); R = 0.0383, R-w = 0.1135 formore » 8,178 reflections with I> 2 sigma(I). The Ir(III) center in 2 exhibits a six-coordinate geometry and displays a chelating diphosphine group. Compound 1 reacts with added CO with fragmentation to yield the known compounds Cp*Ir(CO)Cl-2 (4) and ClRe(CO)(5) (5) in near quantitative yield by IR spectroscopy. Using the protocol established by our groups for the synthesis of 1, we have explored the reaction of [Cp*IrCl2](2) with ClMn(CO)(5) as a potential route to Cp*Ir(mu-Cl)(3)Mn(CO)(3); unfortunately, 4 was the only product isolated from this reaction. The solid-state structure of 4 was determined by X-ray diffraction analysis. 4 crystallizes in the triclinic space group P-1, a = 7.4059 (4) angstrom, b = 7.8940 (4) angstrom, c = 11.8488 (7) angstrom, alpha = 80.020 (1), beta = 79.758 (1), gamma = 68.631 (1), V = 630.34 (6) angstrom(3), Z = 2, and d(calc) = 2.246 Mg/m(3); R = 0.0126, R-w = 0.0329 for 2,754 reflections with I> 2 sigma(I). The expected three-legged piano-stool geometry in 4 has been crystallographically confirmed.« less

Incorrect support and missing center tolerances of phasing algorithms

DOE PAGES

Huang, Xiaojing; Nelson, Johanna; Steinbrener, Jan; ...

2010-01-01

In x-ray diffraction microscopy, iterative algorithms retrieve reciprocal space phase information, and a real space image, from an object's coherent diffraction intensities through the use of a priori information such as a finite support constraint. In many experiments, the object's shape or support is not well known, and the diffraction pattern is incompletely measured. We describe here computer simulations to look at the effects of both of these possible errors when using several common reconstruction algorithms. Overly tight object supports prevent successful convergence; however, we show that this can often be recognized through pathological behavior of the phase retrieval transfermore » function. Dynamic range limitations often make it difficult to record the central speckles of the diffraction pattern. We show that this leads to increasing artifacts in the image when the number of missing central speckles exceeds about 10, and that the removal of unconstrained modes from the reconstructed image is helpful only when the number of missing central speckles is less than about 50. In conclusion, this simulation study helps in judging the reconstructability of experimentally recorded coherent diffraction patterns.« less

Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veluraja, K., E-mail: veluraja@msuniv.ac.in; Vennila, K.N.; Umamakeshvari, K.

Research highlights: {yields} Techniques to get oriented mucin fibre. {yields} X-ray fibre diffraction pattern for mucin. {yields} Molecular modeling of mucin based on X-ray fibre diffraction pattern. -- Abstract: The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 A. The high intense d-spacing signal at 4.22 A is attributed to the antiparallel {beta}-sheet structure identified in the fraction of themore » homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 A reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule.« less

Mapping of reciprocal space of La{sub 0.30}CoO{sub 2} in 3D: Analysis of superstructure diffractions and intergrowths with Co{sub 3}O{sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brázda, Petr, E-mail: brazda@fzu.cz; Palatinus, Lukáš; Klementová, Mariana

2015-07-15

We have used electron diffraction tomography and powder X-ray diffraction to elucidate the structural properties of layered cobaltate γ-La{sub 0.30}CoO{sub 2}. The structure consists of hexagonal sheets of edge-sharing CoO{sub 6} octahedra interleaved by lanthanum monolayers. The La{sup 3+} cations occupy only one third of available P2 sites, forming a 2-dimensional a√3×a√3 superstructure in a–b plane. The results show that there exists no order in the mutual relative shift between the neighbouring La interlayers within the a–b plane. This is manifested in the observed monotonous decrease of the diffracted intensity of the superstructure diffractions along c{sup ⁎} in both X-raymore » and electron diffraction data. The observed lack of stacking order differentiates the La{sub x}CoO{sub 2} from its Ca and Sr analogues where at least a partial stacking order of the cationic interlayers is manifested in experimental data published in literature. - Highlights: • We use electron diffraction tomography for reciprocal space mapping of La{sub 0.30}CoO{sub 2}. • We observed a complete disorder of the stacking of Lanthanum interlayers. • Co{sub 3}O{sub 4} intergrown with La{sub 0.30}CoO{sub 2} crystals brings about fake superstructure diffractions. • Twinning of Co{sub 3}O{sub 4} enhances the problem of fake superstructure diffractions.« less

CD, DVD, and Blu-Ray Disc Diffraction with a Laser Ray Box

ERIC Educational Resources Information Center

DeWeerd, Alan J.

2016-01-01

A compact disc (CD) can be used as a diffraction grating, even though its track consists of a series of pits, not a continuous groove. Previous authors described how to measure the track spacing on a CD using an incident laser beam normal to the surface or one at an oblique angle. In both cases, the diffraction pattern was projected on a screen…

Structural and magnetic phase transitions in Cs2[FeCl5(H2O)].

PubMed

Fröhlich, Tobias; Stein, Jonas; Bohatý, Ladislav; Becker, Petra; Gukasov, Arsen; Braden, Markus

2018-06-05

The compound [Formula: see text] is magnetoelectric but not multiferroic with an erythrosiderite-related structure. We present a comprehensive investigation of its structural and antiferromagnetic phase transitions by polarization microscopy, pyroelectric measurements, x-ray diffraction and neutron diffraction. At about [Formula: see text] K, the compound changes its symmetry from Cmcm to I2/c, with a doubling of the original c-axis. This transformation is associated with rotations of the [Formula: see text] octahedra and corresponds to an ordering of the [Formula: see text] molecules and of the related [Formula: see text] bonds. A significant ferroelectric polarization can be excluded for this transition by precise pyrocurrent measurements. The antiferromagnetic phase transition occurring at [Formula: see text] results in the magnetic space group [Formula: see text], which perfectly agrees with previous measurements of the linear magnetoelectric effect and magnetization.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

PubMed Central

Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

2008-01-01

Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441

Temperature and composition phase diagram in the iron-based ladder compounds Ba 1 - x Cs x Fe 2 Se 3

DOE PAGES

Hawai, Takafumi; Nambu, Yusuke; Ohgushi, Kenya; ...

2015-05-28

We investigated the iron-based ladder compounds (Ba,Cs)Fe₂Se₃. Their parent compounds BaFe₂Se₃ and CsFe₂Se₃ have different space groups, formal valences of Fe, and magnetic structures. Electrical resistivity, specific heat, magnetic susceptibility, x-ray diffraction, and powder neutron diffraction measurements were conducted to obtain a temperature and composition phase diagram of this system. Block magnetism observed in BaFe₂Se₃ is drastically suppressed with Cs doping. In contrast, stripe magnetism observed in CsFe₂Se₃ is not so fragile against Ba doping. A new type of magnetic structure appears in intermediate compositions, which is similar to stripe magnetism of CsFe₂Se₃, but interladder spin configuration is different. Intermediatemore » compounds show insulating behavior, nevertheless a finite T-linear contribution in specific heat was obtained at low temperatures.« less

Boron monosulfide: Equation of state and pressure-induced phase transition

NASA Astrophysics Data System (ADS)

Cherednichenko, K. A.; Kruglov, I. A.; Oganov, A. R.; Le Godec, Y.; Mezouar, M.; Solozhenko, V. L.

2018-04-01

Quasi-hydrostatic compression of rhombohedral boron monosulfide (r-BS) has been studied up to 50 GPa at room temperature using diamond-anvil cells and angle-dispersive synchrotron X-ray diffraction. A fit of the experimental P-V data to the Vinet equation of state yields the bulk modulus B0 of 42.2(1.4) GPa and its first pressure derivative B0' of 7.6(2) that are in excellent agreement with our ab initio calculations. Formation of a new high-pressure phase of boron monosulfide (hp-BS) has been observed above 35 GPa. According to ab initio evolutionary crystal structure predictions combined with Rietveld refinement of high-pressure X-ray diffraction data, the structure of hp-BS has trigonal symmetry and belongs to the space group P-3m1. As it follows from the electron density of state calculations, the phase transformation is accompanied by an insulator-metal transition.

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

A new polymorph of 4'-hydroxyvalerophenone revealed by thermoanalytical and X-ray diffraction studies

NASA Astrophysics Data System (ADS)

Lopes, Cátia S. D.; Bernardes, Carlos E. S.; Piedade, M. Fátima M.; Diogo, Hermínio P.; da Piedade, Manuel E. Minas

2017-04-01

A new polymorph of 1-(4-hydroxyphenyl)pentan-1-one (4'-hydroxyvalerophenone, HVP) was identified by using differential scanning calorimetry, hot stage microscopy, and X-ray powder diffraction. This novel crystal form (form II) was obtained by crystallization from melt. It has a fusion temperature of T fus = 324.3 ± 0.2 K and an enthalpy of fusion Δfus H m o = 18.14±0.18 kJ·mol-1. These values are significantly lower than those observed for the previously known phase (form I, monoclinic, space group P21/ c, T fus = 335.6 ± 0.7 K; Δfus H m o = 26.67±0.04 kJ·mol-1), which can be prepared by crystallization from ethanol. The results here obtained, therefore, suggest that form I is thermodynamically more stable than the newly identified form II and, furthermore, that the two polymorphs are monotropically related.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

Single-crystal X-ray diffraction study of SrGeO3 high-pressure perovskite phase at 100 K

NASA Astrophysics Data System (ADS)

Nakatsuka, Akihiko; Arima, Hiroshi; Ohtaka, Osamu; Fujiwara, Keiko; Yoshiasa, Akira

2017-10-01

Single-crystal X-ray diffraction study of SrGeO3 perovskite (cubic; space group Pmɜ¯m) synthesized at 6 GPa and 1223 K was conducted at a low temperature of 100 K. The residual electron density revealed the presence of the bonding electron at the center of the Ge-O bond, in accordance with our previous conclusion that the Ge-O bond is strongly covalent. From comparison with our previous structure-refinement result at 296 K, the mean square displacement (MSD) of the O atom in the direction of the Ge-O bond is suggested to exhibit no significant temperature dependence, in contrast to that in the direction perpendicular to the bond. Thus, the strong covalency of the Ge-O bond can have a large influence on the temperature dependence of thermal vibration of the O atom.

Temperature and composition phase diagram in the iron-based ladder compounds Ba1-xCsxFe2Se3

NASA Astrophysics Data System (ADS)

Hawai, Takafumi; Nambu, Yusuke; Ohgushi, Kenya; Du, Fei; Hirata, Yasuyuki; Avdeev, Maxim; Uwatoko, Yoshiya; Sekine, Yurina; Fukazawa, Hiroshi; Ma, Jie; Chi, Songxue; Ueda, Yutaka; Yoshizawa, Hideki; Sato, Taku J.

2015-05-01

We investigated the iron-based ladder compounds (Ba,Cs ) Fe2Se3 . Their parent compounds BaFe2Se3 and CsFe2Se3 have different space groups, formal valences of Fe, and magnetic structures. Electrical resistivity, specific heat, magnetic susceptibility, x-ray diffraction, and powder neutron diffraction measurements were conducted to obtain a temperature and composition phase diagram of this system. Block magnetism observed in BaFe2Se3 is drastically suppressed with Cs doping. In contrast, stripe magnetism observed in CsFe2Se3 is not so fragile against Ba doping. A new type of magnetic structure appears in intermediate compositions, which is similar to stripe magnetism of CsFe2Se3 , but interladder spin configuration is different. Intermediate compounds show insulating behavior, nevertheless a finite T -linear contribution in specific heat was obtained at low temperatures.

A novel coordination polymer of Ni(II) based on 1,3,5-benzenetricarboxylic acid synthesis, characterization, crystal structure, thermal study, and luminescent properties

NASA Astrophysics Data System (ADS)

Saheli, Sania; Rezvani, Alireza

2017-01-01

A new metal-organic framework (MOF) formulated as [Ni(H2btc)(OH)(H2O)2] (1) (H3btc = 1,3,5-benzenetricarboxylic acid) was synthesized using the hydrothermal technique. The complex 1 was characterized by elemental analysis, infrared spectroscopy, and powder X-ray diffraction in addition to single crystal X-ray diffraction. X-ray crystal structural analysis displayed that the compound belonged to the monoclinic space group P21/n with cell parameters a = 6.8658(14) Å, b = 18.849(4) Å, c = 8.5608(17) Å. In the title complex, ligand is linked to metal centers through two μ-oxo bridges and forming a 2D layer which is led to form an interesting geometry. The thermal stability and fluorescence property of 1 have also been investigated.

Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

PubMed

Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

1992-03-01

Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

2007-07-01

An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

PubMed

Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

2010-01-01

Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

X-Ray diffraction, spectroscopy and thermochemical characterization of the pharmaceutical paroxetine nitrate salt

NASA Astrophysics Data System (ADS)

Carvalho, Paulo S.; de Melo, Cristiane C.; Ayala, Alejandro P.; Ellena, Javier

2016-08-01

A comprehensive solid state study of Paroxetine nitrate hydrate, (PRX+·NO3-)H2O, is reported. This salt was characterized by a combination of methods, including Single crystal X-ray diffraction, Thermal analysis, Fourier transform infrared spectroscopy (FTIR) and Solubility measurements. (PRX+·NO3-)H2O crystallizes in the monoclinic C2 space group (Z‧ = 1) and its packing was analyzed in details, showing that the main supramolecular motif consists in a C22(4) chain formed by charge-assisted N+-H⋯O- hydrogen bonds. The salt formation and conformation features were also accuracy established via FTIR spectra. In comparison with the pharmaceutical approved (PRX+ṡCl-)ṡ0.5H2O, (PRX+ṡNO3-)ṡH2O showed a decrease of 24 °C in the drug melting peak and a slight reduction in its water solubility value.

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Structural analysis and martensitic transformation in equiatomic HfPd alloy

NASA Astrophysics Data System (ADS)

Hisada, S.; Matsuda, M.; Takashima, K.; Yamabe-Mitarai, Y.

2018-02-01

We investigated the crystal structure and the martensitic transformation in equiatomic HfPd alloy. The analysis of the crystal structure by electron diffraction and Rietveld refinement using X-ray diffraction data indicates that the space group of the martensitic phase is Cmcm, and the lattice parameters are a = 0.329 nm, b = 1.021 nm, and c = 0.438 nm. Martensitic variants are composed of the plate-like morphology of several hundred nm, and the boundaries between the variants have (021)Cmcm twin relations. This (021)Cmcm twin boundary seems to be sharp without ledge and steps. Differential scanning calorimetry measurement indicates that each martensitic transformation temperature is determined to be Ms = 819 K, Mf = 794 K, As = 928 K, and Af = 954 K. Based on the dimension change using a thermo-mechanical analyzer, the expansion and shrinkage of the sample occurred with the forward and reverse martensitic transformation, respectively.

Carbonate-based zeolitic imidazolate framework for highly selective CO2 capture.

PubMed

Basnayake, Sajani A; Su, Jie; Zou, Xiadong; Balkus, Kenneth J

2015-02-16

In this study, we report the formation of a new crystal structure, ZIF-CO3-1, which results from the reaction of Zn(2+), 2-methylimidazole, and carbonate. ZIF-CO3-1 can be synthesized solvothermally in N,N-dimethylformamide (DMF)/water (H2O) or by utilizing of CO2 gas at various temperatures in DMF/H2O or H2O. This reaction selectively consumes CO2 because CO2 is incorporated in the ZIF as carbonate. CO2 can be quantitatively released by acidifying the ZIF. Powder X-ray diffraction, single-crystal X-ray diffraction, FTIR spectroscopy, scanning electron microscopy, elemental analysis, and thermogravimetric analysis were used to characterize the ZIF structure. ZIF-CO3-1 (chemical formula C9H10N4O3Zn2), crystallizes in the orthorhombic crystal system with noncentrosymmetric space group Pba2.

A new series of lanthanide coordination polymers with 2,2‧-bipyridine and glutaric acid: Synthesis, crystal structures and properties of [Ln(bipy)(glut)(NO3)

NASA Astrophysics Data System (ADS)

Wang, Chunguang; Xing, Yongheng; Li, Zhangpeng; Li, Jing; Zeng, Xiaoqing; Ge, Maofa; Niu, Shuyun

2009-08-01

A series of new lanthanide coordination polymers, with the formula [Ln(bipy)(glut)(NO 3)] (Ln = Eu ( 1), Tb ( 2), Sm ( 3), Pr ( 4); bipy = 2,2'-bipyridine; H 2glut = glutaric acid), have been synthesized under the hydrothermal condition and characterized by elemental analysis, IR spectroscopy, powder X-ray diffraction, and single-crystal X-ray diffraction. Structural analyses reveal that all four complexes are isostructural and crystallized in monoclinic system, P2 1/ c space group. For these complexes, the Ln 3+ are all linked through glutaric acid ligands to form 1D chain-like polymeric structures, and bipy and NO3- are coordinated on two sides of the chains. The thermogravimetric analysis of 1 and photoluminescent properties of 1 and 2 are discussed in detail.

Phase transitions in heated Sr{sub 2}MgTeO{sub 6} double perovskite oxide probed by X-ray diffraction and Raman spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manoun, Bouchaib, E-mail: manounb@gmail.com; Tamraoui, Y.; Lazor, P.

2013-12-23

Double-perovskite oxide Sr{sub 2}MgTeO{sub 6} has been synthetized, and its crystal structure was probed by the technique of X-ray diffraction at room temperature. The structure is monoclinic, space group I2/m. Temperature-induced phase transitions in this compound were investigated by Raman spectroscopy up to 550 °C. Two low-wavenumber modes corresponding to external lattice vibrations merge at temperature of around 100 °C, indicating a phase transition from the monoclinic (I2/m) to the tetragonal (I4/m) structure. At 300 °C, changes in the slopes of temperature dependencies of external and O–Te–O bending modes are detected and interpreted as a second phase transition from the tetragonal (I4/m) tomore » the cubic (Fm-3m) structure.« less

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

PubMed

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

The effect of the cation substitution on the structural and vibrational properties of Cs2NaGaxSc1-xF6 solid solution

NASA Astrophysics Data System (ADS)

Doriguetto, A. C.; Boschi, T. M.; Pizani, P. S.; Mascarenhas, Y. P.; Ellena, J.

2004-08-01

Raman scattering and x-ray diffration were used to characterize the structural and vibrational properties of the Cs2NaGaxSc1-xF6 solid solutions, for x ranging from 0.0 to 1.0. The Raman spectra, taken at room and low temperature, allow us to follow the phase evolution in detail and indicate the breaking of the local symmetry since low Ga concentration levels. Five compositions were studied by x-ray diffraction: x=0.0, 0.2, 0.5, 0.8, and 1.0. A cubic space group, Fm3¯m, was found to x=0.0 and x=0.2 and a trigonal one was found to x=0.5, 0.8, and 1.0. Details of both phases are presented and the correlation between x-ray diffraction and Raman scattering is discussed.

Crystal structure, thermal and optical properties of Benzimidazole benzimidazolium picrate crystal

NASA Astrophysics Data System (ADS)

Jagadesan, A.; Peramaiyan, G.; Srinivasan, T.; Kumar, R. Mohan; Arjunan, S.

2016-02-01

A new organic framework of benzimidazole with picric acid has been synthesized. A single crystal with a size of 38×10×4 mm3 was grown by a slow evaporation solution growth technique. X-ray diffraction study revealed that the BZP crystal belongs to triclinic system with space group P-1. High resolution X-ray diffraction study shows the absence of grain boundaries without any defects. The thermal stability and specific heat capacity of BZP were investigated by TG/DT and TG/DSC analyses. From the UV-vis-NIR spectral study, optical transmission window and band gap of BZP were found out. The nonlinear refractive index (n2) and third order susceptibility Re(χ(3)) values of BZP crystal are estimated to be 1.73×10-7 cm2/W and 1.26×10-5 esu, respectively using a Z-scan technique.

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

PubMed Central

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-01-01

The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

PubMed

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-07-01

The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

Magnetic texturing due to the partial ordering of Fe+3 and Cu+2 in NdBaCuFeO5

NASA Astrophysics Data System (ADS)

Pissas, M.

2017-06-01

The crystal and magnetic structure of the oxygen deficient double perovskite NdBaCuFeO5 was studied, using neutron powder diffraction data. The structure was refined from neutron powder diffraction data using the space groups P 4 / mmm and P 4 mm . For 2K ⩽ T ⩽TN2 = 260K three families of magnetic Bragg peaks exist. These peaks can be indexed with commensurate propagation vectors k1 =[1/2 1/2 1/2], k2 =[1/2 1/2 0] and the incommensurate k3 =[1/2 1/2 0.4]. Above TN2 only magnetic Bragg peaks originated from k1 and k2 propagation, were observed. The incommensurate magnetic structure can be attributed to a circular inclined spiral ordering as in YBaCuFeO5 compound.

X-Ray diffraction and mu-Raman investigation of the monoclinic-orthorhombic phase transition in Th(1-x)U(x)(C(2)O(4))(2).2H(2)O solid solutions.

PubMed

Clavier, Nicolas; Hingant, Nina; Rivenet, Murielle; Obbade, Saïd; Dacheux, Nicolas; Barré, Nicole; Abraham, Francis

2010-02-15

A complete Th(1-x)U(x)(C(2)O(4))(2).2H(2)O solid solution was prepared by mild hydrothermal synthesis from a mixture of hydrochloric solutions containing cations and oxalic acid. The crystal structure has been solved from twinned single crystals for x = 0, 0.5, and 1 with monoclinic symmetry, space group C2/c, leading to unit cell parameters of a approximately 10.5 A, b approximately 8.5 A, and c approximately 9.6 A. The crystal structure consists of a two-dimensional arrangement of actinide centers connected through bis-bidentate oxalate ions forming squares. The actinide metal is coordinated by eight oxygen atoms from four oxalate entities and two water oxygen atoms forming a bicapped square antiprism. The connection between the layers is assumed by hydrogen bonds between the water molecules and the oxygen of oxalate of an adjacent layer. Under these conditions, the unit cell contains two independent oxalate ions. From high-temperature mu-Raman and X-ray diffraction studies, the compounds were found to undergo a transition to an orthorhombic form (space group Ccca). The major differences in the structural arrangement concern the symmetry of uranium, which decreases from C2 to D2, leading to a unique oxalate group. Consequently, the nu(s)(C-O) double band observed in the Raman spectra recorded at room temperature turned into a singlet. This transformation was then used to make the phase transition temperature more precise as a function of the uranium content of the sample.

Space Station UCS antenna pattern computation and measurement. [UHF Communication Subsystem

NASA Technical Reports Server (NTRS)

Hwu, Shian U.; Lu, Ba P.; Johnson, Larry A.; Fournet, Jon S.; Panneton, Robert J.; Ngo, John D.; Eggers, Donald S.; Arndt, G. D.

1993-01-01

The purpose of this paper is to analyze the interference to the Space Station Ultrahigh Frequency (UHF) Communication Subsystem (UCS) antenna radiation pattern due to its environment - Space Station. A hybrid Computational Electromagnetics (CEM) technique was applied in this study. The antenna was modeled using the Method of Moments (MOM) and the radiation patterns were computed using the Uniform Geometrical Theory of Diffraction (GTD) in which the effects of the reflected and diffracted fields from surfaces, edges, and vertices of the Space Station structures were included. In order to validate the CEM techniques, and to provide confidence in the computer-generated results, a comparison with experimental measurements was made for a 1/15 scale Space Station mockup. Based on the results accomplished, good agreement on experimental and computed results was obtained. The computed results using the CEM techniques for the Space Station UCS antenna pattern predictions have been validated.

Magnetic ground state of the multiferroic hexagonal LuFe O3

NASA Astrophysics Data System (ADS)

Suresh, Pittala; Vijaya Laxmi, K.; Bera, A. K.; Yusuf, S. M.; Chittari, Bheema Lingam; Jung, Jeil; Anil Kumar, P. S.

2018-05-01

The structural, electric, and magnetic properties of bulk hexagonal LuFe O3 are investigated. Single phase hexagonal LuFe O3 has been successfully stabilized in the bulk form without any doping by sol-gel method. The hexagonal crystal structure with P 63c m space group has been confirmed by x-ray-diffraction, neutron-diffraction, and Raman spectroscopy study at room temperature. Neutron diffraction confirms the hexagonal phase of LuFe O3 persists down to 6 K. Further, the x-ray photoelectron spectroscopy established the 3+ oxidation state of Fe ions. The temperature-dependent magnetic dc susceptibility, specific heat, and neutron-diffraction studies confirm an antiferromagnetic ordering below the Néel temperature (TN)˜130 K . Analysis of magnetic neutron-diffraction patterns reveals an in-plane (a b -plane) 120∘ antiferromagnetic structure, characterized by a propagation vector k =(0 0 0 ) with an ordered moment of 2.84 μB/F e3 + at 6 K. The 120∘ antifferomagnetic ordering is further confirmed by spin-orbit coupling density functional theory calculations. The on-site coulomb interaction (U ) and Hund's parameter (JH) on Fe atoms reproduced the neutron-diffraction Γ1 spin pattern among the Fe atoms. P -E loop measurements at room temperature confirm an intrinsic ferroelectricity of the sample with remnant polarization Pr˜0.18 μ C /c m2 . A clear anomaly in the dielectric data is observed at ˜TN revealing the presence of magnetoelectric coupling. A change in the lattice constants at TN has also been found, indicating the presence of a strong magnetoelastic coupling. Thus a coupling between lattice, electric, and magnetic degrees of freedom is established in bulk hexagonal LuFe O3 .

A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

2006-03-01

Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

Aperture Mask for Unambiguous Parity Determination in Long Wavelength Imagers

NASA Technical Reports Server (NTRS)

Bos, Brent

2011-01-01

A document discusses a new parity pupil mask design that allows users to unambiguously determine the image space coordinate system of all the James Webb Space Telescope (JWST) science instruments by using two out-of-focus images. This is an improvement over existing mask designs that could not completely eliminate the coordinate system parity ambiguity at a wavelength of 5.6 microns. To mitigate the problem of how the presence of diffraction artifacts can obscure the pupil mask detail, this innovation has been created with specifically designed edge features so that the image space coordinate system parity can be determined in the presence of diffraction, even at long wavelengths.

Aplanatic and quasi-aplanatic diffraction gratings

DOEpatents

Hettrick, M.C.

1987-09-14

A reflection diffraction grating having a series of transverse minute grooves of progressively varying spacing along a concave surface enables use of such gratings for x-ray or longer wavelength imaging of objects. The variable groove spacing establishes aplanatism or substantially uniform magnetification across the optical aperture. The grating may be sued, for example, in x-ray microscopes or telescopes of the imaging type and in x-ray microprobed. Increased spatial resolution and field of view may be realized in x-ray imaging. 5 figs.

Synthesis, growth, structural and optical studies of a novel organic Piperazine (bis) p-toluenesulfonate single crystal.

PubMed

Rekha, P; Peramaiyan, G; NizamMohideen, M; Kumar, R Mohan; Kanagadurai, R

2015-03-15

A novel organic single crystal of Piperazinium (bis) p-toluenesulfonate (PPTS) was grown by a slow evaporation solution growth technique. The structure of the grown crystal was determined using single crystal X-ray diffraction analysis. The PPTS crystal belongs to the triclinic crystal system with space group of P1¯. The presence of functional groups was confirmed by FTIR spectral analysis. The optical transmittance range and cut-off wavelength were identified by UV-vis-NIR spectral studies. The luminescent properties of PPTS crystal were investigated. The thermal behavior of PPTS crystal was studied by TG-DT analyses. Copyright © 2014 Elsevier B.V. All rights reserved.

Synthesis, crystal structure, thermal and nonlinear optical properties of new metal-organic single crystal: Tetrabromo (piperazinium) zincate (II) (TBPZ)

NASA Astrophysics Data System (ADS)

Boopathi, K.; Babu, S. Moorthy; Ramasamy, P.

2018-04-01

Tetrabromo (piperazinium) zincate, a new metal-organic crystal has been synthesized and its single crystal grown by slow evaporation method. The grown crystal has characterized by structural, spectral, thermal, linear and nonlinear optical properties. Single crystal X-ray diffractions study reveals that grown crystal belongs to orthorhombic crystal system with space group P212121. The presence of functional groups is identified by FT-IR spectral analysis. Thermal stability of the crystal was ascertained by TG-DTA measurement. The second order harmonic generation efficiency was measured using Kurtz and Perry technique and it was found to be 1.5 times that of KDP.

Growth, structural, spectroscopic and optical characterization of barium doped calcium tartrate

NASA Astrophysics Data System (ADS)

Verma, Seema; Raina, Bindu; Gupta, Vandana; Bamzai, K. K.

2018-05-01

Barium doped calcium tartrates synthesized by controlled diffusion using silica gel technique at ambient temperature was characterized by single crystal X-ray diffraction which establishes monoclinic crystal system with volume of the unit cell 923.97(10) Ǻ3 and the space group being P21. UV - Vis characterization gives various linear optical constants like absorption, transmittance, reflectance, band gap, extinction coefficient, urbach energy, complex dielectric constant, optical and electrical conductivity. These constants are considered to be essential in characterizing materials that are used in various applications like fabrication of optoelectronic devices. FTIR spectrum establishes the presence of various bands of functional groups expected from metal tartrate with water of crystallization.

Stratified Diffractive Optic Approach for Creating High Efficiency Gratings

NASA Technical Reports Server (NTRS)

Chambers, Diana M.; Nordin, Gregory P.

1998-01-01

Gratings with high efficiency in a single diffracted order can be realized with both volume holographic and diffractive optical elements. However, each method has limitations that restrict the applications in which they can be used. For example, high efficiency volume holographic gratings require an appropriate combination of thickness and permittivity modulation throughout the bulk of the material. Possible combinations of those two characteristics are limited by properties of currently available materials, thus restricting the range of applications for volume holographic gratings. Efficiency of a diffractive optic grating is dependent on its approximation of an ideal analog profile using discrete features. The size of constituent features and, consequently, the number that can be used within a required grating period restricts the applications in which diffractive optic gratings can be used. These limitations imply that there are applications which cannot be addressed by either technology. In this paper we propose to address a number of applications in this category with a new method of creating high efficiency gratings which we call stratified diffractive optic gratings. In this approach diffractive optic techniques are used to create an optical structure that emulates volume grating behavior. To illustrate the stratified diffractive optic grating concept we consider a specific application, a scanner for a space-based coherent wind lidar, with requirements that would be difficult to meet by either volume holographic or diffractive optic methods. The lidar instrument design specifies a transmissive scanner element with the input beam normally incident and the exiting beam deflected at a fixed angle from the optical axis. The element will be rotated about the optical axis to produce a conical scan pattern. The wavelength of the incident beam is 2.06 microns and the required deflection angle is 30 degrees, implying a grating period of approximately 4 microns. Creating a high efficiency volume grating with these parameters would require a grating thickness that cannot be attained with current photosensitive materials. For a diffractive optic grating, the number of binary steps necessary to produce high efficiency combined with the grating period requires feature sizes and alignment tolerances that are also unattainable with current techniques. Rotation of the grating and integration into a space-based lidar system impose the additional requirements that it be insensitive to polarization orientation, that its mass be minimized and that it be able to withstand launch and space environments.

Optical Micromachining

NASA Technical Reports Server (NTRS)

1998-01-01

Under an SBIR (Small Business Innovative Research) with Marshall Space Flight Center, Potomac Photonics, Inc., constructed and demonstrated a unique tool that fills a need in the area of diffractive and refractive micro-optics. It is an integrated computer-aided design and computer-aided micro-machining workstation that will extend the benefits of diffractive and micro-optic technology to optical designers. Applications of diffractive optics include sensors and monitoring equipment, analytical instruments, and fiber optic distribution and communication. The company has been making diffractive elements with the system as a commercial service for the last year.

Growth, optical, thermal, mechanical and dielectric studies of sodium succinate hexahydrate (β phase) single crystal: A promising third order NLO material

NASA Astrophysics Data System (ADS)

Mageshwari, P. S. Latha; Priya, R.; Krishnan, S.; Joseph, V.; Das, S. Jerome

2016-11-01

A third order nonlinear optical (NLO)single crystals of sodium succinate hexahydrate (SSH) (β phase) has been grown by a slow evaporation growth technique using aqueous solution at ambient temperature. The lattice parameters and morphology of SSH were determined by single crystal X-ray diffraction analysis. SSH crystallizes in centrosymmetric monoclinic system with space group P 21 / c and the crystalline purity was analyzed by powder X-ray diffraction analysis. The UV-vis-NIR spectrum reveals that the crystal is transparent in the entire visible region. The recorded FT-IR spectrum verified the presence of various functional groups in the material. NMR analysis of the grown crystal confirms the structural elucidation and detects the major and minor functional groups present in the title compound. ICP-OES analysis proved the presence of sodium in SSH. TG-DTA/DSCanalysis was used to investigate the thermal stability of the material. The dielectric permittivity and dielectric loss of SSH were carried out as a function of frequency for different temperatures and the results were discussed. The mechanical stability was evaluated from Vicker's microhardness test. The third order nonlinear optical properties of SSH has been investigated employing Z-scan technique with He-Ne laser operating at 632.8 nm wavelength.

Breaking resolution limits in ultrafast electron diffraction and microscopy

PubMed Central

Baum, Peter; Zewail, Ahmed H.

2006-01-01

Ultrafast electron microscopy and diffraction are powerful techniques for the study of the time-resolved structures of molecules, materials, and biological systems. Central to these approaches is the use of ultrafast coherent electron packets. The electron pulses typically have an energy of 30 keV for diffraction and 100–200 keV for microscopy, corresponding to speeds of 33–70% of the speed of light. Although the spatial resolution can reach the atomic scale, the temporal resolution is limited by the pulse width and by the difference in group velocities of electrons and the light used to initiate the dynamical change. In this contribution, we introduce the concept of tilted optical pulses into diffraction and imaging techniques and demonstrate the methodology experimentally. These advances allow us to reach limits of time resolution down to regimes of a few femtoseconds and, possibly, attoseconds. With tilted pulses, every part of the sample is excited at precisely the same time as when the electrons arrive at the specimen. Here, this approach is demonstrated for the most unfavorable case of ultrafast crystallography. We also present a method for measuring the duration of electron packets by autocorrelating electron pulses in free space and without streaking, and we discuss the potential of tilting the electron pulses themselves for applications in domains involving nuclear and electron motions. PMID:17056711

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

PubMed

Tang, M X; Zhang, Y Y; E, J C; Luo, S N

2018-05-01

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, M. X.; Zhang, Y. Y.; E, J. C.

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

The intra-annular acylamide chelate-coordinated compound: The keto-tautomer of metal (II) milrinone complex

NASA Astrophysics Data System (ADS)

Gong, Yun; Liu, Jinzhi; Tang, Wang; Hu, Changwen

2008-03-01

In the presence of N, N'-dimethyllformamide (DMF), two isostructural metal (II)-milrinone complexes formulated as M(C 12H 8N 3O) 2 (M = Co 1 and Ni 2) have been synthesized and characterized by elemental analysis, IR, TG and single crystal X-ray diffraction. The two compounds crystallize in the tetragonal system, chiral space group P4 32 12. They exhibit similar two dimensional (2D) square grid-like framework, in which milrinone acts as a ditopic ligand with its terminal pyridine and intra-annular acylamide groups covalently bridging different metal centers. The intra-annular acylamide ligand shows a chelate-coordinated mode. Compounds 1 and 2 are stable under 200 °C. Compound 3 formulated as (C 12H 9N 3O) 4·H 2O was obtained in the presence of water, the water molecule in the structure leads to the racemization of compound 3 and it crystallizes in the monoclinic system, non-chiral space group P2 1/ c. Milrinone exhibits a keto-form in the three compounds and compounds 1- 3 exhibit different photoluminescence properties.

Temperature Dependence of the Structural Parameters in the Transformation of Aragonite to Calcite, as Determined from In Situ Synchrotron Powder X-ray-Diffratction Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.; Hassan, Ishmael; West Indies)

The temperature dependency of the crystal structure and the polymorphic transition of CaCO{sub 3} from aragonite to calcite were studied using Rietveld structure refinement and high-temperature in situ synchrotron powder X-ray-diffraction data at ambient pressure, P. The orthorhombic metastable aragonite at room P, space group Pmcn, transforms to trigonal calcite, space group R{bar 3}c, at about T{sub c} = 468 C. This transformation occurs rapidly; it starts at about 420 C and is completed by 500 C, an 80 C interval that took about 10 minutes using a heating rate of 8 C/min. Structurally, from aragonite to calcite, the distributionmore » of the Ca atom changes from approximately hexagonal to cubic close-packing. A 5.76% discontinuous increase in volume accompanies the reconstructive first-order transition. Besides the change in coordination of the Ca atom from nine to six from aragonite to calcite, the CO{sub 3} groups change by a 30{sup o} rotation across the transition.« less

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu

2006-12-01

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less

Synthesis, structural studies and antimicrobial activity of N'-((2Z, 3E)-3-(hydroxyimino)butan-2-ylidene)-2-phenylacetohydrazide and its Co(II), Ni(II) complexes

NASA Astrophysics Data System (ADS)

Karadeniz, Şeyma; Ataol, Cigdem Yuksektepe; Şahin, Onur; İdil, Önder; Bati, Hümeyra

2018-06-01

A new aroylhydrazoneoxime, N'-((2Z, 3E)-3-(hydroxyimino)butan-2-ylidene)-2-phenylacetohydrazide ligand (LH2) and its Ni(II) and Co(II) complexes, have been synthesized and characterized by elemental and thermal analyses, IR and UV-vis spectroscopy, magnetic moment and X-ray diffraction. The antimicrobial activities of these compounds were tested by using minimal inhibitory concentration method (MIC). The ligand-containing aroylhydrazone and oxime groups and its Ni complex crystallize in the triclinic system and P 1 - space group, while its Co complex crystallizes in the monoclinic system and the C 2/c space group. X-ray results show that the ligand in the keto form is transformed into enolic form when it forms coordination. From elemental analysis data, the stoichiometry of Co(II) complex was found to be 1:2 (metal/ligand), but 1:1 for Ni(II). IR spectra indicate that the ligand acts as monoanionic NNO- tridentate and coordination takes place form through the oxime nitrogen, imine nitrogen, and enolate oxygen atoms.

Preliminary X-ray analysis of twinned crystals of the Q88Y25_Lacpl esterase from Lactobacillus plantarum WCFS1

PubMed Central

Álvarez, Yanaisis; Esteban-Torres, María; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Martínez-Ripoll, Martín; Mancheño, José M.

2011-01-01

Q88Y25_Lacpl is an esterase produced by the lactic acid bacterium Lactobacillus plantarum WCFS1 that shows amino-acid sequence similarity to carboxyl­esterases from the hormone-sensitive lipase family, in particular the AFEST esterase from the archaeon Archaeoglobus fulgidus and the hyperthermophilic esterase EstEI isolated from a metagenomic library. N-­terminally His6-tagged Q88Y25_Lacpl has been overexpressed in Escherichia coli BL21 (DE3) cells, purified and crystallized at 291 K using the hanging-drop vapour-diffusion method. Mass spectrometry was used to determine the purity and homogeneity of the enzyme. Crystals of His6-tagged Q88Y25_Lacpl were prepared in a solution containing 2.8 M sodium acetate trihydrate pH 7.0. X-ray diffraction data were collected to 2.24 Å resolution on beamline ID29 at the ESRF. The apparent crystal point group was 422; however, initial global analysis of the intensity statistics (data processed with high symmetry in space group I422) and subsequent tests on data processed with low symmetry (space group I4) showed that the crystals were almost perfectly merohedrally twinned. Most probably, the true space group is I4, with unit-cell parameters a = 169.05, b = 169.05, c = 183.62 Å. PMID:22102251

Crystal growth, piezoelectric, non-linear optical and mechanical properties of lithium hydrogen oxalate monohydrate single crystal

NASA Astrophysics Data System (ADS)

Chandran, Senthilkumar; Paulraj, Rajesh; Ramasamy, P.

2017-05-01

Semi-organic lithium hydrogen oxalate monohydrate non-linear optical single crystals have been grown by slow evaporation solution growth technique at 35 °C. Single crystal X-ray diffraction study showed that the grown crystal belongs to the triclinic system with space group P1. The mechanical strength decreases with increasing load. The piezoelectric coefficient is found to be 1.41 pC/N. The nonlinear optical property was measured using Kurtz Perry powder technique and SHG efficiency was almost equal to that of KDP.

Crystals of Serum Albumin for Use in Genetic Engineering and Rational Drug Design

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1996-01-01

Serum albumin crystal forms have been produced which exhibit superior x-ray diffraction quality. The crystals are produced from both recombinant and wild-type human serum albumin, canine, and baboon serum albumin and allow the performance of drug-binding studies as well as genetic engineering studies. The crystals are grown from solutions of polyethylene glycol or ammonium sulphate within prescribed limits during growth times from one to several weeks and include the following space groups: P2(sub 1), C2, P1.

Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

PubMed Central

Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

2010-01-01

The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

Tris(acetonitrile)chloropalladium tetrafluoroborate synthesis, application and structural analysis

NASA Astrophysics Data System (ADS)

Dybała, Izabela; Demchuk, Oleg M.

2016-10-01

Results of the single crystal X-ray diffraction analysis of tris(acetonitrile)chloropalladium tetrafluoroborate [PdCl(CH3CN)3]BF4 are presented in details. It was found that the title compound crystallises in the monoclinic system, in the space group C2/c. The role of charge-assisted C-HṡṡṡF-B interactions in crystal architecture was investigated. Due to its untypical properties the prepared [PdCl(CH3CN)3]BF4 has proved to be an excellent palladium source in the synthesis of phosphine-palladium complexes.

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

Water-Free Rare Earth-Prussian Blue Type Analogues: Synthesis, Structure, Computational Analysis, and Magnetic Data of {Ln[superscript III](DMF)[subscript 6]Fe[superscript III](CN)[subcsript 6]}[subscript infinity] (Ln = Rare Earths Excluding Pm)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, Duane C.; Liu, Shengming; Chen, Xuenian

2009-11-04

Water-free rare earth(III) hexacyanoferrate(III) complexes, {l_brace}Ln(DMF){sub 6}({mu}-CN){sub 2}Fe(CN){sub 4}{r_brace}{sub {infinity}} (DMF = N,N-dimethylformamide; Ln = Sm, 1; Eu, 2; Gd, 3; Tb, 4; Dy, 5; Ho, 6; Er, 7; Tm, 8; Yb, 9; Lu, 10; Y, 11; La, 12; Ce, 13; Pr, 14; Nd, 15), were synthesized in dry DMF through the metathesis reactions of [(18-crown-6)K]{sub 3}Fe(CN){sub 6} with LnX{sub 3}(DMF){sub n} (X = Cl or NO{sub 3}). Anhydrous DMF solutions of LnX{sub 3}(DMF){sub n} were prepared at room temperature from LnCl{sub 3} or LnX{sub 3} {center_dot} nH{sub 2}O under a dynamic vacuum. All compounds were characterized by IR, X-raymore » powder diffraction (except for 10), and single crystal X-ray diffraction (except for 2, 7, 10). Infrared spectra reveal that a monotonic, linear relationship exists between the ionic radius of the lanthanide and the {nu}{sub {mu}-CN} stretching frequency of 1-10, 12-15 while 11 deviates slightly from the ionic radius relationship. X-ray powder diffraction data are in agreement with powder patterns calculated from single crystal X-ray diffraction results, a useful alternative for bulk sample confirmation when elemental analysis data are difficult to obtain. Eight-coordinate Ln(III) metal centers are observed for all structures. trans-cyanide units of [Fe(CN){sub 6}]{sup 3-} formed isocyanide linkages to Ln(III) resulting in one-dimensional polymeric chains. Structures of compounds 1-9 and 11 are isomorphous, crystallizing in the space group C2/c. Structures of compounds 12-15 are also isomorphous, crystallizing in the space group P2/n. One unique polymeric chain exists in the structures of 1-9 and 11 while two unique polymeric chains exist in structures of 12-15. One of the polymeric chains of 12-15 is similar to that observed for 1-9, 11 while the other is more distorted and has a shorter Ln-Fe distance. Magnetic susceptibility measurements for compounds 3-6, 8, 11 were performed on polycrystalline samples of the compounds.« less

Phase Imaging: A Compressive Sensing Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, Sebastian; Stevens, Andrew; Browning, Nigel D.

Since Wolfgang Pauli posed the question in 1933, whether the probability densities |Ψ(r)|² (real-space image) and |Ψ(q)|² (reciprocal space image) uniquely determine the wave function Ψ(r) [1], the so called Pauli Problem sparked numerous methods in all fields of microscopy [2, 3]. Reconstructing the complete wave function Ψ(r) = a(r)e-iφ(r) with the amplitude a(r) and the phase φ(r) from the recorded intensity enables the possibility to directly study the electric and magnetic properties of the sample through the phase. In transmission electron microscopy (TEM), electron holography is by far the most established method for phase reconstruction [4]. Requiring a highmore » stability of the microscope, next to the installation of a biprism in the TEM, holography cannot be applied to any microscope straightforwardly. Recently, a phase retrieval approach was proposed using conventional TEM electron diffractive imaging (EDI). Using the SAD aperture as reciprocal-space constraint, a localized sample structure can be reconstructed from its diffraction pattern and a real-space image using the hybrid input-output algorithm [5]. We present an alternative approach using compressive phase-retrieval [6]. Our approach does not require a real-space image. Instead, random complimentary pairs of checkerboard masks are cut into a 200 nm Pt foil covering a conventional TEM aperture (cf. Figure 1). Used as SAD aperture, subsequently diffraction patterns are recorded from the same sample area. Hereby every mask blocks different parts of gold particles on a carbon support (cf. Figure 2). The compressive sensing problem has the following formulation. First, we note that the complex-valued reciprocal-space wave-function is the Fourier transform of the (also complex-valued) real-space wave-function, Ψ(q) = F[Ψ(r)], and subsequently the diffraction pattern image is given by |Ψ(q)|2 = |F[Ψ(r)]|2. We want to find Ψ(r) given a few differently coded diffraction pattern measurements yn = |F[HnΨ(r)]|2, where the matrices Hn encode the mask structure of the aperture. This is a nonlinear inverse problem, but has been shown to be solvable even in the underdetermined case [6]. Since each diffraction pattern yn contains diffraction information from selected regions of the same sample, the differences in each pattern contain local phase information, which can be combined to form a full estimate of the real-space wave-function[7]. References: [1] W. Pauli in “Die allgemeinen Prinzipien der Wellenmechanik“, ed. H Geiger and W Scheel, (Julius Springer, Berlin). [2] A. Tonomura, Rev. Mod. Phys. 59 (1987), p. 639. [3] J. Miao et al, Nature 400 (1999), p. 342. [4] H. Lichte et al, Annu. Rev. Mater. Res. 37 (2007), p. 539. [5] J. Yamasaki et al, Appl. Phys. Lett. 101 (2012), 234105. [6] P Schniter and S Rangan. Signal Proc., IEEE Trans. on. 64(4), (2015), pp. 1043. [7] Supported by the Chemical Imaging, Signature Discovery, and Analytics in Motion initiatives at PNNL. PNNL is operated by Battelle Memorial Inst. for the US DOE; contract DE-AC05-76RL01830.« less

Thaumatin crystallization aboard the International Space Station using liquid-liquid diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN).

PubMed

Barnes, Cindy L; Snell, Edward H; Kundrot, Craig E

2002-05-01

This paper reports results from the first biological crystal-growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor-diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from 77 to 273 K in about 4 d, about the same time it took to warm from 273 to 293 K. The temperature within the EGN was 293-297 K for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space-grown crystal extended to 1.28 A, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground-control crystal was only 1.47 A. It is not clear if the difference in diffraction limit arises from factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that the EGN on the ISS can be used to produce space-grown crystals that diffract to high resolution.

Thaumatin Crystallization Aboard the International Space Station Using Liquid-Liquid Diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN)

NASA Technical Reports Server (NTRS)

Kundrot, Craig; Barnes, Cindy L.; Snell, Edward H.; Stinson, Thomas N. (Technical Monitor)

2002-01-01

This paper reports results from the first biological crystal growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different Volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from -196 C to 0 C in about four days, about the same time it took to warm from 0 C to 20 C. The temperature within the EGN was 20 - 24 C for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space grown crystal extended to 1.28 Angstroms, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground control crystal was only 1.47 Angstroms. It is not clear if the difference in diffraction limit is due to factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that EGN on the ISS can be used to produce space grown crystals that diffract to high resolution.

Single phase Pb0.7Bi0.3Fe0.65Nb0.35O3 multiferroic: Neutron diffraction, impedance and modulus studies

NASA Astrophysics Data System (ADS)

Dadami, Sunanda T.; Matteppanvar, Shidaling; Shivaraja, I.; Rayaprol, Sudhindra; Deshpande, S. K.; Angadi, Basavaraj

2018-04-01

The Pb0.7Bi0.3Fe0.65Nb0.35O3 (PBFNO) multiferroic solid solution was synthesized by using single step solid state reaction method. Single phase formation was confirmed through room temperature (RT) X Ray Diffraction (XRD) and Neutron Diffraction (ND). Rietveld refinement was used to perform the structural analysis using FullProf Suite program. RT XRD and ND patterns well fitted with monoclinic structure (Cm space group) and cell parameters from the ND data are found to be a = 5.6474(4) Å, b = 5.6415(3) Å, c = 3.9992(3) Å and β = 89.95(2)°. ND data at RT exhibits G-type antiferromagnetic structure. The electrical properties (impedance and modulus) of PBFNO were studied as a function of frequency (100 Hz - 5 MHz) and temperature (133 K - 293 K) by Impedance spectroscopy technique. Impedance and modulus spectroscopy studies confirm the contribution to the conductivity is from grains only and the relaxation is of non-Debye type. The PBFNO sample exhibits negative temperature coefficient of resistance (NTCR) behaviour. PBFNO is found be a potential candidate for RT applications.

Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi

Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 Mmore » sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.« less

Thermoelectric properties and thermal stability of Bi-doped PbTe single crystal

NASA Astrophysics Data System (ADS)

Chen, Zhong; Li, Decong; Deng, Shuping; Tang, Yu; Sun, Luqi; Liu, Wenting; Shen, Lanxian; Yang, Peizhi; Deng, Shukang

2018-06-01

In this study, n-type Bi-doped single-crystal PbTe thermoelectric materials were prepared by melting and slow cooling method according to the stoichiometric ratio of Pb:Bi:Te = 1-x:x:1 (x = 0, 0.1, 0.15, 0.2, 0.25). The X-ray diffraction patterns of Pb1-xBixTe samples show that all main diffraction peaks are well matched with the PbTe matrix, which has a face-centered cubic structure with the space group Fm 3 bar m . Electron probe microanalysis reveals that Pb content decreases gradually, and Te content remains invariant basically with the increase of Bi content, indicating that Bi atoms are more likely to replace Pb atoms. Thermal analysis shows that the prepared samples possess relatively high thermal stability. Simultaneously, transmission electron microscopy and selected area electron diffraction pattern indicate that the prepared samples have typical single-crystal structures with good mechanical properties. Moreover, the electrical conductivity of the prepared samples improved significantly compared with that of the pure sample, and the maximum ZT value of 0.84 was obtained at 600 K by the sample with x = 0.2.

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

CFA-4 - a fluorinated metal-organic framework with exchangeable interchannel cations.

PubMed

Fritzsche, J; Grzywa, M; Denysenko, D; Bon, V; Senkovska, I; Kaskel, S; Volkmer, D

2017-05-23

The syntheses and crystal structures of the fluorinated linker 1,4-bis(3,5-bis(trifluoromethyl)-1H-pyrazole-4-yl)benzene (H 2 -tfpb; 1) and the novel metal-organic framework family M[CFA-4] (Coordination Framework Augsburg University-4), M[Cu 5 (tfpb) 3 ] (M = Cu(i), K, Cs, Ca(0.5)), are described. The ligand 1 is fully characterized by single crystal X-ray diffraction, photoluminescence-, NMR-, IR spectroscopy, and mass spectrometry. The copper(i)-containing MOF crystallizes in the hexagonal crystal system within the chiral space group P6 3 22 (no. 182) and the unit cell parameters are as follows: a = 23.630(5) Å, c = 41.390(5) Å, V = 20 015(6) Å 3 . M[CFA-4] features a porous 3-D structure constructed from pentanuclear copper(i) secondary building units {Cu(pz) 6 } - (pz = pyrazolate). Cu(I)[CFA-4] is fully characterized by synchrotron single crystal X-ray diffraction, thermogravimetric analysis, variable temperature powder X-ray diffraction, IR spectroscopy, photoluminescence and gas sorption measurements. Moreover, thermal stability and gas sorption properties of K[CFA-4] and Cu(I)[CFA-4] are compared.

Purification, crystallization and X-ray diffraction analysis of a novel ring-cleaving enzyme (BoxC{sub C}) from Burkholderia xenovorans LB400

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bains, Jasleen; Boulanger, Martin J., E-mail: mboulang@uvic.ca

2008-05-01

Preliminary X-ray diffraction studies of a novel ring-cleaving enzyme from B. xenovorans LB400 encoded by the benzoate-oxidation (box) pathway. The assimilation of aromatic compounds by microbial species requires specialized enzymes to cleave the thermodynamically stable ring. In the recently discovered benzoate-oxidation (box) pathway in Burkholderia xenovorans LB400, this is accomplished by a novel dihydrodiol lyase (BoxC{sub C}). Sequence analysis suggests that BoxC{sub C} is part of the crotonase superfamily but includes an additional uncharacterized region of approximately 115 residues that is predicted to mediate ring cleavage. Processing of X-ray diffraction data to 1.5 Å resolution revealed that BoxC{sub C} crystallizedmore » with two molecules in the asymmetric unit of the P2{sub 1}2{sub 1}2{sub 1} space group, with a solvent content of 47% and a Matthews coefficient of 2.32 Å{sup 3} Da{sup −1}. Selenomethionine BoxC{sub C} has been purified and crystals are currently being refined for anomalous dispersion studies.« less

On the novel double perovskites A2Fe(Mn0.5W0.5)O6 (A= Ca, Sr, Ba). Structural evolution and magnetism from neutron diffraction data

NASA Astrophysics Data System (ADS)

García-Ramos, Crisanto A.; Larrégola, Sebastián; Retuerto, María; Fernández-Díaz, María Teresa; Krezhov, Kiril; Alonso, José Antonio

2018-06-01

New A2Fe(Mn0.5W0.5)O6 (A = Ca, Sr, Ba) double perovskite oxides have been prepared by ceramic techniques. X-ray diffraction (XRD) complemented with neutron powder diffraction (NPD) indicate a structural evolution from monoclinic (space group P21/n) for A = Ca to cubic (Fm-3m) for A = Sr and finally to hexagonal (P63/mmc) for A = Ba as the perovskite tolerance factor increases with the A2+ ionic size. The three oxides present different tilting schemes of the FeO6 and (Mn,W)O6 octahedra. NPD data also show evidence in all cases of a considerable anti-site disordering, involving the partial occupancy of Fe positions by Mn atoms, and vice-versa. Magnetic susceptibility data show magnetic transitions below 50 K characterized by a strong irreversibility between ZFC and FC susceptibility curves. The A = Ca perovskite shows a G-type magnetic structure, with weak ordered magnetic moments due to the mentioned antisite disordering. Interesting magnetostrictive effects are observed for the Sr perovskite below 10 K.

Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory.

PubMed

Musumeci, P; Moody, J T; Scoby, C M

2008-10-01

Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10(7)-10(8) electrons packed in bunches of approximately 100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics.

Crystal structure determination of new antimitotic agent bis(p-fluorobenzyl)trisulfide.

PubMed

An, Haoyun; Hu, Xiurong; Gu, Jianming; Chen, Linshen; Xu, Weiming; Mo, Xiaopeng; Xu, Wanhong; Wang, Xiaobo; Xu, Xiao

2008-01-01

The purpose of this research was to investigate the physical characteristics and crystalline structure of bis(p-fluorobenzyl)trisulfide, a new anti-tumor agent. Methods used included X-ray single crystal diffraction, X-ray powder diffraction (XRPD), Fourier-transform infrared (FT-IR) spectroscopy, differential scanning calorimetric (DSC) and thermogravimetric (TG) analyses. The findings obtained with X-ray single crystal diffraction showed that a monoclinic unit cell was a = 12.266(1) A, b = 4.7757(4) A, c = 25.510(1) A, beta = 104.25(1) degrees ; cell volume = 1,448.4(2) A(3), Z = 4, and space group C2/c. The XRPD studies of the four crystalline samples, obtained by recrystallization from four different solvents, indicated that they had the same diffraction patterns. The diffraction pattern stimulated from the crystal structure data is in excellent agreement with the experimental results. In addition, the identical FT-IR spectra of the four crystalline samples revealed absorption bands corresponding to S-S and C-S stretching as well as the characteristic aromatic substitution. Five percent weight loss at 163.3 degrees C was observed when TG was used to study the decomposition process in the temperature range of 20-200 degrees C. DSC also allowed for the determination of onset temperatures at 60.4(1)-60.7(3) degrees C and peak temperatures at 62.1(3)-62.4(3) degrees C for the four crystalline samples studied. The results verified that the single crystal structure shared the same crystal form with the four crystalline samples investigated.

The significance of Bragg's law in electron diffraction and microscopy, and Bragg's second law.

PubMed

Humphreys, C J

2013-01-01

Bragg's second law, which deserves to be more widely known, is recounted. The significance of Bragg's law in electron diffraction and microscopy is then discussed, with particular emphasis on differences between X-ray and electron diffraction. As an example of such differences, the critical voltage effect in electron diffraction is described. It is then shown that the lattice imaging of crystals in high-resolution electron microscopy directly reveals the Bragg planes used for the imaging process, exactly as visualized by Bragg in his real-space law. Finally, it is shown how in 2012, for the first time, on the centennial anniversary of Bragg's law, single atoms have been identified in an electron microscope using X-rays emitted from the specimen. Hence atomic resolution X-ray maps of a crystal in real space can be formed which give the positions and identities of the different atoms in the crystal, or of a single impurity atom in the crystal.

Atomic study on the ordered structure in Al melts induced by liquid/substrate interface with Ti solute

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, H. L.; Han, Y. F., E-mail: yfhan@sjtu.edu.cn, E-mail: bdsun@sjtu.edu.cn; Zhou, W.

2015-01-26

Atomic ordering in Al melts induced by liquid/substrate interface with Ti solute was investigated by ab initio molecular dynamics simulations and in-situ synchrotron X-ray diffraction. It is predicted that deformed nanoscale ordering Al layers with a rhombohedral-centered hexagonal structure (R3{sup ¯}m space group) instead of the intrinsic fcc structure (Fm3{sup ¯}m space group) form on substrate at temperature above Al liquids. With Al atoms stacking away from the interface, the ordering structure reaches a critical thickness, which inhibits the consecutive stacking of Al atoms on substrates. The locally stacking reconstruction induced by Ti atom relieves the accumulated elastic strain energymore » in ordered Al layers, facilitating fully heterogeneous nucleation on substrate beyond the deformed ordering Al layer around the melting point. The roles of liquid/substrate interface with Ti solute in the physical behavior of heterogeneous nucleation on substrate were discussed.« less

Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke

2005-01-01

Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less

Crystallization of Chicken Egg-White Lysozyme from Ammonium Sulfate

NASA Technical Reports Server (NTRS)

Forsythe, Elizabeth L.; Snell, Edward H.; Pusey, Marc L.

1997-01-01

Chicken egg-white lysozyme was crystallized from ammonium sulfate over the pH range 4.0-7.8, with protein concentrations from 100 to 150 mg/ml. Crystals were obtained by vapor-diffusion or batch-crystallization methods. The protein crystallized in two morphologies with an apparent morphology dependence on temperature and protein concentration. In general, tetragonal crystals could be grown by lowering the protein concentration or temperature. Increasing the temperature or protein concentration resulted in the growth of orthorhombic crystals. Representative crystals of each morphology were selected for X-ray analysis. The tetragonal crystals belonged to the P4(sub 3)2(sub 1)2 space group with crystals grown at ph 4.4 having unit-cell dimensions of a = b = 78.7 1, c=38.6 A and diffracting to beyond 2.0 A. The orthorhombic crystals, grown at pH 4.8, were of space group P2(sub 1)2(sub 1)2 and had unit-cell dimensions of a = 30.51, b = 56.51 and c = 73.62 A.

A comparative study on the crystal structure of bicycle analogues to the natural phytotoxin helminthosporins

NASA Astrophysics Data System (ADS)

Barbosa, Luiz Cláudio de Almeida; Teixeira, Robson Ricardo; Nogueira, Leonardo Brandão; Maltha, Celia Regina Alvares; Doriguetto, Antônio Carlos; Martins, Felipe Terra

2016-02-01

Herein we described structural insights of a series of analogues to helminthosporin phytotoxins. The key reaction used to prepare the compounds corresponded to the [3 + 4] cycloaddition between the oxyallyl cation generated from 2,4-dibromopentan-3-one and different furans. Their structures were confirmed upon IR, NMR and X-ray diffraction analyses. While bicycles 7, 8 and 9 crystallize in the centrosymmetric monoclinic space group P21/c, compound 10 was solved in the noncentrosymmetric orthorhombic space group P212121. The solid materials obtained were shown to be racemic crystals (7, 8, 9) or racemic conglomerate (10). In all compounds, there is formation of a bicycle featured by fused tetrahydropyranone and 2,5-dihydrofuran rings. They adopt chair and envelope conformations, respectively. Crystal packing of all compounds is stabilized through C-H•••O contacts. Conformational aspects as well as similarities and differences among the crystal structures of the synthesized analogues are discussed.

Structural study of polymorphism in methylprednisolone aceponate

NASA Astrophysics Data System (ADS)

Knyazev, A. V.; Somov, N. V.; Shipilova, A. S.; Gusarova, E. V.; Knyazeva, S. S.; Stepanova, O. V.; Chuprunov, E. V.

2017-08-01

The crystal structures of methylprednisolone aceponate were determined by X-ray diffraction analysis at temperatures 90 K and 150 K: space group P212121, a = 14.8592(2), b = 19.6844(5), c = 26.1626(4) Å, Z = 12; R = 0.0598 (T = 90 K); space group P212121, a = 6.57348(14), b = 14.8295(3), c = 26.2214(5) Å, Z = 4; R = 0.0518 (T = 150 K). Features of structural changes in the phase transition were revealed. The abrupt change in the unit cell parameters in the phase transition was shown by low-temperature X-ray powder. The methods of degree of invariance of crystal electron density and molecular Voronoi-Dirichlet polyhedra were used for the analysis of polymorphism in methylprednisolone aceponate. The atomic structure at 90 K have a translational pseudosymmetry of electron density η = 0.329(1). The decrease of number of intermolecular contacts in the high-temperature modification due to rupture of intermolecular non-valence contacts C/O was observed.

Expression, crystallization and preliminary crystallographic analysis of the extracellular IgV-like domain of the human natural killer cell inhibitory receptor p75/AIRM1.

PubMed

Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A

2003-10-01

p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.

Purification, crystallization and preliminary X-ray analysis of the BseCI DNA methyltransferase from Bacillus stearothermophilus in complex with its cognate DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary

2007-01-01

The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less

TIMo/sub 2/ /SUP IV/ P/sub 3/O/sub 12/: a molybdenophosphate with a tunnel structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leclaire, A.; Monier, J.C.; Raveau, B.

1985-10-01

A molybdenophosphate, TIMo/sub 2/ /SUP IV/ P/sub 3/O/sub 12/, with an original tunnel structure, has been isolated. Its structure has been determined by X-ray diffraction on a single crystal. It crystallizes in the orthorhombic system with a = 8.836(1), b = 9.255(1), c = 12.288(1) A, possible space groups Pbcm and Pbc2/sub 1/ with /ZETA/ = 4. The structure was solved and refined in the centrosymmetric space group Pbcm. The host lattice ''Mo/sub 3/P/sub 3/O/sub 12/'' is built up from corner-sharing octahedra and tetrahedra and forms tunnels running along the b axis and cages where the TI+ ions are located.more » The relationships of this framework wit that of the phosphate tungsten bronze CsP/sub 8/W/sub 8/O/sub 40/ and that of the hexagonal tungsten bronze are discussed.« less

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

Physical and electrical properties of SrTiO3 and SrZrO3

NASA Astrophysics Data System (ADS)

Fashren Muhamad, Norhizatol; Aina Maulat Osman, Rozana; Sobri Idris, Mohd; Yasin, Mohd Najib Mohd

2017-11-01

Perovskite type oxide strontium titanate (SrTiO3) and strontium zirconate (SrZrO3) ceramic powder has been synthesized using conventional solid state reaction method. The powders were mixed and ground undergone calcinations at 1400°C for 12 h and sintered at 1550°C for 5h. X-ray Diffraction exposes physical properties SrTiO3 which exhibit cubic phase (space group: pm-3m) at room temperature meanwhile SrZrO3 has Orthorhombic phase (space group: pnma). The electrical properties such as dielectric constant (ɛr), dielectric loss (tan δ), and conductivity (σ) were studied in variation temperature and frequency. High dielectric constant of SrTiO3 and SrZrO3 were observed at 10 kHz for both samples about 240 and 21 respectively at room temperature. The dielectric loss of SrTiO3 and SrZrO3 is very low loss value approximately 0.00076 and 0.67512 indicates very good dielectric.

Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

Diffractometer data collecting method and apparatus

DOEpatents

Steinmeyer, P.A.

1991-04-16

Diffractometer data is collected without the use of a movable receiver. A scanning device, positioned in the diffractometer between a sample and detector, varies the amount of the beam diffracted from the sample that is received by the detector in such a manner that the beam is detected in an integrated form. In one embodiment, a variable diameter beam stop is used which comprises a drop of mercury captured between a pair of spaced sheets and disposed in the path of the diffracted beam. By varying the spacing between the sheets, the diameter of the mercury drop is varied. In another embodiment, an adjustable iris diaphragm is positioned in the path of the diffracted beam and the iris opening is adjusted to control the amount of the beam reaching the detector. 5 figures.

Diffractometer data collecting method and apparatus

DOEpatents

Steinmeyer, Peter A.

1991-04-16

Diffractometer data is collected without the use of a movable receiving s. A scanning device, positioned in the diffractometer between a sample and detector, varies the amount of the beam diffracted from the sample that is received by the detector in such a manner that the beam is detected in an integrated form. In one embodiment, a variable diameter beam stop is used which comprises a drop of mercury captured between a pair of spaced sheets and disposed in the path of the diffracted beam. By varying the spacing between the sheets, the diameter of the mercury drop is varied. In another embodiment, an adjustable iris diaphragm is positioned in the path of the diffracted beam and the iris opening is adjusted to control the amount of the beam reaching the detector.

An integral equation method for calculating sound field diffracted by a rigid barrier on an impedance ground.

PubMed

Zhao, Sipei; Qiu, Xiaojun; Cheng, Jianchun

2015-09-01

This paper proposes a different method for calculating a sound field diffracted by a rigid barrier based on the integral equation method, where a virtual boundary is assumed above the rigid barrier to divide the whole space into two subspaces. Based on the Kirchhoff-Helmholtz equation, the sound field in each subspace is determined with the source inside and the boundary conditions on the surface, and then the diffracted sound field is obtained by using the continuation conditions on the virtual boundary. Simulations are carried out to verify the feasibility of the proposed method. Compared to the MacDonald method and other existing methods, the proposed method is a rigorous solution for whole space and is also much easier to understand.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chao, Tzu-Ling; Yang, Chen-I., E-mail: ciyang@thu.edu.tw

The preparations and properties of three new homochiral three-dimensional (3D) coordination polymers, [M(D-cam)(pyz)(H{sub 2}O){sub 2}]{sub n} (M=Co (1) and Ni (2); D-H{sub 2}cam=(+) D-camphoric acid; pyz=pyrazine) and [Mn{sub 2}(D-cam){sub 2}(H{sub 2}O){sub 2}] (3), under solvothermal conditions is described. Single-crystal X-ray diffraction analyses revealed that all of compounds are homochiral 3D structure. 1 and 2 are isostructural and crystallize in the trigonal space group P3{sub 2}21, while 3 crystallizes in monoclinic space group P2{sub 1}. The structure of 1 and 2 consists of metal-D-cam helical chains which are pillared with pyrazine ligands into a 3D framework structure and 3 features amore » 3D homochiral framework involving one-dimensional manganese-carboxylate chains that are aligned parallel to the b axis. Magnetic susceptibility data of all compounds were collected. The findings indicate that μ{sub 2}-pyrazine dominate weak antiferromagnetic coupling within 1 and 2, while 3 exhibits antiferromagnetic behavior through the carboxylate groups of D-cam ligand. -- Graphical abstract: The preparations and properties of three new homochiral three-dimensional (3D) coordination polymers, [M(D-cam)(pyz)(H{sub 2}O){sub 2}]{sub n} (M=Co (1) and Ni (2); D-H{sub 2}cam=(+) D-camphoric acid; pyz=pyrazine) and [Mn{sub 2}(D-cam){sub 2}(H{sub 2}O){sub 2}] (3), under solvothermal conditions is described. Single-crystal X-ray diffraction analyses revealed that all of compounds are homochiral 3D structure. 1 and 2 are isostructural and crystallize in the trigonal space group P3{sub 2}21, while 3 crystallizes in monoclinic space group P2{sub 1}. The structure of 1 and 2 consists of metal-D-cam helical chains which are pillared with pyrazine ligands into a 3D framework structure and 3 features a 3D homochiral framework involving one-dimensional manganese-carboxylate chains that are aligned parallel to the b axis. Magnetic susceptibility data of all compounds were collected. The findings indicate that μ{sub 2}-pyrazine dominate weak antiferromagnetic coupling within 1 and 2, while 3 exhibits antiferromagnetic behavior through the carboxylate groups of D-cam ligand. Highlights: • Three homochiral 3D coordination polymers were synthesized. • 1 and 2 are 3D structure with metal-D-cam helical chains pillared by pyrazine. • 3 shows a 3D homochiral framework involving 1D manganese-carboxylate chains. • Magnetic data analysis indicates that 1–3 exhibit weak antiferromagnetic coupling.« less

Coherent diffraction imaging: consistency of the assembled three-dimensional distribution.

PubMed

Tegze, Miklós; Bortel, Gábor

2016-07-01

The short pulses of X-ray free-electron lasers can produce diffraction patterns with structural information before radiation damage destroys the particle. From the recorded diffraction patterns the structure of particles or molecules can be determined on the nano- or even atomic scale. In a coherent diffraction imaging experiment thousands of diffraction patterns of identical particles are recorded and assembled into a three-dimensional distribution which is subsequently used to solve the structure of the particle. It is essential to know, but not always obvious, that the assembled three-dimensional reciprocal-space intensity distribution is really consistent with the measured diffraction patterns. This paper shows that, with the use of correlation maps and a single parameter calculated from them, the consistency of the three-dimensional distribution can be reliably validated.

Investigation of the effect of phase nonuniformities and the microwave field distribution on the electronic efficiency of a diffraction-radiation generator

NASA Astrophysics Data System (ADS)

Maksimov, P. P.; Tsvyk, A. I.; Shestopalov, V. P.

1985-10-01

The effect of local phase nonuniformities of the diffraction gratings and the field distribution of the open cavity on the electronic efficiency of a diffraction-radiation generator (DRG) is analyzed numerically on the basis of a self-consistent system of nonlinear stationary equations for the DRG. It is shown that the interaction power and efficiency of a DRG can be increased by the use of an open cavity with a nonuniform diffraction grating and a complex form of microwave field distribution over the interaction space.

GAPD: a GPU-accelerated atom-based polychromatic diffraction simulation code.

PubMed

E, J C; Wang, L; Chen, S; Zhang, Y Y; Luo, S N

2018-03-01

GAPD, a graphics-processing-unit (GPU)-accelerated atom-based polychromatic diffraction simulation code for direct, kinematics-based, simulations of X-ray/electron diffraction of large-scale atomic systems with mono-/polychromatic beams and arbitrary plane detector geometries, is presented. This code implements GPU parallel computation via both real- and reciprocal-space decompositions. With GAPD, direct simulations are performed of the reciprocal lattice node of ultralarge systems (∼5 billion atoms) and diffraction patterns of single-crystal and polycrystalline configurations with mono- and polychromatic X-ray beams (including synchrotron undulator sources), and validation, benchmark and application cases are presented.

A novel multi-detection technique for three-dimensional reciprocal-space mapping in grazing-incidence X-ray diffraction.

PubMed

Schmidbauer, M; Schäfer, P; Besedin, S; Grigoriev, D; Köhler, R; Hanke, M

2008-11-01

A new scattering technique in grazing-incidence X-ray diffraction geometry is described which enables three-dimensional mapping of reciprocal space by a single rocking scan of the sample. This is achieved by using a two-dimensional detector. The new set-up is discussed in terms of angular resolution and dynamic range of scattered intensity. As an example the diffuse scattering from a strained multilayer of self-assembled (In,Ga)As quantum dots grown on GaAs substrate is presented.

Growth, nonlinear optical, thermal, dielectric and laser damage threshold studies of semiorganic crystal: monohydrate piperazine hydrogen phosphate.

PubMed

Krishnan, P; Gayathri, K; Bhagavannarayana, G; Gunasekaran, S; Anbalagan, G

2013-02-01

Monohydrate piperazine hydrogen phosphate (MPHP), a semi organic nonlinear optical material has been synthesized and single crystals were grown from aqueous solution by slow evaporation technique. Single crystal X-ray diffraction study on grown crystal reveals that they belong to monoclinic crystal system with space group P2(1)/c; (a=6.39Å; b=12.22Å; c=11.16Å; β=97.14°; V=864Å(3)). The structural perfection of the grown crystal was analyzed by high-resolution X-ray diffraction (HRXRD) rocking curve measurements. FTIR spectrum confirms the presence of the functional groups in synthesized material. UV-Vis spectrum indicates that the crystal is transparent in the entire visible region with a lower cut off wavelength of 387 nm. The variation of dielectric properties of the grown crystal with respect to frequency has been investigated at different temperatures. Thermal analysis carried out on the MPHP crystal shows that the crystal is stable up to 135°C. Relative powder second harmonic generation efficiency tested by Kurtz-Perry powder technique, which was about 0.638 times that of Potassium dihydrogen phosphate. Copyright © 2012 Elsevier B.V. All rights reserved.

A novel conformation of gel grown biologically active cadmium nicotinate

NASA Astrophysics Data System (ADS)

Nair, Lekshmi P.; Bijini, B. R.; Divya, R.; Nair, Prabitha B.; Eapen, S. M.; Dileep Kumar, B. S.; Nishanth Kumar, S.; Nair, C. M. K.; Deepa, M.; Rajendra Babu, K.

2017-11-01

The elimination of toxic heavy metals by the formation of stable co-ordination compounds with biologically active ligands is applicable in drug designing. A new crystalline complex of cadmium with nicotinic acid is grown at ambient temperature using the single gel diffusion method in which the crystal structure is different from those already reported. Single crystal x-ray diffraction reveals the identity of crystal structure belonging to monoclinic system, P21/c space group with cell dimensions a = 17.220 (2) Å, b = 10.2480 (2) Å, c = 7.229(9) Å, β = 91.829(4)°. Powder x-ray diffraction analysis confirmed the crystallinity of the sample. The unidentate mode of co-ordination between the metal atom and the carboxylate group is supported by the Fourier Transform Infra Red spectral data. Thermal analysis ensures the thermal stability of the complex. Kinetic and thermodynamic parameters are also calculated. The stoichiometry of the complex is confirmed by the elemental analysis. The UV-visible spectral analysis shows the wide transparency window of the complex in the visible region. The band gap of the complex is found to be 3.92 eV. The complex shows excellent antibacterial and antifungal activity.

Overexpression, crystallization and preliminary X-ray crystallographic analysis of phosphopantetheine adenylyltransferase from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Ji Yong; Lee, Hyung Ho; Yoon, Hye Jin

2006-11-01

Phosphopantetheine adenylyltransferase from En. faecalis was crystallized and X-ray diffraction data were collected to 2.70 Å resolution. Phosphopantetheine adenylyltransferase, an essential enzyme in the coenzyme A biosynthetic pathway, catalyzes the reversible transfer of an adenylyl group from ATP to 4′-phosphopantetheine, yielding 3′-dephospho-CoA and pyrophosphate. Enterococcus faecalis PPAT has been overexpressed in Escherichia coli as a fusion with a C-terminal purification tag and crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium HEPES pH 7.5, 0.8 M sodium dihydrogen phosphate and 0.8 M potassium dihydrogen phosphate. X-ray diffraction data were collected to 2.70 Å at 100 K.more » The crystals belong to the primitive tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 160.81, c = 225.68 Å. Four copies of the hexameric molecule are likely to be present in the asymmetric unit, giving a crystal volume per protein weight (V{sub M}) of 3.08 Å{sup 3} Da{sup −1} and a solvent content of 60.1%.« less

1D cyanide complexes with 2-pyridinemethanol: Synthesis, crystal structures and spectroscopic properties

NASA Astrophysics Data System (ADS)

Sayın, Elvan; Kürkçüoğlu, Güneş Süheyla; Yeşilel, Okan Zafer; Hökelek, Tuncer

2015-12-01

Two new one-dimensional coordination polymers, [Cu(hmpH)2Pd(μ-CN)2(CN)2]n (1) and [Cu(hmpH)2Pt(μ-CN)2(CN)2]n (2), (hmpH = 2-pyridinemethanol), have been synthesized and characterized by vibrational (FT-IR and Raman) spectroscopy, single crystal X-ray diffraction, thermal and elemental analyses techniques. Single crystal X-ray diffraction analysis indicates that complexes 1 and 2 are isomorphous and isostructural, and crystallize in the triclinic system and P-1 space group. The Pd(II) or Pt(II) ions are four coordinated with four cyanide-carbon atoms in a square planar geometry. Cu(II) ion displays a distorted octahedral coordination by two N-atoms and two O-atoms of hmpH ligands, two bridging cyanide groups. In one dimensional structure of the complexes, [M(CN)4]2- (M = Pd(II) or Pt(II)) anions and [Cu(hmpH)2]2+ cations are linked via bridging cyanide ligands. In the complexes, the presence of intramolecular C-H⋯M (M = Pd(II) or Pt(II)) interactions with distance values of 3.00-2.95 Å are established, respectively.

Crystallization of recombinant Haemophilus influenzaee (P4) acid phosphatase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ou, Zhonghui; Felts, Richard L.; Reilly, Thomas J.

2006-05-01

Lipoprotein e (P4) is a class C acid phosphatase and a potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. Haemophilus influenzae infects the upper respiratory tract of humans and can cause infections of the middle ear, sinuses and bronchi. The virulence of the pathogen is thought to involve a group of surface-localized macromolecular components that mediate interactions at the host–pathogen interface. One of these components is lipoprotein e (P4), which is a class C acid phosphatase and amore » potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. The space group is P4{sub 2}2{sub 1}2, with unit-cell parameters a = 65.6, c = 101.4 Å, one protein molecule per asymmetric unit and 37% solvent content. This is the first report of the crystallization of a class C acid phosphatase.« less

Geometrically frustrated magnetic structures of the heavy-fermion compound CePdAl studied by powder neutron diffraction

NASA Astrophysics Data System (ADS)

Dönni, A.; Ehlers, G.; Maletta, H.; Fischer, P.; Kitazawa, H.; Zolliker, M.

1996-12-01

The heavy-fermion compound CePdAl with ZrNiAl-type crystal structure (hexagonal space group 0953-8984/8/50/043/img8) was investigated by powder neutron diffraction. The triangular coordination symmetry of magnetic Ce atoms on site 3f gives rise to geometrical frustration. CePdAl orders below 0953-8984/8/50/043/img9 with an incommensurate antiferromagnetic propagation vector 0953-8984/8/50/043/img10, and a longitudinal sine-wave (LSW) modulated spin arrangement. Magnetically ordered moments at Ce(1) and Ce(3) coexist with frustrated disordered moments at Ce(2). The experimentally determined magnetic structure is in agreement with group theoretical symmetry analysis considerations, calculated by the program MODY, which confirm that for Ce(2) an ordered magnetic moment parallel to the magnetically easy c-axis is forbidden by symmetry. Further low-temperature experiments give evidence for a second magnetic phase transition in CePdAl between 0.6 and 1.3 K. Magnetic structures of CePdAl are compared with those of the isostructural compound TbNiAl, where a non-zero ordered magnetic moment for the geometrically frustrated Tb(2) atoms is allowed by symmetry.

Reply to “Structural and magnetic behavior of the cubic oxyfluoride SrFeO{sub 2}F studied by neutron diffraction”

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clemens, Oliver, E-mail: oliver.clemens@kit.edu; Karlsruher Institut für Technologie, Institut für Nanotechnologie, Hermann-von-Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen; Berry, Frank J.

2015-03-15

In this article we comment on the results published by Thompson et al. (, J. Solid State Chem. 219 (2014) 173–178) on the crystal structure of SrFeO{sub 2}F, who claim the compound to crystallize in the cubic space group Pm-3m. We give a more detailed explanation of the determination of our previously reported structural model with Imma symmetry (Clemens et al., J. Solid State Chem. 206 (2013) 158–169), with addition of variable temperature XRD measurements with high counting time to provide unambiguous evidence for the Imma model being correct for our sample. - Graphical abstract: The crystal structure of SrFeO{submore » 2}F is discussed with regards to previous reports. - Highlights: • SrFeO{sub 2}F was synthesized by polymer based fluorination of SrFeO{sub 3}. • Evaluation of the diffraction data shows a pseudocubic cell metric. • Superstructure reflections at low d-spacings indicate deviation from cubic symmetry. • The phase transition temperature from orthorhombic to cubic was determined using variable temperature X-ray diffraction. • Results published by Thompson et al. are critically discussed with respect to those observations.« less

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

2005-04-01

Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

Structural characterization of titania by X-ray diffraction, photoacoustic, Raman spectroscopy and electron paramagnetic resonance spectroscopy.

PubMed

Kadam, R M; Rajeswari, B; Sengupta, Arijit; Achary, S N; Kshirsagar, R J; Natarajan, V

2015-02-25

A titania mineral (obtained from East coast, Orissa, India) was investigated by X-ray diffraction (XRD), photoacoustic spectroscopy (PAS), Raman and Electron Paramagnetic Resonance (EPR) studies. XRD studies indicated the presence of rutile (91%) and anatase (9%) phases in the mineral. Raman investigation supported this information. Both rutile and anatase phases have tetragonal structure (rutile: space group P4(2)/mnm, a=4.5946(1) Å, c=2.9597(1) Å, V=62.48(1) (Å)(3), Z=2; anatase: space group I4(1)/amd, 3.7848(2) Å, 9.5098(11) Å, V=136.22(2) (Å)(3), Z=4). The deconvoluted PAS spectrum showed nine peaks around 335, 370, 415,485, 555, 605, 659, 690,730 and 785 nm and according to the ligand field theory, these peaks were attributed to the presence of V(4+), Cr(3+), Mn(4+) and Fe(3+) species. EPR studies revealed the presence of transition metal ions V(4+)(d(1)), Cr(3+)(d(3)), Mn(4+)(d(3)) and Fe(3+)(d(5)) at Ti(4+) sites. The EPR spectra are characterized by very large crystal filed splitting (D term) and orthorhombic distortion term (E term) for multiple electron system (s>1) suggesting that the transition metal ions substitute the Ti(4+) in the lattice which is situated in distorted octahedral coordination of oxygen. The possible reasons for observation of unusually large D and E term in the EPR spectra of transition metal ions (S=3/2 and 5/2) are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

New metal-organic frameworks of [M(C6H5O7)(C6H6O7)(C6H7O7)(H2O)] . H2O (M=La, Ce) and [Ce2(C2O4)(C6H6O7)2] . 4H2O

NASA Astrophysics Data System (ADS)

Weng, Sheng-Feng; Wang, Yun-Hsin; Lee, Chi-Shen

2012-04-01

Two novel materials, [M(C6H5O7)(C6H6O7)(C6H7O7)(H2O)] . H2O (M=La(1a), Ce(1b)) and [Ce2(C2O4)(C6H6O7)2] . 4H2O (2), with a metal-organic framework (MOF) were prepared with hydrothermal reactions and characterized with photoluminescence, magnetic susceptibility, thermogravimetric analysis and X-ray powder diffraction in situ. The crystal structures were determined by single-crystal X-ray diffraction. Compound 1 crystallized in triclinic space group P1¯ (No. 2); compound 2 crystallized in monoclinic space group P21/c (No. 14). The structure of 1 is built from a 1D MOF, composed of deprotonated citric ligands of three kinds. Compound 2 contains a 2D MOF structure consisting of citrate and oxalate ligands; the oxalate ligand arose from the decomposition in situ of citric acid in the presence of CuII ions. Photoluminescence spectra of compounds 1b and 2 revealed transitions between the 5d1 excited state and two levels of the 4f1 ground state (2F5/2 and 2F7/2). Compounds 1b and 2 containing CeIII ion exhibit a paramagnetic property with weak antiferromagnetic interactions between the two adjacent magnetic centers.

Phase equilibria in the NaF-CdO-NaPO3 system at 873 K and crystal structure and physico-chemical characterizations of the new Na2CdPO4F fluorophosphate

NASA Astrophysics Data System (ADS)

Aboussatar, Mohamed; Mbarek, Aïcha; Naili, Houcine; El-Ghozzi, Malika; Chadeyron, Geneviève; Avignant, Daniel; Zambon, Daniel

2017-04-01

Isothermal sections of the diagram representing phase relationships in the NaF-CdO-NaPO3 system have been investigated by solid state reactions and powder X-ray diffraction. This phase diagram investigation confirms the polymorphism of the NaCdPO4 side component and the structure of the ß high temperature polymorph (orthorhombic, space group Pnma and unit cell parameters a=9.3118(2), b=7.0459(1), c=5.1849(1) Å has been refined. A new fluorophosphate, Na2CdPO4F, has been discovered and its crystal structure determined and refined from powder X-ray diffraction data. It exhibits a new 3D structure with orthorhombic symmetry, space group Pnma and unit cell parameters a=5.3731(1), b=6.8530(1), c=12.2691(2) Å. The structure is closely related to those of the high temperature polymorph of the nacaphite Na2CaPO4F and the fluorosilicate Ca2NaSiO4F but differs essentially in the cationic repartition since the structure is fully ordered with one Na site (8d) and one Cd site (4c). Relationships with other Na2MIIPO4F (MII=Mg, Ca, Mn, Fe, Co, Ni) have been examined and the crystal-chemical and topographical analysis of these fluorophosphates is briefly reviewed. IR, Raman, optical and 19F, 23Na, 31P MAS NMR characterizations of Na2CdPO4F have been investigated.

Electro-Optic Modulator.

DTIC Science & Technology

An electro - optic modulator is used to modulate coherent light beams by the application of an electric potential. It combines a Fabry-Perot etalon and...a diffraction grating in a single unit. An etalon is constructed with an electro - optic material between reflecting surfaces. A voltage applied...between alternate, spaced-apart electrodes of a metal grid attached to one reflecting surface induces a diffraction grating in the electro optic material. Light entering the etalon is diffracted, reflected and efficiently coupled out.

Analysis of the diffraction effects for a multi-view autostereoscopic three-dimensional display system based on shutter parallax barriers with full resolution

NASA Astrophysics Data System (ADS)

Meng, Yang; Yu, Zhongyuan; Jia, Fangda; Zhang, Chunyu; Wang, Ye; Liu, Yumin; Ye, Han; Chen, Laurence Lujun

2017-10-01

A multi-view autostereoscopic three-dimensional (3D) system is built by using a 2D display screen and a customized parallax-barrier shutter (PBS) screen. The shutter screen is controlled dynamically by address driving matrix circuit and it is placed in front of the display screen at a certain location. The system could achieve densest viewpoints due to its specially optical and geometric design which is based on concept of "eye space". The resolution of 3D imaging is not reduced compared to 2D mode by using limited time division multiplexing technology. The diffraction effects may play an important role in 3D display imaging quality, especially when applied to small screen, such as iPhone screen etc. For small screen, diffraction effects may contribute crosstalk between binocular views, image brightness uniformity etc. Therefore, diffraction effects are analyzed and considered in a one-dimensional shutter screen model of the 3D display, in which the numerical simulation of light from display pixels on display screen through parallax barrier slits to each viewing zone in eye space, is performed. The simulation results provide guidance for criteria screen size over which the impact of diffraction effects are ignorable, and below which diffraction effects must be taken into account. Finally, the simulation results are compared to the corresponding experimental measurements and observation with discussion.

Layered-structural monoclinic–orthorhombic perovskite La{sub 2}Ti{sub 2}O{sub 7} to orthorhombic LaTiO{sub 3} phase transition and their microstructure characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herrera, G., E-mail: manuel.herrera@enp.unam.mx; Departamento de Química Inorgánica, Universidad de Valencia, 46100 Burjasot, Valencia; Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, 04510 México D. F.

2014-03-01

The layered-structural ceramics, such as lanthanum titanate (La{sub 2}Ti{sub 2}O{sub 7}), have been known for their good temperature and low dielectric loss at microwave frequencies that make them good candidate materials for high frequency applications. However, few studies have been conducted on the synthesis optimization by sol gel reaction, in particular by acrylamide polymerization route. The interest in La{sub 2}Ti{sub 2}O{sub 7} ceramic has been greatly increased recently due to the effect of oriented grains. This anisotropy of the microstructure leads to anisotropy in dielectric, electrical and mechanical properties. In this study, grain oriented lanthanum titanate was produced by themore » sol–gel acrylamide polymerization route. The characterizations of the samples were achieved by thermal analysis, X-ray diffraction (XRD), scanning electron microscopy (SEM), atomic force microscopy (AFM), and transmission electron microscopy (TEM). X-ray diffraction indicates that the formation of monoclinic perovskite La{sub 2}Ti{sub 2}O{sub 7} nanocrystals is a necessary first step to obtain orthorhombic LaTiO{sub 3} nanocomposites (with space group Pbnm). In this work we identified that the monoclinic perovskite La{sub 2}Ti{sub 2}O{sub 7} with space group P2{sub 1} transforms its structure into one with the orthorhombic space group Cmc2{sub 1} at approximately 1073 K. The microstructure associated consisted of flaky monoclinic La{sub 2}Ti{sub 2}O{sub 7} nanocomposites in comparison with round-shaped LaTiO{sub 3} nanocomposites. - Highlights: • The flaky-like La{sub 2}Ti{sub 2}O{sub 7} compound was synthesized by sol–gel acrylamide route. • Simultaneous monitoring of the DTA and XRD with temperature was performed. • Phase transformation characterization of La{sub 2}Ti{sub 2}O{sub 7} has been carried out. • The variation of the La{sub 2}Ti{sub 2}O{sub 7} and LaTiO{sub 3} grain morphology has been compared.« less

Novel organic NLO material bis(N-phenylbiguanidium(1+)) oxalate - A combined X-ray diffraction, DSC and vibrational spectroscopic study of its unique polymorphism

NASA Astrophysics Data System (ADS)

Matulková, Irena; Císařová, Ivana; Vaněk, Přemysl; Němec, Petr; Němec, Ivan

2017-01-01

Three polymorphic modifications of bis(N-phenylbiguanidium(1+)) oxalate are reported, and their characterization is discussed in this paper. The non-centrosymmetric bis(N-phenylbiguanidium(1+)) oxalate (I), which was obtained from an aqueous solution at 313 K, belongs to the monoclinic space group Cc (a = 6.2560(2) Å, b = 18.6920(3) Å, c = 18.2980(5) Å, β = 96.249(1)°, V = 2127.0(1) Å3, Z = 4, R = 0.0314 for 4738 observed reflections). The centrosymmetric bis(N-phenylbiguanidium(1+)) oxalate (II) was obtained from an aqueous solution at 298 K and belongs to the monoclinic space group P21/n (a = 6.1335(3) Å, b = 11.7862(6) Å, c = 14.5962(8) Å, β = 95.728(2)°, V = 1049.90(9) Å3, Z = 4, R = 0.0420 for 2396 observed reflections). The cooling of the centrosymmetric phase (II) leads to the formation of bis(N-phenylbiguanidium(1+)) oxalate (III) (a = 6.1083(2) Å, b = 11.3178(5) Å, c = 14.9947(5) Å, β = 93.151(2)°, V = 1035.05(8) Å3, Z = 4, R = 0.0345 for 2367 observed reflections and a temperature of 110 K), which also belongs to the monoclinic space group P21/n. The crystal structures of the three characterized phases are generally based on layers of isolated N-phenylbiguanidium(1 +) cations separated by oxalate anions and interconnected with them by several types of N-H...O hydrogen bonds. The observed phases generally differ not only in their crystal packing but also in the lengths and characteristics of their hydrogen bonds. The thermal behaviour of the prepared compounds was studied using the DSC method in the temperature range from 90 K up to a temperature near the melting point of each crystal. The bis(N-phenylbiguanidium(1+)) oxalate (II) crystals exhibit weak reversible thermal effects on the DSC curve at 147 K (heating run). Further investigation of this effect, which was assigned to the isostructural phase transformation, was performed using FTIR, Raman spectroscopy and X-ray diffraction analysis in a wide temperature range.

Feasibility of a 30-meter space based laser transmitter

NASA Technical Reports Server (NTRS)

Berggren, R. R.; Lenertz, G. E.

1975-01-01

A study was made of the application of large expandable mirror structures in future space missions to establish the feasibility and define the potential of high power laser systems for such applications as propulsion and power transmission. Application of these concepts requires a 30-meter diameter, diffraction limited mirror for transmission of the laser energy. Three concepts for the transmitter are presented. These concepts include consideration of continuous as well as segmented mirror surfaces and the major stow-deployment categories of inflatable, variable geometry and assembled-in-space structures. The mirror surface for each concept would be actively monitored and controlled to maintain diffraction limited performance at 10.6 microns during operation. The proposed mirror configurations are based on existing aerospace state-of-the-art technology. The assembled-in-space concept appears to be the most feasible, at this time.

Structural evolution of calcite at high temperatures: Phase V unveiled

PubMed Central

Ishizawa, Nobuo; Setoguchi, Hayato; Yanagisawa, Kazumichi

2013-01-01

The calcite form of calcium carbonate CaCO3 undergoes a reversible phase transition between Rc and Rm at ~1240 K under a CO2 atmosphere of ~0.4 MPa. The joint probability density function obtained from the single-crystal X-ray diffraction data revealed that the oxygen triangles of the CO3 group in the high temperature form (Phase V) do not sit still at specified positions in the space group Rm, but migrate along the undulated circular orbital about carbon. The present study also shows how the room temperature form (Phase I) develops into Phase V through an intermediate form (Phase IV) in the temperature range between ~985 K and ~1240 K. PMID:24084871

Mapping the continuous reciprocal space intensity distribution of X-ray serial crystallography.

PubMed

Yefanov, Oleksandr; Gati, Cornelius; Bourenkov, Gleb; Kirian, Richard A; White, Thomas A; Spence, John C H; Chapman, Henry N; Barty, Anton

2014-07-17

Serial crystallography using X-ray free-electron lasers enables the collection of tens of thousands of measurements from an equal number of individual crystals, each of which can be smaller than 1 µm in size. This manuscript describes an alternative way of handling diffraction data recorded by serial femtosecond crystallography, by mapping the diffracted intensities into three-dimensional reciprocal space rather than integrating each image in two dimensions as in the classical approach. We call this procedure 'three-dimensional merging'. This procedure retains information about asymmetry in Bragg peaks and diffracted intensities between Bragg spots. This intensity distribution can be used to extract reflection intensities for structure determination and opens up novel avenues for post-refinement, while observed intensity between Bragg peaks and peak asymmetry are of potential use in novel direct phasing strategies.

Characterization of diffraction gratings scattering in uv and ir for space applications

NASA Astrophysics Data System (ADS)

Achour, Sakina; Kuperman-Le Bihan, Quentin; Etcheto, Pierre

2017-09-01

The use of Bidirectional Scatter Distribution Function (BSDF) in space industry and especially when designing telescopes is a key feature. Indeed when speaking about space industry, one can immediately think about stray light issues. Those important phenomena are directly linked to light scattering. Standard BSDF measurement goniophotometers often have a resolution of about 0.1° and are mainly working in or close to the visible spectrum. This resolution is far too loose to characterize ultra-polished surfaces. Besides, wavelength range of BSDF measurements for space projects needs to be done far from visible range. How can we measure BSDF of ultra-polished surfaces and diffraction gratings in the UV and IR range with high resolution? We worked on developing a new goniophometer bench in order to be able to characterize scattering of ultra-polished surfaces and diffraction gratings used in everyday space applications. This ten meters long bench was developed using a collimated beam approach as opposed to goniophotometer using focused beam. Sources used for IR characterization were CO2 (10.6?m) and Helium Neon (3.39?m) lasers. Regarding UV sources, a collimated and spatially filtered UV LED was used. The detection was ensure by a photomultiplier coupled with synchronous detection as well as a MCT InSb detector. The so-built BSDF measurement instrument allowed us to measure BSDF of ultra-polished surfaces as well as diffraction gratings with an angular resolution of 0.02° and a dynamic of 1013 in the visible range. In IR as well as in UV we manage to get 109 with same angular resolution of 0.02°. The 1m arm and translation stages allows us to measure samples up to 200mm. Thanks to such a device allowing ultra-polished materials as well as diffraction gratings scattering characterization, it is possible to implement those BSDF measurements into simulation software and predict stray light issues. This is a big help for space industry engineers to apprehend stray light due to surface finishes and to delete those effects before the whole project is done. We are now thinking of possible improvement on our optical bench to try to get dynamic in IR and UV similar to what we have in visible range (e.g. 1013).

Teaching Fraunhofer diffraction via experimental and simulated images in the laboratory

NASA Astrophysics Data System (ADS)

Peinado, Alba; Vidal, Josep; Escalera, Juan Carlos; Lizana, Angel; Campos, Juan; Yzuel, Maria

2012-10-01

Diffraction is an important phenomenon introduced to Physics university students in a subject of Fundamentals of Optics. In addition, in the Physics Degree syllabus of the Universitat Autònoma de Barcelona, there is an elective subject in Applied Optics. In this subject, diverse diffraction concepts are discussed in-depth from different points of view: theory, experiments in the laboratory and computing exercises. In this work, we have focused on the process of teaching Fraunhofer diffraction through laboratory training. Our approach involves students working in small groups. They visualize and acquire some important diffraction patterns with a CCD camera, such as those produced by a slit, a circular aperture or a grating. First, each group calibrates the CCD camera, that is to say, they obtain the relation between the distances in the diffraction plane in millimeters and in the computer screen in pixels. Afterwards, they measure the significant distances in the diffraction patterns and using the appropriate diffraction formalism, they calculate the size of the analyzed apertures. Concomitantly, students grasp the convolution theorem in the Fourier domain by analyzing the diffraction of 2-D gratings of elemental apertures. Finally, the learners use a specific software to simulate diffraction patterns of different apertures. They can control several parameters: shape, size and number of apertures, 1-D or 2-D gratings, wavelength, focal lens or pixel size.Therefore, the program allows them to reproduce the images obtained experimentally, and generate others by changingcertain parameters. This software has been created in our research group, and it is freely distributed to the students in order to help their learning of diffraction. We have observed that these hands on experiments help students to consolidate their theoretical knowledge of diffraction in a pedagogical and stimulating learning process.

Isolation, purification, crystallization and preliminary X-ray studies of two 30 kDa proteins from silkworm haemolymph.

PubMed

Pietrzyk, Agnieszka J; Bujacz, Anna; Łochyńska, Małgorzata; Jaskólski, Mariusz; Bujacz, Grzegorz

2011-03-01

Juvenile hormone-binding protein (JHBP) and the low-molecular-mass lipoprotein PBMHP-12 belong to a group of 30 kDa proteins that comprise the major protein component of the haemolymph specific to the fifth-instar larvae stage of the mulberry silkworm Bombyx mori L. Proteins from this group are often essential for the development of the insect. In a project aimed at crystallographic characterization of B. mori JHBP (BmJHBP), it was copurified together with PBMHP-12. Eventually, the two proteins were isolated and crystallized separately. The BmJHBP crystals were orthorhombic (space group C222(1)) and the PBMHP-12 crystals were triclinic. The crystals diffracted X-rays to 2.9 Å (BmJHBP) and 1.3 Å (PBMHP-12) resolution.

Wigner analysis of three dimensional pupil with finite lateral aperture

PubMed Central

Chen, Hsi-Hsun; Oh, Se Baek; Zhai, Xiaomin; Tsai, Jui-Chang; Cao, Liang-Cai; Barbastathis, George; Luo, Yuan

2015-01-01

A three dimensional (3D) pupil is an optical element, most commonly implemented on a volume hologram, that processes the incident optical field on a 3D fashion. Here we analyze the diffraction properties of a 3D pupil with finite lateral aperture in the 4-f imaging system configuration, using the Wigner Distribution Function (WDF) formulation. Since 3D imaging pupil is finite in both lateral and longitudinal directions, the WDF of the volume holographic 4-f imager theoretically predicts distinct Bragg diffraction patterns in phase space. These result in asymmetric profiles of diffracted coherent point spread function between degenerate diffraction and Bragg diffraction, elucidating the fundamental performance of volume holographic imaging. Experimental measurements are also presented, confirming the theoretical predictions. PMID:25836443

Diffraction of digital micromirror device gratings and its effect on properties of tunable fiber lasers.

PubMed

Chen, Xiao; Yan, Bin-bin; Song, Fei-jun; Wang, Yi-quan; Xiao, Feng; Alameh, Kamal

2012-10-20

A digital micromirror device (DMD) is a kind of widely used spatial light modulator. We apply DMD as wavelength selector in tunable fiber lasers. Based on the two-dimensional diffraction theory, the diffraction of DMD and its effect on properties of fiber laser parameters are analyzed in detail. The theoretical results show that the diffraction efficiency is strongly dependent upon the angle of incident light and the pixel spacing of DMD. Compared with the other models of DMDs, the 0.55 in. DMD grating is an approximate blazed state in our configuration, which makes most of the diffracted radiation concentrated into one order. It is therefore a better choice to improve the stability and reliability of tunable fiber laser systems.

Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry.

PubMed

Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

2017-04-01

X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La 3 Ga 5 SiO 14 ) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space-time modulation of an X-ray beam.

Opto-mechanical design and development of a 460mm diffractive transmissive telescope

NASA Astrophysics Data System (ADS)

Qi, Bo; Wang, Lihua; Cui, Zhangang; Bian, Jiang; Xiang, Sihua; Ma, Haotong; Fan, Bin

2018-01-01

Using lightweight, replicated diffractive optics, we can construct extremely large aperture telescopes in space.The transmissive primary significantly reduces the sensitivities to out of plane motion as compared to reflective systems while reducing the manufacturing time and costs. This paper focuses on the design, fabrication and ground demonstration of a 460mm diffractive transmissive telescope the primary F/# is 6, optical field of view is 0.2° imagine bandwidth is 486nm 656nm.The design method of diffractive optical system was verified, the ability to capture a high-quality image using diffractive telescope collection optics was tested.The results show that the limit resolution is 94lp/mm, the diffractive system has a good imagine performance with broad bandwidths. This technology is particularly promising as a means to achieve extremely large optical primaries from compact, lightweight packages.

Microchemical Analysis Of Space Operation Debris

NASA Technical Reports Server (NTRS)

Cummings, Virginia J.; Kim, Hae Soo

1995-01-01

Report discusses techniques used in analyzing debris relative to space shuttle operations. Debris collected from space shuttle, expendable launch vehicles, payloads carried by space shuttle, and payloads carried by expendable launch vehicles. Optical microscopy, scanning electron microscopy with energy-dispersive spectrometry, analytical electron microscopy with wavelength-dispersive spectrometry, and X-ray diffraction chosen as techniques used in examining samples of debris.

Deactivation of Zeolite Catalyst H-ZSM-5 during Conversion of Methanol to Gasoline: Operando Time- and Space-Resolved X-ray Diffraction.

PubMed

Rojo-Gama, Daniel; Mentel, Lukasz; Kalantzopoulos, Georgios N; Pappas, Dimitrios K; Dovgaliuk, Iurii; Olsbye, Unni; Lillerud, Karl Petter; Beato, Pablo; Lundegaard, Lars F; Wragg, David S; Svelle, Stian

2018-03-15

The deactivation of zeolite catalyst H-ZSM-5 by coking during the conversion of methanol to hydrocarbons was monitored by high-energy space- and time-resolved operando X-ray diffraction (XRD) . Space resolution was achieved by continuous scanning along the axial length of a capillary fixed bed reactor with a time resolution of 10 s per scan. Using real structural parameters obtained from XRD, we can track the development of coke at different points in the reactor and link this to a kinetic model to correlate catalyst deactivation with structural changes occurring in the material. The "burning cigar" model of catalyst bed deactivation is directly observed in real time.

Space Shuttle Underside Astronaut Communications Performance Evaluation

NASA Technical Reports Server (NTRS)

Hwu, Shian U.; Dobbins, Justin A.; Loh, Yin-Chung; Kroll, Quin D.; Sham, Catherine C.

2005-01-01

The Space Shuttle Ultra High Frequency (UHF) communications system is planned to provide Radio Frequency (RF) coverage for astronauts working underside of the Space Shuttle Orbiter (SSO) for thermal tile inspection and repairing. This study is to assess the Space Shuttle UHF communication performance for astronauts in the shadow region without line-of-sight (LOS) to the Space Shuttle and Space Station UHF antennas. To insure the RF coverage performance at anticipated astronaut worksites, the link margin between the UHF antennas and Extravehicular Activity (EVA) Astronauts with significant vehicle structure blockage was analyzed. A series of near-field measurements were performed using the NASA/JSC Anechoic Chamber Antenna test facilities. Computational investigations were also performed using the electromagnetic modeling techniques. The computer simulation tool based on the Geometrical Theory of Diffraction (GTD) was used to compute the signal strengths. The signal strength was obtained by computing the reflected and diffracted fields along the propagation paths between the transmitting and receiving antennas. Based on the results obtained in this study, RF coverage for UHF communication links was determined for the anticipated astronaut worksite in the shadow region underneath the Space Shuttle.

Modeling of Amorphous Calcium Carbonate

NASA Astrophysics Data System (ADS)

Sinha, Sourabh; Rez, Peter

2011-10-01

Many species (e.g. sea urchin) form amorphous calcium carbonate (ACC) precursor phases that subsequently transform into crystalline CaCO3. It is certainly possible that ACC might have up to 10 wt% Mg and ˜3 wt% of water. The structure of ACC and mechanisms by which it transforms to crystalline phase are still unknown. Our goal here is to determine an atomic structure model that is consistent with diffraction and IR measurements of ACC. For this purpose a calcite supercell with 24 formula units (120 atoms) was constructed. Various configurations with 6 Mg atoms substituting for Ca (6 wt%) and 3-5 H2O molecules (2.25- 3.75 wt%) inserted in the spaces between Ca atoms, were relaxed using VASP. Most noticeable effects were the tilts of CO3 groups and distortion of Ca sub-lattice, especially in the case of water. The distributions of nearest Ca-Ca distance and CO3 tilts were extracted from those configurations. We also performed the same analysis starting with aragonite. Sampling from above distributions we built models for amorphous calcite/aragonite of size ˜1700 nm^3. We found that the induced distortions were not enough to generate a diffraction pattern typical of an amorphous material. Next we studied diffraction pattern of several nano-crystallites as recent studies suggest that amorphous calcite might be composed of nano- crystallites. We could then generate a diffraction pattern that appeared similar to that from ACC, for a nano-crystallite of size ˜2 nm^3.

High resolution X-ray diffraction imaging of lead tin telluride

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Dobbyn, Ronald C.; Black, David; Burdette, Harold; Kuriyama, Masao; Spal, Richard; Simchick, Richard; Fripp, Archibald

1991-01-01

High resolution X-ray diffraction images of two directly comparable crystals of lead tin telluride, one Bridgman-grown on Space Shuttle STS 61A and the other terrestrially Bridgman-grown under similar conditions from identical material, present different subgrain structure. In the terrestrial, sample 1 the appearance of an elaborate array of subgrains is closely associated with the intrusion of regions that are out of diffraction in all of the various images. The formation of this elaborate subgrain structure is inhibited by growth in microgravity.

High Power Optical Coatings by Atomic Layer Deposition and Signatures of Laser-Induced Damage

DTIC Science & Technology

2012-08-28

diffraction angle 0 into crystal lattice spacing d by the Bragg condition, mX = 2d sin 0. Here X is the x - ray wavelength... angle x - ray diffraction (GAXRD) measurements, which were made at a fixed shallow incidence angle of 0.5°. Detector scans were done to measure the...was finished with 200 hafnia cycles m the fmal half period rather than 400. Crystallinity was measured by x - ray diffraction (XRD) with

Calculation reduction method for color digital holography and computer-generated hologram using color space conversion

NASA Astrophysics Data System (ADS)

Shimobaba, Tomoyoshi; Nagahama, Yuki; Kakue, Takashi; Takada, Naoki; Okada, Naohisa; Endo, Yutaka; Hirayama, Ryuji; Hiyama, Daisuke; Ito, Tomoyoshi

2014-02-01

A calculation reduction method for color digital holography (DH) and computer-generated holograms (CGHs) using color space conversion is reported. Color DH and color CGHs are generally calculated on RGB space. We calculate color DH and CGHs in other color spaces for accelerating the calculation (e.g., YCbCr color space). In YCbCr color space, a RGB image or RGB hologram is converted to the luminance component (Y), blue-difference chroma (Cb), and red-difference chroma (Cr) components. In terms of the human eye, although the negligible difference of the luminance component is well recognized, the difference of the other components is not. In this method, the luminance component is normal sampled and the chroma components are down-sampled. The down-sampling allows us to accelerate the calculation of the color DH and CGHs. We compute diffraction calculations from the components, and then we convert the diffracted results in YCbCr color space to RGB color space. The proposed method, which is possible to accelerate the calculations up to a factor of 3 in theory, accelerates the calculation over two times faster than the ones in RGB color space.

Application of a real-space three-dimensional image reconstruction method in the structural analysis of noncrystalline biological macromolecules enveloped by water in coherent x-ray diffraction microscopy.

PubMed

Kodama, Wataru; Nakasako, Masayoshi

2011-08-01

Coherent x-ray diffraction microscopy is a novel technique in the structural analyses of particles that are difficult to crystallize, such as the biological particles composing living cells. As water is indispensable for maintaining particles in functional structures, sufficient hydration of targeted particles is required during sample preparation for diffraction microscopy experiments. However, the water enveloping particles also contributes significantly to the diffraction patterns and reduces the electron-density contrast of the sample particles. In this study, we propose a protocol for the structural analyses of particles in water by applying a three-dimensional reconstruction method in real space for the projection images phase-retrieved from diffraction patterns, together with a developed density modification technique. We examined the feasibility of the protocol through three simulations involving a protein molecule in a vacuum, and enveloped in either a droplet or a cube-shaped water. The simulations were carried out for the diffraction patterns in the reciprocal planes normal to the incident x-ray beam. This assumption and the simulation conditions corresponded to experiments using x-ray wavelengths of shorter than 0.03 Å. The analyses demonstrated that our protocol provided an interpretable electron-density map. Based on the results, we discuss the advantages and limitations of the proposed protocol and its practical application for experimental data. In particular, we examined the influence of Poisson noise in diffraction patterns on the reconstructed three-dimensional electron density in the proposed protocol.

Space infrared telescope facility wide field and diffraction limited array camera (IRAC)

NASA Technical Reports Server (NTRS)

Fazio, G. G.

1986-01-01

IRAC focal plane detector technology was developed and studies of alternate focal plane configurations were supported. While any of the alternate focal planes under consideration would have a major impact on the Infrared Array Camera, it was possible to proceed with detector development and optical analysis research based on the proposed design since, to a large degree, the studies undertaken are generic to any SIRTF imaging instrument. Development of the proposed instrument was also important in a situation in which none of the alternate configurations has received the approval of the Science Working Group.

Ba 2TeO: A new layered oxytelluride

DOE PAGES

Besara, T.; Ramirez, D.; Sun, J.; ...

2015-02-01

For single crystals of the new semiconducting oxytelluride phase, Ba 2TeO, we synthesized from barium oxide powder and elemental tellurium in a molten barium metal flux. Ba 2TeO crystallizes in tetragonal symmetry with space group P4/nmm (#129), a=5.0337(1) Å, c=9.9437(4) Å, Z=2. The crystals were characterized by single crystal x-ray diffraction, heat capacity and optical measurements. Moreover, the optical measurements along with electronic band structure calculations indicate semiconductor behavior with a band gap of 2.93 eV. Resistivity measurements show that Ba 2TeO is highly insulating.

IR study of dickite-formamide intercalate, Al 2Si 2O 5(OH) 4-H 2NCOH

NASA Astrophysics Data System (ADS)

Zamama, M.; Knidiri, Mohamed

2000-05-01

Direct intercalation of formamide (FAM) in dickite occurs spontaneously when samples are treated by ultrason. The X-ray diffraction patterns show that this intercalation increases the d 001 spacing from 7.19 to 10.77 Å. It is concluded from infrared studies that hydrogen bonds are formed between CO groups of formamide and inner surface hydroxyls of dickite, indicated by the shift of the hydroxyl bands from 3708, 3654 cm -1 and 3622 for natural dickite to 3575, 3520, 3450 and 3612 cm -1 for FAM-intercalated dickite.

IR study of dickite-formamide intercalate, Al2Si2O5(OH)4-H2NCOH.

PubMed

Zamama, M; Knidiri, M

2000-05-01

Direct intercalation of formamide (FAM) in dickite occurs spontaneously when samples are treated by ultrason. The X-ray diffraction patterns show that this intercalation increases the d001 spacing from 7.19 to 10.77 A. It is concluded from infrared studies that hydrogen bonds are formed between C=O groups of formamide and inner surface hydroxyls of dickite, indicated by the shift of the hydroxyl bands from 3708, 3654 cm(-1) and 3622 for natural dickite to 3575, 3520, 3450 and 3612 cm(-1) for FAM-intercalated dickite.