Observation of defect-induced Photoresponse and charge carrier transport in single GeSe2 nanobelt devices

NASA Astrophysics Data System (ADS)

Mukherjee, Bablu; Tok, Eng Soon; Haur Sow, Chorng

2013-03-01

Single crystal GeSe2 nanobelts were grown using chemical vapor deposition techniques. Morphology of the nanostructures was characterized using scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffractometry (XRD) and Raman spectroscopy. Electronic transport properties, impedance spectroscopy, photoconductive characteristics and temperature-dependent electrical resistivity measurements were carried out on individual GeSe2 nanobelt devices. The photosensitivity of single GeSe2 nanobelt (NB) devices was examined with two different excitation wavelengths of laser beams with photon energies above band gap and at sub-band gap of the NB. A maximum photoconductive gain 106 % was achieved at a wavelength of 808 nm. The magnitude of the photocurrent and response time of the individual GeSe2 NB device indicate that the photoresponse could be attributed to the presence of isolated mid band gap defect levels. Temperature dependent photocurrent measurements indicate the rough estimation of the energy levels for the defect states. Localized photostudy shows that the large photoresponse of the device primarily occurs at the metal-NB contact regions. Department of Physics, 2 Science Drive 3, National University of Singapore (NUS), Singapore 117542

Synthesis of Copper-Antimony-Sulfide Nanocrystals for Solution-Processed Solar Cells.

PubMed

Suehiro, Satoshi; Horita, Keisuke; Yuasa, Masayoshi; Tanaka, Tooru; Fujita, Katsuhiko; Ishiwata, Yoichi; Shimanoe, Kengo; Kida, Tetsuya

2015-08-17

The p-type nanocrystals (NCs) of copper-based chalcogenides, such as CuInSe2 and Cu2ZnSnS4, have attracted increasing attention in photovoltaic applications due to their potential to produce cheap solution-processed solar cells. Herein, we report the synthesis of copper-antimony-sulfide (CAS) NCs with different crystal phases including CuSbS2, Cu3SbS4, and Cu12Sb4S13. In addition, their morphology, crystal phase, and optical properties were characterized using transmission electron microscopy, X-ray diffractometry, UV-vis-near-IR spectroscopy, and photoemission yield spectroscopy. The morphology, crystal phase, and electronic structure were significantly dependent on the chemical composition in the CAS system. Devices were fabricated using particulate films consisting of CAS NCs prepared by spin coating without a high-temperature treatment. The CAS NC-based devices exhibited a diode-like current-voltage characteristic when coupled with an n-type CdS layer. In particular, the CuSbS2 NC devices exhibited photovoltaic responses under simulated sunlight, demonstrating its applicability for use in solution-processed solar cells.

Different preparation methods and characterization of magnetic maghemite coated with chitosan

NASA Astrophysics Data System (ADS)

Hojnik Podrepšek, Gordana; Knez, Željko; Leitgeb, Maja

2013-06-01

The preparation of maghemite (γ-Fe2O3) micro- and nanoparticles coated with chitosan, used as carriers for immobilized enzymes, was investigated. γ-Fe2O3 nanoparticles were synthesized by coprecipitation of Fe2+ and Fe3+ ions in the presence of ammonium. They were coated with chitosan by the microemulsion process, suspension cross-linking technique, and covalent binding of chitosan on the γ-Fe2O3 surface. The methods distinguished the concentration of chitosan, concentration of acetic acid solution, concentration of a cross-linking agent, temperature of synthesis, pH of the medium, and time of synthesis. γ-Fe2O3 micro- and nanoparticles coated with chitosan prepared after three preparation methods were evaluated by scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy analysis, energy dispersive spectrometry, thermogravimetric analysis, differential scanning calorimetry analysis, vibrating sample magnetometry, dynamic light scattering, laser diffraction granulometry, and X-ray diffractometry. These positive attributes demonstrated that these magnetic micro- and nanoparticles coated with chitosan may be used as a promising carrier for further diverse biomedical applications.

Formation and morphology of Zn(2)Ti(3)O(8) powders using hydrothermal process without dispersant agent or mineralizer.

PubMed

Wang, Cheng-Li; Hwang, Weng-Sing; Chang, Kuo-Ming; Ko, Horng-Huey; Hsi, Chi-Shiung; Huang, Hong-Hsin; Wang, Moo-Chin

2011-01-28

Synthesis of Zn(2)Ti(3)O(8) powders for attenuating UVA using TiCl(4), Zn(NO(3))(2)·6H(2)O and NH(4)OH as precursor materials by hydrothermal process has been investigated. The X-ray diffractometry (XRD) results show the phases of ZnO, anatase TiO(2) and Zn(2)Ti(3)O(8) coexisted when the zinc titanate powders were calcined at 600 °C for 1 h. When calcined at 900 °C for 1 h, the XRD results reveal the existence of ZnO, Zn(2)TiO(4), rutile TiO(2) and ZnTiO(3). Scanning electron microscope (SEM) observations show extensive large agglomeration in the samples. Transmission electron microscope (TEM) and electron diffraction (ED) examination results indicate that ZnTiO(3) crystallites formed with a size of about 5 nm on the matrix of plate-like ZnO when calcined at 700 °C for 1 h. The calcination samples have acceptable absorbance at a wavelength of 400 nm, indicating that the zinc titanate precursor powders calcined at 700 °C for 1 h can be used as an UVA-attenuating agent.

Formation and Morphology of Zn2Ti3O8 Powders Using Hydrothermal Process without Dispersant Agent or Mineralizer

PubMed Central

Wang, Cheng-Li; Hwang, Weng-Sing; Chang, Kuo-Ming; Ko, Horng-Huey; Hsi, Chi-Shiung; Huang, Hong-Hsin; Wang, Moo-Chin

2011-01-01

Synthesis of Zn2Ti3O8 powders for attenuating UVA using TiCl4, Zn(NO3)2·6H2O and NH4OH as precursor materials by hydrothermal process has been investigated. The X-ray diffractometry (XRD) results show the phases of ZnO, anatase TiO2 and Zn2Ti3O8 coexisted when the zinc titanate powders were calcined at 600 °C for 1 h. When calcined at 900 °C for 1 h, the XRD results reveal the existence of ZnO, Zn2TiO4, rutile TiO2 and ZnTiO3. Scanning electron microscope (SEM) observations show extensive large agglomeration in the samples. Transmission electron microscope (TEM) and electron diffraction (ED) examination results indicate that ZnTiO3 crystallites formed with a size of about 5 nm on the matrix of plate-like ZnO when calcined at 700 °C for 1 h. The calcination samples have acceptable absorbance at a wavelength of 400 nm, indicating that the zinc titanate precursor powders calcined at 700 °C for 1 h can be used as an UVA-attenuating agent. PMID:21541035

Passivation of hematite nanorod photoanodes with a phosphorus overlayer for enhanced photoelectrochemical water oxidation

NASA Astrophysics Data System (ADS)

Xiong, Dehua; Li, Wei; Wang, Xiaoguang; Liu, Lifeng

2016-09-01

Hematite (i.e., α-Fe2O3) nanorod photoanodes passivated with a phosphorus overlayer have been fabricated by decomposing sodium hypophosphite (NaH2PO2) at a low temperature over the hematite nanorod surface. Extensive scanning electron microscopy, transmission electron microscopy, x-ray diffractometry and UV-vis spectroscopy characterizations confirm that conformal deposition of an amorphous phosphorus overlayer does not change the crystal structure, morphology, and optical absorption properties of hematite photoanodes. X-ray photoelectron spectroscopy reveals that phosphorus in the deposited overlayer exists in an oxidized state. Comprehensive steady-state polarization, transient photocurrent response, and impedance spectroscopy measurements as well as Mott-Schottky analysis manifest that the phosphorus overlayer is able to effectively passivate surface states and suppress electron-hole recombination, substantially enhancing the photocurrent for water oxidation. Combining the phosphorization treatment with two-step thermal activation, a photocurrent density of 1.1 mA cm-2 is achieved at 1.23 V versus reversible hydrogen electrode under illumination of 100 mW cm-2, ca 55 times higher than that of the non-activated pristine hematite photoanode measured under the same conditions. The simple and fast phosphorization strategy we present here can be readily applied to passivate surfaces of other semiconductor photoelectrodes to improve their photoelectrochemical performance.

Ferric ion-assisted in situ synthesis of silver nanoplates on polydopamine-coated silk.

PubMed

Xiao, Jing; Zhang, Huihui; Mao, Cuiping; Wang, Ying; Wang, Ling; Lu, Zhisong

2016-10-01

In the present study, a ferric ion (Fe(3+))-assisted in situ synthesis approach was developed to grow silver (Ag) nanoplates on the polydopamine (PDA)-coated silk without the use of additional reductants. The essential role of Fe(3+) in the formation of Ag nanoplates is revealed by comparing the morphologies of Ag nanostructures prepared on the silk-coated PDA film with/without Fe(3+) doping. Scanning electron micrographs show that high-density Ag nanoplates could be synthesized in the reaction system containing 50μg/mL FeCl3 and 50mM AgNO3. The size of the Ag nanoplate could be tuned by adjusting the reaction duration. Based on the data, a mechanism involving the Fe(3+)-selected growth of Ag atoms along the certain crystal faces was proposed to explain the fabrication process. Transmission electron microscopy and X-ray diffractometry indicate that the Ag nanoplates possess good crystalline structures. Raman spectra demonstrate that the nanoplates could strongly enhance the Raman scattering of the PDA molecules. The Ag nanoplate-coated silk could be utilized as a flexible substrate for the development of surface-enhanced Raman scattering biosensors. Copyright © 2016 Elsevier Inc. All rights reserved.

Synthesis of high generation thermo-sensitive dendrimers for extraction of rivaroxaban from human fluid and pharmaceutic samples.

PubMed

Parham, Negin; Panahi, Homayon Ahmad; Feizbakhsh, Alireza; Moniri, Elham

2018-04-13

In this present study, poly (N-isopropylacrylamide) as a thermo-sensitive agent was grafted onto magnetic nanoparticles, then ethylenediamine and methylmethacrylate were used to synthesize the first generation of poly amidoamine (PAMAM) dendrimers successively and the process continued alternatively until the ten generations of dendrimers. The synthesized nanocomposite was investigated using Fourier transform infrared spectrometry, thermalgravimetry analysis, X-ray diffractometry, elemental analysis and vibrating-sample magnetometer. The particle size and morphology were characterized using dynamic light scattering, field emission scanning electron microscopy and transmission electron microscopy. Batch experiments were conducted to investigate the parameters affecting adsorption and desorption of rivaroxaban by synthesized nanocomposite. The maximum sorption of rivaroxaban by the synthesized nanocomposite was obtained at pH of 8. The resulting grafted magnetic nanoparticle dendrimers were applied for extraction of rivaroxaban from biologic human liquids and medicinal samples. The specifications of rivaroxaban sorbed by a magnetic nanoparticle dendrimer showed good accessibility and high capacity of the active sites within the dendrimers. Urine and drug matrix extraction recoveries of more than 92.5 and 99.8 were obtained, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

Ion-induced crystal damage during plasma-assisted MBE growth of GaN layers

NASA Astrophysics Data System (ADS)

Kirchner, V.; Heinke, H.; Birkle, U.; Einfeldt, S.; Hommel, D.; Selke, H.; Ryder, P. L.

1998-12-01

Gallium nitride layers were grown by plasma-assisted molecular-beam epitaxy on (0001)-oriented sapphire substrates using an electron cyclotron resonance (ECR) and a radio frequency (rf) plasma source. An applied substrate bias was varied from -200 to +250 V, resulting in a change of the density and energy of nitrogen ions impinging the growth surface. The layers were investigated by high-resolution x-ray diffractometry and high-resolution transmission electron microscopy (HRTEM). Applying a negative bias during growth has a marked detrimental effect on the crystal perfection of the layers grown with an ECR plasma source. This is indicated by a change in shape and width of (0002) and (202¯5) reciprocal lattice points as monitored by triple axis x-ray measurements. In HRTEM images, isolated basal plane stacking faults were found, which probably result from precipitation of interstitial atoms. The crystal damage in layers grown with a highly negative substrate bias is comparable to that observed for ion implantation processes at orders of magnitude larger ion energies. This is attributed to the impact of ions on the growing surface. None of the described phenomena was observed for the samples grown with the rf plasma source.

Photoluminescent properties of complex metal oxide nanopowders for gas sensing

NASA Astrophysics Data System (ADS)

Bovhyra, R. V.; Mudry, S. I.; Popovych, D. I.; Savka, S. S.; Serednytski, A. S.; Venhryn, Yu. I.

2018-03-01

This work carried out research on the features of photoluminescence of the mixed and complex metal oxide nanopowders (ZnO/TiO2, ZnO/SnO2, Zn2SiO4) in vacuum and gaseous ambient. The nanopowders were obtained using pulsed laser reactive technology. The synthesized nanoparticles were characterized by X-ray diffractometry, energy-dispersive X-ray analysis, and scanning and transmission electron microscopy analysis for their sizes, shapes and collocation. The influence of gas environment on the photoluminescence intensity was investigated. A change of ambient gas composition leads to a rather significant change in the intensity of the photoluminescence spectrum and its deformation. The most significant changes in the photoluminescent spectrum were observed for mixed ZnO/TiO2 nanopowders. This obviously is the result of a redistribution of existing centers of luminescence and the appearance of new adsorption centers of luminescence on the surface of nanopowders. The investigated nanopowders can be effectively used as sensing materials for the construction of the multi-component photoluminescent sensing matrix.

Effect of Laser Powder Bed Fusion Parameters on the Microstructure and Texture Development in Superelastic Ti-18Zr-14Nb Alloy

NASA Astrophysics Data System (ADS)

Kreitcberg, A.; Brailovski, V.; Sheremetyev, V.; Prokoshkin, S.

2017-12-01

The effect of different laser powder bed fusion (L-PBF) parameters on the phase composition, microstructure, and crystallographic texture of Ti-18Zr-14Nb alloy was studied. Two levels of laser power, scanning speed, and hatching space were used, while the layer thickness was kept constant. The resulting volume energy density was ranged from 20 to 60 J/mm3, and the build rate, from 12 to 36 cm3/h. The manufactured coupons were analyzed by X-ray diffractometry, transmission, and scanning electron microscopy. It was found that the greater influence observed on the microstructure and texture development was caused by the value of laser power, while the lowest, by that of hatching space. Based on the results obtained, the processing optimization strategy aimed at improving the density, superelastic, and fatigue properties of the L-PBF manufactured Ti-18Zr-14Nb alloy was proposed.

Hierarchical macro-mesoporous structures in the system TiO{sub 2}-Al{sub 2}O{sub 3}, obtained by hydrothermal synthesis using Tween-20 as a directing agent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Benjume, M.L.; Espitia-Cabrera, M.I.; Contreras-Garcia, M.E., E-mail: eucontre@zeus.umich.mx

2009-12-15

Macro-mesoporous powders of titania, alumina, and mixed titania-20%alumina systems were obtained by hydrothermal synthesis employing surfactant Tween-20 as structural directing agent in order to promote the textural properties of titania. The effect of the alumina in the titania phase and on textural properties was analyzed. The obtained powders presented a macroporous channel structure that was characterized by X-ray diffractometry, scanning and transmission electron microscopy, N{sub 2} adsorption-desorption analysis, pore size distribution, Fourier transform infrared spectrometry, and thermogravimetric analysis. It was found that alumina content retarded the anatase phase crystallization and increased the Brunauer-Emmet-Teller surface area from 136 to 210 m{supmore » 2}/g. The powders calcined at 400 deg. C are thermally stable and possess an interconnected macro-mesoporous hierarchical structure; the results indicate that this synthesis can be employed to prepare mixed titania-alumina with good textural properties.« less

Change Spectrum Characteristics Modification of Films Deposited by Magnetron Sputtering with the Assistance of Argon Ions Beam

NASA Astrophysics Data System (ADS)

Umnov, S.; Asainov, O.

2015-04-01

Thin aluminum films were prepared using the method of magnetron sputtering with and without argon ion beam assistance. The influence of argon ion beam on the reflectivity in the UV range and the structure of aluminum films was studied. The structure of the films was studied by transmission electron microscopy (TEM), X-ray diffractometry (XRD) and atomic- force microscope (AFM). The study has shown that the films deposed with the assistance of the argon ion beam have more significant microstresses associated with an increase of crystallites microstructure defects as compared to the films deposed without ion assistance. Comparison of the measured reflectivity of aluminum films deposed without and with the assistance of the ion beam has shown that the films characterized by a higher level of microstructure def ects have increased reflectivity in the UV range. The studies suggest that the defects of thin aluminum films crystal structure influence its optical properties.

Structural properties of H-implanted InP crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bocchi, C.; Franzosi, P.; Lazzarini, L.

1993-07-01

H has been implanted in InP crystals at the energy E [equals] 100 keV and at different doses ranging from [sigma] [equals] 1 x 10[sup 13] to [sigma] [equals] 5 x 10[sup 16] cm[sup [minus]2]. The depth dependence of the elastic lattice strain has been investigated by high resolution X-ray diffractometry. The implantation produces a lattice dilation. The strain increases with increasing depth, reaches the maximum at about 0.75 [mu]m, and then decreases rapidly; moreover the maximum strain is proportional to the dose. No extended crystal defects have been detected by transmission electron microscopy up to [sigma] <1 x 10[supmore » 16] cm[sup [minus]2] a buried amorphous layer 28 nm in thickness has been observed at the same depth where the strain is maximum. The thickness of the amorphous layer increases by further increasing the dose and reaches a value of about 0.18 [mu]m for [sigma] [equals] 5 x 10[sup 16] cm[sup [minus]2].« less

Self-assembled flower-like antimony trioxide microstructures with high infrared reflectance performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge, Shengsong, E-mail: geshengsong@126.com; Yang, Xiaokun; Shao, Qian

A simple hydrothermal process was adopted to self-assembly prepare high infrared reflective antimony trioxide with three-dimensional flower-like microstructures. The morphologies of antimony trioxide microstructures were characterized by X-ray diffractometry (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), and high resolution transmission electron microscopy (HRTEM) respectively. It is also found that experimental parameters, such as NaOH concentration, surfactant concentration and volume ratio of ethanol–water played crucial roles in controlling the morphologies of Sb{sub 2}O{sub 3} microstructures. A possible growth mechanism of flower-like Sb{sub 2}O{sub 3} microstructure was proposed based on the experimental data. UV–vis–NIR spectra verified that the near infraredmore » reflectivity of the obtained flower-like microstructures could averagely achieve as 92% with maximum reflectivity of 98%, obviously higher than that of other different morphologies of antimony trioxide microstructures. It is expected that the flower-like Sb{sub 2}O{sub 3} nanostructures have some applications in optical materials and heat insulation coatings. - Graphical abstract: Flower-like Sb{sub 2}O{sub 3} microstructures that composed of nanosheets with thickness of ca. 100 nm exhibit high reflectivity under UV–vis–NIR spectra. Highlights: ► Uniform flower-like microstructures were synthesized via simple hydrothermal reaction. ► The flower-like Sb{sub 2}O{sub 3} microstructures exhibited higher reflectivity than other morphologies under the UV–vis–NIR light. ► Influencing parameters on the Sb{sub 2}O{sub 3} morphologies have been discussed in detail. ► Possible mechanism leading to flower-like microstructures was proposed.« less

Synthesis and characterization of polyethylenimine-based iron oxide composites as novel contrast agents for MRI.

PubMed

Masotti, A; Pitta, A; Ortaggi, G; Corti, M; Innocenti, C; Lascialfari, A; Marinone, M; Marzola, P; Daducci, A; Sbarbati, A; Micotti, E; Orsini, F; Poletti, G; Sangregorio, C

2009-04-01

Use of polyethylenimines (PEIs) of different molecular weight and selected carboxylated-PEI derivatives (PEI-COOH) in the synthesis and stabilization of iron oxide nanoparticles, to obtain possible multifunctional contrast agents. Oxidation of Fe(II) at slightly elevated pH and temperature resulted in the formation of highly soluble and stable nanocomposites of iron oxides and polymer. Composites were characterized and studied by atomic force microscopy (AFM), transmission electron microscopy (TEM), X-ray diffractometry, AC and DC magnetometry, NMR relaxometry and magnetic resonance imaging (MRI). From AFM the dimensions of the aggregates were found to be in the ~150-250 nm size region; the mean diameter of the magnetic core of the compounds named PEI-25, PEI-500 and PEI-COOH60 resulted d approximately 20 +/- 5 nm for PEI-25, d approximately 9.5 +/- 1.0 nm for PEI-500 and d approximately 6.8 +/- 1.0 nm for PEI-COOH60. In PEI-COOH60 TEM and X-ray diffractometry revealed small assemblies of mineral magnetic cores with clear indications that the main constituents are maghemite and/or magnetite as confirmed by AC and DC SQUID magnetometry. For PEI-COOH60, the study of NMR-dispersion profiles revealed r (1) and r (2) relaxivities comparable to superparamagnetic iron-oxide commercial compounds in the whole investigated frequency range 7 < or = nu < or = 212 MHz. PEI-25 was studied as possible MRI contrast agent (CA) to map the cerebral blood volume (CBV) and cerebral blood flow (CBF) in an animal model obtaining promising results. The reported compounds may be further functionalized to afford novel multifunctional systems for biomedical applications.

Use of an integrated approach to characterize the physicochemical properties of foundry green sands

USDA-ARS?s Scientific Manuscript database

A fresh green sand, spent green sand, and a weathered spent green sand from a landfill were analyzed using diffractometry, electron microscopy, granulometry, spectrometry, and thermogravimetry. Our objective was to understand how the physicochemical properties of the green sands change from their o...

Enhanced Photocatalytic Activity toward Organic Pollutants Degradation and Mechanism Insight of Novel CQDs/Bi₂O₂CO₃ Composite.

PubMed

Zhang, Zisheng; Lin, Shuanglong; Li, Xingang; Li, Hong; Zhang, Tong; Cui, Wenquan

2018-05-15

Novel carbon quantum dots (CQDs) modified with Bi₂O₂CO₃ (CQDs/Bi₂O₂CO₃) were prepared using a simple dynamic-adsorption precipitation method. X-ray diffractometry (XRD), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDX), and scanning electron microscopy (SEM) were used to test the material composition, structure, and band structures of the as-prepared samples. Methylene blue (MB) and colorless phenol, as target organic pollutants, were used to evaluate the photocatalytic performance of the CQDs/Bi₂O₂CO₃ hybrid materials under visible light irradiation. Experimental investigation shows that 2⁻5 nm CQDs were uniformly decorated on the surface of Bi₂O₂CO₃; CQDs/Bi₂O₂CO₃ possess an efficient photocatalytic performance, and the organic matter removal rate of methylene blue and phenol can reach up to 94.45% and 61.46% respectively, within 2 h. In addition, the degradation analysis of phenol by high performance liquid chromatography (HPLC) proved that there are no other impurities in the degradation process. Photoelectrochemical testing proved that the introduction of CQDs (electron acceptor) effectively suppresses the recombination of e - -h⁺, and promotes charge transfer. Quenching experiments and electron spin resonance (ESR) suggested that ·OH, h⁺, and ·O₂ - were involved in the photocatalytic degradation process. These results suggested that the up-conversion function of CQDs could improve the electron transfer and light absorption ability of photocatalysts and ·O₂ - formation. Furthermore, the up-conversion function of CQDs would help maintain photocatalytic stability. Finally, the photocatalytic degradation mechanism was proposed according to the above experimental result.

Green synthesis palladium nanoparticles mediated by white tea (Camellia sinensis) extract with antioxidant, antibacterial, and antiproliferative activities toward the human leukemia (MOLT-4) cell line.

PubMed

Azizi, Susan; Mahdavi Shahri, Mahnaz; Rahman, Heshu Sulaiman; Rahim, Raha Abdul; Rasedee, Abdullah; Mohamad, Rosfarizan

2017-01-01

Among nanoparticles used for medical applications, palladium nanoparticles (PdNPs) are among the least investigated. This study was undertaken to develop PdNPs by green synthesis using white tea (W.tea; Camellia sinensis ) extract to produce the Pd@W.tea NPs. The Pd@W.tea NPs were characterized by UV-vis spectroscopy and X-ray diffractometry, and evaluated with transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The Pd@W.tea NPs were spherical (size 6-18 nm) and contained phenols and flavonoids acquired from the W.tea extract. Pd@W.tea NPs has good 1-diphenyl-2-picrylhydrazyl (DPPH), OH, and NO-scavenging properties as well as antibacterial effects toward Staphylococcus epidermidis and Escherichia coli . MTT assay showed that Pd@W.tea NPs (IC 50 =0.006 μM) were more antiproliferative toward the human leukemia (MOLT-4) cells than the W.tea extract (IC 50 =0.894 μM), doxorubicin (IC 50 =2.133 μM), or cisplatin (IC 50 =0.013 μM), whereas they were relatively innocuous for normal human fibroblast (HDF-a) cells. The anticancer cell effects of Pd@W.tea NPs are mediated through the induction of apoptosis and G2/M cell-cycle arrest.

Atomic Layer Deposition of Rhenium Disulfide.

PubMed

Hämäläinen, Jani; Mattinen, Miika; Mizohata, Kenichiro; Meinander, Kristoffer; Vehkamäki, Marko; Räisänen, Jyrki; Ritala, Mikko; Leskelä, Markku

2018-06-01

2D materials research is advancing rapidly as various new "beyond graphene" materials are fabricated, their properties studied, and materials tested in various applications. Rhenium disulfide is one of the 2D transition metal dichalcogenides that has recently shown to possess extraordinary properties such as that it is not limited by the strict monolayer thickness requirements. The unique inherent decoupling of monolayers in ReS 2 combined with a direct bandgap and highly anisotropic properties makes ReS 2 one of the most interesting 2D materials for a plethora of applications. Here, a highly controllable and precise atomic layer deposition (ALD) technique is applied to deposit ReS 2 thin films. Film growth is demonstrated on large area (5 cm × 5 cm) substrates at moderate deposition temperatures between 120 and 500 °C, and the films are extensively characterized using field emission scanning electron microscopy/energy-dispersive X-ray spectroscopy, X-ray diffractometry using grazing incidence, atomic force microscopy, focused ion beam/transmission electron microscopy, X-ray photoelectron spectroscopy, and time-of-flight elastic recoil detection analysis techniques. The developed ReS 2 ALD process highlights the potential of the material for applications beyond planar structure architectures. The ALD process also offers a route to an upgrade to an industrial scale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Enhanced UV-visible response of bismuth subcarbonate nanowires for degradation of xanthate and photocatalytic reaction mechanism.

PubMed

Cui, Kuixin; He, Yuehui; Jin, Shengming

2016-04-01

(BiO)2CO3 nanowires were prepared by simple hydrothermal treatment of commercial Bi2O3 powders and characterized by X-ray diffractometry, scanning electron microscopy, transmission electron microscopy (TEM), high-resolution TEM, and X-ray photoelectron spectroscopy (XPS). The photocatalytic activity of (BiO)2CO3 nanowires was studied through degradation of sodium isopropyl xanthate. Photocatalytic experimental results indicated that the as-prepared (BiO)2CO3 nanowires show high photocatalytic efficiency. Photocatalytic activity increased after two cycles. Time-dependent UV-vis spectra demonstrated that the final degradation products included isopropyl alcohol and carbon disulfide. UV-vis diffuse reflection spectra showed that the band gap of the as-prepared (BiO)2CO3 nanowires and recycled (BiO)2CO3 nanowires were 2.75 eV and 1.15 eV, respectively. XPS results indicated that formation of Bi2S3@(BiO)2CO3 core-shell nanowires occurred after recycled photodegradation of isopropyl xanthate owing to existence of two types of Bi configurations in the recycled (BiO)2CO3 nanowires. A probable degradation mechanism of isopropyl xanthate was also proposed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Microwave assisted synthesis and characterisation of a zinc oxide/tobacco mosaic virus hybrid material. An active hybrid semiconductor in a field-effect transistor device.

PubMed

Sanctis, Shawn; Hoffmann, Rudolf C; Eiben, Sabine; Schneider, Jörg J

2015-01-01

Tobacco mosaic virus (TMV) has been employed as a robust functional template for the fabrication of a TMV/zinc oxide field effect transistor (FET). A microwave based approach, under mild conditions was employed to synthesize stable zinc oxide (ZnO) nanoparticles, employing a molecular precursor. Insightful studies of the decomposition of the precursor were done using NMR spectroscopy and material characterization of the hybrid material derived from the decomposition was achieved using dynamic light scattering (DLS), transmission electron microscopy (TEM), grazing incidence X-ray diffractometry (GI-XRD) and atomic force microscopy (AFM). TEM and DLS data confirm the formation of crystalline ZnO nanoparticles tethered on top of the virus template. GI-XRD investigations exhibit an orientated nature of the deposited ZnO film along the c-axis. FET devices fabricated using the zinc oxide mineralized virus template material demonstrates an operational transistor performance which was achieved without any high-temperature post-processing steps. Moreover, a further improvement in FET performance was observed by adjusting an optimal layer thickness of the deposited ZnO on top of the TMV. Such a bio-inorganic nanocomposite semiconductor material accessible using a mild and straightforward microwave processing technique could open up new future avenues within the field of bio-electronics.

Organic-Inorganic Hydrophobic Nanocomposite Film with a Core-Shell Structure

PubMed Central

Liu, Peng; Chen, Ying; Yu, Zhiwu

2016-01-01

A method to prepare novel organic-inorganic hydrophobic nanocomposite films was proposed by a site-specific polymerization process. The inorganic part, the core of the nanocomposite, is a ternary SiO2–Al2O3–TiO2 nanoparticles, which is grafted with methacryloxy propyl trimethoxyl silane (KH570), and wrapped by fluoride and siloxane polymers. The synthesized samples are characterized by transmission electron microscopy (TEM), Fourier transform infrared (FTIR) spectrscopy, X-ray diffractometry (XRD), contact angle meter (CA), and scanning electron microscope (SEM). The results indicate that the novel organic-inorganic hydrophobic nanocomposite with a core-shell structure was synthesized successfully. XRD analysis reveals the nanocomposite film has an amorphous structure, and FTIR analysis indicates the nanoparticles react with a silane coupling agent (methacryloxy propyl trimethoxyl silane KH570). Interestingly, the morphology of the nanoparticle film is influenced by the composition of the core. Further, comparing with the film synthesized by silica nanoparticles, the film formed from SiO2–Al2O3–TiO2 nanoparticles has higher hydrophobic performance, i.e., the contact angle is greater than 101.7°. In addition, the TEM analysis reveals that the crystal structure of the particles can be changed at high temperatures. PMID:28774141

Ergonomic Synthesis Suitable for Industrial Production of Silver-Festooned Zinc Oxide Nanorods

NASA Astrophysics Data System (ADS)

Khan, G. R.; Khan, R. A.

2015-07-01

For maximizing productivity, minimizing cost, time-boxing process and optimizing human effort, a single-step, cost-effective, ultra-fast and environmentally benign synthesis suitable for industrial production of nanocrystalline ZnO, and Ag-doped ZnO has been reported in this paper. The synthesis based on microwave-supported aqueous solution method used zinc acetate dehydrate and silver nitrate as precursors for fabrication of nanorods. The synthesized products were characterized by X-ray diffractometry (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Raman spectroscopy and UV-Vis-NIR spectroscopy. The undoped and Ag-doped ZnO nanorods crystallized in a hexagonal wurtzite structure having spindle-like morphology. The blue shift occurred at absorption edge of Ag-doped ZnO around 260 nm compared to 365 nm of bulk ZnO. The red shift occurred at Raman peak site of 434 cm-1 compared to characteristic wurtzite phase peak of ZnO (437 cm-1). The bandgap energies were found to be 3.10 eV, 3.11 eV and 3.18 eV for undoped, 1% Ag-doped, and 3% Ag-doped ZnO samples, respectively. The TEM results provided average particle sizes of 17 nm, 15 nm and 13 nm for undoped, and 1% and 3% Ag-doped ZnO samples, respectively.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen Long; Department of Chemistry, Huangshan University, Huangshan 245041; Post-Doctoral Scientific Research Workstation, HuangShan NOVEL Co. Ltd, Huangshan 245061

In this paper, biomimetic synthesis of aragonite superstructures using a low molecular weight organic-hexamethylenetetramine (HMT) as an additive in the presence of CO{sub 2} supplied by an ammonium carbonate ((NH{sub 4}){sub 2}CO{sub 3}) diffusion method at room temperature was studied. The products were characterized by scanning or transmission electron microscopy, Fourier transform infrared (FT-IR) spectroscopy, X-ray powder diffractometry, and selected area electron diffraction. The results showed the aragonite superstructures especially dumbbell-flower-like ones were obtained. The formation process of calcium carbonate (CaCO{sub 3}) in HMT aqueous solution was investigated, suggesting that the products transformed from calcite to vaterite primarily, and thenmore » changed into a mixture of aragonite and calcite with an increase of reaction time. The formation mechanism of CaCO{sub 3} in HMT solution was also discussed, revealing that aragonite might be controlled by HMT molecules and NH{sub 4}{sup +} ions together. - Graphical abstract: The well-defined aragonite hierarchical superstructures are formed using hexamethylenetetramine in aqueous solution. Highlights: > Aragonite superstructures are formed with hexamethylenetetramine at about 25 deg. C. > Dumbbell-flower-like aragonite produces when hexamethylenetetramine/Ca{sup 2+}=10:1. > CaCO{sub 3} formation in hexamethylenetetramine solution violates the Ostwald ripening. > Hexamethylenetetramine and NH{sub 4}{sup +} might control the growth of aragonite together.« less

Iron-antimony-based hybrid oxides as high-performance anodes for lithium-ion storage

NASA Astrophysics Data System (ADS)

Nguyen, Tuan Loi; Kim, Doo Soo; Hur, Jaehyun; Park, Min Sang; Yoon, Sukeun; Kim, Il Tae

2018-06-01

We report a facile approach to synthesize Fe-Sb-based hybrid oxides nanocomposites consisting of Sb, Sb2O3, and Fe3O4 for use as new anode materials for lithium-ion batteries. The composites are synthesized via galvanic replacement between Fe3+ and Sb at high temperature in triethylene glycol medium. The phase, morphology, and composition changes of the composites involved in the various stages of the replacement reaction are characterized using X-ray diffractometry, high-resolution transmission electron microscopy, and energy dispersive X-ray spectroscopy. The as-prepared composites have different compositions with very small particle sizes (<< 10 nm). The FexSbyOz-18 h composite, for instance, exhibits high capacity, better cyclic stability, and rate performance than other composites, with a highly stable specific capacity of 434 mAh g-1 at 500 cycles. The excellent electrochemical performance can be ascribed to the high interfacial contact area between the nanocomposite and electrolyte, stable structure of the composites owing to a mixture of inactive phases generated by the conversion reaction between Li+ and oxide metal-whose structure serves as an electron conductor, inhibits agglomeration of Sb particles, and acts as an effective buffer against volume change of Sb during cycling-and high Li+ diffusion ability.

Preparation and physical properties of tara gum film reinforced with cellulose nanocrystals.

PubMed

Ma, Qianyun; Hu, Dongying; Wang, Lijuan

2016-05-01

Cellulose nanocrystals (CNC) prepared from microcrystalline cellulose were blended in tara gum solution to prepare nanocomposite films. The morphology, crystallinity, and thermal properties of the CNC and films were evaluated by using transmission electron microscopy, X-ray diffractometry, and thermogravimetric analysis, respectively. The resultant CNC was rod-shaped with diameters of around 8.6 nm. The effect of CNC content on physical and thermal properties of films was studied. The composite film tensile strength increased from 27.86 to 65.73 MPa, elastic modulus increased from 160.98 MPa to 882.49 MPa and the contact angle increased from 55.8° to 98.7° with increasing CNC content from 0 to 6 wt%. However, CNC addition increased the thermal stability slightly and CNC content above 6 wt% decreased the tensile strength by CNC aggregation in the matrix. The nanocomposite film containing 6 wt% CNC possessed the highest light transmittance, mechanical properties, and lowest oxygen permeability. CNC addition is a suitable method to modify tara gum matrix polymer properties. Copyright © 2016 Elsevier B.V. All rights reserved.

From nicotinate-containing layered double hydroxides (LDHs) to NAD coenzyme-LDH nanocomposites - Syntheses and structural characterization by various spectroscopic methods

NASA Astrophysics Data System (ADS)

Muráth, Szabolcs; Dudás, Csilla; Kukovecz, Ákos; Kónya, Zoltán; Sipos, Pál; Pálinkó, István

2017-07-01

The syntheses of nicotinate anion- and NAD coenzyme-layered double hydroxide (LDH) composites were performed with the aim of having the organic component among the layers. In-house prepared CaAl-LDHs were the host materials. Intercalation was attempted by direct ion exchange or by the dehydration-rehydration method applying aqueous solvent mixtures (containing ethanol, propanol, acetone, N,N-dimethylformamide). For structural characterization, beside X-ray diffractometry, X-ray photoelectron and IR spectroscopies, transmission and scanning electron microscopies as well as energy-dispersive X-ray analysis were used. Molecular modelling served for the visualization of the arrangements of the intercalated ions among the layers of the LDH samples. Although not all the intercalation methods and solvent mixtures led to intercalated composite materials, successful ones could be identified. The combination of spectroscopic methods helped in proposing sensible spatial arrangements for the intercalated anions. The NAD-CaAl-LDH composite proved to be an active catalyst in the oxidation of hydroquinone to 1,4-bezoquinoe in the presence of H2O2.

Unidirectional growth, rocking curve, linear and nonlinear optical properties of LPHCl single crystals

NASA Astrophysics Data System (ADS)

Kumar, P. Ramesh; Gunaseelan, R.; Raj, A. Antony; Selvakumar, S.; Sagayaraj, P.

2012-06-01

Nonlinear optical amino-acid single crystal of L-phenylalanine hydrochloride (LPHCl) was successfully grown by unidirectional Sankaranarayanan-Ramasamy (SR) method under ambient conditions for the first time. The grown single crystal was subjected to different characterization analyses in order to find out its suitability for device fabrication. The crystalline perfection was evaluated using high-resolution X-ray diffractometry. It is evident from the optical absorption study that crystal has excellent transmission in the entire visible region with its lower cut off wavelength around 290 nm.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Zheng; Li, Zhilin; Institute of Carbon Fibers and Composites, Beijing University of Chemical Technology, Beijing 100029

Graphical abstract: The MWCNT/Ni-B catalyst has been successfully prepared by an electroless deposition process. The Ni-B nanoparticles on the supporter are amorphous and are well-distributed. The catalytic conversion towards hydrogenation of styrene shows excellent catalytic activity of the obtained materials. Highlights: Black-Right-Pointing-Pointer A two-step treatment of MWCNTs enabled the homogeneous growth of Ni-B nanoparticles. Black-Right-Pointing-Pointer Ni-B nanoparticles were amorphous with an average size of 60 nm. Black-Right-Pointing-Pointer There were electron transfer between Ni and B. Black-Right-Pointing-Pointer The catalyst had excellent catalytic activity towards hydrogenation of styrene. -- Abstract: Nickel-boron (Ni-B) nanoparticles supported on multi-walled carbon nanotubes (MWCNTs) were successfully synthesizedmore » through an electroless deposition process using the plating bath with sodium borohydride as a reducing agent. The structural and morphological analyses using field-emission scanning electron microscopy, X-ray diffractometry and high-resolution transmission electron microscopy have shown that the Ni-B nanoparticles deposited on the sidewalls of MWCNTs are fine spheres comprised of amorphous structure with the morphologically unique fine-structure like flowers, and homogenously dispersed with a narrow particle size distribution centered at around 60 nm diameter. The catalytic activity of MWCNT/Ni-B nanoparticles was evaluated with respect to hydrogenation of styrene. The hydrogenation catalyzed by MWCNT-supported Ni-B nanoparticles has been found to make styrene selectively converted into ethylbenzene. The highest conversion reaches 99.8% under proper reaction conditions, which demonstrates the high catalytic activity of MWCNT/Ni-B nanoparticles.« less

Pseudomorphic GeSiSn, SiSn and Ge layers in strained heterostructures

NASA Astrophysics Data System (ADS)

Timofeev, V. A.; Nikiforov, A. I.; Tuktamyshev, A. R.; Mashanov, V. I.; Loshkarev, I. D.; Bloshkin, A. A.; Gutakovskii, A. K.

2018-04-01

The GeSiSn, SiSn layer growth mechanisms on Si(100) were investigated and the kinetic diagrams of the morphological GeSiSn, SiSn film states in the temperature range of 150 °C-450 °C at the tin content from 0% to 35% were built. The phase diagram of the superstructural change on the surface of Sn grown on Si(100) in the annealing temperature range of 0 °C-850 °C was established. The specular beam oscillations were first obtained during the SiSn film growth from 150 °C to 300 °C at the Sn content up to 35%. The transmission electron microscopy and x-ray diffractometry data confirm the crystal perfection and the pseudomorphic GeSiSn, SiSn film state, and also the presence of smooth heterointerfaces between GeSiSn or SiSn and Si. The photoluminescence for the multilayer periodic GeSiSn/Si structures in the range of 0.6-0.8 eV was detected. The blue shift with the excitation power increase is observed suggesting the presence of a type II heterostructure. The creation of tensile strained Ge films, which are pseudomorphic to the underlying GeSn layer, is confirmed by the results of the formation and analysis of the reciprocal space map in the x-ray diffractometry. The tensile strain in the Ge films reached the value in the range of 0.86%-1.5%. The GeSn buffer layer growth in the Sn content range from 8% to 12% was studied. The band structure of heterosystems based on pseudomorphic GeSiSn, SiSn and Ge layers was calculated and the valence and conduction band subband position dependences on the Sn content were built. Based on the calculation, the Sn content range in the GeSiSn, SiSn, and GeSn layers, which corresponds to the direct bandgap GeSiSn, SiSn, and Ge material, was obtained.

Synthesis of core-shell structured FAU/SBA-15 composite molecular sieves and their performance in catalytic cracking of polystyrene

NASA Astrophysics Data System (ADS)

Du, Jinlong; Shi, Chunwei; Wu, Wenyuan; Bian, Xue; Chen, Ping; Cui, Qingzhu; Cui, Zhixuan

2017-12-01

Composite molecular sieves, FAU/SBA-15, having core-shell structure were synthesized. The synthesized composite sieves were characterized by X-ray diffractometry (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDS), pyrolysis fourier transform infrared (Py-FTIR) spectroscopy, temperature programmed desorption spectra (NH3-TPD), UV Raman spectroscopy, nuclear magnetic resonance (NMR) and other techniques. XRD, SEM, TEM, N2 adsorption-desorption, mass spectrometry, NMR and EDS results showed that the composite molecular sieve contained two pore channels. Py-FTIR results showed that the addition of HY molecular sieves improved the acidity of the composite zeolite. The crystallization mechanism during the growth of FAU/SBA-15 shell was deduced from the influence of crystallization time on the synthesis of FAU/SBA-15 core-shell structured composite molecular sieve. HY dissociated partially in H2SO4 solution, and consisted of secondary structural units. This framework structure was more stable than its presence in the isolated form on the same ring or in the absence of Al. Thus it played a guiding role and connected with SBA-15 closely through the Si-O bond. This resulted in the gradual covering of the exterior surface of FAU phase by SBA-15 molecular sieves. The presence of SBA-15 restricted the formation of the other high mass components and increased the selectivity towards ethylbenzene.

Soft chemistry routes for synthesis of rare earth oxide nanoparticles with well defined morphological and structural characteristics

NASA Astrophysics Data System (ADS)

Mancic, L.; Marinkovic, B. A.; Marinkovic, K.; Dramicanin, M.; Milosevic, O.

2011-11-01

Phosphors of (Y0.75Gd0.25)2O3:Eu3+ (5 at.%) have been prepared through soft chemistry routes. Conversion of the starting nitrates mixture into oxide is performed through two approaches: (a) hydrothermal treatment (HT) at 200 °C/3 h of an ammonium hydrogen carbonate precipitated mixture and (b) by thermally decomposition of pure nitrate precursor solution at 900 °C in dispersed phase (aerosol) within a tubular flow reactor by spray pyrolysis process (SP). The powders are additionally thermally treated at different temperatures: 600, 1000, and 1100 °C for either 3 or 12 h. HT—derived particles present exclusively one-dimensional morphology (nanorods) up to the temperatures of 600 °C, while the leaf-like particles start to grow afterward. SP—derived particles maintain their spherical shape up to the temperatures of 1100 °C. These submicron sized spheres were actually composed of randomly aggregated nanoparticles. All powders exhibits cubic Ia- 3 structure (Y0.75Gd0.25)2O3:Eu and have improved optical characteristics due to their nanocrystalline nature. The detailed study of the influence of structural and morphological powder characteristics on their emission properties is performed based on the results of X-ray powder diffractometry, scanning electron microscopy, X-ray energy dispersive spectroscopy, transmission electron microscopy, and photoluminescence measurements.

Sonochemical synthesis of highly crystalline photocatalyst for industrial applications.

PubMed

Noman, Muhammad Tayyab; Militky, Jiri; Wiener, Jakub; Saskova, Jana; Ashraf, Muhammad Azeem; Jamshaid, Hafsa; Azeem, Musaddaq

2018-02-01

Highly photo active pure anatase form of TiO 2 nanoparticles with average particle size 4nm have been successfully synthesized by ultrasonic acoustic method (UAM). The effects of process variables i.e. precursors concentration and sonication time were investigated based on central composite design and response surface methodology. The characteristics of the resulting nanoparticles (RNP) were analyzed by scanning electron microscopy, dynamic light scattering, transmission electron microscopy, X-ray diffractometry and Raman spectroscopy. Photocatalytic experiments were performed with methylene blue dye which is considered as model organic pollutant in textile industry. A comparative analysis between the RNP and commercially available Degussa P25 for photocatalytic performance against dye removal efficiency was performed. The rapid removal of methylene blue in case of RNP indicates their higher photocatalytic activity than P25. Maximum dye removal efficiency 98.45% was achieved with optimal conditions i.e. TTIP conc. 10mL, EG conc. 4mL and sonication time 1h. Interestingly, no significant difference was found in the photocatalytic performance of RNP after calcination. Moreover, self-cleaning efficiency of RNP deposited on cotton was evaluated in RGB color space. The obtained results indicate the significant impact of ultrasonic irradiations on the photocatalytic performance of pure anatase form than any other hybrid type of TiO 2 nanoparticles. Copyright © 2017 Elsevier B.V. All rights reserved.

Spectroellipsometric studies of sol-gel derived Sr0.6Ba0.4Nb2O6 films

NASA Astrophysics Data System (ADS)

Ho, Melanie M. T.; Tang, T. B.; Mak, C. L.; Pang, G. K. H.; Chan, K. Y.; Wong, K. H.

2006-10-01

Sr0.6Ba0.4Nb2O6 (SBN) films have been fabricated on (001)Si substrates by a sol-gel technique. The annealing process was carried out in air at various temperatures ranging from 200to700°C. Studies using x-ray diffractometry, high resolution transmission electron microscopy, and scanning electron microscopy showed that polycrystalline films, with a grain size of about 100nm, were obtained only for annealing temperatures ⩾600°C. The optical properties of these sol-gel derived SBN films were studied by spectroscopic ellipsometry (SE). In the analysis of the measured SE spectra, a triple-layer Lorentz model has been developed and used to deduce the optical properties of the SBN films. Our systematic SE measurements revealed that the refractive indices of the SBN films increase with the annealing temperature. This increase is more pronounced at around the crystallization temperature, i.e., between 500 and 600°C. The extinction coefficients of the films also exhibit a similar trend, showing a zero value for amorphous films and larger values for films annealed at above 600°C. Our results demonstrate that while crystallization helps to raise the refractive index of the film due to film densification, it also promotes scattering by grain boundary, resulting in a larger extinction coefficient.

Morphology and structure features of ZnAl{sub 2}O{sub 4} spinel nanoparticles prepared by matrix-isolation-assisted calcination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, Xuelian, E-mail: xueliandu@126.com; Li, Liqiang; Zhang, Wenxing

2015-01-15

Graphical abstract: The substrate ZnO as the isolation medium is effective in preventing the sintering and agglomeration of ZnAl{sub 2}O{sub 4} nanoparticles, and it also prevents their contamination. High purity, well-dispersed, and single-crystal ZnAl{sub 2}O{sub 4} nanoparticles with 3.72 eV band gap were obtained. - Abstract: Well-dispersed ZnAl{sub 2}O{sub 4} spinel nanoparticles with an average crystalline size of 25.7 nm were synthesized successfully and easily by polymer-network and matrix-isolation-assisted calcination. The product microstructure and features were investigated by X-ray diffractometry, thermogravimetric and differential thermal analysis, Fourier transform-infrared spectroscopy, N{sub 2} adsorption–desorption isotherms, and energy dispersive X-ray spectra. The morphology andmore » optical performance of the as-prepared ZnAl{sub 2}O{sub 4} nanoparticles were characterized by scanning electron microscope, transmission electron microscopy, and photoluminescence spectrometer. Experimental results indicate that excess ZnO acted as the isolation medium is effective in preventing the sintering and agglomeration of ZnAl{sub 2}O{sub 4} nanoparticles, and it also prevents their contamination. Then, high purity and well-dispersed ZnAl{sub 2}O{sub 4} nanoparticles with single-crystal structure were obtained.« less

Water treatment with exceptional virus inactivation using activated carbon modified with silver (Ag) and copper oxide (CuO) nanoparticles.

PubMed

Shimabuku, Quelen Letícia; Arakawa, Flávia Sayuri; Fernandes Silva, Marcela; Ferri Coldebella, Priscila; Ueda-Nakamura, Tânia; Fagundes-Klen, Márcia Regina; Bergamasco, Rosangela

2017-08-01

Continuous flow experiments (450 mL min -1 ) were performed in household filter in order to investigate the removal and/or inactivation of T4 bacteriophage, using granular activated carbon (GAC) modified with silver and/or copper oxide nanoparticles at different concentrations. GAC and modified GAC were characterized by X-ray diffractometry, specific surface area, pore size and volume, pore average diameter, scanning electron microscopy, transmission electron microscopy, zeta potential and atomic absorption spectroscopy. The antiviral activity of the produced porous media was evaluated by passing suspensions of T4 bacteriophage (∼10 5  UFP/mL) through filters. The filtered water was analyzed for the presence of the bacteriophage and the release of silver and copper oxide. The porous media containing silver and copper oxide nanoparticles showed high inactivation capacity, even reaching reductions higher than 3 log. GAC6 (GAC/Ag0.5%Cu1.0%) was effective in the bacteriophage inactivation, reaching 5.53 log reduction. The levels of silver and copper released in filtered water were below the recommended limits (100 ppb for silver and 1000 ppb for copper) in drinking water. From this study, it is possible to conclude that activated carbon modified with silver and copper oxide nanoparticles can be used as a filter for virus removal in the treatment of drinking water.

Growth, structural, optical, thermal and mechanical properties of ammonium pentaborate single crystal.

PubMed

Balakrishnan, T; Bhagavannarayana, G; Ramamurthi, K

2008-11-15

Nonlinear optical single crystals of ammonium pentaborate (APB) were grown by the slow cooling method from aqueous solution. Grown crystal was characterized by powder X-ray diffraction (PXRD) and FT-IR spectral analysis. Perfection of the grown crystal was evaluated by high-resolution X-ray diffractometry (HRXRD). The effect of nylon threading on the perfection of the grown bigger crystal was also studied by HRXRD. The range and percentage of optical transmission was ascertained by recording UV-vis-NIR spectrum. Thermal properties were investigated by TG-DTA and DSC analyses. Its mechanical hardness was estimated by Vickers microhardness tester.

Growth of ferroelectric Ba{sub 0.8}Sr{sub 0.2}TiO{sub 3} epitaxial films by ultraviolet pulsed laser irradiation of chemical solution derived precursor layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Queraltó, A.; Pérez del Pino, A., E-mail: aperez@icmab.es; Mata, M. de la

2015-06-29

Highly crystalline epitaxial Ba{sub 0.8}Sr{sub 0.2}TiO{sub 3} (BST) thin-films are grown on (001)-oriented LaNiO{sub 3}-buffered LaAlO{sub 3} substrates by pulsed laser irradiation of solution derived barium-zirconium-titanium precursor layers using a UV Nd:YAG laser source at atmospheric conditions. The structural analyses of the obtained films, studied by X-ray diffractometry and transmission electron microscopy, demonstrate that laser processing allows the growth of tens of nm-thick BST epitaxial films with crystalline structure similar to that of films obtained through conventional thermal annealing methods. However, the fast pulsed nature of the laser employed leads to crystallization kinetic evolution orders of magnitude faster than inmore » thermal treatments. The combination of specific photothermal and photochemical mechanisms is the main responsible for the ultrafast epitaxial laser-induced crystallization. Piezoresponse microscopy measurements demonstrate equivalent ferroelectric behavior in laser and thermally annealed films, being the piezoelectric constant ∼25 pm V{sup −1}.« less

Formation and characterization of calcium orthophosphates in the presence of two different acidic macromolecules

NASA Astrophysics Data System (ADS)

Pelin, Irina M.; Maier, Vasilica; Suflet, Dana M.; Popescu, Irina; Darie-Nita, Raluca N.; Aflori, Magdalena; Butnaru, Maria

2017-10-01

The synthetic nanocrystalline calcium orthophosphates have a notable bioactivity due to the chemical similarity with biological apatite from calcified tissues. In mineralized tissues, the highly ordered structures come from organized assemblies of biomacromolecules and inorganic nanoparticles. One of the purposes of this work was to study the effect of two types of acidic macromolecules: atelocollagen and phosphorylated curdlan onto calcium orthophosphates formation after 30 days of maturation at 2 ± 2 °C. The resulted samples after a long aging time, either calcium orthophosphates or composites, were first investigated by FT-IR spectroscopy and X-ray diffractometry and the results indicated that precipitated hydroxyapatite with low crystallinity was obtained when the synthesis was performed in the presence of phosphorylated curdlan. The macromolecules influenced the morphology of the particles as shown by scanning and transmission electron microscopy. The presence of macromolecules as demonstrated by thermal investigation also influenced the rheological properties of the samples. The second purpose of the work was to evaluate the cytotoxicity of the samples using the MTT assay, and the results revealed very good cells viability. The preliminary results are encouraging regarding the use of these materials for further tests in order to develop injectable bone substitutes.

Structural and optical properties of low temperature grown AlN films on sapphire using helicon sputtering system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Meei-Ru; Chen, Hou-Guang; Kao, Hui-Ling, E-mail: hlkao@cycu.edu.tw

2015-05-15

AlN thin films have been deposited directly on c-plane sapphire substrates at low temperatures by a helicon sputtering system. The structural quality of AlN epitaxial films was characterized by x-ray diffractometry and transmission electron microscopy. The films exhibit smooth surface with root-mean-square roughness as small as 0.7 nm evaluated by atomic force microscope. The optical transmittance spectra show a steep absorption edge at the wavelength of 200 nm and a high transmittance of over 80% in the visible range. The band-edge transition (6.30 eV) of AlN film was observed in the cathodoluminescence spectrum recorded at 11 K. The spectral response of metal–semiconductor–metal photodetectors constructedmore » with AlN/sapphire reveals the peak responsivity at 200 nm and a UV/visible rejection ratio of about two orders of magnitude. The results of this low temperature deposition suggest the feasibility of the epitaxial growth of AlN on sapphire substrates and the incorporation of the AlN films in the surface acoustic wave devices and the optical devices at deep ultraviolet region.« less

Structural characterization and bioavailability of ternary nanoparticles consisting of amylose, α-linoleic acid and β-lactoglobulin complexed with naringin.

PubMed

Feng, Tao; Wang, Ke; Liu, Fangfang; Ye, Ran; Zhu, Xiao; Zhuang, Haining; Xu, Zhimin

2017-06-01

Naringin is a bioflavonoid that is rich in citrus plants and possesses enormous health benefits. However, the use of naringin as a nutraceutical is significantly limited by its low bioavailability. In this study, a novel water-soluble ternary nanoparticle material consisting of amylose, α-linoleic acid and β-lactoglobulin was developed to encapsulate naringin to improve its bioavailability. The physicochemical characteristics of the ternary nanoparticle-naringin inclusion complex were analysed by ultraviolet-visible spectroscopy (UV), Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC), high-resolution transmission electron microscopy (TEM), X-ray diffractometry (XRD) and particle size distribution. The results confirmed the formation of the ternary nanoparticle-naringin inclusion complex. The encapsulation efficiency (EE) and loading content (LC) of the ternary nanoparticle-naringin inclusion complex were 78.73±4.17% and 14.51±3.43%, respectively. In addition, the results of the ternary nanoparticle-naringin inclusion complex in simulated gastric fluid (SGF) and simulated intestinal fluid (SIF) demonstrated that naringin can be gradually released from the complex. In conclusion, ternary nanoparticles are considered promising carriers to effectively improve the bioavailability of naringin. Copyright © 2017 Elsevier B.V. All rights reserved.

LiMn2O4–yBryNanoparticles Synthesized by a Room Temperature Solid-State Coordination Method

PubMed Central

2009-01-01

LiMn2O4–yBrynanoparticles were synthesized successfully for the first time by a room temperature solid-state coordination method. X-ray diffractometry patterns indicated that the LiMn2O4–yBrypowders were well-crystallized pure spinel phase. Transmission electron microscopy images showed that the LiMn2O4–yBrypowders consisted of small and uniform nanosized particles. Synthesis conditions such as the calcination temperature and the content of Br−were investigated to optimize the ideal condition for preparing LiMn2O4–yBrywith the best electrochemical performances. The optimized synthesis condition was found in this work; the calcination temperature is 800 °C and the content of Br−is 0.05. The initial discharge capacity of LiMn2O3.95Br0.05obtained from the optimized synthesis condition was 134 mAh/g, which is far higher than that of pure LiMn2O4, indicating introduction of Br−in LiMn2O4is quite effective in improving the initial discharge capacity. PMID:20628635

Synthesis and characterization of ferrite-semiconductor nano composite for photocatalytic degradation of aqueous nitrobenzene solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Modi, K. B.; Kathad, C. R.; Raval, P. Y.

2016-05-06

Nanoparticles of semiconductor TiO{sub 2}, zinc ferrite (ZnFe{sub 2}O{sub 4}) and ZnFe{sub 2}O{sub 4}-TiO{sub 2} composite, were synthesized by auto combustion route. Subsequent characterization of synthesized photocatalysts was carried out by X-ray powder diffractometry, transmission electron microscopy, UV-Vis-Diffuse Reflectance Spectroscopy to study the structural and textural properties. The specific surface area, pore diameter and pore volume of synthesized materials were investigated by N{sub 2} adsorption analysis while the presence of TiO{sub 2} in the composite material was verified by infrared spectral analysis. The photocatalytic activity of synthesized photocatalysts was evaluated by degradation of nitrobenzene (NB) in aqueous medium under irradiationmore » of ultraviolet light. The result revealed that 77, 73 and 70% of NB was degraded using TiO{sub 2}, ZnFe{sub 2}O{sub 4} and ZnFe{sub 2}O{sub 4}-TiO{sub 2} photocatalysts after 4h in the presence of UV irradiation. The composite photocatalyst was found easy to separate from the treated solution.« less

Single Crystal Diffractometry

NASA Astrophysics Data System (ADS)

Arndt, U. W.; Willis, B. T. M.

2009-06-01

Preface; Acknowledgements; Part I. Introduction; Part II. Diffraction Geometry; Part III. The Design of Diffractometers; Part IV. Detectors; Part V. Electronic Circuits; Part VI. The Production of the Primary Beam (X-rays); Part VII. The Production of the Primary Beam (Neutrons); Part VIII. The Background; Part IX. Systematic Errors in Measuring Relative Integrated Intensities; Part X. Procedure for Measuring Integrated Intensities; Part XI. Derivation and Accuracy of Structure Factors; Part XII. Computer Programs and On-line Control; Appendix; References; Index.

Study the effect of mechanical alloying parameters on synthesis of Cr{sub 2}Nb–Al{sub 2}O{sub 3} nanocomposite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shayesteh, Payam, E-mail: shayesteh.payam@gmail.com; Mirdamadi, Shamseddin; Razavi, Hossein

2014-01-01

Graphical abstract: - Highlights: • Cr{sub 2}Nb–Al{sub 2}O{sub 3} nanocomposite synthesized through MA. • Effect of BPR, rotating speed, milling time and PCA concentration investigated. • After annealing at 1100 °C crystalline phase were appeared. • Williamson–Hall analysis was used in order to study the grain size of nano composite. - Abstract: In this study, Cr{sub 2}Nb–20 vol.% Al{sub 2}O{sub 3} nanocomposite was prepared successfully by mechanochemical reaction between Al, Nb and Cr{sub 2}O{sub 3} powders. Amorphization of powder occurred during mechanical alloying because of high energy collisions between powders and steel balls in milling container which transfer high degreemore » of energy to powders. Therefore, annealing was needed to form crystalline phases. The influence of different mechanical alloying parameters such as BPR, rotating speed, milling time and PCA concentration on synthesis of composite material were investigated. After mechanical alloying, the powder was encapsulated in quartz and then annealed at 1100 °C for 3 h. After annealing, 3 different phases were appeared (Cr{sub 2}Nb (cubic), Cr{sub 2}Nb (hexagonal) and α-Al{sub 2}O{sub 3}). The structural changes of powder particles during mechanical alloying were studied by X-ray diffractometry (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM) and transmission electron microscopy (TEM)« less

He-irradiation effects on glass-ceramics for joining of SiC-based materials

NASA Astrophysics Data System (ADS)

Gozzelino, L.; Casalegno, V.; Ghigo, G.; Moskalewicz, T.; Czyrska-Filemonowicz, A.; Ferraris, M.

2016-04-01

CaO-Al2O3 (CA) and SiO2-Al2O3-Y2O3 (SAY) glass-ceramics are promising candidates for SiC/SiC indirect joints. In view of their use in locations where high radiation level is expected (i.e. fusion plants) it is important to investigate how radiation-induced damage can modify the material microstructure. To this aim, pellets of both types were irradiated with 5.5 MeV 4He+ ions at an average temperature of 75 °C up to a fluence of almost 2.3·1018 cm-2. This produces a displacement defect density that increases with depth and reaches a value of about 40 displacements per atom in the ion implantation region, where the He-gas reaches a concentration of several thousands of atomic parts per million. X-ray diffractometry and scanning electron microscopy showed no change in the microstructure and in the morphology of the pellet surface. Moreover, a transmission electron microscopy investigation on cross-section lamellas revealed the occurrence of structural defects and agglomerates of He-bubbles in the implantation region for the CA sample and a more homogeneous He-bubble distribution in the SAY pellet, even outside the implantation layer. In addition, no amorphization was found in both samples, even in correspondence to the He implantation zone. The radiation damage induced only occasional micro-cracks, mainly located at grain boundaries (CA) or within the grains (SAY).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Xiaodong; Wu, Hong, E-mail: wuhong927@126.com

Metallic glass composite coatings Ti{sub 45}Cu{sub 41}Ni{sub 9}Zr{sub 5} and Ti{sub 45}Cu{sub 41}Ni{sub 6}Zr{sub 5}Sn{sub 3} (at.%) on a Ti-30Nb-5Ta-7Zr (wt.%) (TNTZ) alloy were prepared by laser cladding. The microstructures of the coatings were characterized by means of X-ray diffractometry (XRD), scanning electron microscopy (SEM) equipped with energy dispersive X-ray analyzer (EDXA), and transmission electron microscopy (TEM). Results indicated that the coatings have an amorphous structure embedded with a few nanocrystalline phases and dendrites. A partial substitution of Ni by Sn can improve the glass forming ability of Ti-base metallic glass system, and induce the formation of nano-sized Ni{sub 2}SnTimore » phase during the cyclic laser heating. The tribological behavior of both the substrate and the coatings was investigated in detail. A significant improvement in both the hardness and the wear resistance of the coatings was achieved with the addition of Sn. The relationship between the wear resistance and the microstructures of the coatings was discussed. - Highlights: •Ti-based metallic glass composite coatings were prepared by laser cladding. •The wear resistance is greatly improved by laser cladding of composite coatings. •Substitution of Ni by Sn increases GFA and wear resistance of the coatings. •A good balance of crystalline/amorphous phases improves the wear resistance. •Adhesive wear serves as the dominant wear mechanism of the composite coatings.« less

Various types of semiconductor photocatalysts modified by CdTe QDs and Pt NPs for toluene photooxidation in the gas phase under visible light

NASA Astrophysics Data System (ADS)

Marchelek, M.; Grabowska, E.; Klimczuk, T.; Lisowski, W.; Zaleska-Medynska, A.

2017-01-01

A novel synthesis process was used to prepare TiO2 microspheres, TiO2 P-25, SrTiO3 and KTaO3 decorated by CdTe QDs and/or Pt NPs. The effect of semiconductor matrix, presence of CdTe QDs and/or Pt NPs on the semiconductor surface as well as deposition technique of Pt NPs (photodeposition or radiolysis) on the photocatalytic activity were investigated. The as-prepared samples were characterized by X-ray powder diffractometry (XRD), X-ray photoelectron spectroscopy (XPS), transmission electron microscopy (TEM) with energy-dispersive X-ray (EDX) spectroscopy, scanning electron microscopy (SEM), photoluminescence spectrometry (PL), Fourier transform infrared (FT-IR) and Raman spectra, diffuse reflectance spectroscopy (DRS) and BET surface area analysis. The photocatalytic decomposition of toluene in gas phase, activated by light-emitting diodes (LEDs), with the CdTe/Pt nanoparticles-modified TiO2 microspheres, P25, SrTiO3 and KTaO3 semiconductors was investigated under UV-vis and visible irradiation.The results showed that the photoactivity depends on semiconductor matrix. The highest photoactivity under Vis light was observed for KTaO3/CdTe-Pt(R) sample (56% of toluene was decompose after 30 min of irradiation). The efficiency of the most active sample was 3 times higher than result for P25 and two times higher than for unmodified KTaO3.

Fluorine incorporation into SnO2 nanoparticles by co-milling with polyvinylidene fluoride

NASA Astrophysics Data System (ADS)

Senna, Mamoru; Turianicová, Erika; Šepelák, Vladimír; Bruns, Michael; Scholz, Gudrun; Lebedkin, Sergei; Kübel, Christian; Wang, Di; Kaňuchová, Mária; Kaus, Maximilian; Hahn, Horst

2014-04-01

Fluorine was incorporated into SnO2 nanoparticles from polyvinylidene fluoride (PVdF) by co-milling. The incorporation process was triggered by an oxidative partial decomposition of PVdF due to the abstraction of oxygen atoms, and began soon after milling with a simultaneous decrease in the crystallite size of SnO2 from 56 nm to 19 nm, and increase in the lattice strain by a factor 7. Appearance of D and G Raman peaks indicated that the decomposition of PVdF was accompanied by the formation of nanometric carbon species. Decomposing processes of PVdF were accompanied by the continuous change in the states of F, with a decrease of C-F in PVdF and increase in Sn-F. This indicates the gradual incorporation of F into SnO2, by replacing a part of oxygen in the oxide with fluorine. These serial mechanochemical reaction processes were discussed on the basis of X-ray diffractometry, FT-IR, Raman and UV-Vis diffuse reflectance spectroscopy, transmission electron microscopy, F1s, Sn3d and C1s X-ray photoelectron spectroscopy and Auger electron spectra, as well as magic angle spinning NMR spectroscopy of 19F and 119Sn. The present findings serve as an initial stage of incorporating fluorine into SnO2 via a solvent-free solid-state process, toward the rational fabrication of fluorine doped SnO2 powders.

Synthesis of core–shell structured FAU/SBA-15 composite molecular sieves and their performance in catalytic cracking of polystyrene

PubMed Central

Du, Jinlong; Shi, Chunwei; Wu, Wenyuan; Bian, Xue; Chen, Ping; Cui, Qingzhu; Cui, Zhixuan

2017-01-01

Abstract Composite molecular sieves, FAU/SBA-15, having core-shell structure were synthesized. The synthesized composite sieves were characterized by X-ray diffractometry (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDS), pyrolysis fourier transform infrared (Py-FTIR) spectroscopy, temperature programmed desorption spectra (NH3-TPD), UV Raman spectroscopy, nuclear magnetic resonance (NMR) and other techniques. XRD, SEM, TEM, N2 adsorption-desorption, mass spectrometry, NMR and EDS results showed that the composite molecular sieve contained two pore channels. Py-FTIR results showed that the addition of HY molecular sieves improved the acidity of the composite zeolite. The crystallization mechanism during the growth of FAU/SBA-15 shell was deduced from the influence of crystallization time on the synthesis of FAU/SBA-15 core-shell structured composite molecular sieve. HY dissociated partially in H2SO4 solution, and consisted of secondary structural units. This framework structure was more stable than its presence in the isolated form on the same ring or in the absence of Al. Thus it played a guiding role and connected with SBA-15 closely through the Si-O bond. This resulted in the gradual covering of the exterior surface of FAU phase by SBA-15 molecular sieves. The presence of SBA-15 restricted the formation of the other high mass components and increased the selectivity towards ethylbenzene. PMID:29383044

Processing of copper converter slag for metals reclamation: Part II: mineralogical study.

PubMed

Deng, Tong; Ling, Yunhan

2004-10-01

Chemical and mineralogical characterizations of a copper converter slag, and its products obtained by curing with strong sulphuric acid and leaching with hot water, were carried out using ore microscopy, scanning electronic microscopy with energy dispersive spectrometry, wave-length dispersive X-ray fluorescence spectrometry, X-ray diffractometry and chemical phase analysis, which provided necessary information to develop a new process for treating such slag and further understanding of the chemical and mineralogical changes in the process.

Molecular beam epitaxial growth and structural characterization of ZnS on (001) GaAs

NASA Technical Reports Server (NTRS)

Benz, R. G., II; Huang, P. C.; Stock, S. R.; Summers, C. J.

1988-01-01

The effect of surface nucleation processes on the quality of ZnS layers grown on (001) GaAs substrates by molecular beam epitaxy is reported. Reflection high energy electron diffraction indicated that nucleation at high temperatures produced more planar surfaces than nucleation at low temperatures, but the crystalline quality as assessed by X-ray double crystal diffractometry is relatively independent of nucleation temperature. A critical factor in layer quality was the initial roughness of the GaAs surfaces.

Nanostructured lipid carriers as novel ophthalmic delivery system for mangiferin: improving in vivo ocular bioavailability.

PubMed

Liu, Rui; Liu, Zhidong; Zhang, Chengui; Zhang, Boli

2012-10-01

The aim of this study was to develop a novel nanostructured lipid carriers (NLCs) system to improve ocular bioavailability of mangiferin (MGN) for the potential treatment of cataract. The physicochemical properties of MGN-loaded NLC (MGN-NLC) formulation were characterized by particle size, polydispersity index, zeta potential, entrapment efficiency, drug loading, morphological property, and crystalline state. in vitro characteristics were investigated by drug release from NLC system, physical stability, and corneal permeation through excised rabbit cornea. Moreover, in vivo ocular tolerability was assessed by a modified Draize test and histological microscopy. Preocular retention capability was evaluated by slit-lamp observation. Pharmacokinetic study in the aqueous humor was performed by microdialysis technique. Transmission electron microscopy depicted spherical and uniform morphology. Differential scanning calorimetry and X-ray diffractometry displayed imperfect crystalline lattice. The optimized MGN-NLC formulation exhibited a sustained drug release with 3 months stability and 4.31-fold increase of in vitro corneal permeation. Furthermore, in vivo studies exhibited a high tolerance in the ocular tissues and prolonged drug retention capacity on the corneal surface. Finally, pharmacokinetic study suggested a 5.69-fold increase of ocular bioavailability compared with MGN solution (MGN-SOL). Therefore, NLC system is a promising approach for ocular delivery of MGN. Copyright © 2012 Wiley Periodicals, Inc.

Mineralogical variation in the size fractions of a Ranong kaolin, southern Thailand

NASA Astrophysics Data System (ADS)

Pisutha-Arnond, Visut; Phuvichit, Suraphol; Leepowpanth, Quanchai

A representative crude Ranong kaolin from the Thungkla-Ranong mine was separated into > 2 mm (granule), 2-1 mm (very coarse sand), 1-0.5 mm (coarse sand), 0.5-0.25 mm (medium sand), 0.25-0.125 mm (fine sand), 0.125-0.062 mm (very fine sand) and 62-28, 28-14, 17-7, 7-4, 4-2, 2-1 and < 1 μ m size fractions. Those size fractions were analyzed by X-ray powder diffractometry (XRD), differential thermal analysis (DTA), scanning electron microscopy (SEM) and transmission electron microscopy (TEM) with attached energy dispersive X-ray spectrometer (EDX). Kaolin group minerals were differentiated by using XRD in combination with various chemical and heat treatments together with TEM, SEM and DTA. The Ranong kaolin consists predominantly of tubular halloysite, poorly crystallized kaolinite and quartz with minor amounts of mica and K-feldspars. Other trace constituents include gibbsite, tourmaline, zircon and colored impurities (i.e. extractable iron hydroxide coating on clay mineral surface). The kaolin minerals are found in all size fractions by which their contents and halloysite/kaolinite ratios increase as the particle sizes become finer. Quartz and mica are also detected in almost all size fractions. They are, however, more abundant with coarsening particle size. Gibbsite, K-feldspar and tourmaline are mainly concentrated in the fine sand to silt size fractions. Crystallinity of kaolin minerals as measured by XRD varied moderately with size. Relatively pure kaolin minerals, predominantly halloysite and kaolinite, can be obtained in the particle size below 1 or 2 μm.

High-throughput multipesticides residue analysis in earthworms by the improvement of purification method: Development and application of magnetic Fe3 O4 -SiO2 nanoparticles based dispersive solid-phase extraction.

PubMed

Sun, Yuhan; Qi, Peipei; Cang, Tao; Wang, Zhiwei; Wang, Xiangyun; Yang, Xuewei; Wang, Lidong; Xu, Xiahong; Wang, Qiang; Wang, Xinquan; Zhao, Changshan

2018-06-01

As a key representative organism, earthworms can directly illustrate the influence of pesticides on environmental organisms in soil ecosystems. The present work aimed to develop a high-throughput multipesticides residue analytical method for earthworms using solid-liquid extraction with acetonitrile as the solvent and magnetic material-based dispersive solid-phase extraction for purification. Magnetic Fe 3 O 4 nanoparticles were modified with a thin silica layer to form Fe 3 O 4 -SiO 2 nanoparticles, which were fully characterized by field-emission scanning electron microscopy, transmission electron microscopy, Fourier-transform infrared spectroscopy, X-ray diffractometry, and vibrating sample magnetometry. The Fe 3 O 4 -SiO 2 nanoparticles were used as the separation media in dispersive solid-phase extraction with primary secondary amine and ZrO 2 as the cleanup adsorbents to eliminate matrix interferences. The amounts of nanoparticles and adsorbents were optimized for the simultaneous determination of 44 pesticides and six metabolites in earthworms by liquid chromatography with tandem mass spectrometry. The method performance was systematically validated with satisfactory results. The limits of quantification were 20 μg/kg for all analytes studied, while the recoveries of the target analytes ranged from 65.1 to 127% with relative standard deviation values lower than 15.0%. The developed method was subsequently utilized to explore the bioaccumulation of bitertanol in earthworms exposed to contaminated soil, verifying its feasibility for real sample analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ohmic Contact Fabrication Using a Focused-ion Beam Technique and Electrical Characterization for Layer Semiconductor Nanostructures.

PubMed

Chen, Ruei-San; Tang, Chih-Che; Shen, Wei-Chu; Huang, Ying-Sheng

2015-12-05

Layer semiconductors with easily processed two-dimensional (2D) structures exhibit indirect-to-direct bandgap transitions and superior transistor performance, which suggest a new direction for the development of next-generation ultrathin and flexible photonic and electronic devices. Enhanced luminescence quantum efficiency has been widely observed in these atomically thin 2D crystals. However, dimension effects beyond quantum confinement thicknesses or even at the micrometer scale are not expected and have rarely been observed. In this study, molybdenum diselenide (MoSe2) layer crystals with a thickness range of 6-2,700 nm were fabricated as two- or four-terminal devices. Ohmic contact formation was successfully achieved by the focused-ion beam (FIB) deposition method using platinum (Pt) as a contact metal. Layer crystals with various thicknesses were prepared through simple mechanical exfoliation by using dicing tape. Current-voltage curve measurements were performed to determine the conductivity value of the layer nanocrystals. In addition, high-resolution transmission electron microscopy, selected-area electron diffractometry, and energy-dispersive X-ray spectroscopy were used to characterize the interface of the metal-semiconductor contact of the FIB-fabricated MoSe2 devices. After applying the approaches, the substantial thickness-dependent electrical conductivity in a wide thickness range for the MoSe2-layer semiconductor was observed. The conductivity increased by over two orders of magnitude from 4.6 to 1,500 Ω(-) (1) cm(-) (1), with a decrease in the thickness from 2,700 to 6 nm. In addition, the temperature-dependent conductivity indicated that the thin MoSe2 multilayers exhibited considerably weak semiconducting behavior with activation energies of 3.5-8.5 meV, which are considerably smaller than those (36-38 meV) of the bulk. Probable surface-dominant transport properties and the presence of a high surface electron concentration in MoSe2 are proposed. Similar results can be obtained for other layer semiconductor materials such as MoS2 and WS2.

Ohmic Contact Fabrication Using a Focused-ion Beam Technique and Electrical Characterization for Layer Semiconductor Nanostructures

PubMed Central

Chen, Ruei-San; Tang, Chih-Che; Shen, Wei-Chu; Huang, Ying-Sheng

2015-01-01

Layer semiconductors with easily processed two-dimensional (2D) structures exhibit indirect-to-direct bandgap transitions and superior transistor performance, which suggest a new direction for the development of next-generation ultrathin and flexible photonic and electronic devices. Enhanced luminescence quantum efficiency has been widely observed in these atomically thin 2D crystals. However, dimension effects beyond quantum confinement thicknesses or even at the micrometer scale are not expected and have rarely been observed. In this study, molybdenum diselenide (MoSe2) layer crystals with a thickness range of 6-2,700 nm were fabricated as two- or four-terminal devices. Ohmic contact formation was successfully achieved by the focused-ion beam (FIB) deposition method using platinum (Pt) as a contact metal. Layer crystals with various thicknesses were prepared through simple mechanical exfoliation by using dicing tape. Current-voltage curve measurements were performed to determine the conductivity value of the layer nanocrystals. In addition, high-resolution transmission electron microscopy, selected-area electron diffractometry, and energy-dispersive X-ray spectroscopy were used to characterize the interface of the metal–semiconductor contact of the FIB-fabricated MoSe2 devices. After applying the approaches, the substantial thickness-dependent electrical conductivity in a wide thickness range for the MoSe2-layer semiconductor was observed. The conductivity increased by over two orders of magnitude from 4.6 to 1,500 Ω−1 cm−1, with a decrease in the thickness from 2,700 to 6 nm. In addition, the temperature-dependent conductivity indicated that the thin MoSe2 multilayers exhibited considerably weak semiconducting behavior with activation energies of 3.5-8.5 meV, which are considerably smaller than those (36-38 meV) of the bulk. Probable surface-dominant transport properties and the presence of a high surface electron concentration in MoSe2 are proposed. Similar results can be obtained for other layer semiconductor materials such as MoS2 and WS2. PMID:26710105

p-type zinc-blende GaN on GaAs substrates

NASA Astrophysics Data System (ADS)

Lin, M. E.; Xue, G.; Zhou, G. L.; Greene, J. E.; Morkoç, H.

1993-08-01

We report p-type cubic GaN. The Mg-doped layers were grown on vicinal (100) GaAs substrates by plasma-enhanced molecular beam epitaxy. Thermally sublimed Mg was, with N2 carrier gas, fed into an electron-cyclotron resonance source. p-type zinc-blende-structure GaN films were achieved with hole mobilities as high as 39 cm2/V s at room temperature. The cubic nature of the films were confirmed by x-ray diffractometry. The depth profile of Mg was investigated by secondary ions mass spectroscopy.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrova, V. A.; Orekhov, A. S.; Chernyakov, D. D.

A method for preparing multilayer film composites based on chitosan has been developed by the example of polymer pairs: chitosan–hyaluronic acid, chitosan–alginic acid, and chitosan–carrageenan. The structure of the composite films is characterized by X-ray diffractometry and scanning electron microscopy. It is shown that the deposition of a solution of hyaluronic acid, alginic acid, or carrageenan on a chitosan gel film leads to the formation of a polyelectrolyte complex layer at the interface, which is accompanied by the ordering of chitosan chains in the surface region; the microstructure of this layer depends on the nature of contacting polymer pairs.

Electric property measurement of free-standing SrTiO3 nanoparticles assembled by dielectrophoresis

NASA Astrophysics Data System (ADS)

Budiman, Faisal; Kotooka, Takumi; Horibe, Yoichi; Eguchi, Masanori; Tanaka, Hirofumi

2018-06-01

Free-standing strontium titanate (SrTiO3/STO) nanoparticles (NPs) were synthesized by the sol–gel method. X-ray diffractometry revealed that the required minimum annealing temperature to synthesize pure and highly crystalline STO NPs was 500 °C. Moreover, morphological observation by field emission scanning electron microscopy showed that the STO NPs have a spherical structure and their size depended on annealing condition. Electrical properties were measured using a low-temperature probing system. Here, an electrode was fabricated by electron beam lithography and the synthesized STO NPs were aligned at the electrodes by dielectrophoresis. The conductance of a sample was proportional to temperature. Two conduction mechanisms originating from hopping and tunneling appeared in the Arrhenius plot.

On the crystal structure of Cr2N precipitates in high-nitrogen austenitic stainless steel. III. Neutron diffraction study on the ordered Cr2N superstructure.

PubMed

Lee, Tae-Ho; Kim, Sung-Joon; Shin, Eunjoo; Takaki, Setsuo

2006-12-01

The ordered structure of Cr(2)N precipitates in high-nitrogen austenitic steel was investigated utilizing high-resolution neutron powder diffractometry (HRPD). On the basis of the Rietveld refinement of neutron diffraction patterns, the ordered Cr2N superstructure was confirmed to be trigonal (space group P31m), with lattice parameters a=4.800 (4) and c=4.472 (5) A, as suggested in previous transmission electron microscopy studies [Lee, Oh, Han, Lee, Kim & Takaki (2005). Acta Cryst. B61, 137-144; Lee, Kim & Takaki (2006). Acta Cryst. B62, 190-196]. The occupancies of the N atoms in four crystallographic sites [1(a), 1(b), 2(d) and 2(c) Wyckoff sites] were determined to be 1.00 (5), 0.0, 0.74 (9) and 0.12 (3), respectively, reflecting a partial disordering of N atoms along the c axis. The position of the metal atom was specified to be x=0.346 (8) and z=0.244 (6), corresponding to a deviation from the ideal position (x=0.333 and z=0.250). This deviation caused the ((1/3 1/3)(0))-type superlattice reflection to appear. A comparison between the ideal and measured crystal structures of Cr2N was performed using a computer simulation of selected-area diffraction patterns.

The effect of nanoparticles size on photocatalytic and antimicrobial properties of Ag-Pt/TiO2 photocatalysts

NASA Astrophysics Data System (ADS)

Zielińska-Jurek, Anna; Wei, Zhishun; Wysocka, Izabela; Szweda, Piotr; Kowalska, Ewa

2015-10-01

Ag-Pt-modified TiO2 nanocomposites were synthesized using the sol-gel method. Bimetallic modified TiO2 nanoparticles exhibited improved photocatalytic activity under visible-light irradiation, better than monometallic Ag/TiO2 and Pt/TiO2 nanoparticles (NPs). All modified powders showed localized surface plasmon resonance (LSPR) in visible region. The photocatalysts' characteristics by X-ray diffractometry (XRD), scanning transmission electron microscopy (STEM), diffuse reflectance spectroscopy (DRS), X-ray photoelectron spectroscopy (XPS), nitrogen adsorption (BET method for specific surface area) showed that sample with the highest photocatalytic activity had anatase structure, about 93 m2/g specific surface area, maximum plasmon absorption at ca. 420 nm and contained small NPs of silver of 6 nm and very fine platinum NPs of 3 nm. The photocatalytic activity was estimated by measuring the decomposition rate of phenol in 0.2 mM aqueous solution under Vis and UV/vis light irradiation. It was found that size of platinum was decisive for the photocatalytic activity under visible light irradiation, i.e., the smaller Pt NPs were, the higher was photocatalytic activity. While, antimicrobial activities, estimated for bacteria Escherichia coli and Staphylococcus aureus, and pathogenic fungi belonging to Candida family, were only observed for photocatalysts containing silver, i.e., Ag/TiO2 and Ag-Pt/TiO2 nanocomposites.

Thermal transport through Ge-rich Ge/Si superlattices grown on Ge(0 0 1)

NASA Astrophysics Data System (ADS)

Thumfart, L.; Carrete, J.; Vermeersch, B.; Ye, N.; Truglas, T.; Feser, J.; Groiss, H.; Mingo, N.; Rastelli, A.

2018-01-01

The cross-plane thermal conductivities of Ge-rich Si/Ge superlattices have been measured using both time-domain thermoreflectance and the differential 3ω method. The superlattices were grown by molecular beam epitaxy on Ge(0 0 1) substrates. Crystal quality and structural information were investigated by x-ray diffractometry and transmission electron microscopy. The influence of segregation during growth on the composition profiles was modeled using the experimental growth temperatures and deposition rates. Those profiles were then employed to obtain parameter-free theoretical estimates of the thermal conductivity by combining first-principles calculations, Boltzmann transport theory and phonon Green’s functions. Good agreement between theory and experiment is observed. The thermal conductivity shows a strong dependence on the composition and the thickness of the samples. Moreover, the importance of the composition profile is reflected in the fact that the thermal conductivity of the superlattices is considerably lower than predicted values for alloys with the same average composition and thickness. Measurement on different samples with the same Si layer thickness and number of periods, but different Ge layer thickness, show that the thermal resistance is only weakly dependent on the Ge layers. We analyze this phenomenon based on the first-principles mode, and build an approximate parametrization showing that, in this regime, the resistivity of a SL is roughly linear on the amount of Si.

Antibacterial activity and cytotoxicity of multi-walled carbon nanotubes decorated with silver nanoparticles

PubMed Central

Seo, Youngmin; Hwang, Jangsun; Kim, Jieun; Jeong, Yoon; Hwang, Mintai P; Choi, Jonghoon

2014-01-01

Recently, various nanoscale materials, including silver (Ag) nanoparticles, have been actively studied for their capacity to effectively prevent bacterial growth. A critical challenge is to enhance the antibacterial properties of nanomaterials while maintaining their biocompatibility. The conjugation of multiple nanomaterials with different dimensions, such as spherical nanoparticles and high-aspect-ratio nanotubes, may increase the target-specific antibacterial capacity of the consequent nanostructure while retaining an optimal biocompatibility. In this study, multi-walled carbon nanotubes (MWCNTs) were treated with a mixture of acids and decorated with Ag nanoparticles via a chemical reduction of Ag cations by ethanol solution. The synthesized Ag-MWCNT complexes were characterized by transmission electron microscopy, X-ray diffractometry, and energy-dispersive X-ray spectroscopy. The antibacterial function of Ag-MWCNTs was evaluated against Methylobacterium spp. and Sphingomonas spp. In addition, the biocompatibility of Ag-MWCNTs was evaluated using both mouse liver hepatocytes (AML 12) and human peripheral blood mononuclear cells. Finally, we determined the minimum amount of Ag-MWCNTs required for a biocompatible yet effective antibacterial treatment modality. We report that 30 μg/mL of Ag-MWCNTs confers antibacterial functionality while maintaining minimal cytotoxicity toward both human and animal cells. The results reported herein would be beneficial for researchers interested in the efficient preparation of hybrid nanostructures and in determining the minimum amount of Ag-MWCNTs necessary to effectively hinder the growth of bacteria. PMID:25336943

Ultrafast electron diffraction and electron microscopy: present status and future prospects

NASA Astrophysics Data System (ADS)

Ishchenko, A. A.; Aseyev, S. A.; Bagratashvili, V. N.; Panchenko, V. Ya; Ryabov, E. A.

2014-07-01

Acting as complementary research tools, high time-resolved spectroscopy and diffractometry techniques proceeding from various physical principles open up new possibilities for studying matter with necessary integration of the 'structure-dynamics-function' triad in physics, chemistry, biology and materials science. Since the 1980s, a new field of research has started at the leading research laboratories, aimed at developing means of filming the coherent dynamics of nuclei in molecules and fast processes in biological objects ('atomic and molecular movies'). The utilization of ultrashort laser pulse sources has significantly modified traditional electron beam approaches to and provided high space-time resolution for the study of materials. Diffraction methods using frame-by-frame filming and the development of the main principles of the study of coherent dynamics of atoms have paved the way to observing wave packet dynamics, the intermediate states of reaction centers, and the dynamics of electrons in molecules, thus allowing a transition from the kinetics to the dynamics of the phase trajectories of molecules in the investigation of chemical reactions.

Nonlinear refraction properties of nickel oxide thin films at 800 nm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melo, Ronaldo P. Jr. de; Silva, Blenio J. P. da; Santos, Francisco Eroni P. dos

2009-11-01

Measurements of the nonlinear refractive index, n{sub 2}, of nickel oxide films prepared by controlled oxidation of nickel films deposited on substrates of soda-lime glass are reported. The structure and morphology of the samples were characterized by scanning electron microscopy, atomic force microscopy, and x-ray diffractometry. Samples of excellent optical quality were prepared. The nonlinear measurements were performed using the thermally managed eclipse Z-scan technique at 800 nm. A large value of n{sub 2}approx =10{sup -12} cm{sup 2}/W and negligible nonlinear absorption were obtained.

Synthesis and characterization of Ru-Ti[sub 4]O[sub 7] microelectrode arrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, L.; Franzen, H.F.; Vitt, J.E.

1994-04-01

A synthesis is described for Ru microelectrode arrays within a conductive Ti[sub 4]O[sub 7] ceramic matrix. Data obtained by X-ray diffractometry and scanning electron microscopy are consistent with the existence of heterogeneous mixtures of Ru particles (ca. 0.8 [mu]m diam) within the Ti[sub 4]O[sub 7] matrices. No mixed metal oxides or other new compounds are detected. Rotated disk electrodes (RDEs) constructed from the Ru-Ti[sub 4]O[sub 7] materials are compared on the basis of their voltammetric response for the oxidations of I[sup [minus

Functionalization of 2D macroporous silicon under the high-pressure oxidation

NASA Astrophysics Data System (ADS)

Karachevtseva, L.; Kartel, M.; Kladko, V.; Gudymenko, O.; Bo, Wang; Bratus, V.; Lytvynenko, O.; Onyshchenko, V.; Stronska, O.

2018-03-01

Addition functionalization after high-pressure oxidation of 2D macroporous silicon structures is evaluated. X-ray diffractometry indicates formation of orthorhombic SiO2 phase on macroporous silicon at oxide thickness of 800-1200 nm due to cylindrical symmetry of macropores and high thermal expansion coefficient of SiO2. Pb center concentration grows with the splitting energy of LO- and TO-phonons and SiO2 thickness in oxidized macroporous silicon structures. This increase EPR signal amplitude and GHz radiation absorption and is promising for development of high-frequency devices and electronically controlled elements.

Study on different characteristics of doped tri calcium phosphate at different sintering temperatures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samanta, Sujan Krishna, E-mail: itssujan@rediffmail.com; Chanda, Abhijit, E-mail: abhijitchanda.biomed@gmail.com

2016-04-13

Pure β-tricalcium phosphate (β-TCP), Zn-doped (3wt %) β-TCP and Mg- doped (3wt %) β-TCP samples were prepared by using a wet chemical precipitation synthesis technique, followed by calcination at 800 °C in air. The developed materials were subjected to sintering at different temperatures. Density and porosity were compared. The X-ray diffractometry (XRD) and Fourier-transformed infrared (FTIR) spectrometer were used to examine the changes in crystalline phases and presence of functional groups of TCP ceramics. The scanning electron microscopy (SEM) was used to study the pore formation, pore size, grain size.

Structure of chitosan gels mineralized by sorption

NASA Astrophysics Data System (ADS)

Modrzejewska, Z.; Skwarczyńska, A.; Douglas, T. E. L.; Biniaś, D.; Maniukiewicz, W.; Sielski, J.

2015-10-01

The paper presents the structural studies of mineralized chitosan hydrogels. Hydrogels produced by using sodium beta-glycerophosphate (Na-β-GP) as a neutralizing agent. Mineralization was performed method "post loading", which consisted in sorption to the gels structure Ca ions. In order to obtain - in the structure of gels - compounds similar to the hydroxyapatites present naturally in bone tissue, gels after sorption were modified in: pH 7 buffer and sodium hydrogen phosphate. In order to determine the structural properties of the gels, the following methods were used: infrared spectroscopy with Fourier transformation, FTIR, X-ray diffractometry, XRD, scanning electron microscopy, SEM.

Multilayer encapsulated mesoporous silica nanospheres as an oral sustained drug delivery system for the poorly water-soluble drug felodipine.

PubMed

Hu, Liang; Sun, Hongrui; Zhao, Qinfu; Han, Ning; Bai, Ling; Wang, Ying; Jiang, Tongying; Wang, Siling

2015-02-01

We used a combination of mesoporous silica nanospheres (MSN) and layer-by-layer (LBL) self-assembly technology to establish a new oral sustained drug delivery system for the poorly water-soluble drug felodipine. Firstly, the model drug was loaded into MSN, and then the loaded MSN were repeatedly encapsulated by chitosan (CHI) and acacia (ACA) via LBL self-assembly method. The structural features of the samples were studied using scanning electron microscopy (SEM), transmission electron microscopy (TEM) and nitrogen adsorption. The encapsulating process was monitored by zeta-potential and surface tension measurements. The physical state of the drug in the samples was characterized by differential scanning calorimetry (DSC) and X-ray diffractometry (XRD). The influence of the multilayer with different number of layers on the drug release rate was studied using thermal gravimetric analysis (TGA) and surface tension measurement. The swelling effect and the structure changes of the multilayer were investigated to explore the relationship between the drug release behavior and the state of the multilayer under different pH conditions. The stability and mucosa adhesive ability of the prepared nanoparticles were also explored. After multilayer coating, the drug release rate was effectively controlled. The differences in drug release behavior under different pH conditions could be attributed to the different states of the multilayer. And the nanoparticles possessed good stability and strong mucosa adhesive ability. We believe that this combination offers a simple strategy for regulating the release rate of poorly water-soluble drugs and extends the pharmaceutical applications of inorganic materials and polymers. Copyright © 2014 Elsevier B.V. All rights reserved.

Synthesis of magnetic mesoporous metal-organic framework-5 for the effective enrichment of malachite green and crystal violet in fish samples.

PubMed

Zhou, Zhihui; Fu, Yanqing; Qin, Qian; Lu, Xin; Shi, Xianzhe; Zhao, Chunxia; Xu, Guowang

2018-07-27

A novel, magnetic and mesoporous Fe 3 O 4 @PEI-MOF-5 material was synthesized for the effective enrichment of malachite green (MG) and crystal violet (CV) in fish samples. The Fe 3 O 4 @PEI-MOF-5 material was prepared by a facile two-step solvothermal approach in which Fe 3 O 4 @PEI and MOF-5 were connected through chemical bonds. Characterization of the newly synthesized Fe 3 O 4 @PEI-MOF-5 material was performed by Fourier transform infrared spectroscopy, X-ray diffractometry, vibrating sample magnetometry, scanning electron microscopy, transmission electron microscopy, thermogravimetric analysis and X-ray photoelectron spectroscopy. This new material was determined to have high magnetization and chemical stability, a large surface area and a distinctive morphology. An effective enrichment and detection method for MG and CV was subsequently developed by combining the Fe 3 O 4 @PEI-MOF-5 material with ultra-high-performance liquid chromatography-tandem mass spectrometry. The linearity ranges of this approach for MG and CV were 1-500ng/mL and 0.25-500ng/mL, respectively, with correlation coefficients (R 2 ) of 0.999. The limits of detection (LODs) of the method for MG and CV were 0.30ng/mL and 0.08ng/mL, respectively, indicating that the Fe 3 O 4 @PEI-MOF-5 material had good adsorption properties for MG and CV. Fe 3 O 4 @PEI-MOF-5 can be expected to also provide efficient enrichment of MG and CV in other complex matrices. Copyright © 2018 Elsevier B.V. All rights reserved.

Blue–green afterglow of BaAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Bao-gai; Ma, Qing-lan; School of Electronics and Information, Nantong University, Jiangsu 226019

Highlights: • Afterglow can be achieved when Eu{sup 2+} is absent in the DyAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors. • The afterglow of DyAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors is discernible to naked eyes for minutes. • Dy{sup 3+} introduced trap centers are believed to be responsible for the afterglow. - Abstract: Dy{sup 3+} doped barium aluminate (BaAl{sub 2}O{sub 4}:Dy{sup 3+}) phosphors were prepared via the sol–gel combustion route at the ignition temperature of 600 °C. The phosphors were characterized with X-ray diffractometry, scanning electron microscopy, transmission electron microscopy, photoluminescence spectroscopy, Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. Regardless of themore » absence of Eu{sup 2+} luminescent centers, broadband blue–green afterglow with its peak at about 490 nm was recorded in the BaAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors. The decay profile of the blue–green afterglow can be best fitted into a two-component exponential function with the two lifetime decay constants to be 8.81 and 45.25 s, respectively. The observation of blue–green afterglow from BaAl{sub 2}O{sub 4}:Dy{sup 3+} in the absence of Eu{sup 2+} provides unique opportunity in unveiling the afterglow mechanisms of rare-earth doped alkaline-metal aluminates. Possible mechanisms on the blue–green afterglow in BaAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors are discussed in terms of the Dy{sup 3+} ions introduced trap centers as well as luminescent centers in the crystal lattice.« less

Effects of solution pH and electrical parameters on hydroxyapatite coatings deposited by a plasma-assisted electrophoresis technique.

PubMed

Nie, X; Leyland, A; Matthews, A; Jiang, J C; Meletis, E I

2001-12-15

Hydroxyapatite (HA) coatings can be deposited using a hybrid process of plasma electrolysis and electrophoresis, called plasma-assisted electrophoretic deposition (PEPD). HA aqueous suspensions with various pH values were prepared using a modified ultrasonic cleaning bath as an agitator/stirrer. Both DC and unbalanced AC power supplies were used to bias the titanium alloy substrate materials employed in this work. Scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffractometry (XRD), and Fourier transform infrared spectroscopy (FTIR) were used to observe and analyze coating morphology and microstructure. It was shown that the morphology and composition of the calcium phosphate coatings were significantly influenced by solution pH values; the level of "pure" HA in the coatings' composition corresponded to both solution pH and the type of power supply employed. Loss of hydroxyl radials (i.e., dehydroxylation), which degrades the performance of the hydroxyapatite coating in terms of long-term chemical and mechanical stability, can be virtually eliminated by a combination of high pH and unbalanced AC plasma power. In addition, the underlying TiO2 coatings used to support the HA layer (preproduced by plasma electrolysis process) have a nanoscaled (10-20 nm) polycrystalline structure. TEM studies also revealed a dense, continuous amorphous titania layer (10 nm in thickness) at the interface between the Ti alloy substrate and the TiO2 layer, which may play a role in improving the corrosion resistance of the substrate. Such a nanophase TiO2 layer (if used as a coating alone) may also provide a further improvement in osteoinductive properties, compared to a conventional TiO2 coating on the Ti alloy substrate. Copyright 2001 John Wiley & Sons, Inc. J Biomed Mater Res 57: 612-618, 2001

A potential bioactive wound dressing based on carboxymethyl cellulose/ZnO impregnated MCM-41 nanocomposite hydrogel.

PubMed

Rakhshaei, Rasul; Namazi, Hassan

2017-04-01

Lack of antibacterial activity, deficient water vapor and oxygen permeability, and insufficient mechanical properties are disadvantages of existing wound dressings. Hydrogels could absorb wound exudates due to their strong swelling ratio and give a cooling sensation and a wet environment. To overcome these shortcomings, flexible nanocomposite hydrogel films was prepared through combination of zinc oxide impregnated mesoporous silica (ZnO-MCM-41) as a nano drug carrier with carboxymethyl cellulose (CMC) hydrogel. Citric acid was used as cross linker to avoid the cytotoxicity of conventional cross linkers. The prepared nanocomposite hydrogel was characterized using X-ray diffractometry (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Zeta potential and UV-vis spectroscopy. Results of swelling and erosion tests showed CMC/ZnO nanocomposite hydrogel disintegrated during the first hours of the test. Using MCM-41 as a substrate for ZnO nanoparticles solved this problem and the CMC/ZnO-MCM-41 showed a great improvement in tensile strength (12%), swelling (100%), erosion (53%) and gas permeability (500%) properties. Drug delivery and antibacterial properties of the nanocomposite hydrogel films studied using tetracycline (TC) as a broad spectrum antibiotic and showed a sustained TC release. This could efficiently decrease bandage exchange. Cytocompatibility of the nanocomposite hydrogel films has been analyzed in adipose tissue-derived stem cells (ADSCs) and results showed cytocompatibility of CMC/ZnO-MCM-41. Based on these results the prepared CMC nanocomposite hydrogel containing ZnO impregnated MCM-41, could serve as a kind of promising wound dressing with sustained drug delivery properties. Copyright © 2016 Elsevier B.V. All rights reserved.

Synthesis of AlFeCuCrMg{sub x} (x = 0, 0.5, 1, 1.7) alloy powders by mechanical alloying

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maulik, Ornov; Kumar, Vinod, E-mail: vkt.meta@mnit.ac.in; Adjunct Faculty, Materials Research Centre, Malaviya National Institute of Technology, Jaipur 302017

2015-12-15

Novel AlFeCuCrMg{sub x} (x = 0, 0.5, 1, 1.7 mol) high-entropy alloys (HEAs) were synthesized by mechanical alloying. The effect of Mg content on the phase evolution of HEAs was investigated using X-Ray diffractometry (XRD), transmission electron microscopy (TEM) and selected area electron diffraction (SAED) pattern analysis. The particle morphology and composition of HEAs were investigated by scanning electron microscopy (SEM). Thermodynamic parameters were calculated and analyzed to explain the formation of a solid solution. XRD analysis revealed BCC as major phase and FCC as a minor phase in as-milled AlFeCuCr and AlFeCuCrMg{sub 0.5} HEAs. Also, XRD analysis of as-milledmore » AlFeCuCrMg, AlFeCuCrMg{sub 1.7} confirmed the formation of two BCC phases (BCC 1 and BCC 2). TEM–SAED analysis of AlFeCuCrMg{sub x} HEAs concurred with XRD results. Microstructural features and mechanism for solid solution formation have been conferred in detail. Phase formation of the present HEAs has been correlated with calculated thermodynamic parameters. Differential thermal analysis (TGA-DTA) of these alloys confirmed that there is no substantial phase change up to 500 °C. - Highlights: • Novel AlFeCuCrMg{sub x} (x = 0, 0.5, 1, 1.7) HEAs were prepared by mechanical alloying. • Phase evolution and lattice parameter were studied by X-Ray Diffraction. • Crystallite size and lattice microstrain calculated failed to obey the Williamson–Hall method. • Criterions for formation of simple solid solution were compared to the thermodynamic parameters of the present HEAs. • Increase in the Mg concentration in AlMg{sub x}FeCuCr (x = 0, 0.5, 1, 1.7) HEAs supports the formation of BCC phase.« less

Ultrasonic spray pyrolysis synthesis of reduced graphene oxide/anatase TiO2 composite and its application in the photocatalytic degradation of methylene blue in water.

PubMed

Park, Jeong-Ann; Yang, Boram; Lee, Joongki; Kim, In Gyeom; Kim, Jae-Hyun; Choi, Jae-Woo; Park, Hee-Deung; Nah, In Wook; Lee, Sang-Hyup

2018-01-01

Reduced graphene oxide (RGO)/anatase TiO 2 composite was prepared using a simple one-step technique-ultrasonic spray pyrolysis-in order to inhibit the aggregation of TiO 2 nanoparticles and to improve the photocatalytic performance for degradation of methylene blue (MB). Different proportions (0-5 wt%) of RGO/TiO 2 composites were characterized by scanning electronic microscopy (SEM), dispersive X-ray spectrometry (EDS), transmission electron microscopy (TEM), Brunauer-Emmett-Teller (BET) surface area, X-ray photoelectron spectroscopy (XPS), X-ray diffractometry (XRD), Raman spectroscopy, UV-vis spectroscopy, and electrochemical impedance spectroscopy (EIS) to verify mechanism. From these analysis, TiO 2 nanoparticles are distributed uniformly on the RGO sheets with crumpled shape during ultrasonic spray pyrolysis and surface area is increasing by increasing portion of RGO. Band gap of RGO 5 /TiO 2 (5 wt% of RGO) composite is 2.72 eV and band gap was reduced by increasing portion of RGO in RGO/TiO 2 composites. The RGO 5 /TiO 2 composite was superior to other lower content of RGO/TiO 2 composites with a rapid transport of charge carriers and an effective charge separation. The highest removal efficiency of MB was obtained at the RGO 5 /TiO 2 composite under UVC irradiation, which coincided with the EIS, and the optimal dose of the composite was determined to be 0.5 g/L. The RGO 5 /TiO 2 composite improve the photocatalytic degradation rate of MB over the TiO 2 due to a retardation of electron-hole recombination. The MB adsorption capacity and photocatalytic degradation efficiency were greatly affected by pH changes and increased with increasing pH due to electrostatic interactions and generation of more hydroxyl radicals. The reusability of RGO 5 /TiO 2 composite was examined during 3 cycles. Copyright © 2017 Elsevier Ltd. All rights reserved.

Spatial Distribution of Trehalose Dihydrate Crystallization in Tablets by X-ray Diffractometry.

PubMed

Thakral, Naveen K; Yamada, Hiroyuki; Stephenson, Gregory A; Suryanarayanan, Raj

2015-10-05

Crystallization of trehalose dihydrate (C12H22O11·2H2O) was induced by storing tablets of amorphous anhydrous trehalose (C12H22O11) at 65% RH (RT). Our goal was to evaluate the advantages and limitations of two approaches of profiling spatial distribution of drug crystallization in tablets. The extent of crystallization, as a function of depth, was determined in tablets stored for different time-periods. The first approach was glancing angle X-ray diffractometry, where the penetration depth of X-rays was modulated by the incident angle. Based on the mass attenuation coefficient of the matrix, the depth of X-ray penetration was calculated as a function of incident angle, which in turn enabled us to "calculate" the extent of crystallization to different depths. In the second approach, the tablets were split into halves and the split surfaces were analyzed directly. Starting from the tablet surface and moving toward the midplane, XRD patterns were collected in 36 "regions", in increments of 0.05 mm. The results obtained by the two approaches were, in general, in good agreement. Additionally, the results obtained were validated by determining the "average" crystallization in the entire tablet by using synchrotron radiation in the transmission mode. The glancing angle method could detect crystallization up to ∼650 μm and had a "surface bias". Being a nondestructive technique, this method will permit repeated analyses of the same tablet at different time points, for example, during a stability study. However, split tablet analyses, while a "destructive" technique, provided comprehensive and unbiased depth profiling information.

Leaching behavior and ESEM characterization of water-sensitive mudstone in southwestern Taiwan.

PubMed

Chen, Hung-Ta; Lin, Tzong-Tzeng; Chang, Juu-En

2003-05-01

This investigation attempts to understand the critical soluble salts in natural mudstone and the leaching, microstructural, and microchemical characteristics in soaked mudstone using scanning electron microscopy (SEM)/energy-dispersive X-ray analysis (EDAX), X-ray fluorescence spectrometry (XRF), X-ray diffractometry (XRD), conductivity measurement, ion chromatography (IC), and environmental scanning electron microscopy (ESEM)/EDAX techniques. Natural mudstone probably includes soluble salts such as Na2SO4, NaCl, NaCO3, and CaCO3. The dissolution of Na2SO4 controls water-sensitive mudstone very susceptible to slaking and dispersion. ESEM micrographs clearly show evidence of mudstone-slaking during soaking since the visible pores are filled with small aggregative masses. A calcium-bearing precipitate from the soaked mudstone is speculated to be attributable to the decomposition of the hydrated product of the fresh mudstone.

Preparation and analysis of multilayer composites based on polyelectrolyte complexes

NASA Astrophysics Data System (ADS)

Petrova, V. A.; Orekhov, A. S.; Chernyakov, D. D.; Baklagina, Yu. G.; Romanov, D. P.; Kononova, S. V.; Volod'ko, A. V.; Ermak, I. M.; Klechkovskaya, V. V.; Skorik, Yu. A.

2016-11-01

A method for preparing multilayer film composites based on chitosan has been developed by the example of polymer pairs: chitosan-hyaluronic acid, chitosan-alginic acid, and chitosan-carrageenan. The structure of the composite films is characterized by X-ray diffractometry and scanning electron microscopy. It is shown that the deposition of a solution of hyaluronic acid, alginic acid, or carrageenan on a chitosan gel film leads to the formation of a polyelectrolyte complex layer at the interface, which is accompanied by the ordering of chitosan chains in the surface region; the microstructure of this layer depends on the nature of contacting polymer pairs.

Preparation, characterization and cytotoxic evaluation of bovine serum albumin nanoparticles encapsulating 5-methylmellein: A secondary metabolite isolated from Xylaria psidii.

PubMed

Arora, Divya; Kumar, Amit; Gupta, Prasoon; Chashoo, Gousia; Jaglan, Sundeep

2017-12-01

In this study, 5-methylmellein (5-MM) loaded bovine serum albumin nanoparticles (BSA NPs) were developed using desolvation technique. The developed nanoparticles were characterized for their mean particle size, polydispersity, zeta potential, loading efficiency, X-ray diffractometry (XRD), differential scanning calorimetry (DSC) and release profile. The developed nanoparticles were spherical in shape under transmission electron microscopy (TEM) and atomic force microscopy (AFM). The developed 5-MM loaded BSA NPs demonstrated a mean particle size with a diameter of 154.95 ± 4.44 nm. The results from XRD and DSC studies demonstrated that the crystal state of the 5-MM was converted to an amorphous state in polymeric matrix. The encapsulation and loading efficiency was found to be 73.26 ± 4.48% and 7.09 ± 0.43%. The in vitro cytotoxicity in human prostate cancer cell line (PC-3), human colon cancer cells (HCT-116) and human breast adenocarcinoma cell line (MCF-7) cells demonstrated enhanced cytotoxicity of 5-MM BSA NPs as compared to native 5-MM after 72-h treatment. The enhancement in cytotoxicity of 5-MM BSA NPs was also supported by increase in cellular apoptosis, mitochondrial membrane potential loss and generation of high reactive oxygen species (ROS). In conclusion, these findings collectively indicated that BSA nanoparticles may serve as promising drug delivery system for improving the efficacy of 5-methylmellein. Copyright © 2017 Elsevier Ltd. All rights reserved.

Synthesis and antibacterial activity of water-dispersible silver nanoparticles via micellar nanoreactors

NASA Astrophysics Data System (ADS)

Pofali, Prasad; Shirolikar, Seema; Borde, Lalit; Pattani, Aditya; Dandekar, Prajakta; Jain, Ratnesh

2018-04-01

We have synthesized silver nanoparticles (AgNPs) using micelles of sugar fatty acid ester by dissolving the surfactant in a mixture of iso-octane and n-butanol, with solid-liquid extraction. Highly concentrated, water-dispersible AgNPs were obtained after thorough washing with alcohol, to remove excess of sucrose fatty acid ester DK SS and salt, followed by drying. The particles were characterized for their size, morphology and crystallinity using UV-Visible spectrophotometry, Transmission Electron Microscopy and x-ray diffractometry. Antibacterial study, confirmed the activity of nanoparticles against E. coli, P. aeruginosa and S. aureus, which causes diseases including diarrhoea and several life-threatening infections. Antibacterial activity of E. coli and P. aeruginosa was found to be 2.5 fold and for S. aureus 1.6 fold compared to 50 ppm conc. of Silver Nitrate. Our method of producing nanoparticles is employed as a platform technology for synthesizing other inorganic nanoparticles. This is the first report discussing the use of micellar carriers for obtaining silver nanopowder, to the best of our knowledge, which has the potential to overcome limitations during fabrication of AgNPs using reverse/inverse micelles. Our method yielded nano-sized, water-dispersible AgNPs via an easy and economic approach. The one-pot approach possesses advantages in terms of cost and simplicity, as compared with traditional methods of producing powdered AgNPs using energy intensive and expensive techniques like lyophilisation. The developed method, thus, possesses immense potential for commercial synthesis of AgNPs.

Innate catalytic and free radical scavenging activities of silver nanoparticles synthesized using Dillenia indica bark extract.

PubMed

Mohanty, Alfa S; Jena, Bhabani S

2017-06-15

A green approach was envisaged for the rapid synthesis of stable silver nanoparticles in an aqueous medium using phenolic rich ethanolic bark extract from D. indica with marked free radical scavenging and reducing ability. Biosynthesis of silver nanoparticles (AgNPs) was confirmed and characterized by using UV-visible spectroscopy, particle size analyzer, X-ray diffractometry (XRD), Transmission Electron Microscopy (TEM) and Fourier Transform Infrared Spectroscopy (FT-IR). Bio-reduction of Ag+ was confirmed with the appearance of golden yellow coloration within 5-10min at 45°C with maximum absorbance at 421nm. XRD analysis of AgNPs indicated the crystalline nature of metallic Ag. As analyzed by TEM, AgNPs were found to be spherical in shape, well dispersed and size varied from 15 to 35nm and dynamic light scattering (DLS) studies showed the average particle size of 29nm with polydispersity index (PDI) of 0.280. Synthesized AgNPs were showing surface functionalization as revealed through FTIR studies. These AgNPs were observed to be highly stable at room temperature (28±2°C) for more than 3months, thereby indicating the ethanolic extract of D. indica was a reducing as well as a capping agent for stabilization of AgNPs. Moreover, these green synthesized AgNPs showed enhanced free radical scavenging and excellent catalytic activities when used in the reduction of 4-nitrophenol and methylene blue dye, at room temperature. Copyright © 2017 Elsevier Inc. All rights reserved.

Fluorescence properties of alloyed ZnSeS quantum dots overcoated with ZnTe and ZnTe/ZnS shells

NASA Astrophysics Data System (ADS)

Adegoke, Oluwasesan; Mashazi, Philani; Nyokong, Tebello; Forbes, Patricia B. C.

2016-04-01

Fluorescent alloyed ternary ZnSeS quantum dots (QDs) have been synthesized via the pyrolysis of organometallic precursors. The effects of passivation of ZnTe and ZnTe/ZnS shells on the optical properties of the ternary alloyed ZnSeS core have been studied. A ligand exchange reaction using L-cysteine as a capping ligand was used to obtain water-soluble nanocrystals. The nanocrystals were each characterized by UV/vis absorption and fluorescence spectroscopy, transmission electron microscopy, X-ray diffractometry (XRD) and X-ray photoelectron spectroscopy (XPS). The photoluminescence (PL) quantum yield (QY) of alloyed ZnSeS QDs was 14% and this value increased to 27% when ZnTe was overcoated around the surface but further coating with a ZnS shell decreased the PL QY slightly to 24%. This implies that ZnTe shell suppressed non-radiative recombination exciton states in the alloyed core while further layering with a ZnS shell offered no further improvement in suppressing the defect states. XPS analysis confirmed the presence of the first shell layering but showed a weakened intensity signal of S (2p) and Se (3d) for the ZnSeS/ZnTe/ZnS QDs. Our work demonstrates for the first time that shell passivation of alloyed Zn-based QDs can offer improved optical properties. We hope the optical information presented in this work will be useful in the selection of alloyed Zn-based QDs appropriate for the intended application.

Formulation and delivery of itraconazole to the brain using a nanolipid carrier system

PubMed Central

Lim, Wei Meng; Rajinikanth, Paruvathanahalli Siddalingam; Mallikarjun, Chitneni; Kang, Yew Beng

2014-01-01

The objectives of this study were to develop and characterize itraconazole (ITZ)-loaded nanostructured lipid carriers (NLCs) and to study their potential for drug delivery into the brain. Precirol® ATO 5 and Transcutol® HP were selected as the lipid phase, and Tween® 80 and Solutol® HS15 as surfactants. The ITZ-NLCs were prepared by a hot and high-pressure homogenization method. The entrapment efficiency for the best formulation batch was analyzed using high-performance liquid chromatography and was found to be 70.5%±0.6%. The average size, zeta potential, and polydispersity index for the ITZ-NLCs used for animal studies were found to be 313.7±15.3 nm, −18.7±0.30 mV, and 0.562±0.070, respectively. Transmission electron microscopy confirmed that ITZ-NLCs were spherical in shape, with a size of less than 200 nm. Differential scanning calorimetry and X-ray diffractometry analysis showed that ITZ was encapsulated in the lipid matrix and present in the amorphous form. The in vitro release study showed that ITZ-NLCs achieved a sustained release, with cumulative release of 80.6%±5.3% up to 24 hours. An in vivo study showed that ITZ-NLCs could increase the ITZ concentration in the brain by almost twofold. These results suggest that ITZ-NLCs can be exploited as nanocarriers to achieve sustained release and brain-targeted delivery. PMID:24833900

Phase transition behavior of (K,Na)NbO3-based high-performance lead-free piezoelectric ceramic composite with different phase compositions depending on Na fraction

NASA Astrophysics Data System (ADS)

Yamada, Hideto; Matsuoka, Takayuki; Yamazaki, Masato; Ohbayashi, Kazushige; Ida, Takashi

2018-01-01

The structures of the main (K1- x Na x )NbO3 perovskite in a high-performance lead-free piezoelectric ceramic composite (K1- x Na x )0.86Ca0.04Li0.02Nb0.85O3-δ-K0.85Ti0.85Nb1.15O5-BaZrO3-MgO-Fe2O3 (x = 0.52 and 0.70) with trace amounts of LiMgFeTiO4 inverse spinel and (Li,K)2(Mg,Fe,Ti,Nb)6O13 layered structure have been investigated by transmission electron microscopy (TEM) and synchrotron powder X-ray diffractometry (XRD) with varying temperatures. The bright-field TEM images have shown tetragonal 90°-domain contrasts at 80 and 40 °C, and the XRD profile has been simulated by adding an average structure of two differently oriented tetragonal structures bound by a 90°-domain wall for the x = 0.52 sample. Aggregates of tilted NbO6 nanodomains have been observed in a high-resolution TEM image, and the crossover of P4mm-Amm2 features from 60 to 20 °C and diffuse 2 × 2 × 2 superlattice reflections of the tilted NbO6 Imm2 structure have been observed in XRD data for the x = 0.70 sample.

Diazepam-loaded solid lipid nanoparticles: design and characterization.

PubMed

Abdelbary, Ghada; Fahmy, Rania H

2009-01-01

The aim of the present study was to investigate the feasibility of the inclusion of a water-insoluble drug (diazepam, DZ) into solid lipid nanoparticles (SLNs), which offer combined advantages of rapid onset and prolonged release of the drug. This work also describes a new approach to prepare suppositories containing DZ-loaded SLN dispersions, as potential drug carrier for the rectal route. Modified high-shear homogenization and ultrasound techniques were employed to prepare SLNs. The effect of incorporation of different concentrations of Compritol ATO 888 or Imwitor 900K and Poloxamer 188 or Tween 80 was investigated. Results showed that varying the type or concentration of lipid matrix or surfactant had a noticeable influence on the entrapment efficiencies, particle size, and release profiles of prepared SLNs. Differential scanning calorimetry and X-ray diffraction measurements showed that the majority of SLNs possessed less ordered arrangements of crystals than the corresponding bulk lipids, which was favorable for increasing the drug loading capacity. Transmission electron microscopy and laser diffractometry studies revealed that the prepared nanoparticles were round and homogeneous and 60% of the formulations were less than 500 nm. Additionally, SLN formulations showed significant (P < 0.05) prolonged release than DZ solution. The subsequent step encompassed the preparation and evaluation of SLN-based suppositories utilizing SLN formulations that illustrated optimal release profiles. The in vitro release of DZ from the suppositories prepared using DZ-loaded SLN dispersions (equivalent to 2 mg DZ) was significantly (P < 0.05) extended compared to suppositories containing 2 mg DZ free drug.

Effect of magnetic and thermal properties of iron oxide nanoparticles (IONs) in nitrile butadiene rubber (NBR) latex

NASA Astrophysics Data System (ADS)

Ong, Hun Tiar; Julkapli, Nurhidayatullaili Muhd; Hamid, Sharifah Bee Abd; Boondamnoen, O.; Tai, Mun Foong

2015-12-01

Nitrile butadiene rubber (NBR) gloves are one of the most important personal protective equipments but they are possible to tear off and contaminate food or pharmaceutical and healthcare products during manufacturing and packaging process. High tendency of torn glove remaining in food or products due to white or light flesh-coloured glove is not easy to be detected by naked eyes. In this paper, iron oxide nanoparticles (IONs) selected as additive for NBR to improve its detectability by mean of magnetic properties. IONs synthesized via precipitation method and compounded with NBR latex before casting on petri dish. The properties of IONs were investigated by X-ray Diffractometry (XRD), Transmission Electron Microscope (TEM), Raman Spectroscopy and Vibrating Sample Magnetometer (VSM). Meanwhile NBR/IONs composites were studied by Thermogravimetry Analysis (TGA), Differential Scanning Calorimetry (DSC) and Vibrating Sample Magnetometer (VSM). It observed that, synthesized IONs shows of 25.28 nm crystallite with 25.86 nm semipherical (changed as) shape. Meanwhile, Magnetite and maghemite phase are found in range of 670 cm-1 and 700 cm-1 respectively, which it contributes magnetization saturation of 73.96 emu/g at 10,000 G by VSM. Thermal stability and magnetic properties were increased with incorporating IONs into NBR latex up to 20 phr. NBR/IONs 5 phr has the optimum thermal stability, lowest glass transition temperature (-14.83 °C) and acceptable range of magnetization saturation (3.83 emu/g at 10,000 G) to form NBR gloves with magnetic detectability.

Oxidative degradation of the antibiotic oxytetracycline by Cu@Fe3O4 core-shell nanoparticles.

PubMed

Pham, Van Luan; Kim, Do-Gun; Ko, Seok-Oh

2018-08-01

A core-shell nanostructure composed of zero-valent Cu (core) and Fe 3 O 4 (shell) (Cu@Fe 3 O 4 ) was prepared by a simple reduction method and was evaluated for the degradation of oxytetracycline (OTC), an antibiotic. The Cu core and the Fe 3 O 4 shell were verified by X-ray diffractometry (XRD) and transmission electron microscopy. The optimal molar ratio of [Cu]/[Fe] (1/1) in Cu@Fe 3 O 4 created an outstanding synergic effect, leading to >99% OTC degradation as well as H 2 O 2 decomposition within 10min at the reaction conditions of 1g/L Cu@Fe 3 O 4 , 20mg/L OTC, 20mM H 2 O 2 , and pH3.0 (and even at pH9.0). The OTC degradation rate by Cu@Fe 3 O 4 was higher than obtained using single nanoparticle of Cu or Fe 3 O 4 . The results of the study using radical scavengers showed that OH is the major reactive oxygen species contributing to the OTC degradation. Finally, good stability, reusability, and magnetic separation were obtained with approximately 97% OTC degradation and no notable change in XRD patterns after the Cu@Fe 3 O 4 catalyst was reused five times. These results demonstrate that Cu@Fe 3 O 4 is a novel prospective candidate for the pharmaceutical and personal care products degradation in the aqueous phase. Copyright © 2018 Elsevier B.V. All rights reserved.

Zirconium phosphatidylcholine-based nanocapsules as an in vivo degradable drug delivery system of MAP30, a momordica anti-HIV protein.

PubMed

Caizhen, Guo; Yan, Gao; Ronron, Chang; Lirong, Yang; Panpan, Chu; Xuemei, Hu; Yuanbiao, Qiao; Qingshan, Li

2015-04-10

An essential in vivo drug delivery system of a momordica anti-HIV protein, MAP30, was developed through encapsulating in chemically synthesized matrices of zirconium egg- and soy-phosphatidylcholines, abbreviated to Zr/EPC and Zr/SPC, respectively. Matrices were characterized by transmission electron microscopy and powder X-ray diffractometry studies. Zr/EPC granule at an approximate diameter of 69.43±7.78 nm was a less efficient encapsulator than the granule of Zr/SPC. Interlayer spacing of the matrices encapsulating MAP30 increased from 8.8 and 9.7 Å to 7.4 and 7.9 nm, respectively. In vivo kinetics on degradation and protein release was performed by analyzing the serum sampling of intravenously injected SPF chickens. The first order and biphasic variations were obtained for in vivo kinetics using equilibrium dialysis. Antimicrobial and anti-HIV assays yielded greatly decreased MIC50 and EC50 values of nanoformulated MAP30. An acute toxicity of MAP30 encapsulated in Zr/EPC occurred at a single intravenous dose above 14.24 mg/kg bw in NIH/KM/ICR mice. The folding of MAP30 from Zr/EPC sustained in vivo chickens for more than 8 days in high performance liquid chromatography assays. These matrices could protect MAP30 efficiently with strong structure retention, lowered toxicity and prolonged in vivo life. Copyright © 2015 Elsevier B.V. All rights reserved.

Surface engineering of nanoparticles with macromolecules for epoxy curing: Development of super-reactive nitrogen-rich nanosilica through surface chemistry manipulation

NASA Astrophysics Data System (ADS)

Jouyandeh, Maryam; Jazani, Omid Moini; Navarchian, Amir H.; Shabanian, Meisam; Vahabi, Henri; Saeb, Mohammad Reza

2018-07-01

Curing behavior of epoxy-based nanocomposites depends on dispersion state of nanofillers and their physical and chemical interactions with the curing moieties. In this work, a systematic approach was introduced for chemical functionalization of nanoparticles with macromolecules in order to enrich crosslinking potential of epoxy/amine systems, particularly at late stages of cure where the curing is diffusion-controlled. Super-reactive hyperbranched polyethylenimine (PEI)-attached nanosilica was materialized in this work to facilitate epoxy-amine curing. Starting from coupling [3-(2,3-epoxypropoxy) propyl] trimethoxysilane (EPPTMS) with hyperbranched PEI, a super-reactive macromolecule was obtained and subsequently grafted onto the nanosilica surface. Eventually, a thermally-stable highly-curable nanocomposite was attained by replacement of amine and imine groups of the PEI with imide and amide groups through the reaction with pyromellitic acid dianhydride. Fourier-transform infrared spectrophotometry, X-ray diffractometry, X-ray photoelectron spectroscopy and transmission electron microscopy approved successful grafting of polymer chains onto the nanosilica surface. Thermogravimetric analyses approved a relatively high grafting ratio of ca. 21%. Curing potential of the developed super-reactive nanoparticle was uncovered through nonisothermal differential scanning calorimetry signifying an enthalpy rise of ca. 120 J/g by addition of 2 wt.% to epoxy at 5 °C/min heating rate. Even at low concentration of 0.5 wt.%, the glass transition temperature of epoxy increased from 128 to 156 °C, demonstrating prolonged crosslinking.

A mixed valence zinc dithiolene system with spectator metal and reactor ligands.

PubMed

Ratvasky, Stephen C; Mogesa, Benjamin; van Stipdonk, Michael J; Basu, Partha

2016-08-16

Neutral complexes of zinc with N,N'-diisopropylpiperazine-2,3-dithione ( i Pr 2 Dt 0 ) and N,N'-dimethylpiperazine-2,3-dithione (Me 2 Dt 0 ) with chloride or maleonitriledithiolate (mnt 2- ) as coligands have been synthesized and characterized. The molecular structures of these zinc complexes have been determined using single crystal X-ray diffractometry. Complexes recrystallize in monoclinic P type systems with zinc adopting a distorted tetrahedral geometry. Two zinc complexes with mixed-valent dithiolene ligands exhibit ligand-to-ligand charge transfer bands. Optimized geometries, molecular vibrations and electronic structures of charge-transfer complexes were calculated using density functional theory (B3LYP/6-311G+(d,p) level). Redox orbitals are shown to be almost exclusively ligand in nature, with a HOMO based heavily on the electron-rich maleonitriledithiolate ligand, and a LUMO comprised mostly of the electron-deficient dithione ligand. Charge transfer is thus believed to proceed from dithiolate HOMO to dithione LUMO, showing ligand-to-ligand redox interplay across a d 10 metal.

Corrosion products of carbonation induced corrosion in existing reinforced concrete facades

DOE Office of Scientific and Technical Information (OSTI.GOV)

Köliö, Arto; Honkanen, Mari; Lahdensivu, Jukka

Active corrosion in reinforced concrete structures is controlled by environmental conditions and material properties. These factors determine the corrosion rate and type of corrosion products which govern the total achieved service life. The type and critical amount of corrosion products were studied by electron microscopy and X-ray diffractometry on concrete and reinforcement samples from existing concrete facades on visually damaged locations. The corrosion products in outdoor environment exposed concrete facades are mostly hydroxides (Feroxyhite, Goethite and Lepidocrocite) with a volume ratio to Fe of approximately 3. The results can be used to calibrate calculation of the critical corrosion penetration ofmore » concrete facade panels.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pratapa, S.; Susanti, L.; Insany, Y. A. S.

Simple coprecipitation method has been used to produce nanoparticles of MgO (magnesia), MgO{center_dot}Al{sub 2}O{sub 3}(spinel), Y{sub 2}O{sub 3}(yttria) and Fe{sub 3}O{sub 4}(ferrite). The raw materials were, in respective, magnesium powder, magnesium and aluminium powders, ytrria powder, and natural sand. The coprecipitation included the use of suitable acid and base to dissolve the powders or sand and to produce precipitates, as well as the use of water to wash and purify the precipitates, and drying at relatively low temperatures, namely lower than 100 deg. C, followed by heating at 450 deg. C, 750 deg. C, 600 deg. C and 200 deg.more » C to produce magnesia, spinel, yttria and ferrite nanopowders, respectively. X-ray diffractometry was used to characterise the purity and nanocrystallinity of the final powders. It was found qualitatively that the powders were of high purity. Further line-broadening analysis using single-line and Rietveld-based softwares was performed to reveal the nanocrystallinity of the powders. Different line breadth values were found for the powders, indicating different crystallite sizes. It was also found that, particularly for spinel and yttria, the diffraction peaks exhibited 'longer' tails, indicating broader crystallite size distribution. The average crystallite size for the powders ranged from 3 to 70 nm. The results could then be used as 'fingerprints' for nanocrystallinity using x-ray diffractometry. The XRD crystallite sizes for yttria and ferrite nanocrystals are in fair agreement with their counterparts from electron microscopy observation.« less

Modified extrusion-spheronization as a technique of microencapsulation for stabilization of choline bitartrate using hydrogenated soya bean oil.

PubMed

Gangurde, Avinash Bhaskar; Sav, Ajay Kumar; Javeer, Sharadchandra Dagadu; Moravkar, Kailas K; Pawar, Jaywant N; Amin, Purnima D

2015-01-01

Choline bitartrate (CBT) is a vital nutrient for fetal brain development and memory function. It is hygroscopic in nature which is associated with stability related problem during storage such as development of fishy odor and discoloration. Microencapsulation method was adopted to resolve the stability problem and for this hydrogenated soya bean oil (HSO) was used as encapsulating agent. Industrially feasible modified extrusion-spheronization technique was selected for microencapsulation. HSO was used as encapsulating agent, hydroxypropyl methyl cellulose E5/E15 as binder and microcrystalline cellulose as spheronization aid. Formulated pellets were evaluated for parameters such as flow property, morphological characteristics, hardness-friability index (HFI), drug content, encapsulation efficiency, and in vitro drug release. The optimized formulations were also characterized for particle size (by laser diffractometry), differential scanning calorimetry, powder X-ray diffractometry (PXRD), Fourier transform infrared spectroscopy, and scanning electron microscopy. The results from the study showed that coating of 90% and 60% CBT was successful with respect to all desired evaluation parameters. Optimized formulation was kept for 6 months stability study as per ICH guidelines, and there was no change in color, moisture content, drug content, and no fishy odor was observed. Microencapsulated pellets of CBT using HSO as encapsulating agent were developed using modified extrusion spheronization technique. Optimized formulations, CBT 90% (F5), and CBT 60% (F10), were found to be stable for 4M and 6M, respectively, at accelerated conditions.

Study of multilayered SiGe semiconductor structures by X-ray diffractometry, grazing-incidence X-ray reflectometry, and secondary-ion mass spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yunin, P. A., E-mail: yunin@ipmras.ru; Drozdov, Yu. N.; Drozdov, M. N.

2013-12-15

In this publication, we report the results of studying a multilayerd nonperiodic SiGe/Si structure by the methods of X-ray diffractometry, grazing-angle X-ray reflectometry, and secondary-ion mass spectrometry (SIMS). Special attention is paid to the processing of the component distribution profile using the SIMS method and to consideration of the most significant experimental distortions introduced by this method. A method for processing the measured composition distribution profile with subsequent consideration of the influence of matrix effects, variation in the etching rate, and remnants of ion sputtering is suggested. The results of such processing are compared with a structure model obtained uponmore » combined analysis of X-ray diffractometry and grazing-angle reflectometry data. Good agreement between the results is established. It is shown that the combined use of independent techniques makes it possible to improve the methods of secondary-ion mass spectrometry and grazing-incidence reflectometry as applied to an analysis of multilayered heteroepitaxial structures (to increase the accuracy and informativity of these methods)« less

A novel strategy to directly fabricate flexible hollow nanofibers with tunable luminescence-electricity-magnetism trifunctionality using one-pot electrospinning.

PubMed

Liu, Yawen; Ma, Qianli; Dong, Xiangting; Yu, Wensheng; Wang, Jinxian; Liu, Guixia

2015-09-21

Novel photoluminescent-electrical-magnetic trifunctional flexible Eu(BA)3phen/PANI/Fe3O4/PVP (BA = benzoic acid, phen = phenanthroline, PANI = polyaniline, PVP = polyvinylpyrrolidone) hollow nanofibers were fabricated by a one-pot electrospinning technique using a specially designed coaxial spinneret for the first time. Very different from the traditional preparation process of hollow fibers via coaxial electrospinning, which needs to firstly fabricate the coaxial fibers and followed by removing the core through high-temperature calcination or solvent extraction, in our current study, no core spinning solution is used to directly fabricate hollow nanofibers. The morphology and properties of the obtained hollow nanofibers were characterized in detail using X-ray diffractometry, scanning electron microscopy, transmission electron microscopy, fluorescence spectroscopy, Fourier-transform infrared spectroscopy, a 4-point probe resistivity measurement system and vibrating sample magnetometry. The Eu(BA)3phen/PANI/Fe3O4/PVP hollow nanofibers, with outer diameters of ca. 305 nm and inner diameters of about 140 nm, exhibit excellent photoluminescence performance, electrical conductivity and magnetic properties. Fluorescence emission peaks of Eu(3+) are observed in the Eu(BA)3phen/PANI/Fe3O4/PVP hollow nanofibers and assigned to the (5)D0→(7)F0 (580 nm), (5)D0→(7)F1 (592 nm) and (5)D0→(7)F2 (616 nm) energy level transitions of Eu(3+) ions, and the (5)D0→(7)F2 hypersensitive transition at 616 nm is the predominant emission peak. The electrical conductivity of the hollow nanofibers reaches up to the order of 10(-3) S cm(-1). The luminescent intensity, electrical conductivity and magnetic properties of the hollow nanofibers can be tuned by adding various amounts of Eu(BA)3phen, PANI and Fe3O4 nanoparticles. The new-type photoluminescent-electrical-magnetic trifunctional flexible hollow nanofibers hold potential for a variety of applications, including electromagnetic interference shielding, microwave absorption, molecular electronics and biomedicine. The design conception and synthetic strategy developed in this study are of universal significance to construct other multifunctional hollow one-dimensional nanomaterials.

New insight into the promoting role of process on the CeO₂-WO₃/TiO₂ catalyst for NO reduction with NH₃ at low-temperature.

PubMed

Zhang, Shule; Zhong, Qin; Shen, Yuge; Zhu, Li; Ding, Jie

2015-06-15

This study aimed at investigating the reason of high catalytic activity for CeO2-WO3/TiO2 catalyst from the aspects of WO3 interaction with other species and the NO oxidation process. Analysis by X-ray diffractometry, photoluminescence spectra, diffuse reflectance UV-visible, X-ray photoelectron spectroscopy, density functional theory calculations, electron paramagnetic resonance spectroscopy, temperature-programmed-desorption of NO and in situ diffuse reflectance infrared transform spectroscopy showed that WO3 could interact with CeO2 to improve the electron gaining capability of CeO2 species. In addition, WO3 species acted as electron donating groups to transfer the electrons to CeO2 species. The two aspects enhanced the formation of reduced CeO2 species to improve the formation of superoxide ions. Furthermore, the Ce species were the active sites for the NO adsorption and the superoxide ions over the catalyst needed oxidizing the adsorbed NO to improve the NO oxidation. This process was responsible for the high catalytic activity of CeO2-WO3/TiO2 catalyst. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization and mechanical properties investigation of TiN-Ag films onto Ti-6Al-4V

NASA Astrophysics Data System (ADS)

Du, Dongxing; Liu, Daoxin; Zhang, Xiaohua; Tang, Jingang; Xiang, Dinggen

2016-03-01

To investigate their effect on fretting fatigue (FF) resistance of a Ti-6Al-4V alloy, hard solid lubricating composite films of TiN with varying silver contents (TiN-Ag) were deposited on a Ti-6Al-4V alloy using ion-assisted magnetron sputtering. The surface morphology and structure were analyzed by atomic force microscopy, X-ray diffractometry, X-ray photoelectron spectroscopy, and transmission electron microscopy. The hardness, bonding strength, and toughness of films were tested using a micro-hardness tester, scratch tester, and a repeated press-press test system that was manufactured in-house, respectively. The FF resistance of TiN-Ag composite films was studied using self-developed devices. The results show that the FF resistance of a titanium alloy can be improved by TiN-Ag composite films, which were fabricated using hard TiN coating doped with soft Ag. The FF life of Ag0.5, Ag2, Ag5, Ag10 and Ag20 composite films is 2.41, 3.18, 3.20, 2.94 and 2.87 times as great as that of the titanium alloy, respectively. This is because the composite films have the better toughness, friction lubrication, and high bonding strength. When the atomic fraction of Ag changes from 2% to 5%, the FF resistance of the composite films shows the best performance. This is attributed to the surface integrity of the composite film is sufficiently fine to prevent the initiation and early propagation of FF cracks.

L-cysteine protected copper nanoparticles as colorimetric sensor for mercuric ions.

PubMed

Soomro, Razium A; Nafady, Ayman; Sirajuddin; Memon, Najma; Sherazi, Tufail H; Kalwar, Nazar H

2014-12-01

This report demonstrates a novel, simple and efficient protocol for the synthesis of copper nanoparticles in aqueous solution using L-cysteine as capping or protecting agent. UV-visible (UV-vis) spectroscopy was employed to monitor the LSPR band of L-cysteine functionalized copper nanoparticles (Cyst-Cu NPs) based on optimizing various reaction parameters. Fourier Transform Infrared (FTIR) spectroscopy provided information about the surface interaction between L-cysteine and Cu NPs. Transmission Electron Microscopy (TEM) confirmed the formation of fine spherical, uniformly distributed Cyst-Cu NPs with average size of 34 ± 2.1 nm. X-ray diffractometry (XRD) illustrated the formation of pure metallic phase crystalline Cyst-Cu NPs. As prepared Cyst-Cu NPs were tested as colorimetric sensor for determining mercuric (Hg(2+)) ions in an aqueous system. Cyst-Cu NPs demonstrated very sensitive and selective colorimetric detection of Hg(2+) ions in the range of 0.5 × 10(-6)-3.5 × 10(-6) mol L(-1) based on decrease in LSPR intensity as monitored by a UV-vis spectrophotometer. The developed sensor is simple, economic compared to those based on precious metal nanoparticles and sensitive to detect Hg(2+) ions with detection limit down to 4.3 × 10(-8) mol L(-1). The sensor developed in this work has a high potential for rapid and on-site detection of Hg(2+) ions. The sensor was successfully applied for assessment of Hg(2+) ions in real water samples collected from various locations of the Sindh River. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural properties of ultrafine Ba-hexaferrite nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makovec, Darko, E-mail: Darko.Makovec@ijs.si; Primc, Darinka; Sturm, Saso

2012-12-15

Crystal structure of ultrafine Ba-hexaferrite (BaFe{sub 12}O{sub 19}) nanoparticles was studied using X-ray diffractometry (XRD), high-resolution transmission electron microscopy (HRTEM), energy-dispersive X-ray spectroscopy (EDXS), X-ray absorption fine structure (XAFS), and Moessbauer spectroscopy (MS), to be compared to the structure of larger nanoparticles and the bulk. The nanoparticles were synthesized with hydrothermal treatment of an appropriate suspension of Ba and Fe hydroxides in the presence of a large excess of OH{sup -}. The ultrafine nanoparticles were formed in a discoid shape, {approx}10 nm wide and only {approx}3 nm thick, comparable to the size of the hexagonal unit cell in the c-direction.more » The HRTEM image analysis confirmed the hexaferrite structure, whereas EDXS showed the composition matching the BaFe{sub 12}O{sub 19} formula. XAFS and MS analyses showed considerable disorder of the structure, most probably responsible for the low magnetization. - Graphical abstract: Left: HREM image of an ultrafine Ba-hexaferrite nanoparticle (inset: TEM image of the nanoparticles); Right: the experimental HRTEM image is compared with calculated image and corresponding atomic model. Highlights: Black-Right-Pointing-Pointer Crystal structure of ultrafine Ba-hexaferrite (BaFe{sub 12}O{sub 19}) nanoparticles was compared to the structure of the bulk. Black-Right-Pointing-Pointer Thickness the discoid nanoparticles was comparable to the size of the hexagonal unit cell in the c-direction. Black-Right-Pointing-Pointer Considerable disorder of the nanoparticles' structure is most probably responsible for their low magnetization.« less

Synthesis and CO2/CH4 separation peformance of Bio-MOF-1 membranes

NASA Astrophysics Data System (ADS)

Bohrman, Joseph Allen

The separation of carbon dioxide from natural gas is of great interest from the environmental and energy perspective, respectively. From the environmental point of view, capturing CO2 effectively from power plants can have a positive impact on reducing greenhouse gas emissions. From the energy point of view, CO2 is an undesirable impurity in natural gas wells, with concentrations as high as 70%. Membrane technology can play a major role in making natural gas purification processes economically feasible. A novel membrane composed of Metal-organic-framework material Zn 8(Ad)4(BPDC)6O 2Me2NH2 (Bio-MOF-1) was designed and created to effectively separate CO2/CH4 gas mixtures. The crystalline structure, composition, and textural properties of Bio-MOF-1 membranes were confirmed through x-ray diffractometry, CHN analysis, transmission electron microscopy, adsorption measurements and BET surface area. A secondary seeded growth approach was employed to prepare these membranes on tubular stainless steel porous support. These membranes displayed high CO2 permeances (11.5x10-7 mol / m2 s Pa) and moderate CO2/CH4 separation selectivities (1.2--2.5). The observed selectivities are above the Knudsen selectivity and indicate that the separation is promoted by preferential CO2 adsorption over CH4. This preferential adsorption is attributed to the presence of adeninate amino basic sites present in the Bio-MOF-1 structure. The work demonstrated shows the feasibility of the development of a novel type of membrane that could be promising for diverse molecular gas separations.

Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review

PubMed Central

Tao, Shu Xia; Chan, Hong Wah; van der Graaf, Harry

2016-01-01

Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided. PMID:28774137

Self-propagating high-temperature synthesis and luminescent properties of ytterbium doped rare earth (Y, Sc, Lu) oxides nanopowders

NASA Astrophysics Data System (ADS)

Permin, D. A.; Novikova, A. V.; Balabanov, S. S.; Gavrishchuk, E. M.; Kurashkin, S. V.; Savikin, A. P.

2018-04-01

This paper describes a comparative study of structural and luminescent properties of 5%Yb-doped yttrium, scandium, and lutetium oxides (Yb:RE2O3) powders and ceramics fabricated by self-propagating high-temperature synthesis. According to X-ray diffractometry and electron microscopy the chosen method ensures preparation of low-agglomerated cubic Ctype crystal structured powders at one step. No crucial differences in luminescence spectra were found the Yb:RE2O3 powders and ceramics. It was shown that the emission lifetimes of the Yb:RE2O3 powders are lowered by crystal structure defects, while its values for ceramics samples are compared to that of monocrystals and more influenced by rare earth impurities.

Silica nanoparticles produced by DC arc plasma from a solid raw materials

NASA Astrophysics Data System (ADS)

Kosmachev, P. V.; Vlasov, V. A.; Skripnikova, N. K.

2017-05-01

Plasma synthesis of SiO2 nanoparticles in experimental atmospheric pressure plasma reactor on the basis of DC arc plasma generator was presented in this paper. Solid high-silica raw materials such as diatomite from Kamyshlovskoye deposit in Russia, quartzite from Chupinskoye deposit in Russia and milled window glass were used. The obtained nanoparticles were characterized based on their morphology, chemical composition and size distribution. Scanning electron microscopy, laser diffractometry, nitrogen absorption (Brunauer-Emmett-Teller method), X-ray photoelectron spectroscopy and energy-dispersive X-ray spectroscopy were used to characterize the synthesized products. The obtained silica nanoparticles are agglomerated, have spherical shape and primary diameters between 10-300 nm. All samples of synthesized nanopowders were compared with commercial nanopowders.

Selective laser sintering of single-phase powder Cr-V tool steel

NASA Astrophysics Data System (ADS)

Kovalev, A. I.; Mishina, V. P.; Wainstein, D. L.; Titov, V. I.; Moiseev, V. F.; Tolochko, N. K.

2002-10-01

Presented is positive experience from selective laser sintering (SLS) of cylindrical steel specimens (3.0% C, 3.0% Cr, 1.0% Si, 12.0% V, Fe balance) 30 mm long and 5 mm in diameter by rapid prototyping. It was demonstrated that monolithic steel material could be successfully fabricated by this technology. Differential thermal analysis (DTA), scanning electron microscopy (SEM), and x-ray diffractometry (XRD) were used to study the microstructure, phase, and chemical composition of the source material and obtained specimens. Low-melting cementite-based eutectic was found to provide the liquid phase sintering of powder tool steel. The porosity of the green sintered specimens did not exceed 5%. The mean hardness value of sintered specimens was 825 HV.

Clay-mineraloid weathering products in Antarctic meteorites

NASA Technical Reports Server (NTRS)

Gooding, James L.

1986-01-01

The production of clay mineraloids (CMs) in the weathering of stony meteorites recovered in the Allan Hills and Elephant Moraine areas of Antarctica is investigated, applying electron microbeam analysis, pyrolysis/mass spectroscopy, X-ray diffractometry, and differential scanning calorimetry to whole-rock chips from two eucrites, two diogenites, and an H5 chondrite. The data are presented in tables, graphs, and photomicrographs and characterized in detail. Massive to incipient-vermicular CM formations with smectitelike or micalike compositions and indications of poor crystallization are observed and attributed to hydrocryogenic diagenesis (with little or no liquid water) on time scales of 10-1000 kyr. The need to take the compositional effects of weathering into account before attempting to reconstruct the preterrestrial histories of meteorites is stressed.

Transmission Kikuchi diffraction and transmission electron forescatter imaging of electropolished and FIB manufactured TEM specimens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zieliński, W., E-mail: wiziel@inmat.pw.edu.pl; Płociński, T.; Kurzydłowski, K.J.

2015-06-15

We present a study of the efficiency of the utility of scanning electron microscope (SEM)-based transmission methods for characterizing grain structure in thinned bulk metals. Foils of type 316 stainless steel were prepared by two methods commonly used for transmission electron microscopy — double-jet electropolishing and focused ion beam milling. A customized holder allowed positioning of the foils in a configuration appropriate for both transmission electron forward scatter diffraction, and for transmission imaging by the use of a forescatter detector with two diodes. We found that both crystallographic orientation maps and dark-field transmitted images could be obtained for specimens preparedmore » by either method. However, for both methods, preparation-induced artifacts may affect the quality or accuracy of transmission SEM data, especially those acquired by the use of transmission Kikuchi diffraction. Generally, the quality of orientation data was better for specimens prepared by electropolishing, due to the absence of ion-induced damage. - Highlights: • The transmission imaging and diffraction techniques are emerging in scanning electron microscopy (SEM) as promising new field of materials characterization. • The manuscript titled: “Transmission Kikuchi Diffraction and Transmission Electron Forescatter Imaging of Electropolished and FIB Manufactured TEM Specimens” documents how different specimen thinning procedures can effect efficiency of transmission Kikuchi diffraction and transmission electron forescatter imaging. • The abilities to make precision crystallographic orientation maps and dark-field images in transmission was studied on electropolished versus focus ion beam manufactured TEM specimens. • Depending on the need, electropolished and focused ion beam technique may produce suitable specimens for transmission imaging and diffraction in SEM.« less

Nanometres-resolution Kikuchi patterns from materials science specimens with transmission electron forward scatter diffraction in the scanning electron microscope.

PubMed

Brodusch, N; Demers, H; Gauvin, R

2013-04-01

A charge-coupled device camera of an electron backscattered diffraction system in a scanning electron microscope was positioned below a thin specimen and transmission Kikuchi patterns were collected. Contrary to electron backscattered diffraction, transmission electron forward scatter diffraction provides phase identification and orientation mapping at the nanoscale. The minimum Pd particle size for which a Kikuchi diffraction pattern was detected and indexed reliably was 5.6 nm. An orientation mapping resolution of 5 nm was measured at 30 kV. The resolution obtained with transmission electron forward scatter diffraction was of the same order of magnitude than that reported in electron nanodiffraction in the transmission electron microscope. An energy dispersive spectrometer X-ray map and a transmission electron forward scatter diffraction orientation map were acquired simultaneously. The high-resolution chemical, phase and orientation maps provided at once information on the chemical form, orientation and coherency of precipitates in an aluminium-lithium 2099 alloy. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.

RF sputtered silicon and hafnium nitrides as applied to 440C steel

NASA Technical Reports Server (NTRS)

Grill, A.; Aron, P. R.

1984-01-01

Silicon nitride and hafnium nitride coatings were deposited on oxidized and unoxidized 440C stainless steel substrates. Sputtering was done in mixtures of argon and nitrogen gases from pressed powder silicon nitride and from hafnium metal targets. The coatings and the interface between the coating and substrate were investigated by X-ray diffractometry, scanning electron microscopy, energy dispersive X-ray analysis and Auger electron spectroscopy. Oxide was found at all interfaces with an interface width of at least 600 A for the oxidized substrates and at least 300 A for the unoxidized substrates. Scratch test results demonstrate that the adhesion of hafnium nitride to both oxidized and unoxidized 440C is superior to that of silicon nitride. Oxidized 440C is found to have increased adhesion, to both nitrides, over that of unoxidized 440C. Coatings of both nitrides deposited at 8 mtorr were found to have increased adhesion to both oxidized and unoxidized 440C over those deposited at 20 mtorr.

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

Modified extrusion-spheronization as a technique of microencapsulation for stabilization of choline bitartrate using hydrogenated soya bean oil

PubMed Central

Gangurde, Avinash Bhaskar; Sav, Ajay Kumar; Javeer, Sharadchandra Dagadu; Moravkar, Kailas K; Pawar, Jaywant N; Amin, Purnima D

2015-01-01

Introduction: Choline bitartrate (CBT) is a vital nutrient for fetal brain development and memory function. It is hygroscopic in nature which is associated with stability related problem during storage such as development of fishy odor and discoloration. Aim: Microencapsulation method was adopted to resolve the stability problem and for this hydrogenated soya bean oil (HSO) was used as encapsulating agent. Materials and Methods: Industrially feasible modified extrusion-spheronization technique was selected for microencapsulation. HSO was used as encapsulating agent, hydroxypropyl methyl cellulose E5/E15 as binder and microcrystalline cellulose as spheronization aid. Formulated pellets were evaluated for parameters such as flow property, morphological characteristics, hardness-friability index (HFI), drug content, encapsulation efficiency, and in vitro drug release. The optimized formulations were also characterized for particle size (by laser diffractometry), differential scanning calorimetry, powder X-ray diffractometry (PXRD), Fourier transform infrared spectroscopy, and scanning electron microscopy. Results and Discussions: The results from the study showed that coating of 90% and 60% CBT was successful with respect to all desired evaluation parameters. Optimized formulation was kept for 6 months stability study as per ICH guidelines, and there was no change in color, moisture content, drug content, and no fishy odor was observed. Conclusion: Microencapsulated pellets of CBT using HSO as encapsulating agent were developed using modified extrusion spheronization technique. Optimized formulations, CBT 90% (F5), and CBT 60% (F10), were found to be stable for 4M and 6M, respectively, at accelerated conditions. PMID:26682198

7 CFR 400.209 - Electronic transmission and receiving system.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 6 2012-01-01 2012-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...

7 CFR 400.209 - Electronic transmission and receiving system.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 6 2013-01-01 2013-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...

7 CFR 400.209 - Electronic transmission and receiving system.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 6 2011-01-01 2011-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...

7 CFR 400.209 - Electronic transmission and receiving system.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 6 2010-01-01 2010-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...

[application of the analytical transmission electron microscopy techniques for detection, identification and visualization of localization of nanoparticles of titanium and cerium oxides in mammalian cells].

PubMed

Shebanova, A S; Bogdanov, A G; Ismagulova, T T; Feofanov, A V; Semenyuk, P I; Muronets, V I; Erokhina, M V; Onishchenko, G E; Kirpichnikov, M P; Shaitan, K V

2014-01-01

This work represents the results of the study on applicability of the modern methods of analytical transmission electron microscopy for detection, identification and visualization of localization of nanoparticles of titanium and cerium oxides in A549 cell, human lung adenocarcinoma cell line. A comparative analysis of images of the nanoparticles in the cells obtained in the bright field mode of transmission electron microscopy, under dark-field scanning transmission electron microscopy and high-angle annular dark field scanning transmission electron was performed. For identification of nanoparticles in the cells the analytical techniques, energy-dispersive X-ray spectroscopy and electron energy loss spectroscopy, were compared when used in the mode of obtaining energy spectrum from different particles and element mapping. It was shown that the method for electron tomography is applicable to confirm that nanoparticles are localized in the sample but not coated by contamination. The possibilities and fields of utilizing different techniques for analytical transmission electron microscopy for detection, visualization and identification of nanoparticles in the biological samples are discussed.

Marble protection: An inorganic electrokinetic approach

NASA Astrophysics Data System (ADS)

Meloni, Paola; Manca, Francesco; Carcangiu, Gianfranco

2013-05-01

The influence of an electric potential difference in an aqueous solution was studied as a method for depositing a calcium oxalate coating over a weathered carbonatic stone. Samples of weathered Carrara white marble were treated at 15 and 50 °C for 5 h in an electrokinetic cell, specifically conceived for this study, containing a solution of ammonium oxalate (4% by weight), and were subsequently characterised by scanning electron microscopy, X-ray diffractometry, thermogravimetric analysis and mercury intrusion porosimetry. The electrokinetic treatment proved to be a cost effective and time saving process, able to produce a thick and homogeneous calcium oxalate coating over the stone surface that improves its chemical and physical resistance in low pH environments, and is able to protect the stone from the by-products of urban pollution.

A facile and efficient strategy for the fabrication of porous linseed gum/cellulose superabsorbent hydrogels for water conservation.

PubMed

Zhang, Hao; Luan, Qian; Huang, Qingde; Tang, Hu; Huang, Fenghong; Li, Wenlin; Wan, Chuyun; Liu, Changsheng; Xu, Jiqu; Guo, Pingmei; Zhou, Qi

2017-02-10

The linseed gum/cellulose composite hydrogels were successfully fabricated by mixing cellulose and linseed gum solutions dissolved in the NaOH/urea aqueous system and cross-linked with epichlorohydrin. The morphology and structure of the composite hydrogels were investigated by scanning electron microscopy (SEM), Fourier transform infrared (FTIR) spectroscopy, X-ray diffractometry (XRD) and thermogravimetric analysis (TGA). The swelling ratio and water retention properties were investigated. The results revealed that linseed gum mainly contributed to water adsorption, whereas the cellulose acted as a backbone to strengthen the porous structure. This work provided a simple way to prepare cellulose-based superabsorbent hydrogels, which could be potentially applied as an effective water conservation material in agriculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

Geology and geochemistry of the Arctic prospect, Ambler District, Alaska

NASA Astrophysics Data System (ADS)

Schmidt, J. M.

The Arctic volcanogenic massive sulfide prospect is the largest known (40 million ton) deposit hosted by the low greenschist grade, latest Devonian Ambler Sequence of bimodal, basaltic and rhyolitic volcanic and volcanoclastic rocks, pelitic, graphitic and calcareous metasediments. Detailed field mapping, core logging, petrography, X-ray diffractometry, electron microprobe analyses and whole-rock major element analyses of hydrothermally altered rocks were used to determine the emplacement history and setting of sulfide deposition. Low greenschist grade metamorphism was essentially isochemical on a macroscopic scale, and preserved volcanic compositions, the major element chemistry of alteration and the compositions of individual metamorphic, alteration and relict igneous minerals. Mineralization at Arctic was formed along a synvolcanic fault in a tectonically and volcanically active basin within a rifted continental margin, possibly related to an actively spreading oceanic rift.

Evolution of Constitution, Structure, and Morphology in FeCo-Based Multicomponent Alloys

NASA Astrophysics Data System (ADS)

Li, R.; Stoica, M.; Liu, G.; Eckert, J.

2010-07-01

Constituent phases, melting behaviors, and microstructure of multicomponent (Fe0.5Co0.5) x (Mo0.1C0.2B0.5Si0.2)100- x alloys ( x = 95, 90, 85, 80, and 70) produced by copper mold casting were evaluated by various analysis techniques, i.e., X-ray diffractometry, scanning electronic microscopy with energy dispersive X-ray spectrometry, and differential scanning calorimetry. Metastable Fe3C- and Cr23C6-type phases were identified in the chill-cast alloys. A schematic illustration was proposed to explain the evolution of constituent phases and microstructure for the alloys with x = 95, 90, and 85 during the solidification process, which could be applicable to controlling microstructural formation of other multicomponent alloys with similar microstructures by artificially adjusting the composition.

Characterization of calcium phosphate coatings deposited by Nd:YAG laser ablation at 355 nm: influence of thickness.

PubMed

Fernández-Pradas, J M; Clèries, L; Sardin, G; Morenza, J L

2002-05-01

Calcium phosphate coatings were deposited by pulsed laser ablation with a radiation of 355 nm from a Nd:YAG laser. All the coatings were obtained at the same conditions, but deposition was stopped after different number of pulses to get coatings with different thickness. The influence of thickness in the structural and mechanical properties of the coatings was investigated. Coatings structure was characterised by scanning electron microscopy, grazing incidence X-ray diffractometry and Raman spectroscopy. The mechanical properties were evaluated by scratch test. The morphology of the coatings is dominated by the presence of droplets. The coatings are composed mainly of hydroxyapatite, alpha tricalcium phosphate and amorphous calcium phosphate. Thinner coatings withstand higher loads of failure in the scratch test.

In-line metrology for roll-to-roll UV assisted nanoimprint lithography using diffractometry

NASA Astrophysics Data System (ADS)

Kreuzer, Martin; Whitworth, Guy L.; Francone, Achille; Gomis-Bresco, Jordi; Kehagias, Nikolaos; Sotomayor-Torres, Clivia M.

2018-05-01

We describe and discuss the optical design of a diffractometer to carry out in-line quality control during roll-to-roll nanoimprinting. The tool measures diffractograms in reflection geometry, through an aspheric lens to gain fast, non-invasive information of any changes to the critical dimensions of target grating structures. A stepwise tapered linear grating with constant period was fabricated in order to detect the variation in grating linewidth through diffractometry. The minimum feature change detected was ˜40 nm to a precision of 10 nm. The diffractometer was then integrated with a roll-to-roll UV assisted nanoimprint lithography machine to gain dynamic measurements in situ.

Ultrastructure of selected struvite-containing urinary calculi from cats.

PubMed

Neumann, R D; Ruby, A L; Ling, G V; Schiffman, P S; Johnson, D L

1996-01-01

To elucidate the ultrastructural details of struvite-containing urinary calculi from cats. Specimens studied were inclusive of the range of textures visible during preliminary analysis by use of a stereoscopic dissecting microscope. Textural types, which were used to infer crystal growth conditions, were differentiated with regard to crystal habit, crystal size, growth orientation, and primary porosity. Thirty specimens were selected from a collection of approximately 1,600 feline urinary calculi: 20 of these were composed entirely of struvite, and 10 consisted of struvite and calcium phosphate (apatite). Qualitative and quantitative analyses of specimens included use of plain and polarized light microscopy, x-ray diffractometry, scanning electron microscopy with backscattered electron imagery, x-ray fluorescence scans, and electron probe microanalysis. Four textural types were recognized among struvite calculi, whereas 2 textural types of struvite-apatite calculi were described. The presence of minute, well interconnected primary pores in struvite-containing urinary calculi from cats is an important feature, which may promote possible interaction of calculi with changes in urine composition. Primary porosity, which can facilitate interaction between the calculus and changing urine composition, may explain the efficacy of dietary or medicinal manipulations to promote the dissolution of struvite-containing uroliths from this species.

In vitro and in vivo evaluation of an oral sustained release hepatoprotective caffeine loaded w/o Pickering emulsion formula - containing wheat germ oil and stabilized by magnesium oxide nanoparticles.

PubMed

Elmotasem, Heba; Farag, Hala K; Salama, Abeer A A

2018-05-16

The objective of this study was to innovate an effective oral sustained release hepatoprotective formula for - the water soluble drug - caffeine. Caffeine is rapidly absorbed and eliminated which dictates frequent administration to achieve adequate therapeutic effect. A w/o Pickering emulsion incorporating caffeine in the internal phase was primed. It contained wheat germ oil and was stabilized by synthesized magnesium oxide nanoparticles (MgO NPs). Components selection was based on their antioxidant, hepatoprotective and anticarcinogenic effects. The MgO NPs were prepared via sol-gel method, and then were characterized using X-ray diffractometry, transmission electron microscopy, contact angle and cytotoxicity. The Pickering emulsion formula stabilized by MgO NPs (F1) was compared to another stabilized by conventional MgO particles (F2). Both were evaluated regarding droplet size, stability and caffeine release. F1 was stable against phase separation for a 2 months period. Its droplets mean size was 665.9 ± 90 nm. F1 afforded sustained release for caffeine that reached 70% within 48 h that followed zero order kinetics. 100 ppm of F1 showed nearly 36% growth inhibition of hepatocellular carcinoma (HEPG2). In vivo and histopathalogical evaluations were conducted on CCl 4 intoxicated rats. Biochemical analysis for liver enzymes - (ALT and AST), oxidative stress biomarkers and the inflammation marker (protein kinase C) - revealed that the selected formula elicited significant hepatoprotection. This formula acted as an economical approach to multiple therapy and afforded safe effective sustained level for caffeine. Copyright © 2018. Published by Elsevier B.V.

Enhanced oral bioavailability of felodipine by novel solid self-microemulsifying tablets.

PubMed

Jing, Boyu; Wang, Zhiyuan; Yang, Rui; Zheng, Xia; Zhao, Jia; Tang, Si; He, Zhonggui

2016-01-01

The novel self-microemulsifying (SME) tablets were developed to enhance the oral bioavailability of a poor water-soluble drug felodipine (FDP). Firstly, FDP was dissolved in the optimized liquid self-microemusifying drug delivery systems (SMEDDS) containing Miglyol® 812, Cremophor® RH 40, Tween 80 and Transcutol® P, and the mixture was solidified with porous silicon dioxide and crospovidone as adsorbents. Then after combining the solidified powders with other excipients, the solid SME tablets were prepared by wet granulation-compression method. The prepared tablets possessed satisfactory characterization; the droplet size of the SME tablets following self-emulsification in water was nearly equivalent to the liquid SMEDDS (68.4 ± 14.0 and 64.4 ± 12.0 nm); differential scanning calorimetry (DSC) and powder X-ray diffractometry (PXRD) analysis demonstrated that FDP in SME tablets had undergone a polymorphism transition from a crystal form to an amorphous state, which was further confirmed by transmission electron microscopy (TEM). A similar dissolution performance of SME tablets and liquid SMEDDS was also obtained under the sink condition (85% within 10 min), both significantly higher than commercial tablets. The oral bioavailability was evaluated for the SME tablets, liquid SMEDDS and commercial conventional tablets in the fasted beagle dogs. The AUC of FDP from the SME tablets was about 2-fold greater than that of conventional tablets, but no significant difference was found when compared with the liquid SMEDDS. Accordingly, these preliminary results suggest that this formulation approach offers a useful large-scale producing method to prepare the solid SME tablets from the liquid SMEDDS for oral bioavailability equivalent enhancement of poorly soluble FDP.

Effects of Nano-CeO₂ with Different Nanocrystal Morphologies on Cytotoxicity in HepG2 Cells.

PubMed

Wang, Lili; Ai, Wenchao; Zhai, Yanwu; Li, Haishan; Zhou, Kebin; Chen, Huiming

2015-09-02

Cerium oxide nanoparticles (nano-CeO₂) have been reported to cause damage and apoptosis in human primary hepatocytes. Here, we compared the toxicity of three types of nano-CeO₂ with different nanocrystal morphologies (cube-, octahedron-, and rod-like crystals) in human hepatocellular carcinoma cells (HepG2). The cells were treated with the nano-CeO₂ at various concentrations (6.25, 12.5, 25, 50, 100 μg/mL). The crystal structure, size and morphology of nano-CeO₂ were investigated by X-ray diffractometry and transmission electron microscopy. The specific surface area was detected using the Brunauer, Emmet and Teller method. The cellular morphological and internal structure were observed by microscopy; apoptotic alterations were measured using flow cytometry; nuclear DNA, mitochondrial membrane potential (MMP), reactive oxygen species (ROS) and glutathione (GSH) in HepG2 cells were measured using high content screening technology. The scavenging ability of hydroxyl free radicals and the redox properties of the nano-CeO₂ were measured by square-wave voltammetry and temperature-programmed-reduction methods. All three types of nano-CeO₂ entered the HepG2 cells, localized in the lysosome and cytoplasm, altered cellular shape, and caused cytotoxicity. The nano-CeO₂ with smaller specific surface areas induced more apoptosis, caused an increase in MMP, ROS and GSH, and lowered the cell's ability to scavenge hydroxyl free radicals and antioxidants. In this work, our data demonstrated that compared with cube-like and octahedron-like nano-CeO₂, the rod-like nano-CeO₂ has lowest toxicity to HepG2 cells owing to its larger specific surface areas.

Microstructural characterization of Charpy-impact-tested nanostructured bainite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsai, Y.T.; Chang, H.T.; Huang, B.M.

2015-09-15

In this work, a possible cause of the extraordinary low impact toughness of nanostructured bainite has been investigated. The microstructure of nanostructured bainite consisted chiefly of carbide-free bainitic ferrite with retained austenite films. X-ray diffractometry (XRD) measurement indicated that no retained austenite existed in the fractured surface of the Charpy-impact-tested specimens. Fractographs showed that cracks propagated mainly along bainitic ferrite platelet boundaries. The change in microstructure after impact loading was verified by transmission electron microscopy (TEM) observations, confirming that retained austenite was completely transformed to strain-induced martensite during the Charpy impact test. However, the zone affected by strained-induced martensite wasmore » found to be extremely shallow, only to a depth of several micrometers from the fracture surface. It is appropriately concluded that upon impact, as the crack forms and propagates, strain-induced martensitic transformation immediately occurs ahead of the advancing crack tip. The successive martensitic transformation profoundly facilitates the crack propagation, resulting in the extremely low impact toughness of nanostructured bainite. Retained austenite, in contrast to its well-known beneficial role, has a deteriorating effect on toughness during the course of Charpy impact. - Highlights: • The microstructure of nanostructured bainite consisted of nano-sized bainitic ferrite subunits with retained austenite films. • Special sample preparations for SEM, XRD and TEM were made, and the strain-affected structures have been explored. • Retained austenite films were found to transform into martensite after impact loading, as evidenced by XRD and TEM results. • The zone of strain-induced martensite was found to extend to only several micrometers from the fracture surface. • The poor Charpy impact toughness is associated with the fracture of martensite at a high strain rate during impact loading.« less

Carbon contamination in scanning transmission electron microscopy and its impact on phase-plate applications.

PubMed

Hettler, Simon; Dries, Manuel; Hermann, Peter; Obermair, Martin; Gerthsen, Dagmar; Malac, Marek

2017-05-01

We analyze electron-beam induced carbon contamination in a transmission electron microscope. The study is performed on thin films potentially suitable as phase plates for phase-contrast transmission electron microscopy. Electron energy-loss spectroscopy and phase-plate imaging is utilized to analyze the contamination. The deposited contamination layer is identified as a graphitic carbon layer which is not prone to electrostatic charging whereas a non-conductive underlying substrate charges. Several methods that inhibit contamination are evaluated and the impact of carbon contamination on phase-plate imaging is discussed. The findings are in general interesting for scanning transmission electron microscopy applications. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

19 CFR 181.93 - Submission of advance ruling requests.

Code of Federal Regulations, 2013 CFR

2013-04-01

... Court of Appeals for the Federal Circuit, or any court of appeal therefrom, or review by a judicial or... warrant and permit. Requests for special consideration made by telegram or electronic transmission will be... or electronic transmission. A telegram or electronic transmission must be followed up with a signed...

19 CFR 181.93 - Submission of advance ruling requests.

Code of Federal Regulations, 2012 CFR

2012-04-01

... Court of Appeals for the Federal Circuit, or any court of appeal therefrom, or review by a judicial or... warrant and permit. Requests for special consideration made by telegram or electronic transmission will be... or electronic transmission. A telegram or electronic transmission must be followed up with a signed...

Quantitative measurement of indomethacin crystallinity in indomethacin-silica gel binary system using differential scanning calorimetry and X-ray powder diffractometry.

PubMed

Pan, Xiaohong; Julian, Thomas; Augsburger, Larry

2006-02-10

Differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) methods were developed for the quantitative analysis of the crystallinity of indomethacin (IMC) in IMC and silica gel (SG) binary system. The DSC calibration curve exhibited better linearity than that of XRPD. No phase transformation occurred in the IMC-SG mixtures during DSC measurement. The major sources of error in DSC measurements were inhomogeneous mixing and sampling. Analyzing the amount of IMC in the mixtures using high-performance liquid chromatography (HPLC) could reduce the sampling error. DSC demonstrated greater sensitivity and had less variation in measurement than XRPD in quantifying crystalline IMC in the IMC-SG binary system.

Transmission electron microscope studies of extraterrestrial materials

NASA Technical Reports Server (NTRS)

Keller, Lindsay P.

1995-01-01

Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.

Orientation and phase mapping in the transmission electron microscope using precession-assisted diffraction spot recognition: state-of-the-art results.

PubMed

Viladot, D; Véron, M; Gemmi, M; Peiró, F; Portillo, J; Estradé, S; Mendoza, J; Llorca-Isern, N; Nicolopoulos, S

2013-10-01

A recently developed technique based on the transmission electron microscope, which makes use of electron beam precession together with spot diffraction pattern recognition now offers the possibility to acquire reliable orientation/phase maps with a spatial resolution down to 2 nm on a field emission gun transmission electron microscope. The technique may be described as precession-assisted crystal orientation mapping in the transmission electron microscope, precession-assisted crystal orientation mapping technique-transmission electron microscope, also known by its product name, ASTAR, and consists in scanning the precessed electron beam in nanoprobe mode over the specimen area, thus producing a collection of precession electron diffraction spot patterns, to be thereafter indexed automatically through template matching. We present a review on several application examples relative to the characterization of microstructure/microtexture of nanocrystalline metals, ceramics, nanoparticles, minerals and organics. The strengths and limitations of the technique are also discussed using several application examples. ©2013 The Authors. Journal of Microscopy published by John Wiley & Sons Ltd on behalf of Royal Microscopical Society.

45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format

Code of Federal Regulations, 2013 CFR

2013-10-01

... 45 Public Welfare 4 2013-10-01 2013-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN.... 1355, App. C Appendix C to Part 1355—Electronic Data Transmission Format All AFCARS data to be sent...

Evaluation of anterior lenticonus in alport syndrome using tracey wavefront aberrometry and transmission electron microscopy.

PubMed

Kim, Kwan Soo; Kim, Mo Sae; Kim, Joon Mo; Choi, Chul Young

2010-01-01

To evaluate the efficacy of Tracey wavefront aberrometry (Tracey Technologies, Houston, TX) and transmission electron microscopy for the detection of anterior lenticonus in Alport syndrome. Tracey wavefront aberrometry was used to treat a patient with bilateral anterior lenticonus who had a history of Alport syndrome. For transmission electron microscopic examination, anterior lens capsules were obtained during clear lens phacoemulsification and intraocular lens implantation. Spherical aberrations were the predominant higher-order aberrations in the internal optics of both eyes. The Tracey wavefront aberrometer showed that most of the irregular astigmatism originated from the lenticular portion. Transmission electron microscopy of the specimens showed anterior lens capsules with decreased thickness and multiple dehiscences. Tracey wavefront aberrometry and transmission electron microscopy are effective tools for evaluation of anterior lenticonus in Alport syndrome. Copyright 2010, SLACK Incorporated.

Archaeometallurgy in Messina: Iron Slug From A Dig at Blog P, Laboratory Analyses and Interpretation.

NASA Astrophysics Data System (ADS)

Caterina, Ingoglia; Maurizio, Triscari; Giuseppe, Sabatino

The archaeological site in Via La Farina, Block P, in Messina, is unique in many ways, due also to the high quantity of samples of iron slag. The slag was examined to identify the production centres of such materials, and, after characterization, was compared to similar material, exclusively for product typology, from different archaeological sites in the province of Messina, situated in the Peloritani Mountains (Messina city, S. Marco d'Alunzio, Milazzo, Francavilla di Sicilia, Novara di Sicilia as well as the archaeological site of Halaesa, near Tusa). Mineralogical characterization of the phases carried out by X-ray diffractometry (XRD) and Rietveld data elaboration, morphological study of slag findings and a semi-quantitative analysis by scanning electronic microscope (SEM+EDX) were performed. A chemical investigation was carried out by electron probe micro analysis (EPMA), to determine major element,. Minor and trace elements were determined by LA-ICP-MS. All the examined slag is related to iron metallurgy, and, in the case of Via La Farina, there is firm archaeological evidence pinpointing to smelting activity.

Reduced graphene oxide-CdS nanocomposite with enhanced photocatalytic 4-Nitrophenol degradation

NASA Astrophysics Data System (ADS)

Chakraborty, Koushik; Ibrahim, Sk; Das, Poulomi; Ghosh, Surajit; Pal, Tanusri

2017-05-01

We report the photocatalytic activity of reduced graphene oxide cadmium sulfide (RGO-CdS) composite towards the degradation of 4-Nitrophenol (4-NP) under simulated solar light illumination. The solution processable RGO-CdS composite was synthesized by one pot single step low cost solvothermal process, where the reduction of graphene oxide (GO), synthesis and attachment of CdS onto RGO sheets were done simultaneously. The structural and morphological characterization of the RGO-CdS composite and the reduction of GO was confirmed by X-ray diffractometry, TEM imaging and Fourier transform infrared spectroscopy respectively. The photocatalytic efficiency of RGO-CdS composite is 2.6 times higher in compare to controlled CdS. In RGO-CdS composite the photo induced electrons transfer from CdS nanorod to RGO sheets, which reduces the recombination probability of photo generated electron-hole in the CdS. These well separated photoinduced charges enhanced the photocatalytic activity of the RGO-CdS composite. Our study establishes the RGO-CdS composite as a potential photocatalyst for the degradation of organic water pollutant.

Enhancement of valve metal osteoconductivity by one-step hydrothermal treatment.

PubMed

Zuldesmi, Mansjur; Waki, Atsushi; Kuroda, Kensuke; Okido, Masazumi

2014-09-01

In this study, we produced super-hydrophilic surfaces of valve metals (Ti, Nb, Ta and Zr) by one-step hydrothermal treatment. Their surface characteristics and osteoconductivity using an in vivo test were then assessed. These data were compared with that of as-polished, as-anodized and both anodized+hydrothermally treated samples. Changes in surface chemistry, surface morphology and structure were investigated by X-ray photoelectron spectroscopy, scanning electron microscopy, and X-ray diffractometry. The results revealed that the water contact angles of valve metals were decreased by hydrothermal treatment and continued to reduce dramatically until lower than 10° after being immersed in phosphate buffered solution. By producing super-hydrophilic surfaces, the osteoconductivity of these hydrothermally treated valve metals was enhanced by up to 55%. Copyright © 2014 Elsevier B.V. All rights reserved.

Analysis of NiAlTa precipitates in beta-NiAl + 2 at. pct Ta alloy

NASA Technical Reports Server (NTRS)

Pathare, V.; Michal, G. M.; Vedula, K.; Nathal, M. V.

1987-01-01

Results are reported from experiments performed to identify the precipitates, and their orientation in the matrix, in a beta-NiAl alloy containing 2 at. pct. Ta after undergoing creep test at 1300 K. Test specimens formed by extruding hot powders were compressed at 1300 K for about 50 hr at a strain rate averaging 6/1 million per sec. The specimens were then thinned and examined under an electron microscope and by X-ray diffractometry. An intermetallic NiAlTa compound with a hexagonal Cl4 structure appeared as second phase precipitates in the samples, exhibiting plate-like shapes and a habit plane close to (012). The prism planes of the hexagonal NiAlTa precipitates paralleled the closest packed planes in the cubic beta-NiAl matrix.

Gold leaf counter electrodes for dye-sensitized solar cells

NASA Astrophysics Data System (ADS)

Shimada, Kazuhiro; Toyoda, Takeshi

2018-03-01

In this study, a gold leaf 100 nm thin film is used as the counter electrode in dye-sensitized solar cells. The traditional method of hammering gold foil to obtain a thin gold leaf, which requires only small amounts of gold, was employed. The gold leaf was then attached to the substrate using an adhesive to produce the gold electrode. The proposed approach for fabricating counter electrodes is demonstrated to be facile and cost-effective, as opposed to existing techniques. Compared with electrodes prepared with gold foil and sputtered gold, the gold leaf counter electrode demonstrates higher catalytic activity with a cobalt-complex electrolyte and higher cell efficiency. The origin of the improved performance was investigated by surface morphology examination (scanning electron microscopy), various electrochemical analyses (cyclic voltammetry, linear sweep voltammetry, and electrochemical impedance spectroscopy), and crystalline analysis (X-ray diffractometry).

Delaminating and restacking MgAl-layered double hydroxide monitored and characterized by a range of instrumental methods

NASA Astrophysics Data System (ADS)

Muráth, Szabolcs; Somosi, Zoltán; Tóth, Ildikó Y.; Tombácz, Etelka; Sipos, Pál; Pálinkó, István

2017-07-01

The delamination-restacking properties of MgAl-layered double hydroxide (MgAl-LDH) were studied in various solvents. The LDH samples were successfully delaminated in polar amides (formamide, N-methylformamide, N-methylacetamide). Usually, delamination was finalized by ultrasonic treatment. As rehydrating solutions, numerous Na-salts with single-, double- and triple-charged anions were used. Reconstruction was accomplished with anions of one or two negative charges, but triple-charged ones generally disrupted the rebuilding process, likely, because their salts with the metals of the LDH are very stable, and the thin layers can more readily transform to salts than the ordered materials. Samples and delamination-restacking processes were characterized by X-ray diffractometry (XRD), infrared spectroscopy (IR), dynamic light scattering (DLS), scanning electron microscopy (SEM) and energy-dispersive X-ray analysis (EDX).

Laser formation of titanium nitride films as a result of Ti coating modification in a nitrogen atmosphere

NASA Astrophysics Data System (ADS)

Eskin, Sergei

1998-12-01

Laser treatment of the 303 and 416 stainless steels with Ti precoating was studied. CW CO2 and UV ArF excimer lasers were used. The TiN films were formed at a treatment velocity of 0.5 to 3 - 5 cm/sec and a power density of CO2 laser at (3 - 5) 104 W/cm2. X-ray diffractometry, x-ray mapping and Auger electron spectroscopy techniques indicated a TiN phase on the surface with oxygen content 12 - 25 at%. The thickness of the TiN film was 0.3 - 0.4 micrometers after treatment of the 5 micrometers Ti coating and about 900 angstroms for the 0.3 micrometers coating. Some characteristics of TiN films were examined and features of the nitriding process are discussed.

[Study on the traditional lime mortar from the memorial archway in the southern Anhui province].

PubMed

Wei, Guo-Feng; Sun, Sheng; Wang, Cheng-Xing; Zhang, Bing-Jian; Chen, Xi-Min

2013-07-01

The traditional lime mortar was investigated by means of scanning electron microscope (SEM), X-ray diffractometry and Fourier transform infrared spectrometry (FTIR). The results show that the mortar from the memorial archway in the southern Anhui province was the organic-inorganic composite materials composed of lime with tung oil or sticky rice. It was found that the excellent performance of the tung oil-lime mortar can be explained by the compact lamellar organic-inorganic composite structure that was produced by carbonization reaction of lime, cross-linking reactions of tung oil and oxygen and complexing reaction of Ca2+ and -COO-. The compact micro-structure of sticky rice-lime mortar, which was produced due to carbonation process of lime controlled by amylopectin, should be the cause of the good performance of this kind of organic-inorganic mortar.

The study of in-situ formed alumina and aluminide intermetallic reinforced aluminum-based metal matrix composites

NASA Astrophysics Data System (ADS)

Yu, Peng

Aluminum-based metal matrix composites (MMCs) have been widely used as structural materials in the automobile and aerospace industry due to their specific properties. In this thesis, we report the fabrication of in-situ formed alumina and aluminide intermetallic reinforced aluminum-based metal matrix composites by the displacement reactions between Al and selected metal oxides (NiO, CuO and ZnO). These MMCs were produced when the Al-20wt% NiO, Al-20wt% CuO and Al-10wt% ZnO green compacts were reaction sintered in the tube furnaces. In this work, differential thermal analysis (DTA) was performed on the green samples. The green samples were then sintered separately in different tube furnaces for 30 minutes. In order to study the reaction mechanisms, the x-ray diffractometry (XRD) was used to obtain diffraction patterns of these sintered samples, the scanning electron microscope (SEM) and transmission electron microscope (TEM) were used to study the microstructures of these samples. The elemental quantitative compositions of samples were determined by the energy dispersive x-ray spectrometry (EDX). In order to study the effect of cooling rate on the samples, the green samples were further sintered to 1000°C and cooled down to room temperature in different conditions: by furnace-cooling, air-quenching, oil-quenching or NaCl-solution-quenching. The SEM, TEM and atomic force microscopy (AFM) were conducted to investigate their microstructures. A microhardness tester was used to measure the hardness values of these samples. It was found that during sintering of the Al-20wt% NiO green sample, displacement reaction between Al and NiO initially occurred in solid-solid form and was soon halted by its products that separated the NiO particles from the Al matrix. The reaction then resumed in solid-liquid form as the temperature increased to the eutectic temperature of Al3Ni-Al when liquid (Al, Ni) phase appeared in the sample. After cooling, Al2O 3 particles, Al3Ni proeutectic phase and fiber-like Al 3Ni-Al eutectic were found in the sintered Al-MMC sample. (Abstract shortened by UMI.)

Electron transmission through a class of anthracene aldehyde molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petreska, Irina, E-mail: irina.petreska@pmf.ukim.mk; Ohanesjan, Vladimir, E-mail: ohanesjan.vladimir@gmail.com; Pejov, Ljupco, E-mail: ljupcop@pmf.ukim.mk

2016-03-25

Transmission of electrons via metal-molecule-metal junctions, involving rotor-stator anthracene aldehyde molecules is investigated. Two model barriers having input parameters evaluated from accurate ab initio calculations are proposed and the transmission coefficients are obtained by using the quasiclassical approximation. Transmission coefficients further enter in the integral for the net current, utilizing Simmons’ method. Conformational dependence of the tunneling processes is evident and the presence of the side groups enhances the functionality of the future single-molecule based electronic devices.

Software electron counting for low-dose scanning transmission electron microscopy.

PubMed

Mittelberger, Andreas; Kramberger, Christian; Meyer, Jannik C

2018-05-01

The performance of the detector is of key importance for low-dose imaging in transmission electron microscopy, and counting every single electron can be considered as the ultimate goal. In scanning transmission electron microscopy, low-dose imaging can be realized by very fast scanning, however, this also introduces artifacts and a loss of resolution in the scan direction. We have developed a software approach to correct for artifacts introduced by fast scans, making use of a scintillator and photomultiplier response that extends over several pixels. The parameters for this correction can be directly extracted from the raw image. Finally, the images can be converted into electron counts. This approach enables low-dose imaging in the scanning transmission electron microscope via high scan speeds while retaining the image quality of artifact-free slower scans. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Electron holography study of magnetization behavior in the writer pole of a perpendicular magnetic recording head by a 1 MV transmission electron microscope.

PubMed

Hirata, Kei; Ishida, Yoichi; Akashi, Tetsuya; Shindo, Daisuke; Tonomura, Akira

2012-01-01

The magnetic domain structure of the writer poles of perpendicular magnetic recording heads was studied using electron holography. Although the domain structure of a 100-nm-thick writer pole could be observed with a 300 kV transmission electron microscope, that of the 250-nm-thick writer pole could not be analyzed due to the limited transmission capability of the instrument. On the other hand, the detailed domain structure of the 250-nm-thick writer pole was successfully analyzed by a 1 MV electron microscope using its high transmission capability. The thickness and material dependency of the domain structure of a writer pole were discussed.

In situ study of the growth and degradation processes in tetragonal lysozyme crystals on a silicon substrate by high-resolution X-ray diffractometry

NASA Astrophysics Data System (ADS)

Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.

2014-09-01

The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.

Physical properties of organic particulate UV-absorbers used in sunscreens. I. Determination of particle size with fiber-optic quasi-elastic light scattering (FOQELS), disc centrifugation, and laser diffractometry.

PubMed

Herzog, Bernd; Katzenstein, Armin; Quass, Katja; Stehlin, Albert; Luther, Helmut

2004-03-01

In this study microparticles consisting of a benzotriazole derivative, which are used as absorbers for UV radiation in cosmetic sunscreens, were investigated. The particles were micronized in presence of a dispersing agent by means of a ball milling process. According to the energy input different particle sizes were produced in the range of 0.16 to 4 microm. The particle sizes obtained after different stages of the micronization process were measured using fiber-optic quasi-elastic light scattering (FOQELS), disc centrifugation, and laser diffractometry. All methods showed satisfactory agreement over the whole range of sizes. With the FOQELS technique the particle size distribution could be resolved to sizes well below 0.1 microm.

Demonstration of transmission high energy electron microscopy

DOE PAGES

Merrill, F. E.; Goett, J.; Gibbs, J. W.; ...

2018-04-06

High energy electrons have been used to investigate an extension of transmission electron microscopy. This technique, transmission high energy electron microscopy (THEEM), provides two additional capabilities to electron microscopy. First, high energy electrons are more penetrating than low energy electrons, and thus, they are able to image through thicker samples. Second, the accelerating mode of a radio-frequency linear accelerator provides fast exposures, down to 1 ps, which are ideal for flash radiography, making THEEM well suited to study the evolution of fast material processes under dynamic conditions. Lastly, initial investigations with static objects and during material processing have been performedmore » to investigate the capabilities of this technique.« less

Measurement of particle size distribution of soil and selected aggregate sizes using the hydrometer method and laser diffractometry

NASA Astrophysics Data System (ADS)

Guzmán, G.; Gómez, J. A.; Giráldez, J. V.

2010-05-01

Soil particle size distribution has been traditionally determined by the hydrometer or the sieve-pipette methods, both of them time consuming and requiring a relatively large soil sample. This might be a limitation in situations, such as for instance analysis of suspended sediment, when the sample is small. A possible alternative to these methods are the optical techniques such as laser diffractometry. However the literature indicates that the use of this technique as an alternative to traditional methods is still limited, because the difficulty in replicating the results obtained with the standard methods. In this study we present the percentages of soil grain size determined using laser diffractometry within ranges set between 0.04 - 2000 μm. A Beckman-Coulter ® LS-230 with a 750 nm laser beam and software version 3.2 in five soils, representative of southern Spain: Alameda, Benacazón, Conchuela, Lanjarón and Pedrera. In three of the studied soils (Alameda, Benacazón and Conchuela) the particle size distribution of each aggregate size class was also determined. Aggregate size classes were obtained by dry sieve analysis using a Retsch AS 200 basic ®. Two hundred grams of air dried soil were sieved during 150 s, at amplitude 2 mm, getting nine different sizes between 2000 μm and 10 μm. Analyses were performed by triplicate. The soil sample preparation was also adapted to our conditions. A small amount each soil sample (less than 1 g) was transferred to the fluid module full of running water and disaggregated by ultrasonication at energy level 4 and 80 ml of sodium hexametaphosphate solution during 580 seconds. Two replicates of each sample were performed. Each measurement was made for a 90 second reading at a pump speed of 62. After the laser diffractometry analysis, each soil and its aggregate classes were processed calibrating its own optical model fitting the optical parameters that mainly depends on the color and the shape of the analyzed particle. As a second alternative a unique optical model valid for a broad range of soils developed by the Department of Soil, Water, and Environmental Science of the University of Arizona (personal communication, already submitted) was tested. The results were compared with the particle size distribution measured in the same soils and aggregate classes using the hydrometer method. Preliminary results indicate a better calibration of the technique using the optical model of the Department of Soil, Water, and Environmental Science of the University of Arizona, which obtained a good correlations (r2>0.85). This result suggests that with an appropriate calibration of the optical model laser diffractometry might provide a reliable soil particle characterization.

Scanning Transmission Electron Microscopy | Materials Science | NREL

Science.gov Websites

mode by collecting the EDS and EELS signals point-by-point as one scans the electron probe across the . Examples of Scanning Transmission Electron Microscopy Capabilities Z-contrast image microphoto taken by

Ochres from rituals of prehistoric human funerals at the Toca do Enoque site, Piauí, Brazil

NASA Astrophysics Data System (ADS)

Cavalcante, Luis Carlos Duarte; da Luz, Maria De Fátima; Guidon, Niéde; Fabris, José Domingos; Ardisson, José Domingos

2011-11-01

The archaeological site known as Toca do Enoque (geographical coordinates, 09° 14' 65.3″ S 43° 55' 62.5″ W) is a rock shelter located in the Serra das Andorinhas (Serra das Confusões National Park), rural area of the city of Guaribas, state of Piauí, Brazil. Several rupestrian paintings (anthropomorphic and zoomorphic motifs along with some pure graphisms), predominantly in red, are found on the sandstone walls. Charcoals, lithic materials, necklaces with teeth, animal bones, gastropod shells, ochres and human skeletons (dated from 6,220 ± 40 to 6,610 ± 40 years before present, BP) were identified in recent excavations in this shelter. Red and yellow ochre samples were collected from prehistoric funeral structures and analyzed with powder X-ray diffractometry, Fourier-transform infrared spectroscopy and 57Fe transmission Mössbauer spectroscopy at 298 K and 80 K. Mössbauer data indicate that the red ochre do contain predominantly hematite ( α-Fe2O3) whereas goethite ( α-FeOOH) is the major mineral in the yellow ochre.

Deciphering the physics and chemistry of perovskites with transmission electron microscopy.

PubMed

Polking, Mark J

2016-03-28

Perovskite oxides exhibit rich structural complexity and a broad range of functional properties, including ferroelectricity, ferromagnetism, and superconductivity. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, electron holography, and other techniques has fueled rapid progress in the understanding of the physics and chemistry of these materials. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, chemistry, electrostatics, and dynamics of perovskite oxides are then explored in detail, with a particular focus on ferroelectric materials.

48 CFR 832.7002-1 - Data transmission.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Data transmission. 832... CONTRACTING REQUIREMENTS CONTRACT FINANCING Electronic Invoicing Requirements 832.7002-1 Data transmission... conforms to the X12 electronic data interchange (EDI) formats established by the Accredited Standards...

48 CFR 832.7002-1 - Data transmission.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Data transmission. 832... CONTRACTING REQUIREMENTS CONTRACT FINANCING Electronic Invoicing Requirements 832.7002-1 Data transmission... conforms to the X12 electronic data interchange (EDI) formats established by the Accredited Standards...

Transmission effects in unfolding electronic-vibrational electron-molecule energy-loss spectra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Shiyang; Khakoo, Murtadha A.; Johnson, Paul V.

2006-03-15

The results of an investigation concerning the sensitivity of conventional unfolding methods applied to electronic-vibrational electron-energy-loss spectra to the transmission efficiency of electron spectrometers are presented. This investigation was made in an effort to understand differences in the differential cross sections for excitation of low-lying electronic states determined experimentally by various groups using electronic-vibrational energy-loss spectra of N{sub 2}. In these experiments, very similar spectral unfolding methods were used, which relied on similar Franck-Condon factors. However, the overall analyses of the electron scattering spectra (by the individual groups) resulted in large differences among the differential cross sections determined from thesemore » energy-loss spectra. The transmission response of the experimental apparatus to different-energy scattered electrons has often been discussed as a key factor that caused these disagreements. The present investigation shows in contrast that the effect of transmission is smaller than that required to independently explain such differences, implying that other systematic effects are responsible for the existing differences between measurements.« less

Swivel assembly

DOEpatents

Hall, David R.; Pixton, David S.; Briscoe, Michael; Bradford, Kline; Rawle, Michael; Bartholomew, David B.; McPherson, James

2007-03-20

A swivel assembly for a downhole tool string comprises a first and second coaxial housing cooperatively arranged. The first housing comprises a first transmission element in communication with surface equipment. The second housing comprises a second transmission element in communication with the first transmission element. The second housing further comprises a third transmission element adapted for communication with a network integrated into the downhole tool string. The second housing may be rotational and adapted to transmit a signal between the downhole network and the first housing. Electronic circuitry is in communication with at least one of the transmission elements. The electronic circuitry may be externally mounted to the first or second housing. Further, the electronic circuitry may be internally mounted in the second housing. The electronic circuitry may be disposed in a recess in either first or second housing of the swivel.

On the Progress of Scanning Transmission Electron Microscopy (STEM) Imaging in a Scanning Electron Microscope.

PubMed

Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar

2018-04-01

Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.

Charge deposition dependence of electron transmission through PET nanocapillaries and a tapered glass microcapillary

NASA Astrophysics Data System (ADS)

Tanis, J. A.; Keerthisinghe, D.; Wickramarachchi, S. J.; Ikeda, T.; Stolterfoht, N.

2018-05-01

Charge deposition dependences of electron transmission through insulating PET nanocapillaries and a tapered glass microcapillary are reported and differences with HCI transmission are noted. Investigations were conducted for electrons with incident energies 500-1000 eV, corresponding to energies per charge similar to those used for HCI studies, incident on (1) an array of PET nanocapillaries (density ∼5 × 108/cm2) with diameters 100 nm in a foil of thickness 12 μm, and (2) on a tapered glass microcapillary with inlet/outlet diameters of 800/100 μm and a length of ∼35 mm. The transmission was measured for incident electrons at small sample tilt angles ranging from 0° to 5° with respect to the beam direction. For most angles, including those near zero degrees, there was an initial quiet period during which essentially no transmission was observed, followed by large rises in the transmission during relatively short periods of charge deposition before equilibrium of the transmission was reached. The resulting equilibrium was stable, blocked or had frequent oscillations depending on the incident energy and the capillary used. Observations for both capillaries show that a negative charge patch is needed to guide incident electrons through the capillaries similar to the manner in which HCIs are guided through capillaries.

Enhancing the bioavailability of magnolol in rabbits using melting solid dispersion with polyvinylpyrrolidone.

PubMed

Lin, Shiuan-Pey; Hou, Yu-Chi; Liao, Tzu-Yun; Tsai, Shang-Yuan

2014-03-01

Preparation of magnolol-loaded amorphous solid dispersion was investigated for improving the bioavailability. A solid dispersion of magnolol was prepared with polyvinylpyrrolidone K-30 (PVP) by melting method, and the physical properties were characterized by using differential scanning calorimetry, powder X-ray diffractometry, Fourier transformation-infrared spectroscopy and scanning electron microscope. In addition, dissolution test was also performed. Subsequently, the bioavailability of magnolol pure compound, its physical mixture and solid dispersion were compared in rabbits. The blood samples withdrawn via marginal ear vein at specific time points were assayed by HPLC method. Oral administration of the solid dispersion of magnolol with PVP significantly increased the systemic exposures of magnolol and magnolol sulfates/glucuronides by 80.1% and 142.8%, respectively, compared to those given with magnolol pure compound. Magnolol-loaded amorphous solid dispersion with PVP has demonstrated enhanced bioavailability of magnolol in rabbits.

Asbestiform minerals in ophiolitic rocks of Calabria (southern Italy).

PubMed

Campopiano, Antonella; Olori, Angelo; Spadafora, Alessandra; Rosaria Bruno, Maria; Angelosanto, Federica; Iannò, Antonino; Casciardi, Stefano; Giardino, Renato; Conte, Maurizio; Oranges, Teresa; Iavicoli, Sergio

2018-03-22

Ophiolitic rocks cropping on Calabria territory, southern Italy, can hold asbestiform minerals potentially harmful for human health. The aim of this work was to detect the fibrous phases of ophiolites along the Coastal Chain of northern Calabria and southern part of the Sila massif. Above 220 massive samples were collected in the study areas and analyzed using optical and electron microscopy, X-ray diffractometry, and Fourier transform infra-red spectrometry. The main fibrous constituent belonged to tremolite-actinolite series followed by fibrous antigorite that becomes more abundant in the samples collected in Reventino Mount surroundings. Results highlighted that serpentinites samples mainly consisted of antigorite and minor chrysotile. Samples collected along the coastal chain of northern Calabria did not hold fibrous materials. The results will be useful for Italian natural occurrences of asbestos (NOA) mapping in order to avoid an unintentional exposition by human activity or weathering processes.

Growth of single crystals of mercuric iodide (HgI/sub 2/) in spacelab III

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Den Berg, L.; Schnepple, W.F.

1981-01-01

Continued development of a system designed to grow crystals by physical vapor transport in the environment of Spacelab III will be described, with special emphasis on simulation of expected space conditions, adjustment of crystal growth parameters, and on board observation and control of the experiment by crew members and ground personnel. A critical factor in the use of mercuric iodide for semiconductor detectors of x-rays and gamma-rays is the crystalline quality of the material. The twofold purpose of the Spacelab III experiment is therefore to grow single crystals with superior electronic properties as an indirect result of the greatly reducedmore » gravity field during the growth, and to obtain data which will lead to improved understanding of the vapor transport mechanism. The experiments planned to evaluate the space crystals, including gamma-ray diffractometry and measurements of stoichiometry, lattice dimensions, mechanical strength, luminescense, and detector performance are discussed.« less

Effects of fines content on hydraulic conductivity and morphology of laterite soil as hydraulic barrier

NASA Astrophysics Data System (ADS)

Bello Yamusa, Yamusa; Yunus, Nor Zurairahetty Mohd; Ahmad, Kamarudin; Rahman, Norhan Abd; Sa'ari, Radzuan

2018-03-01

Laterite soil was investigated to find out the effects of fines content and to identify the micro-structural and molecular characteristics to evaluate its potentiality as a compacted soil landfill liner material. Tests were carried out on natural soil and reconstituted soil by dry weight of soil samples to determine the physical and engineering properties of the soil. All tests were carried out on the samples by adopting the British Standard 1377:1990. The possible mechanisms that contributed to the clay mineralogy were analyzed using spectroscopic and microscopic techniques such as field emission scanning electron microscopy (FESEM), energy-dispersive X-ray (EDX) and X-ray diffractometry (XRD). The laterite soil was found to contain kaolinite as the major clay minerals. A minimum of 50% fines content of laterite soil met the required result for hydraulic barriers in waste containment facilities.

Observing Graphene Grow: Catalyst–Graphene Interactions during Scalable Graphene Growth on Polycrystalline Copper

PubMed Central

2013-01-01

Complementary in situ X-ray photoelectron spectroscopy (XPS), X-ray diffractometry, and environmental scanning electron microscopy are used to fingerprint the entire graphene chemical vapor deposition process on technologically important polycrystalline Cu catalysts to address the current lack of understanding of the underlying fundamental growth mechanisms and catalyst interactions. Graphene forms directly on metallic Cu during the high-temperature hydrocarbon exposure, whereby an upshift in the binding energies of the corresponding C1s XPS core level signatures is indicative of coupling between the Cu catalyst and the growing graphene. Minor carbon uptake into Cu can under certain conditions manifest itself as carbon precipitation upon cooling. Postgrowth, ambient air exposure even at room temperature decouples the graphene from Cu by (reversible) oxygen intercalation. The importance of these dynamic interactions is discussed for graphene growth, processing, and device integration. PMID:24041311

Nacre-like calcium carbonate controlled by ionic liquid/graphene oxide composite template.

PubMed

Yao, Chengli; Xie, Anjian; Shen, Yuhua; Zhu, Jinmiao; Li, Hongying

2015-06-01

Nacre-like calcium carbonate nanostructures have been mediated by an ionic liquid (IL)-graphene oxide (GO) composite template. The resultant crystals were characterized by scanning electron microscopy (SEM), Fourier transform infrared (FT-IR) spectroscopy, and X-ray powder diffractometry (XRD). The results showed that either 1-butyl-3-methylimidazolium tetrafluoroborate ([BMIM]BF4) or graphene oxide can act as a soft template for calcium carbonate formation with unusual morphologies. Based on the time-dependent morphology changes of calcium carbonate particles, it is concluded that nacre-like calcium carbonate nanostructures can be formed gradually utilizing [BMIM]BF4/GO composite template. During the process of calcium carbonate formation, [BMIM]BF4 acted not only as solvents but also as morphology templates for the fabrication of calcium carbonate materials with nacre-like morphology. Based on the observations, the possible mechanisms were also discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

Different decay patterns observed in a nineteenth-century building (Palma, Spain).

PubMed

Genestar, Catalina; Pons, Carmen; Cerro, José Carlos; Cerdà, Víctor

2014-01-01

The effects of atmospheric pollutants and climatic conditions were studied in a decayed column in the Seminary of Sant Pere. This nineteenth-century building is situated in the historic centre of Palma (Mallorca, Spain), less than 0.5 km from the sea. Samples were collected from the internal and external part of the crusts formed in the four sides of the column. The samples were analysed by means of thermal analysis, X-ray diffractometry, scanning electron microscopy, Fourier transform infrared spectroscopy and ion chromatography. Results show significant differences in the four sides of the column. A high degree of carbonate stone sulfation is observed in all of the samples analysed. A synergistic effect between atmospheric factors and micropollutants on the deterioration of stone is observed. A high uptake of atmospheric particulate matter is found in the external part of the black crusts.

Synthesis of vaterite and aragonite crystals using biomolecules of tomato and capsicum

NASA Astrophysics Data System (ADS)

Chen, Long; Xu, Wang-Hua; Zhao, Ying-Guo; Kang, Yan; Liu, Shao-Hua; Zhang, Zai-Yong

2012-12-01

In this paper, biomimetic synthesis of calcium carbonate (CaCO3) in the presence of biomolecules of two vegetables-tomato and capsicum is investigated. Scanning electron microscopy and X-ray powder diffractometry were used to characterize the CaCO3 obtained. The biomolecules in the extracts of two vegetables are determined by UV-vis or FTIR. The results indicate that a mixture of calcite and vaterite spheres constructed from small particles is produced with the extract of tomato, while aragonite rods or ellipsoids are formed in the presence of extract of capsicum. The possible formation mechanism of the CaCO3 crystals with tomato biomolecules can be interpreted by particle-aggregation based non-classical crystallization laws. The proteins and/or other biomolecules in tomato and capsicum may control the formation of vaterite and aragonite crystals by adsorbing onto facets of them.

Gold nanoparticle decorated multi-walled carbon nanotubes as counter electrode for dye sensitized solar cells.

PubMed

Kaniyoor, Adarsh; Ramaprabhu, Sundara

2012-11-01

A novel counter electrode material for dye sensitized solar cells (DSSCs) composed of nanostructured Au particles decorated on functionalized multi-walled carbon nanotubes (f-MWNTs) is demonstrated for the first time. MWNTs synthesized by catalytic chemical vapor deposition technique are purified and functionalized by treating with concentrated acids. Au nanoparticles are decorated on f-MWNTs by a rapid and facile microwave assisted polyol reduction method. The materials are characterized by X-ray diffractometry, Fourier transform infra red spectroscopy and electron microscopy. The DSSC fabricated with Au/f-MWNTs based counter electrode shows enhanced power conversion efficiency (eta) of 4.9% under AM 1.5G simulated solar radiation. In comparison, the reference DSSCs fabricated with f-MWNTs and Pt counter electrodes show eta of 2.1% and 4.5%. This high performance of Au/f-MWNTs counter electrode is investigated using electrochemical impedance spectroscopy and cyclic voltammetry studies.

Improvement in the Shape Memory Response of Ti50.5Ni24.5Pd25 High-Temperature Shape Memory Alloy with Scandium Microalloying

NASA Technical Reports Server (NTRS)

Atli, K. C.; Karaman, I; Noebe, R. D.; Garg, A.; Chumlyakov, Y. I.; Kireeva, I. V.

2010-01-01

A Ti(50.5)Ni(24.5)Pd25 high-temperature shape memory alloy (HTSMA) is microalloyed with 0.5 at. pct scandium (Sc) to enhance its shape-memory characteristics, in particular, dimensional stability under repeated thermomechanical cycles. For both Ti(50.5)Ni(24.5)Pd25 and the Sc-alloyed material, differential scanning calorimetry is conducted for multiple cycles to characterize cyclic stability of the transformation temperatures. The microstructure is evaluated using electron microscopy, X-ray diffractometry, and wavelength dispersive spectroscopy. Isobaric thermal cycling experiments are used to determine transformation temperatures, dimensional stability, and work output as a function of stress. The Sc-doped alloy displays more stable shape memory response with smaller irrecoverable strain and narrower thermal hysteresis than the baseline ternary alloy. This improvement in performance is attributed to the solid solution hardening effect of Sc.

Inorganic fullerene-like tungsten disulfide nanocoating for friction reduction of nickel-titanium alloys.

PubMed

Samorodnitzky-Naveh, Gili R; Redlich, Meir; Rapoport, Lev; Feldman, Yishay; Tenne, Reshef

2009-12-01

To fabricate a friction-reducing coating onto different nickel-titanium (NiTi) substrates using inorganic fullerene-like tungsten disulfide (IF-WS(2)) nanoparticles and to estimate in vitro friction reducing extent of the coating. Different NiTi substrates were coated with cobalt and IF-WS(2) nanoparticles film by the electrodeposition procedure. Coating composition analyses was made by scanning-electron microscopy, energy dispersive x-ray spectroscopy, x-ray powder diffractometry and x-ray photoelectron spectroscopy. Friction evaluation was carried out using standard tribological tests and an Instron system. Stable and well-adhered cobalt + IF-WS(2) coating of the NiTi substrates was obtained. Friction tests presented up to 66% reduction of the friction coefficient. NiTi alloy is widely used for many medical appliances; hence, this unique friction-reducing coating could be implemented to provide better manipulation and lower piercing rates.

The ceramics of Malpaís of Zacapu, Michoacán, Mexico, during the Early and Middle Postclassic periods (900-1450 AD): Micro-chemical characterization of surface paintings

NASA Astrophysics Data System (ADS)

Jadot, E.; Schiavon, N.; Manso, M.

2016-05-01

Tarascan ceramic sherds from two Postclassical archaeological sites (900-1450 AD) at the Malpaís of Zacapu, Michoacán, Mexico, were investigated by combining Back-Scattered Scanning Electron Microscopy and Energy Dispersive Spectroscopy (BSEM-EDS), μ-X-Ray Diffractometry (μ-XRD), μ-X-ray Fluorescence Spectroscopy (μ-XRF) and μ-Raman Spectroscopy. These sherds are famous for their forms and decorations although the composition of its raw materials remains so far unknown and focused only on the composition of the ceramic paste. For the purpose of surface decoration characterization, the pigments used in slips and paintings were identified as hematite, magnetite, amorphous carbon, graphite and lignite. Furthermore chemical and molecular structure determination allowed the identification of technological aspects such as the firing temperatures and atmospheres used in ceramics production.

Petro-mineralogical Studies of the Paleoproterozoic Phosphorites in the Sonrai basin, Lalitpur District, Uttar Pradesh, India

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dar, Shamim A., E-mail: sjshamim@gmail.com; Khan, K. F.; Khan, Saif A.

2015-09-15

The Paleoproterozoic phosphorites constitute an economically significant component of the Sonrai basin of Lalitpur district. These are associated with ferruginous shale, ironstone, limestone and quartz breccia. Petro-mineralogical studies of samples of the phosphorites, using X-ray diffractometry and scanning electron microscopy, reveal that the collophane (carbonate-fluorapatite) is the dominant phosphate mineral. Calcite, dolomite, quartz, mica and haematite are the dominant gangue constituents. The phosphate minerals occur as oolites mutually replaced by carbonate and silica. The presence of iron oxides has been found in most of the thin sections. There is meagre evidence of organic matter in the form of filaments ofmore » microbial phosphate laminae in the samples of phosphorite. The mineral assemblages, their texture and various forms in these phosphorites may be due to some environmental vicissitudes followed by replacement processes and biogenic activities.« less

Fabrication of Ti-0.48Al Alloy by Centrifugal Casting.

PubMed

Park, Jong Bum; Lee, Jung-Il; Ryu, Jeong Ho

2018-09-01

Many of the unique properties of TiAl alloys that make are attractive for use in high-temperature structural applications also make it challenging to process them into useful products. Cast TiAl is rapidly nearing commercialization, particularly in the vehicle industry, owing to its low production cost. In this study, the centrifugal casting of a TiAl (Ti-48%Al, mole fraction) turbocharger was simulated and an experimental casting was created in vacuum using an induction melting furnace coupled to a ceramic composite mold. Numerical simulation results agreed with the experiment. The crystal structure, microstructure, and chemical composition of the TiAl prepared by centrifugal casting were studied by X-ray diffractometry, optical microscopy, field emission scanning electron microscopy (FE-SEM) and energy dispersive spectroscopy (EDS). FE-SEM and EDS examinations of the TiAl casting revealed that the thickness of the oxide layer (α-case) was typically less than 35 μm.

21 CFR 1311.05 - Standards for technologies for electronic transmission of orders.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 9 2011-04-01 2011-04-01 false Standards for technologies for electronic... JUSTICE REQUIREMENTS FOR ELECTRONIC ORDERS AND PRESCRIPTIONS General § 1311.05 Standards for technologies for electronic transmission of orders. (a) A registrant or a person with power of attorney to sign...

21 CFR 1311.05 - Standards for technologies for electronic transmission of orders.

Code of Federal Regulations, 2010 CFR

2010-04-01

... technologies for electronic transmission of orders. (a) A registrant or a person with power of attorney to sign orders for Schedule I and II controlled substances may use any technology to sign and electronically... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Standards for technologies for electronic...

Angularly-selective transmission imaging in a scanning electron microscope.

PubMed

Holm, Jason; Keller, Robert R

2016-08-01

This work presents recent advances in transmission scanning electron microscopy (t-SEM) imaging control capabilities. A modular aperture system and a cantilever-style sample holder that enable comprehensive angular selectivity of forward-scattered electrons are described. When combined with a commercially available solid-state transmission detector having only basic bright-field and dark-field imaging capabilities, the advances described here enable numerous transmission imaging modes. Several examples are provided that demonstrate how contrast arising from diffraction to mass-thickness can be obtained. Unanticipated image contrast at some imaging conditions is also observed and addressed. Published by Elsevier B.V.

Sheath energy transmission in a collisional plasma with collisionless sheath

DOE PAGES

Tang, Xian-Zhu; Guo, Zehua

2015-10-16

Sheath energy transmission governs the plasma energy exhaust onto a material surface. The ion channel is dominated by convection, but the electron channel has a significant thermal conduction component, which is dominated by the Knudsen layer effect in the presence of an absorbing wall. First-principle kinetic simulations also reveal a robustly supersonic sheath entry flow. The ion sheath energy transmission and the sheath potential are accurately predicted by a sheath model of truncated bi-Maxwellian electron distribution. The electron energy transmission is further enhanced by a parallel heat flux of the perpendicular degrees of freedom.

21 CFR 1311.170 - Transmission requirements.

Code of Federal Regulations, 2011 CFR

2011-04-01

... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...

21 CFR 1311.170 - Transmission requirements.

Code of Federal Regulations, 2014 CFR

2014-04-01

... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...

21 CFR 1311.170 - Transmission requirements.

Code of Federal Regulations, 2013 CFR

2013-04-01

... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...

21 CFR 1311.170 - Transmission requirements.

Code of Federal Regulations, 2012 CFR

2012-04-01

... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...

Measuring Transmission Efficiencies Of Mass Spectrometers

NASA Technical Reports Server (NTRS)

Srivastava, Santosh K.

1989-01-01

Coincidence counts yield absolute efficiencies. System measures mass-dependent transmission efficiencies of mass spectrometers, using coincidence-counting techniques reminiscent of those used for many years in calibration of detectors for subatomic particles. Coincidences between detected ions and electrons producing them counted during operation of mass spectrometer. Under certain assumptions regarding inelastic scattering of electrons, electron/ion-coincidence count is direct measure of transmission efficiency of spectrometer. When fully developed, system compact, portable, and used routinely to calibrate mass spectrometers.

Transmission/Scanning Transmission Electron Microscopy | Materials Science

Science.gov Websites

imaging such as high resolution TEM. Transmission electron diffraction patterns help to determine the microstructure of a material and its defects. Phase-contrast imaging or high-resolution (HR) TEM imaging gives high scattering angle can be collected to form high-resolution, chemically sensitive, atomic number (Z

Effect of Charging Electron Exposure on 1064nm Transmission Through Bare Sapphire Optics and SiO2 over HfO2 AR-Coated Sapphire Optics

NASA Technical Reports Server (NTRS)

Ottens, Brian P.; Connelly, Joseph; Brown, Stephen; Roeder, James; Kauder, Lonny; Cavanaugh, John

2010-01-01

Experiments measuring the effect of electron exposure on 1064nm transmission for optical sapphire were conducted. Detailed before and after inspections did not identify any resulting Litchenburg patterns. Pre- and post-exposure 1064nm transmission measurements are compared.

Effect of Charging Electron Exposure on 1064nm Transmission through Bare Sapphire Optics and SiO2 over HfO2 AR-coated Sapphire Optics

NASA Technical Reports Server (NTRS)

Ottens, Brian P.; Connelly, Joseph; Brown, Stephen; Roeder, james; Kauder, Lonny; Cavanaugh, John

2008-01-01

Experiments measuring the effect of electron exposure on 1064nm transmission for optical sapphire were conducted. Detailed before and after inspections did not identify any resulting Litchenburg patterns. Pre- and post-exposure 1064nm transmission measurements are compared.

Chitosan microparticles: influence of the gelation process on the release profile and oral bioavailability of albendazole, a class II compound.

PubMed

Piccirilli, Gisela N; García, Agustina; Leonardi, Darío; Mamprin, María E; Bolmaro, Raúl E; Salomón, Claudio J; Lamas, María C

2014-11-01

Encapsulation of albendazole, a class II compound, into polymeric microparticles based on chitosan-sodium lauryl sulfate was investigated as a strategy to improve drug dissolution and oral bioavailability. The microparticles were prepared by spray drying technique and further characterized by means of X-ray powder diffractometry, infrared spectroscopy and scanning electron microscopy. The formation of a novel polymeric structure between chitosan and sodium lauryl sulfate, after the internal or external gelation process, was observed by infrared spectroscopy. The efficiency of encapsulation was found to be between 60 and 85% depending on the internal or external gelation process. Almost spherically spray dried microparticles were observed using scanning electron microscopy. In vitro dissolution results indicated that the microparticles prepared by internal gelation released 8% of the drug within 30 min, while the microparticles prepared by external gelation released 67% within 30 min. It was observed that the AUC and Cmax values of ABZ from microparticles were greatly improved, in comparison with the non-encapsulated drug. In conclusion, the release properties and oral bioavailability of albendazole were greatly improved by using spraydried chitosan-sodium lauryl sulphate microparticles.

Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope

NASA Astrophysics Data System (ADS)

Qian, Hui; Egerton, Ray F.

2017-11-01

Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.

The Design and Construction of a Simple Transmission Electron Microscope for Educational Purposes.

ERIC Educational Resources Information Center

Hearsey, Paul K.

This document presents a model for a simple transmission electron microscope for educational purposes. This microscope could demonstrate thermonic emission, particle acceleration, electron deflection, and flourescence. It is designed to be used in high school science courses, particularly physics, taking into account the size, weight, complexity…

29 CFR 1926.1420 - Signals-radio, telephone or other electronic transmission of signals.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 29 Labor 8 2013-07-01 2013-07-01 false Signals-radio, telephone or other electronic transmission of signals. 1926.1420 Section 1926.1420 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL... CONSTRUCTION Cranes and Derricks in Construction § 1926.1420 Signals—radio, telephone or other electronic...

29 CFR 1926.1420 - Signals-radio, telephone or other electronic transmission of signals.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 8 2012-07-01 2012-07-01 false Signals-radio, telephone or other electronic transmission of signals. 1926.1420 Section 1926.1420 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL... CONSTRUCTION Cranes and Derricks in Construction § 1926.1420 Signals—radio, telephone or other electronic...

Secondary electron imaging of monolayer materials inside a transmission electron microscope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cretu, Ovidiu, E-mail: cretu.ovidiu@nims.go.jp; Lin, Yung-Chang; Suenaga, Kazutomo

2015-08-10

A scanning transmission electron microscope equipped with a backscattered and secondary electron detector is shown capable to image graphene and hexagonal boron nitride monolayers. Secondary electron contrasts of the two lightest monolayer materials are clearly distinguished from the vacuum level. A signal difference between these two materials is attributed to electronic structure differences, which will influence the escape probabilities of the secondary electrons. Our results show that the secondary electron signal can be used to distinguish between the electronic structures of materials with atomic layer sensitivity, enhancing its applicability as a complementary signal in the analytical microscope.

Transmitting and processing electronic prescriptions: experiences of physician practices and pharmacies

PubMed Central

Cross, Dori A; Boukus, Ellyn R; Cohen, Genna R

2011-01-01

Objective A core feature of e-prescribing is the electronic exchange of prescription data between physician practices and pharmacies, which can potentially improve the efficiency of the prescribing process and reduce medication errors. Barriers to implementing this feature exist, but they are not well understood. This study's objectives were to explore recent physician practice and pharmacy experiences with electronic transmission of new prescriptions and renewals, and identify facilitators of and barriers to effective electronic transmission and pharmacy e-prescription processing. Design Qualitative analysis of 114 telephone interviews conducted with representatives from 97 organizations between February and September 2010, including 24 physician practices, 48 community pharmacies, and three mail-order pharmacies actively transmitting or receiving e-prescriptions via Surescripts. Results Practices and pharmacies generally were satisfied with electronic transmission of new prescriptions but reported that the electronic renewal process was used inconsistently, resulting in inefficient workarounds for both parties. Practice communications with mail-order pharmacies were less likely to be electronic than with community pharmacies because of underlying transmission network and computer system limitations. While e-prescribing reduced manual prescription entry, pharmacy staff frequently had to complete or edit certain fields, particularly drug name and patient instructions. Conclusions Electronic transmission of new prescriptions has matured. Changes in technical standards and system design and more targeted physician and pharmacy training may be needed to address barriers to e-renewals, mail-order pharmacy connectivity, and pharmacy processing of e-prescriptions. PMID:22101907

Ultrastructure of selected struvite-containing urinary calculi from dogs.

PubMed

Domingo-Neumann, R A; Ruby, A L; Ling, G V; Schiffman, P S; Johnson, D L

1996-09-01

To elucidate the ultrastructural details of struvite-containing urinary calculi from dogs. 38 specimens were selected from a collection of approximately 13,000 canine urinary calculi: 18 of these were composed entirely of struvite, and 20 consisted of struvite and calcium phosphate (apatite). Qualitative and quantitative analyses of specimens included use of plain and polarized light microscopy, x-ray diffractometry, scanning electron microscopy with backscattered electron imagery, x-ray fluorescence scans, and electron microprobe analysis. 4 textural types were recognized among struvite calculi, and 4 textural types of struvite-apatite calculi were described. Evidences of calculus dissolution were described from 4 calculi studied. The presence of small, well interconnected primary pores in struvite-containing urinary calculi from dogs appears to be a significant factor in determining the possible interaction of calculi with changes in the urine composition. The progress of dissolution from the calculus surface to the calculus interior appears to be largely affected by the primary porosity originally present between crystals forming the calculus framework. Apatite was observed to be more resistant to dissolution than struvite. The prevalence of fine concentric laminations having low porosity, and the common occurrence of apatite among struvite-containing urinary calculi from dogs may be 2 reasons why the efficacy of dietary and medicinal manipulations in dissolving urinary calculi is greater among cats than it is among dogs.

Understanding materials challenges for rechargeable ion batteries with in situ transmission electron microscopy

NASA Astrophysics Data System (ADS)

Yuan, Yifei; Amine, Khalil; Lu, Jun; Shahbazian-Yassar, Reza

2017-08-01

An in-depth understanding of material behaviours under complex electrochemical environment is critical for the development of advanced materials for the next-generation rechargeable ion batteries. The dynamic conditions inside a working battery had not been intensively explored until the advent of various in situ characterization techniques. Real-time transmission electron microscopy of electrochemical reactions is one of the most significant breakthroughs poised to enable radical shift in our knowledge on how materials behave in the electrochemical environment. This review, therefore, summarizes the scientific discoveries enabled by in situ transmission electron microscopy, and specifically emphasizes the applicability of this technique to address the critical challenges in the rechargeable ion battery electrodes, electrolyte and their interfaces. New electrochemical systems such as lithium-oxygen, lithium-sulfur and sodium ion batteries are included, considering the rapidly increasing application of in situ transmission electron microscopy in these areas. A systematic comparison between lithium ion-based electrochemistry and sodium ion-based electrochemistry is also given in terms of their thermodynamic and kinetic differences. The effect of the electron beam on the validity of in situ observation is also covered. This review concludes by providing a renewed perspective for the future directions of in situ transmission electron microscopy in rechargeable ion batteries.

Understanding materials challenges for rechargeable ion batteries with in situ transmission electron microscopy

PubMed Central

Yuan, Yifei; Amine, Khalil; Lu, Jun; Shahbazian-Yassar, Reza

2017-01-01

An in-depth understanding of material behaviours under complex electrochemical environment is critical for the development of advanced materials for the next-generation rechargeable ion batteries. The dynamic conditions inside a working battery had not been intensively explored until the advent of various in situ characterization techniques. Real-time transmission electron microscopy of electrochemical reactions is one of the most significant breakthroughs poised to enable radical shift in our knowledge on how materials behave in the electrochemical environment. This review, therefore, summarizes the scientific discoveries enabled by in situ transmission electron microscopy, and specifically emphasizes the applicability of this technique to address the critical challenges in the rechargeable ion battery electrodes, electrolyte and their interfaces. New electrochemical systems such as lithium–oxygen, lithium–sulfur and sodium ion batteries are included, considering the rapidly increasing application of in situ transmission electron microscopy in these areas. A systematic comparison between lithium ion-based electrochemistry and sodium ion-based electrochemistry is also given in terms of their thermodynamic and kinetic differences. The effect of the electron beam on the validity of in situ observation is also covered. This review concludes by providing a renewed perspective for the future directions of in situ transmission electron microscopy in rechargeable ion batteries.

Electron transmission through a steel capillary

NASA Astrophysics Data System (ADS)

Maljković, J. B.; Borka, D.; Ranković, M. Lj.; Marinković, B. P.; Milosavljević, A. R.; Lemell, C.; Tőkési, K.

2018-05-01

The transmission of low-energy electrons through a macroscopic steel capillary has been investigated both experimentally and theoretically. The length of the steel capillary was L = 19.5 mm and the inner diameter was d = 0.9 mm. The kinetic energy distribution of electrons transmitted through the steel capillary was recorded for a tilt angle of ψ = 2.6 ° of the incident electron beam with respect to the capillary axis. Accompanying simulations based on classical transport theory reproduce the experimental data to a high degree of agreement. Transmission for other tilt angles has also been simulated to investigate the influence of the tilt angle on the guiding efficiency.

Attainment of 40.5 pm spatial resolution using 300 kV scanning transmission electron microscope equipped with fifth-order aberration corrector.

PubMed

Morishita, Shigeyuki; Ishikawa, Ryo; Kohno, Yuji; Sawada, Hidetaka; Shibata, Naoya; Ikuhara, Yuichi

2018-02-01

The achievement of a fine electron probe for high-resolution imaging in scanning transmission electron microscopy requires technological developments, especially in electron optics. For this purpose, we developed a microscope with a fifth-order aberration corrector that operates at 300 kV. The contrast flat region in an experimental Ronchigram, which indicates the aberration-free angle, was expanded to 70 mrad. By using a probe with convergence angle of 40 mrad in the scanning transmission electron microscope at 300 kV, we attained the spatial resolution of 40.5 pm, which is the projected interatomic distance between Ga-Ga atomic columns of GaN observed along [212] direction.

Prompt increase of ultrashort laser pulse transmission through thin silver films

NASA Astrophysics Data System (ADS)

Bezhanov, S. G.; Danilov, P. A.; Klekovkin, A. V.; Kudryashov, S. I.; Rudenko, A. A.; Uryupin, S. A.

2018-03-01

We study experimentally and numerically the increase in ultrashort laser pulse transmissivity through thin silver films caused by the heating of electrons. Low to moderate energy femtosecond laser pulse transmission measurements through 40-125 nm thickness silver films were carried out. We compare the experimental data with the values of transmitted fraction of energy obtained by solving the equations for the field together with the two-temperature model. The measured values were fitted with sufficient accuracy by varying the electron-electron collision frequency whose exact values are usually poorly known. Since transmissivity experiences more pronounced changes with the increase in temperature compared to reflectivity, we suggest this technique for studying the properties of nonequilibrium metals.

Unfolding linac photon spectra and incident electron energies from experimental transmission data, with direct independent validation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, E. S. M.; McEwen, M. R.; Rogers, D. W. O.

2012-11-15

Purpose: In a recent computational study, an improved physics-based approach was proposed for unfolding linac photon spectra and incident electron energies from transmission data. In this approach, energy differentiation is improved by simultaneously using transmission data for multiple attenuators and detectors, and the unfolding robustness is improved by using a four-parameter functional form to describe the photon spectrum. The purpose of the current study is to validate this approach experimentally, and to demonstrate its application on a typical clinical linac. Methods: The validation makes use of the recent transmission measurements performed on the Vickers research linac of National Research Councilmore » Canada. For this linac, the photon spectra were previously measured using a NaI detector, and the incident electron parameters are independently known. The transmission data are for eight beams in the range 10-30 MV using thick Be, Al and Pb bremsstrahlung targets. To demonstrate the approach on a typical clinical linac, new measurements are performed on an Elekta Precise linac for 6, 10 and 25 MV beams. The different experimental setups are modeled using EGSnrc, with the newly added photonuclear attenuation included. Results: For the validation on the research linac, the 95% confidence bounds of the unfolded spectra fall within the noise of the NaI data. The unfolded spectra agree with the EGSnrc spectra (calculated using independently known electron parameters) with RMS energy fluence deviations of 4.5%. The accuracy of unfolding the incident electron energy is shown to be {approx}3%. A transmission cutoff of only 10% is suitable for accurate unfolding, provided that the other components of the proposed approach are implemented. For the demonstration on a clinical linac, the unfolded incident electron energies and their 68% confidence bounds for the 6, 10 and 25 MV beams are 6.1 {+-} 0.1, 9.3 {+-} 0.1, and 19.3 {+-} 0.2 MeV, respectively. The unfolded spectra for the clinical linac agree with the EGSnrc spectra (calculated using the unfolded electron energies) with RMS energy fluence deviations of 3.7%. The corresponding measured and EGSnrc-calculated transmission data agree within 1.5%, where the typical transmission measurement uncertainty on the clinical linac is 0.4% (not including the uncertainties on the incident electron parameters). Conclusions: The approach proposed in an earlier study for unfolding photon spectra and incident electron energies from transmission data is accurate and practical for clinical use.« less

Use of glancing angle X-ray powder diffractometry to depth-profile phase transformations during dissolution of indomethacin and theophylline tablets.

PubMed

Debnath, Smita; Predecki, Paul; Suryanarayanan, Raj

2004-01-01

The purpose of this study was (i) to develop glancing angle x-ray powder diffractometry (XRD) as a method for profiling phase transformations as a function of tablet depth; and (ii) to apply this technique to (a) study indomethacin crystallization during dissolution of partially amorphous indomethacin tablets and to (b) profile anhydrate --> hydrate transformations during dissolution of theophylline tablets. The intrinsic dissolution rates of indomethacin and theophylline were determined after different pharmaceutical processing steps. Phase transformations during dissolution were evaluated by various techniques. Transformation in the bulk and on the tablet surface was characterized by conventional XRD and scanning electron microscopy, respectively. Glancing angle XRD enabled us to profile these transformations as a function of depth from the tablet surface. Pharmaceutical processing resulted in a decrease in crystallinity of both indomethacin and theophylline. When placed in contact with the dissolution medium, while indomethacin recrystallized, theophylline anhydrate rapidly converted to theophylline monohydrate. Due to intimate contact with the dissolution medium, drug transformation occurred to a greater extent at or near the tablet surface. Glancing angle XRD enabled us to depth profile the extent of phase transformations as a function of the distance from the tablet surface. The processed sample (both indomethacin and theophylline) transformed more rapidly than did the corresponding unprocessed drug. Several challenges associated with the glancing angle technique, that is, the effects of sorbed water, phase transformations during the experimental timescale, and the influence of phase transformation on penetration depth, were addressed. Increased solubility, and consequently dissolution rate, is one of the potential advantages of metastable phases. This advantage is negated if, during dissolution, the metastable to stable transformation rate > dissolution rate. Glancing angle XRD enabled us to quantify and thereby profile phase transformations as a function of compact depth. The technique has potential utility in monitoring surface reactions, both chemical decomposition and physical transformations, in pharmaceutical systems.

Synthesis and characterization of zeolites prepared from industrial fly ash.

PubMed

Franus, Wojciech; Wdowin, Magdalena; Franus, Małgorzata

2014-09-01

In this paper, we present the possibility of using fly ash to produce synthetic zeolites. The synthesis class F fly ash from the Stalowa Wola SA heat and power plant was subjected to 24 h hydrothermal reaction with sodium hydroxide. Depending on the reaction conditions, three types of synthetic zeolites were formed: Na-X (20 g fly ash, 0.5 dm(3) of 3 mol · dm(-3) NaOH, 75 °C), Na-P1 (20 g fly ash, 0.5 dm(3) of 3 mol · dm(-3) NaOH, 95 °C), and sodalite (20 g fly ash, 0.8 dm(3) of 5 mol · dm(-3) NaOH + 0.4 dm(3) of 3 mol · dm(-3) NaCl, 95 °C). As synthesized materials were characterized to obtain mineral composition (X-ray diffractometry, Scanning electron microscopy-energy dispersive spectrometry), adsorption properties (Brunauer-Emmett-Teller surface area, N2 isotherm adsorption/desorption), and ion exchange capacity. The most effective reaction for zeolite preparation was when sodalite was formed and the quantitative content of zeolite from X-ray diffractometry was 90 wt%, compared with 70 wt% for the Na-X and 75 wt% for the Na-P1. Residues from each synthesis reaction were the following: mullite, quartz, and the remains of amorphous aluminosilicate glass. The best zeolitic material as characterized by highest specific surface area was Na-X at almost 166 m(2) · g(-1), while for the Na-P1 and sodalite it was 71 and 33 m(2) · g(-1), respectively. The ion exchange capacity decreased in the following order: Na-X at 1.8 meq · g(-1), Na-P1 at 0.72 meq · g(-1), and sodalite at 0.56 meq · g(-1). The resulting zeolites are competitive for commercially available materials and are used as ion exchangers in industrial wastewater and soil decontamination.

Tomography experiment of an integrated circuit specimen using 3 MeV electrons in the transmission electron microscope.

PubMed

Zhang, Hai-Bo; Zhang, Xiang-Liang; Wang, Yong; Takaoka, Akio

2007-01-01

The possibility of utilizing high-energy electron tomography to characterize the micron-scale three dimensional (3D) structures of integrated circuits has been demonstrated experimentally. First, electron transmission through a tilted SiO(2) film was measured with an ultrahigh-voltage electron microscope (ultra-HVEM) and analyzed from the point of view of elastic scattering of electrons, showing that linear attenuation of the logarithmic electron transmission still holds valid for effective specimen thicknesses up to 5 microm under 2 MV accelerating voltages. Electron tomography of a micron-order thick integrated circuit specimen including the Cu/via interconnect was then tried with 3 MeV electrons in the ultra-HVEM. Serial projection images of the specimen tilted at different angles over the range of +/-90 degrees were acquired, and 3D reconstruction was performed with the images by means of the IMOD software package. Consequently, the 3D structures of the Cu lines, via and void, were revealed by cross sections and surface rendering.

Electron Energy Loss Spectral Imaging of TiC Formed by Supernovae: A Scanning Transmission Electron Microscopy Study of Grain Formation and Alteration Mechanisms

NASA Astrophysics Data System (ADS)

Daulton, T. L.; Bernatowicz, T. J.; Croat, T. K.

2012-03-01

Micrometer-sized spherules of graphite formed by supernovae contain numerous TiC and Fe-Ni subgrains. These subgrains often have disordered surface rims. The mechanism(s) of rim formation on these subgrains is studied by transmission electron microscopy.

77 FR 60689 - Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-04

... filings must be submitted in accordance with the Commission's electronic tariff filing (eTariff... eTariff Filing Title field and in the Description field in eFiling. DATES: Effective on October 4... electronic tariff filing (eTariff) requirements in Electronic Tariff Filings, Order No. 714, FERC Stats...

Microstructure and corrosion behavior of porous coatings on titanium alloy by vacuum-brazed method.

PubMed

Lee, T M; Chang, E; Yen, C H

2006-05-01

The microstructural evolution and electrochemical characteristics of brazed porous-coated Ti-6Al-4V alloy were analyzed and compared with respect to the conventionally 1300 degrees C sintering method. The titanium filler metal of low-melting-point (934 degrees C) Ti-15Cu-15Ni was used to braze commercially pure (CP) titanium beads onto the substrate of Ti-6Al-4V alloy at 970 degrees C for 2 and 8 h. Optical microscopy, scanning and transmission electron microscopy, and X-ray diffractometry (XRD) were used to characterize the microstructure and phase of the brazed metal; also, the potentiostat was used for corrosion study. Experimental results indicate that the bead/substrate contact interface of the 970 degrees C brazed specimens show larger contact area and higher radius curvature in comparison with 1300 degrees C sintering method. The microstructure of brazed specimens shows the Widmanstätten structure in the brazed zone and equiaxed alpha plus intergranular beta in the Ti-6Al-4V substrate. The intermetallic Ti2Ni phase existing in the prior filler metal diminishes, while the Ti2Cu phase can be identified for the substrate at 970 for 2 h, but the latter phase decrease with time. In Hank's solution at 37 degrees C, the corrosion rates of the 1300 degrees C sintering and the 970 degrees C brazed samples are similar at corrosion potential (E(corr)) in potentiodynamic test, and the value of E(corr) for the brazed sample is noble to the sintering samples. The current densities of the brazed specimens do not exceed 100 microA/cm2 at 3.5 V (SCE). These results suggest that the vacuum-brazed method exhibits the potentiality to manufacture the porous-coated specimens for biomedical application. (c) 2005 Wiley Periodicals, Inc.

Comparative study of structure formation and mechanical behavior of age-hardened Ti–Nb–Zr and Ti–Nb–Ta shape memory alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inaekyan, K.; Brailovski, V., E-mail: vladimir.brailovski@etsmtl.ca; Prokoshkin, S.

2015-05-15

This work sets out to study the peculiar effects of aging treatment on the structure and mechanical behavior of cold-rolled and annealed biomedical Ti–21.8Nb–6.0Zr (TNZ) and Ti–19.7Nb–5.8Ta (TNT) (at.%) shape memory alloys by means of transmission electron microscopy, X-ray diffractometry, functional fatigue and thermomechanical testing techniques. Dissimilar effects of aging treatment on the mechanical behavior of Zr- and Ta-doped alloys are explained by the differences in the ω-phase formation rate, precipitate size, fraction and distribution, and by their effect on the alloys' critical stresses and transformation temperatures. Even short-time aging of the TNZ alloy leads to its drastic embrittlement causedmore » by “overaging”. On the contrary, during aging of the TNT alloy, formation of finely dispersed ω-phase precipitates is gradual and controllable, which makes it possible to finely adjust the TNT alloy functional properties using precipitation hardening mechanisms. To create in this alloy nanosubgrained dislocation substructure containing highly-dispersed coherent nanosized ω-phase precipitates, the following optimum thermomechanical treatment is recommended: cold rolling (true strain 0.37), followed by post-deformation annealing (600 °C, 15–30 min) and age-hardening (300 °C, 30 min) thermal treatments. It is shown that in TNT alloy, pre-transition diffraction effects (diffuse reflections) can “mask” the β-phase substructure and morphology of secondary phases. - Highlights: • TNZ alloy is characterized by much higher ω-phase precipitation rate than TNT alloy. • Difference in precipitation rates is linked to the difference in Zr and Ta diffusion mobility. • Aging of nanosubgrained TNZ alloy worsens its properties irrespective of the aging time. • Aging time of nanosubgrained TNT alloy can be optimized to improve its properties.« less

Epitaxy of Zn{sub 2}TiO{sub 4} (1 1 1) thin films on GaN (0 0 1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsiao, Chu-Yun; Wu, Jhih-Cheng; Shih, Chuan-Feng, E-mail: cfshih@mail.ncku.edu.tw

2013-03-15

Highlights: ► High-permittivity spinel Zn{sub 2}TiO{sub 4} thin films were grown on GaN (0 0 1) by sputtering. ► Oxygen atmosphere and post heat-treatment annealing effectively enhanced epitaxy. ► The epitaxial Zn{sub 2}TiO{sub 4} modifies the dielectric properties of ceramic oxide. - Abstract: High-permittivity spinel Zn{sub 2}TiO{sub 4} thin films were grown on GaN (0 0 1) by rf-sputtering. Grazing-angle, powder, and pole-figure X-ray diffractometries (XRD) were performed to identify the crystallinity and the preferred orientation of the Zn{sub 2}TiO{sub 4} films. Lattice image at the Zn{sub 2}TiO{sub 4} (1 1 1)/GaN (0 0 1) interface was obtained by high-resolutionmore » transmission-electron microscopy (HR-TEM). An oxygen atmosphere in sputtering and post heat-treatment using rapid thermal annealing effectively enhanced the epitaxy. The epitaxial relationship was determined from the XRD and HR-TEM results: (111){sub Zn{sub 2TiO{sub 4}}}||(001){sub GaN}, (202{sup ¯}){sub Zn{sub 2TiO{sub 4}}}||(110){sub GaN},and[21{sup ¯}1{sup ¯}]{sub Zn{sub 2TiO{sub 4}}}||[01{sup ¯}10]{sub GaN}. Finally, the relative permittivity, interfacial trap density and the flat-band voltage of the Zn{sub 2}TiO{sub 4} based capacitor were ∼18.9, 8.38 × 10{sup 11} eV{sup −1} cm{sup −2}, and 1.1 V, respectively, indicating the potential applications of the Zn{sub 2}TiO{sub 4} thin film to the GaN-based metal-oxide-semiconductor capacitor.« less

Preparation of Superparamagnetic Zn0.5Mn0.5Fe2O4 Particle by Coprecipitation-Sonochemical Method for Radar Absorbing Material

NASA Astrophysics Data System (ADS)

Taufiq, A.; Bahtiar, S.; Sunaryono; Hidayat, N.; Hidayat, A.; Mufti, N.; Diantoro, M.; Fuad, A.; Munasir; Rahmawati, R.; Adi, W. A.; Pratapa, S.; Darminto

2017-05-01

One of many applications of spinel ferrite nanoparticles is related to their performance as radar absorbing materials. In this work, we report developing synthesis method through combined coprecipitation-sonochemical routes in preparing Zn0.5Mn0.5Fe2O4 nanoparticle from iron sand in Indonesia as a vital raw material. The structure, size, morphology, and elements of the Zn0.5Mn0.5Fe2O4 nanoparticle were investigated via X-Ray diffractometry and Transmission/Scanning Electron Microscopy (TEM/SEM) combining Energy Dispersive Spectroscopy (EDS). The magnetic properties of the Zn0.5Mn0.5Fe2O4 nanoparticle were characterized by using Vibrating Sample Magnetometer (VSM). Furthermore, the reflection loss character of the Zn0.5Mn0.5Fe2O4 nanoparticle was determined via Vector Network Analyzer (VNA). From the qualitative and quantitative analysis of the XRD data, it can be identified that the Zn0.5Mn0.5Fe2O4 particle formed a spinel cubic structure in a single phase with the lattice parameter of approximately 8.401 Å. It is known from the TEM image that the Zn0.5Mn0.5Fe2O4 particle had a size of about 9.7 nm and tended to agglomerate. Furthermore, the data analysis of the M(H) curve presented that the Zn0.5Mn0.5Fe2O4 nanoparticle has a superparamagnetic behavior with the saturation magnetization of approximately 43 emu/g. Finally, the data analysis of the reflection loss as a function of frequency showed that the Zn0.5Mn0.5Fe2O4 nanoparticle performs as a radar absorbing material with the absorption performance of approximately -11.0 dB at the frequency of 10.8 GHz

What causes the Besnus transition in monoclinic pyrrhotite?

NASA Astrophysics Data System (ADS)

Gehring, A. U.; Koulialias, D.; Löffler, J. F.; Charilaou, M.

2016-12-01

Monoclinic 4C pyrrhotite (ideal formula Fe7S8) is a major magnetic remanence carrier in the Earth's crust and in extraterrestrial materials. Because of its low-temperature magnetic transition around 30 K also known as Besnus transition, this mineral phase is easily detectable in rock samples. An intrinsic origin of the Besnus transition due to a crystallographic change similar to that in the Verwey transition has generally been postulated (1). Although the physical properties of pyrrhotite have intensively been studied, the physics behind the pronounced change in magnetization at the low-temperature transition is still unresolved. To address this question we performed structural and magnetic analyses on a natural pyrrhotite single crystal (Fe6.6S8) from Auerbach, Germany (2,3). Chemical analysis, X-ray diffractometry and transmission electron microscopy show that this pyrrhotite consists of an intergrowth of 4C and an incommensurate 5C* superstructure that are polymorphs with different vacancy distributions. The occurrence of two superstructures is magnetically confirmed by symmetric inflection points in the hysteresis measurements above the transition at about 30 K. The disappearance of the inflection points and the associated change of the hysteresis parameters indicate that the two superstructures become embedded to form a unitary magnetic anisotropy system at the transition. This embedding of the 5C* into the 4C pyrrhotite at about 30 K is directly visible by the occurrence of additional 4-fold and 12-fold symmetry terms in magnetic anisotropy and anisotropic magnetic resistivity mesarurements, respectively. From this it follows that the Besnus transition in monoclinic pyrrhotite is an extrinsic magnetic phenomenon with respect to the 4C superstructure, i.e., a coupling effect, and therefore the physics behind it is in fact different from that of the well-known Verwey transition. (1) Rochette et al., The IRM Quarterly, 21, 1 (2011); (2) Charilaou et al., J. Appl. Phys., 118, 083903 (2015); (3) Koulialias et al., Geophys. J. Int., 204, 961-967 (2016).

Synthesis and characterization of NiFe{sub 2}O{sub 4}–Pd magnetically recyclable catalyst for hydrogenation reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karaoğlu, E., E-mail: ekaraoglu@fatih.edu.tr; Özel, U.; Caner, C.

2012-12-15

Graphical abstract: Display Omitted Highlights: ► Novel superparamagnetic NiFe{sub 2}O{sub 4}–Pd magnetically recyclable catalyst was fabricated through co-precipitation. ► It could be reused several times without significant loss in catalytic activity for hydrogenation reaction. ► No further modification of the NiFe{sub 2}O{sub 4}–Pd magnetically recyclable catalyst is necessary for utilization as catalyst. -- Abstract: Herein we report the fabrication and characterization magnetically recyclable catalysts of NiFe{sub 2}O{sub 4}–Pd nanocomposite as highly effective catalysts for reduction reactions in liquid phase. The reduction Pd{sup 2+} was accomplished with polyethylene glycol 400 (PEG-400) instead of sodium borohydride (NaBH{sub 4}) and NiFe{sub 2}O{sub 4}more » nanoparticles was prepared by sonochemically using FeCI{sub 3}·6H{sub 2}O and NiCl{sub 2}. The chemical characterization of the product was done with X-ray diffractometry, Infrared spectroscopy, transmission electron microscopy, UV–Vis spectroscopy, thermal gravimetry and inductively coupled plasma. Thus formed NiFe{sub 2}O{sub 4}–Pd MRCs showed a very high activity in reduction reactions of 4-nitro aniline and 1,3-dinitrobenzene in liquid phase. It was found out that the catalytic activity of NiFe{sub 2}O{sub 4}–Pd MRCs on the reduction of 4-nitro aniline and 1,3-dinitrobenzene in liquid phase are between 99–93% and 98–93%, respectively. Magnetic character of this system allowed recovery and multiple use without significant loss of its catalytic activity. It is found that NiFe{sub 2}O{sub 4}–Pd MRCs showed very efficient catalytic activity and multiple usability.« less

[In vivo study on influence of a discrete nano-hydroxyapatite on leukemia P388 tissue in BALB/C mice].

PubMed

Li, Ge; Huang, Jian-ming; Aoki, Hideki; Li, Yan; Zhang, Rong; Deng, Bi-fang

2007-09-01

To study the influence of a discrete nano-hydroxyapatite crystal (nano-HAp) on lymphatic leukemia P388 behavior by in vivo techniques. A nano-HAp was prepared by a neutralization reaction of 0.1 mol calcium hydroxide suspension and 0.06 mol phosphoric acid solutions at room temperature over pH7. The various doses of the nano-HAp only and the nano-HAp mixture with cyclophosphamide (CY) were injected into mice inoculated with solid tumor lymphatic leukemia P388 and dispersed into PRMI 1640 media harvested the leukemia P388 cells. Sixty P388 BALB/C mice were randomly grouped; 36 of them were used as nano-HAp treated groups and 24 mice as the control groups. The leukemia growth in the mice was examined morphologically, histopathologically and under a transmission electron microscope (TEM). The nano-HAp was identified as a hydroxyapatite by an X-ray diffractometry (XRD) and a Fourier transform infrared spectroscopy (FTIR). The morphology and sizes were observed under a TEM. The tissue growth inhibition ratio (weight%) of solid lymphatic leukemia P388 bearing mice treated with nano-HAp at doses 35 mg/kg, 53 mg/kg and nano-HAp (53 mg/kg) combined with CY (35 mg/kg) in 3 consecutive days via intraperitineal injections were 14.95%, 32.67% and 60.45% respectively. Apoptosis of P388 cell cocultured with nano-HAp was confirmed by TEM. The tissue growth restriction of solid tumor lymphatic leukemia P388 was greater after an injection of nano-HAp only or nano-HAp mixed with CY than that obtained after injection with physiological saline solution as a control (P < 0.01), and the tissue growth restriction of solid tumor after an injection of nano-HAp combined with CY was greater than that obtained after nano-HAp or CY injection only (P < 0.01).

Applications of emerging transmission electron microscopy technology in PCD research and diagnosis.

PubMed

Shoemark, Amelia

2017-01-01

Primary Ciliary Dyskinesia (PCD) is a heterogeneous genetic condition characterized by dysfunction of motile cilia. Patients suffer from chronic infection and inflammation of the upper and lower respiratory tract. Diagnosis of PCD is confirmed by identification of a hallmark defect of ciliary ultrastructure or by identification of biallelic pathogenic mutations in a known PCD gene. Since the first description of PCD in 1976, assessment of ciliary ultrastructure by transmission electron microscopy (TEM) has been central to diagnosis and research. Electron tomography is a technique whereby a series of transmission electron micrographs are collected at different angles and reconstructed into a single 3D model of a specimen. Electron tomography provides improved spatial information and resolution compared to a single micrograph. Research by electron tomography has revealed new insight into ciliary ultrastructure and consequently ciliary function at a molecular and cellular level. Gene discovery studies in PCD have utilized electron tomography to define the structural consequences of variants in cilia genes. Modern transmission electron microscopes capable of electron tomography are increasingly being installed in clinical laboratories. This presents the possibility for the use of tomography technique in a diagnostic setting. This review describes the electron tomography technique, the contribution tomography has made to the understanding of basic cilia structure and function and finally the potential of the technique for use in PCD diagnosis.

Free electron laser

DOEpatents

Villa, Francesco

1990-01-01

A high gain, single-pass free electron laser formed of a high brilliance electron injector source, a linear accelerator which imparts high energy to the electron beam, and an undulator capable of extremely high magnetic fields, yet with a very short period. The electron injector source is the first stage (gap) of the linear accelerator or a radial line transformer driven by fast circular switch. The linear accelerator is formed of a plurality of accelerating gaps arranged in series. These gaps are energized in sequence by releasing a single pulse of energy which propagates simultaneously along a plurality of transmission lines, each of which feeds the gaps. The transmission lines are graduated in length so that pulse power is present at each gap as the accelerated electrons pass therethrough. The transmission lines for each gap are open circuited at their ends. The undualtor has a structure similar to the accelerator, except that the transmission lines for each gap are substantially short circuited at their ends, thus converting the electric field into magnetic field. A small amount of resistance is retained in order to generate a small electric field for replenishing the electron bunch with the energy lost as it traverses through the undulator structure.

STEM VQ Method, Using Scanning Transmission Electron Microscopy (STEM) for Accurate Virus Quantification

DTIC Science & Technology

2017-02-02

Corresponding Author Abstract Accurate virus quantification is sought, but a perfect method still eludes the scientific community. Electron...unlimited. UNCLASSIFIED 2 provides morphology data and counts all viral particles, including partial or noninfectious particles; however, EM methods ...consistent, reproducible virus quantification method called Scanning Transmission Electron Microscopy – Virus Quantification (STEM-VQ) which simplifies

Crystal structure of stacking faults in InGaAs/InAlAs/InAs heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trunkin, I. N.; Presniakov, M. Yu.; Vasiliev, A. L., E-mail: a.vasiliev56@gmail.com

Stacking faults and dislocations in InGaAs/InAlAs/InAs heterostructures have been studied by electron microscopy. The use of different techniques of transmission electron microscopy (primarily, highresolution dark-field scanning transmission electron microscopy) has made it possible to determine the defect structure at the atomic level.

Ionospheric modification at twice the electron cyclotron frequency.

PubMed

Djuth, F T; Pedersen, T R; Gerken, E A; Bernhardt, P A; Selcher, C A; Bristow, W A; Kosch, M J

2005-04-01

In 2004, a new transmission band was added to the HAARP high-frequency ionospheric modification facility that encompasses the second electron cyclotron harmonic at altitudes between approximately 220 and 330 km. Initial observations indicate that greatly enhanced airglow occurs whenever the transmission frequency approximately matches the second electron cyclotron harmonic at the height of the upper hybrid resonance. This is the reverse of what happens at higher electron cyclotron harmonics. The measured optical emissions confirm the presence of accelerated electrons in the plasma.

78 FR 77354 - Procedural Rules To Permit Parties To File and Serve Documents Electronically

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-23

... by handwriting his or her signature. For documents filed by electronic transmission, a party may sign... transmission. A party or representative of the party shall sign a document by handwriting his signature. (2...

Transmission electron microscopy of amyloid fibrils.

PubMed

Gras, Sally L; Waddington, Lynne J; Goldie, Kenneth N

2011-01-01

Transmission Electron Microscopy of negatively stained and cryo-prepared specimens allows amyloid fibrils to be visualised at high resolution in a dried or a hydrated state, and is an essential method for characterising the morphology of fibrils and pre-fibrillar species. We outline the key steps involved in the preparation and observation of samples using negative staining and cryo-electron preservation. We also discuss methods to measure fibril characteristics, such as fibril width, from electron micrographs.

Accurate Virus Quantitation Using a Scanning Transmission Electron Microscopy (STEM) Detector in a Scanning Electron Microscope

DTIC Science & Technology

2017-06-29

Accurate Virus Quantitation Using a Scanning Transmission Electron Microscopy (STEM) Detector in a Scanning Electron Microscope Candace D Blancett1...L Norris2, Cynthia A Rossi4 , Pamela J Glass3, Mei G Sun1,* 1 Pathology Division, United States Army Medical Research Institute of Infectious...Diseases (USAMRIID), 1425 Porter Street, Fort Detrick, Maryland, 21702 2Biostatistics Division, United States Army Medical Research Institute of

The spatial coherence function in scanning transmission electron microscopy and spectroscopy.

PubMed

Nguyen, D T; Findlay, S D; Etheridge, J

2014-11-01

We investigate the implications of the form of the spatial coherence function, also referred to as the effective source distribution, for quantitative analysis in scanning transmission electron microscopy, and in particular for interpreting the spatial origin of imaging and spectroscopy signals. These questions are explored using three different source distribution models applied to a GaAs crystal case study. The shape of the effective source distribution was found to have a strong influence not only on the scanning transmission electron microscopy (STEM) image contrast, but also on the distribution of the scattered electron wavefield and hence on the spatial origin of the detected electron intensities. The implications this has for measuring structure, composition and bonding at atomic resolution via annular dark field, X-ray and electron energy loss STEM imaging are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Electron probe X-ray microanalysis of cultured myogenic C2C12 cells with scanning and scanning transmission electron microscopy.

PubMed

Tylko, G; Karasiński, J; Wróblewski, R; Roomans, G M; Kilarski, W M

2000-01-01

Heterogeneity of the elemental content of myogenic C2C12 cultured cells was studied by electron probe X-ray microanalysis (EPXMA) with scanning (SEM EPXMA) and scanning transmission electron microscopy (STEM EPXMA). The best plastic substrate for growing cells was Thermanox. For STEM EPXMA, a Formvar film coated with carbon was found to be suitable substrate. The cells examined by scanning transmission electron microscopy showed great heterogeneity in their elemental content in comparison with the cells examined in the scanning electron microscope despite of an almost identical preparation procedure for EPXMA. Nevertheless the K/Na ratios obtained from both methods of EPXMA were very close (4.1 and 4.3). We conclude that the observed discrepancy in the elemental content obtained by the two methods may be due to differences in instrumentation and this must be taken into account when planning a comparative study.

Phase-space foundations of electron holography

NASA Astrophysics Data System (ADS)

Lubk, A.; Röder, F.

2015-09-01

We present a unified formalism for describing various forms of electron holography in quantum mechanical phase space including their extensions to quantum-state reconstructions. The phase-space perspective allows for taking into account partial coherence as well as the quantum mechanical detection process typically hampering the unique reconstruction of a wave function. We elaborate on the limitations imposed by the electron optical elements of the transmission electron microscope as well as the scattering at the target. The results provide the basis for vastly extending the scope of electron holographic techniques towards analyzing partially coherent signals such as inelastically scattered electrons or electron pulses used in ultrafast transmission electron microscopy.

Klein tunneling in Weyl semimetals under the influence of magnetic field.

PubMed

Yesilyurt, Can; Tan, Seng Ghee; Liang, Gengchiau; Jalil, Mansoor B A

2016-12-12

Klein tunneling refers to the absence of normal backscattering of electrons even under the case of high potential barriers. At the barrier interface, the perfect matching of electron and hole wavefunctions enables a unit transmission probability for normally incident electrons. It is theoretically and experimentally well understood in two-dimensional relativistic materials such as graphene. Here we investigate the Klein tunneling effect in Weyl semimetals under the influence of magnetic field induced by ferromagnetic stripes placed at barrier boundaries. Our results show that the resonance of Fermi wave vector at specific barrier lengths gives rise to perfect transmission rings, i.e., three-dimensional analogue of the so-called magic transmission angles in two-dimensional Dirac semimetals. Besides, the transmission profile can be shifted by application of magnetic field in the central region, a property which may be utilized in electro-optic applications. When the applied potential is close to the Fermi level, a particular incident vector can be selected by tuning the magnetic field, thus enabling highly selective transmission of electrons in the bulk of Weyl semimetals. Our analytical and numerical calculations obtained by considering Dirac electrons in three regions and using experimentally feasible parameters can pave the way for relativistic tunneling applications in Weyl semimetals.

Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope.

PubMed

Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva

2017-05-01

We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope.

PubMed

Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva

2017-02-01

We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2017 Elsevier B.V. All rights reserved.

Spin-dependent electron many-body effects in GaAs

NASA Astrophysics Data System (ADS)

Nemec, P.; Kerachian, Y.; van Driel, H. M.; Smirl, Arthur L.

2005-12-01

Time- and polarization-resolved differential transmission measurements employing same and oppositely circularly polarized 150fs optical pulses are used to investigate spin characteristics of conduction band electrons in bulk GaAs at 295K . Electrons and holes with densities in the 2×1016cm-3-1018cm-3 range are generated and probed with pulses whose center wavelength is between 865 and 775nm . The transmissivity results can be explained in terms of the spin sensitivity of both phase-space filling and many-body effects (band-gap renormalization and screening of the Coulomb enhancement factor). For excitation and probing at 865nm , just above the band-gap edge, the transmissivity changes mainly reflect spin-dependent phase-space filling which is dominated by the electron Fermi factors. However, for 775nm probing, the influence of many-body effects on the induced transmission change are comparable with those from reduced phase space filling, exposing the spin dependence of the many-body effects. If one does not take account of these spin-dependent effects one can misinterpret both the magnitude and time evolution of the electron spin polarization. For suitable measurements we find that the electron spin relaxation time is 130ps .

A large-area wireless power-transmission sheet using printed organic transistors and plastic MEMS switches.

PubMed

Sekitani, Tsuyoshi; Takamiya, Makoto; Noguchi, Yoshiaki; Nakano, Shintaro; Kato, Yusaku; Sakurai, Takayasu; Someya, Takao

2007-06-01

The electronics fields face serious problems associated with electric power; these include the development of ecologically friendly power-generation systems and ultralow-power-consuming circuits. Moreover, there is a demand for developing new power-transmission methods in the imminent era of ambient electronics, in which a multitude of electronic devices such as sensor networks will be used in our daily life to enhance security, safety and convenience. We constructed a sheet-type wireless power-transmission system by using state-of-the-art printing technologies using advanced electronic functional inks. This became possible owing to recent progress in organic semiconductor technologies; the diversity of chemical syntheses and processes on organic materials has led to a new class of organic semiconductors, dielectric layers and metals with excellent electronic functionalities. The new system directly drives electronic devices by transmitting power of the order of tens of watts without connectors, thereby providing an easy-to-use and reliable power source. As all of the components are manufactured on plastic films, it is easy to place the wireless power-transmission sheet over desks, floors, walls and any other location imaginable.

Transmission Electron Microscopy of Minerals and Rocks

NASA Astrophysics Data System (ADS)

McLaren, Alex C.

1991-04-01

Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.

A simple way to obtain backscattered electron images in a scanning transmission electron microscope.

PubMed

Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki

2014-08-01

We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Direct observation of anti-phase boundaries in heteroepitaxy of GaSb thin films grown on Si(001) by transmission electron microscopy

NASA Astrophysics Data System (ADS)

Woo, S. Y.; Hosseini Vajargah, S.; Ghanad-Tavakoli, S.; Kleiman, R. N.; Botton, G. A.

2012-10-01

Unambiguous identification of anti-phase boundaries (APBs) in heteroepitaxial films of GaSb grown on Si has been so far elusive. In this work, we present conventional transmission electron microscopy (TEM) diffraction contrast imaging using superlattice reflections, in conjunction with convergent beam electron diffraction analysis, to determine a change in polarity across APBs in order to confirm the presence of anti-phase disorder. In-depth analysis of anti-phase disorder is further supported with atomic resolution high-angle annular dark-field scanning transmission electron microscopy. The nature of APBs in GaSb is further elucidated by a comparison to previous results for GaAs epilayers grown on Si.

Spin-resolved conductance of Dirac electrons through multibarrier arrays

NASA Astrophysics Data System (ADS)

Dahal, Dipendra; Gumbs, Godfrey; Iurov, Andrii

We use a transfer matrix method to calculate the transmission coefficient of Dirac electrons through an arbitrary number of square potential barrier in gapped monolayer graphene(MLG) and bilayer graphene (BLG). The widths of barriers may not be chosen equal. The shift in the angle of incidence and the width of the barrier required for resonance are investigated numerically for both MLG and BLG. We compare the effects due to energy gap on these two transmission coefficient for each of these two structures (MLG and BLG). We present our results as functions of barrier width, height as well as incoming electron energy as well as band gap and examine the conditions for which perfect reflection or transmission occurs. Our transmission data are further used to calculate conductivity.

The Synergistic Effect of Iodide and Sodium Nitrite on the Corrosion Inhibition of Mild Steel in Bicarbonate-Chloride Solution.

PubMed

Eyu, Gaius Debi; Will, Geoffrey; Dekkers, Willem; MacLeod, Jennifer

2016-10-26

The effect of potassium iodide (KI) and sodium nitrite (NaNO₂ inhibitor on the corrosion inhibition of mild steel in chloride bicarbonate solution has been studied using electrochemical techniques. Potentiodynamic polarisation data suggest that, when used in combination, KI and NaNO₂ function together to inhibit reactions at both the anode and the cathode, but predominantly anodic. KI/NO₂ - concentration ratios varied from 2:1 to 2:5; inhibition efficiency was optimized for a ratio of 1:1. The surface morphology and corrosion products were analysed using scanning electron microscopy (SEM) and X-ray diffractometry (XRD). The latter shows that the addition of I - to NO₂ facilitates the formation of a passivating oxide (γ-Fe₂O₃) as compared to NO₂ - alone, decreasing the rate of metal dissolution observed in electrochemical testing. The synergistic effect of KI/NO₂ - inhibition was enhanced under the dynamic conditions associated with testing in a rotating disc electrode.

Structural investigation of chitosan-based microspheres with some anti-inflammatory drugs

NASA Astrophysics Data System (ADS)

Dreve, Simina; Kacso, Iren; Popa, Adriana; Raita, Oana; Dragan, Felicia; Bende, A.; Borodi, Gh.; Bratu, I.

2011-06-01

The use of chitosan as an excipient in oral formulations, as a drug delivery vehicle for ulcerogenic anti-inflammatory drugs and as base in polyelectrolyte complex systems, to prepare solid release systems as sponges was investigated. The preparation by double emulsification of chitosan hydrogels carrying diclofenac, acetyl-salycilic acid and hydrocortisone acetate as anti-inflammatory drugs is reported. The concentration of anti-inflammatory drug in the chitosan hydrogel generating the sponges was 0.08 mmol. Chitosan-drug loaded sponges with anti-inflammatory drugs were prepared by freeze-drying at -60 °C and 0.009 atm. Structural investigations of the solid formulations were done by Fourier-transformed infrared and ultraviolet-visible spectroscopy, spectrofluorimetry, differential scanning calorimetry and X-ray diffractometry. The results indicated that the drug molecules are forming temporary chelates in chitosan hydrogels and sponges. Electron paramagnetic resonance demonstrates the presence of free radicals in a wide range and the antioxidant activity for chitosan-drug supramolecular cross-linked assemblies.

Crystalline inclusions in the cytoplasm and nuclei of cells of acute myeloid leukaemia.

PubMed

Pearson, E C

1989-01-01

In a survey by electron microscopy of peripheral blood and/or bone marrow from 230 adult patients with acute myeloid leukaemia, five were observed to contain crystalline inclusions in the cytoplasm of the leukaemic cells and a sixth contained crystals in the nuclei. In four cases, two of FAB type M2 and two of M4, the cytoplasmic crystals were hexagonal in section and 1-2 micron long. Two examples showed internal periodicities in the range 3.3-4.0 nm when the electronmicrographs were analysed by optical diffractometry. A single case of M1 contained smaller trapezoidal crystals with a 4.9nm periodicity. The sixth patient, with unusual cytological abnormalities and a rare t(3; 6) chromosomal translocation, contained six-sided crystals in the nuclei of some relatively undifferentiated cells. To the best of our knowledge such intranuclear crystals have not previously been reported in leukaemia. The relevance of the crystals to the leukaemic process is discussed.

Mortar radiocarbon dating: preliminary accuracy evaluation of a novel methodology.

PubMed

Marzaioli, Fabio; Lubritto, Carmine; Nonni, Sara; Passariello, Isabella; Capano, Manuela; Terrasi, Filippo

2011-03-15

Mortars represent a class of building and art materials that are widespread at archeological sites from the Neolithic period on. After about 50 years of experimentation, the possibility to evaluate their absolute chronology by means of radiocarbon ((14)C) remains still uncertain. With the use of a simplified mortar production process in the laboratory environment, this study shows the overall feasibility of a novel physical pretreatment for the isolation of the atmospheric (14)CO(2) (i.e., binder) signal absorbed by the mortars during their setting. This methodology is based on the assumption that an ultrasonic attack in liquid phase isolates a suspension of binder carbonates from bulk mortars. Isotopic ((13)C and (14)C), % C, X-ray diffractometry (XRD), and scanning electron microscopy (SEM) analyses were performed to characterize the proposed methodology. The applied protocol allows suppression of the fossil carbon (C) contamination originating from the incomplete burning of the limestone during the quick lime production, providing unbiased dating for "laboratory" mortars produced operating at historically adopted burning temperatures.

Phase purity of NiCo2O4, a catalyst candidate for electrolysis of water

NASA Technical Reports Server (NTRS)

Singer, J.; Fielder, W. L.; Garlick, R. G.; Negas, T.

1987-01-01

NiCo2O4 is shown to be difficult to obtain as a pure phase, and may never have been so obtained. High resolution x-ray diffractometry is required for its precise characterization. Film XRD is not likely to show the asymmetry in the spinel diffraction lines, caused by poorly crystallized NiO, as seen in diffractometer traces. The Co3O4 which is expected to accompany NiO as an impurity in NiCo2O4 syntheses has the same diffraction pattern as the binary oxide. Firings of the co-precipitated hydroxides at 300, 350, and 400 C, including one in pure O2, failed to produce single phase cobaltate. Scanning electron microscopy showed all the sintered products to range over several orders of magnitude in agglomerate/particle size. Surface areas by BET were all in the range 40 to 110 m sq/g, equivalent to particles of 200 to 100 Angstrom diameter. The spinel diffraction line breadths were compatible with those approximate dimensions.

Hydrothermal synthesis of nanostructured Y2O3 and (Y0.75Gd0.25)2O3 based phosphors

NASA Astrophysics Data System (ADS)

Mančić, Lidija; Lojpur, Vesna; Marinković, Bojan A.; Dramićanin, Miroslav D.; Milošević, Olivera

2013-08-01

Examples of (Y2O3-Gd2O3):Eu3+ and Y2O3:(Yb3+/Er3+) rare earth oxide-based phosphors are presented to highlight the controlled synthesis of 1D and 2D nanostructures through simple hydrothermal method. Conversion of the starting nitrates mixture into carbonate hydrate phase is performed with the help of ammonium hydrogen carbonate solution during hydrothermal treatment at 200 °C/3 h. Morphological architectures of rare earth oxides obtained after subsequent powders thermal treatment at 600 and 1100 °C for 3 and 12 h and their correlation with the optical characteristics are discussed based on X-ray powder diffractometry, field emission scanning electron microscopy, infrared spectroscopy and photoluminescence measurements. Strong red and green emission followed by the superior decay times are attributed to the high powders purity and homogeneous dopants distribution over the host lattice matrix.

Magnetic force microscopy study of domain walls in Co{sub 2}Z ferrite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Lang; Verweij, Henk, E-mail: verweij.1@osu.edu

2014-03-01

Graphical abstract: - Highlights: • Hexaferrite Co{sub 2}Z is synthesized through the modified Pechini method. • Magnetic domains are observed in anisotropic Co{sub 2}Z single grain using MFM. • Observed single grain domain thickness is in good agreement with Dotsh model. - Abstract: Hexaferrite Co{sub 2}Z was synthesized through the modified Pechini method. Partially oriented samples were obtained after consolidation with uniaxial pressing and calcination/sintering at 1300 °C/1330 °C. The sample composition and morphology was identified with X-ray diffractometry (XRD) and scanning electron microscopy (SEM) with energy-dispersive X-ray spectrometry (EDS). MFM studies of the single grains revealed a domain structuremore » with 0.7 μm wide. The Co{sub 2}Z static magnetization was measured with a vibrating sample magnetometer (VSM), and was used to calculate a single grain domain with a thickness of 4.8 μm. This result is in good agreement with SEM observations of the single grain thickness.« less

Synthesis of barium and strontium carbonate crystals with unusual morphologies using an organic additive

NASA Astrophysics Data System (ADS)

Chen, Long; Jiang, Jizhong; Bao, Zuben; Pan, Jian; Xu, Weibing; Zhou, Lili; Wu, Zhigang; Chen, Xu

2013-12-01

In this paper, strontium carbonate (SrCO3) and barium carbonate (BaCO3) crystals were synthesized in the presence of an organic additive-hexamethylenetetramine (HMT) using two CO2 sources. Scanning electron microscopy and X-ray powder diffractometry were used to characterize the products. The results showed that the morphologies of orthorhombic strontianite SrCO3 transformed from branch-like to flower-like, and to capsicum-like at last, while the morphologies of BaCO3 change from fiber-like to branchlike, and to rod-like finally with an increase of the molar ratio HMT/Sr2+ and HMT/Ba2+ from 0.2 to 10 using ammonium carbonate as CO2 source. When using diethyl carbonate instead of ammonium carbonate as CO2 source, SrCO3 flowers aggregated by rods and BaCO3 shuttles were formed. The possible formation mechanisms of SrCO3 and BaCO3 crystals obtained in different conditions were also discussed.

Analysis of microstructure and mechanical properties of aluminium-copper joints welded by FSW process

NASA Astrophysics Data System (ADS)

Iordache, M.; Sicoe, G.; Iacomi, D.; Niţu, E.; Ducu, C.

2017-08-01

The research conducted in this article aimed to check the quality of joining some dissimilar materials Al-Cu by determining the mechanical properties and microstructure analysis. For the experimental measurements there were used tin alloy Al - EN-AW-1050A with a thickness of 2 mm and Cu99 sheet with a thickness of 2 mm, joined by FSW weld overlay. The main welding parameters were: rotating speed of the rotating element 1400 rev/min, speed of the rotating element 50 mm/min. The experimental results were determined on samples specially prepared for metallographic analysis. In order to prepare samples for their characterization, there was designed and built a device that allowed simultaneous positioning and fixing for grinding. The characteristics analyzed in the joint welded samples were mictrostructure, microhardness and residual stresses. The techniques used to determine these characteristics were optical microscopy, electron microscopy with fluorescence radioactive elemental analysis (EDS), Vickers microhardness line - HV0.3 and X-ray diffractometry.

Mechanochemical synthesis and intercalation of Ca(II)Fe(III)-layered double hydroxides

NASA Astrophysics Data System (ADS)

Ferencz, Zs.; Szabados, M.; Varga, G.; Csendes, Z.; Kukovecz, Á.; Kónya, Z.; Carlson, S.; Sipos, P.; Pálinkó, I.

2016-01-01

A mechanochemical method (grinding the components without added water - dry grinding, followed by further grinding in the presence of minute amount of water or NaOH solution - wet grinding) was used in this work for the preparation and intercalation of CaFe-layered double hydroxides (LDHs). Both the pristine LDHs and the amino acid anion (cystinate and tyrosinate) intercalated varieties were prepared by the two-step grinding procedure in a mixer mill. By systematically changing the conditions of the preparation method, a set of parameters could be determined, which led to the formation of close to phase-pure LDH. The optimisation procedure was also applied for the intercalation processes of the amino acid anions. The resulting materials were structurally characterised by a range of methods (X-ray diffractometry, scanning electron microscopy, energy dispersive analysis, thermogravimetry, X-ray absorption and infra-red spectroscopies). It was proven that this simple mechanochemical procedure was able to produce complex organic-inorganic nanocomposites: LDHs intercalated with amino acid anions.

Chitosan-based nanocarriers for antimalarials

NASA Astrophysics Data System (ADS)

Dreve, Simina; Kacso, Iren; Popa, Adriana; Raita, Oana; Bende, A.; Borodi, Gh.; Bratu, I.

2012-02-01

The objective of this research was to synthesize and characterize chitosan-based liquid and solid materials with unique absorptive and mechanical properties as carriers for quinine - one of the most used antimalarial drug. The use of chitosan (CTS) as base in polyelectrolyte complex systems, to prepare solid release systems as sponges is presented. The preparation by double emulsification of CTS hydrogels carrying quinine as anti-malarial drug is reported. The concentration of quinine in the CTS hydrogel was 0.08 mmol. Chitosan - drug loaded hydrogel was used to generate solid sponges by freeze-drying at -610°C and 0.09 atm. Structural investigations of the solid formulations were done by Fourier-transformed infrared spectroscopy (FTIR), ultraviolet-visible spectroscopy (UV-VIS), spectrofluorimetry, differential scanning calorimetry (DSC) and X-ray diffractometry. The results indicated that the drug molecule is forming temporary chelates in CTS hydrogels and sponges. Electron paramagnetic resonance (EPR) demonstrates the presence of free radicals in a wide range and the antioxidant activity for chitosan - drug supramolecular cross-linked assemblies.

Preparation of CMC-modified melamine resin spherical nano-phase change energy storage materials.

PubMed

Hu, Xiaofeng; Huang, Zhanhua; Zhang, Yanhua

2014-01-30

A novel carboxymethyl cellulose (CMC)-modified melamine-formaldehyde (MF) phase change capsule with excellent encapsulation was prepared by in situ polymerization. Effects of CMC on the properties of the capsules were studied by Fourier transformation infrared spectroscopy (FTIR), differential scanning calorimetry (DSC), scanning electronic microscopy (SEM), X-ray diffractometry (XRD), and thermogravimetric analysis (TGA). The results showed that the CMC-modified capsules had an average diameter of about 50nm and good uniformity. The phase change enthalpy of the capsules was increased and the cracking ratio decreased by incorporating a suitable amount of CMC. The optimum phase change enthalpy of the nanocapsules was 83.46J/g, and their paraffin content was 63.1%. The heat resistance of the capsule shells decreased after CMC modification. In addition, the nanocapsule cracking ratio of the nanocapsules was 11.0%, which is highly attractive for their application as nano phase change materials. Copyright © 2013 Elsevier Ltd. All rights reserved.

Enhanced photocatalytic activity of Fe-doped TiO2 coated on N-doped activated carbon composites for photocatalytic degradation of dyeing wastewater

NASA Astrophysics Data System (ADS)

Zhou, Jie; Zhu, Beibei; Wang, Lu; Li, Ya; Qiao, Qichen

2017-10-01

Fe-doped TiO2 coated on N-doped activated carbon (Fe-TiO2/N-AC, FTNA) composites were synthesized simply by a straightforward two-step procedure. The obtained materials were characterized by X-ray diffractometry (XRD), N2 adsorption-desorption, scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and FT-IR spectroscopies. Through the degradation of dyeing wastewater, the photocatalytic activity of FTNA was investigated under ultraviolet light irradiation. The results showed that containing N functional groups were successfully introduced onto the surface of the activated carbon. Compared with Fe-TiO2/AC (FTA), FTNA with average particle size of TiO2 13.6 nm and surface area 1007.89 m2/g showed a higher photoactivity. Additionally, for the photocatalytic degradation of dyeing wastewater, the optimum N content and catalyst content were 0.8% and 5g/L, respectively. Moreover, the photoactivity and photo stability of the catalyst after many runs was also evaluated.

Encapsulation of Ethylene Gas into Granular Cold-Water-Soluble Starch: Structure and Release Kinetics.

PubMed

Shi, Linfan; Fu, Xiong; Tan, Chin Ping; Huang, Qiang; Zhang, Bin

2017-03-15

Ethylene gas was introduced into granular cold-water-soluble (GCWS) starches using a solid encapsulation method. The morphological and structural properties of the novel inclusion complexes (ICs) were characterized using scanning electron microscopy, X-ray diffractometry, and Raman spectroscopy. The V-type single helix of GCWS starches was formed through controlled gelatinization and ethanol precipitation and was approved to host ethylene gas. The controlled release characteristics of ICs were also investigated at various temperature and relative humidity conditions. Avrami's equation was fitted to understand the release kinetics and showed that the release of ethylene from the ICs was accelerated by increasing temperature or RH and was decelerated by increased degree of amylose polymerization. The IC of Hylon-7 had the highest ethylene concentration (31.8%, w/w) among the five starches, and the IC of normal potato starch showed the best controlled release characteristics. As a renewable and inexpensive material, GCWS starch is a desirable solid encapsulation matrix with potential in agricultural and food applications.

Synthesization, Characterization, and in Vitro Evaluation of Cytotoxicity of Biomaterials Based on Halloysite Nanotubes.

PubMed

Sánchez-Fernández, Antonio; Peña-Parás, Laura; Vidaltamayo, Román; Cué-Sampedro, Rodrigo; Mendoza-Martínez, Ana; Zomosa-Signoret, Viviana C; Rivas-Estilla, Ana M; Riojas, Paulina

2014-12-04

Halloysite is an aluminosilicate clay that has been widely used for controlled drug delivery, immobilization of enzymes, and for the capture of circulating tumor cells (CTCs). Surface modification of halloysite by organosilanes has been explored to improve their properties. In this study halloysite clay nanotubes (HNTs) were functionalized by two different organosilanes: Trimethoxy(propyl)silane (TMPS), and Triethoxy(octyl)silane (EOS). Untreated and modified samples were characterized by scanning electron microscopy (SEM), X-ray diffractometry (XRD), thermogravimetrical analysis (TGA), and Fourier transform infrared spectroscopy (FTIR). Results showed a strong interaction of organosilanes with the chemical groups present in HNTs. Biocompatibility and cytotoxicity of these nanomaterials were determined using C6 rat glioblastoma cells. Our results indicate that prior to functionalization, HNTs show a high biocompatibility and low cytotoxicity. However, HNTs functionalized with EOS and TMPS showed high cytotoxicity by inducing apoptosis. These results allow the identification of potential applications in biomedical areas for HNTs.

Synthesization, Characterization, and in Vitro Evaluation of Cytotoxicity of Biomaterials Based on Halloysite Nanotubes

PubMed Central

Sánchez-Fernández, Antonio; Peña-Parás, Laura; Vidaltamayo, Román; Cué-Sampedro, Rodrigo; Mendoza-Martínez, Ana; Zomosa-Signoret, Viviana C.; Rivas-Estilla, Ana M.; Riojas, Paulina

2014-01-01

Halloysite is an aluminosilicate clay that has been widely used for controlled drug delivery, immobilization of enzymes, and for the capture of circulating tumor cells (CTCs). Surface modification of halloysite by organosilanes has been explored to improve their properties. In this study halloysite clay nanotubes (HNTs) were functionalized by two different organosilanes: Trimethoxy(propyl)silane (TMPS), and Triethoxy(octyl)silane (EOS). Untreated and modified samples were characterized by scanning electron microscopy (SEM), X-ray diffractometry (XRD), thermogravimetrical analysis (TGA), and Fourier transform infrared spectroscopy (FTIR). Results showed a strong interaction of organosilanes with the chemical groups present in HNTs. Biocompatibility and cytotoxicity of these nanomaterials were determined using C6 rat glioblastoma cells. Our results indicate that prior to functionalization, HNTs show a high biocompatibility and low cytotoxicity. However, HNTs functionalized with EOS and TMPS showed high cytotoxicity by inducing apoptosis. These results allow the identification of potential applications in biomedical areas for HNTs. PMID:28788274

In situ removal of arsenic from groundwater by using permeable reactive barriers of organic matter/limestone/zero-valent iron mixtures.

PubMed

Gibert, O; de Pablo, J; Cortina, J-L; Ayora, C

2010-08-01

In this study, two mixtures of municipal compost, limestone and, optionally, zero-valent iron were assessed in two column experiments on acid mine treatment. The effluent solution was systematically analysed throughout the experiment and precipitates from both columns were withdrawn for scanning electron microscopy, energy-dispersive X-ray spectroscopy, X-ray diffractometry analysis and, from the column containing zero-valent iron, solid digestion and sequential extraction analysis. The results showed that waters were cleaned of arsenic, metals and acidity, but chemical and morphological analysis suggested that metal removal was not due predominantly to biogenic sulphide generation but to pH increase, i.e. metal (oxy)hydroxide and carbonate precipitation. Retained arsenic and metal removal were clearly associated to co-precipitation with and/or sorption on iron and aluminum (oxy)hydroxides. An improvement on the arsenic removal efficiency was achieved when the filling mixture contained zero-valent iron. Values of arsenic concentrations were then always below 10 microg/L.

Characterization of the bioactive and mechanical behavior of dental ceramic/sol-gel derived bioactive glass mixtures.

PubMed

Abbasi, Zahra; Bahrololoum, Mohammad E; Bagheri, Rafat; Shariat, Mohammad H

2016-02-01

Dental ceramics can be modified by bioactive glasses in order to develop apatite layer on their surface. One of the benefits of such modification is to prolong the lifetime of the fixed dental prosthesis by preventing the formation of secondary caries. Dental ceramic/sol-gel derived bioactive glass mixture is one of the options for this modification. In the current study, mixtures of dental ceramic/bioactive glass with different compositions were successfully produced. To evaluate their bioactive behavior, prepared samples were immersed in a simulated body fluid at various time intervals. The prepared and soaked specimens were characterized using Fourier transform infrared spectroscopy, X-ray diffractometry and scanning electron microscopy. Since bioactive glasses have deleterious effects on the mechanical properties of dental ceramics, 3-point bending tests were used to evaluate the flexural strength, flexural strain, tangent modulus of elasticity and Weibull modulus of the specimens in order to find the optimal relationship between mechanical and bioactive properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

Application of high-angle annular dark field scanning transmission electron microscopy, scanning transmission electron microscopy-energy dispersive X-ray spectrometry, and energy-filtered transmission electron microscopy to the characterization of nanoparticles in the environment.

PubMed

Utsunomiya, Satoshi; Ewing, Rodney C

2003-02-15

A major challenge to the development of a fundamental understanding of transport and retardation mechanisms of trace metal contaminants (<10 ppm) is their identification and characterization at the nanoscale. Atomic-scale techniques, such as conventional transmission electron microscopy, although powerful, are limited by the extremely small amounts of material that are examined. However, recent advances in electron microscopy provide a number of new analytical techniques that expand its application in environmental studies, particularly those concerning heavy metals on airborne particulates or water-borne colloids. High-angle annular dark field scanning transmission electron microscopy (HAADF-STEM), STEM-energy-dispersive X-ray spectrometry (EDX), and energy-filtered TEM (EFTEM) can be effectively used to identify and characterize nanoparticles. The image contrast in HAADF-STEM is strongly correlated to the atomic mass: heavier elements contribute to brighter contrast. Gold nanocrystals in pyrite and uranium nanocrystals in atmospheric aerosols have been identified by HAADF-STEM and STEM-EDX mapping and subsequently characterized by high-resolution TEM (HRTEM). EFTEM was used to identify U and Fe nanocrystals embedded in an aluminosilicate. A rare, As-bearing nanophase, westerveldite (FeAs), was identified by STEM-EDX and HRTEM. The combined use of these techniques greatly expands the effective application of electron microscopy in environmental studies, especially when applied to metals of very low concentrations. This paper describes examples of how these electron microbeam techniques can be used in combination to characterize a low concentration of heavy metals (a few ppm) on nanoscale particles.

Electron Source Brightness and Illumination Semi-Angle Distribution Measurement in a Transmission Electron Microscope.

PubMed

Börrnert, Felix; Renner, Julian; Kaiser, Ute

2018-05-21

The electron source brightness is an important parameter in an electron microscope. Reliable and easy brightness measurement routes are not easily found. A determination method for the illumination semi-angle distribution in transmission electron microscopy is even less well documented. Herein, we report a simple measurement route for both entities and demonstrate it on a state-of-the-art instrument. The reduced axial brightness of the FEI X-FEG with a monochromator was determined to be larger than 108 A/(m2 sr V).

Electron Diffraction Using Transmission Electron Microscopy

PubMed Central

Bendersky, Leonid A.; Gayle, Frank W.

2001-01-01

Electron diffraction via the transmission electron microscope is a powerful method for characterizing the structure of materials, including perfect crystals and defect structures. The advantages of electron diffraction over other methods, e.g., x-ray or neutron, arise from the extremely short wavelength (≈2 pm), the strong atomic scattering, and the ability to examine tiny volumes of matter (≈10 nm3). The NIST Materials Science and Engineering Laboratory has a history of discovery and characterization of new structures through electron diffraction, alone or in combination with other diffraction methods. This paper provides a survey of some of this work enabled through electron microscopy. PMID:27500060

Analysis on electronic control unit of continuously variable transmission

NASA Astrophysics Data System (ADS)

Cao, Shuanggui

Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.

Analysis of synthetic diamond single crystals by X-ray topography and double-crystal diffractometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prokhorov, I. A., E-mail: igor.prokhorov@mail.ru; Ralchenko, V. G.; Bolshakov, A. P.

2013-12-15

Structural features of diamond single crystals synthesized under high pressure and homoepitaxial films grown by chemical vapor deposition (CVD) have been analyzed by double-crystal X-ray diffractometry and topography. The conditions of a diffraction analysis of diamond crystals using Ge monochromators have been optimized. The main structural defects (dislocations, stacking faults, growth striations, second-phase inclusions, etc.) formed during crystal growth have been revealed. The nitrogen concentration in high-pressure/high-temperature (HPHT) diamond substrates is estimated based on X-ray diffraction data. The formation of dislocation bundles at the film-substrate interface in the epitaxial structures has been revealed by plane-wave topography; these dislocations are likelymore » due to the relaxation of elastic macroscopic stresses caused by the lattice mismatch between the substrate and film. The critical thicknesses of plastic relaxation onset in CVD diamond films are calculated. The experimental techniques for studying the real diamond structure in optimizing crystal-growth technology are proven to be highly efficient.« less

Development of a secondary electron energy analyzer for a transmission electron microscope.

PubMed

Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke

2018-04-01

A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.

A Novel Microcharacterization Technique in the Measurement of Strain and Orientation Gradient in Advanced Materials

NASA Technical Reports Server (NTRS)

Garmestai, H.; Harris, K.; Lourenco, L.

1997-01-01

Representation of morphology and evolution of the microstructure during processing and their relation to properties requires proper experimental techniques. Residual strains, lattice distortion, and texture (micro-texture) at the interface and the matrix of a layered structure or a functionally gradient material and their variation are among parameters important in materials characterization but hard to measure with present experimental techniques. Current techniques available to measure changes in interred material parameters (residual stress, micro-texture, microplasticity) produce results which are either qualitative or unreliable. This problem becomes even more complicated in the case of a temperature variation. These parameters affect many of the mechanical properties of advanced materials including stress-strain relation, ductility, creep, and fatigue. A review of some novel experimental techniques using recent advances in electron microscopy is presented here to measure internal stress, (micro)texture, interracial strength and (sub)grain formation and realignment. Two of these techniques are combined in the chamber of an Environmental Scanning Electron Microscope to measure strain and orientation gradients in advanced materials. These techniques which include Backscattered Kikuchi Diffractometry (BKD) and Microscopic Strain Field Analysis are used to characterize metallic and intermetallic matrix composites and superplastic materials. These techniques are compared with the more conventional x-ray diffraction and indentation techniques.

Microstructures and Mechanical Properties of Co-Cr Dental Alloys Fabricated by Three CAD/CAM-Based Processing Techniques

PubMed Central

Kim, Hae Ri; Jang, Seong-Ho; Kim, Young Kyung; Son, Jun Sik; Min, Bong Ki; Kim, Kyo-Han; Kwon, Tae-Yub

2016-01-01

The microstructures and mechanical properties of cobalt-chromium (Co-Cr) alloys produced by three CAD/CAM-based processing techniques were investigated in comparison with those produced by the traditional casting technique. Four groups of disc- (microstructures) or dumbbell- (mechanical properties) specimens made of Co-Cr alloys were prepared using casting (CS), milling (ML), selective laser melting (SLM), and milling/post-sintering (ML/PS). For each technique, the corresponding commercial alloy material was used. The microstructures of the specimens were evaluated via X-ray diffractometry, optical and scanning electron microscopy with energy-dispersive X-ray spectroscopy, and electron backscattered diffraction pattern analysis. The mechanical properties were evaluated using a tensile test according to ISO 22674 (n = 6). The microstructure of the alloys was strongly influenced by the manufacturing processes. Overall, the SLM group showed superior mechanical properties, the ML/PS group being nearly comparable. The mechanical properties of the ML group were inferior to those of the CS group. The microstructures and mechanical properties of Co-Cr alloys were greatly dependent on the manufacturing technique as well as the chemical composition. The SLM and ML/PS techniques may be considered promising alternatives to the Co-Cr alloy casting process. PMID:28773718

A study of Bi-Pb-Sn-Cd-Sb penta-alloys rapidly quenched from melt

NASA Astrophysics Data System (ADS)

Kamal, M.; El-Bediwi, A. B.

2004-11-01

Optical microscopy, X-ray diffractometry, the double bridge method, the Vickers microhardness testing and dynamic resonance techniques have been used to investigate structure, electrical resistivity, hardness, internal friction and elastic modulus of quenched Bi-Pb-Sn-Cd-Sb penta-alloys. The properties of these penta-alloys are greatly affected by rapid quenching. The intermetallic compound chi(Pb-Bi) or Bi3Pb7 is obtained after rapid quenching using the melt-spinning technique, and this is in agreement with reports by other authors [Marshall, T.J., Mott, G. T. and Grieverson, M. H. (1975). Br. J. Radiol., 48, 924, Kamal, M., El-Bediwi, A. B. and Karman, M. B. (1998). Structure, mechanical properties and electrical resistivity of rapidly solidified Pb-Sn-Cd and Pb-Bi-Sn-Cd alloys. J. Mater. Sci.: Mater. Electron., 9, 425, Borromee-Gautier, C., Giessen, B. C. and Grrant, N. J. (1968). J. Chem. Phys., 48,1905, Moon, K.-W., Boettinger, W. J., Kanner, U. R., Handwerker, C. A. and Lee, D.-J. (2001). The effect of Pb contamination on the solidification behavior of Sn-Bi solders. J. Electron. Mater, 30, 45.]. The quenched Bi43.5Pb44.5Cd5Sn2Sb5 alloy has important properties for safety devices in fire detection and extinguishing systems.

Structural, Optical and Electrical Properties of ITO Thin Films

NASA Astrophysics Data System (ADS)

Sofi, A. H.; Shah, M. A.; Asokan, K.

2018-02-01

Transparent and conductive thin films of indium tin oxide were fabricated on glass substrates by the thermal evaporation technique. Tin doped indium ingots with low tin content were evaporated in vacuum (1.33 × 10-7 kpa) followed by an oxidation for 15 min in the atmosphere in the temperature range of 600-700°C. The structure and phase purity, surface morphology, optical and electrical properties of thin films were studied by x-ray diffractometry and Raman spectroscopy, scanning electron microcopy and atomic force microscopy, UV-visible spectrometry and Hall measurements in the van der Pauw configuration. The x-ray diffraction study showed the formation of the cubical phase of polycrystalline thin films. The morphological analysis showed the formation of ginger like structures and the energy dispersive x-ray spectrum confirmed the presence of indium (In), tin (Sn) and oxygen (O) elements. Hall measurements confirmed n-type conductivity of films with low electrical resistivity ( ρ) ˜ 10-3 Ω cm and high carrier concentration ( n) ˜ 1020 cm-3. For prevalent scattering mechanisms in the films, experimental data was analyzed by calculating a mean free path ( L) using a highly degenerate electron gas model. Furthermore, to investigate the performance of the deposited films as a transparent conductive material, the optical figure of merit was obtained for all the samples.

19 CFR 143.44 - RLF procedure.

Code of Federal Regulations, 2010 CFR

2010-04-01

... transmission of invoice data. For RLF transactions, a customs broker or importer of record must transmit electronically, using EIP, any invoice data required by CBP. (b) Electronic transmission of payment. For RLF...) Automation requirements. Only those entries and entry summaries that CBP processes completely in an...

21 CFR 1311.170 - Transmission requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... prescription that has been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this... transmitted electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c...

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Crystallographic features related to a van der Waals coupling in the layered chalcogenide FePS{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murayama, Chisato; Okabe, Momoko; Fukuda, Koichiro

We investigated the crystallographic structure of FePS{sub 3} with a layered structure using transmission electron microscopy and powder X-ray diffraction. We found that FePS{sub 3} forms a rotational twin structure with the common axis along the c*-axis. The high-resolution transmission electron microscopy images revealed that the twin boundaries were positioned at the van der Waals gaps between the layers. The narrow bands of dark contrast were observed in the bright-field transmission electron microscopy images below the antiferromagnetic transition temperature, T{sub N} ≈ 120 K. Low-temperature X-ray diffraction showed a lattice distortion; the a- and b-axes shortened and lengthened, respectively, as the temperature decreasedmore » below T{sub N.} We propose that the narrow bands of dark contrast observed in the bright-field transmission electron microscopy images are caused by the directional lattice distortion with respect to each micro-twin variant in the antiferromagnetic phase.« less

Transmission Electron Microscope Measures Lattice Parameters

NASA Technical Reports Server (NTRS)

Pike, William T.

1996-01-01

Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

Ponderomotive phase plate for transmission electron microscopes

DOEpatents

Reed, Bryan W [Livermore, CA

2012-07-10

A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.

Growth and Electronic Structure of Heusler Compounds for Use in Electron Spin Based Devices

DTIC Science & Technology

2015-06-01

either Co– or MnSi– initiated films on c(4x4) GaAs. Studies using x - ray photoemission spectroscopy (XPS), STM/STS, and transmission electron microscopy...Co– or MnSi– initiated films on c(4x4) GaAs. Studies using x - ray photoemission spectroscopy (XPS), STM/STS, and transmission electron microscopy (TEM...diagram of the Palmstrøm lab in-situ growth and char- acterization setup, with 6 MBE growth chambers, 3 scanning probe microscopes, an x - ray

Synthesis of LiFePO4/C composites based on natural iron stone using a sol gel method

NASA Astrophysics Data System (ADS)

Angela, Riyan; Islam, Humaatul; Sari, Vamellia; Latif, Chaironi; Zainuri, Mochamad; Pratapa, Suminar

2017-01-01

Synthesis of LiFePO4/C composites has been carried out using a sol gel method. The Fe precursor was made from a natural iron stone of Tanah Laut, South Kalimantan, while the other raw materials were commercial Li2CO3 powder and NH4H2PO4 powder with HCl and water as solvents. Citric acid was used as the carbon source in the synthesis. This study used a molar ratio of 1:1:2 for Li:Fe:P with variation of added citric acid of 1.5 and 2.5 g. The solutions were dried in air at 100°C. The dried powders were characterized using DSC-TGA and then calcined at 600 and 700°C under argon environment for 10 hours. The calcined powders were characterized by X-ray diffractometry (XRD), scanning electron microscopy-energy dispersive x-ray (SEM-EDX), and LCR meter. It was found that the samples contained LiFePO4 as the dominant phase and LiFeP2O7 and Fe2O3 as secondary phases. The analysis showed that the addition of citric acid influenced the electronic conductivity of the composites. A Rietveld relative weight fraction of up to 94.7% was achieved in the synthesis at temperature 600°C. The LFP/C sample exhibited electronic conductivity of 4.56×10-3 Scm-1 which was six times of that of the pure LFP.

The nanosphere iron mineral(s) in Mars soil

NASA Technical Reports Server (NTRS)

Banin, A.; Ben-Shlomo, T.; Margulies, L.; Blake, D. F.; Mancinelli, R. L.; Gehring, A. U.

1993-01-01

A series of surface-modified clays containing nanophase (np) iron/oxyhydroxides of extremely small particle sizes, with total iron contents as high as found in Mars soil, were prepared by iron deposition on the clay surface from ferrous chloride solution. Comprehensive studies of the iron mineralogy in these 'Mars-soil analogs' were conducted using chemical extractions, solubility analyses, pH and redox, x ray and electron diffractometry, electron microscopic imaging specific surface area and particle size determinations, differential thermal analyses, magnetic properties characterization, spectral reflectance, and Viking biology simulation experiments. The clay matrix and the procedure used for synthesis produced nanophase iron oxides containing a certain proportion of divalent iron, which slowly converts to more stable, fully oxidized iron minerals. The noncrystalline nature of the iron compounds precipitated on the surface of the clay was verified by their complete extractability in oxalate. Lepidocrocite (gamma-FeOOH) was detected by selected area electron diffraction. It is formed from a double iron Fe(II)/Fe(III) hydroxyl mineral such as 'green rust', or ferrosic hydroxide. Magnetic measurements suggested that lepidocrocite converted to the more stable meaghemite (gamma-Fe203) by mild heat treatment and then to nanophase hematite (aplha-Fe203) by extensive heat treatment. Their chemical reactivity offers a plausible mechanism for the somewhat puzzling observations of the Viking biology experiments. Their unique chemical reactivities are attributed to the combined catalytic effects of the iron oxide/oxyhydroxide and silicate phase surfaces. The mode of formation of these (nanophase) iron oxides on Mars is still unknown.

Cryo-scanning transmission electron tomography of vitrified cells.

PubMed

Wolf, Sharon Grayer; Houben, Lothar; Elbaum, Michael

2014-04-01

Cryo-electron tomography (CET) of fully hydrated, vitrified biological specimens has emerged as a vital tool for biological research. For cellular studies, the conventional imaging modality of transmission electron microscopy places stringent constraints on sample thickness because of its dependence on phase coherence for contrast generation. Here we demonstrate the feasibility of using scanning transmission electron microscopy for cryo-tomography of unstained vitrified specimens (CSTET). We compare CSTET and CET for the imaging of whole bacteria and human tissue culture cells, finding favorable contrast and detail in the CSTET reconstructions. Particularly at high sample tilts, the CSTET signals contain more informative data than energy-filtered CET phase contrast images, resulting in improved depth resolution. Careful control over dose delivery permits relatively high cumulative exposures before the onset of observable beam damage. The increase in acceptable specimen thickness broadens the applicability of electron cryo-tomography.

Keggin-type polyoxometalate nanosheets: synthesis and characterization via scanning transmission electron microscopy.

PubMed

Hiyoshi, Norihito

2018-05-17

Polyoxometalate nanosheets were synthesized at the gas/liquid interface of an aqueous solution of Keggin-type silicotungstic acid, cesium chloride, and n-octylamine. The structure of the nanosheets was elucidated via aberration-corrected scanning transmission electron microscopy at the atomic and molecular levels.

Soil Particle Size Analysis by Laser Diffractometry: Result Comparison with Pipette Method

NASA Astrophysics Data System (ADS)

Šinkovičová, Miroslava; Igaz, Dušan; Kondrlová, Elena; Jarošová, Miriam

2017-10-01

Soil texture as the basic soil physical property provides a basic information on the soil grain size distribution as well as grain size fraction representation. Currently, there are several methods of particle dimension measurement available that are based on different physical principles. Pipette method based on the different sedimentation velocity of particles with different diameter is considered to be one of the standard methods of individual grain size fraction distribution determination. Following the technical advancement, optical methods such as laser diffraction can be also used nowadays for grain size distribution determination in the soil. According to the literature review of domestic as well as international sources related to this topic, it is obvious that the results obtained by laser diffractometry do not correspond with the results obtained by pipette method. The main aim of this paper was to analyse 132 samples of medium fine soil, taken from the Nitra River catchment in Slovakia, from depths of 15-20 cm and 40-45 cm, respectively, using laser analysers: ANALYSETTE 22 MicroTec plus (Fritsch GmbH) and Mastersizer 2000 (Malvern Instruments Ltd). The results obtained by laser diffractometry were compared with pipette method and the regression relationships using linear, exponential, power and polynomial trend were derived. Regressions with the three highest regression coefficients (R2) were further investigated. The fit with the highest tightness was observed for the polynomial regression. In view of the results obtained, we recommend using the estimate of the representation of the clay fraction (<0.01 mm) polynomial regression, to achieve a highest confidence value R2 at the depths of 15-20 cm 0.72 (Analysette 22 MicroTec plus) and 0.95 (Mastersizer 2000), from a depth of 40-45 cm 0.90 (Analysette 22 MicroTec plus) and 0.96 (Mastersizer 2000). Since the percentage representation of clayey particles (2nd fraction according to the methodology of Complex Soil Survey done in Slovakia) in soil is the determinant for soil type specification, we recommend using the derived relationships in soil science when the soil texture analysis is done according to laser diffractometry. The advantages of laser diffraction method comprise the short analysis time, usage of small sample amount, application for the various grain size fraction and soil type classification systems, and a wide range of determined fractions. Therefore, it is necessary to focus on this issue further to address the needs of soil science research and attempt to replace the standard pipette method with more progressive laser diffraction method.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Tunable valley polarization by a gate voltage when an electron tunnels through multiple line defects in graphene.

PubMed

Liu, Zhe; Jiang, Liwei; Zheng, Yisong

2015-02-04

By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.

Electronic Information Delivery Systems: Reports on Five Projects Sponsored by the Fred Meyer Charitable Trust.

ERIC Educational Resources Information Center

Ferguson, Douglas K.; And Others

1987-01-01

Describes five research projects that are setting up electronic information delivery systems to serve rural areas in the Pacific Northwest. The technologies being evaluated include simultaneous remote searching, facsimile transmissions, bit map image transmissions, and a combination of optical character recognition equipment and television…

45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format

Code of Federal Regulations, 2014 CFR

2014-10-01

... 45 Public Welfare 4 2014-10-01 2014-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN... FAMILIES, FOSTER CARE MAINTENANCE PAYMENTS, ADOPTION ASSISTANCE, AND CHILD AND FAMILY SERVICES GENERAL Pt...

45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 4 2012-10-01 2012-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN... FAMILIES, FOSTER CARE MAINTENANCE PAYMENTS, ADOPTION ASSISTANCE, AND CHILD AND FAMILY SERVICES GENERAL Pt...

27 CFR 41.81 - Taxpayment.

Code of Federal Regulations, 2010 CFR

2010-04-01

... tax must be paid on the basis of a return on the customs form or by authorized electronic transmission... customs form or authorized electronic transmission the following internal revenue tax information. (1) For... rate of tax, and the tax due. (4) For cigars. The importer will show: (i) The number imported under...

Contact dependence of the conductance through C60

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

1998-08-01

The electronic transmission through a C60 molecule is studied with emphasis on the contact geometry. The transmission can not be understood simply by the electronic structure of the C60 molecule itself, interference effects related to the metal/molecule contact are in fact very important for the conductance.

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2010 CFR

2010-01-01

... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... will not be admitted under the Visa Waiver Program unless an appropriate official of the carrier... departure from the United States by sea or air of an alien admitted under the Visa Waiver Program, an...

Performance of low-voltage STEM/TEM with delta corrector and cold field emission gun.

PubMed

Sasaki, Takeo; Sawada, Hidetaka; Hosokawa, Fumio; Kohno, Yuji; Tomita, Takeshi; Kaneyama, Toshikatsu; Kondo, Yukihito; Kimoto, Koji; Sato, Yuta; Suenaga, Kazu

2010-08-01

To reduce radiation damage caused by the electron beam and to obtain high-contrast images of specimens, we have developed a highly stabilized transmission electron microscope equipped with a cold field emission gun and spherical aberration correctors for image- and probe-forming systems, which operates at lower acceleration voltages than conventional transmission electron microscopes. A delta-type aberration corrector is designed to simultaneously compensate for third-order spherical aberration and fifth-order 6-fold astigmatism. Both were successfully compensated in both scanning transmission electron microscopy (STEM) and transmission electron microscopy (TEM) modes in the range 30-60 kV. The Fourier transforms of raw high-angle annular dark field (HAADF) images of a Si[110] sample revealed spots corresponding to lattice spacings of 111 and 96 pm at 30 and 60 kV, respectively, and those of raw TEM images of an amorphous Ge film with gold particles showed spots corresponding to spacings of 91 and 79 pm at 30 and 60 kV, respectively. Er@C(82)-doped single-walled carbon nanotubes, which are carbon-based samples, were successfully observed by HAADF-STEM imaging with an atomic-level resolution.

Structural analysis of ion-implanted chemical-vapor-deposited diamond by transmission electron microscope

NASA Astrophysics Data System (ADS)

Jiang, N.; Deguchi, M.; Wang, C. L.; Won, J. H.; Jeon, H. M.; Mori, Y.; Hatta, A.; Kitabatake, M.; Ito, T.; Hirao, T.; Sasaki, T.; Hiraki, A.

1997-04-01

A transmission electron microscope (TEM) study of ion-implanted chemical-vapor-deposited (CVD) diamond is presented. CVD diamond used for transmission electron microscope observation was directly deposited onto Mo TEM grids. As-deposited specimens were irradiated by C (100 keV) ions at room temperature with a wide range of implantation doses (10 12-10 17/cm 2). Transmission electron diffraction (TED) patterns indicate that there exists a critical dose ( Dc) for the onset of amorphization of CVD diamond as a result of ion induced damage and the value of critical dose is confirmed to be about 3 × 10 15/cm 2. The ion-induced transformation process is clearly revealed by high resolution electron microscope (HREM) images. For a higher dose implantation (7 × 10 15/cm 2) a large amount of diamond phase is transformed into amorphous carbon and many tiny misoriented diamond blocks are found to be left in the amorphous solid. The average size of these misoriented diamond blocks is only about 1-2 nm. Further bombardment (10 17/cm 2) almost kills all of the diamond phase within the irradiated volume and moreover leads to local formation of micropolycrystalline graphite.

Filter for a drill string

DOEpatents

Hall, David R.; Pixton, David S.; Briscoe, Michael; McPherson, James

2007-12-04

A filter for a drill string comprises a perforated receptacle having an open end and a perforated end and first and second mounting surfaces are adjacent the open end. A transmission element is disposed within each of the first and second mounting surfaces. A capacitor may modify electrical characteristics of an LC circuit that comprises the transmission elements. The respective transmission elements are in communication with each other and with a transmission network integrated into the drill string. The transmission elements may be inductive couplers, direct electrical contacts, or optical couplers. In some embodiments of the present invention, the filter comprises an electronic component. The electronic component may be selected from the group consisting of a sensor, a router, a power source, a clock source, a repeater, and an amplifier.

Electronic Biometric Transmission Specification. Version 1.2

DTIC Science & Technology

2006-11-08

Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non

Purchase of a Transmission Electron Microscope for Xavier University of Louisiana

DTIC Science & Technology

2015-05-15

imaging facility on the second floor of the Pharmacy Addition at Xavier University that already includes two scanning electron microscopes. The new TEM...is now in use. Xavier University has formally pledged to provide funds for the 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 13. SUPPLEMENTARY...for Public Release; Distribution Unlimited Final Report: Purchase of a Transmission Electron Microscope for Xavier University of Louisiana The views

Achromatic elemental mapping beyond the nanoscale in the transmission electron microscope.

PubMed

Urban, K W; Mayer, J; Jinschek, J R; Neish, M J; Lugg, N R; Allen, L J

2013-05-03

Newly developed achromatic electron optics allows the use of wide energy windows and makes feasible energy-filtered transmission electron microscopy (EFTEM) at atomic resolution. In this Letter we present EFTEM images formed using electrons that have undergone a silicon L(2,3) core-shell energy loss, exhibiting a resolution in EFTEM of 1.35 Å. This permits elemental mapping beyond the nanoscale provided that quantum mechanical calculations from first principles are done in tandem with the experiment to understand the physical information encoded in the images.

Amorphization induced by focused ion beam milling in metallic and electronic materials.

PubMed

Huh, Yoon; Hong, Ki Jung; Shin, Kwang Soo

2013-08-01

Focused ion beam (FIB) milling using high-energy gallium ions is widely used in the preparation of specimens for transmission electron microscopy (TEM). However, the energetic ion beam induces amorphization on the edge of specimens during milling, resulting in a mischievous influence on the clearness of high-quality transmission electron micrographs. In this work, the amorphization induced by the FIB milling was investigated by TEM for three kinds of materials, metallic materials in bulk shape, and semiconductive and electronic ceramic materials as a substrate for the deposition of thin films.

Fabrication of ZnS nanoparticle chains on a protein template

PubMed Central

Hulleman, J.; Kim, S. M.; Tumkur, T.; Rochet, J.-C.; Stach, E.; Stanciu, L.

2011-01-01

In the present study, we have exploited the properties of a fibrillar protein for the template synthesis of zinc sulfide (ZnS) nanoparticle chains. The diameter of the ZnS nanoparticle chains was tuned in range of ~30 to ~165 nm by varying the process variables. The nanoparticle chains were characterized by field emission scanning electron microscopy, UV–Visible spectroscopy, transmission electron microscopy, electron energy loss spectroscopy, and high-resolution transmission electron microscopy. The effect of incubation temperature on the morphology of the nanoparticle chains was also studied. PMID:21804765

Understanding electron magnetic circular dichroism in a transition potential approach

NASA Astrophysics Data System (ADS)

Barthel, J.; Mayer, J.; Rusz, J.; Ho, P.-L.; Zhong, X. Y.; Lentzen, M.; Dunin-Borkowski, R. E.; Urban, K. W.; Brown, H. G.; Findlay, S. D.; Allen, L. J.

2018-04-01

This paper introduces an approach based on transition potentials for inelastic scattering to understand the underlying physics of electron magnetic circular dichroism (EMCD). The transition potentials are sufficiently localized to permit atomic-scale EMCD. Two-beam and three-beam systematic row cases are discussed in detail in terms of transition potentials for conventional transmission electron microscopy, and the basic symmetries which arise in the three-beam case are confirmed experimentally. Atomic-scale EMCD in scanning transmission electron microscopy (STEM), using both a standard STEM probe and vortex beams, is discussed.

Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation

DOE PAGES

Sun, Cheng; Sprouster, David J.; Hattar, K.; ...

2018-02-09

In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.

Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Cheng; Sprouster, David J.; Hattar, K.

In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.

Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope.

PubMed

Johnston-Peck, Aaron C; DuChene, Joseph S; Roberts, Alan D; Wei, Wei David; Herzing, Andrew A

2016-11-01

Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO 2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. Published by Elsevier B.V.

Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope

PubMed Central

Johnston-Peck, Aaron C.; DuChene, Joseph S.; Roberts, Alan D.; Wei, Wei David; Herzing, Andrew A.

2016-01-01

Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300 keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. PMID:27469265

Transmission of electrons inside the cryogenic pumps of ITER injector.

PubMed

Veltri, P; Sartori, E

2016-02-01

Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particle trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.

Electronic transmission in non-linear potential profile of GaAs/AlxGa1-xAs biased quantum well structure

NASA Astrophysics Data System (ADS)

Meghoufel, F. Z.; Bentata, S.; Terkhi, S.; Bendahma, F.; Cherid, S.

2013-05-01

We study the effect of the nonlinearity on electrons transmission properties in a double barriers structure GaAs/AlxGa1-xAs superlattices. The nonlinearity is introduced as an effective potential in the Schrödinger equation and translates the electronic Colombian repulsion. We have used the transfer matrix formalism and the plane wave functions approximation to solve numerically the equation and calculate the electronic transmission coefficient. We have shown the occurrence of two allowed states within the same well instead of a single, translating the presence of two resonant states at two different energies. The first allowed state intensity strongly decreases with increasing the nonlinear parameter, whereas the second one called the degeneracy state increases. Both the two states evolve towards higher resonances energies.

High-pressure freezing for scanning transmission electron tomography analysis of cellular organelles.

PubMed

Walther, Paul; Schmid, Eberhard; Höhn, Katharina

2013-01-01

Using an electron microscope's scanning transmission mode (STEM) for collection of tomographic datasets is advantageous compared to bright field transmission electron microscopic (TEM). For image formation, inelastic scattering does not cause chromatic aberration, since in STEM mode no image forming lenses are used after the beam has passed the sample, in contrast to regular TEM. Therefore, thicker samples can be imaged. It has been experimentally demonstrated that STEM is superior to TEM and energy filtered TEM for tomography of samples as thick as 1 μm. Even when using the best electron microscope, adequate sample preparation is the key for interpretable results. We adapted protocols for high-pressure freezing of cultivated cells from a physiological state. In this chapter, we describe optimized high-pressure freezing and freeze substitution protocols for STEM tomography in order to obtain high membrane contrast.

Transmission environmental scanning electron microscope with scintillation gaseous detection device.

PubMed

Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

2015-03-01

A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. Copyright © 2014 Elsevier B.V. All rights reserved.

Nanowire growth kinetics in aberration corrected environmental transmission electron microscopy

DOE PAGES

Chou, Yi -Chia; Panciera, Federico; Reuter, Mark C.; ...

2016-03-15

Here, we visualize atomic level dynamics during Si nanowire growth using aberration corrected environmental transmission electron microscopy, and compare with lower pressure results from ultra-high vacuum microscopy. We discuss the importance of higher pressure observations for understanding growth mechanisms and describe protocols to minimize effects of the higher pressure background gas.

Big Comsats for big jobs at low user cost. [considering wrist telephony, electronic mail transmission and educational television applications

NASA Technical Reports Server (NTRS)

Bekey, I.

1979-01-01

Three examples are used to illustrate what is possible with large space systems: (1) personal communications using wrist telephones, (2) electronic transmission of mail, and (3) wide dissemination of educational TV. Design concepts and costs are explored and compared to alternative ground-based concepts.

Transmission electron microscopy: direct observation of crystal structure in refractory ceramics.

PubMed

Shaw, T M; Thomas, G

1978-11-10

Using high-resolution multibeam interference techniques in the transmission electron microscope, images have been obtained that make possible a real-space structure analysis of a beryllium-silicon-nitrogen compound. The results illustrate the usefulness of lattice imaging in the analysis of local crystal structure in these technologically promising ceramic materials.

45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format

Code of Federal Regulations, 2010 CFR

2010-10-01

... mainframe-to-mainframe data exchange system using the Sterling Software data transfer package called “SUPERTRACS.” This package will allow data exchange between most computer platforms (both mini and mainframe... 45 Public Welfare 4 2010-10-01 2010-10-01 false Electronic Data Transmission Format C Appendix C...

45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format

Code of Federal Regulations, 2011 CFR

2011-10-01

... mainframe-to-mainframe data exchange system using the Sterling Software data transfer package called “SUPERTRACS.” This package will allow data exchange between most computer platforms (both mini and mainframe... 45 Public Welfare 4 2011-10-01 2011-10-01 false Electronic Data Transmission Format C Appendix C...

Analysis of liquid suspensions using scanning electron microscopy in transmission: estimation of the water film thickness using Monte-Carlo simulations.

PubMed

Xiao, J; Foray, G; Masenelli-Varlot, K

2018-02-01

Environmental scanning electron microscopy (ESEM) allows the observation of liquids under specific conditions of pressure and temperature. Moreover, when working in the transmission mode, that is in scanning transmission electron microscopy (STEM), nano-objects can be analysed inside a liquid. The contrast in the images is mass-thickness dependent as in STEM-in-TEM (transmission electron microscopy) using closed cells. However, in STEM-in-ESEM, as the liquid-vapour equilibrium is kept dynamically, the thickness of the water droplet remains unknown. In this paper, the contrasts measured in the experimental images are compared with calculations using Monte-Carlo simulations in order to estimate the thickness of water. Two examples are given. On gold nanoparticles, the thickness of a thick film can be estimated thanks to a contrast inversion. On core-shell latex particles, the grey level of the shell compared with those of the core and of the water film gives a relatively precise measurement of the water film thickness. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Total-scattering pair-distribution function of organic material from powder electron diffraction data.

PubMed

Gorelik, Tatiana E; Schmidt, Martin U; Kolb, Ute; Billinge, Simon J L

2015-04-01

This paper shows that pair-distribution function (PDF) analyses can be carried out on organic and organometallic compounds from powder electron diffraction data. Different experimental setups are demonstrated, including selected area electron diffraction and nanodiffraction in transmission electron microscopy or nanodiffraction in scanning transmission electron microscopy modes. The methods were demonstrated on organometallic complexes (chlorinated and unchlorinated copper phthalocyanine) and on purely organic compounds (quinacridone). The PDF curves from powder electron diffraction data, called ePDF, are in good agreement with PDF curves determined from X-ray powder data demonstrating that the problems of obtaining kinematical scattering data and avoiding beam damage of the sample are possible to resolve.

Method and apparatus for a high-resolution three dimensional confocal scanning transmission electron microscope

DOEpatents

de Jonge, Niels [Oak Ridge, TN

2010-08-17

A confocal scanning transmission electron microscope which includes an electron illumination device providing an incident electron beam propagating in a direction defining a propagation axis, and a precision specimen scanning stage positioned along the propagation axis and movable in at least one direction transverse to the propagation axis. The precision specimen scanning stage is configured for positioning a specimen relative to the incident electron beam. A projector lens receives a transmitted electron beam transmitted through at least part of the specimen and focuses this transmitted beam onto an image plane, where the transmitted beam results from the specimen being illuminated by the incident electron beam. A detection system is placed approximately in the image plane.

New developments in electron microscopy for serial image acquisition of neuronal profiles.

PubMed

Kubota, Yoshiyuki

2015-02-01

Recent developments in electron microscopy largely automate the continuous acquisition of serial electron micrographs (EMGs), previously achieved by laborious manual serial ultrathin sectioning using an ultramicrotome and ultrastructural image capture process with transmission electron microscopy. The new systems cut thin sections and capture serial EMGs automatically, allowing for acquisition of large data sets in a reasonably short time. The new methods are focused ion beam/scanning electron microscopy, ultramicrotome/serial block-face scanning electron microscopy, automated tape-collection ultramicrotome/scanning electron microscopy and transmission electron microscope camera array. In this review, their positive and negative aspects are discussed. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Surface microstructure and high temperature corrosion resistance of arc-sprayed FeCrAl coating irradiated by high current pulsed electron beam

NASA Astrophysics Data System (ADS)

Hao, Shengzhi; Zhao, Limin; He, Dongyun

2013-10-01

The surface microstructure of arc-sprayed FeCrAl coating irradiated by high current pulsed electron beam (HCPEB) with long pulse duration of 200 μs was characterized by using optical microscopy, scanning electron microscopy and X-ray diffractometry. The distribution of chemical composition in modified surface layer was measured with electron probe micro-analyzer. The high temperature corrosion resistance of FeCrAl coating was tested in a saturated Na2SO4 and K2SO4 solution at 650 °C. After HCPEB irradiation, the coarse surface of arc-sprayed coating was changed as discrete bulged nodules with smooth and compact appearance. When using low energy density of 20 J/cm2, the surface modified layer was continuous entirely with an average melting depth of ˜30 μm. In the surface remelted layer, Fe and Cr elements gave a uniform distribution, while Al and O elements agglomerated particularly at the concave part between nodule structures to form α-Al2O3 phase. After high temperature corrosion tests, the FeCrAl coating treated with HCPEB of 20 J/cm2 remained a glossy surface with weight increment of ˜51 mg/cm2, decreased by 20% as compared to the initial sample. With the increasing energy density of HCPEB irradiation, the integrity of surface modified layer got segmented due to the formation of larger bulged nodules and cracks at the concave parts. For the HCPEB irradiation of 40 J/cm2, the high temperature corrosion resistance of FeCrAl coating was deteriorated drastically.

Two-dimensional mapping of polarizations of rhombohedral nanostructures in the orthorhombic phase of KNbO3 by the combined use of scanning transmission electron microscopy and convergent-beam electron diffraction

NASA Astrophysics Data System (ADS)

Tsuda, Kenji; Tanaka, Michiyoshi

2015-08-01

Rhombohedral nanostructures previously found in the orthorhombic phase of KNbO3, by convergent-beam electron diffraction [Tsuda et al., Appl. Phys. Lett. 102, 051913 (2013)], have been investigated by the combined use of scanning transmission electron microscopy and convergent-beam electron diffraction. Two-dimensional distributions of the rhombohedral nanostructures, or nanometer-scale spatial fluctuations of polarization clusters, have been successfully visualized. The correlation length of the observed spatial fluctuations of local polarizations is related to the cpc/apc ratio and the transition entropy.

Atmospheric pressure scanning transmission electron microscopy.

PubMed

de Jonge, Niels; Bigelow, Wilbur C; Veith, Gabriel M

2010-03-10

Scanning transmission electron microscope (STEM) images of gold nanoparticles at atmospheric pressure have been recorded through a 0.36 mm thick mixture of CO, O2, and He. This was accomplished using a reaction cell consisting of two electron-transparent silicon nitride membranes. Gold nanoparticles of a full width at half-maximum diameter of 1.0 nm were visible above the background noise, and the achieved edge resolution was 0.4 nm in accordance with calculations of the beam broadening.

Nano Electronics on Atomically Controlled van der Waals Quantum Heterostructures

DTIC Science & Technology

2015-03-30

for the structural of the atomically sharp interface between hBN and Bi2Te3. Finally, we have developed unprecedentedly clean graphene supercoductor...crystals by MBE method. We also use transmission electron microscopy (TEM) analysis for the structural of the atomically sharp interface between hBN and...by MBE method. We also use transmission electron microscopy (TEM) analysis for the structural of the atomically sharp interface between hBN and Bi2Te3

Exploring transmission Kikuchi diffraction using a Timepix detector

NASA Astrophysics Data System (ADS)

Vespucci, S.; Winkelmann, A.; Mingard, K.; Maneuski, D.; O'Shea, V.; Trager-Cowan, C.

2017-02-01

Electron backscatter diffraction (EBSD) is a well-established scanning electron microscope (SEM)-based technique [1]. It allows the non-destructive mapping of the crystal structure, texture, crystal phase and strain with a spatial resolution of tens of nanometers. Conventionally this is performed by placing an electron sensitive screen, typically consisting of a phosphor screen combined with a charge coupled device (CCD) camera, in front of a specimen, usually tilted 70° to the normal of the exciting electron beam. Recently, a number of authors have shown that a significant increase in spatial resolution is achievable when Kikuchi diffraction patterns are acquired in transmission geometry; that is when diffraction patterns are generated by electrons transmitted through an electron-transparent, usually thinned, specimen. The resolution of this technique, called transmission Kikuchi diffraction (TKD), has been demonstrated to be better than 10 nm [2,3]. We have recently demonstrated the advantages of a direct electron detector, Timepix [4,5], for the acquisition of standard EBSD patterns [5]. In this article we will discuss the advantages of Timepix to perform TKD and for acquiring spot diffraction patterns and more generally for acquiring scanning transmission electron microscopy micrographs in the SEM. Particularly relevant for TKD, is its very compact size, which allows much more flexibility in the positioning of the detector in the SEM chamber. We will furthermore show recent results using Timepix as a virtual forward scatter detector, and will illustrate the information derivable on producing images through processing of data acquired from different areas of the detector. We will show results from samples ranging from gold nanoparticles to nitride semiconductor nanorods.

Atomic resolution elemental mapping using energy-filtered imaging scanning transmission electron microscopy with chromatic aberration correction.

PubMed

Krause, F F; Rosenauer, A; Barthel, J; Mayer, J; Urban, K; Dunin-Borkowski, R E; Brown, H G; Forbes, B D; Allen, L J

2017-10-01

This paper addresses a novel approach to atomic resolution elemental mapping, demonstrating a method that produces elemental maps with a similar resolution to the established method of electron energy-loss spectroscopy in scanning transmission electron microscopy. Dubbed energy-filtered imaging scanning transmission electron microscopy (EFISTEM) this mode of imaging is, by the quantum mechanical principle of reciprocity, equivalent to tilting the probe in energy-filtered transmission electron microscopy (EFTEM) through a cone and incoherently averaging the results. In this paper we present a proof-of-principle EFISTEM experimental study on strontium titanate. The present approach, made possible by chromatic aberration correction, has the advantage that it provides elemental maps which are immune to spatial incoherence in the electron source, coherent aberrations in the probe-forming lens and probe jitter. The veracity of the experiment is supported by quantum mechanical image simulations, which provide an insight into the image-forming process. Elemental maps obtained in EFTEM suffer from the effect known as preservation of elastic contrast, which, for example, can lead to a given atomic species appearing to be in atomic columns where it is not to be found. EFISTEM very substantially reduces the preservation of elastic contrast and yields images which show stability of contrast with changing thickness. The experimental application is demonstrated in a proof-of-principle study on strontium titanate. Copyright © 2017 Elsevier B.V. All rights reserved.

Efficient linear phase contrast in scanning transmission electron microscopy with matched illumination and detector interferometry

DOE PAGES

Ophus, Colin; Ciston, Jim; Pierce, Jordan; ...

2016-02-29

The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, makingmore » it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Ultimately, simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals.« less

Correlative scanning-transmission electron microscopy reveals that a chimeric flavivirus is released as individual particles in secretory vesicles.

PubMed

Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe

2014-01-01

The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.

Efficient linear phase contrast in scanning transmission electron microscopy with matched illumination and detector interferometry.

PubMed

Ophus, Colin; Ciston, Jim; Pierce, Jordan; Harvey, Tyler R; Chess, Jordan; McMorran, Benjamin J; Czarnik, Cory; Rose, Harald H; Ercius, Peter

2016-02-29

The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, making it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals.

Efficient linear phase contrast in scanning transmission electron microscopy with matched illumination and detector interferometry

PubMed Central

Ophus, Colin; Ciston, Jim; Pierce, Jordan; Harvey, Tyler R.; Chess, Jordan; McMorran, Benjamin J.; Czarnik, Cory; Rose, Harald H.; Ercius, Peter

2016-01-01

The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, making it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals. PMID:26923483

Correlative Scanning-Transmission Electron Microscopy Reveals that a Chimeric Flavivirus Is Released as Individual Particles in Secretory Vesicles

PubMed Central

Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe

2014-01-01

The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations. PMID:24681578

Interaction of electrons with light metal hydrides in the transmission electron microscope.

PubMed

Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei

2014-12-01

Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mineralogical characterization of Greda clays and monitoring of their phase transformations on thermal treatment

NASA Astrophysics Data System (ADS)

Panduro, E. Chavez; Cabrejos, J. Bravo

2010-01-01

The mineralogical characterization of two clay samples from the Central Andean Region of Peru, denominated White Greda and Red Greda, is reported. These clays contain the clay minerals mica and illite respectively. Both clays were treated thermally in an oxidising atmosphere under controlled conditions up to 1,100°C with the purpose of obtaining information about structural changes that may be useful for pottery manufacture. X-ray fluorescence was used for the elemental characterization of the samples and X-ray diffractometry was used to determine the collapse and formation of the mineral phases present in the samples caused by thermal treatment. At temperatures above 1,000°C it is observed the formation of spinel in the case of White Greda and of hematite, corundum and cristobalite in the case of Red Greda. Room temperature transmission Mössbauer spectroscopy allowed the monitoring of the variation of the hyperfine parameters with the thermal treatment temperature; In the case of the evolution of the quadruple splitting of the paramagnetic Fe3 + sites with temperature, in both clays, the analyses reproduced results such as the “camel back” curve shape, found by other workers (Wagner and Wagner, Hyperfine Interact 154:35-82, 2004; Wagner and Kyek, Hyperfine Interact 154:5-33, 2004).

In-situ straining and time-resolved electron tomography data acquisition in a transmission electron microscope.

PubMed

Hata, S; Miyazaki, S; Gondo, T; Kawamoto, K; Horii, N; Sato, K; Furukawa, H; Kudo, H; Miyazaki, H; Murayama, M

2017-04-01

This paper reports the preliminary results of a new in-situ three-dimensional (3D) imaging system for observing plastic deformation behavior in a transmission electron microscope (TEM) as a directly relevant development of the recently reported straining-and-tomography holder [Sato K et al. (2015) Development of a novel straining holder for transmission electron microscopy compatible with single tilt-axis electron tomography. Microsc. 64: 369-375]. We designed an integrated system using the holder and newly developed straining and image-acquisition software and then developed an experimental procedure for in-situ straining and time-resolved electron tomography (ET) data acquisition. The software for image acquisition and 3D visualization was developed based on the commercially available ET software TEMographyTM. We achieved time-resolved 3D visualization of nanometer-scale plastic deformation behavior in a Pb-Sn alloy sample, thus demonstrating the capability of this system for potential applications in materials science. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Insights into radiation damage from atomic resolution scanning transmission electron microscopy imaging of mono-layer CuPcCl16 films on graphene.

PubMed

Mittelberger, Andreas; Kramberger, Christian; Meyer, Jannik C

2018-03-19

Atomically resolved images of monolayer organic crystals have only been obtained with scanning probe methods so far. On the one hand, they are usually prepared on surfaces of bulk materials, which are not accessible by (scanning) transmission electron microscopy. On the other hand, the critical electron dose of a monolayer organic crystal is orders of magnitudes lower than the one for bulk crystals, making (scanning) transmission electron microscopy characterization very challenging. In this work we present an atomically resolved study on the dynamics of a monolayer CuPcCl 16 crystal under the electron beam as well as an image of the undamaged molecules obtained by low-dose electron microscopy. The results show the dynamics and the radiation damage mechanisms in the 2D layer of this material, complementing what has been found for bulk crystals in earlier studies. Furthermore, being able to image the undamaged molecular crystal allows the characterization of new composites consisting of 2D materials and organic molecules.

Weak-beam scanning transmission electron microscopy for quantitative dislocation density measurement in steels.

PubMed

Yoshida, Kenta; Shimodaira, Masaki; Toyama, Takeshi; Shimizu, Yasuo; Inoue, Koji; Yoshiie, Toshimasa; Milan, Konstantinovic J; Gerard, Robert; Nagai, Yasuyoshi

2017-04-01

To evaluate dislocations induced by neutron irradiation, we developed a weak-beam scanning transmission electron microscopy (WB-STEM) system by installing a novel beam selector, an annular detector, a high-speed CCD camera and an imaging filter in the camera chamber of a spherical aberration-corrected transmission electron microscope. The capabilities of the WB-STEM with respect to wide-view imaging, real-time diffraction monitoring and multi-contrast imaging are demonstrated using typical reactor pressure vessel steel that had been used in an European nuclear reactor for 30 years as a surveillance test piece with a fluence of 1.09 × 1020 neutrons cm-2. The quantitatively measured size distribution (average loop size = 3.6 ± 2.1 nm), number density of the dislocation loops (3.6 × 1022 m-3) and dislocation density (7.8 × 1013 m m-3) were carefully compared with the values obtained via conventional weak-beam transmission electron microscopy studies. In addition, cluster analysis using atom probe tomography (APT) further demonstrated the potential of the WB-STEM for correlative electron tomography/APT experiments. © The Author 2017. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Consecutive light microscopy, scanning-transmission electron microscopy and transmission electron microscopy of traumatic human brain oedema and ischaemic brain damage.

PubMed

Castejon, O J; Castejon, H V; Diaz, M; Castellano, A

2001-10-01

Cortical biopsies of 11 patients with traumatic brain oedema were consecutively studied by light microscopy (LM) using thick plastic sections, scanning-transmission electron microscopy ((S)TEM) using semithin plastic sections and transmission electron microscopy (TEM) using ultrathin sections. Samples were glutaraldehyde-osmium fixed and embedded in Araldite or Epon. Thick sections were stained with toluidine-blue for light microscopy. Semithin sections were examined unstained and uncoated for (S)TEM. Ultrathin sections were stained with uranyl and lead. Perivascular haemorrhages and perivascular extravasation of proteinaceous oedema fluid were observed in both moderate and severe oedema. Ischaemic pyramidal and non-pyramidal nerve cells appeared shrunken, electron dense and with enlargement of intracytoplasmic membrane compartment. Notably swollen astrocytes were observed in all samples examined. Glycogen-rich and glycogen-depleted astrocytes were identified in anoxic-ischaemic regions. Dark and hydropic satellite, interfascicular and perivascular oligodendrocytes were also found. The status spongiosus of severely oedematous brain parenchyma observed by LM and (S)TEM was correlated with the enlarged extracellular space and disrupted neuropil observed by TEM. The (S)TEM is recommended as a suitable technique for studying pathological processes in the central nervous system and as an informative adjunct to LM and TEM.

Transmission of electrons inside the cryogenic pumps of ITER injector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veltri, P., E-mail: pierluigi.veltri@igi.cnr.it; Sartori, E.

2016-02-15

Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particlemore » trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.« less

Isotope analysis in the transmission electron microscope.

PubMed

Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani

2016-10-10

The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.

46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...

46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...

46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...

46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...

46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.

Code of Federal Regulations, 2010 CFR

2010-10-01

..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...

Triggered plasma opening switch

DOEpatents

Mendel, Clifford W.

1988-01-01

A triggerable opening switch for a very high voltage and current pulse includes a transmission line extending from a source to a load and having an intermediate switch section including a plasma for conducting electrons between transmission line conductors and a magnetic field for breaking the plasma conduction path and magnetically insulating the electrons when it is desired to open the switch.

Tissue and cellular localization of tannins in Tunisian dates (Phoenix dactylifera L.) by light and transmission electron microscopy.

PubMed

Hammouda, Hédi; Alvarado, Camille; Bouchet, Brigitte; Kalthoum-Chérif, Jamila; Trabelsi-Ayadi, Malika; Guyot, Sylvain

2014-07-16

A histological approach including light microscopy and transmission electron microscopy (TEM) was used to provide accurate information on the localization of condensed tannins in the edible tissues and in the stone of date fruits (Phoenix dactylifera L.). Light microscopy was carried out on fresh tissues after staining by 4-dimethylaminocinnamaldehyde (DMACA) for a specific detection of condensed tannins. Thus, whether under light microscopy or transmission electron microscopy (TEM), results showed that tannins are not located in the epidermis but more deeply in the mesocarp in the vacuole of very large cells. Regarding the stones, tannins are found in a specific cell layer located at 50 μm from the sclereid cells of the testa.

Light-driven phase shifter

DOEpatents

Early, James W.

1990-01-01

A light-driven phase shifter is provided for modulating a transmission light beam. A gaseous medium such as argon is provided with electron energy states excited to populate a metastable state. A tunable dye laser is selected with a wavelength effective to deplete the metastable electron state and may be intensity modulated. The dye laser is directed through the gaseous medium to define a first optical path having an index of refraction determined by the gaseous medium having a depleted metastable electron state. A transmission laser beam is also directed through the gaseous medium to define a second optical path at least partially coincident with the first optical path. The intensity of the dye laser beam may then be varied to phase modulate the transmission laser beam.

A graphene oxide-carbon nanotube grid for high-resolution transmission electron microscopy of nanomaterials.

PubMed

Zhang, Lina; Zhang, Haoxu; Zhou, Ruifeng; Chen, Zhuo; Li, Qunqing; Fan, Shoushan; Ge, Guanglu; Liu, Renxiao; Jiang, Kaili

2011-09-23

A novel grid for use in transmission electron microscopy is developed. The supporting film of the grid is composed of thin graphene oxide films overlying a super-aligned carbon nanotube network. The composite film combines the advantages of graphene oxide and carbon nanotube networks and has the following properties: it is ultra-thin, it has a large flat and smooth effective supporting area with a homogeneous amorphous appearance, high stability, and good conductivity. The graphene oxide-carbon nanotube grid has a distinct advantage when characterizing the fine structure of a mass of nanomaterials over conventional amorphous carbon grids. Clear high-resolution transmission electron microscopy images of various nanomaterials are obtained easily using the new grids.

A fast image simulation algorithm for scanning transmission electron microscopy.

PubMed

Ophus, Colin

2017-01-01

Image simulation for scanning transmission electron microscopy at atomic resolution for samples with realistic dimensions can require very large computation times using existing simulation algorithms. We present a new algorithm named PRISM that combines features of the two most commonly used algorithms, namely the Bloch wave and multislice methods. PRISM uses a Fourier interpolation factor f that has typical values of 4-20 for atomic resolution simulations. We show that in many cases PRISM can provide a speedup that scales with f 4 compared to multislice simulations, with a negligible loss of accuracy. We demonstrate the usefulness of this method with large-scale scanning transmission electron microscopy image simulations of a crystalline nanoparticle on an amorphous carbon substrate.

Controlling resonant tunneling in graphene via Fermi velocity engineering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lima, Jonas R. F., E-mail: jonas.lima@ufrpe.br; Pereira, Luiz Felipe C.; Bezerra, C. G.

We investigate the resonant tunneling in a single layer graphene superlattice with modulated energy gap and Fermi velocity via an effective Dirac-like Hamiltonian. We calculate the transmission coefficient with the transfer matrix method and analyze the effect of a Fermi velocity modulation on the electronic transmission, in the case of normal and oblique incidence. We find it is possible to manipulate the electronic transmission in graphene by Fermi velocity engineering, and show that it is possible to tune the transmitivity from 0 to 1. We also analyze how a Fermi velocity modulation influences the total conductance and the Fano factor.more » Our results are relevant for the development of novel graphene-based electronic devices.« less

A fast image simulation algorithm for scanning transmission electron microscopy

DOE PAGES

Ophus, Colin

2017-05-10

Image simulation for scanning transmission electron microscopy at atomic resolution for samples with realistic dimensions can require very large computation times using existing simulation algorithms. Here, we present a new algorithm named PRISM that combines features of the two most commonly used algorithms, namely the Bloch wave and multislice methods. PRISM uses a Fourier interpolation factor f that has typical values of 4-20 for atomic resolution simulations. We show that in many cases PRISM can provide a speedup that scales with f 4 compared to multislice simulations, with a negligible loss of accuracy. We demonstrate the usefulness of this methodmore » with large-scale scanning transmission electron microscopy image simulations of a crystalline nanoparticle on an amorphous carbon substrate.« less

Light modulating device

DOEpatents

Rauh, R. David; Goldner, Ronald B.

1989-01-01

In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity.

Light modulating device

DOEpatents

Rauh, R.D.; Goldner, R.B.

1989-12-26

In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity are disclosed. 1 fig.

Characterization and evaluation of miconazole salts and cocrystals for improved physicochemical properties.

PubMed

Tsutsumi, Shunichirou; Iida, Motoo; Tada, Norio; Kojima, Takashi; Ikeda, Yukihiro; Moriwaki, Toshiya; Higashi, Kenjirou; Moribe, Kunikazu; Yamamoto, Keiji

2011-12-15

Miconazole salts and cocrystals were studied to improve the physicochemical properties of miconazole. Maleate, hemifumarate, and hemisuccinate were prepared and characterized by powder X-ray diffractometry, differential scanning calorimetry, and single crystal X-ray diffractometry. The intrinsic dissolution rate and stability of each miconazole crystal form were compared to those of freebase and nitrate to evaluate the optimal crystal form. Crystal structure analysis indicated that maleate was a salt formed by proton transfer from the acid to the imidazole group of miconazole. Hemifumarate and hemisuccinate were determined to be cocrystals formed by hydrogen bonding between the acids and the base in their crystal lattices. Intrinsic dissolution tests showed that the formation of salts and cocrystals improved the dissolution rate of miconazole. Stability tests of preliminary formulations prepared with each crystal form indicated that maleate and hemifumarate were unstable at 80°C and generated a specific degraded product, i.e., a Michael adduct, between miconazole and the acids. Hemisuccinate had a superior intrinsic dissolution rate and stability, and is thus considered a promising crystal form of miconazole. Copyright © 2011 Elsevier B.V. All rights reserved.

High-resolution low-dose scanning transmission electron microscopy.

PubMed

Buban, James P; Ramasse, Quentin; Gipson, Bryant; Browning, Nigel D; Stahlberg, Henning

2010-01-01

During the past two decades instrumentation in scanning transmission electron microscopy (STEM) has pushed toward higher intensity electron probes to increase the signal-to-noise ratio of recorded images. While this is suitable for robust specimens, biological specimens require a much reduced electron dose for high-resolution imaging. We describe here protocols for low-dose STEM image recording with a conventional field-emission gun STEM, while maintaining the high-resolution capability of the instrument. Our findings show that a combination of reduced pixel dwell time and reduced gun current can achieve radiation doses comparable to low-dose TEM.

Foucault imaging by using non-dedicated transmission electron microscope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken

2012-08-27

An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

Concurrent in situ ion irradiation transmission electron microscope

DOE PAGES

Hattar, K.; Bufford, D. C.; Buller, D. L.

2014-08-29

An in situ ion irradiation transmission electron microscope has been developed and is operational at Sandia National Laboratories. This facility permits high spatial resolution, real time observation of electron transparent samples under ion irradiation, implantation, mechanical loading, corrosive environments, and combinations thereof. This includes the simultaneous implantation of low-energy gas ions (0.8–30 keV) during high-energy heavy ion irradiation (0.8–48 MeV). In addition, initial results in polycrystalline gold foils are provided to demonstrate the range of capabilities.

High yield production of long branched Au nanoparticles characterized by atomic resolution transmission electron microscopy

PubMed Central

Mayoral, Alvaro; Magen, Cesar; Jose-Yacaman, Miguel

2011-01-01

Long multi-branched gold nanoparticles have been synthesized in a very high yield through a facile synthesis combining two different capping agents. The stability of these materials with the time has been tested and their characterization have been performed by diverse advanced electron microscopy techniques, paying special attention to aberration corrected transmission electron microscopy in order to unambiguously analyze the surface structure of the branches and provide insights for the formation of stellated gold nanoparticles. PMID:22125420

Development of a high brightness ultrafast Transmission Electron Microscope based on a laser-driven cold field emission source.

PubMed

Houdellier, F; Caruso, G M; Weber, S; Kociak, M; Arbouet, A

2018-03-01

We report on the development of an ultrafast Transmission Electron Microscope based on a cold field emission source which can operate in either DC or ultrafast mode. Electron emission from a tungsten nanotip is triggered by femtosecond laser pulses which are tightly focused by optical components integrated inside a cold field emission source close to the cathode. The properties of the electron probe (brightness, angular current density, stability) are quantitatively determined. The measured brightness is the largest reported so far for UTEMs. Examples of imaging, diffraction and spectroscopy using ultrashort electron pulses are given. Finally, the potential of this instrument is illustrated by performing electron holography in the off-axis configuration using ultrashort electron pulses. Copyright © 2017 Elsevier B.V. All rights reserved.

Total-scattering pair-distribution function of organic material from powder electron diffraction data

DOE PAGES

Gorelik, Tatiana E.; Billinge, Simon J. L.; Schmidt, Martin U.; ...

2015-04-01

This paper shows for the first time that pair-distribution function analyses can be carried out on organic and organo-metallic compounds from powder electron diffraction data. Different experimental setups are demonstrated, including selected area electron diffraction (SAED) and nanodiffraction in transmission electron microscopy (TEM) or nanodiffraction in scanning transmission electron microscopy (STEM) modes. The methods were demonstrated on organo-metallic complexes (chlorinated and unchlorinated copper-phthalocyanine) and on purely organic compounds (quinacridone). The PDF curves from powder electron diffraction data, called ePDF, are in good agreement with PDF curves determined from X-ray powder data demonstrating that the problems of obtaining kinematical scattering datamore » and avoiding beam-damage of the sample are possible to resolve.« less

Hybrid electronic/optical synchronized chaos communication system.

PubMed

Toomey, J P; Kane, D M; Davidović, A; Huntington, E H

2009-04-27

A hybrid electronic/optical system for synchronizing a chaotic receiver to a chaotic transmitter has been demonstrated. The chaotic signal is generated electronically and injected, in addition to a constant bias current, to a semiconductor laser to produce an optical carrier for transmission. The optical chaotic carrier is photodetected to regenerate an electronic signal for synchronization in a matched electronic receiver The system has been successfully used for the transmission and recovery of a chaos masked message that is added to the chaotic optical carrier. Past demonstrations of synchronized chaos based, secure communication systems have used either an electronic chaotic carrier or an optical chaotic carrier (such as the chaotic output of various nonlinear laser systems). This is the first electronic/optical hybrid system to be demonstrated. We call this generation of a chaotic optical carrier by electronic injection.

eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument.

PubMed

Geelen, Daniël; Thete, Aniket; Schaff, Oliver; Kaiser, Alexander; van der Molen, Sense Jan; Tromp, Rudolf

2015-12-01

We are developing a transmission electron microscope that operates at extremely low electron energies, 0-40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. Copyright © 2015. Published by Elsevier B.V.

47 CFR 54.5 - Terms and definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; (2) The transmission of information as part of a gateway to an... information, but may include data transmission, address translation, protocol conversion, billing management...

47 CFR 54.5 - Terms and definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; and (2) The transmission of information as part of a gateway to... content of information, but may include data transmission, address translation, protocol conversion...

47 CFR 54.5 - Terms and definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; (2) The transmission of information as part of a gateway to an... information, but may include data transmission, address translation, protocol conversion, billing management...

Performance evaluation and comparison of three-terminal energy selective electron devices with different connective ways and filter configurations

NASA Astrophysics Data System (ADS)

Peng, Wanli; Zhang, Yanchao; Yang, Zhimin; Chen, Jincan

2018-02-01

Three-terminal energy selective electron (ESE) devices consisting of three electronic reservoirs connected by two energy filters and an electronic conductor with negligible resistance may work as ESE refrigerators and amplifiers. They have three possible connective ways for the electronic conductor and six electronic transmission forms. The configuration of energy filters may be described by the different transmission functions such as the rectangular and Lorentz transmission functions. The ESE devices with three connective ways can be, respectively, regarded as three equivalent hybrid systems composed of an ESE heat engine and an ESE refrigerator/heat pump. With the help of the theory of the ESE devices operated between two electronic reservoirs, the coefficients of performance and cooling rates (heat-pumping rates) of hybrid systems are directly derived. The general performance characteristics of hybrid systems are revealed. The optimal regions of these devices are determined. The performances of the devices with three connective ways of the electronic conductor and two configurations of energy filters are compared in detail. The advantages and disadvantages of each of three-terminal ESE devices are expounded. The results obtained here may provide some guidance for the optimal design and operation of three-terminal ESE devices.

Lattice damage and Al-metal precipitation in 2.5 MeV-electron-irradiated AlH3

NASA Astrophysics Data System (ADS)

Zogal, O. J.; Vajda, P.; Beuneu, F.; Pietraszko, A.

1998-04-01

AlH3 powder was bombarded with energetic electrons at 20 K and at room temperature and investigated by EPR, NMR, X-ray diffractometry, and microwave dielectric-constant measurements. The EPR spectra of the irradiated powder and of a selected single crystal cuboid of ˜ {10^{ - 1}} mm edge show a complex asymmetric line centered at g = 2.009, with a Curie-like temperature dependence, attributed to radiation-induced color centers and/or their agglomerates. At the same time, the grains, which have become shiny black after irradiation, exhibit an increase of both the real and the imaginary part of ɛ. 27Al-NMR spectra of the irradiated powder present a Knight-shifted line at 1600(50) ppm, close to the position of bulk metallic Al, and corresponding to a concentration of c(Al) ˜ {10^{ - 1}}. In addition, the main hydride line differs from that before irradiation, demonstrating an alteration of environmental symmetry. The irradiation induces also a change in shape and width of the 1H-NMR line, another indication of symmetry change in the lattice. Finally, a refined X-ray single-crystal structure analysis of the irradiated cuboid indicates a change of structure from trigonal R -3 c to R -3, with a loss of mirror symmetry for the two Al sites caused by the introduction of Al-defects in the vicinity of one of them.

Transmission electron microscopy study of Listeria monocytogenes serotype 1/2a cells exposed to sublethal heat stress and carvacrol

USDA-ARS?s Scientific Manuscript database

The objective of this study was to investigate the morphological changes that occurred in Listeria monocytogenes serotype 1/2a cells as visualized by transmission electron microscopy (TEM) after exposure to sublethal heat stress at 48°C for 60 min and in combination with lethal concentration of carv...

76 FR 2358 - Texas Eastern Transmission Company and Dominion Transmission, Inc.; Notice of Application To...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-13

... Commission encourages electronic filing of comments and has expert eFiling staff available to assist you at... Documents and Filings. An eComment is an easy method for interested persons to submit brief, text-only comments on a project; (2) You may file your comments electronically by using the eFiling feature, which is...

Heterogeneous Distribution of Carbonaceous Material in Murchison Matrix: In Situ Observations Using Energy Filtered Transmission Electron Microscopy

NASA Technical Reports Server (NTRS)

Brearley, Adrian J.

2002-01-01

Energy filtered TEM (Transmission Electron Microscopy) has been used to study the location of carbonaceous material in situ in Murchison matrix. Carbon occurs frequently as narrow rims around sulfide grains, but is rare in regions of matrix that are dominated by phyllosilicates. Additional information is contained in the original extended abstract.

In Situ Observation of Carbonaceous Material in the Matrices of CV and CM Carbonaceous Chondrites: Preliminary Results from Energy Filtered Transmission Electron Microscopy

NASA Technical Reports Server (NTRS)

Brearley, A. J.; Abreu, N. M.

2001-01-01

Energy filtered transmission electron microscopy shows that organic matter can be detected in situ in the matrices of carbonaceous chondrites at a spatial resolution of at least 1 nm. In CM chondrites, carbon is often associated with sulfide particles. Additional information is contained in the original extended abstract.

Data and clock transmission interface for the WCDA in LHAASO

NASA Astrophysics Data System (ADS)

Chu, S. P.; Zhao, L.; Jiang, Z. Y.; Ma, C.; Gao, X. S.; Yang, Y. F.; Liu, S. B.; An, Q.

2016-12-01

The Water Cherenkov Detector Array (WCDA) is one of the major components of the Large High Altitude Air Shower Observatory (LHAASO). In the WCDA, 3600 Photomultiplier Tubes (PMTs) and the Front End Electronics (FEEs) are scattered over a 90000 m2 area, while high precision time measurements (0.5 ns RMS) are required in the readout electronics. To meet this requirement, the clock has to be distributed to the FEEs with high precision. Due to the ``triggerless'' architecture, high speed data transfer is required based on the TCP/IP protocol. To simplify the readout electronics architecture and be consistent with the whole LHAASO readout electronics, the White Rabbit (WR) switches are used to transfer clock, data, and commands via a single fiber of about 400 meters. In this paper, a prototype of data and clock transmission interface for LHAASO WCDA is developed. The performance tests are conducted and the results indicate that the clock synchronization precision of the data and clock transmission is better than 50 ps. The data transmission throughput can reach 400 Mbps for one FEE board and 180 Mbps for 4 FEE boards sharing one up link port in WR switch, which is better than the requirement of the LHAASO WCDA.

Effect of a gap opening on the conductance of graphene with magnetic barrier structures

NASA Astrophysics Data System (ADS)

Esmailpour, Mohammad

2018-04-01

In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.

The importance of transmission electron microscopy analysis of spermatozoa: Diagnostic applications and basic research.

PubMed

Moretti, Elena; Sutera, Gaetano; Collodel, Giulia

2016-06-01

This review is aimed at discussing the role of ultrastructural studies on human spermatozoa and evaluating transmission electron microscopy as a diagnostic tool that can complete andrology protocols. It is clear that morphological sperm defects may explain decreased fertilizing potential and acquire particular value in the field of male infertility. Electron microscopy is the best method to identify systematic or monomorphic and non-systematic or polymorphic sperm defects. The systematic defects are characterized by a particular anomaly that affects the vast majority of spermatozoa in a semen sample, whereas a heterogeneous combination of head and tail defects found in variable percentages are typically non-systematic or polymorphic sperm defects. A correct diagnosis of these specific sperm alterations is important for choosing the male infertility's therapy and for deciding to turn to assisted reproduction techniques. Transmission electron microscopy (TEM) also represents a valuable method to explore the in vitro effects of different compounds (for example drugs with potential spermicidal activity) on the morphology of human spermatozoa. Finally, TEM used in combination with immunohistochemical techniques, integrates structural and functional aspects that provide a wide horizon in the understanding of sperm physiology and pathology. transmission electron microscopy: TEM; World Health Organization: WHO; light microscopy: LM; motile sperm organelle morphology examination: MSOME; intracytoplasmic morphologically selected sperm injection: IMSI; intracytoplasmic sperm injection: ICSI; dysplasia of fibrous sheath: DFS; primary ciliary dyskinesia: PCD; outer dense fibers: ODF; assisted reproduction technologies: ART; scanning electron microscopy: SEM; polyvinylpirrolidone: PVP; tert-butylhydroperoxide: TBHP.

In-situ integrity control of frozen-hydrated, vitreous lamellas prepared by the cryo-focused ion beam-scanning electron microscope.

PubMed

de Winter, D A Matthijs; Mesman, Rob J; Hayles, Michael F; Schneijdenberg, Chris T W M; Mathisen, Cliff; Post, Jan A

2013-07-01

Recently a number of new approaches have been presented with the intention to produce electron beam transparent cryo-sections (lamellas in FIB-SEM terminology) from hydrated vitreously frozen cryo samples with a Focused Ion Beam (FIB) system, suitable for cryo-Transmission Electron Microscopy (cryo-TEM). As the workflow is still challenging and time consuming, it is important to be able to determine the integrity and suitability (cells vs. no cells; vitreous vs. crystalline) of the lamellas. Here we present an in situ method that tests both conditions by using the cryo-Scanning Electron Microscope (cryo-SEM) in transmission mode (TSEM; Transmission Scanning Electron Microscope) once the FIB-made lamella is ready. Cryo-TSEM imaging of unstained cells yields strong contrast, enabling direct imaging of material present in the lamellas. In addition, orientation contrast is shown to be suitable for distinguishing crystalline lamellas from vitreous lamellas. Tilting the stage a few degrees results in changes of contrast between ice grains as a function of the tilt angle, whereas the contrast of areas with vitreous ice remains unchanged as a function of the tilt angle. This orientation contrast has subsequently been validated by cryo-Electron BackScattered Diffraction (EBSD) in transmission mode. Integration of the presented method is discussed and the role it can play in future developments for a new and innovative all-in-one cryo-FIB-SEM life sciences instrument. Copyright © 2013 Elsevier Inc. All rights reserved.

Effect of hydrodynamics and surface roughness on the electrochemical behaviour of carbon steel in CSG produced water

NASA Astrophysics Data System (ADS)

Eyu, Gaius Debi; Will, Geoffrey; Dekkers, Willem; MacLeod, Jennifer

2015-12-01

The influence of fluid flow, surface roughness and immersion time on the electrochemical behaviour of carbon steel in coal seam gas produced water under static and hydrodynamic conditions has been studied. The disc electrode surface morphology before and after the corrosion test was characterized using scanning electron microscopy (SEM). The corrosion product was examined using X-ray photoelectron spectroscopy (XPS) and X-ray diffractometry (XRD).The results show that the anodic current density increased with increasing surface roughness and consequently a decrease in corrosion surface resistance. Under dynamic flow conditions, the corrosion rate increased with increasing rotating speed due to the high mass transfer coefficient and formation of non-protective akaganeite β-FeO(OH) and goethite α-FeO(OH) corrosion scale at the electrode surface. The corrosion rate was lowest at 0 rpm. The corrosion rate decreased in both static and dynamic conditions with increasing immersion time. The decrease in corrosion rate is attributed to the deposition of corrosion products on the electrode surface. SEM results revealed that the rougher surface exhibited a great tendency toward pitting corrosion.

Electrochemical properties of monolithic nickel sulfide electrodes for use in sodium batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Go, Dae-Yeon; Park, Jinsoo, E-mail: jsp@ikw.ac.kr; Noh, Pan-Jin

2014-10-15

Highlights: • We succeeded in preparing monolithic Ni{sub 3}S{sub 2} integrated electrode through the sulfuration. • The sulfuration is a facile and useful method to synthesize metal sulfides with nanostructure. • As-prepared monolithic Ni{sub 3}S{sub 2} electrodes showed very stable and cycle performance over charge/discharge cycling. - Abstract: Monolithic nickel sulfide electrodes were prepared using a facile synthesis method, sulfuration and annealing. As-prepared Ni{sub 3}S{sub 2} electrodes were characterized by X-ray diffractometry and field emission scanning electron microscopy. Thermal stability was determined by thermal gravimetric analysis and differential scanning calorimetry. Electrochemical properties were measured by galvanostatic charge and discharge cyclingmore » for Na-ion batteries. Three kinds of Ni{sub 3}S{sub 2} electrodes were prepared by varying the sulfuration time (5, 15 and 25 min). The electrochemical results indicated that the capacities increased with an increase in sulfuration time and the cycle performance was stable as a result of monolithic integration of nanostructured Ni{sub 3}S{sub 2} on Ni plates, leading to low interfacial resistance.« less

Capacity fading of LiAlyNi1-x-yCoxO2 cathode for lithium-ion batteries during accelerated calendar and cycle life tests (effect of depth of discharge in charge-discharge cycling on the suppression of the micro-crack generation of LiAlyNi1-x-yCoxO2 particle)

NASA Astrophysics Data System (ADS)

Watanabe, Shoichiro; Kinoshita, Masahiro; Hosokawa, Takashi; Morigaki, Kenichi; Nakura, Kensuke

2014-08-01

Cycle performance of a LiAl0.10Ni0.76Co0.14O2 (NCA) cathode/graphite cell closely depended on the range of depth of discharge in charge-discharge processes (ΔDOD). When ΔDOD was 10-70%, cycle performance at 25 °C was maintained even at 60 °C. Deterioration phenomena were analyzed by electrochemical method, X-ray photoelectron spectroscopy (XPS), X-ray diffractometry (XRD), and micro-cracks in NCA particles were analyzed with cross-sectional views by scanning electron microscopy (SEM). Many micro-cracks were observed only after a 0-100% DOD region cycle test. Cycle tests in several restricted ΔDOD conditions showed that the deterioration was closely related to not the upper and lower limits of DOD or operation voltage but the width of ΔDOD.

Fundamentals of Passive Oxidation In SiC and Si3N4

NASA Technical Reports Server (NTRS)

Thomas-Ogbuji, Linus U.

1998-01-01

The very slow oxidation kinetics of silicon carbide and silicon nitride, which derive from their adherent and passivating oxide films, has been explored at length in a broad series of studies utilizing thermogravimetric analysis, electron and optical micrography, energy dispersive spectrometry, x-ray diffractometry, micro-analytical depth profiling, etc. Some interesting microstructural phenomena accompanying the process of oxidation in the two materials will be presented. In Si3N4 the oxide is stratified, with an SiO2 topscale (which is relatively impervious to O2)underlain by a coherent subscale of silicon oxynitride which is even less permeable to O2- Such "defence in depth" endows Si3N4 with what is perhaps the highest oxidation resistance of any material, and results in a unique set of oxidation processes. In SiC the oxidation reactions are much simpler, yet new issues still emerge; for instance, studies involving controlled devitrification of the amorphous silica scale confirmed that the oxidation rate of SiC drops by more than an order of magnitude when the oxide scale fully crystallizes.

Synthesis of Lithium Metal Oxide Nanoparticles by Induction Thermal Plasmas.

PubMed

Tanaka, Manabu; Kageyama, Takuya; Sone, Hirotaka; Yoshida, Shuhei; Okamoto, Daisuke; Watanabe, Takayuki

2016-04-06

Lithium metal oxide nanoparticles were synthesized by induction thermal plasma. Four different systems-Li-Mn, Li-Cr, Li-Co, and Li-Ni-were compared to understand formation mechanism of Li-Me oxide nanoparticles in thermal plasma process. Analyses of X-ray diffractometry and electron microscopy showed that Li-Me oxide nanoparticles were successfully synthesized in Li-Mn, Li-Cr, and Li-Co systems. Spinel structured LiMn₂O₄ with truncated octahedral shape was formed. Layer structured LiCrO₂ or LiCoO₂ nanoparticles with polyhedral shapes were also synthesized in Li-Cr or Li-Co systems. By contrast, Li-Ni oxide nanoparticles were not synthesized in the Li-Ni system. Nucleation temperatures of each metal in the considered system were evaluated. The relationship between the nucleation temperature and melting and boiling points suggests that the melting points of metal oxides have a strong influence on the formation of lithium metal oxide nanoparticles. A lower melting temperature leads to a longer reaction time, resulting in a higher fraction of the lithium metal oxide nanoparticles in the prepared nanoparticles.

RADIOACTIVITY DOSAGE OF ORNAMENTAL GRANITIC ROCKS BASED ON CHEMICAL, MINERALOGICAL AND LITHOLOGICAL DATA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salas, H.T.; Nalini, H.A. Jr.; Mendes, J.C.

2004-10-03

One hundred samples of granitic rock were collected from granite traders in Belo Horizonte. Autoradiography, optical microscopy, diffractometry, and chemical analysis (X-ray spectrometry, X-ray fluorescence, neutron activation, gravimetry and electron probe microanalysis) were used to determine the mineral assemblages and lithotypes. Autoradiographic results for several samples showed the presence of monazite, allanite and zircon. Chemical analysis revealed concentrations of uranium of {le} 30ppm, and thorium {le} 130ppm. Higher concentrations generally correlated with high concentrations of light rare earths in silica-rich rocks of granitic composition. Calculations were made of radioactive doses for floor tiles in a standard room for samples withmore » total concentration of uranium and thorium greater than 60ppm. On the basis of calculations of {sup 232}Th, {sup 40}K and {sup 226}Ra from Th, K and U analysis, the doses calculated were between 0.11 and 0.34 mSv/year, which are much lower than the acceptable international exposure standard of 1.0 mSv/year.« less

Synthesis and Characterization of Cobalt Substituted Zinc Ferrite Nanoparticles by Microwave Combustion Method.

PubMed

Sundararajan, M; Kennedy, L John; Vijaya, J Judith

2015-09-01

Pure and cobalt doped zinc ferrites were prepared by microwave combustion method using L-arginine as a fuel. The prepared samples were characterized by various instrumental techniques such as X-ray powder diffractometry, high resolution scanning electron microscopy (HR-SEM), energy dispersive X-ray analysis, Fourier transformed infrared (FT-IR) spectroscopy, photoluminescence spectroscopy and UV-Visible diffuse reflectance spectroscopy. Vibrating sample magnetometry at room temperature was recorded to study the magnetic behavior of the samples. X-ray analysis confirmed the formation of zinc ferrites normal spinel-type structure with an average crystallite sizes in the range, 25.69 nm to 35.68 nm. The lattice parameters decreased as cobalt fraction was increased. The HR-SEM images showed nanoparticles are agglomerated. The estimated band gap energy value was found to decrease with an increase in cobalt content (1.87 to 1.62 eV). Broad visible emissions are observed in the photoluminescence spectra. A gradual increase in the coercivity and saturation magnetization (M(s)) were noted at relatively higher cobalt doping fractions.

World's Largest Gold Crystal Studied at Los Alamos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vogel, Sven; Nakotte, Heinz

2014-04-03

When geologist John Rakovan needed better tools to investigate whether a dazzling 217.78-gram piece of gold was in fact the world's largest single-crystal specimen - a distinguishing factor that would not only drastically increase its market value but also provide a unique research opportunity - he traveled to Los Alamos National Laboratory's Lujan Neutron Scattering Center to peer deep inside the mineral using neutron diffractometry. Neutrons, different from other probes such as X-rays and electrons, are able to penetrate many centimeters deep into most materials. Revealing the inner structure of a crystal without destroying the sample - imperative, as thismore » one is worth an estimated $1.5 million - would allow Rakovan and Lujan Center collaborators Sven Vogel and Heinz Nakotte to prove that this exquisite nugget, which seemed almost too perfect and too big to be real, was a single crystal and hence a creation of nature. Its owner, who lives in the United States, provided the samples to Rakovan to assess the crystallinity of four specimens, all of which had been found decades ago in Venezuela.« less

Preparation and characterization of non-crystalline granular starch and corresponding carboxymethyl starch.

PubMed

Zhang, Bao; Li, Xiaomin; Xie, Qiutao; Tao, Han; Wang, Wu; Chen, Han-Qing

2017-10-01

Native corn starch slurried in 50% ethanol solution was treated at 60°C, 70°C, 80°C, and 85°C, respectively. The resultant starches were investigated by polarized microscopy, scanning electron microscopy (SEM), differential scanning calorimetry (DSC), and X-ray diffractometry (XRD). The Maltese cross of ethanol-heating treated starch gradually weaken with increasing temperature and completely disappeared at 85°C. SEM data indicated the treated granular exhibited a rougher surface with more pores and grooves than native starch granular, but the shape of the treated starch was still intact. DSC and XRD data confirmed ethanol-heating treated starch changed from crystalline to non-crystalline structure at 85°C. The highest degree of substitution (DS) and corresponding reaction efficiency (RE) for the carboxymethylation of native starch were 0.66 and 36.7%, respectively, while the corresponding DS and RE for non-crystalline granular starches increased by 0.29 and 16.1% at the same reaction condition, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Nitriding of titanium and titanium: 8 percent aluminum, 1 percent molybdenum, 1 percent vanadium alloy with an ion-beam source

NASA Technical Reports Server (NTRS)

Gill, A.

1983-01-01

Titanium and Ti-8Al-1Mo-1V alloy were nitrided with an ion-beam source of nitrogen or argon and nitrogen at a total pressure of 2 x 10 to the minus 4th power to 10 x 10 to the minus 4th power torr. The treated surface was characterized by surface profilometry, X-ray diffractometry, Auger electron spectroscopy and microhardness measurements. The tetragonal Ti2N phase formed in pure titanium and Ti-8Al-1Mo-1V alloy with traces of AlN in the alloy. Two opposite processes competed during the ion-beam-nitriding process: (1) formation of nitrides in the surface layer and (2) sputtering of the nitrided layers by the ion beam. The highest surface hardnesses, about 500 kg/sq mm in titanium and 800 kg/sq mm in Ti-8Al-1Mo-1V, were obtained by ion nitriding with an ion beam of pure nitrogen at 4.2 x 10 to the minus 4th power torr at a beam voltage of 1000 V.

World's Largest Gold Crystal Studied at Los Alamos

ScienceCinema

Vogel, Sven; Nakotte, Heinz

2018-02-07

When geologist John Rakovan needed better tools to investigate whether a dazzling 217.78-gram piece of gold was in fact the world's largest single-crystal specimen - a distinguishing factor that would not only drastically increase its market value but also provide a unique research opportunity - he traveled to Los Alamos National Laboratory's Lujan Neutron Scattering Center to peer deep inside the mineral using neutron diffractometry. Neutrons, different from other probes such as X-rays and electrons, are able to penetrate many centimeters deep into most materials. Revealing the inner structure of a crystal without destroying the sample - imperative, as this one is worth an estimated $1.5 million - would allow Rakovan and Lujan Center collaborators Sven Vogel and Heinz Nakotte to prove that this exquisite nugget, which seemed almost too perfect and too big to be real, was a single crystal and hence a creation of nature. Its owner, who lives in the United States, provided the samples to Rakovan to assess the crystallinity of four specimens, all of which had been found decades ago in Venezuela.

Preparation, characterization and in vitro evaluation of solid dispersions containing docetaxel.

PubMed

Chen, Jie; Qiu, Liyan; Hu, Minxin; Jin, Yi; Han, Jieru

2008-06-01

Solid dispersions using water-soluble carriers were studied for improving the dissolution of docetaxel, a poorly soluble compound. In order to obtain the most optimized formulation, we prepared many solid dispersions with different carriers, different solvents, or at a series of drug-to-carrier ratios, and compared their dissolution. The accumulative dissolution of docetaxel from poloxamer 188 was more excellent than that from PVP(k30) and glyceryl monostearate, and the dissolution of docetaxel from solid dispersion was markedly higher than that of pure docetaxel; meanwhile the increased dissolution was partly dependent on the ratios of docetaxel and poloxamer 188. The ethanol used to prepare solid dispersion is of more significant effect on the dissolution of docetaxel than that of acetone. The docetaxel/poloxamer 188 system was characterized by differential scanning calorimetry (DSC), X-ray diffractometry (XRD), and environmental scanning electron microscope (ESEM). The results of DSC, XRD, and ESEM analyses of docetaxel/poloxamer 188 system showed that there are intermolecular interactions between docetaxel and poloxamer, and the crystallinity of docetaxel disappeared. These results show that solid dispersion is a promising approach of developing docetaxel drug formulates.

Characterization and electrochemical properties of Ni(Si)/Ni5Si2 multiphase coatings prepared by HVOF spraying

NASA Astrophysics Data System (ADS)

Verdian, M. M.; Raeissi, K.; Salehi, M.

2012-11-01

Ni(Si)/Ni5Si2 powders were produced by mechanical alloying (MA) of Ni-25 at.% Si powder mixture. Then, the as-milled powders were sprayed onto copper substrate using high velocity oxy-fuel (HVOF) process. The phase composition and microstructure of the coatings were examined by X-ray diffractometry and scanning electron microscopy. Polarization tests and electrochemical impedance spectroscopy (EIS) measurements were also employed to study corrosion performance of the coatings in 3.5% NaCl solution. The results showed that although single phase Ni3Si was formed during annealing of Ni(Si)/Ni5Si2 powders, but, only Ni(Si) and Ni5Si2 are present in HVOF coatings and no new phase has been formed during spraying. The coatings had microhardness up to 746 HV0.05. Further investigations showed the corrosion performance of multiphase coatings in 3.5% NaCl solution was better than that of copper substrate. The phase transitions during MA, HVOF and annealing processes were discussed in association with Ni-Si phase diagram and nature of each process.

Review of Research Work on Ti-BASED Composite Coatings

NASA Astrophysics Data System (ADS)

Gabbitas, Brian; Salman, Asma; Zhang, Deliang; Cao, Peng

The service life of industrial components is limited predominantly by Chemical corrosion/mechanical wear. The project is concerned with the investigation of the capability of Ti(Al,O)/Al2O3 coatings to improve the service life of tool steel (H13) used for dies in aluminium high pressure die casting. This paper gives a general review on the research work conducted at the University of Waikato on producing and evaluating the titanium/alumina based composite coatings. The powder feedstocks for making the composite coatings were produced by high energy mechanical milling of a mixture of Al and TiO2 powders in two different molar ratios followed by a thermal reaction process. The feedstocks were then thermally sprayed using a high velocity air-fuel (HVAF) technique on H13 steel substrates to produce a Ti(Al,O)/Al2O3 composite coatings. The performance of the coating was assessed in terms of thermal shock resistance and reaction kinetics with molten aluminium. The composite powders and coatings were characterized using scanning electron microscopy (SEM), optical microscopy and X-ray diffractometry (XRD).

Novel Solid Encapsulation of Ethylene Gas Using Amorphous α-Cyclodextrin and the Release Characteristics.

PubMed

Ho, Binh T; Bhandari, Bhesh R

2016-05-04

This research investigated the encapsulation of ethylene gas into amorphous α-cyclodextrins (α-CDs) at low (LM) and high (HM) moisture contents at 1.0-1.5 MPa for 24-120 h and its controlled release characteristics at 11.2-52.9% relative humidity (RH) for 1-168 h. The inclusion complexes (ICs) were characterized using X-ray diffractometry (XRD), nuclear magnetic resonance spectroscopy (CP-MAS (13)C NMR), and scanning electron microscopy (SEM). Ethylene concentrations in the ICs were from 0.45 to 0.87 mol of ethylene/mol CD and from 0.42 to 0.54 mol of ethylene/mol CD for LM and HM α-CDs, respectively. Ethylene gas released from the encapsulated powder at higher rates with increasing RH. An analysis of release kinetics using Avrami's equation showed that the LM and HM amorphous α-CDs were not associated with significant differences in release constant k and parameter n for any given RH condition. NMR spectra showed the presence of the characteristic carbon-carbon double bond of ethylene gas in the encapsulated α-CD powder.

Preparation and Optimization of Amorphous Ursodeoxycholic Acid Nano-suspensions by Nanoprecipitation based on Acid-base Neutralization for Enhanced Dissolution.

PubMed

Xie, Yike; Chen, Zhongjian; Su, Rui; Li, Ye; Qi, Jianping; Wu, Wei; Lu, Yi

2017-01-01

Ursodeoxycholic acid, usually used to dissolve cholesterol gallstones in clinic, is a typical hydrophobic drug with poor oral bioavailability due to dissolution rate-limited performance. The objective of this study was to increase the dissolution of ursodeoxycholic acid by amorphous nanosuspensions. Nanoprecipitation based on acid-base neutralization was used to prepare the nanosuspensions with central composite design to optimize the formula. The nanosuspensions were characterized by particle size, morphology, crystallology and dissolution. The ursodeoxycholic acid nanosuspensions showed mean particle size around 380 nm with polydispersion index value about 0.25. Scanning electron microscope observed high coverage of HPMC-E50 onto the surface of the nanosuspensions. Differential scanning calorimetry and powder X-ray diffractometry revealed amorphous structure of the ursodeoxycholic acid nanosuspensions. A significant increase of dissolution in acidic media was achieved by the amorphous nanosuspensions compared with the physical mixture. It can be predicted that the amorphous nanosuspensions show great potential in improving the oral bioavailability of ursodeoxycholic acid. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Photocatalytic degradation of an azo textile dye (C.I. Reactive Red 195 (3BF)) in aqueous solution over copper cobaltite nanocomposite coated on glass by Doctor Blade method

NASA Astrophysics Data System (ADS)

Habibi, Mohammad Hossein; Rezvani, Zoya

2015-08-01

The degradation of C.I. Reactive Red 195 (3BF) in aqueous solution using copper cobaltite nanocomposite coated on glass by Doctor Blade method was studied. Structural, optical and morphological properties of nanocomposite coatings were characterized by X-ray powder diffractometry (XRD), diffuse reflectance spectroscopy (DRS) and field emission scanning electron microscopy (FESEM). The nanoparticles exhibit a particle size of 31 nm, showing a good nanoscale crystalline morphology. The photocatalytic activity of copper cobaltite nanocomposite coated on glass was studied by performing the photocatalytic degradation of 3BF at different irradiation time. The effect of irradiation time on the degradation of 3BF was studied and the results showed that more than 85% of the 3BF was degraded in 45 min of irradiation. The pseudo-first-order kinetic models were used and the rate constants were evaluated with pseudo first order rate constants of 4.10 × 10-2 min-1. The main advantage of the photocatalyst coated on glass overcomes the difficulties in separation and recycle of photocatalyst suspensions.

Effect of contact area on electron transport through graphene-metal interface.

PubMed

Liu, Hongmei; Kondo, Hisashi; Ohno, Takahisa

2013-08-21

We perform first-principles investigations of electron transport in armchair graphene nanoribbons adsorbed on Cu(111) and Ni(111) surfaces with various contact areas. We find that the contact area between metals and graphene has different influences on the conductance. The Cu-graphene system shows an increase in differential conductance for more contact area at a low bias voltage, primarily originating from the shift of transmission peaks relative to the Fermi energy. As the bias increases, there is an irregular change of conductance, including a weak negative differential conductance for more contact area. In contrast, the conductance of the Ni-graphene junction is monotonically enhanced with increasing overlap area. The minority spin which shows a broad transmission is responsible for the conductance increase of Ni-graphene. These behaviors can be attributed to different mechanisms of the interfacial electron transport: Charge transfer between graphene and Cu largely dominates the transmission enhancement of Cu-graphene, whereas hybridization between graphene and Ni states plays a more important role in the transmission enhancement of Ni-graphene. The different behaviors of transmission increase correlate with not only the strength of the graphene-metal interaction but also the location of metal d states.

Writing silica structures in liquid with scanning transmission electron microscopy.

PubMed

van de Put, Marcel W P; Carcouët, Camille C M C; Bomans, Paul H H; Friedrich, Heiner; de Jonge, Niels; Sommerdijk, Nico A J M

2015-02-04

Silica nanoparticles are imaged in solution with scanning transmission electron microscopy (STEM) using a liquid cell with silicon nitride (SiN) membrane windows. The STEM images reveal that silica structures are deposited in well-defined patches on the upper SiN membranes upon electron beam irradiation. The thickness of the deposits is linear with the applied electron dose. Scanning electron microscopy (SEM) and atomic force microscopy (AFM) demonstrate that the deposited patches are a result of the merging of the original 20 nm-diameter nanoparticles, and that the related surface roughness depends on the electron dose rate used. Using this approach, sub-micrometer scale structures are written on the SiN in liquid by controlling the electron exposure as function of the lateral position. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fabrication and In Situ Transmission Electron Microscope Characterization of Free-Standing Graphene Nanoribbon Devices.

PubMed

Wang, Qing; Kitaura, Ryo; Suzuki, Shoji; Miyauchi, Yuhei; Matsuda, Kazunari; Yamamoto, Yuta; Arai, Shigeo; Shinohara, Hisanori

2016-01-26

Edge-dependent electronic properties of graphene nanoribbons (GNRs) have attracted intense interests. To fully understand the electronic properties of GNRs, the combination of precise structural characterization and electronic property measurement is essential. For this purpose, two experimental techniques using free-standing GNR devices have been developed, which leads to the simultaneous characterization of electronic properties and structures of GNRs. Free-standing graphene has been sculpted by a focused electron beam in transmission electron microscope (TEM) and then purified and narrowed by Joule heating down to several nanometer width. Structure-dependent electronic properties are observed in TEM, and significant increase in sheet resistance and semiconducting behavior become more salient as the width of GNR decreases. The narrowest GNR width we obtained with the present method is about 1.6 nm with a large transport gap of 400 meV.

Highly Uniform Atomic Layer-Deposited MoS2@3D-Ni-Foam: A Novel Approach To Prepare an Electrode for Supercapacitors.

PubMed

Nandi, Dip K; Sahoo, Sumanta; Sinha, Soumyadeep; Yeo, Seungmin; Kim, Hyungjun; Bulakhe, Ravindra N; Heo, Jaeyeong; Shim, Jae-Jin; Kim, Soo-Hyun

2017-11-22

This article takes an effort to establish the potential of atomic layer deposition (ALD) technique toward the field of supercapacitors by preparing molybdenum disulfide (MoS 2 ) as its electrode. While molybdenum hexacarbonyl [Mo(CO) 6 ] serves as a novel precursor toward the low-temperature synthesis of ALD-grown MoS 2 , H 2 S plasma helps to deposit its polycrystalline phase at 200 °C. Several ex situ characterizations such as X-ray diffractometry (XRD), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), and so forth are performed in detail to study the as-grown MoS 2 film on a Si/SiO 2 substrate. While stoichiometric MoS 2 with very negligible amount of C and O impurities was evident from XPS, the XRD and high-resolution transmission electron microscopy analyses confirmed the (002)-oriented polycrystalline h-MoS 2 phase of the as-grown film. A comparative study of ALD-grown MoS 2 as a supercapacitor electrode on 2-dimensional stainless steel and on 3-dimensional (3D) Ni-foam substrates clearly reflects the advantage and the potential of ALD for growing a uniform and conformal electrode material on a 3D-scaffold layer. Cyclic voltammetry measurements showed both double-layer capacitance and capacitance contributed by the faradic reaction at the MoS 2 electrode surface. The optimum number of ALD cycles was also found out for achieving maximum capacitance for such a MoS 2 @3D-Ni-foam electrode. A record high areal capacitance of 3400 mF/cm 2 was achieved for MoS 2 @3D-Ni-foam grown by 400 ALD cycles at a current density of 3 mA/cm 2 . Moreover, the ALD-grown MoS 2 @3D-Ni-foam composite also retains high areal capacitance, even up to a high current density of 50 mA/cm 2 . Finally, this directly grown MoS 2 electrode on 3D-Ni-foam by ALD shows high cyclic stability (>80%) over 4500 charge-discharge cycles which must invoke the research community to further explore the potential of ALD for such applications.

Note on in situ (scanning) transmission electron microscopy study of liquid samples.

PubMed

Jiang, Nan

2017-08-01

Liquid cell (scanning) transmission electron microscopy has been developed rapidly, using amorphous SiN x membranes as electron transparent windows. The current interpretations of electron beam effects are mainly based on radiolytic processes. In this note, additional effects of the electric field due to electron-beam irradiation are discussed. The electric field can be produced by the charge accumulation due to the emission of secondary and Auger electrons. Besides various beam-induced phenomena, such as nanoparticle precipitation and gas bubble formation and motion, two other effects need to be considered; one is the change of Gibbs free energy of nucleation and the other is the violation of Brownian motion due to ion drifting driven by the electric field. Copyright © 2017 Elsevier B.V. All rights reserved.

Hartmann characterization of the PEEM-3 aberration-corrected X-ray photoemission electron microscope.

PubMed

Scholl, A; Marcus, M A; Doran, A; Nasiatka, J R; Young, A T; MacDowell, A A; Streubel, R; Kent, N; Feng, J; Wan, W; Padmore, H A

2018-05-01

Aberration correction by an electron mirror dramatically improves the spatial resolution and transmission of photoemission electron microscopes. We will review the performance of the recently installed aberration corrector of the X-ray Photoemission Electron Microscope PEEM-3 and show a large improvement in the efficiency of the electron optics. Hartmann testing is introduced as a quantitative method to measure the geometrical aberrations of a cathode lens electron microscope. We find that aberration correction leads to an order of magnitude reduction of the spherical aberrations, suggesting that a spatial resolution of below 100 nm is possible at 100% transmission of the optics when using x-rays. We demonstrate this improved performance by imaging test patterns employing element and magnetic contrast. Published by Elsevier B.V.

Room temperature chemical synthesis of lead selenide thin films with preferred orientation

NASA Astrophysics Data System (ADS)

Kale, R. B.; Sartale, S. D.; Ganesan, V.; Lokhande, C. D.; Lin, Yi-Feng; Lu, Shih-Yuan

2006-11-01

Room temperature chemical synthesis of PbSe thin films was carried out from aqueous ammoniacal solution using Pb(CH3COO)2 as Pb2+ and Na2SeSO3 as Se2- ion sources. The films were characterized by a various techniques including, X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HR-TEM), selected area electron diffraction (SAED), Fast Fourier transform (FFT) and UV-vis-NIR techniques. The study revealed that the PbSe thin film consists of preferentially oriented nanocubes with energy band gap of 0.5 eV.

Imaging of high-angle annular dark-field scanning transmission electron microscopy and observations of GaN-based violet laser diodes.

PubMed

Shiojiri, M; Saijo, H

2006-09-01

The first part of this paper is devoted to physics, to explain high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) imaging and to interpret why HAADF-STEM imaging is incoherent, instructing a strict definition of interference and coherence of electron waves. Next, we present our recent investigations of InGaN/GaN multiple quantum wells and AlGaN/GaN strained-layer superlattice claddings in GaN-based violet laser diodes, which have been performed by HAADF-STEM and high-resolution field-emission gun scanning electron microscopy.

Quantitative Cryo-Scanning Transmission Electron Microscopy of Biological Materials.

PubMed

Elbaum, Michael

2018-05-11

Electron tomography provides a detailed view into the 3D structure of biological cells and tissues. Physical fixation by vitrification of the aqueous medium provides the most faithful preservation of biological specimens in the native, fully hydrated state. Cryo-microscopy is challenging, however, because of the sensitivity to electron irradiation and due to the weak electron scattering of organic material. Tomography is even more challenging because of the dependence on multiple exposures of the same area. Tomographic imaging is typically performed in wide-field transmission electron microscopy (TEM) mode with phase contrast generated by defocus. Scanning transmission electron microscopy (STEM) is an alternative mode based on detection of scattering from a focused probe beam, without imaging optics following the specimen. While careful configuration of the illumination and detectors is required to generate useful contrast, STEM circumvents the major restrictions of phase contrast TEM to very thin specimens and provides a signal that is more simply interpreted in terms of local composition and density. STEM has gained popularity in recent years for materials science. The extension of STEM to cryomicroscopy and tomography of cells and macromolecules is summarized herein. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

X-Ray Diffraction of Intermetallic Compounds: A Physical Chemistry Laboratory Experiment

ERIC Educational Resources Information Center

Varberg, Thomas D.; Skakuj, Kacper

2015-01-01

Here we describe an experiment for the undergraduate physical chemistry laboratory in which students synthesize the intermetallic compounds AlNi and AlNi3 and study them by X-ray diffractometry. The compounds are synthesized in a simple one-step reaction occurring in the solid state. Powder X-ray diffractograms are recorded for the two compounds…

Liquid scanning transmission electron microscopy: imaging protein complexes in their native environment in whole eukaryotic cells.

PubMed

Peckys, Diana B; de Jonge, Niels

2014-04-01

Scanning transmission electron microscopy (STEM) of specimens in liquid, so-called Liquid STEM, is capable of imaging the individual subunits of macromolecular complexes in whole eukaryotic cells in liquid. This paper discusses this new microscopy modality within the context of state-of-the-art microscopy of cells. The principle of operation and equations for the resolution are described. The obtained images are different from those acquired with standard transmission electron microscopy showing the cellular ultrastructure. Instead, contrast is obtained on specific labels. Images can be recorded in two ways, either via STEM at 200 keV electron beam energy using a microfluidic chamber enclosing the cells, or via environmental scanning electron microscopy at 30 keV of cells in a wet environment. The first series of experiments involved the epidermal growth factor receptor labeled with gold nanoparticles. The labels were imaged in whole fixed cells with nanometer resolution. Since the cells can be kept alive in the microfluidic chamber, it is also feasible to detect the labels in unfixed, live cells. The rapid sample preparation and imaging allows studies of multiple whole cells.

Correlative fluorescence microscopy and scanning transmission electron microscopy of quantum-dot-labeled proteins in whole cells in liquid.

PubMed

Dukes, Madeline J; Peckys, Diana B; de Jonge, Niels

2010-07-27

Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7x12 nm were visible in a 5 microm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs.

Correlative Fluorescence Microscopy and Scanning Transmission Electron Microscopy of Quantum Dot Labeled Proteins in Whole Cells in Liquid

PubMed Central

Dukes, Madeline J.; Peckys, Diana B.; de Jonge, Niels

2010-01-01

Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7 × 12 nm were visible in a 5 μm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs. PMID:20550177

Using size-selected gold clusters on graphene oxide films to aid cryo-transmission electron tomography alignment

PubMed Central

Arkill, Kenton P.; Mantell, Judith M.; Plant, Simon R.; Verkade, Paul; Palmer, Richard E.

2015-01-01

A three-dimensional reconstruction of a nano-scale aqueous object can be achieved by taking a series of transmission electron micrographs tilted at different angles in vitreous ice: cryo-Transmission Electron Tomography. Presented here is a novel method of fine alignment for the tilt series. Size-selected gold clusters of ~2.7 nm (Au561 ± 14), ~3.2 nm (Au923 ± 22), and ~4.3 nm (Au2057 ± 45) in diameter were deposited onto separate graphene oxide films overlaying holes on amorphous carbon grids. After plunge freezing and subsequent transfer to cryo-Transmission Electron Tomography, the resulting tomograms have excellent (de-)focus and alignment properties during automatic acquisition. Fine alignment is accurate when the evenly distributed 3.2 nm gold particles are used as fiducial markers, demonstrated with a reconstruction of a tobacco mosaic virus. Using a graphene oxide film means the fiducial markers are not interfering with the ice bound sample and that automated collection is consistent. The use of pre-deposited size-selected clusters means there is no aggregation and a user defined concentration. The size-selected clusters are mono-dispersed and can be produced in a wide size range including 2–5 nm in diameter. The use of size-selected clusters on a graphene oxide films represents a significant technical advance for 3D cryo-electron microscopy. PMID:25783049

Scanning electron microscopy of hepatic ultrastructure: secondary, backscattered, and transmitted electron imaging.

PubMed

Miyai, K; Abraham, J L; Linthicum, D S; Wagner, R M

1976-10-01

Several methods of tissue preparation and different modes of operation of the scanning electron microscope were used to study the ultrastructure of rat liver. Rat livers were perfusion fixed with buffered 2 per cent paraformaldehyde or a mixture of 1.5 per cent paraformaldehyde and 1 per cent glutaraldehyde and processed as follows. Tissue blocks were postfixed in buffered 2 per cent osmium tetroxide followed sequentially by the ligand-mediated osmium binding technique, dehydration and cryofracture in ethanol, and critical point drying. They were then examined without metal coating in the scanning electron microscope operating in the secondary electron and backscattered electron modes. Fifty-micrometer sections were cut with a tissue sectioner, stained with lead citrate, postfixed with osmium, dehydrated, critical point dried, and examined in the secondary electron and back-scattered electron modes. Frozen sections (0.25 to 0.75 mum. thick) were cut by the method of Tokuyasu (Toluyasu KT: J Cell Biol 57:551, 1973) and their scanning transmission electron microscope images were examined either with a scanning transmission electron microscope detector or with a conversion stub using the secondary electron detector. Secondary electron images of the liver prepared by ligand-mediated osmium binding and subsequent cryofracture revealed such intracellular structures as cisternae of the endoplasmic reticulum, lysosomes, mitochondria, lipid droplets, nucleolus and nuclear chromatin, as well as the usual surface morphology, Lipocytes in the perisinusoidal space were readily identified. Backscattered electron images. Unembedded frozen sections had little drying artifact and were virtually free of freezing damage. The scanning transmission electron microscope image revealed those organelles visualized by the secondary electron mode in the ligand-mediated osmium binding-treated tissue.

Structural, morphological and optical properties of chromium oxide nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Babukutty, Blessy; Parakkal, Fasalurahman; Nair, Swapna S., E-mail: swapna.s.nair@gmail.com

2015-06-24

Chromium oxide nanoparticles are synthesized by reduction route from chloride precursors with surfactant, trioctylphosphine oxide (TOPO). Structural and morphological characterization are analyzed using X-ray Diffraction (XRD) and Transmission Electron Microscopy (TEM). Transmission Electron micrographs show that the average grain size lies in the range 5nm to 10nm. Optical characterization has been done by UV-VIS spectrophotometer. Distinct optical absorptions of Cr{sup 3+} ions show hinting towards the presence of Cr{sub 2}O{sub 3}. Presence of oxygen is also confirmed from Electron Energy Loss Spectroscopy (EELS) studies.

Scanning transmission electron microscopy: Albert Crewe's vision and beyond.

PubMed

Krivanek, Ondrej L; Chisholm, Matthew F; Murfitt, Matthew F; Dellby, Niklas

2012-12-01

Some four decades were needed to catch up with the vision that Albert Crewe and his group had for the scanning transmission electron microscope (STEM) in the nineteen sixties and seventies: attaining 0.5Å resolution, and identifying single atoms spectroscopically. With these goals now attained, STEM developments are turning toward new directions, such as rapid atomic resolution imaging and exploring atomic bonding and electronic properties of samples at atomic resolution. The accomplishments and the future challenges are reviewed and illustrated with practical examples. Copyright © 2012 Elsevier B.V. All rights reserved.

Transmission Electron Microscopy Analysis of Skin Lesions from Sporotrichosis Epidemic in Rio de Janeiro, Brazil

PubMed Central

Porto Ferreira, Cassio; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana

2015-01-01

Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. PMID:25653392

Structural characterization and gas reactions of small metal particles by high resolution in-situ TEM (Transmission Electron Microscopy) and TED (Transmission Electron Diffraction)

NASA Technical Reports Server (NTRS)

Heinemann, K.

1987-01-01

The detection and size analysis of small metal particles supported on amorphous substrates becomes increasingly difficult when the particle size approaches that of the phase contrast background structures of the support. An approach of digital image analysis, involving Fourier transformation of the original image, filtering, and image reconstruction was studied with respect to the likelihood of unambiguously detecting particles of less than 1 nm diameter on amorphous substrates from a single electron micrograph.

Impact of membrane-induced particle immobilization on seeded growth monitored by in situ liquid scanning transmission electron microscopy

DOE PAGES

Weiner, Rebecca G.; Chen, Dennis P.; Unocic, Raymond R.; ...

2016-04-01

In situ liquid cell scanning transmission electron microscopy probes seeded growth in real time. The growth of Pd on Au nanocubes is monitored as a model system to compare growth within a liquid cell and traditional colloidal synthesis. Furthermore, different growth patterns are observed due to seed immobilization and the highly reducing environment within the liquid cell.

Highlighting material structure with transmission electron diffraction correlation coefficient maps.

PubMed

Kiss, Ákos K; Rauch, Edgar F; Lábár, János L

2016-04-01

Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. Copyright © 2016 Elsevier B.V. All rights reserved.

Electron-Beam Produced Air Plasma: Optical Measurement of Beam Current

NASA Astrophysics Data System (ADS)

Vidmar, Robert; Stalder, Kenneth; Seeley, Megan

2006-10-01

Experiments to quantify the electron beam current and distribution of beam current in air plasma are discussed. The air plasma is produced by a 100-keV 10-mA electron beam source that traverses a transmission window into a chamber with air as a target gas. Air pressure is between 1 mTorr and 760 Torr. Strong optical emissions due to electron impact ionization are observed for the N2 2^nd positive line at 337.1 nm and the N2^+ 1^st negative line at 391.4 nm. Calibration of optical emissions using signals from the isolated transmission window and a Faraday plate are discussed. The calibrated optical system is then used to quantify the electron distribution in the air plasma.

Scanning electron microscope observation of dislocations in semiconductor and metal materials.

PubMed

Kuwano, Noriyuki; Itakura, Masaru; Nagatomo, Yoshiyuki; Tachibana, Shigeaki

2010-08-01

Scanning electron microscope (SEM) image contrasts have been investigated for dislocations in semiconductor and metal materials. It is revealed that single dislocations can be observed in a high contrast in SEM images formed by backscattered electrons (BSE) under the condition of a normal configuration of SEM. The BSE images of dislocations were compared with those of the transmission electron microscope and scanning transmission electron microscope (STEM) and the dependence of BSE image contrast on the tilting of specimen was examined to discuss the origin of image contrast. From the experimental results, it is concluded that the BSE images of single dislocations are attributed to the diffraction effect and related with high-angle dark-field images of STEM.

A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy

DOE PAGES

Pryor, Alan; Ophus, Colin; Miao, Jianwei

2017-10-25

Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less

Room Temperature Ferromagnetism of Fe Doped Indium Tin Oxide Based on Dispersed Fe3O4 Nanoparticles

NASA Astrophysics Data System (ADS)

Okada, Koichi; Kohiki, Shigemi; Nishi, Sachio; Shimooka, Hirokazu; Deguchi, Hiroyuki; Mitome, Masanori; Bando, Yoshio; Shishido, Toetsu

2007-09-01

Transmission electron microscopy revealed that Fe3O4 nanoparticles with diameter of ≈200 nm dispersed in Fe doped indium tin oxide (Fe@ITO) powders exhibiting co-occurrence of room temperature ferromagnetism and superparamagnetism. Although we observed no X-ray diffraction peak from Fe related compounds for Fe0.19@ITO (ITO: In1.9Sn0.1O3) powders, the powders showed both hysteresis loop in field dependent magnetization at 300 K and divergence of zero-field-cooled magnetization from field-cooled magnetization. Scanning transmission electron microscopy with energy dispersive X-ray spectroscopy demonstrated that the nanoparticle with diameter of ≈200 nm consists of Fe and oxygen. Transmission electron diffraction revealed that crystal structure of the nanoparticle is inverse spinel type Fe3O4. The Fe3O4 crystalline phase by electron diffraction is consistent with the saturation magnetization of 1.3 μB/Fe and magnetic anomaly at ≈110 K observed for the powders.

Jikiken /EXOS-B/ observation of Siple transmissions

NASA Technical Reports Server (NTRS)

Kimura, I.; Matsumoto, H.; Hashimoto, K.; Mukai, T.; Helliwell, R. A.; Bell, T. F.; Inan, U. S.; Katsufrakis, J. P.

1981-01-01

Preliminary results of observations by the Japanese magnetospheric satellite Jikiken (EXOS-B) of Siple transmissions and VLF emissions triggered by the Siple signals are reviewed. The experiments discussed were carried out in July, August, and September of 1979 and in December 1979 and January 1980. Only four events concentrated within the period from August 14 to 18 were found in which triggered emissions were associated with Siple transmissions. The electron distributions observed on the equatorial crossing passes, when Siple triggered emissions were detected, suggest that the cyclotron resonance condition is satisfied for Siple signals and electrons of energy around 1 keV or less, provided the interaction region is inside the plasmapause. It is noted that if these emissions were generated outside the plasmapause, electron energies much higher than 10 keV would be necessary for the cyclotron interaction, which were above the range of the measurements. For the high latitude passes of August 14 and 17, the electron fluxes were found to be very small.

A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy.

PubMed

Pryor, Alan; Ophus, Colin; Miao, Jianwei

2017-01-01

Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. Here, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditional multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic , using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic .

Chemical mapping and quantification at the atomic scale by scanning transmission electron microscopy.

PubMed

Chu, Ming-Wen; Chen, Cheng Hsuan

2013-06-25

With innovative modern material-growth methods, a broad spectrum of fascinating materials with reduced dimensions-ranging from single-atom catalysts, nanoplasmonic and nanophotonic materials to two-dimensional heterostructural interfaces-is continually emerging and extending the new frontiers of materials research. A persistent central challenge in this grand scientific context has been the detailed characterization of the individual objects in these materials with the highest spatial resolution, a problem prompting the need for experimental techniques that integrate both microscopic and spectroscopic capabilities. To date, several representative microscopy-spectroscopy combinations have become available, such as scanning tunneling microscopy, tip-enhanced scanning optical microscopy, atom probe tomography, scanning transmission X-ray microscopy, and scanning transmission electron microscopy (STEM). Among these tools, STEM boasts unique chemical and electronic sensitivity at unparalleled resolution. In this Perspective, we elucidate the advances in STEM and chemical mapping applications at the atomic scale by energy-dispersive X-ray spectroscopy and electron energy loss spectroscopy with a focus on the ultimate challenge of chemical quantification with atomic accuracy.

Tunable transmission of quantum Hall edge channels with full degeneracy lifting in split-gated graphene devices.

PubMed

Zimmermann, Katrin; Jordan, Anna; Gay, Frédéric; Watanabe, Kenji; Taniguchi, Takashi; Han, Zheng; Bouchiat, Vincent; Sellier, Hermann; Sacépé, Benjamin

2017-04-13

Charge carriers in the quantum Hall regime propagate via one-dimensional conducting channels that form along the edges of a two-dimensional electron gas. Controlling their transmission through a gate-tunable constriction, also called quantum point contact, is fundamental for many coherent transport experiments. However, in graphene, tailoring a constriction with electrostatic gates remains challenging due to the formation of p-n junctions below gate electrodes along which electron and hole edge channels co-propagate and mix, short circuiting the constriction. Here we show that this electron-hole mixing is drastically reduced in high-mobility graphene van der Waals heterostructures thanks to the full degeneracy lifting of the Landau levels, enabling quantum point contact operation with full channel pinch-off. We demonstrate gate-tunable selective transmission of integer and fractional quantum Hall edge channels through the quantum point contact. This gate control of edge channels opens the door to quantum Hall interferometry and electron quantum optics experiments in the integer and fractional quantum Hall regimes of graphene.

A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pryor, Alan; Ophus, Colin; Miao, Jianwei

Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less

Structural Fingerprinting of Nanocrystals in the Transmission Electron Microscope

NASA Astrophysics Data System (ADS)

Rouvimov, Sergei; Plachinda, Pavel; Moeck, Peter

2010-03-01

Three novel strategies for the structurally identification of nanocrystals in a transmission electron microscope are presented. Either a single high-resolution transmission electron microscopy image [1] or a single precession electron diffractogram (PED) [2] may be employed. PEDs from fine-grained crystal powders may also be utilized. Automation of the former two strategies is in progress and shall lead to statistically significant results on ensembles of nanocrystals. Open-access databases such as the Crystallography Open Database which provides more than 81,500 crystal structure data sets [3] or its mainly inorganic and educational subsets [4] may be utilized. [1] http://www.scientificjournals.org/journals 2007/j/of/dissertation.htm [2] P. Moeck and S. Rouvimov, in: {Drugs and the Pharmaceutical Sciences}, Vol. 191, 2009, 270-313 [3] http://cod.ibt.lt, http://www.crystallography.net, http://cod.ensicaen.fr, http://nanocrystallography.org, http://nanocrystallography.net, http://journals.iucr.org/j/issues/2009/04/00/kk5039/kk5039.pdf [4] http://nanocrystallography.research.pdx.edu/CIF-searchable

Three-dimensional imaging of adherent cells using FIB/SEM and STEM.

PubMed

Villinger, Clarissa; Schauflinger, Martin; Gregorius, Heiko; Kranz, Christine; Höhn, Katharina; Nafeey, Soufi; Walther, Paul

2014-01-01

In this chapter we describe three different approaches for three-dimensional imaging of electron microscopic samples: serial sectioning transmission electron microscopy (TEM), scanning transmission electron microscopy (STEM) tomography, and focused ion beam/scanning electron microscopy (FIB/SEM) tomography. With these methods, relatively large volumes of resin-embedded biological structures can be analyzed at resolutions of a few nm within a reasonable expenditure of time. The traditional method is serial sectioning and imaging the same area in all sections. Another method is TEM tomography that involves tilting a section in the electron beam and then reconstruction of the volume by back projection of the images. When the scanning transmission (STEM) mode is used, thicker sections (up to 1 μm) can be analyzed. The third approach presented here is focused ion beam/scanning electron microscopy (FIB/SEM) tomography, in which a sample is repeatedly milled with a focused ion beam (FIB) and each newly produced block face is imaged with the scanning electron microscope (SEM). This process can be repeated ad libitum in arbitrary small increments allowing 3D analysis of relatively large volumes such as eukaryotic cells. We show that resolution of this approach is considerably improved when the secondary electron signal is used. However, the most important prerequisite for three-dimensional imaging is good specimen preparation. For all three imaging methods, cryo-fixed (high-pressure frozen) and freeze-substituted samples have been used.

76 FR 16446 - Delphi Corporation Electronics And Safety Division Including On-Site Leased Workers From Acro...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-23

...: Heating, ventilating, air-conditioning systems (HVAC), amplifiers, mainboards, gas control modules, hybrid airmeter electronics, hybrid ignition electronics, pressure sensors, transmission control modules, crash...

47 CFR 54.5 - Terms and definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... electronic publishing, but does not include any use of any such capability for the management, control, or... transmission of information as part of a gateway to an information service, when that transmission does not involve the generation or alteration of the content of information, but may include data transmission...

Specimen-thickness effects on transmission Kikuchi patterns in the scanning electron microscope.

PubMed

Rice, K P; Keller, R R; Stoykovich, M P

2014-06-01

We report the effects of varying specimen thickness on the generation of transmission Kikuchi patterns in the scanning electron microscope. Diffraction patterns sufficient for automated indexing were observed from films spanning nearly three orders of magnitude in thickness in several materials, from 5 nm of hafnium dioxide to 3 μm of aluminum, corresponding to a mass-thickness range of ~5 to 810 μg cm(-2) . The scattering events that are most likely to be detected in transmission are shown to be very near the exit surface of the films. The energies, spatial distribution and trajectories of the electrons that are transmitted through the film and are collected by the detector are predicted using Monte Carlo simulations. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

An in-plane magnetic chiral dichroism approach for measurement of intrinsic magnetic signals using transmitted electrons

PubMed Central

Song, Dongsheng; Tavabi, Amir H.; Li, Zi-An; Kovács, András; Rusz, Ján; Huang, Wenting; Richter, Gunther; Dunin-Borkowski, Rafal E.; Zhu, Jing

2017-01-01

Electron energy-loss magnetic chiral dichroism is a powerful technique that allows the local magnetic properties of materials to be measured quantitatively with close-to-atomic spatial resolution and element specificity in the transmission electron microscope. Until now, the technique has been restricted to measurements of the magnetic circular dichroism signal in the electron beam direction. However, the intrinsic magnetization directions of thin samples are often oriented in the specimen plane, especially when they are examined in magnetic-field-free conditions in the transmission electron microscope. Here, we introduce an approach that allows in-plane magnetic signals to be measured using electron magnetic chiral dichroism by selecting a specific diffraction geometry. We compare experimental results recorded from a cobalt nanoplate with simulations to demonstrate that an electron magnetic chiral dichroism signal originating from in-plane magnetization can be detected successfully. PMID:28504267

Development of an environmental high-voltage electron microscope for reaction science.

PubMed

Tanaka, Nobuo; Usukura, Jiro; Kusunoki, Michiko; Saito, Yahachi; Sasaki, Katuhiro; Tanji, Takayoshi; Muto, Shunsuke; Arai, Shigeo

2013-02-01

Environmental transmission electron microscopy and ultra-high resolution electron microscopic observation using aberration correctors have recently emerged as topics of great interest. The former method is an extension of the so-called in situ electron microscopy that has been performed since the 1970s. Current research in this area has been focusing on dynamic observation with atomic resolution under gaseous atmospheres and in liquids. Since 2007, Nagoya University has been developing a new 1-MV high voltage (scanning) transmission electron microscope that can be used to observe nanomaterials under conditions that include the presence of gases, liquids and illuminating lights, and it can be also used to perform mechanical operations to nanometre-sized areas as well as electron tomography and elemental analysis by electron energy loss spectroscopy. The new instrument has been used to image and analyse various types of samples including biological ones.

49 CFR 229.20 - Electronic recordkeeping.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Electronic recordkeeping. 229.20 Section 229.20..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.20 Electronic recordkeeping... part through electronic transmission, storage, and retrieval provided that all of the requirements...

49 CFR 229.20 - Electronic recordkeeping.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Electronic recordkeeping. 229.20 Section 229.20..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.20 Electronic recordkeeping... part through electronic transmission, storage, and retrieval provided that all of the requirements...

Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials

NASA Astrophysics Data System (ADS)

Zhang, Daliang; Zhu, Yihan; Liu, Lingmei; Ying, Xiangrong; Hsiung, Chia-En; Sougrat, Rachid; Li, Kun; Han, Yu

2018-02-01

High-resolution imaging of electron beam–sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.

Resonant tunneling through electronic trapping states in thin MgO magnetic junctions.

PubMed

Teixeira, J M; Ventura, J; Araujo, J P; Sousa, J B; Wisniowski, P; Cardoso, S; Freitas, P P

2011-05-13

We report an inelastic electron tunneling spectroscopy study on MgO magnetic junctions with thin barriers (0.85-1.35 nm). Inelastic electron tunneling spectroscopy reveals resonant electronic trapping within the barrier for voltages V>0.15  V. These trapping features are associated with defects in the barrier crystalline structure, as confirmed by high-resolution transmission electron microscopy. Such defects are responsible for resonant tunneling due to energy levels that are formed in the barrier. A model was applied to determine the average location and energy level of the traps, indicating that they are mostly located in the middle of the MgO barrier, in accordance with the high-resolution transmission electron microscopy data and trap-assisted tunneling conductance theory. Evidence of the influence of trapping on the voltage dependence of tunnel magnetoresistance is shown.

Interaction between single gold atom and the graphene edge: A study via aberration-corrected transmission electron microscopy

NASA Astrophysics Data System (ADS)

Wang, Hongtao; Li, Kun; Cheng, Yingchun; Wang, Qingxiao; Yao, Yingbang; Schwingenschlögl, Udo; Zhang, Xixiang; Yang, Wei

2012-04-01

Interaction between single noble metal atoms and graphene edges has been investigated via aberration-corrected and monochromated transmission electron microscopy. A collective motion of the Au atom and the nearby carbon atoms is observed in transition between energy-favorable configurations. Most trapping and detrapping processes are assisted by the dangling carbon atoms, which are more susceptible to knock-on displacements by electron irradiation. Thermal energy is lower than the activation barriers in transition among different energy-favorable configurations, which suggests electron-beam irradiation can be an efficient way of engineering the graphene edge with metal atoms.Interaction between single noble metal atoms and graphene edges has been investigated via aberration-corrected and monochromated transmission electron microscopy. A collective motion of the Au atom and the nearby carbon atoms is observed in transition between energy-favorable configurations. Most trapping and detrapping processes are assisted by the dangling carbon atoms, which are more susceptible to knock-on displacements by electron irradiation. Thermal energy is lower than the activation barriers in transition among different energy-favorable configurations, which suggests electron-beam irradiation can be an efficient way of engineering the graphene edge with metal atoms. Electronic supplementary information (ESI) available: Additional Figures for characterization of mono-layer CVD graphene samples with free edges and Pt atoms decorations and analysis of the effect of electron irradiation; supporting movie on edge evolution. See DOI: 10.1039/c2nr00059h

Composite embedded fiber optic data links in Standard Electronic Modules

NASA Astrophysics Data System (ADS)

Ehlers, S. L.; Jones, K. J.; Morgan, R. E.; Hixson, Jay

1990-12-01

The goal of this project is to fabricate a chassis/circuit card demonstration entirely 'wired' with embedded and interconnected optical fibers. Graphite/epoxy Standard Electronic Module E (SEM-E) configured panels have been successfully fabricated. Fiber-embedded SEM-E configured panels have been subjected to simultaneous signal transmission and vibration testing. Packaging constraints will require tapping composite-embedded optical fibers at right angles to the direction of optical transmission.

In-Fiber Magneto-Optic Devices Based on Ultrahigh Verdet Constant Organic Materials and Holey Fibers

DTIC Science & Technology

2009-02-02

protocols and a noise equivalent magnetic field sensitivity of ~ 100 pT/ VHz has been demonstrated. • Magneto-optic properties of magnetite - PMMA composite...nanoparticle - PMMA nanocomposite. We have used both transmission electron microscopy (TEM) and scanning transmission electron microscopy (STEM) to...we expect to enhance it in our devices by their proper symmetrization as described above. Passive Poking core ^^ direction Magnetic AA

Studying localized corrosion using liquid cell transmission electron microscopy

DOE PAGES

Chee, See Wee; Pratt, Sarah H.; Hattar, Khalid; ...

2014-11-07

Using liquid cell transmission electron microscopy (LCTEM), localized corrosion of Cu and Al thin films immersed in aqueous NaCl solutions was studied. We demonstrate that potentiostatic control can be used to initiate pitting and that local compositional changes, due to focused ion beam implantation of Au + ions, can modify the corrosion susceptibility of Al films. Likewise, a discussion on strategies to control the onset of pitting is also presented.

Preparation and Observation of Thick Biological Samples by Scanning Transmission Electron Tomography.

PubMed

Trépout, Sylvain; Bastin, Philippe; Marco, Sergio

2017-03-12

This report describes a protocol for preparing thick biological specimens for further observation using a scanning transmission electron microscope. It also describes an imaging method for studying the 3D structure of thick biological specimens by scanning transmission electron tomography. The sample preparation protocol is based on conventional methods in which the sample is fixed using chemical agents, treated with a heavy atom salt contrasting agent, dehydrated in a series of ethanol baths, and embedded in resin. The specific imaging conditions for observing thick samples by scanning transmission electron microscopy are then described. Sections of the sample are observed using a through-focus method involving the collection of several images at various focal planes. This enables the recovery of in-focus information at various heights throughout the sample. This particular collection pattern is performed at each tilt angle during tomography data collection. A single image is then generated, merging the in-focus information from all the different focal planes. A classic tilt-series dataset is then generated. The advantage of the method is that the tilt-series alignment and reconstruction can be performed using standard tools. The collection of through-focal images allows the reconstruction of a 3D volume that contains all of the structural details of the sample in focus.

Tunneling effect on double potential barriers GaAs and PbS

NASA Astrophysics Data System (ADS)

Prastowo, S. H. B.; Supriadi, B.; Ridlo, Z. R.; Prihandono, T.

2018-04-01

A simple model of transport phenomenon tunnelling effect through double barrier structure was developed. In this research we concentrate on the variation of electron energy which entering double potential barriers to transmission coefficient. The barriers using semiconductor materials GaAs (Galium Arsenide) with band-gap energy 1.424 eV, distance of lattice 0.565 nm, and PbS (Lead Sulphide) with band gap energy 0.41 eV distance of lattice is 18 nm. The Analysisof tunnelling effect on double potentials GaAs and PbS using Schrodinger’s equation, continuity, and matrix propagation to get transmission coefficient. The maximum energy of electron that we use is 1.0 eV, and observable from 0.0025 eV- 1.0 eV. The shows the highest transmission coefficient is0.9982 from electron energy 0.5123eV means electron can pass the barriers with probability 99.82%. Semiconductor from materials GaAs and PbS is one of selected material to design semiconductor device because of transmission coefficient directly proportional to bias the voltage of semiconductor device. Application of the theoretical analysis of resonant tunnelling effect on double barriers was used to design and develop new structure and combination of materials for semiconductor device (diode, transistor, and integrated circuit).

Cross-sectional TEM specimen preparation for W/B{sub 4}C multilayer sample using FIB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mondal, Puspen, E-mail: puspen@rrcat.gov.in; Pradhan, P. C.; Tiwari, Pragya

2016-05-23

A recent emergence of a cross-beam scanning electron microscopy (SEM)/focused-ion-beam (FIB) system have given choice to fabricate cross-sectional transmission electron microscopy (TEM) specimen of thin film multilayer sample. A 300 layer pair thin film multilayer sample of W/B{sub 4}C was used to demonstrate the specimen lift-out technique in very short time as compared to conventional cross-sectional sample preparation technique. To get large area electron transparent sample, sample prepared by FIB is followed by Ar{sup +} ion polishing at 2 kV with grazing incident. The prepared cross-sectional sample was characterized by transmission electron microscope.

Analysis of Local Structure, Chemistry and Bonding by Electron Energy Loss Spectroscopy

NASA Astrophysics Data System (ADS)

Mayer, Joachim

In the present chapter, the reader will first be introduced briefly to the basic principles of analytical transmission electron microscopy (ATEM) with special emphasis on electron energy-loss spectroscopy (EELS) and energy-filtering TEM. The quantification of spectra to obtain chemical information and the origin and interpretation of near-edge fine structures in EELS (ELNES) are discussed. Special attention will be given to the characterization of internal interfaces and the literature in this area will be reviewed. Selected examples of the application of ATEM in the investigation of internal interfaces will be given. These examples include both EELS in the energy-filtering TEM and in the scanning transmission electron microscope (STEM).

Multiple mobility edges in a 1D Aubry chain with Hubbard interaction in presence of electric field: Controlled electron transport

NASA Astrophysics Data System (ADS)

Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.

2016-09-01

Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.

Magnetic gating of a 2D topological insulator

NASA Astrophysics Data System (ADS)

Dang, Xiaoqian; Burton, J. D.; Tsymbal, Evgeny Y.

2016-09-01

Deterministic control of transport properties through manipulation of spin states is one of the paradigms of spintronics. Topological insulators offer a new playground for exploring interesting spin-dependent phenomena. Here, we consider a ferromagnetic ‘gate’ representing a magnetic adatom coupled to the topologically protected edge state of a two-dimensional (2D) topological insulator to modulate the electron transmission of the edge state. Due to the locked spin and wave vector of the transport electrons the transmission across the magnetic gate depends on the mutual orientation of the adatom magnetic moment and the current. If the Fermi energy matches an exchange-split bound state of the adatom, the electron transmission can be blocked due to the full back scattering of the incident wave. This antiresonance behavior is controlled by the adatom magnetic moment orientation so that the transmission of the edge state can be changed from 1 to 0. Expanding this consideration to a ferromagnetic gate representing a 1D chain of atoms shows a possibility to control the spin-dependent current of a strip of a 2D topological insulator by magnetization orientation of the ferromagnetic gate.

Chemical compositions, infrared spectroscopy, and X-ray diffractometry study on brown-rotted woods

Treesearch

Gai-Yun Li; Luo-Hua Huang; Chung Hse; Te-Fu Qin

2011-01-01

The effect of brown-rot decay on the chemical composition and crystallinity of Masson pine was studied by exposing it to Wolfiporia cocos (Schwein.) Ryvarden and Gilbn. for durations of up to 15 weeks in the field. The holocellulose content, α-cellulose content, and wood crystallinity decreased slowly in the initial stage, followed by a significant reduction...

Crystal and Vibrational Structure of Energetic 3,5-dinitro 1,3,5-oxadiazinane (DOD) by Single Crystal X-ray Diffractometry and Raman Spectroscopy

DTIC Science & Technology

2018-03-19

calculations using a temperature of 298 K. 15. SUBJECT TERMS 3,5-dinitro-1,3,5-oxadiazinane (DOD), X-ray crystallography , Raman, energetic material...X-ray analysis. 2.2 Characterization X-ray Crystallography . DOD crystals were characterized with a SuperNova, Dualflex, EosS2 diffractometer using

Electronic structure and fine structural features of the air-grown UNxOy on nitrogen-rich uranium nitride

NASA Astrophysics Data System (ADS)

Long, Zhong; Zeng, Rongguang; Hu, Yin; Liu, Jing; Wang, Wenyuan; Zhao, Yawen; Luo, Zhipeng; Bai, Bin; Wang, Xiaofang; Liu, Kezhao

2018-06-01

Oxide formation on surface of nitrogen-rich uranium nitride film/particles was investigated using X-ray photoelectron spectroscopy (XPS), auger electron spectroscopy (AES), aberration-corrected transmission electron microscopy (TEM), and high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) coupled with electron energy-loss spectroscopy (EELS). XPS and AES studies indicated that the oxidized layer on UN2-x film is ternary compound uranium oxynitride (UNxOy) in 5-10 nm thickness. TEM/HAADF-STEM and EELS studies revealed the UNxOy crystallizes in the FCC CaF2-type structure with the lattice parameter close to the CaF2-type UN2-x matrix. The work can provide further information to the oxidation mechanism of uranium nitride.

A Versatile High-Vacuum Cryo-transfer System for Cryo-microscopy and Analytics

PubMed Central

Tacke, Sebastian; Krzyzanek, Vladislav; Nüsse, Harald; Wepf, Roger Albert; Klingauf, Jürgen; Reichelt, Rudolf

2016-01-01

Cryogenic microscopy methods have gained increasing popularity, as they offer an unaltered view on the architecture of biological specimens. As a prerequisite, samples must be handled under cryogenic conditions below their recrystallization temperature, and contamination during sample transfer and handling must be prevented. We present a high-vacuum cryo-transfer system that streamlines the entire handling of frozen-hydrated samples from the vitrification process to low temperature imaging for scanning transmission electron microscopy and transmission electron microscopy. A template for cryo-electron microscopy and multimodal cryo-imaging approaches with numerous sample transfer steps is presented. PMID:26910419

Analysis of Multilayer Devices for Superconducting Electronics by High-Resolution Scanning Transmission Electron Microscopy and Energy Dispersive Spectroscopy

DOE PAGES

Missert, Nancy; Kotula, Paul G.; Rye, Michael; ...

2017-02-15

We used a focused ion beam to obtain cross-sectional specimens from both magnetic multilayer and Nb/Al-AlOx/Nb Josephson junction devices for characterization by scanning transmission electron microscopy (STEM) and energy dispersive X-ray spectroscopy (EDX). An automated multivariate statistical analysis of the EDX spectral images produced chemically unique component images of individual layers within the multilayer structures. STEM imaging elucidated distinct variations in film morphology, interface quality, and/or etch artifacts that could be correlated to magnetic and/or electrical properties measured on the same devices.

Scanning Transmission Electron Microscopy at High Resolution

PubMed Central

Wall, J.; Langmore, J.; Isaacson, M.; Crewe, A. V.

1974-01-01

We have shown that a scanning transmission electron microscope with a high brightness field emission source is capable of obtaining better than 3 Å resolution using 30 to 40 keV electrons. Elastic dark field images of single atoms of uranium and mercury are shown which demonstrate this fact as determined by a modified Rayleigh criterion. Point-to-point micrograph resolution between 2.5 and 3.0 Å is found in dark field images of micro-crystallites of uranium and thorium compounds. Furthermore, adequate contrast is available to observe single atoms as light as silver. Images PMID:4521050

Transmission electron microscopy analysis of skin lesions from sporotrichosis epidemic in Rio de Janeiro, Brazil.

PubMed

Ferreira, Cassio Porto; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana

2015-02-01

Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. © The American Society of Tropical Medicine and Hygiene.

Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

An inexpensive approach for bright-field and dark-field imaging by scanning transmission electron microscopy in scanning electron microscopy.

PubMed

Patel, Binay; Watanabe, Masashi

2014-02-01

Scanning transmission electron microscopy in scanning electron microscopy (STEM-in-SEM) is a convenient technique for soft materials characterization. Various specimen-holder geometries and detector arrangements have been used for bright-field (BF) STEM-in-SEM imaging. In this study, to further the characterization potential of STEM-IN-SEM, a new specimen holder has been developed to facilitate direct detection of BF signals and indirect detection of dark-field (DF) signals without the need for substantial instrument modification. DF imaging is conducted with the use of a gold (Au)-coated copper (Cu) plate attached to the specimen holder which directs highly scattered transmitted electrons to an off-axis yttrium-aluminum-garnet (YAG) detector. A hole in the copper plate allows for BF imaging with a transmission electron (TE) detector. The inclusion of an Au-coated Cu plate enhanced DF signal intensity. Experiments validating the acquisition of true DF signals revealed that atomic number (Z) contrast may be achieved for materials with large lattice spacing. However, materials with small lattice spacing still exhibit diffraction contrast effects in this approach. The calculated theoretical fine probe size is 1.8 nm. At 30 kV, in this indirect approach, DF spatial resolution is limited to 3.2 nm as confirmed experimentally.

Study of transmission line attenuation in broad band millimeter wave frequency range.

PubMed

Pandya, Hitesh Kumar B; Austin, M E; Ellis, R F

2013-10-01

Broad band millimeter wave transmission lines are used in fusion plasma diagnostics such as electron cyclotron emission (ECE), electron cyclotron absorption, reflectometry and interferometry systems. In particular, the ECE diagnostic for ITER will require efficient transmission over an ultra wide band, 100 to 1000 GHz. A circular corrugated waveguide transmission line is a prospective candidate to transmit such wide band with low attenuation. To evaluate this system, experiments of transmission line attenuation were performed and compared with theoretical loss calculations. A millimeter wave Michelson interferometer and a liquid nitrogen black body source are used to perform all the experiments. Atmospheric water vapor lines and continuum absorption within this band are reported. Ohmic attenuation in corrugated waveguide is very low; however, there is Bragg scattering and higher order mode conversion that can cause significant attenuation in this transmission line. The attenuation due to miter bends, gaps, joints, and curvature are estimated. The measured attenuation of 15 m length with seven miter bends and eighteen joints is 1 dB at low frequency (300 GHz) and 10 dB at high frequency (900 GHz), respectively.

Electronic and structural properties of B i2S e3:Cu

NASA Astrophysics Data System (ADS)

Sobczak, Kamil; Strak, Pawel; Kempisty, Pawel; Wolos, Agnieszka; Hruban, Andrzej; Materna, Andrzej; Borysiuk, Jolanta

2018-04-01

Electronic and structural properties of B i2S e3 and its extension to copper doped B i2S e3:Cu were studied using combined ab initio simulations and transmission electron microscopy based techniques, including electron energy loss spectroscopy, energy filtered transmission electron microscopy, and energy dispersive x-ray spectroscopy. The stability of the mixed phases was investigated for substitutional and intercalation changes of basic B i2S e3 structure. Four systems were compared: B i2S e3 , structures obtaining by Cu intercalation of the van der Waals gap, by substitution of Bi by Cu in quintuple layers, and C u2Se . The structures were identified and their electronic properties were obtained. Transmission electron microscopy measurements of B i2S e3 and the B i2S e3:Cu system identified the first structure as uniform and the second as composite, consisting of a nonuniform lower-Cu-content matrix and randomly distributed high-Cu-concentration precipitates. Critical comparison of the ab initio and experimental data identified the matrix as having a B i2S e3 dominant part with randomly distributed Cu-intercalated regions having 1Cu-B i2S e3 structure. The precipitates were determined to have 3Cu-B i2S e3 structure.

Ultrastructure Features and Three-Dimensional Transmission Electron Tomography of Dhub Lizard (Uromastyx Aegyptia) Cornea and Its Adaptation to a Desert Environment.

PubMed

Akhtar, Saeed; Alkhalaf, Mousa; Khan, Adnan A; Almubrad, Turki M

2016-08-01

We report ultrastructural features and transmission electron tomography of the dhub lizard (Uromastyx aegyptia) cornea and its adaptation to hot and dry environments. Six corneas of dhub lizards were fixed in 2.5% glutaraldehyde and processed for electron microscopy and tomography. The ultrathin sections were observed with a JEOL 1400 transmission electron microscope. The cornea of the dhub lizard is very thin (~28-30 µm). The epithelium constitutes ~14% of the cornea, whereas the stroma constitutes 80% of the cornea. The middle stromal lamellae are significantly thicker than anterior and posterior stromal lamellae. Collagen fibril (CF) diameters in the anterior stroma are variable in size (25-75 nm). Proteoglycans (PGs) are very large in the middle and posterior stroma, whereas they are small in the anterior stroma. Three-dimensional electron tomography was carried out to understand the structure and arrangement of the PG and CFs. The presence of large PGs in the posterior and middle stroma might help the animal retain a large amount of water to protect it from dryness. The dhub corneal structure is equipped to adapt to the dry and hot desert environment.

Synthesis and Cs-Corrected Scanning Transmission Electron Microscopy Characterization of Multimetallic Nanoparticles

NASA Astrophysics Data System (ADS)

Khanal, Subarna; Bhattarai, Nabraj; Velázquez-Salazar, Jesus; Jose-Yacaman, Miguel; Subarna Khanal Team

2014-03-01

Multimetallic nanoparticles have been attracted greater attention both in materials science and nanotechnology due to its unique electronic, optical, biological, and catalytic properties lead by physiochemical interactions among different atoms and phases. The distinct features of multimetallic nanoparticles enhanced synergetic properties, large surface to volume ratio and quantum size effects ultimately lead to novel and wide range of possibilities for different applications than monometallic counterparts. For instance, PtPd, Pt/Cu, Au-Au3Cu, AgPd/Pt, AuCu/Pt and many other multimetallic nanoparticles have raised interest for their various applications in fuel cells, ethanol and methanol oxidation reactions, hydrogen storage, and so on. The nanostructures were analyzed by transmission electron microscopy (TEM) and by aberration-corrected scanning transmission electron microscopy (Cs-corrected STEM), in combination with high angle annular dark field (HAADF), bright field (BF), energy dispersive X-ray spectroscopy (EDS), and electron energy loss spectroscopy (EELS) detectors. These techniques allowed us to probe the structure at the atomic level of the nanoparticles revealing new structural information and elemental composition of the nanoparticles. The authors would like to acknowledge NSF grants DMR-1103730, ``Alloys at the Nanoscale: The Case of Nanoparticles Second Phase'' and NSF PREM Grant # DMR 0934218.

Swift heavy ion track formation in Gd2Zr2-xTixO7 pyrochlore: Effect of electronic energy loss

NASA Astrophysics Data System (ADS)

Lang, Maik; Toulemonde, Marcel; Zhang, Jiaming; Zhang, Fuxiang; Tracy, Cameron L.; Lian, Jie; Wang, Zhongwu; Weber, William J.; Severin, Daniel; Bender, Markus; Trautmann, Christina; Ewing, Rodney C.

2014-10-01

The morphology of swift heavy ion tracks in the Gd2Zr2-xTixO7 pyrochlore system has been investigated as a function of the variation in chemical composition and electronic energy loss, dE/dx, over a range of energetic ions: 58Ni, 101Ru, 129Xe, 181Ta, 197Au, 208Pb, and 238U of 11.1 MeV/u specific energy. Bright-field transmission electron microscopy, synchrotron X-ray diffraction, and Raman spectroscopy reveal an increasing degree of amorphization with increasing Ti-content and dE/dx. The size and morphology of individual ion tracks in Gd2Ti2O7 were characterized by high-resolution transmission electron microscopy revealing a core-shell structure with an outer defect-fluorite dominated shell at low dE/dx to predominantly amorphous tracks at high dE/dx. Inelastic thermal-spike calculations have been used together with atomic-scale characterization of ion tracks in Gd2Ti2O7 by high resolution transmission electron microscopy to deduce critical energy densities for the complex core-shell morphologies induced by ions of different dE/dx.

49 CFR 213.369 - Inspection records.

Code of Federal Regulations, 2010 CFR

2010-10-01

... transfer records through electronic transmission, storage, and retrieval provided that— (1) The electronic... security such as recognition of an electronic signature, or other means, which uniquely identify the initiating person as the author of that record. No two persons shall have the same electronic identity; (2...

Advanced Nanoscale Thin Film & Bulk Materials Towards Thermoelectric Power Conversion Efficiencies of 30%

DTIC Science & Technology

2014-02-27

Electron Microscopy. Detailed Kronig -Penny (K-P)) modeling of electron transport through these superlattices suggests an estimated e-h transition energy...superalttices was confirmed by Transmission Electron Microscopy. Detailed Kronig -Penny (K-P)) modeling of electron transport through these superlattices

Dislocation density of pure copper processed by accumulative roll bonding and equal-channel angular pressing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyajima, Yoji, E-mail: miyajima.y.ab@m.titech.ac.jp; Okubo, Satoshi; Abe, Hiroki

The dislocation density of pure copper fabricated by two severe plastic deformation (SPD) processes, i.e., accumulative roll bonding and equal-channel angular pressing, was evaluated using scanning transmission electron microscopy/transmission electron microscopy observations. The dislocation density drastically increased from ~ 10{sup 13} m{sup −} {sup 2} to about 5 × 10{sup 14} m{sup −} {sup 2}, and then saturated, for both SPD processes.

In vitro model for Campylobacter pylori adherence properties.

PubMed Central

Neman-Simha, V; Mégraud, F

1988-01-01

The adherence of 12 strains of Campylobacter pylori was studied on four cell lines. Immunofluorescence and scanning and transmission electron microscopy were used to visualize the bacteria. A heavy adherence to the epithelial cell line HEp-2 and to the intestinal cell line Int-407 was noted. By transmission electron microscopy, a close association between bacteria and cells in the form of cup-like structures was observed, but pedestals were not present. Images PMID:3182085

Study of irradiated Hadfield steel using transmission Mössbauer spectroscopy with high velocity resolution and conversion electron Mössbauer spectroscopy

NASA Astrophysics Data System (ADS)

Semionkin, V. A.; Neshev, F. G.; Tsurin, V. A.; Milder, O. B.; Oshtrakh, M. I.

2010-03-01

Proton irradiated Hadfield steel foil was studied using transmission Mössbauer spectroscopy with high velocity resolution and conversion electron Mössbauer spectroscopy. It was shown that proton irradiation leads to structural changes in the foil as well as to surface oxidation with ferric hydrous oxide formation (ferrihydrite). Moreover, oxidation on the foil underside was higher than on the foil right side.

Nanostructure size determination in p-type porous silicon by the use of transmission electron diffraction image processing

NASA Astrophysics Data System (ADS)

Ramirez-Porras, A.

2005-06-01

The structure of p-type porous silicon (PS) has been investigated by the use of transmission electron diffraction (TED) microscopy and image processing. The results suggest the presence of well oriented crystalline phases and polycrystalline phases characterized by random orientation. These phases are believed to be formed by spheres with a mean diameter of 4.3 nm and a standard deviation of 1.3 nm.

Milligram-per-second femtosecond laser production of Se nanoparticle inks and ink-jet printing of nanophotonic 2D-patterns

NASA Astrophysics Data System (ADS)

Ionin, Andrey; Ivanova, Anastasia; Khmel'nitskii, Roman; Klevkov, Yury; Kudryashov, Sergey; Mel'nik, Nikolay; Nastulyavichus, Alena; Rudenko, Andrey; Saraeva, Irina; Smirnov, Nikita; Zayarny, Dmitry; Baranov, Anatoly; Kirilenko, Demid; Brunkov, Pavel; Shakhmin, Alexander

2018-04-01

Milligram-per-second production of selenium nanoparticles in water sols was realized through 7-W, 2 MHz-rate femtosecond laser ablation of a crystalline trigonal selenium pellet. High-yield particle formation mechanism and ultimate mass-removal yield were elucidated by optical profilometry and scanning electron microscopy characterization of the corresponding crater depths and topographies. Deposited selenium particles were inspected by scanning and transmission electron microscopy, while their hydrosols (nanoinks) were characterized by optical transmission, Raman and dynamic light scattering spectroscopy. 2D patterns and coatings were ink-jet printed on thin supported silver films and their bare silica glass substrates, as well as on IR-transparent CaF2 substrates, and characterized by electron microscopy, energy-dispersive x-ray spectroscopy, and broadband (vis-mid IR) transmission spectroscopy, exhibiting crystalline selenium nanoparticles with high refractive index as promising all-dielectric sensing building nanoblocks in nanophotonics.

High-angle annular dark field scanning transmission electron microscopy on carbon-based functional polymer systems.

PubMed

Sourty, Erwan; van Bavel, Svetlana; Lu, Kangbo; Guerra, Ralph; Bar, Georg; Loos, Joachim

2009-06-01

Two purely carbon-based functional polymer systems were investigated by bright-field conventional transmission electron microscopy (CTEM) and high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM). For a carbon black (CB) filled polymer system, HAADF-STEM provides high contrast between the CB agglomerates and the polymer matrix so that details of the interface organization easily can be revealed and assignment of the CB phase is straightforward. For a second system, the functional polymer blend representing the photoactive layer of a polymer solar cell, details of its nanoscale organization could be observed that were not accessible with CTEM. By varying the camera length in HAADF-STEM imaging, the contrast can be enhanced between crystalline and amorphous compounds due to diffraction contrast so that nanoscale interconnections between domains are identified. In general, due to its incoherent imaging characteristics HAADF-STEM allows for reliable interpretation of the data obtained.

Irradiation Creep in Graphite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ubic, Rick; Butt, Darryl; Windes, William

2014-03-13

An understanding of the underlying mechanisms of irradiation creep in graphite material is required to correctly interpret experimental data, explain micromechanical modeling results, and predict whole-core behavior. This project will focus on experimental microscopic data to demonstrate the mechanism of irradiation creep. High-resolution transmission electron microscopy should be able to image both the dislocations in graphite and the irradiation-induced interstitial clusters that pin those dislocations. The team will first prepare and characterize nanoscale samples of virgin nuclear graphite in a transmission electron microscope. Additional samples will be irradiated to varying degrees at the Advanced Test Reactor (ATR) facility and similarlymore » characterized. Researchers will record microstructures and crystal defects and suggest a mechanism for irradiation creep based on the results. In addition, the purchase of a tensile holder for a transmission electron microscope will allow, for the first time, in situ observation of creep behavior on the microstructure and crystallographic defects.« less

Nanoscale deformation analysis with high-resolution transmission electron microscopy and digital image correlation

DOE PAGES

Wang, Xueju; Pan, Zhipeng; Fan, Feifei; ...

2015-09-10

We present an application of the digital image correlation (DIC) method to high-resolution transmission electron microscopy (HRTEM) images for nanoscale deformation analysis. The combination of DIC and HRTEM offers both the ultrahigh spatial resolution and high displacement detection sensitivity that are not possible with other microscope-based DIC techniques. We demonstrate the accuracy and utility of the HRTEM-DIC technique through displacement and strain analysis on amorphous silicon. Two types of error sources resulting from the transmission electron microscopy (TEM) image noise and electromagnetic-lens distortions are quantitatively investigated via rigid-body translation experiments. The local and global DIC approaches are applied for themore » analysis of diffusion- and reaction-induced deformation fields in electrochemically lithiated amorphous silicon. As a result, the DIC technique coupled with HRTEM provides a new avenue for the deformation analysis of materials at the nanometer length scales.« less

Boron doped simulated graphene field effect transistor model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Preetika, E-mail: preetikamadhav@yahoo.co.in; Gupta, Shuchi, E-mail: sgupta@pu.ac.in; Kaur, Inderpreet, E-mail: inderpreety@yahoo.co.in

2016-05-06

Graphene based electronic devices due to its unique properties has transformed electronics. A Graphene Field Effect Transistor (GNRFET) model is simulated in Virtual Nano Lab (VNL) and the calculations are based on density functional theory (DFT). Simulations were performed on this pristine GNRFET model and the transmission spectrum was observed. The graph obtained showed a uniform energy gap of +1 to −1eV and the highest transmission peak at −1.75 eV. To this pristine model of GNRFET, doping was introduced and its effect was seen on the Fermi level obtained in the transmission spectrum. Boron as a dopant was used whichmore » showed variations in both the transmission peaks and the energy gap. In this model, first the single boron was substituted in place of carbon and Fermi level showed an energy gap of 1.5 to −0.5eV with the highest transmission peak at −1.3 eV. In another variation in the model, two carbon atoms were replaced by two boron atoms and Fermi level shifted from 2 to 0.25eV. In this observation, the highest transmission peak was observed at −1(approx.). The use of nanoelectronic devices have opened many areas of applications as GFET is an excellent building block for electronic circuits, and is being used in applications such as high-performance frequency doublers and mixers, digital modulators, phase detectors, optoelectronics and spintronics.« less

Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography.

PubMed

Murata, Kazuyoshi; Esaki, Masatoshi; Ogura, Teru; Arai, Shigeo; Yamamoto, Yuta; Tanaka, Nobuo

2014-11-01

Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ~3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. Copyright © 2014 Elsevier B.V. All rights reserved.

Electron Spectroscopic Methods in Teaching.

ERIC Educational Resources Information Center

Allan, Michael

1987-01-01

Discusses electron-loss spectroscopy and the experimentally observed excitation energies in terms of qualitative MO theory. Reviews information on photoelectron spectroscopy and electron transmission spectroscopy and their relation to the occupied and unoccupied orbital levels. Focuses on teaching applications. (ML)

Ultrafast transmission electron microscopy using a laser-driven field emitter: Femtosecond resolution with a high coherence electron beam.

PubMed

Feist, Armin; Bach, Nora; Rubiano da Silva, Nara; Danz, Thomas; Möller, Marcel; Priebe, Katharina E; Domröse, Till; Gatzmann, J Gregor; Rost, Stefan; Schauss, Jakob; Strauch, Stefanie; Bormann, Reiner; Sivis, Murat; Schäfer, Sascha; Ropers, Claus

2017-05-01

We present the development of the first ultrafast transmission electron microscope (UTEM) driven by localized photoemission from a field emitter cathode. We describe the implementation of the instrument, the photoemitter concept and the quantitative electron beam parameters achieved. Establishing a new source for ultrafast TEM, the Göttingen UTEM employs nano-localized linear photoemission from a Schottky emitter, which enables operation with freely tunable temporal structure, from continuous wave to femtosecond pulsed mode. Using this emission mechanism, we achieve record pulse properties in ultrafast electron microscopy of 9Å focused beam diameter, 200fs pulse duration and 0.6eV energy width. We illustrate the possibility to conduct ultrafast imaging, diffraction, holography and spectroscopy with this instrument and also discuss opportunities to harness quantum coherent interactions between intense laser fields and free-electron beams. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Suppressing Klein tunneling in graphene using a one-dimensional array of localized scatterers.

PubMed

Walls, Jamie D; Hadad, Daniel

2015-02-13

Graphene's unique physical and chemical properties make it an attractive platform for use in micro- and nanoelectronic devices. However, electrostatically controlling the flow of electrons in graphene can be challenging as a result of Klein tunneling, where electrons normally incident to a one-dimensional potential barrier of height V are perfectly transmitted even as V → ∞. In this study, theoretical and numerical calculations predict that the transmission probability for an electron wave normally incident to a one-dimensional array of localized scatterers can be significantly less than unity when the electron wavelength is smaller than the spacing between scatterers. In effect, placing periodic openings throughout a potential barrier can, somewhat counterintuitively, decrease transmission in graphene. Our results suggest that electrostatic potentials with spatial variations on the order of the electron wavelength can suppress Klein tunneling and could find applications in developing graphene electronic devices.

Electronic, optical and photocatalytic behavior of Mn, N doped and co-doped TiO{sub 2}: Experiment and simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Ya Fei; Li, Can, E-mail: canli1983@gmail.com; Lu, Song

2016-03-15

The crystal phase structure, surface morphology, chemical states and optical properties of Mn, N mono-doped and co-doped TiO{sub 2} nanoparticles were investigated by X-ray powder diffractometry, Raman spectra, scanning electron microscopy, X-ray photoelectron spectroscopy and UV–vis diffuse reflectance spectroscopy. Meanwhile, geometry structures, formation energies, electronic and optical properties of all systems have been also analyzed by density functional theory. The results showed that the band gap values and the carrier mobility in the valence band, conduction band and impurity levels have a synergetic influence on the visible-light absorption and photocatalytic activity of the doped TiO{sub 2}. The number and themore » carrier mobility of impurity level jointly influence the photocatalytic activity of catalyst under visible-light. Especially, the photocatalytic activity of Mn-2N co-doped TiO{sub 2} beyond three-fold than that of pure TiO{sub 2} under visible-light. - Graphical abstract: The ILs formed by N-2p orbital in N single doped specimen lie above the VB, while the ILs formed by Mn-3d orbital in Mn single doped specimen appear below the CB. However, a large amount of ILs formed by N-2p orbital and Mn-3d orbital in N and Mn codoped specimens. The band gap values and the carrier mobility in the valence band, conduction band and impurity levels have a synergetic influence on the visible-light absorption and photocatalytic activity of the doped TiO{sub 2}. The number and the carrier mobility of impurity level jointly influence the photocatalytic activity of catalyst under visible-light.« less

15 CFR 30.60 - Confidentiality of Electronic Export Information.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 15 Commerce and Foreign Trade 1 2011-01-01 2011-01-01 false Confidentiality of Electronic Export... § 30.60 Confidentiality of Electronic Export Information. (a) Confidential status. The EEI collected... in any form including but not limited to electronic transmission, paper printout, or certified...

15 CFR 30.60 - Confidentiality of Electronic Export Information.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 15 Commerce and Foreign Trade 1 2013-01-01 2013-01-01 false Confidentiality of Electronic Export... § 30.60 Confidentiality of Electronic Export Information. (a) Confidential status. The EEI collected... in any form including but not limited to electronic transmission, paper printout, or certified...

15 CFR 30.60 - Confidentiality of Electronic Export Information.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Confidentiality of Electronic Export... § 30.60 Confidentiality of Electronic Export Information. (a) Confidential status. The EEI collected... in any form including but not limited to electronic transmission, paper printout, or certified...

Nucleation of diamond by pure carbon ion bombardment—a transmission electron microscopy study

NASA Astrophysics Data System (ADS)

Yao, Y.; Liao, M. Y.; Wang, Z. G.; Lifshitz, Y.; Lee, S. T.

2005-08-01

A cross-sectional high-resolution transmission electron microscopy (HRTEM) study of a film deposited by a 1 keV mass-selected carbon ion beam onto silicon held at 800 °C is presented. Initially, a graphitic film with its basal planes perpendicular to the substrate is evolving. The precipitation of nanodiamond crystallites in upper layers is confirmed by HRTEM, selected area electron diffraction, and electron energy loss spectroscopy. The nucleation of diamond on graphitic edges as predicted by Lambrecht et al. [W. R. L. Lambrecht, C. H. Lee, B. Segall, J. C. Angus, Z. Li, and M. Sunkara, Nature, 364 607 (1993)] is experimentally confirmed. The results are discussed in terms of our recent subplantation-based diamond nucleation model.

Large-scale synthesis of monodisperse magnesium ferrite via an environmentally friendly molten salt route.

PubMed

Lou, Zhengsong; He, Minglong; Wang, Ruikun; Qin, Weiwei; Zhao, Dejian; Chen, Changle

2014-02-17

Sub-micrometer-sized magnesium ferrite spheres consisting of uniform small particles have been prepared using a facile, large-scale solid-state reaction employing a molten salt technique. Extensive structural characterization of the as-prepared samples has been performed using scanning electron microscope, transmission electron microscopy, high-resolution transmission electron microscopy, selected area electron diffraction, and X-ray diffraction. The yield of the magnesium ferrite sub-micrometer spheres is up to 90%, and these sub-micrometer spheres are made up of square and rectangular nanosheets. The magnetic properties of magnesium ferrite sub-micrometer spheres are investigated, and the magnetization saturation value is about 24.96 emu/g. Moreover, the possible growth mechanism is proposed based on the experimental results.

Electron tomography and computer visualisation of a three-dimensional 'photonic' crystal in a butterfly wing-scale.

PubMed

Argyros, A; Manos, S; Large, M C J; McKenzie, D R; Cox, G C; Dwarte, D M

2002-01-01

A combination of transmission electron tomography and computer modelling has been used to determine the three-dimensional structure of the photonic crystals found in the wing-scales of the Kaiser-I-Hind butterfly (Teinopalpus imperialis). These scales presented challenges for electron microscopy because the periodicity of the structure was comparable to the thickness of a section and because of the complex connectivity of the object. The structure obtained has been confirmed by taking slices of the three-dimensional computer model constructed from the tomography and comparing these with transmission electron microscope (TEM) images of microtomed sections of the actual scale. The crystal was found to have chiral tetrahedral repeating units packed in a triclinic lattice.

In situ TEM observation of novel chemical evolution of MnBr2 catalyzed by Cu under electron beam irradiation

NASA Astrophysics Data System (ADS)

Wang, Wei; Bai, Xianwei; Guan, Xiangxiang; Shen, Xi; Yao, Yuan; Wang, Yanguo; Zou, Bingsuo; Yu, Richeng

2017-10-01

Manganese bromide has attracted enormous attention for its applications in the syntheses of organic-inorganic hybrid compounds. A complete understanding of structural and chemical stabilities of MnBr2 is important for controlling its properties. Here, we focus on the irradiation resistance of MnBr2. The chief purpose of this research is reached by in situ transmission electron microscopy. It is demonstrated that the deliquescent MnBr2 powder is prone to adsorb the vapor in air, and the hydrous MnBr2 can be decomposed under its continuous exposure to electron beam, indicated by a transmission electron microscope via the catalysis of Cu grid at room temperature.

Heat- and electron-beam-induced transport of gold particles into silicon oxide and silicon studied by in situ high-resolution transmission electron microscopy.

PubMed

Biskupek, Johannes; Kaiser, Ute; Falk, Fritz

2008-06-01

In this study, we describe the transport of gold (Au) nanoparticles from the surface into crystalline silicon (Si) covered by silicon oxide (SiO(2)) as revealed by in situ high-resolution transmission electron microscopy. Complete crystalline Au nanoparticles sink through the SiO(2) layer into the Si substrate when high-dose electron irradiation is applied and temperature is raised above 150 degrees C. Above temperatures of 250 degrees C, the Au nanoparticles finally dissolve into fragments accompanied by crystallization of the amorphized Si substrate around these fragments. The transport process is explained by a wetting process followed by Stokes motion. Modelling this process yields boundaries for the interface energies involved.

3D simulation of electron and ion transmission of GEM-based detectors

NASA Astrophysics Data System (ADS)

Bhattacharya, Purba; Mohanty, Bedangadas; Mukhopadhyay, Supratik; Majumdar, Nayana; da Luz, Hugo Natal

2017-10-01

Time Projection Chamber (TPC) has been chosen as the main tracking system in several high-flux and high repetition rate experiments. These include on-going experiments such as ALICE and future experiments such as PANDA at FAIR and ILC. Different R&D activities were carried out on the adoption of Gas Electron Multiplier (GEM) as the gas amplification stage of the ALICE-TPC upgrade version. The requirement of low ion feedback has been established through these activities. Low ion feedback minimizes distortions due to space charge and maintains the necessary values of detector gain and energy resolution. In the present work, Garfield simulation framework has been used to study the related physical processes occurring within single, triple and quadruple GEM detectors. Ion backflow and electron transmission of quadruple GEMs, made up of foils with different hole pitch under different electromagnetic field configurations (the projected solutions for the ALICE TPC) have been studied. Finally a new triple GEM detector configuration with low ion backflow fraction and good electron transmission properties has been proposed as a simpler GEM-based alternative suitable for TPCs for future collider experiments.

Preparation of cryofixed cells for improved 3D ultrastructure with scanning transmission electron tomography.

PubMed

Höhn, Katharina; Sailer, Michaela; Wang, Li; Lorenz, Myriam; Schneider, Marion E; Walther, Paul

2011-01-01

Scanning transmission electron tomography offers enhanced contrast compared to regular transmission electron microscopy, and thicker samples, up to 1 μm or more, can be analyzed, since the depth of focus and inelastic scattering are not limitations. In this study, we combine this novel imaging approach with state of the art specimen preparation by using novel light transparent sapphire specimen carrier for high-pressure freezing and a freeze substitution protocol for better contrast of membranes. This combination allows for imaging membranes and other subcellular structures with unsurpassed quality. This is demonstrated with mitochondria, where the inner and outer mitochondrial membranes as well as the membranes in the cristae appear in very close apposition with a minimal intermembrane space. These findings correspond well with old observations using freeze fracturing. In 880-nm thick sections of hemophagocytes, the three-dimensional structure of membrane sheets could be observed in the virtual sections of the tomogram. Microtubules, actin and intermediate filaments could be visualized within one sample. Intermediate filaments, however, could even be better observed in 3D using surface scanning electron tomography.

Studying Dynamic Processes of Nano-sized Objects in Liquid using Scanning Transmission Electron Microscopy.

PubMed

Hermannsdörfer, Justus; de Jonge, Niels

2017-02-05

Samples fully embedded in liquid can be studied at a nanoscale spatial resolution with Scanning Transmission Electron Microscopy (STEM) using a microfluidic chamber assembled in the specimen holder for Transmission Electron Microscopy (TEM) and STEM. The microfluidic system consists of two silicon microchips supporting thin Silicon Nitride (SiN) membrane windows. This article describes the basic steps of sample loading and data acquisition. Most important of all is to ensure that the liquid compartment is correctly assembled, thus providing a thin liquid layer and a vacuum seal. This protocol also includes a number of tests necessary to perform during sample loading in order to ensure correct assembly. Once the sample is loaded in the electron microscope, the liquid thickness needs to be measured. Incorrect assembly may result in a too-thick liquid, while a too-thin liquid may indicate the absence of liquid, such as when a bubble is formed. Finally, the protocol explains how images are taken and how dynamic processes can be studied. A sample containing AuNPs is imaged both in pure water and in saline.

Studying Dynamic Processes of Nano-sized Objects in Liquid using Scanning Transmission Electron Microscopy

PubMed Central

Hermannsdörfer, Justus; de Jonge, Niels

2017-01-01

Samples fully embedded in liquid can be studied at a nanoscale spatial resolution with Scanning Transmission Electron Microscopy (STEM) using a microfluidic chamber assembled in the specimen holder for Transmission Electron Microscopy (TEM) and STEM. The microfluidic system consists of two silicon microchips supporting thin Silicon Nitride (SiN) membrane windows. This article describes the basic steps of sample loading and data acquisition. Most important of all is to ensure that the liquid compartment is correctly assembled, thus providing a thin liquid layer and a vacuum seal. This protocol also includes a number of tests necessary to perform during sample loading in order to ensure correct assembly. Once the sample is loaded in the electron microscope, the liquid thickness needs to be measured. Incorrect assembly may result in a too-thick liquid, while a too-thin liquid may indicate the absence of liquid, such as when a bubble is formed. Finally, the protocol explains how images are taken and how dynamic processes can be studied. A sample containing AuNPs is imaged both in pure water and in saline. PMID:28190028

Interesting features of transmission across locally periodic delta potentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dharani, M., E-mail: m-dharani@blr.amrita.edu, E-mail: mdharu@yahoo.co.in; Shastry, C. S.

2016-05-23

We study the theory of transmission of electrons through N delta potential barriers as well as wells. Some of the interesting features like the correlation between resonance peak positions and box states, number of peaks in transmission band and bound states are analyzed for locally periodic attractive, repulsive and pair of attractive and repulsive potentials.

Investigation of Transmission Resonances with Specific Properties in Rectangular Semiconductor Quantum Wells

ERIC Educational Resources Information Center

Niketic, Nemanja; Milanovic, Vitomir; Radovanovic, Jelena

2012-01-01

In this paper we provide a detailed analysis of the energy position and type of transmission maxima in rectangular quantum wells (QWs), taking into consideration the difference of electron effective masses in the barrier and well layers. Particular attention is given to transmission maxima that are less than unity and the implications of effective…

Dynamics and Hall-edge-state mixing of localized electrons in a two-channel Mach-Zehnder interferometer

NASA Astrophysics Data System (ADS)

Bellentani, Laura; Beggi, Andrea; Bordone, Paolo; Bertoni, Andrea

2018-05-01

We present a numerical study of a multichannel electronic Mach-Zehnder interferometer, based on magnetically driven noninteracting edge states. The electron path is defined by a full-scale potential landscape on the two-dimensional electron gas at filling factor 2, assuming initially only the first Landau level as filled. We tailor the two beamsplitters with 50 % interchannel mixing and measure Aharonov-Bohm oscillations in the transmission probability of the second channel. We perform time-dependent simulations by solving the electron Schrödinger equation through a parallel implementation of the split-step Fourier method, and we describe the charge-carrier wave function as a Gaussian wave packet of edge states. We finally develop a simplified theoretical model to explain the features observed in the transmission probability, and we propose possible strategies to optimize gate performances.